Conjugate of KRAS-targeting polypeptide and small molecule and Anti-cancer use thereof

Abstract

A conjugate of a polypeptide and a small molecule and anti-cancer use thereof. The conjugate of the polypeptide and the small molecule is obtained by connecting a cyclic peptide and a small molecule compound through a chemical bond. The structural formula of the cyclic peptide is shown below, and the small molecule compound is a small molecule inhibitor or a derivative thereof capable of inhibiting GLI1 activity. The conjugate acts on two targets: KRAS G12C and GLI1, has good anti-tumor activity, and can address the problem that a tumor patient carrying a KRAS mutation is prone to drug resistance.

Description

KRAS-targeting peptide-small molecule conjugates and their anticancer applications Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to a conjugate of a KRAS G12C-targeting polypeptide and a small molecule and its anti-cancer application. Background Art

[0002] Non-small cell lung cancer (NSCLC) is the most common type of lung cancer, accounting for approximately 80% of all lung cancer cases. Treatment for lung cancer patients mainly includes surgery, chemoradiotherapy, immunotherapy, and targeted therapy. Currently, testing for mutation sites in genes such as EGFR, KRAS, BRAF, ALK, and MET is the standard approach for determining whether lung cancer patients should undergo targeted therapy. For patients with epidermal growth factor receptor (EGFR)-sensitive mutations, the efficacy of EGFR tyrosine kinase inhibitors (TKIs) has reached 71.2%. KRAS mutations are the second most common mutation in NSCLC after EGFR mutations, occurring in approximately 25% of NSCLC cases. The most common KRAS mutation is the G12C mutation. As a driver mutation, KRAS G12C activates signaling pathways such as MAPK and PI3K-AKT-mTOR, promoting cell proliferation and differentiation and driving tumorigenesis. KRAS is also a key downstream regulatory gene in the EGFR signaling pathway. KRAS G12C mutations can activate the tumor without the need for EGFR signals, accelerating NSCLC progression and rendering EGFR-TKI targeted therapy ineffective. In addition to lung cancer, KRAS mutations are also commonly found in a variety of malignancies, including pancreatic cancer, colorectal cancer, and breast cancer. Therefore, the development of targeted therapeutics targeting KRAS mutations holds great promise.

[0003] For patients with KRAS G12C mutations, two KRAS G12C inhibitors, Sotorasib and Adagrasib, are currently approved for the treatment of patients with advanced or metastatic NSCLC carrying KRAS G12C mutations who have received at least one previous systemic treatment. Sotorasib has also shown anti-tumor activity in pancreatic cancer and colorectal cancer. Although Sotorasib and Adagrasib have good efficacy in the early stages of cancer patients carrying KRAS G12C mutations, they are very likely to induce drug resistance. Currently, there are no good treatment options or drugs in clinical practice that can significantly prolong the survival of patients after drug resistance develops. Single-target drug therapy can no longer cope with the increasing number of mutation types in lung cancer patients in clinical practice. Therefore, there is an urgent need to find new lung cancer drug targets and conduct multi-target intervention treatments for patients with KRAS G12C mutation lung cancer in order to achieve better treatment effects.

[0004] The activation of the Hedgehog signaling pathway plays an important role in the KRAS mutation process. The activation of the Hedgehog pathway is one of the necessary conditions for maintaining the growth of NSCLC cells carrying KRAS mutations. Glioma-associated oncogene homolog 1 (GLI1) is the terminal effector of the Hedgehog pathway. GLI1 has been found to play a decisive role in the occurrence and development of various cancers, including lung cancer, and the overexpression of GLI1 is positively correlated with the aggravation of tumor malignancy. The applicant has previously reported that inhibiting GLI1 can inhibit lung cancer angiogenesis, and it has also been found that GLI1 promotes the metastasis and invasion of NSCLC tumor cells by regulating Snail. At the same time, GLI1 also regulates the expression of multiple genes related to tumor resistance, such as SOX2, OCT4, and AXL.

[0005] Summary of the Invention

[0006] Based on this, the present invention has developed a conjugate of a peptide and a small molecule, which can specifically target KRAS G12C and release a GLI1 small molecule inhibitor at the tumor site to kill or inhibit the growth of cancer cells. The conjugate intervenes at both KRAS G12C and GLI1 targets and has good anti-tumor activity.

[0007] The present invention includes the following technical solutions.

[0008] In one aspect, the present invention provides a conjugate of a polypeptide and a small molecule, which is obtained by connecting a cyclic peptide and a small molecule compound through a chemical bond;

[0009] The structural formula of the cyclic peptide is:

[0010] The small molecule compound is a small molecule inhibitor or a derivative thereof that can inhibit the activity of GLI1.

[0011] In some embodiments, the small molecule compound is selected from the following compounds:

[0012] In some embodiments, the carboxyl group at the C-terminus of the cyclic peptide and the small molecule compound are connected via an amide bond or an ester bond.

[0013] In some embodiments, the structural formula of the conjugate of the polypeptide and small molecule is:

[0014] In a second aspect, the present invention also provides the use of the conjugate of the polypeptide and small molecule in the preparation of a drug for preventing and / or treating tumors.

[0015] In some embodiments, the tumor is lung cancer, pancreatic cancer, colorectal cancer, or breast cancer.

[0016] In some embodiments, the tumor is a tumor carrying a KRAS mutation; the KRAS mutation may be a KRAS G12C mutation, that is, the tumor is further preferably a tumor carrying a KRAS G12C mutation.

[0017] In some embodiments, the tumor is a tumor that overexpresses GLI1. The tumor of the present invention can be a tumor carrying a KRAS G12C mutation, a tumor that overexpresses GLI1, or a tumor that carries a KRAS G12C mutation and overexpresses GLI1.

[0018] In some embodiments, the tumor is non-small cell lung cancer; further preferably, the non-small cell lung cancer overexpresses GLI1, or the non-small cell lung cancer carries KRAS G12C mutation, or the non-small cell lung cancer carries KRAS G12C mutation and overexpresses GLI1.

[0019] In a third aspect, the present invention further provides a drug for preventing and / or treating tumors, which is prepared from active ingredients and pharmaceutically acceptable excipients, wherein the active ingredients include the conjugate of the polypeptide and small molecule described in the present invention, and / or the FN1-8 methylamino derivative described in the present invention or a pharmaceutically acceptable salt thereof.

[0020] In a third aspect, the present invention further provides a method for preventing and / or treating tumors, comprising: administering a safe and effective amount of the conjugate of the polypeptide and small molecule of the present invention; and / or,

[0021] administering a safe and effective amount of the FN1-8 methylamino derivative or a pharmaceutically acceptable salt thereof of the present invention; and / or,

[0022] Administer a safe and effective amount of the drug for preventing and / or treating tumors of the present invention.

[0023] The present invention chemically links the CLYDVAGSDKYCGP cyclic peptide with a GLI1 small molecule inhibitor to create a novel conjugate. The cyclic peptide in the conjugate specifically targets the KRAS G12C protein. By inhibiting GLI1 activity, the GLI1 small molecule inhibitor can both suppress cancer cell proliferation and disrupt downstream oncogenic pathways activated by KRAS mutations. This conjugate, which targets both KRAS G12C and GLI1, exhibits excellent anti-tumor activity and can alleviate the drug resistance that is common in patients with KRAS mutation-carrying tumors.

[0024] In addition, the dipeptide linker GP in the cyclic peptide is the substrate recognition sequence of fibroblast activation protein (FAPα), and FAPα is mainly highly expressed in tumor-associated fibroblasts. Therefore, the conjugate of the present invention will only be cleaved and release the GLI1 small molecule inhibitor at the tumor site, which has tumor responsiveness, reduces the systemic toxicity of the drug, can greatly reduce the toxic and side effects of the drug, and improve its safety.

[0025] By coupling a specific cyclic peptide with a small molecule inhibitor, the present invention can not only improve the shortcomings of the polypeptide's strong water solubility and low bioavailability, but also reduce the non-selective toxicity of small molecule drugs such as FN1-8, thereby improving drug safety. In addition, the modified cyclic peptide of the present invention has better in vivo stability than the linear peptide LYDVAGSDKY. Therefore, the conjugate of the present invention is a very promising therapeutic drug for KRAS mutant tumors, and can achieve dual-target, anti-drug resistance, and high efficacy therapeutic effects for lung cancer and other malignant tumors carrying the KRAS G12C mutation. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 is the HPLC chart of the LYDVAGSDKY line peptide.

[0027] Figure 2 is the mass spectrum of the LYDVAGSDKY line peptide.

[0028] FIG3 is an HPLC chart of CLYDVAGSDKYC cyclic peptide.

[0029] Figure 4 is the mass spectrum of the CLYDVAGSDKYC cyclic peptide.

[0030] FIG5 is an HPLC chart of CLYDVAGSDKYCGP cyclic peptide.

[0031] FIG6 is a mass spectrum of CLYDVAGSDKYCGP cyclic peptide.

[0032] Figure 7 is a hydrogen spectrum of the FN1-8 methylamino derivative (FN1-8-CH2-NH2).

[0033] FIG8 is an HPLC chart of the conjugate HGPF.

[0034] FIG9 is the mass spectrum of the conjugate HGPF.

[0035] FIG10 is a HPLC chart of serum stability of LYDVAGSDKY line peptide.

[0036] FIG11 is a HPLC chart of serum stability of CLYDVAGSDKYC cyclic peptide.

[0037] FIG12 is a line graph showing the stability of linear peptides and cyclic peptides.

[0038] FIG13 is a HPLC chart of the conjugate HGP-FITC.

[0039] FIG14 is a mass spectrum of the conjugate HGP-FITC.

[0040] FIG15 shows the uptake of HGP-FITC at different concentrations by lung cancer cells carrying KRAS G12C mutation.

[0041] FIG16 is a specific analysis of HGP-FITC targeting KRAS G12C.

[0042] FIG17 shows the BRET assay for analyzing drug responsiveness to FAPα.

[0043] FIG18 is a CCK8 assay to analyze the cytotoxicity of drugs to tumor cells.

[0044] FIG19 is a scratch assay analyzing the inhibitory effect of drugs on tumor cell proliferation and migration. DETAILED DESCRIPTION

[0045] The experimental methods in the following examples of the present invention, where no specific conditions are specified, are generally carried out under conventional conditions or conditions recommended by the manufacturers. The various commonly used chemical reagents used in the examples are all commercially available products.

[0046] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0047] The terms "comprise," "comprising," and "having," and any variations thereof, are intended to cover non-exclusive inclusions. For example, a process, method, apparatus, product, or device comprising a series of steps is not limited to the listed steps or modules but may optionally include steps not listed, or other steps inherent to the process, method, product, or device.

[0048] In this application, "plurality" refers to two or more. "And / or" describes the relationship between related objects, indicating that three possible relationships exist. For example, "A and / or B" can mean: A exists alone, A and B exist simultaneously, or B exists alone. The character " / " generally indicates that the related objects are in an "or" relationship.

[0049] In one embodiment of the present invention, a conjugate of a polypeptide and a small molecule is provided, which is obtained by connecting a cyclic peptide and a small molecule compound through a chemical bond;

[0050] The structural formula of the cyclic peptide is:

[0051] The small molecule compound is a small molecule inhibitor or a derivative thereof that can inhibit the activity of GLI1.

[0052] In another embodiment of the present invention, a drug for preventing and / or treating tumors is provided, which is prepared from active ingredients and pharmaceutically acceptable excipients. The active ingredients include the conjugate of the polypeptide and small molecule described in the present invention, and / or the FN1-8 methylamino derivative described in the present invention or a pharmaceutically acceptable salt thereof.

[0053] In another embodiment of the present invention, a method for preventing and / or treating tumors is provided, comprising: administering a safe and effective amount of a conjugate of the polypeptide and a small molecule of the present invention; and / or,

[0054] administering a safe and effective amount of the FN1-8 methylamino derivative or a pharmaceutically acceptable salt thereof of the present invention; and / or,

[0055] Administer a safe and effective amount of the drug for preventing and / or treating tumors of the present invention.

[0056] The medicaments or methods provided herein for preventing and / or treating tumors comprise (or administer) a safe and effective amount of an active ingredient (i.e., a conjugate of a polypeptide and a small molecule described herein, and / or a FN1-8 methylamino derivative or a pharmaceutically acceptable salt thereof) and a pharmaceutically acceptable excipient. Administration involves administering a safe and effective amount of the conjugate or compound described herein to a mammal (e.g., a human) in need of treatment, wherein the dosage is a pharmaceutically effective dose. The specific dosage should also take into account factors such as the route of administration and the patient's health status, all of which are within the skill of a skilled physician.

[0057] Here, "safe and effective amount" means an amount of the active ingredient sufficient to significantly improve the condition without causing serious side effects. "Pharmaceutically acceptable excipients" refer to one or more compatible solid or liquid fillers or gels suitable for human use, of sufficient purity, and with sufficiently low toxicity. "Compatibility" here refers to the ability of the components of the composition to blend with the active ingredient of the present invention, and with each other, without significantly reducing the efficacy of the active ingredient.

[0058] Examples of pharmaceutically acceptable excipients include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as ), wetting agents (such as sodium lauryl sulfate), colorants, flavorings, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0059] There is no particular limitation on the administration of the active ingredient or pharmaceutical composition of the present invention. Representative administration methods include (but are not limited to): oral, intratumoral, rectal, parenteral (intravenous, intramuscular or subcutaneous) and the like.

[0060] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules.

[0061] In these solid dosage forms, the active ingredient is mixed with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate, or with:

[0062] (a) fillers or extenders, for example, starch, lactose, sucrose, glucose, mannitol and silicic acid;

[0063] (b) binders, for example, hydroxymethylcellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose and gum arabic;

[0064] (c) humectants, for example, glycerin;

[0065] (d) disintegrants, for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate;

[0066] (e) a buffering solvent, for example, paraffin;

[0067] (f) absorption accelerators, for example, quaternary ammonium compounds;

[0068] (g) wetting agents, for example, cetyl alcohol and glyceryl monostearate;

[0069] (h) adsorbents, for example, kaolin;

[0070] (i) Lubricants, for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, or mixtures thereof. In capsules, tablets and pills, the dosage form may also contain a buffering agent.

[0071] The solid dosage forms can also be prepared using coatings and shells, such as enteric coatings and other materials known in the art. They can contain opacifying agents, and the release of the active ingredient in such compositions can be delayed in a certain portion of the digestive tract. Examples of embedding components that can be used are polymeric substances and waxes.

[0072] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, or tinctures. In addition to the active ingredient, the liquid dosage form may contain inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers, for example, ethanol, isopropyl alcohol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3-butylene glycol, dimethylformamide, and oils, particularly cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil, and sesame oil, or mixtures thereof. In addition to these inert diluents, the composition may also contain adjuvants, such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents, and fragrances.

[0073] In addition to the active ingredients, suspensions may contain suspending agents such as, for example, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum methoxide and agar, or mixtures of these substances.

[0074] Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

[0075] The conjugates or compounds of the present invention can be administered alone or in combination with other drugs known to treat or improve similar conditions.

[0076] The following are specific examples. All reagents, materials and raw materials in the following examples can be obtained from commercial channels.

[0077] Example 1: Synthesis of LYDVAGSDKY linear peptide and CLYDVAGSDKYC cyclic peptide

[0078] First, LYDVAGSDKY and CLYDVAGSDKYC peptides were synthesized by solid phase synthesis method as follows.

[0079] 1.1 Solvent treatment

[0080] DMF and methanol were soaked with G3 molecular sieves overnight before use to remove impurities and water.

[0081] 1.2 Full swelling of the resin

[0082] Weigh 2.0 g of blank dichlororesin into a clean, dry reaction tube, add 15 mL of DMF, and activate at room temperature for about 30 min.

[0083] 1.3 Connect to the first amino acid at the N-terminus

[0084] At room temperature, remove the solvent from the swollen resin through a sand core filter. Add 1 mmol of a 5-fold molar excess of the first N-terminal amino acid, Fmoc-Leu-OH (for LYDVAGSDKY synthesis) or Fmoc-Cys-OH (for CLYDVAGSDKYC synthesis), a 5-fold molar excess of DMAP, and a 5-fold molar excess of DIC. Add DMF as the solvent and let react at room temperature for 3 hours. After the reaction is complete, wash the resin 4-6 times with 5-6 mL of DMF each time. Then, add 2 mL of pyridine and acetic anhydride in a 1:1 volume ratio and let react for 30 minutes. After the reaction is complete, wash the resin 4-6 times with 5-6 mL of DMF each time (to block any unreacted active sites on the unloaded resin).

[0085] 1.4 Removal of Fmoc protecting group

[0086] Remove the solvent from the previous step by suction, add 10 mL of 20% piperidine DMF solution to the resin, blow and stir under N2 for 10 minutes, filter out the solution, add 10 mL of 20% piperidine DMF solution, blow and stir under N2 for 5 minutes, and then filter out the solution. Repeat this operation twice, then wash with DMF 4 times and methanol 2 times, 5-6 mL each time.

[0087] 1.5 Ninhydrin detection removal effect

[0088] Take out a small amount of resin, wash it three times with methanol, add one drop each of ninhydrin, KCN, and phenol solution, and heat at 105℃-110℃ for 5 minutes. If it turns dark blue, it is a positive reaction, indicating that the removal is complete and the next step can be carried out. If it is colorless, it means that the protecting group is not completely removed, and the above deprotection operation needs to be repeated.

[0089] 1.6 Connecting the second amino acid and removing the Fmoc protecting group

[0090] A 3-fold molar excess of the second N-terminal amino acid, Fmoc-Try-OH (for the synthesis of LYDVAGSDKY) or Fmoc-Leu-OH (for the synthesis of CLYDVAGSDKYC), a 3-fold molar excess of HBTU, and a 3-fold molar excess of HOBT were added to the reaction system after deprotection in the previous step. An appropriate amount of DMF solution was added to completely dissolve the solution. Then, a 10-fold molar excess of pure DIEA was added. The reaction was allowed to react at room temperature for 40 minutes and the solution was washed with DMF 4-6 times, each time 5-6 mL. A small amount of resin was tested with ninhydrin detection reagent, which showed a colorless color. Then, 10 mL of a 20% piperidine solution in DMF was added to remove the Fmoc residue twice, for 10 minutes and 5 minutes, respectively. The residue was then washed with DMF 4 times and methanol 2 times, each time 5-6 mL. A small amount of resin was removed and tested with ninhydrin detection reagent. If the color was blue, the reaction could proceed to the next step.

[0091] 1.7 Removal of the remaining amino acids and Fmoc protecting group

[0092] Repeat step 1.6 in this way until the last amino acid at the C-terminus of the peptide is synthesized, remove the Fmoc protecting group, detect NH2 blue with ninhydrin, and proceed to the next step.

[0093] 1.8 Connecting Boc protecting group

[0094] Add 2 equivalents of di-tert-butyl carbonate (Boc)2O and react at room temperature for 2 hours in DMF. Drain the solvent and wash the resin twice with methanol, dichloromethane, and DMF, respectively. Ninhydrin color development indicates colorlessness, confirming the Boc connection. Drain the resin again.

[0095] 1.9 Resin removal and peptide separation

[0096] The resin obtained in step 1.8 was fully protected and cleaved twice using trifluoroacetic acid cleavage solution (1% TFA: 2% TIS: 2% EDT: 95% H2O), each time for 10 minutes. The cleavage solutions from the two times were collected and lyophilized to obtain the fully protected linear peptides LYDVAGSDKY and CLYDVAGSDKYC.

[0097] The HPLC detection results of the linear peptide LYDVAGSDKY are shown in FIG1 , and its mass spectrum is shown in FIG2 , which proves that the LYDVAGSDKY linear peptide is obtained.

[0098] 1.10 Cyclization of CLYDVAGSDKYC Linear Peptide

[0099] The CLYDVAGSDKYC linear peptide obtained in the previous step was added to a 50 mM NH4HCO3 aqueous solution to adjust the peptide concentration to 0.1 mg / mL. Hydrogen peroxide was then added to a final concentration of 5%. The mixture was allowed to react for 1 hour to form a disulfide bond between the two cysteine ​​thiol groups in the linear peptide. After lyophilization, the fully protected CLYDVAGSDKYC cyclic peptide was obtained.

[0100] The HPLC detection results of CLYDVAGSDKYC cyclic peptide are shown in FIG3 , and its mass spectrum is shown in FIG4 , which proves that CLYDVAGSDKYC cyclic peptide is obtained.

[0101] Example 2: Synthesis of a cyclic peptide with a GP linker (CLYDVAGSDKYCGP)

[0102] According to the method of Example 1, CLYDVAGSDKYCGP linear peptide was first synthesized, and then cyclized to finally obtain CLYDVAGSDKYCGP cyclic peptide. The structure of the product was identified by HPLC (Figure 5), mass spectrometry (Figure 6) and other technical means. The results showed that the cyclic peptide CLYDVAGSDKYCGP was successfully synthesized, and its structural formula is as follows:

[0103] Example 3: Synthesis of the methylamino derivative of FN1-8 (FN1-8-CH2-NH2)

[0104] 3.1 A mixture of ethyl cinnamate (0.52 ml), benzaldehyde phenylhydrazine (600 mg), chloramine trihydrate-T (844 mg), and methanol (5 mL) was heated under reflux under nitrogen for 24 hours. The reaction mixture was diluted with 400 ml of a 1:1 mixture of ethyl acetate and n-hexane, filtered through a fritted funnel, mixed thoroughly with an appropriate amount of silica gel, and evaporated to dryness using a rotary vacuum evaporator. The residue was purified by column chromatography (petroleum ether:ethyl acetate = 15:1) to obtain compound 1 (650 mg) in a 67% yield.

[0105] 3.2 Compound 1 (2.00 g) was mixed with methanol (4 ml), 1,4-dioxane (2 ml), and 10% aqueous sodium chloride solution (2 ml) and allowed to react at room temperature for 1 hour. The reaction mixture was diluted with 30 ml of water and then washed with ethyl acetate:n-hexane in a ratio of 3:10. The mixture was separated using a separatory funnel. The aqueous phase was acidified with disodium chromotropic acid and extracted with ethyl acetate. The extract was washed twice with water and then twice with brine, and finally dried over anhydrous sodium sulfate. The extract was mixed with an appropriate amount of silica gel and evaporated to dryness using a vacuum rotary evaporator. The residue was purified by column chromatography (petroleum ether:ethyl acetate = 15:1) to obtain compound 2 (410 mg) in a 68% yield.

[0106] 3.3 Compound 2 (1.5 g) was mixed with THF (20 ml), DIEA (1.70 mg), T4P (4.70 g), and 1,4-phenylenediamine (830 mg) and allowed to react at room temperature for 1 hour. The reaction solution was washed with brine, saturated sodium sulfate aqueous solution, and water. After separation using a separatory funnel, the organic phase was dried over anhydrous sodium sulfate, mixed with an appropriate amount of silica gel, and evaporated to dryness using a vacuum rotary evaporator. The residue was separated and purified by column chromatography to obtain the methylamino derivative of FN1-8, FN1-8-CH2-NH2 (357 mg), with a yield of 65% and a purity greater than 97%.

[0107] The H NMR spectrum of the methylamino derivative of FN1-8 (FN1-8-CH2-NH2) is shown in Figure 7.

[0108] Example 4: Synthesis of a conjugate of a cyclic peptide and a FN1-8 methylamino derivative (HGPF)

[0109] The CLYDVAGSDKYCGP cyclic peptide obtained in Example 2 was dissolved in 15 mL of anhydrous pyridine and cooled to -15°C. 1 mL of POCl₃ was added to the solution. An anhydrous dichloromethane solution of the FN1-8 methylamino derivative obtained in Example 3 (100 mg of FN1-8-CH₂-NH₂ dissolved in 200 mL of dichloromethane) was gradually added dropwise at -15°C. The mixture was allowed to react for 2 hours, and the crude product was dried by spin drying. A cutting solution (95% TFA, 2% TIS, 2% EDT, 1% H₂O) was added and allowed to react for 2 hours to obtain 11.45 mg of the target product, HGPF.

[0110] HPLC (Figure 8) and mass spectrometry (Figure 9) confirmed that the conjugate HGPF, in which the cyclic peptide and the FN1-8 methylamino derivative were connected via a GP dipeptide linker, was successfully obtained. Its structure is as follows:

[0111] Example 5: Polypeptide stability experiment

[0112] 5.1 Serum preparation

[0113] Healthy C57 male mice (18-24 g) were given fresh blood by orbital venous sampling and placed in a 1.5 ml centrifuge tube. The blood was allowed to stand for 1 hour to coagulate and then centrifuged at 3000 g at 4°C for 15 min. The supernatant was collected and used for peptide stability studies.

[0114] 5.2 Incubation experiment

[0115] LYDVAGSDKY linear peptide and CLYDVAGSDKYC cyclic peptide were prepared into 10mM stock solutions with physiological saline, and 40μl of the stock solution was respectively added to 360μl of mouse serum and 360μl of pH7.4 buffer (the ratio of polypeptide drug to serum / PBS was 1:9), immediately vortexed and incubated in a 37°C constant temperature incubator. At time points 0, 2h, 4h, 8h, 10h, 12h, and 24h, 40μl of samples were respectively taken into 1.5ml pre-cooled centrifuge tubes and 40μl of glacial acetonitrile was added to inactivate the enzyme. After ice bathing for 5min, 20μl of 0.5% glacial acetic acid / water was added to ensure that the enzymatic hydrolysis process stopped, the reaction was terminated and vortexed. The sample was centrifuged at 15,000 g for 30 min at 4°C, the supernatant was aspirated, and diluted 5-fold with deionized water. The peak time, peak area and other indicators of the linear and cyclic peptides were immediately detected by HPLC (Figures 10 and 11).

[0116] 5.3 Results Analysis

[0117] Using the peptide content at 0 h as a standard, it can be seen that under the same incubation time, the degradation rate of the linear peptide is significantly faster than that of the cyclic peptide, and the stability of the cyclic peptide is significantly better than that of the linear peptide ( Figure 12 ).

[0118] Example 6: Targeting of KRAS G12C by Cyclic Peptide Conjugates

[0119] 6.1 Synthesis of HGP-FITC

[0120] Following the same procedure as in Example 1, the fully protected linear peptide CLYDVAGSDKYCGPK was first synthesized, followed by cyclization of the linear peptide. Finally, following the same procedure as in Example 3, the cyclic peptide was conjugated to the fluorescent group FITC to obtain a fluorescently labeled cyclic peptide (HGP-FITC). Since HGPF itself is non-fluorescent, HGP-FITC was used instead of HGPF to test the targeting of the cyclic peptide conjugate to lung cancer cell lines. Figures 13 and 14 show the HPLC report and mass spectrum of HGP-FITC, and its structure is as follows:

[0121] 6.2 The lung cancer cell line H358 (carrying KRAS G12C mutation) was incubated with different concentrations of HGP-FITC and detected by flow cytometry after 8 hours.

[0122] Flow cytometry results showed that H358 cells took up HGP-FITC in a concentration-dependent manner ( FIG. 15 ).

[0123] 6.3 Based on the flow cytometry results, a 25 μM concentration was selected for subsequent experiments. Lung cancer cell line H358 (carrying the KRAS G12C mutation) was blocked for 24 hours with either a 1:1000 dilution of KRAS antibody or 10 μM sotorasib (KRAS G12C inhibitor). The cells were then incubated with 25 μM HGP-FITC. Fluorescence uptake was measured by flow cytometry 8 hours later.

[0124] The results showed that when KRAS sites were pre-blocked with KRAS antibodies and Sotorasib, H358 cells significantly reduced their uptake of HGP-FITC (Figure 16). This result demonstrates that cyclic peptide conjugates such as HGP-FITC and HGPF have specific targeting capabilities for KRAS G12C.

[0125] Example 7: Specific recognition and cleavage of polypeptides containing GP linkers by FAPα

[0126] This example uses a bioluminescence resonance energy transfer (BRET) experiment to demonstrate that the linker GP in HGPF can be specifically recognized and cleaved by FAPα. The principle is that when the energy donor RLUC fluorescent protein and the energy acceptor EYFP fluorescent protein are close to each other, the emission wavelength of RLUC is 460nm, which is exactly the excitation wavelength of EYFP, allowing EYFP to emit light with a wavelength of 530nm. First, a BRET reporter plasmid is constructed, which can express EYFP, CLYDVAGSDKYCGP short peptide and RLUC in cells. At the same time, a plasmid overexpressing FAPα is constructed. If the above two plasmids are expressed in mammalian cells at the same time, FAPα will cut the fusion protein expressed by the reporter plasmid from the GP dipeptide. After RLUC and EYFP are separated, energy transfer cannot occur. Therefore, by performing fluorescence detection at a specific wavelength, it is possible to very sensitively verify whether FAPα can cut the linker. The specific steps are as follows:

[0127] 7.1 Construction of BRET reporter plasmid:

[0128] (1) Design of oligo primers for expressing CLYDVAGSDKYCGP short peptide:

[0129] F:ctgtctgtacgacgtcgcgggctccgataaatacggtcctgcaagcggttgtg(SEQ ID NO:1)

[0130] R:gatccacaaccgcttgcaggaccgtatttatcggagcccgcgacgtcgtacagacagagct (SEQ ID NO: 2)

[0131] The two oligo fragments were annealed to form double-stranded DNA, which was then inserted into the BRET vector (purchased from Qingke Biotechnology) through the SacI and BamHI restriction sites to obtain the BRET reporter plasmid.

[0132] 7.2 Construction of FAPα overexpression plasmid:

[0133] (1) The coding region sequence of the FAPα gene is:

[0134] (2) The above sequence was inserted into the pcDNA3.1(+) plasmid through the two restriction sites of BamHI and NotI to obtain the FAPα overexpression plasmid.

[0135] 7.3 Steps of BRET experiment:

[0136] (1) Plating: 293T cells in logarithmic growth phase were plated at 3×10 5 The cells were evenly plated in a six-well plate and cultured in a 37°C, 5% CO2 cell culture incubator for 12 hours.

[0137] (2) Transfection: FAPα overexpression plasmid and BRET reporter plasmid were transfected into 293T cells at a ratio of 9:1. Simultaneously, FAPα and BRET reporter plasmids were transfected into 293T cells at the same ratio as a control. After 48 h, cells were lysed with 200 μl of cell lysis buffer per well of a 6-well plate. The lysate was collected and the supernatant was centrifuged.

[0138] (3) Detection: First, prepare a 5 μM coelenterazine reaction solution with PBS. Add 10 μl of cell lysate to the ELISA plate, then add 10 μl of 5 μM coelenterazine. After incubation in the dark for 15 minutes, detect at wavelengths of 460 nm and 530 nm. The degree of BRET quantification is expressed as the ratio of the emitted light at 460 nm to 530 nm.

[0139] The results of the BRET experiment showed that the GP short peptide could be specifically cleaved by FAPα ( FIG. 17 ).

[0140] Example 8: Killing effect of HGPF on lung cancer cells

[0141] The cytotoxicity of HGPF, cyclic peptide (CLYDVAGSDKYCGP), FN1-8, and FN1-8 methylamino derivative (FN1-8-CH2-NH2) was detected by CCK8 assay. The experimental steps are as follows:

[0142] 8.1 Plating: H358 cells in the logarithmic growth phase were seeded in 96-well plates (100 μl / well). Six replicate wells were prepared for each group, and the number of cells per well was set at 5×10 3 The cells were placed in a 37°C, 5% CO2 incubator for 12 h.

[0143] 8.2 Experimental groups were treated with varying concentrations of HGPF, HGPF + FAPα, cyclic peptide, FN1-8, and FN1-8-CH2-NH2. Each drug was first prepared as a 100 mM stock solution, and then nine concentrations were set: 100 μM, 50 μM, 25 μM, 12.5 μM, 6.25 μM, 3.125 μM, 1.5625 μM, and 0.78125 μM. The HGPF + FAPα group was treated with HGPF at the above concentrations, followed by the addition of FAPα (1 μM) to simulate the tumor tissue microenvironment.

[0144] 8.3 After 24 hours, wash the cells twice with PBS and add 100 μL of premixed CCK8 solution (culture medium:CCK8 working solution = 9:1) to each well. Incubate the cells in a 37°C, 5% CO2 incubator for another 2 hours.

[0145] 8.4 Use a microplate reader to measure the absorbance D(λ) of each well at a wavelength of 450 nm. Analyze the D(λ) values ​​of the zero adjustment group, control group, and experimental group to determine the cell viability. Cell viability reflects the cytotoxicity of the drug. The groups are as follows:

[0146] Experimental group (culture medium containing cells, CCK-8, and test drugs)

[0147] Control group (culture medium containing cells, CCK-8, and no test drug)

[0148] Zero adjustment group (culture medium without cells and test substances, containing CCK-8)

[0149] The CCK8 results (Figure 18) showed that the cyclic peptide and the HGPF group without FAPα had very weak cytotoxicity to lung cancer cells, while the HGPF group with FAPα, the FN1-8 group, and the FN1-8-CH2-NH2 group all had good cytotoxicity to tumor cells, among which the IC50 of FN1-8-CH2-NH2 was 4.676 μM and the IC50 of FN1-8 was 4.341 μM, and the IC50 of the two were similar. However, further increasing the concentration of FN1-8 did not significantly improve its cytotoxicity and could not achieve complete inhibition. The results show that the inhibitory effect of FN1-8-CH2-NH2 on cell viability is significant, and when the concentration of FN1-8-CH2-NH2 is 100 μM, the inhibition rate of H358 cells can reach 100%, indicating that the killing effect of FN1-8-CH2-NH2 after structural modification of the present invention on tumor cells is improved compared with FN1-8; and the IC50 of the conjugated drug HGPF is 3.656 μM, which is better than that of the FN1-8-CH2-NH2 group, indicating that the HGPF conjugate obtained by conjugating the cyclic peptide of the present invention and FN1-8-CH2-NH2 can improve the anti-tumor effect.

[0150] Example 9: Detection of the inhibitory effect of HGPF on lung cancer cell proliferation and migration using a scratch assay

[0151] The inhibitory effects of the conjugate HGPF and cyclic peptide (CLYDVAGSDKYCGP) on lung cancer cell proliferation and migration were detected by scratch assay. The experimental steps are as follows:

[0152] 9.1 Plating: First, mark three positioning lines on the bottom of a 6-well plate. Inoculate H358 cells in the logarithmic growth phase into the 6-well plate (2 ml / well). The number of cells per well is set to 1×10 6 The cells were placed in a 37°C, 5% CO2 incubator for 24 h.

[0153] 9.2 Marking: Place the plate cover on top of a 6-well plate and use a 100μ pipette tip to mark three straight lines vertically in each well. Wash four times with PBS to remove floating cell debris.

[0154] 9.3 Drug administration: The culture medium was replaced with a culture medium containing 2% serum, and each group was given 10 μM of drug. Pictures were taken at 0 hour and 24 hours to observe the healing of the wound, and the images were analyzed using ImageJ software.

[0155] The results of the scratch test showed that the cyclic peptide and the HGPF group without FAPα had no inhibitory effect on the proliferation and migration of tumor cells, while the HGPF group with FAPα could significantly inhibit the proliferation and migration of tumor cells ( FIG. 19 ).

[0156] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.

Claims

1. A conjugate of a polypeptide and a small molecule, characterized in that: It is obtained by connecting cyclic peptides and small molecule compounds through chemical bonds; The structural formula of the cyclic peptide is: The small molecule compound is a small molecule inhibitor or a derivative thereof that can inhibit the activity of GLI1.

2. The conjugate of a polypeptide and a small molecule according to claim 1, characterized in that: The small molecule compound is selected from the following compounds:

3. The conjugate of a polypeptide and a small molecule according to claim 1 or 2, characterized in that: The carboxyl group at the C-terminus of the cyclic peptide and the small molecule compound are connected via an amide bond or an ester bond.

4. The conjugate of a polypeptide and a small molecule according to claim 1, characterized in that Its structural formula is:

5. A FN1-8 methylamino derivative or a pharmaceutically acceptable salt thereof, characterized in that: The structural formula of the FN1-8 methylamino derivative is:

6. Use of a conjugate of a polypeptide according to any one of claims 1 to 4 and a small molecule in the preparation of a drug for preventing and / or treating tumors.

7. Use of the FN1-8 methylamino derivative or a pharmaceutically acceptable salt thereof according to claim 5 in the preparation of a medicament for preventing and / or treating tumors.

8. The use according to claim 6 or 7, characterized in that The tumors are: lung cancer, pancreatic cancer, colorectal cancer, and breast cancer.

9. The use according to claim 8, characterized in that The tumor is a tumor carrying a KRAS mutation.

10. The use according to claim 9, characterized in that The KRAS mutation is a KRASG12C mutation.

11. The use according to claim 8, characterized in that The tumor is a tumor that overexpresses GLI1.

12. The use according to claim 8, characterized in that The tumor is non-small cell lung cancer.

13. A drug for preventing and / or treating tumors, characterized in that: The active ingredient is prepared from active ingredients and pharmaceutically acceptable excipients, wherein the active ingredient includes the conjugate of the polypeptide and small molecule according to any one of claims 1 to 4, and / or the FN1-8 methylamino derivative or a pharmaceutically acceptable salt thereof according to claim 5.

14. A method for preventing and / or treating tumors, characterized in that: The method comprises: administering a safe and effective amount of a conjugate of a polypeptide and a small molecule according to any one of claims 1 to 4; and / or, administering a safe and effective amount of the FN1-8 methylamino derivative or a pharmaceutically acceptable salt thereof according to claim 5; and / or, Administer a safe and effective amount of the drug according to claim 13.

15. The method according to claim 14, characterized in that The tumors are: lung cancer, pancreatic cancer, colorectal cancer, and breast cancer.

16. The method according to claim 8, characterized in that The tumor is a tumor carrying a KRAS mutation.

17. The method according to claim 9, characterized in that The KRAS mutation is a KRASG12C mutation.

18. The method according to claim 8, characterized in that The tumor is a tumor that overexpresses GLI1.

19. The method according to claim 8, characterized in that The tumor is non-small cell lung cancer.

Images