Engineering native e. coli for tumor imaging under hypoxia conditions
Genetic engineering of E. coli strains EcAZ-1 and EcN using a transposon-based method to incorporate IFP 2.0 and express bioactive compounds addresses the challenge of modifying undomesticated strains, enhancing tumor imaging and compound production for gastrointestinal cancer detection.
Patent Information
- Application Number
- PCT/US2025/024545
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-01-28
- Filing Date
- 2025-04-14
- Publication Date
- 2025-10-16
AI Technical Summary
The genetic manipulation of wild or undomesticated E. coli strains, such as EcAZ-1, is challenging due to their resistance to conventional genetic modification techniques, limiting their application in biomedical research and therapeutic interventions, particularly for gastrointestinal cancer detection and bioactive compound production.
A transposon-based genomic recombination method is employed to modify E. coli strains EcAZ-1 and EcN, incorporating an oxygen-independent fluorescent protein (IFP 2.0) and enhancing its fluorescence with heme oxygenase and biliverdin, while expressing bioactive compounds like naringenin and mycosporine-like amino acids under hypoxia-specific promoters.
The engineered E. coli strains effectively colonize the gut and enhance tumor imaging capabilities under hypoxic conditions, demonstrating potential for gastrointestinal cancer detection and bioactive compound production, showcasing robust biotechnological applications.
Smart Images

Figure US2025024545_16102025_PF_FP_ABST
Abstract
Description
[0001] Engineering Native E. coli for Tumor Imaging under Hypoxia Conditions
[0002] STATEMENT OF FEDERAL FUNDING
[0003] This invention was made with government support under U01 CA265719 awarded by the National Institutes of Health. The government has certain rights in the invention.
[0004] BACKGROUND
[0005] 1. Field of the Invention
[0006] The invention disclosed herein relates to bacteria that produce heterologous fluorescence protein under hypoxia condition to be utilized for gastrointestinal cancer diagnosis as well as bacteria that produce bioactive natural product.
[0007] 2. Background
[0008] Microbes are ubiquitously present in almost all environmental niches.7They play pivotal roles in ecological balance and processes essential for life on Earth, such as nutrient cycling, decomposition, food digestion, immunity, and the biosynthesis of chemicals. With the advent of genetic engineering, the modification of microbial genomes has become a promising strategy in addressing multiple societal challenges,2ranging from human health and climate change to sustainability and waste recycling. Despite significant progress, the transformative potential of microbes remains largely underexploited. Recent advances in DNA sequencing technologies have shed light on the extensive genetic diversity of environmental microbes,5, 4uncovering a realm of untapped microbial functionality. However, the natural microbial repertoire often lacks the specific traits needed for desired applications. Over the past decades, synthetic biology has demonstrated successes in augmenting the capabilities of microbes, endowing them with enhanced or novel functionalities. On the other hand, this progress has so far been predominantly focused on a limited set of domesticated or model microbial strains, which are more tractable to genetic manipulation.9
[0009] The human gut microbiota, comprising potentially over 1,000 species9, 11exemplifies the complex interplay between microbes and human health. Alterations in the microbiome have been linked to a broad spectrum of diseases, including cancer, obesity, diabetes, mental health disorders, cardiovascular diseases, inflammatory bowel disease, and infections / 2as well as influencing the efficacy of therapeutic interventions.75Given the notable role of the human microbiome in maintaining and sustaining host health, microbiomc engineering emerges as a promising avenue for health improvement and disease mitigation.74, 71Indeed, the advances of next-generation sequencing and bioinformatics have uncovered the genomes of thousands of microbiome isolates.76, 77These advances facilitate a deeper understanding of microbiota functionality down to the strain level.75Furthermore, new bacterial culturing methods are making it possible to isolate >1,000 bacterial species from the human gut microbiome79, 20and some isolates have been used to construct the synthetic microbial community to investigate the interplays between the microbiome and human health.27Nonetheless, the genetic manipulation of microbiome isolates to achieve desired functionalities presents significant challenges,75, 22, 25with only a few strains, such as Escherichia coli Nissle 1917 (EcN),27Bifidobacterium, Bacteroides and lactic acid bacteria,25,26being extensively studied.
[0010] E. coli is one of the most well-characterized model organisms and has been instrumental in advancing the understanding of genetics, molecular biology, immunology, physiology, and biochemistry.27Despite its well-characterized status, E. coli exhibits significant population diversity,25, 29with an estimated population in nature reaching IO20. This bacterium predominantly resides within the mammalian intestinal microbiome,50accounting for 0.1-5% of the total community. However, its pathogenic variants, classified into at least 11 pathotypes, contribute to a spectrum of intestinal and extraintestinal diseases in humans,57leading to nearly one million deaths worldwide in 2019.52The intricate relationship between E. coli and human health is further highlighted by the presence of the genotoxic pks+ E. coli, which harbors a 50-kb colibactin biosynthetic gene cluster (BGC). These strains are found in approximately 20% of healthy individuals, 40% of patients with inflammatory bowel disease, and 60% of colorectal cancer patients.55'55The genetic manipulation of E. coli offers a pathway to deepen our understanding of these interactions, yet challenges persist. Wild or undomesticated strains of E. coli often resist genetic modification techniques developed for lab-adapted strains,56posing a significant barrier to both fundamental and applied microbial research.
[0011] SUMMARY
[0012] Here is presented the genetic engineering of a native E. coli strain, Ec AZ- 1 , isolated from the fecal sample of a conventionally -raised C57BL / 6 male mouse, alongside EcN. EcAZ-1 has demonstrated an ability to persistently colonize the gut of conventionally raised mice and offers protective effects against colon cancer development in a mouse model.57A transposon-based genomic recombination method was successfully employed to modify both EcAZ-1 and EcN.38Using this method, an oxygen-independent fluorescent protein, IFP 2.0,39was incorporated into their genomes. IFP 2.0's fluorescence level was further enhanced by co-expressing a heme oxygenase and supplying biliverdin (BV), the chromophore of IFP 2.0. Furthermore, IFP 2.0 in both EcAZ-1 and EcN were successfully expressed under the control of three hypoxia-specific promoters. Finally, both strains were engineered to produce natural products (NPs) naringenin and mycosporine-like amino acids0showcasing the potential of genetically engineered E. coli in biomedical research and applications.
[0013] Based on the results presented in this disclosure, recombinant bacteria expressing a heterologous fluorescence protein are provided, and the heterologous fluorescence protein is expressed from a heterologous nucleic acid comprising a promoter sequence and a codon- optimized gene encoding the heterologous fluorescence protein under the control of the promoter sequence. The heterologous nucleic acid is inserted into the bacterial chromosome.
[0014] In a certain embodiment, the heterologous fluorescence protein is green fluorescent protein (GFP) encoded by a nucleic acid sequence comprising SEQ ID NO:6 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 6. In a preferred embodiment, the heterologous fluorescence protein is infrared fluorescent proteins 2.0 (IFP2.0) encoded by a nucleic acid sequence comprising SEQ ID NO:4 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 4.
[0015] In some embodiments, the promoter for IFP2.0 expression is a hypoxia-inducible promoter selected from Pfnr promoter of SEQ ID NO:1, FF20 promoter of SEQ ID NO:2, FF20* promoter of SEQ ID NO: 3, or any promoter having a nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 1, 2, or 3.
[0016] In some embodiments, the promoter for IFP2.0 expression is a chemically inducible promoter selected from isopropyl-P-d-thiogalactopyranoside (IPTG)-inducible T7 promoter of SEQ ID NO: 15, arabinose-inducible pBAD promoter of SEQ ID NO: 16, or any promoter having a nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 15 or 16.
[0017] In some embodiments, the recombinant bacteria express another heterologous protein, heme-oxygenase (HOI), which is encoded from a heterologous codon-optimized gene; and the gene encoding HOI comprises a nucleic acid sequence of SEQ ID NO:5 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 5. The gene encoding HOI is translated from a polycistronic mRNA that encodes IFP2.0, optionally after the 3 ’-end of the gene encoding IFP2.0, under the control of the same promoter.
[0018] As used herein, the term "polycistronic" refers to a single mRNA molecule that encodes multiple proteins, unlike the typical monocistronic mRNA of eukaryotes, which encodes only one. This is a common feature in prokaryotes (bacteria and archaea).
[0019] In other embodiments, the recombinant bacteria further comprise a heterologous nucleic acid to express a heterologous polypeptide or heterologous polypeptides for the synthesis of a bioactive compound, optionally to be secreted from the recombinant bacteria. The expression of the polypeptide(s) can be controlled by the same promoter that controls IFP2.0 expression or by different promoter, and the heterologous nucleic acid is inserted into the bacterial chromosome. For example, the bioactive compound is naringenin or mycosporine-like amino acids.
[0020] In another embodiment, a composition for gastrointestinal cancer detection is provided, and the composition comprises the recombinant bacteria described above. The recombinant bacteria is optionally lyophilized. The composition may comprise about 103- 1011colony forming units of bacteria, and the composition is formulated into solid, semi-solid, or liquid dosage form for oral- or rectal administration. For oral administration, the composition is formulated into powder, granules, tablets, packed in a gelatin- or vegetable gel capsule, gel, paste, or suspended in a solution. For rectal administration, the composition is formulated into suppositories. The composition optionally comprises excipients necessary for the dosage form.
[0021] In another embodiment, a method of detecting gastrointestinal cancer using the composition comprising bacteria expressing IFP2.0 and optionally HOI under the control of a hypoxia inducible promoter is provided, and the method comprises steps of: a. administering the composition through oral- or rectal route; b. optionally administering biliverdin and / or hemin through oral- or rectal route; and c. scanning the fluorescence.
[0022] In the aforementioned method, the quantity of biliverdin (M.W. 582.646 g / mol) and hemin (M.W. 651.95 g / mol) to be administered may depend on the quantity of the bacteria to be administered. Although in a literature, biliverdin 50 pmol / kg / day was tried in mice (Yamashita K, et al. FASEB J. 2004. PMID: 14977878), the daily dose might be less than about 300 mg considering their effect on the liver or other organs.
[0023] In another embodiment, a method of detecting gastrointestinal cancer using the composition comprising bacteria expressing IFP2.0 and optionally HOI under the control of the T7 promoter or pBAD promoter, and the method comprises steps of: a. administering the composition through oral- or rectal route; b. administering IPTG, lactose or arabinose through oral- or rectal route; c. optionally administering biliverdin and / or hemin through oral- or rectal route; and d. scanning the fluorescence.
[0024] In the aforementioned method, the quantity of lactose and arabinose to be administered may depend on the quantity of the bacteria to be administered. The daily dose might be less than about 12 g, considering lactose intolerance or proven daily intake amount of L-arabinosc.
[0025] In another embodiment, a kit for administering the composition is provided, and the kit comprises: a. a container comprising the bacterial composition; b. a container comprising biliverdin and / or hemin in a dosage form of solution, powder, capsule, tablet, or suppository; and optionally c. a container comprising lactose or arabinose in a dosage form of solution, powder, capsule, tablet, or suppository.
[0026] In some embodiments, recombinant bacteria producing naringenin are provided, and the bacteria comprise a heterologous nucleic acid comprising a promoter sequence and codon- optimized genes encoding enzymes for naringenin biosynthesis under the control of the promoter sequence, comprising: i. a nucleic acid sequence comprising SEQ ID NO:7 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO:7, which encodes L-tyrosine ammonia-lyase (TAL) or a homolog thereof; ii. a nucleic acid sequence comprising SEQ ID NO:8 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO:8, which encodes 4-coumarate-CoA ligase (4CL) or a homolog thereof; iii. a nucleic acid sequence comprising SEQ ID NO:9 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO:9, which encodes chaicone synthase (CHS) or a homolog thereof; and iv. a nucleic acid sequence comprising SEQ ID NO: 10 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 10, which encodes chaicone isomerase (CHI) or a homolog thereof.
[0027] In some embodiments, recombinant bacteria producing mycosporine-like amino acids are provided, and the bacteria comprise a heterologous nucleic acid comprising a promoter sequence and codon-optimized genes encoding enzymes for the biosynthesis of mycosporine-like amino acids under the control of the promoter sequence, comprising: i. a nucleic acid sequence comprising SEQ ID NO: 11 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 11, which encodes MysA (a dehydroquinate synthase homolog) or a homolog thereof; ii. a nucleic acid sequence comprising SEQ ID NO: 12 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 12, which encodes MysB (an O-mcthyltransfcrasc) or a homolog thereof; iii. a nucleic acid sequence comprising SEQ ID NO: 13 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 13, which encodes MysC (an ATP-grasp ligase) or a homolog thereof; and iv. a nucleic acid sequence comprising SEQ ID NO: 14 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 14, which encodes MysD (D-alanine-D-alanine ligase) or a homolog thereof, wherein mycosporine-like amino acids are mycosporine-glycine and porphyra-334. In the aforementioned bacteria, the genes are assembled as a single operon under the control of an inducible promoter, optionally the inducible promoter being T7 promoter, or a constitutively active promoter. As used herein, the term “operon” refers to a functional unit of DNA in prokaryotes (bacteria and archaea) where a cluster of genes, all transcribed together from a single promoter as a polycistronic mRNA, encodes proteins with related functions, often involved in the same metabolic pathway. Also, the heterologous nucleic acid sequence is inserted into the bacterial chromosome.
[0028] Preferably, the recombinant bacteria described above are species from the human gut microbiome, which are aerobic and facultatively anaerobic bacteria or anaerobic bacteria, and optionally the recombinant bacteria is E. coli. In particular, E.coli strain is one selected from E. coli BL21, E.coli EcAZ-1, E.coli EcAZ-2, E.coli MG1655, and E.coli Nissle 1917, and in more particular E.coli strain is E.coli EcAZ-1 or E.coli Nissle 1917.
[0029] In another embodiment, a method for producing naringenin is provided, comprising steps of: i. culturing recombinant bacteria as described herein (e.g. EcAZ-1 or EcN) under conditions suitable for production of naringenin, optionally in the presence of L-tyrosine; ii. adding an amount of IPTG (e.g. about 0.1 mM) to the bacterial culture when ODeoo reaches between 0.4 and 0.6, and further incubating the bacterial culture at a predetermined temperature (e.g. at about 18°C) for a period of time (up to about 8-24hr) while gently shaking it; and iii. extracting naringenin from the recombinant bacteria.
[0030] In another embodiment, a method for producing mycosporine-like amino acids, comprising steps of: i. culturing recombinant bacteria as described herein (e.g. EcAZ-1 or EcN) under conditions suitable for production of mycosporine-like amino acids; ii. adding an amount of IPTG (e.g. about 0.1 mM) to the bacterial culture when ODeoo reaches between 0.4 and 0.6, and further incubating the bacterial culture at a predetermined temperature (e.g. at about 18°C) for a period of time (up to about 8-24hr) while gently shaking it; and iii. extracting mycosporine-like amino acids from the recombinant bacteria. BRIEF DESCRIPTION OF THE DRWINGS
[0031] Figure 1. Schematic representation of genetic engineering of EcAZ-1 and EcN by a chassis-independent recombinase-assisted genome engineering (CRAGE) method to express fluorescent proteins and natural products. LP, landing pad; T7RP, T7 RNA polymerase; KmR, kanamycin resistant gene; AprR, apramycin resistant gene; Cre, Cre recombinase gene; GOI, gene of interest; NP, natural product.
[0032] Figure 2. Growth of wild-type (WT) and engineered strains EcAZ-1 and EcN harboring PW17 landing pad (LP), GFP, or IFP2.0. Bacteria were cultured in LB at 37°C, and optical density at 600 nm (ODeoo) was measured at 9 h and overnight using a microplate reader in a 96-well plate format. Data represent the mean ± standard deviation (s.d.) from three independent experiments.
[0033] Figure 3. Genetic engineering of EcAZ-1 and EcN via the CRAGE method. A. Luminescence analysis of 96 randomly selected colonies of EcAZ-1 engineered to express the luxCDABE operon, induced by 0.1 mM IPTG in 96-well microplates. Dark dots and pink dots represent the signals of induced and uninduced colonies, respectively. LP-containing EcAZ-1 (green dot) served as the negative control. A black dashed line indicates the average luminescence intensity across all positive colonies. RLU: Relative Light Unit. B. Luminescence of eight randomly selected EcN colonies expressing the / uxCDABE operon. Protein expression was induced with 0.1 mM IPTG in 96-well microplates. EcN containing the PW17 landing pad (LP) was used as a control. The data represent the mean ± s.d. from three independent experiments.
[0034] Figure 4. Fluorescence analysis of randomly picked 96 colonies of EcAZ-1 and 20 colonies of EcN expressing GFP. Culture was induced by 0.1 mM IPTG and incubated for 5 hours at 37 °C. Fluorescence measurements were taken in 96-well microplates, using an excitation wavelength of 488 nm and an emission wavelength of 510 nm. The data represents the mean ± s.d. of three independent experiments, a.u.: arbitrary units.
[0035] Figure 5. Fluorescence analysis of randomly picked 20 colonies of EcAZ-1 and EcN expressing IFP2.0. Expressions of IFP2.0 in engineered EcAZ-1 and EcN were induced by 0.1 mM IPTG in LB at 37°C overnight under anaerobic condition. Fluorescence measurements were taken in 96-well microplates, using an excitation wavelength of 690 nm and an emission wavelength of 710 nm. Dark dots and pink dots represent the signals of induced and uninduced colonics, respectively. LP-containing EcAZ-1 and EcN (green dots) served as the negative control. A black dashed line indicates the average fluorescence intensity across all positive colonies.
[0036] Figure 6. Expression of oxygen-independent fluorescent protein IFP 2.0 in EcAZ-1 and EcN. A. Fluorescence analysis of engineered EcAZ-1 and EcN expressing IFP2.0. Expressions of IFP2.0 in engineered EcAZ-1 and EcN were induced by 0.1 mM IPTG in LB at 37 °C overnight under the anaerobic condition. Fluorescence measurements were taken in clear-bottom 96-well microplates, using an excitation wavelength of 690 nm and an emission wavelength of 710 nm. The average fluorescent intensity of positive colonies is shown. Data represent mean ± s.d. of three independent experiments. B. Improving the fluorescence intensity in EcAZ-1 and EcN by either supplementing BV or co-expressing HOI in the presence or absence of heme (HM). Expressions of IFP 2.0 and HO 1 were induced by 0.1 mM IPTG in either GMM or LB at 37 °C overnight under aerobic conditions. The fluorescence was measured in a clear-bottom 96-well plate. The medium was supplemented with BV (2 pM) or hemin (2 pM). Data arc generated after normalization with the growth and presented as mean ± s.d. of two independent experiments. C. Media effect on fluorescence signals. The ratios of fluorescence signals were compared for engineered EcAZ-1 and EcN cultured in LB and GMM.
[0037] Figure 7. Supplying biliverdin (BV) or hemin (Fe) and co-expressing IFP2.0 with HOI improved the fluorescence intensity in engineered EcAZ-1 (A) and ECN (B). Modified strains. (EcAZ-1 or EcN harboring T7-IFP2 with or without HOI) were grown at 37°C in GMM (gut microbiota medium) or LB and incubated at 37°C until log phase. IPTG 0.1 mM was then added to induce the expression, and EcAZ-1 or EcN was incubated at 37°C overnight. The fluorescence was measured in a clear-bottom 96-well plate by an Agilent Synergy Hl microplate reader (excitation at 690 nm and emission at 710 nm). The medium was supplemented with BV (2 pM) or hemin (2 pM). Data are generated after normalization with the growth and presented as mean ± s.d. of two independent experiments.
[0038] Figure 8. Growth of engineered EcAZ-1 and EcN carrying hypoxia promoters and IFP2.0 in GMM or LB. Engineered strains were grown in 200 pl LB or GMM containing 25 pg / ml apramycin in a 96-well plate. The cultures were incubated aerobically or anaerobically at 37°C overnight. ODeoo values were then measured by a microplate reader. The data represent the mean ± s.d. of three independent experiments.
[0039] Figure 9. A. Fluorescence signals generated from EcAZ-1 expressing IFP2.0 controlled by T7, and hypoxia promoters Pfnr, FF20 and FF20*. Red bars represent control experiments without IPTG induction (T7) or under aerobic conditions. The data represent mean ± s.d. of two independent experiments. B. Fluorescence signals generated from EcN expressing IFP2.0 controlled by T7, Pfnr, FF20, and FF20* promoters. Red bars represent control experiments without IPTG induction (T7) or under aerobic conditions. The data represent mean ± s.d. of three independent experiments. C. Time-course of fluorescence generation from EcAZ-1 expressing IFP2.0. The protein expression of engineered strains and control strains were induced by 0.1 mM IPTG or anaerobic condition and incubated at 37°C for overnight. All the cultures were in LB medium supplied with 2 pM BV. At each time point, the samples were collected into a 96-well plate for fluorescence measurement by an Agilent Synergy microplate reader (excitation at 690 nm and emission at 710 nm). Data represents the mean ± s.d. from two independent experiments.
[0040] Figure 10. Hypoxia promoters activate the expression of IFP 2.0 in EcAZ- 1 and EcN under anaerobic conditions. A. Fluorescence analysis of EcAZ-1 and EcN expressing IFP 2.0 controlled by T7, Pfnr, FF20, and FF20* promoters. Engineered strains were cultured in LB in 96-well microplates at 37 °C until log phase. The protein expression was then induced by 0.1 mM IPTG for the T7 promoter or were placed under anaerobic conditions for the hypoxia promoters. BV (2 pM) was supplied, and the cultures were further incubated for overnight. Fluorescence measurements were taken in clear-bottom 96-well microplates, using an excitation wavelength of 690 nm and an emission wavelength of 710 nm. Aerobic fermentation was used as the negative control for hypoxia-specific promoters. The data represent the mean ± s.d. of three independent experiments. B. Effect of BV supplementation on fluorescent signals. The fold-improvement of fluorescence intensity by BV supplement was calculated by dividing the fluorescent intensity of a sample supplemented with BV from that without its supplementation.
[0041] Figure 11. A. Fluorescence signals generated from EcAZ-1 expressing IFP2.0 controlled by T7- or pBAD promoters. B. Time-course of fluorescence signals generated from EcAZ-1 expressing IFP2.0 controlled by T7- or pBAD promoter. The protein expression of engineered strains and control strains were induced by 0.1 mM IPTG or 0.1% L- arabinose and incubated anaerobically at 37°C overnight. The samples were then collected into a 96-well plate for fluorescence measurement by an Agilent Synergy Hl microplate reader (excitation at 690 nm and emission at 710 nm).
[0042] Figure 12. A. Biosynthesis pathway of naringenin from L-Tyrosine. B. Biosynthesis pathway of MAA analogs.
[0043] Figure 13. Representative agarose gel of PCR analysis of the colonies of engineered EcAZ- 1 harboring the naringenin (Nar) BGC (calculated size = ~6.4 kb) and MAA BGC (calculated size = ~5.2 kb). DNA electrophoresis was performed in a 0.6% agarose gel along with a GeneRuler 1 kb DNA Ladder.
[0044] Figure 14. Heterologous production of bioactive naringenin and mycosporine-like amino acids in EcAZ-1 and EcN. A. HPLC analysis of EcAZ-1 expressing the naringenin BGC under aerobic (iii) and anaerobic (ii) conditions. Engineered EcAZ-1 without IPTG induction under aerobic conditions (i) and naringenin standard (iv) served as controls. The detection wavelength is 283 nm. B. Extracted ion chromatogram (EIC, m / z = 273.03-273.13) traces of ethyl acetate extraction of engineered EcAZ-1 (iii) and EcN (iv). Engineered EcAZ-1 without IPTG induction (i) and naringenin standard (ii) served as controls. The experiments were conducted under aerobic conditions. C. HRMS analysis of naringenin produced by engineered EcAZ-1. D. EIC traces of porphyra-334 (m / z = 347.1439-347.1459, ii), MG (m / z = 246.0965-246.0979, iv), and 4-DG (m / z = 189.0751-189.0763, iv) in the methanolic extraction of EcAZ-1 engineered with the MAA BGC. Standard MG (ii) and 4-DG (iv) served as controls and engineered Ec AZ- 1 without IPTG induction acted as a negative control. The induced production of MAAs was performed under aerobic conditions. HRMS traces of 4-DG, MG and porphyra-334 produced by engineered EcAZ-1 showed expected m / z values. EIC and MS traces of different metabolites molecules were shown with different colors.
[0045] Figure 15. HR-MS / MS fragmentations of naringenin (CE=20, A), 4-DG (CE = 20, B), MG (CE = 20, C), and porphyra-334 (CE = 20, D) produced by engineered EcAZ- 1. The observed m / z values of key fragments are shown in red along with proposed fragment structures.
[0046] Figure 16. Extracted ion chromatograms (EICs) of naringenin (m / z - 272.98-273.18), MG (m / z = 246.05-246.15) and porphyra-334 (m / z = 347.09-347.19) from engineered EcAZ-1 and EcN expressing the BGC of naringenin or MAA aerobically or anaerobically. Engineered EcAZ-1 without IPTG induction under aerobic conditions served as a negative control. Naringenin, MG and porphyra-334 standards were included as controls, i, Engineered EcAZ-1 without IPTG induction under aerobic conditions; ii, standard; iii, aerobic expression in engineered EcAZ-1; iv, anaerobic expression in engineered EcAZ-1; v, aerobic expression in engineered EcN; vi, anaerobic expression in engineered EcN. The peaks of expected products were shadowed in orange. Normalization Level (NL) intensities of the EIC peaks are included.
[0047] Figure 17. A. Normalized fluorescence signals generated from EcAZ-1 and EcN expressing IFP2.0 controlled by T7, Pfnr, FF20, and FF20* promoters. Strains were cultured in LB with or without BV (2 pM) supplement. The data represent the mean ± s.d. of three independent experiments. B. Fluorescence or normalized fluorescence signals generated from EcAZ-1 and EcN expressing IFP2.0 controlled by T7, Pfnr, FF20, and FF20* promoters when cultured in GMM with or without BV (2 M) supplement. The data represent the mean ± s.d. of three independent experiments. C. Fold improvements of fluorescence signals by BV supplement generated from EcAZ-1 and ECN expressing IFP2.0 controlled by T7, Pfnr, FF20, and FF20* promoters in GMM.
[0048] DETAILED DESCRIPTION
[0049] A. Overview
[0050] The results here demonstrate the efficacy of the CRAGE method in genetically engineering native and probiotic E. coli strains EcAZ-1 and EcN. The successful integration of functional genes such as GFP and IFP 2.0 into these strains not only underscores the versatility of CRAGE but also enhances capabilities for detailed functional studies and biotechnological applications in health and disease contexts. Particularly, the engineered strains exhibited potential in tumor imaging under both aerobic and anaerobic conditions. Additionally, the successful production of bioactive compounds naringenin and MAAs in engineered EcAZ-1 emphasizes the expanded biotechnological applications of this strain, which robustly colonizes the gut of conventionally raised mouse.57This also encourages the further exploration of native microbiota as a rich resource for addressing complex biological challenges.59Future work should aim to leverage the CRAGE method to manipulate genetically resistant, undomesticated strains widely available in diverse environments and to rigorously assess the functionalities of engineered EcAZ-1 and EcN in cellular and animal models. These efforts hold considerable promise for advancing microbiomc- based therapeutic strategies and synthetic biology innovations.
[0051] B . Definitions
[0052] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference.
[0053] Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, microbiology, genetics, protein, and nucleic acid methods and techniques described herein are those well-known and commonly used in the art. The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed through the present specification unless otherwise indicated.
[0054] The terms “about” or “approximately” as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of + / - 10% or less, +1-5% or less, + / -1% or less, and + / - 0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier “about” or “approximately” refers is itself also specifically, and preferably, disclosed.
[0055] Reference throughout this specification to “one embodiment”, “some embodiment,” “certain embodiment,” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases “in one embodiment,” “in some embodiment,” or “certain embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment but may include other embodiments presented here. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some, but not other features included in other embodiments, combinations of features of different embodiments arc meant to be within the scope of the invention. For example, in the appended claims, any of the claimed embodiments can be used in any combination.
[0056] The term “nucleotide” as used herein refers to a subunit of a nucleic acid (whether DNA or RNA or an analogue thereof) which may include, but is not limited to, a phosphate group, a 5- carbon sugar group and a nitrogen containing base, as well as analogs of such sub-units. Other groups (e.g., protecting groups) can be attached to the sugar group and nitrogen containing base group. It will be appreciated that, as used herein, the terms “nucleotide” will include those moieties which contain not only the naturally occurring purine and pyrimidine bases, e.g., adenine (A), thymine (T), cytosine (C), guanine (G), or uracil (U), but also modified purine and pyrimidine bases and other heterocyclic bases which have been modified (these moieties are sometimes referred to herein, collectively, as “purine and pyrimidine bases and analogs thereof’).
[0057] The terms “nucleotide sequence,” or “nucleic acid sequence” as used herein refers to the specific order or arrangement of nucleotides (adenine, guanine, cytosine, and thymine in DNA, or uracil in RNA, represented using the letters A, C, G, and T (or U in RNA)) within a nucleic acid, DNA or RNA, which carries genetic information. The order of some nucleotides dictates the sequence of amino acids in proteins, which in turn determines the structure and function of those proteins. The term “nucleic acid” refers to unmodified RNA or DNA or modified RNA or DNA as well as single and double-stranded DNA, DNA that comprises single and double- stranded regions, single and double-stranded RNA, and RNA that comprises single and double-stranded regions, hybrid molecules between DNA and RNA, which may comprise single stranded DNA or RNA.
[0058] The term “vector” as used herein refers to a nucleic acid molecule capable of transporting a foreign nucleic acid fragment, and the vector nucleic acid is linked to the foreign nucleic acid fragment. It is usually a DNA molecule that is used as a vehicle to cany a particular foreign nucleic acid sequence, usually DNA, into a host / recipient cell where it can be replicated and / or expressed. The vector typically includes features to facilitate the manipulation of DNA as well as a genetic marker for their selective recognition. The most common vectors are DNA plasmids, viruses and artificial chromosomes. Sometimes, “plasmid” and “vector” may be used interchangeably as the plasmid is the most commonly used form of vector. Some vectors can be autonomously replicated in a host cell (cpisomal vectors), or others may be integrated into the genome of a host cell and replicated along with the host genome (non-episomal vectors). Integrating vectors typically contain at least one sequence homologous to the bacterial chromosome that allows for recombination to occur between homologous DNA in the vector and the bacterial chromosome. Integrating vectors may also comprise bacteriophage or transposon sequences.
[0059] The term “plasmid” as used herein refers to a double- stranded, covalently closed, circular DNA into which additional DNA segments can be ligated and which can be isolated from bacterial cells. Plasmid exists in its bacterial hosts as extrachromosomal pieces of DNA that vary in size from 1 kb to >200 kb. Most of the plasmids used in molecular cloning have a multiple cloning site (MCS), also called a polylinker, which is a short segment of DNA that contains various restriction enzyme sites, and this is a standard feature of engineered plasmids for the insertion of a foreign DNA. In addition, the plasmid should have an origin of replication (ori) site - usually bacterial origin where DNA replication is initiated, marker genes - antibiotics resistance gene for selection and / or screening with antibiotics, and promoters - usually viral origin for gene expression. It should be small in size so that it can be easily delivered into the host cell. Plasmids do not generally replicate in the host mammalian cells. By performing a process of DNA transfection or transformation, a plasmid which contains a gene of interest is efficiently delivered to the cells of interest. Numerous plasmid vectors are commercially available, and the modification thereof for specific cloning strategies is well known to the skilled person in the field.
[0060] As used herein, a "promoter" is defined as a regulatory DNA sequence that is generally located upstream of a gene and capable of binding RNA polymerase to initiate transcription. Some plasmids may comprise more than one RNA polymerase II (pol II) promoters and / or RNA polymerase III (pol III) promoters. A promoter can be a constitutively active promoter (i.e., a promoter that is constitutively in an active / "ON" state), it may be an inducible promoter (i.e., a promoter whose state, activc / "ON" or inactivc / "OFF", is controlled by an external stimulus, c.g., the presence of a particular compound or protein), it may be a spatially restricted promoter (i.e., transcriptional control element, enhancer, etc.) (e.g., tissue specific promoter, cell type specific promoter, etc.), and it may be a temporally restricted promoter (i.e., the promoter is in the "ON" state or "OFF" state during specific stages of embryonic development or during specific stages of a biological process). A well-known example of an inducible promoter is the promoter of the lac operon. In the lac operon system, a promoter for lactose operon has an operator sequence between the promoter and transcription initiation site. The operator sequence is the site where transcription repressor binds, which is removed from the operator site when an inducer, allolactose or isopropyl -d-l -thiogalactopyranoside (IPTG) binds to the repressor. Other examples of inducible promoter is pBAD promoter, which is activated by arabinose, and hypoxia-inducible promoters, which is activated by hypoxia-inducible factor, a transcription factor whose activation depends primarily upon redox-sensitive stabilization of one of its subunits.
[0061] As used herein, “sequence identity” or “sequence homology” in the context of two nucleic acid or polypeptide sequences refers to the percentage of residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity / homology is used in reference to proteins, it is recognized that certain amino acid residues at the same position may not be identical due to conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have “sequence similarity” or “similarity”. Means for making this adjustment are well known to those of skill in the art. Typically, this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of one and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and one. There arc many software tools for comparing genetic similarity, such as BLAST (Basic Local Alignment Search Tool), Artemis Comparison Tool (ACT), OrthoFinder, YASS and Mauve.
[0062] As used herein, the term "subject" refers to mammals, and in particular humans. A suitable subject for the invention is a human suspected of having, has been diagnosed as having, or is at risk of developing cancer, in particular gastrointestinal cancer and / or inflammation. As used herein, the term "administering" refers to introducing an agent (e.g. recombinant bacteria) to a subject, and an agent “administration” can be performed using any of the various drug delivery methods known to those skilled in the art. Methods of an agent “administration” include, but are not limited to oral administration, rectal administration by way of suppositories or enema, parenteral administration (subcutaneous, intravenous, intradermal, intramuscular, intraperitoneal (IP), intraarterial, intracardiac, intraarticular, and intraspinal injection), transdermal or topical administration directly into or onto a target tissue, nasal administration or inhalation, or administration by any route or method that delivers a therapeutically effective amount of the drug or composition to the cells or tissue to which it is targeted. Preferably, the administration method according to the embodiments of this invention is oral or rectal administration, but if need be, parenteral or topical administration can be contemplated.
[0063] As used herein, the term “composition” refers to a pharmaceutical composition, meaning a mixture of substances suitable for administering to a subject, which includes one or more pharmaceutically active ingredients and inactive excipients. For example, a pharmaceutical composition may comprise a certain colony forming unit (efu) of bacterial cells and pharmaceutical excipients such as buffer, binder, gel capsule, etc.
[0064] As used herein, the term “excipient”, in the context of pharmaceuticals, refers to any substances other than the active ingredient or agent, contained in pharmaceutical dosage forms. The excipients are considered as inert substances, i.e., they do not have any active role in therapeutics, but they can be used to support the process to produce an effective product. Examples of excipients are active pharmaceutical ingredient excipients, binder excipients, capsule shell excipients, carrier excipients, coating systems excipients, controlled release excipients, diluent excipients, disintegrant excipients, effervescent system excipients, emulsifier excipients, film former excipients, flavor excipients, high-functionality excipients, lipid excipients, lubricant excipients, modified release excipients, penetration enhancer excipients, penneation enhancer excipients, pH modifier excipients, plasticizer excipients, preservative excipients, sachet filling excipients, solubilizer excipients, solvent excipients, surfactant excipients, sustained release excipients, taste masking excipients, thickener excipients, viscosity modifier excipients, blending excipients, filler excipients, compaction excipients, direct compression excipients, dry granulation excipients, hot melt extrusion excipients, wet granulation excipients, rapid release agent excipients, film formation excipients, increased bioavailability excipients, dispersion excipients, solubility enhancement excipients, stabilizer excipients, capsule filling excipients, powder blends excipients, tablet compressibility excipients, etc. (Remington: The Science and Practice of Pharmacy, 23e, 2021; https: / / www.americanpharmaceuticalreview.com / 25335-Pharmaceutical- Raw-Materials-and-APIs / 25283-Pharmaceutical-Excipients / )
[0065] For example, in solid oral dosage forms, excipients of diluents, binders, disintegrants, controlled release agents, neutral cores (carriers / substrates for loading of actives for sustained or immediate-release formulations), pH modifiers, encapsulating agents, emulsifiers / solubilizers, coating agents, plasticizers, colorants, lubricants / glidants, sweeteners, flavors, taste-masking agents, co-processed excipients, and / or polymers for hot-melt extrusion can be included. In liquid oral dosage forms, excipients of vehicles, suspending agents and thickeners, emulsifiers / solubilizers, antioxidants, preservatives, pH modifiers, encapsulating agents, flavors, and / or taste-masking agents can be included. In parenteral dosage forms, excipients of lyoprotectants, encapsulating agents, solubilizers and emulsifiers, tonicity agent, solvents and cosolvents, viscosity building agents, antioxidants and chelating agents, preservatives, and / or buffering agents can be included. In topical or transdermal dosage forms, excipients of gelling agent, humectants, solubilizes and emulsifiers, suspending agents and thickeners, preservatives, and / or stabilizers can be included. In suppositories, glycerol-gelatin base, hard fat and its mixture, agar, theobroma oil (cocoa butter), PEG (high molecular’ weight) can be included. Examples of each type of excipients can be found in Remington: The Science and Practice of Pharmacy, 23e, 2021.
[0066] As used herein, the term “dosage form” refers to a pharmaceutical preparation in which a specific mixture of active ingredients of a drug and inactive components (excipients) are formulated in a particular shape or form to facilitated administration and accurate delivery of active ingredients, and / or to be presented in the market. Solid dosage forms include powders, granules, capsules, tablets, cachets, pills, lozenges, troches, gummies, suppositories. Semi-solid dosage forms include ointment, creams, paste, gels, poultices. Liquid dosage forms include collodions, droughts, elixirs, emulsions, suspension, enemas, gargles, linctuses, lotion, liniments, mouth washes, nasal drop, paints, syrups, and solution. Gaseous dosage forms include aerosols, inhalations, and sprays. C. Examples of Embodiment
[0067] E. coli is a widely studied model organism and an integral component of the human gut microbiome, offering significant potential for bacteria-based therapeutic applications. In this disclosure, the chassis-independent recombinase-assisted genome (CRAGE) engineering technique was leveraged to engineer the native gut strain E. coli EcAZ- 1 and the probiotic strain E. coli Nissle 1917 (EcN) for the expression of a gene of interest, which can be utilized for diagnosis and / or treatment of gastrointestinal diseases.
[0068] Considering that CRAGE method is based on a transposon-dependent recombination and homologous recombination, the CRAGE method can be applied to various bacteria, including commensal bacterial strains isolated from a human, e.g., either from the surface or mucosa of oral cavity, nasopharynx, respiratory tract, gastrointestinal tract, urogenital tract, skin, or from secretion fluids, saliva, urine, stool, or biopsy samples, to engineer or transform the bacteria with a heterologous polynucleotide expressing a heterologous protein to render a therapeutic effect. The advantage of using native bacteria instead of lab strains is that those bacteria are already adapted to the host's luminal environment, allowing engineered native bacteria to colonize without disturbing the flora.
[0069] Depending on the disease to be diagnosed or treated, bacterial genera found in human microbiota can be contemplated for the application of CRAGE method, including Bacteroides (including Alistipes, Prevotella, Paraprevotella, Parabacteroides, or Odorlbacter). Clostridium, Streptococcus, Lactococcus, Eubacterium rectale, Enterobacter sp., Klebsiella sp., Bifidobacterium, Staphylococcus, Lactobacillus, Veillonella, Haemophilus, Moraxella, Coryne bacterium and Propionibacterium. Using appropriate agar plates and antibiotics known to one of ordinary skill in the art, these bacteria can be cultured and selected / removed for a specific strain isolation.
[0070] Cancer, especially gastrointestinal cancer, is one of the diseases that can be treated or diagnosed using gut microbiome. Usually, cancer cells grow more rapidly than normal cells, which increases oxygen consumption, and such cell growth outpaces blood vessel formation (angiogenesis). In addition, due to the compression or inflammation of the surrounding cells and tissues by cancer cell mass, blood flow is disrupted. So, cancer cells generate anaerobic conditions, and considering this aspect, preferred candidate bacteria are anaerobic bacteria or facultative anaerobic bacteria isolated from human intestine.
[0071] E. coli is a facultative anaerobe, meaning it can grow both in the presence and absence of oxygen, preferring aerobic respiration when oxygen is available, but resorting to anaerobic respiration or fermentation when oxygen is absent. In this disclosure, E.coli strains EcAZ-1 and EcN, were engineered with CRAGE method; however other E. coli strains may be considered, such as E. coli BL21, E. coli EcAZ-2, and E. coli MG 1655.
[0072] In some embodiments, E. coli strains, EcAZ-1 and EcN, were engineered to express an oxygen independent fluorescent protein, IFP2.0 with or without HOI protein, as well as an oxygendependent fluorescent protein GFP from the bacterial chromosome for GI cancer diagnosis.
[0073] In an embodiment, IFP2.0, an oxygen independent florescence protein, is expressed without HOI or with HOI, and its fluorescence is generated in anaerobic condition. In another embodiment, IFP2.0 is cloned to be regulated by a hypoxia-inducible promoter, and this will help enhance the susceptibility of fluorescence to anaerobic condition, which can indicate the location of cancer cell mass. Also, the fluorescence intensity may be interpreted as the size of cancer cell mass or the severity of the cancer. However, it can also be contemplated that GFP or other fluorescence proteins such as cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), and far-red fluorescent protein (FRFP) are cloned with a hypoxia inducible promoter to obtain fluorescence signal under anaerobic condition.
[0074] In a certain embodiment, IFP2.0 is expressed with HOI under the same promoter, i.e., IFP2.0 and HOI are expressed from a polycistronic mRNA like an operon; however HOI can be cloned with another promoter and separately integrated into the chromosome at a different site or as plasmid.
[0075] In some embodiments, EcAZ- 1 and EcN were engineered using CRAGE method to express enzymes necessary for the biosynthesis of bioactivc compounds, including the plant-derived flavonoid naringenin, and mycosporine-like amino acids. In certain embodiments, as an example of controlled production of the compound, the genes belonging to naringenin or mycosporine-like amino acids biosynthetic gene cluster (BGC) are assembled as a single operon under the control of the T7 promoter inducible with IPTG addition, which mimics the natural inducer, allolactose that binds to the lac repressor protein, causing a conformational change to prevents its binding to the lac operator, allowing transcription of the downstream gene.
[0076] These compound-producing bacteria can be utilized to extract a large quantity of compounds in the laboratory. However, if need be, these bacteria can be formulated as a dietary supplement that can be taken daily for the prevention of GI cancer or inflammatory bowel diseases. For example, the bacteria can be consumed as edible probiotic products producing flavonoid antioxidant compounds. If the probiotic products are dairy products containing lactose or galactose such as yogurt, the naringenin or MAA operon under the control of T7 promoter inducible with IPTG may also be induced in human gut, although lactose or galactose may not be as efficient as IPTG and can be metabolized as a carbon source. If the compound BGC is cloned with an arabinose inducible promoter, the recombinant bacteria producing the compound may be orally taken with some fruits comprising arabinose or concentrated arabinose. Or the compound BGC can be cloned wit constitutively active promoter.
[0077] Also, the compound-producing bacteria can be utilized for a therapeutic purpose. For the treatment of GI cancer, the bacteria can be co -administered with anticancer drugs. In such a case, the compound synthesis can be induced under anaerobic condition by cloning the genes with a hypoxia-inducible promoter such as Pfnr, FF20, and FF20* promoters, or the compound can be constitutively produced by cloning the BGC with a constitutively active promoter.
[0078] In addition, the bacteria expressing the compound BGC can co-express IFP2.0 with or without HOI. In such a case, both sets of genes can be cloned together under the same promoter (e.g., T7, pBAD, and Pfnr-, FF20-, or FF20* hypoxia inducible promoter) and integrated into the same site of the bacterial chromosome; or the compound BGC operon and IFP2.0 with or without HOI can be cloned separately and integrated into different sites of the bacterial chromosome. For example, the compound BGC operon is cloned with the T7 promoter or constitutively active promoter, and IFP2.0 gene with or without HOI gene is cloned with a hypoxia inducible promoter.
[0079] In certain embodiments, the MAA biosynthesis gene cluster may further comprise other Mys genes such as a non-ribosomal peptide synthetase (NRPS)-like enzyme (MysE) and methyltransferase enzymes (MysF).
[0080] D. Formulation and Administration methods For diagnostic application, the recombinant bacteria expressing IFP2.0 with or without HOI arc formulated into a pharmaceutical composition suitable for humans in need thereof. The composition comprises bacteria of about 103, 104, 105, 106, 107, 108, 109, IO10, or 1011efu as an active ingredient. There are an estimated 100 trillion to 1000 trillion (1014-1015) bacterial cells in the human intestine, and E. coli population constitutes a small fraction of around 0.1-5.0% (1011- 5xl013), and the quantity of bacteria to be administered may be determined empirically not to disturb the gut microbiota of a subject. The body weight of a subject is another factor to be considered when determining the applicable bacterial number.
[0081] In preferred embodiments, the composition is formulated for oral or rectal administration, and thus the dosage form needs to be suitable for oral- or rectal administration. However, the compositions can also be administered through transdermal, topical, intranasal, urogenital (intravesical, intraurethral, and vaginal), or parenteral route. For oral administration, the compositions can be delivered, e.g., via edible solution, capsule, tablet, powder, granules, or through gavage. For rectal administration, the composition can be delivered via suppository or enema. If need be, injection, infusion, localized perfusion via a catheter, via a lavage, or by other methods or any combination of the foregoing can be contemplated, as would be known to one of ordinary skill in the art (see, for example, Lloyd V. Allen, Jr., Remington: The Science and Practice of Pharmacy, 23e, 2022, Pharmaceutical Press, expressly incorporated herein by reference in its entirety). If these recombinant bacteria are to be used for respiratory tract cancer diagnosis, aerosol or nasal spray may be contemplated.
[0082] In some dosage forms (e.g., capsule, tablet, powder, granules), the composition comprises lyophilized bacteria.
[0083] In some embodiments, the composition is formulated for oral administration as a solid, semi-solid, or liquid form. In a preferred embodiment, a capsule comprises a recombinant bacterial composition as a solid (e.g., powder, granules, pill), semi-solid (e.g., paste, gel), or liquid (e.g., solution, emulsion) form. In some embodiments, the capsule material comprises at least one of a soft gelatin, a hard gelatin, and / or a polymer. Suitable polymers include, but are not limited to: cellulosic polymers such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose (HPMC), methyl cellulose, ethyl cellulose, cellulose acetate, cellulose acetate phthalate, cellulose acetate trimellitate, hydroxypropylmethyl cellulose phthalate, hydroxypropylmethyl cellulose succinate and carboxymethylcellulose sodium; acrylic acid polymers and / or copolymers, such as those formed from acrylic acid, methacrylic acid, methyl acrylate, ammonio methylacrylate, ethyl acrylate, methyl methacrylate and / or ethyl methacrylate (e.g., those copolymers sold under the trade name "Eudragit"); vinyl polymers and / or copolymers such as polyvinyl pyrrolidone, polyvinyl acetate, polyvinylacetate phthalate, vinylacetate crotonic acid copolymer, and / or ethylene- vinyl acetate copolymers; and / or shellac (purified lac).
[0084] Tablets, pills, and the like can be compressed, multiply compressed, multiply layered, and / or coated. The coating can be single or multiple. In some embodiments, the tablet or pill is coated with sucrose, glucose, starch (e.g., com starch, wheat starch, potato starch, tapioca starch), dextrans (branched polysaccharide composed of glucose units), maltodextrin, cyclodextrins, inulins, pectin, mannans, cellulose, hemicellulose, gum arabic, locust bean gum, mesquite gum, guar gum, gellan gum, gum karaya, gum ghatti, tragacanth gum, funori, carrageenans, agar, alginates, or chitosans. In another embodiment, the coating material comprises at least one of fatty acids, waxes, shellac, and polymers like cellulose acetate phthalate (CAP) and methacrylic acid copolymers. In some embodiments the coating material comprises a fat and oil. In certain embodiments, the at least one of a fat and an oil is high temperature melting. In certain embodiments, the at least one of a fat and an oil is hydrogenated or partially hydrogenated. In certain embodiments, the at least one of a fat and an oil is derived from a plant. In certain embodiments, the at least one of a fat and an oil comprises at least one of glycerides, free fatty acids, and / or fatty acid esters. In some embodiments, the coating material comprises at least one edible wax. The edible wax can be derived from animals, insects, or plants. Non-limiting examples include beeswax, lanolin, bayberry wax, carnauba wax, and / or rice bran wax. Tablets and pills can additionally be prepared with enteric coatings.
[0085] Alternatively, powders or granules embodying the lyophilized recombinant bacterial compositions disclosed herein can be incorporated into a drinkable solution (2-200 mL) for oral administration. Other suitable products for oral administration that can be contemplated include aqueous and nonaqueous solutions, emulsions, suspensions and / or solutions and / or suspensions reconstituted from non-effervescent granules, containing at least one of suitable solvents, preservatives, emulsifying agents, suspending agents, diluents, sweeteners, coloring agents, and / or flavoring agents. In some embodiments, the composition contains at least or at least about 0.5%, 1 %, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater than 90% bacterial cells on a mass basis. In some formulations, the administered dose does not exceed 200, 300, 400, 500, 600, 700, 800, 900 milligrams or 1 gram in mass.
[0086] The composition may comprise necessary excipients to enhance bioavailability and / or preservation of the bacteria. In various embodiments, the weight fraction of the excipient or combination of excipients in the formulation is usually about or at 99% or less (but not zero), such as about or at 95% or less (but not zero), about or at 90% or less (but not zero), about or at 85%) or less (but not zero), about or at 80% or less (but not zero), about or at 75% or less (but not zero), about or at 70% or less (but not zero), about or at 65% or less (but not zero), about or at 60% or less (but not zero), about or at 55% or less (but not zero), about or at 50%) or less (but not zero), about or at 45% or less (but not zero), about or at 40% or less (but not zero), about or at 35% or less (but not zero), about or at 30% or less (but not zero), about or at 25% or less (but not zero), about or at 20% or less (but not zero), about or at 15% or less (but not zero), about or at 10% or less (but not zero), about or at 5% or less (but not zero), about or at 2% or less (but not zero), or about or at 1% or less (but not zero) of the total weight of the composition.
[0087] An example is a gelatin or vegetable capsules filled with lyophilized recombinant bacteria described here for oral administration. An appropriate capsule is a gelatin capsule for 50-1000 mg, containing from 10-500 mg of lyophilized bacterial powder (e.g., from 103to 1011bacteria cells), microcrystalline cellulose of about 10% to 90% of the total weight (w / w), and magnesium stearate of about 0.25% to 5.0% (w / w), and other the necessary excipients.
[0088] In some embodiments, the capsule or tablet comprising lyophilized bacteria is enteric- coated to protect the bacteria through the stomach acid.
[0089] In some embodiments, the composition is formulated for rectal administration as a suppository or enema solution dosage form.
[0090] Furthermore, kits are provided, comprising at least one container comprising at least one engineered E. coli strain as lyophilized powder, or edible solution, paste, capsule, or tablet, or rectal administration dosage form such as suppository or enema solution, comprising the lyophilized recombinant bacteria. In some embodiments, the kit also comprises at least one container comprising biliverdin (e.g., about 300 mg) and / or hemin (e.g., about 300 mg) in a dosage form for oral- or rectal administration, as described above. In other embodiments, the kit may further comprise at least one container comprising lactose (e.g. about 12 g) or arabinose (e.g., about 12 g) in a dosage form for oral- or rectal administration, as described above.
[0091] EXAMPLES
[0092] Example 1. Materials and Methods
[0093] 1.1. General Methods
[0094] Reagents and chemicals were purchased from major vendors, e.g., Thermo Scientific, New England Biolabs, Fisher Scientific, and Sigma Aldrich. Plasmid preparation and DNA purification were performed with GeneJET Plasmid Miniprep Kit and GeneJETGel Extraction Kit (Thermo Scientific), respectively. Genes were synthesized by Twist Bioscience. Primers were ordered from Sigma Aldrich. E. coli DH5a (Agilent) was used for routine cloning studies. E. coli Nissle 1917 (EcN) was provided by Ardeypharm Company of Germany.
[0095] 1.2. Engineering of EcAZ-1 and EcN by the CRAGE method
[0096] The experimental procedures of the CRAGE method were previously published.58Briefly, a landing pad (from the plasmid PW 17) was first conjugated into the recipient strain and integrated into its chromosome by a transposase. This landing pad harbors a Cre recombinase gene, a kanamycin-resistant gene, and a T7 RNA polymerase gene required for T7 promoter-regulated protein expression, as well as a mariner transposon flanked by two pairs of mutually exclusive lox sites loxP and lox5171. Secondly, an accessory plasmid (PW34 for fluorescence / luminescence reporters, PW5Y for biosynthetic gene clusters) containing the functional gene under the control of the T7 promoter, and an apramycin-resistant gene flanked by the two corresponding lox sites, was conjugated into the strain containing the landing pad. Cre recombinase catalyzes the chromosomal integration of this functional gene. The positive colonies were selected by antibiotic counter- selection (kanamycin and apramycin). To verify the successful integration of landing pad or functional genes, PCRs were performed to amplify the landing pad primers (SBP572 (CCACCTTCGTAAGACTGTAGTG) and 99W (TCCCAGATCTCAAACTGGAACAACACTC) amplifying a 374 bp LP region) and functional gene region and the plasmid backbone region (primers SBP202 (GAAAAGCTGGGCGCGTTAAGCCAGCCCCGACACCCG) and SBP203 (GGGGCTGGCTTAACGCGCCCAGCTTTTCAATTC) amplifying a 645 bp plasmid backbone region). To construct the fluorescent protein expressing strains, the backbone of PW34 (w / o the luxABCD operon) was ligated with synthetic IFP2.0, IFP2.0+HO1 or GFP gene at BamHI / EcoRI sites, along with T7, Pfnr, FF20, or FF20* promoter, terminator, and ribosome binding site (RBS) region. The generated plasmids with genes of interest were then integrated into the chromosome of EcAZ-1 or EcN using the CRAGE method above. The integration was verified by colony PCR and antibiotic counterselection.
[0097] To optimize the conjugation efficiency between EcAZ-1 with E. coli WM6026, different ratios of donor (E. coli WM6026 harboring PW 17) to recipient (EcAZ- 1 ) (2: 1 , 4: 1 , 6: 1 and 10:1 ) were mixed, and the mixtures were washed three times with fresh LB. The pellets were then resuspended in 50 pL LB with 0.3 mM DAP (diaminopimelic acid) and transfer onto a nitrocellulose filter membrane on an LB agar plate containing 0.3 mM DAP. The plates were then incubated under 37°C for 12 or 24 h. The bacterial mixtures were then scraped off and washed with 1 mL fresh LB three times. The pellets were then resuspended in 1 mL fresh LB, and 100 pL of the mixtures were plated on an LB plate containing 50 pg / ml kanamycin (Km). Following overnight incubation under 37°C, the numbers of grown colonies were counted to evaluate the conjugation efficiencies under different conjugation conditions. The chromosomal integration of the landing pad from PW 17 in recipient was then confirmed by PCR analysis of about 20 randomly picked colonies (Table 2).
[0098] 1.3. Fluorescence protein expression and fluorescence measurement
[0099] To construct the fluorescence expressing strains, the backbone of PW34 (w / o the luxABCD operon) was ligated with synthetic ifp2.0, ifp2.0+hol or gfp gene at BamHI / EcoRI sites, along with T7, Pfnr, FF20, or FF20* promoter. Subsequent conjugation and chromosomal integration into LP-containing EcAZ-l / EcN followed the CRAGE method.5The gene integration was verified by colony PCR and antibiotic counterselection. Fluorescent protein expressing strains were cultured in 2 ml medium (LB or gut microbiota medium GMM) containing 25 pg / mL apramycin at 37°C and 250 RPM overnight. The cultures were then diluted 100 times into a 96- well microplate, each well containing 200 pl LB or GMM with 25 pg / mL apramycin. After growing at 37°C until log phase, the protein expression was induced by 0.1 mM IPTG or in an anaerobic chamber (Whitley DG250 Anaerobic Workstation). BV (2 pM) for IFP2.0 activation or heme (2 pM), which is converted by HOI into carbon monoxide (CO), ferrous iron, and biliverdin, may also be supplied to the culture medium at this time. Strains were then incubated at 18°C or room temperature, 180 RPM for 12-20 h in the anaerobic chamber for the expression of IFP2.0 controlled by hypoxia promoters. Fluorescence measurements of the samples were carried out on a BioTek Synergy Hl Multimode Reader with excitation at 690 nm and emission at 710 nm for IFP2.0 expression, and excitation at 488 nm and emission at 510 nm for GFP expression. The fluorescence from wild type strains or those conjugated with the empty vector as negative controls were used for normalization of fluorescence signals. Two or three technical replicates were conducted for the measurement. The ODeoo values of the samples were also measured.
[0100] 1.4. Heterologous production of naringenin and MAA
[0101] To construct the naringenin BGC, synthesized genes encoding TAL, 4CL, CHS and CHI were inserted into the Xhol, Hindlll, Sad and BamHI, respectively, on pET28b (+) along with the T7 promoter. The gene cluster was then amplified and cloned into NotYJSadl sites of PW5Y to create PW5Y-Nar. To construct the MAA BGC, the mysABCD cluster along with T7 promoter was amplified from pETDuet-1 -my sABCD56and cloned into Nol\ / Sa \ sites of PW5Y to create PW5Y-MAA. The conjugation and chromosomal integration into EcAZ-1 and EcN followed the CRAGE method, and the procedure described above. To evaluate the production of naringenin or MAA, engineered strains were cultured in 100 to 200 mL LB containing 25 pg / ml apramycin at 37°C, 180 RPM until ODeoo reached 0.6. Protein expressions were then induced by 0.1 mM IPTG at 18°C, 180 RPM overnight. Anaerobic fermentation was performed in an anaerobic chamber (Whitley DG250 Anaerobic Workstation) while the other conditions were the same.
[0102] To prepare naringenin extracts, the culture was extracted with an equal volume of ethyl acetate three times. The organic extracts were collected, combined, dried and evaporated in the speed vacuum concentrator. The residues were resuspended in 200 pL acetonitrile and after centrifugation, 10 pL of the solution was injected for HPLC and HRLC-MS analysis. To extract MAAs, cell pellets were collected after centrifugation at 4,500 RPM for 10 min and then extracted with 2 mL of methanol twice. Methanolic extracts were combined and dried in the speed vacuum concentrator and the residues were resuspended in 200 pL water for LC-HRMS and HR-MS / MS analysis. 1 .5. HPLC and LC-MS Analysis
[0103] HPLC analysis was performed on a Shimadzu Prominence UHPLC system (Kyoto, Japan) fitted with an Agilent Poroshell 120 EC-C18 column (2.7 pm, 4.6 x 50 mm), coupled with a PDA detector. The HPLC program started with 1 % solvent B (methanol with 0.1 % formic acid) for 1 min, followed by a linear gradient of 1-20 % solvent B in 3 min and another linear gradient of 20 - 95 % solvent B in 4 min. The column was further cleaned with 95 % solvent B for 1 min and then re-equilibrated with 1 % solvent B for 1 min. Solvent A was water with 0.1 % formic acid. The flow rate was set as 0.5 ml / min. The same LC program was used in the LC-MS analysis on a Thermo Scientific™ TSQ Altis™ Plus Triple Quadrupole Mass Spectrometer with a Thermo Scientific™ Vanquish HPLC system. The system was equipped with H-ESI ion source. Molecules in samples were analyzed by both negative and positive mode at 3500 and 2500 voltages, respectively. Electrospray ionization was used for MS detection, and ion counts for a particular m / z peak were determined by peak height. LC-HRMS and HRMS / MS experiments were conducted on a Thermo Scientific™ Q Exactive Focus mass spectrometer with Dionex™ Ultimate™ RSLC 3000 uHPLC system, equipped with an H-ESI II probe on an Ion Max API Source. The same solvents A and B were used to separate analytes on an Agilent Poroshell 120 EC-C18 column (2.7 pm, 3.0 x 50 mm). A typical LC program with a 0.5 mL / min flow rate was: 10% B for 2 min, 10-95% B over 8.5 mins, 95% B for 2.5 mins, 95 to 10 % B in 0.5 mins, and reequilibration in 2% B for 2 mins. The eluents from the first 2 mins and last 3 mins were diverted to a waste bottle. MSI signals were acquired under the Full MS positive ion mode covering a mass range of m / z 90-700, with a resolution at 35,000 and an AGC target of le6. Precursor ions were selected in the orbitrap typically with an isolation width of 3.0 m / z and fragmented in the HCD (Higher-energy C-trap dissociation) cell with stepwise collision energies (CE) of 20, 25, and 30.
[0104] Example 2. EcAZ-1 and EcN can be engineered by CRAGE.
[0105] Similar to most gut-derived strains, EcAZ-1 remains undomesticated,57and traditional genetic modification methods such as transformation or transduction have largely failed to introduce genetic materials. To address this barrier, it was sought to engineer EcAz-1 using a chassis-independent recombinase-assisted genome engineering (CRAGE) method (Figure I ), ’7 which has enabled the chromosomal integration of genetic materials up to 100 kb in size in diverse bacteria.
[0106] This method begins with the integration of a landing pad (LP), containing a ere recombinase gene flanked by mutually exclusive lox sites, mediated by an enhanced Himarl mariner transposon mutant (Figure I).47Subsequently, the LP is replaced with the desired genetic constructs using the Cre recombinase, enabling controlled gene expression via a T7 promoter and T7 RNA polymerase system. The success of CRAGE in engineering lab-used E. coll BL21 and EPI3OO*72, 43suggests its potential application to EcAZ- 1.
[0107] Initial conjugation of EcAZ-1 with E. coli WM6026 harboring the vector PW I 7 ’’' yielded about 1,000 colonies, indicating that EcAZ-1 could be engineered using this method. To further improve conjugation efficiency, various donor (E. coli WM6026 harboring PW17) to recipient (EcAZ-1) ratios (2:1, 4:1, 6:1, and 10:1) and incubation times (12 and 24 hours) were tested. Optimal conditions were identified as a 6:1 donor-to-recipient ratio and a 12-hour incubation, which produced over 3,500 conjugants in a single experiment. Then, an LP-containing EcAZ-1 colony was randomly selected, which displayed growth comparable to the wild type (Figure 2), and the optimized conditions were used to conjugate it with E. coli WM6026 containing PW34, a plasmid carrying the luxCDABE operon (lux').38Upon IPTG induction, 57 out of 96 randomly picked colonies produced luminescence (S.D. = 954.05 units, coefficient of variation = 11.4%) (Figure 3A), indicating that the lux operon was expressed in about 60% of conjugants. The negative control, EcAZ-1 integrated with the empty LP-containing EcAZ-1, showed no luminescence signal upon IPTG induction. Similarly, the lux operon was expressed in EcN using the CRAGE method. All eight randomly picked EcN conjugants produced luminescence after IPTG induction (Figure 3B). These results confirm that CRAGE is effective for engineering both EcAZ-1 and EcN.
[0108] Further validation of CRAGE's application was achieved by expressing the green fluorescent protein (GFP), whose gene replaced the lux operon in PW34, in both EcAZ-1 and EcN. About 75-80% of randomly picked colonies (96 for EcAZ-1 and 20 for EcN) generated fluorescence signals upon IPTG induction, with EcAZ-1 conjugants showing a slightly higher average signal than EcN (Mean ± SD: EcAZ-1 = 112,782.4 ± 7,852.2 fluorescent units; EcN: 107,772.9 ± 6,795.7 fluorescent units) (Figure 4). Negligible fluorescence was observed in wild- type (WT) and LP-containing (LP) strains. Overall, these results highlight CRAGE as a robust method for the genetic engineering of both undomcsticatcd and probiotic E. coli strains.
[0109] Example 3. Expression of the oxygen-independent fluorescent protein IFP 2,0 in EcAZ-1 and EcN
[0110] Solid tumors commonly exhibit a hypoxic microenvironment due to the imbalance between oxygen delivery and consumption, which significantly impacts cancer progression and treatment outcomes, including increased metastasis risk, therapy resistance, and poor prognosis.74Previous efforts have explored the use of bacteria, particularly anaerobes, for targeted delivery to these hypoxic zones within tumors.45, 46Building on this concept, it was aimed to engineer EcAZ-1 and EcN to produce a fluorescent signal specifically under hypoxic conditions to enhance tumor imaging capabilities.
[0111] For this purpose, IFP 2.0, an engineered oxygen-independent, bacteriophytochrome-based infrared fluorescent protein, was selected for its superior performance in whole-body imaging of mice compared with traditional oxygen-dependent fluorescent proteins like GFP. ’5Although IFP 2.0 has a lower fluorescence quantum yield, it offers significantly enhanced imaging capabilities in hypoxic environments. The codon-optimized ifp 2.0 gene replaced the lux operon in the plasmid PW34, and the construct was introduced into E. coli WM6026 for conjugation with the LP carrying EcAZ-1 and EcN used above (Table 1). Twenty conjugants of each engineered strain were randomly selected, and their fluorescence signals upon IPTG induction were assessed under anaerobic conditions. Consistent with the GFP expression results (Figure 4), more than 75% of the conjugants generated detectable fluorescent signals (Figure 5), which were comparable between engineered EcN and EcAZ-1 (mean ± SD: EcN = 2,042.3 ± 328.1 fluorescent units; EcAZ-1 = 2,794 ± 109.6 fluorescent units, Figure 6A). Negligible fluorescence was observed in WT or LP-containing strains under anaerobic conditions, as well as in positive conjugants without IPTG induction (Figure 6A). These results demonstrate the potential of engineering EcAZ-1 and EcN with IFP 2.0 for enhanced imaging of hypoxic regions within tumors.
[0112] It was found that GFP exhibited a fluorescence signal at least 40 times stronger than IFP 2.0 in engineered EcAZ-1 and EcN (Figures 4 and 5), highlighting potential areas for improvement. Since biliverdin (BV) is the chromophore of IFP 2.0,39it was hypothesized that limited BV availability could be restricting IFP 2.0's fluorescence intensity in these strains. To test this, one positive colony exhibiting an average fluorescent signal was selected, and then its IFP 2.0 expression was induced by IPTG in both Luria-Bertani (LB) and gut microbiota medium (GMM) and supplemented with 2 pM BV (Figures 6B and 7). This supplementation enhanced the fluorescence levels of engineered EcAZ-1 and EcN by 2.6 times in both media after 3 hours (Figures 6B and 7), suggesting that enhancing BV availability could improve IFP 2.0 fluorescence intensity. Notably, fluorescence levels of engineered EcAZ-1 were similar in both LB and GMM, whereas LB supported higher fluorescence levels for engineered EcN (Figures 6B and 7).
[0113] To further augment BV cellular availability, a codon-optimized heme oxygenase gene hoi) from Bradyrhizobium sp. (Table I),47was introduced along with ifp 2.0, to replace the lux operon in the plasmid PW34.wHOI enzymatically converts heme to BV in the presence of O2, thereby potentially increasing the intracellular pool of IFP 2.0's chromophore. The two genes were integrated into the same locus of the chromosome of LP carrying EcAZ-1 and EcN used above. Ten randomly picked conjugants were screened, and one representative clone was selected from each strain (EcAZ-1 -IFP2.0+HO1 or EcN-IFP2.0+HOl) with average fluorescence levels for further analysis. After normalizing cell growth, the co-expression of HOI enhanced the fluorescence intensity of EcAZ-1 -IFP2.0 by 3-fold in both LB and GMM (Figures 6B and 7), with similar improvements observed for EcN-IFP2.0+HOl. Supplementation with 2 pM hemin, the substrate of HOI, further boosted the signal in EcAZ-1 -IFP2.0+HO1 by 1.1 times on average, demonstrating the synergistic effect of precursor supplementation and co-expression of HOI in boosting fluorescence output. Interestingly, hemin supplementation resulted in only a slight increase in fluorescence intensity in GMM for EcN-IFP2.0+HOl, while it reduced the signal in LB (Figures 6B and 7). Overall, GMM supported higher fluorescence signals in EcAZ-1 but lower signals in EcN compared with LB (Figure 6C). These results collectively indicate that the coexpression of IFP 2.0 and HOI, combined with strategic heme or BV supplementation, significantly enhances the fluorescence level of engineered bacterial strains. This approach enhances their potential as imaging tools, particularly in challenging environments like hypoxic tumor microenvironments.
[0114] Example 4. Expression of IFP 2.0 in EcAZ-1 and EcN under hypoxia conditions.
[0115] Non-invasive tumor imaging in vivo using engineered bacteria demands hypoxia-specific inducible systems. To develop a hypoxia-inducible system in EcAZ-1, the ifp2.0 gene was put under regulation by various hypoxia promoters, including Pfnr, FF20 and FF20*. Also used T7- controlled IFP2.0 was used as the positive control. These promoters, together with ifp 2.0, were cloned into the plasmid PW34 to replace the lux opcron and integrated into the chromosome of LP carrying EcAZ-1 and EcN used above. The expression of IFP2.0 was induced by 0.1 mM IPTG or anaerobic condition. The strains were incubated under 37°C, overnight in a 96 well microplate and washed before fluorescence measurement. Over 75% of randomly selected colonies displayed fluorescence signals, and one positive colony with average intensity was selected for each promoter for further analysis. In EcAZ-1, IFP 2.0 expression under the T7 promoter was 1.5 to 1.9-fold higher compared with the tested hypoxia-specific promoters (Figures 9 and 10).
[0116] To assess promoter sensitivity in EcAZ-1, fluorescence was measured at 0 h, 1 h, 3 h, 5 h, and 20 h (Figure 9). After 1 h, the fluorescence of IFP 2.0 under T7 promoter control reached around 22.4% of its maximal fluorescence intensity, while those controlled by Pfnr, FF20, and FF20* promoters reached about 17.6%, 14.2%, and 14.3%, respectively. During the first 5 h, the fluorescence increase rate for the T7 system was 1,902.8 unit / h, compared to 1,316.2 units / h for Pfnr, 1,388.6 units / h for FF20, and 1,516.4 units / h for FF20*. Under aerobic conditions, fluorescence from the hypoxia- specific promoters did not increase over time (Figure 9C), confirming their specificity to hypoxia. Similarly, FF20, FF20*, and Pfnr significantly induced the expression of IFP 2.0 in EcN under anaerobic conditions (Figure 9B), although the induction was lower compared with EcAZ-1 (Figure 9A).
[0117] Supplementation of the culture medium with 2 pM BV further enhanced IFP 2.0 fluorescence under hypoxia-specific promoters in both EcAZ-1 and EcN by 2.7 to 4.2 times (Figure 10A), reaching fluorescence levels comparable to those under T7 promoter control. Similar results were observed when these experiments were performed in GMM (Figure 17), where both engineered strains showed slightly better growth than in EB (Figure 8). After growth normalization, engineered EcAZ-1 and EcN produced comparable fluorescence signals (fluorescence / ODeoo) in both media (Figure 17). Furthermore, BV supplementation resulted in a slightly greater improvement of fluorescence signals controlled by hypoxia-dependent promoters in both strains in EB, compared with the T7 promoter (Figures 10B). A similar improvement across all promoters was observed in GMM (Figure 17). Collectively, these results underscore the effectiveness of hypoxia- specific promoters in regulating IFP 2.0 expression under anaerobic conditions, demonstrating the potential of engineered EcAZ-1 and EcN as cancer-specific imaging tools.
[0118] Example 5. Expression of IFP 2,0 in EcAZ-1 and EcN under pBAD promoter
[0119] In addition to these hypoxia promoters, a chemical promoter pBAD for regulating IFP2.0 expression was also evaluated. The signal intensity and sensitivity of IFP2.0 under control of pBAD were relatively lower to that under the control of T7 promoter (Figure 11).
[0120] Altogether, these results demonstrated that the hypoxia promoters as well as chemicalinducible promoters can lead to the expression of IFP2.0 under anaerobic conditions, suggesting the potential applications as cancer- inducible imaging tools. On the other hand, the tested hypoxia promoters are weaker than the commonly used chemical promoters, and the induction of IFP2.0 under anaerobic conditions is slower than the induction by chemicals.
[0121] Example 6. Heterologous production of naringenin and mycosporine-like amino acids in EcAZ- 1 and EcN
[0122] Natural products have long been used for human health maintenance and disease treatment.49, 50E. coli is a model synthetic biology chassis in the heterologous production of natural products.57It was sought to evaluate if the native gut E. coli EcAZ-1 can be used to produce bioactive natural products, laying the basis for its broad biomedical applications.
[0123] First, the production of the flavone naringenin was tested, which is produced by a variety of plants and shows many beneficial effects on human health, such as scavenging reactive oxidative species, modulating carbohydrate metabolism and immune responses.52Starting from L-tyrosine, the biosynthesis of naringenin requires four enzymes, L-tyrosine ammonia-lyase (TAL), 4-coumarate-CoA ligase (4CL), chaicone synthase (CHS) and chaicone isomerase (CHI) (Figure 12A). These four genes were synthesized, assembled as a single operon under the control of the T7 promoter (Table 1) and cloned into the vector PW5Y for conjugation with LP-containing EcAZ-1.
[0124] One colony confirmed by PCR was randomly picked for the test of naringenin production (Figure 13). After IPTG induction at 18°C overnight, the cultures were extracted by ethyl acetate for HPLC and LC-MS analysis. The production of naringenin was observed under both aerobic and anaerobic conditions (Figure 14A), and the aerobic production was about 1.3 times higher. The identity of naringenin was confirmed by HRMS-EIC analysis (observed [M+H]+= 273.0750, calculated [M+H]+= 273.0757) (Figure 14C) and HR-MS / MS fragmentation (Figure 15A). Similarly, EcN was engineered to express the naringenin BGC and observed the production of naringenin under aerobic conditions (Figure 14B). The aerobic yields of naringenin in EcAZ-1 and EcN differed by about 10 times, which might be relevant to the different genetic background and chromosomal location of inserted BGC.55, 54
[0125] The capability of EcAZ-1 to produce mycosporine-like amino acids (MAAs), a family of natural UV protectants, was further evaluated.55MAAs also possess anti-inflammatory, antioxidative, and antiaging properties. The biosynthesis of disubstituted MAAs, starts from the conversion of an intermediate of the pentose phosphate pathway, sedoheptulose 7-phosphate, into 4-deoxygadusol (4-DG) by MysA (a dehydroquinate synthase homolog) and MysB (an O- methyltransferase) (Figure 12B).55Subsequently MysC and MysD, two ATP-grasp enzymes, sequentially produce mycosporine-glycine (MG) and disubstituted MAA analogs such as porphyra-334.
[0126] Using the same method as the heterologous production of naringenin in EcAZ-1 and EcN, the MAA BGC from the cyanobacterium Nostoc linckia NIES-2556was expressed under the control of T7 promoter. After the induction by 0.1 mM IPTG at 18°C overnight under aerobic conditions, HPLC, HRMS and HRMS / MS analysis revealed the production of porphyra-334 (observed [M+H]+= 347.1441, calculated [M+H]+= 347.1449) as well as biosynthetic intermediates MG (observed [M+H]+= 246.0969, calculated [M+H]+= 246.0972) and 4-DG (observed [M+H]+= 189.0756, calculated [M+H]+= 189.0757) by the engineered EcAZ-1 (Figures 14D and 15 B-D). A lower yield of these compounds was observed under the anaerobic condition (Figure 16), which might be due to the altered metabolic flux and slower growth of EcAZ-1.57, 58The MAA BGC was also expressed in EcN. MG and porphyra-334 were produced by EcN under both aerobic and anaerobic conditions (Figure 16). No 4-DG was detected in the anaerobic fermentation of engineered EcAZ-1 and EcN. Altogether, these results demonstrated that EcAZ-1 and EcN arc promising chassis to produce different bioactivc molecules, presenting new opportunities to develop bacteria-based approaches to sustain human health.
[0127] Table 1. DNA sequences of synthetic genes and elements.
[0128] Table 2. Primers used in this study.
[0129]
[0130] References:
[0131] [1] Falkowski, P. G., Fenchel, T., and Delong, E. F. (2008) The microbial engines that drive Earth's biogeochemical cycles, Science 320, 1034-1039.
[0132] [2] (2023) Can microbes save the planet?, Nature Biotechnology 41, 735-735.
[0133] [3] Sunagawa, S., Coelho, L. P., Chaffron, S., Kultima, J. R., Labadie, K., Salazar, G., Djahanschiri, B., Zeller,
[0134] G., Mende, D. R., Alberti, A., Cornejo-Castillo, F. M., Costea, P. I., Cruaud, C., d'Ovidio, F., Engelen, S., Ferrera, I., Gasol, J. M., Guidi, L., Hildebrand, F., Kokoszka, F., Lepoivre, C., Lima-Mendez, G., Poulain, J., Poulos, B. T., Royo-Llonch, M., Sarmento, H., Vieira-Silva, S., Dimier, C., Picheral, M., Searson, S., Kandels-Lewis, S., Tara Oceans, c., Bowler, C., de Vargas, C., Gorsky, G., Grimsley, N., Hingamp, P., ludicone, D., Jaillon, O., Not, F., Ogata, H., Pesant, S., Speich, S., Stemmann, L., Sullivan, M. B., Weissenbach, J., Wincker, P., Karsenti, E., Raes, J., Acinas, S. G., and Bork, P. (2015) Ocean plankton. Structure and function of the global ocean microbiome, Science 348, 1261359.
[0135] [4] Bardgett, R. D., and van der Putten, W. H. (2014) Belowground biodiversity and ecosystem functioning,
[0136] Nature 515, 505-511.
[0137] [5] Khalil, A. S., and Collins, J. J. (2010) Synthetic biology: applications come of age, Nat Rev Genet 11, 367-
[0138] 379. [6] Keasling, J. D. (2008) Synthetic biology for synthetic chemistry, / CS Chem Biol 3, 64-76.
[0139] [7] McCarty, N. S., and Ledesma-Amaro, R. (2019) Synthetic Biology Tools to Engineer Microbial
[0140] Communities for Biotechnology, Trends Biotechnol 37, 181-197.
[0141] [8] Hillson, N., Caddick, M., Cai, Y., Carrasco, J. A., Chang, M. W., Curach, N. C., Bell, D. J., Le Feuvre, R.,
[0142] Friedman, D. C., Fu, X., Gold, N. D., Herrgard, M. J., Holowko, M. B., Johnson, J. R., Johnson, R. A., Keasling, J. D., Kitney, R. I., Kondo, A., Liu, C., Martin, V. J. J., Menolascina, F., Ogino, C., Patron, N. J., Pavan, M., Poh, C. L., Pretorius, I. S., Rosser, S. J., Scrutton, N. S., Storch, M., Tekotte, H., Travnik, E., Vickers, C. E., Yew, W. S., Yuan, Y., Zhao, H., and Freemont, P. S. (2019) Building a global alliance of biofoundries, Nat Common 10, 2040.
[0143] [9] Adams, B. L. (2016) The Next Generation of Synthetic Biology Chassis: Moving Synthetic Biology from the Laboratory to the Field, ACS Synth Biol 5, 1328-1330.
[0144]
[0010] Sender, R., Fuchs, S., and Milo, R. (2016) Revised Estimates for the Number of Human and Bacteria
[0145] Cells in the Body, PLoS Biol 14, el002533.
[0146]
[0011] Yan, Q., Li, S., Yan, Q., Huo, X., Wang, C., Wang, X., Sun, Y., Zhao, W., Yu, Z., Zhang, Y., Guo, R., Lv, Q.,
[0147] He, X., Yao, C., Li, Z., Chen, F., Ji, Q., Zhang, A., Jin, H., Wang, G., Feng, X., Feng, L., Wu, F., Ning, J., Deng, S., An, Y., Guo, D. A., Martin, F. M., and Ma, X. (2024) A genomic compendium of cultivated human gut fungi characterizes the gut mycobiome and its relevance to common diseases, Cell 187, 2969-2989 e2924.
[0148]
[0012] Ogunrinola, G. A., Oyewale, J. O., Oshamika, O. O., and Olasehinde, G. I. (2020) The Human
[0149] Microbiome and Its Impacts on Health, Int J Microbiol 2020, 8045646.
[0150]
[0013] Hou, K., Wu, Z. X., Chen, X. Y., Wang, J. Q., Zhang, D., Xiao, C., Zhu, D., Koya, J. B., Wei, L., Li, J., and
[0151] Chen, Z. S. (2022) Microbiota in health and diseases, Signal Transduct Target Ther 7, 135.
[0152]
[0014] Jin, W. B., Li, T. T., Huo, D., Qu, S., Li, X. V., Arifuzzaman, M., Lima, S. F., Shi, H. Q., Wang, A., Putzel, G.
[0153] G., Longman, R. S., Artis, D., and Guo, C. J. (2022) Genetic manipulation of gut microbes enables single-gene interrogation in a complex microbiome, Cell 185, 547-562 e522.
[0154]
[0015] Bai, X., Huang, Z., Duraj-Thatte, A. M., Ebert, M. P., Zhang, F., Burgermeister, E., Liu, X., Scott, B. M.,
[0155] Li, G., and Zuo, T. (2023) Engineering the gut microbiome, Nature Reviews Bioengineering 1, 665- 679.
[0156]
[0016] Forster, S. C., Kumar, N., Anonye, B. O., Almeida, A., Viciani, E., Stares, M. D., Dunn, M., Mkandawire,
[0157] T. T., Zhu, A., Shao, Y., Pike, L. J., Louie, T., Browne, H. P., Mitchell, A. L., Neville, B. A., Finn, R. D., and Lawley, T. D. (2019) A human gut bacterial genome and culture collection for improved metagenomic analyses, Nat Biotechnol 37, 186-192.
[0158]
[0017] Almeida, A., Nayfach, S., Boland, M., Strozzi, F., Beracochea, M., Shi, Z. J., Pollard, K. S., Sakharova, E.,
[0159] Parks, D. H., Hugenholtz, P., Segata, N., Kyrpides, N. C., and Finn, R. D. (2021) A unified catalog of 204,938 reference genomes from the human gut microbiome, Nat Biotechnol 39, 105-114.
[0160]
[0018] Patnode, M. L., Guruge, J. L., Castillo, J. J., Couture, G. A., Lombard, V., Terrapon, N., Henrissat, B.,
[0161] Lebrilla, C. B., and Gordon, J. I. (2021) Strain-level functional variation in the human gut microbiota based on bacterial binding to artificial food particles, Cell Host Microbe 29, 664-673 e665.
[0162]
[0019] Browne, H. P., Forster, S. C., Anonye, B. O., Kumar, N., Neville, B. A., Stares, M. D., Goulding, D., and
[0163] Lawley, T. D. (2016) Culturing of 'unculturable' human microbiota reveals novel taxa and extensive sporulation, Nature 533, 543-546.
[0164]
[0020] Lagier, J. C., Khelaifia, S., Alou, M. T., Ndongo, S., Dione, N., Hugon, P., Caputo, A., Cadoret, F., Traore,
[0165] S. I., Seek, E. H., Dubourg, G., Durand, G., Mourembou, G., Guilhot, E., Togo, A., Bellali, S., Bachar, D., Cassir, N., Bittar, F., Delerce, J., Mailhe, M., Ricaboni, D., Bilen, M., Dangui Nieko, N. P., Dia Badiane, N. M., Valles, C., Mouelhi, D., Diop, K., Million, M., Musso, D., Abrahao, J., Azhar, E. L, Bibi, F., Yasir, M., Diallo, A., Sokhna, C., Djossou, F., Vitton, V., Robert, C., Rolain, J. M., La Scola, B., Fournier, P. E., Levasseur, A., and Raoult, D. (2016) Culture of previously uncultured members of the human gut microbiota by culturomics, Nat Microbiol 1, 16203.
[0021] Cheng, A. G., Ho, P. Y., Aranda-Diaz, A., Jain, S., Yu, F. B., Meng, X., Wang, M., lakiviak, M., Nagashima,
[0166] K., Zhao, A., Murugkar, P., Patil, A., Atabakhsh, K., Weakley, A., Yan, J., Brumbaugh, A. R., Higginbottom, S., Dimas, A., Shiver, A. L, Deutschbauer, A., Neff, N., Sonnenburg, J. L, Huang, K. C., and Fischbach, M. A. (2022) Design, construction, and in vivo augmentation of a complex gut microbiome, Cell 185, 3617-3636 e3619.
[0167]
[0022] Cubillos-Ruiz, A., Guo, T., Sokolovska, A., Miller, P. F., Collins, J. J., Lu, T. K., and Lora, J. M. (2021)
[0168] Engineering living therapeutics with synthetic biology, Nat Rev Drug Discov 20, 941-960.
[0169]
[0023] Kelly, V. W., Liang, B. K., and Sirk, S. J. (2020) Living Therapeutics: The Next Frontier of Precision
[0170] Medicine, ACS Synth Biol 9, 3184-3201.
[0171]
[0024] Lynch, J. P., Goers, L., and Lesser, C. F. (2022) Emerging strategies for engineering Escherichia coli
[0172] Nissle 1917-based therapeutics, Trends Pharmacol Sci 43, 772-786.
[0173]
[0025] Bermudez-Humaran, L. G., Aubry, C., Motta, J. P., Deraison, C., Steidler, L., Vergnolle, N., Chatel, J. M., and Langella, P. (2013) Engineering lactococci and lactobacilli for human health, Curr Opin Microbiol 16, 278-283.
[0174]
[0026] Zuo, F., Chen, S., and Marcotte, H. (2020) Engineer probiotic bifidobacteria for food and biomedical applications - Current status and future prospective, Biotechnol Adv 45, 107654.
[0175]
[0027] Hobman, J. L., Penn, C. W., and Pallen, M. J. (2007) Laboratory strains of Escherichia coli: model citizens or deceitful delinquents growing old disgracefully?, Mol Microbiol 64, 881-885.
[0176]
[0028] Whitman, W. B., Coleman, D. C., and Wiebe, W. J. (1998) Prokaryotes: the unseen majority, Proc Natl
[0177] Acad Sci U SA 95, 6578-6583.
[0178]
[0029] Denamur, E., Clermont, O., Bonacorsi, S., and Gordon, D. (2021) The population genetics of pathogenic Escherichia coli, Nat Rev Microbiol 19, 37-54.
[0179]
[0030] Tenaillon, O., Skurnik, D., Picard, B., and Denamur, E. (2010) The population genetics of commensal
[0180] Escherichia coli, Nat Rev Microbiol 8, 207-217.
[0181]
[0031] Geurtsen, J., de Been, M., Weerdenburg, E., Zomer, A., McNally, A., and Poolman, J. (2022) Genomics and pathotypes of the many faces of Escherichia coli, FEMS Microbiol Rev 46.
[0182]
[0032] Collaborators, G. B. D. A. R. (2022) Global mortality associated with 33 bacterial pathogens in 2019: a systematic analysis for the Global Burden of Disease Study 2019, Lancet 400, 2221-2248.
[0183]
[0033] Nougayrede, J. P., Homburg, S., Taieb, F., Boury, M., Brzuszkiewicz, E., Gottschalk, G., Buchrieser, C.,
[0184] Hacker, J., Dobrindt, U., and Oswald, E. (2006) Escherichia coli induces DNA double-strand breaks in eukaryotic cells, Science 313, 848-851.
[0185]
[0034] Dejea, C. M., Fathi, P., Craig, J. M., Boleij, A., Taddese, R., Geis, A. L., Wu, X., DeStefano Shields, C. E.,
[0186] Hechenbleikner, E. M., Huso, D. L., Anders, R. A., Giardiello, F. M., Wick, E. C., Wang, H., Wu, S., Pardoll, D. M., Housseau, F., and Sears, C. L. (2018) Patients with familial adenomatous polyposis harbor colonic biofilms containing tumorigenic bacteria, Science 359, 592-597.
[0187]
[0035] Arthur, J. C., Perez-Chanona, E., Muhlbauer, M., Tomkovich, S., Uronis, J. M., Fan, T. J., Campbell, B.
[0188] J., Abujamel, T., Dogan, B., Rogers, A. B., Rhodes, J. M., Stintzi, A., Simpson, K. W., Hansen, J. J., Keku, T. O., Fodor, A. A., and Jobin, C. (2012) Intestinal inflammation targets cancer-inducing activity of the microbiota, Science 338, 120-123.
[0189]
[0036] Liu, D., Siguenza, N. E., Zarrinpar, A., and Ding, Y. (2022) Methods of DNA introduction for the engineering of commensal microbes, Engineering Microbiology 2, 100048.
[0190]
[0037] Russell, B. J., Brown, S. D., Siguenza, N., Mai, L, Saran, A. R., Lingaraju, A., Maissy, E. S., Dantas
[0191] Machado, A. C., Pinto, A. F. M., Sanchez, C., Rossitto, L. A., Miyamoto, Y., Richter, R. A., Ho, S. B., Eckmann, L., Hasty, J., Gonzalez, D. J., Saghatelian, A., Knight, R., and Zarrinpar, A. (2022) Intestinal transgene delivery with native E. coli chassis allows persistent physiological changes, Cell 185, 3263-3277 e3215.
[0192]
[0038] Wang, G., Zhao, Z., Ke, J., Engel, Y., Shi, Y. M., Robinson, D., Bingol, K., Zhang, Z., Bowen, B., Louie, K.,
[0193] Wang, B., Evans, R., Miyamoto, Y., Cheng, K., Kosina, S., De Raad, M., Silva, L., Luhrs, A., Lubbe, A., Hoyt, D. W., Francavilla, C., Otani, H., Deutsch, S., Washton, N. M., Rubin, E. M., Mouncey, N. J., Visel, A., Northen, T., Cheng, J. F., Bode, H. B., and Yoshikuni, Y. (2019) CRAGE enables rapid activation of biosynthetic gene clusters in undomesticated bacteria, Nat Microbiol 4, 2498-2510.
[0194]
[0039] Yu, D., Gustafson, W. C., Han, C., Lafaye, C., Noirclerc-Savoye, M., Ge, W. P., Thayer, D. A., Huang, H.,
[0195] Kornberg, T. B., Royant, A., Jan, L Y., Jan, Y. N., Weiss, W. A., and Shu, X. (2014) An improved monomeric infrared fluorescent protein for neuronal and tumour brain imaging, Nat Commun 5, 3626.
[0196]
[0040] Punchakara, A., Prajapat, G., Bairwa, H. K., Jain, S., and Agrawal, A. (2023) Applications of mycosporine-like amino acids beyond photoprotection, Appl Environ Microbiol 89, e0074023.
[0197]
[0041] Lampe, D. J., Akerley, B. J., Rubin, E. J., Mekalanos, J. J., and Robertson, H. M. (1999) Hyperactive transposase mutants of the Himarl mariner transposon, Proc Natl Acad Sci U S A 96, 11428-11433.
[0198]
[0042] Ke, J., Zhao, Z., Coates, C. R., Hadjithomas, M., Kuftin, A., Louie, K., Weller, D., Thomashow, L.,
[0199] Mouncey, N. J., Northen, T. R., and Yoshikuni, Y. (2022) Development of platforms for functional characterization and production of phenazines using a multi-chassis approach via CRAGE, Metab Eng 69, 188-197.
[0200]
[0043] Noonan, A. J. C., Qiu, Y., Ho, J. C. H., Ocampo, J., Vreugdenhil, K. A., Marr, R. A., Zhao, Z., Yoshikuni,
[0201] Y., and Hallam, S. J. (2020) CRAGE-mediated insertion of fluorescent chromosomal markers for accurate and scalable measurement of co-culture dynamics in Escherichia coli, Synth Biol (Oxf) 5, ysaa015.
[0202]
[0044] Jing, X., Yang, F., Shao, C., Wei, K., Xie, M., Shen, H., and Shu, Y. (2019) Role of hypoxia in cancer therapy by regulating the tumor microenvironment, Mol Cancer 18, 157.
[0203]
[0045] Xiao, S., Shi, H., Zhang, Y., Fan, Y., Wang, L., Xiang, L., Liu, Y., Zhao, L., and Fu, S. (2022) Bacteria-driven hypoxia targeting delivery of chemotherapeutic drug proving outcome of breast cancer, J Nanobiotechnology 20, 178.
[0204]
[0046] Luo, C. H., Huang, C. T., Su, C. H., and Yeh, C. S. (2016) Bacteria-Mediated Hypoxia-Specific Delivery of Nanoparticles for Tumors Imaging and Therapy, Nano Lett 16, 3493-3499.
[0205]
[0047] Giraud, E., Hannibal, L., Fardoux, J., Vermeglio, A., and Dreyfus, B. (2000) Effect of Bradyrhizobium photosynthesis on stem nodulation of Aeschynomene sensitiva, Proc Natl Acad Sci U S A 97, 14795-14800.
[0206]
[0048] Spiro, S., Roberts, R. E., and Guest, J. R. (1989) FNR-dependent repression of the ndh gene of
[0207] Escherichia coli and metal ion requirement for FNR-regulated gene expression, Mol Microbiol 3, 601-608.
[0208]
[0049] Dias, D. A., Urban, S., and Roessner, U. (2012) A historical overview of natural products in drug discovery, Metabolites 2, 303-336.
[0209]
[0050] Atanasov, A. G., Zotchev, S. B., Dirsch, V. M., International Natural Product Sciences, T., and Supuran,
[0210] C. T. (2021) Natural products in drug discovery: advances and opportunities, Nat Rev Drug Discov 20, 200-216.
[0211]
[0051] Ahmadi, M. K., and Pfeifer, B. A. (2016) Recent progress in therapeutic natural product biosynthesis using Escherichia coli, Curr Opin Biotechnol 42, 7-12.
[0212]
[0052] Ucar, K., and Goktas, Z. (2023) Biological activities of naringenin: A narrative review based on in vitro and in vivo studies, Nutr Res 119, 43-55.
[0213]
[0053] Bryant, J. A., Sellars, L. E., Busby, S. J., and Lee, D. J. (2014) Chromosome position effects on gene expression in Escherichia coli K-12, Nucleic Acids Res 42, 11383-11392.
[0214]
[0054] Hong, C. K. Y., Ramu, A., Zhao, S., and Cohen, B. A. (2024) Effect of genomic and cellular environments on gene expression noise, Genome Biol 25, 137.
[0215]
[0055] Chen, M., Jiang, Y., and Ding, Y. (2023) Recent progress in unraveling the biosynthesis of natural sunscreens mycosporine-like amino acids, J Ind Microbiol Biotechnol 50.
[0056] Chen, M., Rubin, G. M., Jiang, G., Raad, Z., and Ding, Y. (2021) Biosynthesis and Heterologous
[0216] Production of Mycosporine-Like Amino Acid Palythines, J Org Chem 86, 11160-11168.
[0217]
[0057] Wang, Q., Ou, M. 5., Kim, Y., Ingram, L 0., and Shanmugam, K. T. (2010) Metabolic Flux Control at the Pyruvate Node in an Anaerobic Escherichia coli Strain with an Active Pyruvate Dehydrogenase, Applied and Environmental Microbiology 76, 2107-2114.
[0218]
[0058] Gonzalez, J. E., Long, C. P., and Antoniewicz, M. R. (2017) Comprehensive analysis of glucose and xylose metabolism in Escherichia coli under aerobic and anaerobic conditions by (13)C metabolic flux analysis, Metab Eng 39, 9-18.
[0219]
[0059] Marsh, J. W., Kirk, C., and Ley, R. E. (2023) Toward Microbiome Engineering: Expanding the Repertoire of Genetically Tractable Members of the Human Gut Microbiome, Annu Rev Microbiol 77, 427-
Claims
CLAIMSWhat is claimed is:
1. Recombinant bacteria expressing a heterologous fluorescence protein, wherein the heterologous fluorescence protein is expressed from a heterologous nucleic acid comprising a promoter sequence and a gene encoding the heterologous fluorescence protein under the control of the promoter sequence, and wherein the heterologous nucleic acid is inserted into the bacterial chromosome.
2. The recombinant bacteria of claim 1, wherein the heterologous fluorescence protein is green fluorescent protein (GFP) encoded by a nucleic acid sequence comprising SEQ ID NO:6 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 6; or infrared fluorescent proteins 2.0 (IFP2.0) encoded by a nucleic acid sequence comprising SEQ ID NO:4 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 4.
3. The recombinant bacteria of claim 2, wherein the fluorescent protein is IFP2.0.
4. The recombinant bacteria of claim 3, wherein the promoter is a hypoxia-inducible promoter selected from Pfnr promoter of SEQ ID NO:1, FF20 promoter of SEQ ID NO:2, FF20* promoter of SEQ ID NO: 3, or any promoter having a nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 1 , 2, or 3.
5. The recombinant bacteria of claim 4, wherein the recombinant bacteria further comprise a gene encoding a heterologous heme-oxygenase (HOI), and wherein the gene encoding HOI comprises a nucleic acid sequence of SEQ ID NO:5 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 5.
6. The recombinant bacteria of claim 5, wherein the gene encoding HOI is translated from a polycistronic mRNA that encodes IFP2.0, optionally after the 3 ’-end of the gene encoding IFP2.0, under the control of the same promoter.
7. The recombinant bacteria of claim 3, wherein the promoter is a chemically inducible promoter selected from isopropyl-p-d-thiogalactopyranoside (IPTG)-inducible T7 promoter of SEQ ID NO: 15, arabinose-inducible pBAD promoter of SEQ ID NO: 16, or any promoter having a nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 15 or 16.
8. The recombinant bacteria of claim 7, wherein the recombinant bacteria optionally comprise a gene encoding a heterologous heme-oxygenase (HOI), and wherein the gene encoding HOI comprises a nucleic acid sequence of SEQ ID NO:5 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 5.
9. The recombinant bacteria of claim 8, wherein the gene encoding HOI is translated from a polycistronic mRNA that encodes IFP2.0, optionally after the 3’-end of the gene encoding IFP2.0, under the control of the same promoter.
10. The recombinant bacteria of claim 3, wherein the recombinant bacteria further comprise a heterologous nucleic acid to express a heterologous polypeptide or heterologous polypeptides for the synthesis of a bioactive compound, which is optionally to be secreted from the recombinant bacteria.
11. The recombinant bacteria of claim 10, wherein the bioactive compound is naringenin or mycosporine-like amino acids.
12. The recombinant bacteria of any of the preceding claims, wherein the bacteria are species from the human gut microbiome, which are facultatively anaerobic bacteria or anaerobic bacteria, and optionally the recombinant bacteria is E. coli.
13. The recombinant bacteria of claim 12, wherein E.coli strain is one selected from E. coli BL21, E.coli EcAZ-1, E.coli EcAZ-2, E.coli MG1655, and E.coli Nissle 1917, and optionally E.coli strain is E.coli EcAZ-1 or E.coli Nissle 1917.
14. A composition for gastrointestinal cancer detection, the composition comprising the recombinant bacteria of claim 13, wherein the recombinant bacteria is optionally lyophilized.
15. The composition of claim 14, wherein the composition comprises about 103-10ncolony forming units of bacteria.
16. The composition of claim 15, wherein the composition is formulated into solid, semisolid, or liquid dosage form for oral- or rectal administration.
17. The composition of claim 16, wherein for oral administration, the composition is formulated into powder, granules, tablets, packed in a gelatin- or vegetable gel capsule, gel, paste, or suspended in a solution.
18. The composition of claim 16, wherein for rectal administration, the composition is formulated into suppositories19. The composition of claim 17 or 18, wherein the composition optionally comprises excipients.
20. A method of detecting gastrointestinal cancer using the composition of claims 4 and 14, the method comprising steps of: a) administering the composition through oral- or rectal route; b) optionally administering biliverdin and / or hemin (0.1-20 micromolar, e.g., 0.29 - 58.3 x IO'7ng / CFU or 5.83x 10'7ng / CFU ; optionally about 2 micromolar) through oral- or rectal route; and c) within 3 hours, scanning the fluorescence.
21. A method of detecting gastrointestinal cancer using the composition of claims 7 and 14, the method comprising steps of: a) administering the composition through oral- or rectal route; b) administering, IPTG or lactose (0.01-5 millimolar, optionally about 0.1 millimolar) or arabinose (0.001-5 % w / v, optionally about 0.1 % w / v) through oral- or rectal route;c) optionally administering biliverdin and / or hemin (0.1-20 micromolar; optionally about 2 micromolar) through oral- or rectal route; and d) within 3 hours, scanning the fluorescence.
22. A kit for administering the composition of claim 14, the kit comprising; a) a container comprising the bacterial composition; b) a container comprising biliverdin and / or hemin in a dosage form of solution, powder, capsule, tablet, or suppository; and optionally c) a container comprising lactose or arabinose in a dosage form of solution, powder, capsule, tablet, or suppository.
23. Recombinant bacteria producing naringenin, comprising a heterologous nucleic acid comprising a promoter sequence and genes encoding enzymes for naringenin biosynthesis under the control of the promoter sequence, comprising: i. a nucleic acid sequence comprising SEQ ID NO:7 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO:7, which encodes 1-tyrosine ammonia-lyase (TAL) or a homolog thereof; ii. a nucleic acid sequence comprising SEQ ID NO:8 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO:8, which encodes 4-coumarate-CoA ligase (4CL) or a homolog thereof; iii. a nucleic acid sequence comprising SEQ ID NO:9 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO:9, which encodes chaicone synthase (CHS) or a homolog thereof; and iv. a nucleic acid sequence comprising SEQ ID NO: 10 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 10, which encodes chaicone isomerase (CHI) or a homolog thereof.
24. The recombinant bacteria of claim 23, wherein the genes are assembled as a single operon under the control of an inducible promoter, optionally the inducible promoter being T7 promoter, or a constitutively active promoter.
25. The recombinant bacteria of claim 23 or 24, wherein the heterologous nucleic acid is inserted into the bacterial chromosome.
26. Recombinant bacteria producing mycosporine-like amino acids, comprising a heterologous nucleic acid comprising a promoter sequence and genes encoding enzymes for the biosynthesis of mycosporinc-likc amino acids under the control of the promoter sequence, comprising: i. a nucleic acid sequence comprising SEQ ID NO: 11 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 11, which encodes MysA (a dehydroquin ate synthase homolog) or a homolog thereof; ii. a nucleic acid sequence comprising SEQ ID NO: 12 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 12, which encodes MysB (an (9-methyltransferase) or a homolog thereof; iii. a nucleic acid sequence comprising SEQ ID NO: 13 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 13, which encodes MysC (an ATP-grasp ligase) or a homolog thereof; and iv. a nucleic acid sequence comprising SEQ ID NO: 14 or any nucleic acid sequence with at least about 80%, 85%, 90%, 95%, 97%, 99% or 100% sequence identity to SEQ ID NO: 14, which encodes MysD (D-alanine-D-alanine ligase) or a homolog thereof, wherein mycosporine-like amino acids are mycosporine-glycine and porphyra-334.
27. The recombinant bacteria of claim 26, wherein the genes are assembled as a single operon under the control of an inducible promoter, optionally the inducible promoter being T7 promoter, or a constitutively active promoter.
28. The recombinant bacteria of claim 26 or 27, wherein the heterologous nucleic acid is inserted into the bacterial chromosome.
29. The recombinant bacteria of any of claims 23-28, wherein the bacteria are species from the human gut microbiomc, and optionally facultatively anaerobic bacteria or anaerobic bacteria, and optionally the recombinant bacteria is E. coli.
30. The recombinant bacteria of claim 18, wherein E.coli strain is one selected from E. coli BL21, E.coli EcAZ-1, E.coli EcAZ-2, E.coli MG1655, and E.coli Nissle 1917, and optionally E.coli strain is E.coli EcAZ-1 or E.coli Nissle 1917.
31. A method for producing naringenin, comprising steps of: i. culturing recombinant bacteria of any of claims 23-25 under conditions suitable for production of naringenin, optionally in the presence of L-tyrosine; ii. adding about 0.1 mM IPTG to the bacterial culture when ODeoo reaches between 0.4 and 0.6, and further incubating the bacterial culture at about 18°C overnight while gently shaking it; and iii. extracting naringenin from the recombinant bacteria.
32. A method for producing mycosporine-like amino acids, comprising steps of: i. culturing recombinant bacteria of any of claims 26-28 under conditions suitable for production of mycosporine-like amino acids; ii. adding about 0.1 mM IPTG to the bacterial culture when ODeoo reaches between 0.4 and 0.6, and further incubating the bacterial culture at about 18°C overnight while gently shaking it; and iii. extracting mycosporine-like amino acids from the recombinant bacteria.
Citation Information
Patent Citations
Systems and Methods to Enhance RNA Stability and Translation and Uses Thereof
US20220010299A1
Engineering microorganisms for diagnostic imaging
US20230320591A1
Proteins that fluoresce at infrared wavelengths or generates singlet oxygen upon illumination
WO2009152364A2
Biliverdin-based photo-thermal preparation and preparation method and application thereof
WO2020047824A1
Enzymatic synthesis of mycosporine-like amino acids
WO2022217117A1