T cell receptors targeting minor histocompatibility antigen ACC-1

Abstract

Provided herein are T cell receptors (TCRs) or antigen-binding fragments thereof, such as those that recognize or bind a relatively hematopoietically-restricted minor histocompatibility antigen, e.g., ACC-1. In particular, the present disclosure relates to TCRs that bind or recognize particular ACC-1 peptides in the context of a major histocompatibility complex (MHC) molecule. The present disclosure further relates to nucleic acids encoding such TCRs, engineered cells comprising such TCRs, methods of isolating such TCRs, and uses thereof, for example, in cell therapy.

Description

T CELL RECEPTORS TARGETING MINOR HISTOCOMPATIBILITYANTIGEN ACC-1CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 637,955, filed April 24, 2024, which is incorporated herein by reference.SEQUENCE LISTING

[0002] The Sequence Listing written in file BSB-001 l ACCI SeqListing.xml is 158.4 kilobytes in size, was created April 21, 2025, and is hereby incorporated by reference.BACKGROUND

[0003] Allogeneic hematopoietic stem cell transplantation (HSCT) (HLA-matched or HLA haplotype matched) may be used for treatment of diseases or conditions such as hematologic malignancies and other nonmalignant conditions. Some subjects may relapse after alloSCT. Improved treatments are necessary to attain an optimal treatment outcome. Provided are embodiments that meet such needs.SUMMARY

[0004] Described are T cell receptors (TCRs), or antigen-binding fragments thereof, that recognize or bind a relatively hematopoietically-restricted minor histocompatibility antigen, e.g., ACC-1. In particular, the TCRs bind to or recognize particular ACC-1 peptides in the context of a major histocompatibility complex (MHC) molecule. The present disclosure further relates to nucleic acids encoding such TCRs, engineered cells comprising such TCRs, methods of isolating such TCRs and uses thereof, for example, in cell therapy.

[0005] Provided herein are TCRs, or antigen-binding fragments thereof, comprising: an alpha chain comprising a variable alpha (Va) region and a beta chain comprising a variable beta (VP) region; or a gamma chain comprising a variable gamma (Vy) region and a delta chain comprising a variable delta (V5) region; wherein:(a) the Va or Vy region comprises a complementarity determining region 3 (CDR- 3) comprising SEQ ID NO: 13, and the VP or V5 region comprises a CDR-3 comprising SEQ ID N0:21;(b) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO:31, and the VP or V5 region comprises a CDR-3 comprising SEQ ID NO:39;(c) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO:49, and the VPor V5 region comprises a CDR-3 comprising SEQ ID NO:57;(d) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO:67, and the VP or V5 region comprises a CDR-3 comprising SEQ ID NO:75;(e) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO: 85, and the VP or V5 region comprises a CDR-3 comprising SEQ ID NO:93; or(f) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO: 103, and the VP or V5 region comprises a CDR-3 comprising SEQ ID NO: 111.

[0006] Also provided herein are TCRs, or antigen-binding fragments thereof, comprising: an alpha chain comprising a Va region and a beta chain comprising a VP region; or a gamma chain comprising a Vy region and a delta chain comprising a V5 region; wherein:(a) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO: 11, a CDR-2 comprising SEQ ID NO: 12, and a CDR-3 comprising SEQ ID NO: 13, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO: 19, a CDR-2 comprising SEQ ID NO:20, and a CDR-3 comprising SEQ ID NO:21;(b) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:29, a CDR-2 comprising SEQ ID NO:30, and a CDR-3 comprising SEQ ID NO:31, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:37, a CDR-2 comprising SEQ ID NO:38, and a CDR-3 comprising SEQ ID NO:38;(c) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:47, a CDR-2 comprising SEQ ID NO:48, and a CDR-3 comprising SEQ ID NO:49, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO: 55, a CDR-2 comprising SEQ ID NO: 56, and a CDR-3 comprising SEQ ID NO: 57;(d) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:65, a CDR-2 comprising SEQ ID NO:66, and a CDR-3 comprising SEQ ID NO:67, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:73, a CDR-2 comprising SEQ ID NO:74, and a CDR-3 comprising SEQ ID NO:75;(e) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO: 83, a CDR-2 comprising SEQ ID NO:84, and a CDR-3 comprising SEQ ID NO:85, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:91, a CDR-2 comprising SEQ ID NO:92, and a CDR-3 comprising SEQ ID NO:93; or(f) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO: 101, a CDR-2 comprising SEQ ID NO: 102, and a CDR-3 comprising SEQ ID NO: 103, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO: 109, a CDR-2 comprising SEQ ID NO: 110,and a CDR-3 comprising SEQ ID NO: 111.

[0007] Also provided herein are TCRs, or antigen-binding fragments thereof, comprising: an alpha chain comprising a Va region and a beta chain comprising a VP region; or a gamma chain comprising a Vy region and a delta chain comprising a V5 region; wherein:(a) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 14, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:22;(b) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:32, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:40;(c) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 50, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:58;(d) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:68, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:76;(e) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 86, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO: 94; or(f) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 104, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO: 112.

[0008] In some embodiments,(a) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO: 14, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO:22;(b) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO:32, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO:40;(c) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO: 50, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO:58;(d) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within theVa or Vy region sequence of SEQ ID NO:68, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO:76;(e) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO: 86, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO:94; or(f) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO: 104, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO: 112.

[0009] Also provided are TCRs, or antigen-binding fragments thereof, comprising: an alpha chain comprising a Va region and a beta chain comprising a VP region; or a gamma chain comprising a Vy region and a delta chain comprising a V5 region; wherein:(a) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 14, and the VP or V5 region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:22;(b) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:32, and the VP or V5 region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:40;(c) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:50, and the VP or V5 region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:58;(d) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:68, and the VP or V5 region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:76;(e) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:86, and the VP or V5 region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:94; or(f) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 104, and the VP or V5 region comprisesa CDR-1, a CDR-2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO: 112.

[0010] Also provided are TCRs, or antigen-binding fragments thereof, comprising: an alpha chain comprising a Va region and a beta chain comprising a VP region, or a gamma chain comprising a Vy region and a delta chain comprising a V5 region, wherein:(a) the Va or Vy region comprises SEQ ID NO: 14 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO:22 or a sequence that has at least 90% sequence identity thereto;(b) the Va or Vy region comprises SEQ ID NO:32 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO:40 or a sequence that has at least 90% sequence identity thereto;(c) the Va or Vy region comprises SEQ ID NO:50 or a sequence that has at least90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO: 58 or a sequence that has at least 90% sequence identity thereto;(d) the Va or Vy region comprises SEQ ID NO:68 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO:76 or a sequence that has at least 90% sequence identity thereto;(e) the Va or Vy region comprises SEQ ID NO:86 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO:94 or a sequence that has at least 90% sequence identity thereto; or(f) the Va or Vy region comprises SEQ ID NO: 104 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO: 112 or a sequence that has at least 90% sequence identity thereto.

[0011] In some embodiments,(a) the Va or Vy region comprises SEQ ID NO: 14, and the VP or V5 region comprises SEQ ID NO:22;(b) the Va or Vy region comprises SEQ ID NO:32, and the VP or V5 region comprises SEQ ID NO:40;(c) the Va or Vy region comprises SEQ ID NO:50, and the VP or V5 region comprises SEQ ID NO:58;(d) the Va or Vy region comprises SEQ ID NO: 68, and the VP or V5 region comprises SEQ ID NO:76;(e) the Va or Vy region comprises SEQ ID NO: 86, and the VP or V5 regioncomprises SEQ ID NO:94; or(f) the Va or Vy region comprises SEQ ID NO: 104, and the VP or V5 region comprises SEQ ID NO: 112.

[0012] In some embodiments, the alpha chain further comprises an alpha constant (Ca) region and the beta chain further comprises a beta constant (CP) region; or the gamma chain further comprises a gamma constant (Cy) region and the delta chain further comprises a delta constant (C5) region. In some embodiments, the Ca comprises SEQ ID NO:3 or 5, and the CP comprises SEQ ID NO:7 or 9.

[0013] In some embodiments,(a) the alpha or gamma chain comprises SEQ ID NO: 17, and the beta or delta chain comprises SEQ ID NO:25;(b) the alpha or gamma chain comprises SEQ ID NO:35, and the beta or delta chain comprises SEQ ID NO:43;(c) the alpha or gamma chain comprises SEQ ID NO:53, and the beta or delta chain comprises SEQ ID NO:61;(d) the alpha or gamma chain comprises SEQ ID NO:71, and the beta or delta chain comprises SEQ ID NO:79;(e) the alpha or gamma chain comprises SEQ ID NO:89, and the beta or delta chain comprises SEQ ID NO:97; or(f) the alpha or gamma chain comprises SEQ ID NO: 107, and the beta or delta chain comprises SEQ ID NO: 115.

[0014] In some embodiments, a TCR is domain swapped when forming a full length TCR, wherein an a variable region is fused to a P constant region and a P variable region is fused to an a constant region (or y variable region is fused to a 5 constant region and a 5 variable region is fused to an y constant region). In some embodiments, a TCR is domain swapped when forming a full length TCR, wherein an a variable region is fused to a y or 5 constant region and a P variable region is fused to an 5 or y constant region (or y variable region is fused to an a or P constant region and a 5 variable region is fused to an p or a constant region).

[0015] In some embodiments, the TCR, or antigen-binding fragment thereof, recognizes a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule. In some embodiments, the MHC molecule is a human leukocyte antigens (HLA)-A molecule. In some embodiments, the HLA-A molecule is of serotype HLA-A*24:02. In some embodiments, the peptide epitope of ACC-1 is set forth in SEQ ID NO: 1.

[0016] Also provided are polynucleotides encoding any of the TCRs, or antigen-binding fragments thereof, provided herein, or a Va, Vy, V0, V5, an alpha chain, a beta chain, a gamma chain, or a delta chain thereof.

[0017] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding the Va region and a nucleotide sequence encoding the V0 region; or a nucleotide sequence encoding the Vy region and a nucleotide sequence encoding the V5 region; wherein:(a) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 15 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the V0 or V5 region comprises SEQ ID NO:23 or a sequence that has at least 90% sequence identity thereto;(b) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:33 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the V0 or V5 region comprises SEQ ID NO:41 or a sequence that has at least 90% sequence identity thereto;(c) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:51 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the V0 or V5 region comprises SEQ ID NO:59 or a sequence that has at least 90% sequence identity thereto;(d) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 69 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the V0 or V5 region comprises SEQ ID NO:77 or a sequence that has at least 90% sequence identity thereto;(e) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 87 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the V0 or V5 region comprises SEQ ID NO:95 or a sequence that has at least 90% sequence identity thereto; or(f) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 105 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the V0 or V5 region comprises SEQ ID NO: 113 or a sequence that has at least 90% sequence identity thereto.

[0018] In some embodiments, the one of more of the nucleic acid sequence encoding the Va, Vy, V0, V5, a constant, y constant, 0 constant, or 5 constant chains is codon optimized. In some embodiments,(a) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 16, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:24;(b) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:34, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:42;(c) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:52, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:60(d) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:70, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:78;(e) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:88, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:96; or(f) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 106, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO: 114.

[0019] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding an alpha chain and a nucleotide sequence encoding a beta chain; or a nucleotide sequence encoding a gamma chain and a nucleotide sequence encoding a delta chain; wherein:(a) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 18 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:26 or a sequence that has at least 90% sequence identity thereto;(b) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:36 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:44 or a sequence that has at least 90% sequence identity thereto;(c) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 54 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:62 or a sequence that has at least 90% sequence identity thereto;(d) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 72 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:80 or a sequence that has at least 90% sequence identity thereto;(e) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 90 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:98 or a sequence that has at least 90% sequence identity thereto; or(f) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 108 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO: 116 or a sequence that has at least 90% sequence identity thereto.Any the above sequences can be codon optimized. Codon optimization can be in the variable region, the constant region, or both. Exemplary variable region optimized codon sequences are provided in Table 3.

[0020] In some embodiments,(a) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 18, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:26;(b) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:36, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:44;(c) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:54, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO: 62;(d) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:72, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:80;(e) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:90, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:98; or(f) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 108, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO: 116.Any the above sequences can be codon optimized. Codon optimization can be in the variable region, the constant region, or both. Exemplary variable region optimized codon sequences are provided in Table 3.

[0021] In some embodiments, the nucleotide sequence encoding the alpha chain and the nucleotide sequence encoding the beta chain are present on a single nucleic acid or vector. In some embodiments, the nucleotide sequence encoding the alpha chain and the nucleotide sequence encoding the beta chain are present on a single nucleic acid or vector and expressed from a single promoter. In some embodiments, the nucleotide sequence encoding the alpha chain and the nucleotide sequence encoding the beta chain are present on a single nucleic acid or vector, separated by a peptide sequence that causes ribosome skipping, and expressed from a single promoter. The peptide that causes ribosome skipping can be, but is not limited, to a 2A peptide. The 2A peptide can be, but is not limited, to a P2A peptide. In some embodiments, the P2A peptide comprises SEQ ID NO: 129.

[0022] In some embodiments, the nucleotide sequence encodes the amino acid sequence of SEQ ID NO:27, 45, 63, 81, 99, or 117. In some embodiments, the nucleotide sequences encoding the alpha and beta chains of SEQ ID NO:27, 45, 63, 81, 99, or 117 are switched.

[0023] In some embodiments, the nucleotide sequence comprises SEQ ID NO:28, 46, 64, 82, 100, or 118, or a codon optimized variant of SEQ ID NO:28, 46, 64, 82, 100, or 118.

[0024] Also provided herein are vectors comprising any of the polynucleotides provided herein. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is a lentiviral vector.

[0025] Also provided herein are engineered cells comprising any of the TCRs or antigenbinding fragment thereof provided herein. Also provided herein are engineered cells comprising any of the polynucleotides provided herein or any of the vectors provided herein. In some embodiments, the TCR or antigen-binding fragment thereof is heterologous to the cell. In some embodiments, the engineered cell is a cell line. In some embodiments, the engineered cell is a primary cell obtained from a subject. In some embodiments, the engineered cell is a T cell.

[0026] Also provided herein are methods for producing an engineered cell that involve introducing any of the polynucleotides provided herein or any of the vectors provided herein into a cell to form the engineered cell.

[0027] Also provided herein are compositions comprising any of the TCRs or antigenbinding fragment thereof provided herein, any of the polynucleotides provided herein, any of the vectors provided herein, or any of the engineered cells provided herein. In some embodiments, the compositions also include a pharmaceutically acceptable excipient.

[0028] Also provided herein are methods for identifying a TCR targeting a relatively hematopoietically restricted minor histocompatibility antigen (miHA), that involve identifying a functional TCR that recognizes a relatively hematopoietically-restricted miHA, among a plurality of functional TCRs, wherein said plurality of functional TCRs are encoded by a plurality of functional TCR-encoding nucleic acid vectors generated by a high-throughput nucleic acid amplification and assembly method using nucleic acid obtained from a single T cell among a plurality of T cells; wherein said plurality of T cells is from a donor subject patient. In some embodiments, the donor is ACC-1 (Y)+and HLA-A*24:02+. In some embodiments, the donor subject is a healthy donor. In some embodiments, the donor subject is a recovered ACC-1 (Y)+cancer patient.

[0029] Also provided herein are methods for identifying a TCR targeting a relatively hematopoietically restricted miHA, that involve: (i) generating a plurality of functional TCR- encoding nucleic acid vectors by a high-throughput nucleic acid amplification and assembly method using nucleic acid obtained from a single T cell among a plurality of T cells; wherein said T cell is from a human donor subject; and (ii) identifying a functional TCR that recognizes the relatively hematopoietically-restricted miHA, among a plurality functional TCRs encoded by the plurality of functional TCR-encoding nucleic acid vectors. In some embodiments, the donor is ACC-1 (Y)+and HLA-A*24:02+. In some embodiments, the donor is a healthy donor.

[0030] In some embodiments, the relatively hematopoietically restricted miHA is a minor histocompatibility antigen ACC-1. In some embodiments, the identified functional TCR recognizes a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule. In some embodiments, the MHC molecule is a human leukocyte antigens (HLA)-A molecule. In some embodiments, the HLA-A molecule is of serotype HLA-A*24:02. In some embodiments, the peptide epitope of ACC-1 is set forth in SEQ ID NO: 1.

[0031] In some embodiments, the donor is a healthy donor. In some embodiments, the donor is a human cancer patient. The donor T cells can be cultured under conditions for cell expansion of the T cells prior to the generating of the plurality of functional TCR-encoding nucleic acid vectors. In some embodiments, the donor T cells are not cultured under conditions for cell expansion of the T cells prior to the generating of the plurality of functional TCR- encoding nucleic acid vectors.

[0032] In some embodiments, the high-throughput nucleic acid amplification and assembly involves: (1) amplifying a first amplification product and a second amplification product from complementary DNA (cDNA) generated from RNA obtained from the single T cell among theplurality of T cells sorted into each of a plurality of separate locations of a device, wherein: said first amplification product comprises a nucleotide sequence encoding a full-length Va region or a full-length Vy region of a TCR, and said second amplification product comprises a nucleotide sequence encoding a full-length VP region or a full-length V5 region of a TCR; and (2) assembling said first amplification product and said second amplification product from each of said plurality of separate locations into a nucleic acid vector to obtain an assembled nucleic acid vector comprising a nucleotide sequence encoding a functional TCR for each of said plurality of separate locations; and said functional TCR comprises (i) a full-length Va region and a full-length VP region from said single T cell or (ii) a full-length Vy region and a full- length V5 region from said single T cell.

[0033] Also provided herein are engineered cells comprising any of the described TCRs or a TCR identified by any of the described methods. In some embodiments, the engineered cell is a T cell that has been modified to knock out an endogenously expressed TCR. Also provided herein are compositions comprising any of the engineered cells provided herein. In some embodiments, the composition also comprises a pharmaceutically acceptable excipient.

[0034] Also provided herein are methods of treatment that involve administering any of the TCRs or antigen-binding fragments thereof provided herein, any of the polynucleotides provided herein, any of the vectors provided herein, any of the engineered cells provided herein, or any of the compositions provided herein, to a subject having a disease or a disorder. Also provided herein are any of the TCRs or antigen-binding fragments thereof provided herein, any of the polynucleotides provided herein, any of the vectors provided herein, any of the engineered cells provided herein, or any of the compositions provided herein, for use in the treatment of a disease or a disorder in a subject. Also provided herein are uses of any of the TCRs or antigen-binding fragments thereof provided herein, any of the polynucleotides provided herein, any of the vectors provided herein, any of the engineered cells provided herein, or any of the compositions provided herein in the manufacture of a medicament for the treatment of a disease or a disorder in a subject. Also provided herein are uses of any of the TCRs or antigen-binding fragments thereof provided herein, any of the polynucleotides provided herein, any of the vectors provided herein, any of the engineered cells provided herein, or any of the compositions provided herein, for the treatment of a disease or a disorder in a subject.

[0035] In some embodiments, the subject is eligible for or is to receive an allogeneic hematopoietic stem cell transplantation (HSCT). In some embodiments, the subject is eligiblefor or is to receive an allogeneic hematopoietic stem cell transplantation (HSCT) from a donor that does not express HLA-A*24:02. In some embodiments, the subject has or has been diagnosed with a malignant hematologic disorder. In some embodiments, the subject has or has been diagnosed with acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), or acute lymphoblastic leukemia (ALL). In some embodiments, the subject has or has been diagnosed with a liquid tumor, a hematopoietic tumor, a lymphoma, or chronic myeloid leukemia CML. In some embodiments, administration of the engineered cell or the composition induces or enhances cells death of cells associated with the malignant hematologic disorder, or induces or enhances a graft versus leukemia effect (GVL) in the subject.BRIEF DESCRIPTION OF THE DRAWINGS

[0036] FIG. 1. Tetramer binding and reporter CD69% example data for ACC-1. FACS analysis of TCR expression and target binding in CD3 / CD8 transduced 293T cells and stably transduced Jurkat cells. ACC-1 TCR A was transiently transfected into (A) 293T cells or (B) lentivirally transduced into Jurkat cells and subsequently evaluated by FACS for (A) anti-ACC- 1 tetramer binding and (B) CD3. TCR engineered Jurkat cells were evaluated for CD69 expressions following co-culture with K562 cells that had been pulsed with varying immunogenic peptide concentrations. (C) FACS analysis of the percentage of CD69 positive Jurkat cells was plotted against the peptide concentration for calculation of the reporter cell line EC50. Data points represent the mean and SD of 3 technical replicates.

[0037] FIG. 2. Graphs illustrating ACC-1 exogenous and endogenous cytotoxicity assays for anti-miHA TCR selection. (A) Calculated cytotoxicity EC50 E:T ratio for ACC-1 TCR C. (B) Cytotoxicity assay E:T ratio for immunogenic and non-immunogenic cells lines for ACC- 1 TCR C. (C) Pulse peptide assay with immunogenic and non-immunogenic peptides for ACC- 1 TCR C. ACC-1 immunogenic cell line was LCL436. ACC-1 non-immunogenic cell line was LCL436. Graphs represent % killing of target cells (Percentage of specific lysis) which was determined by flowcytometry. Data points represent the mean average value for 3 technical replicated and the error bars represent standard deviation.

[0038] FIG. 3. FACS validation of ACC-1 TCR-T engineering in primary T cells. Primary T cell transduction control (e.g., anti-NPMl TCR and untransfected (UTD) T cells or ACC-1 TCR D T cells were analyzed by FACS for CD3 surface mobilization, CD34 lentiviral transduction marker expression and target peptide binding using tetramers. For anti-NPMl TCR, CD3 vs NPM1 tetramer, CD34 vs tetramer, and CD3 vs CD34 confirmed anti-NPMl TCR expression. For the UTD, CD3 vs ACC1 tetramer, CD34 vs ACC1 tetramer, and CD3 vsCD34 confirmed endogenous TCRKO. For the ACC-1 TCRD, CD3 vs ACC1 tetramer, CD34 vs ACC1 tetramer, and CD3 vs CD34, confirmed ACC-1 TCRD expression. Viral transduction efficiency was confirmed to be above 95% of the primary TCR-T with tetramer binding exceeding 90%.

[0039] FIG. 4. Graphs illustrating ACC1 TCR-T cytotoxicity. Graphs represent the number of cells remaining after incubation with engineered ACC1 TCR T cells. Target cells either expressed (LCL17968) or did not express (LCL19901) the immunogenic ACC1 peptide. Target cells were contacted with engineered ACC1 TCR T cells at the indicated ratio of Effector to Target cells. Left bar at each ratio is immunogenic LCL17968 cells. Right bar at each ratio is non-immunogenic LCL 19901 cells.

[0040] FIG. 5. Graphs illustrating ACC1 TCR-T cytotoxicity. Graphs represent the number of cells remaining after incubation with engineered ACC1 TCR T cells. Target cells either expressed (LCL 17968) or did not express (LCL 19901) the immunogenic ACC1 peptide. Target cells were contacted with engineered ACC1 TCR T cells at the indicated ratio of Effector to Target cells. Left bar at each ratio is immunogenic LCL 17968 cells. Right bar at each ratio is non-immunogenic LCL 19901 cells.

[0041] FIG. 6. Graphs illustrating control TCR-T cytotoxicity. Graphs represent the number of cells remaining after incubation with engineered TCR KO T cells or negative control TCR T cells. Target cells either expressed (LCL17968) or did not express (LCL19901) the immunogenic ACC1 peptide. Target cells were contacted with engineered TCR T cells at the indicated ratio of Effector to Target cells. Left bar at each ratio is immunogenic LCL17968 cells. Right bar at each ratio is non-immunogenic LCL 19901 cells.

[0042] FIG. 7. Graphs illustrating ACC1 TCR-T cytotoxicity. Graphs represent the number of cells remaining after incubation with engineered ACC1 TCR T cells, TCR KO T cells, or negative control TCR T cells. Target cells either expressed (LCL436) or did not express (LCL17995) the immunogenic ACC1 peptide. Target cells were contacted with engineered ACC1 TCR T cells at the indicated ratio of Effector to Target cells. Left bar at each ratio is immunogenic LCL436 cells. Right bar at each ratio is non-immunogenic LCL17995 cells.

[0043] FIG. 8. Graphs illustrating ACC1 TCR-T cytotoxicity. Graphs represent the number of cells remaining after incubation with engineered ACC1 TCR T cells. Target cells either expressed (LCL436) or did not express (LCL17995) the immunogenic ACC1 peptide. Target cells were contacted with engineered ACC1 TCR T cells at the indicated ratio of Effector toTarget cells. Left bar at each ratio is immunogenic LCL436 cells. Right bar at each ratio is non- immunogenic LCL 17995 cells.

[0044] FIG. 9. Graphs illustrating ACC1 TCR-T cytotoxicity. Graphs represent the number of cells remaining after incubation with engineered ACC1 TCR T cells. Target cells either expressed (LCL436) or did not express (LCL17995) the immunogenic ACC1 peptide. Target cells were contacted with engineered ACC1 TCR T cells at the indicated ratio of Effector to Target cells. Left bar at each ratio is immunogenic LCL436 cells. Right bar at each ratio is non- immunogenic LCL 17995 cells.DETAILED DESCRIPTION

[0045] Provided herein are TCRs, including recombinant TCRs, that bind or recognize a peptide epitope associated with a relatively hematopoietically-restricted minor histocompatibility antigen, e.g., ACC-1, such as a peptide epitope expressed on the surface of a cell in the context of an MHC molecule. Among the provided embodiments are approaches useful in the treatment of such diseases and conditions and / or for targeting cell types, such as cancer cells or cells associated with a hematological ailment. In some embodiments, the provided TCRs and antigen-binding fragments thereof, bind or recognize a peptide epitope of ACC-1, in the context of an MHC molecule.

[0046] Also provided herein are nucleic acid molecules encoding the TCRs, engineered cells containing the TCRs, compositions containing the TCRs or cells, and methods of treatment or uses, such as therapeutic uses, involving administering such TCRs, engineered cells or compositions, and uses of such TCRs, cells or compositions. In some aspects, engineered cells that express a provided TCR or antigen binding fragment thereof, exhibit cytotoxic activity against target cells expressing the peptide epitope, such as cancer cells or cells associated with a hematological ailment. Also provided herein are methods for identifying a TCR targeting a relatively hematopoietically restricted miHA.

[0047] Allogeneic Stem Cell Transplantation (Allo-SCT) can be a curative therapy for patients with hematologic malignancies as well as for patients with nonmalignant but medically serious conditions such as non-malignant blood disorders (e.g., hemoglobinopathies, thalassemias) and autoimmune diseases. AlloSCT can also be used to create tolerance to transplanted solid organs. Mature aP T cells contained in the donor allograft play important roles and can be considered in two broad classes. One class promotes the reconstitution of antipathogen immunity, especially through the transfer of memory T cells. A second class of T cells, called alloreactive T cells, recognizes the patient as “non-self’. When alloSCT is usedfor the treatment of hematological malignancies, alloreactive donor T cells can kill malignant cells, thereby mediating a graft-versus-leukemia (GVL) effect. However, they can also cause graft-versus-host disease (GVHD), wherein alloreactive T cells attack healthy host tissues, including, e.g., the skin, bowel, and liver.

[0048] In a human leukocyte antigen (HLA) matched or haploidentical alloSCT, alloreactive T cells target miHAs, the peptide products of coding polymorphisms that distinguish recipients from donors. Importantly, alloreactive CD8+ T cells that target miHAs with expression limited to hematopoietic cells are unlikely to cause GVHD. Administering anti-miHA T cells could minimize the risk of widespread toxicity without compromising therapeutic efficacy in the context of augmenting alloSCT or as a standalone therapy, among other strategies.

[0049] Cell therapies (including those involving the administration of cells expressing recombinant receptors or TCRs specific for a disease or disorder of interest, such as a recombinant TCR and / or other recombinant antigen receptors), as well as other adoptive immune cell and adoptive T cell therapies can be effective in the treatment of diseases and disorders. In certain contexts, available approaches to adoptive cell therapy may not always be entirely satisfactory. In some contexts, optimal efficacy can depend on the ability of the administered cells to express the recombinant receptor, and for the recombinant receptor to recognize and bind to a target, e.g., target antigen, such as peptide epitopes of ACC-1, within the subject, for example, based on the affinity of the antigen-binding domain of the TCR to its target antigen. In some cases, consistency and / or efficiency of expression of the recombinant receptor, and activity of the receptor is limited in certain cells or certain cell populations of available therapeutic approaches.

[0050] A heterologous TCR, (e.g., a humanized TCR or a fully human recombinant TCR), when engineered into a human T cell, may compete with endogenous TCR complexes and / or can form mispairings with endogenous TCR chains, which may, in certain aspects, reduce recombinant TCR signaling, activity, and / or expression, and ultimately result in reduced activity of the engineered cells. For example, in some cases, suboptimal expression of an engineered or recombinant TCR can occur due to competition with an endogenous TCR and / or with TCRs having mispaired chains, for signaling molecules and / or domains such as the invariant CD3 signaling molecules (e.g., availability of co-expressed CD3 5, a, y and / or C, chains) that are involved in permitting expression of the complex on the cell surface. In some aspects, available CD3 molecules can limit the expression and function of the TCRs in thecells. To reduce or eliminate mispairing of the heterologous TCR with an endogenous TCR, the expression of the endogenous TCR may be reduced or eliminated. In some embodiments, an anti-ACC-1 TCR-expressing T cell is further modified to knock out the endogenously expressed TCR. In some embodiments, expression of an endogenous TRAC gene and an endogenous TRBC gene of the T cell have been knocked out, such as by CRISPR.

[0051] In some aspects, the provided embodiments are based on observations of improved affinity, expression, or activity of an exemplary fully human recombinant TCR, such as certain provided TCRs specific to ACC-1, even at a low effector to target (E:T) ratio. The activity of the engineered T cells expressing a recombinant TCR, e.g., cytokine secretion and / or cytolytic activity, in some cases may be limited when fewer engineered T cells are present compared to the target cells. In some aspects, such improvements in activity, particularly at a low E:T ratio and using fully human sequences, are advantageous in improving the efficacy of the therapy.

[0052] In some cases, certain available approaches to obtain antigen-specific recombinant receptors, such as recombinant TCRs, can result in recombinant receptors that exhibit cross reactivity to a different, non-target antigen (see, e.g., Cameron et al., (2013) Science Translational Medicine, 5(197): 197ral03). In some aspects, the provided embodiments are based on observations that as described herein, for example, that certain provided TCRs specific to a particular immunogenic ACC-1 peptide presented by HL A subtype A*24:02, do not show cross reactivity to cells expressing other peptide antigens or alloreactivity to other HLA subtypes. The provided TCRs thus exhibit improved expression and activity, with minimal risk of cross reactivity to other antigens, such as non-target antigens, that can be present in the subject, or peptide epitopes presented via non-target HLA subtypes.

[0053] In some aspects, therapeutic approaches using such TCRs, for example adoptive cell therapy with engineered human T cells expressing the provided recombinant TCRs, can ultimately result in high efficacy, for example, by improving the GVL effect. In some contexts, the provided embodiments, including the TCRs, polynucleotides encoding such TCRs, engineered cells and cell compositions, can provide various advantages over available therapies with TCRs, to improve the activity of the recombinant receptors and response to adoptive cell therapies targeting cancer cells and cells associated with hematological ailments.

[0054] All publications, including patent documents, scientific articles, and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forthin the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.

[0055] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.I. T CELL RECEPTORS TARGETING HISTOCOMPATIBILITY ANTIGEN 2 (ACC-1)

[0056] Provided herein are TCRs, such as those that bind or recognize a peptide epitope associated with a relatively hematopoietically restricted miHA, such as a peptide epitope expressed on the surface of an immune cell, a cancer cell and / or a cell associated with a hematological ailment, in the context of an MHC molecule. In some embodiments, the provided TCRs bind or recognize a peptide epitope of miHA ACC-1, in the context of an MHC molecule. Such TCRs and antigen-binding fragments exhibit antigenic specificity for binding or recognizing such peptide epitopes. Also provided in some embodiments are nucleic acid molecules encoding the TCRs, engineered cells expressing the TCRs, compositions and methods of treatment involving administering such TCRs, engineered cells or compositions. In some aspects, engineered cells that express a provided TCR or antigen-binding fragment, exhibit cytotoxic activity against target cells expressing the peptide epitope, such as cancer cells or cells that are associated with a hematological ailment.

[0057] In some embodiments, the described TCRs recognize a miHA ACC-1 antigen expressed on bone-marrow-derived cells from a person having an ACC-1 DYLQYVLQI (SEQ ID NO: 1) allele. The ACC 1 antigen is encoded by the BCL2A1 gene.A. Allogeneic stem cell transplantation

[0058] AlloSCT is a potentially curative treatment option for patients with hematologic malignancies. In an alloSCT (HLA-matched or haploidentical), patients receive a conditioning regimen, consisting of chemotherapy sometimes with radiation therapy, which facilitates the transplant by killing some residual malignant cells, by creating space in the recipient’s bone marrow for donor stem cell engraftment, and by killing patient immune cells that can mediate donor allograft rejection.

[0059] Mature alpha / beta donor T cells contained in the donor graft play important roles and can be considered in two broad classes. One class promotes the reconstitution of antipathogen immunity, especially through the transfer of memory T cells. A second class of T cells recognizes the patient as “nonself.” These so called “alloreactive” T cells have bothpositive and detrimental effects. A critical benefit of these cells is that they can kill recipient malignant cells mediating the GVL effect. Alloreactive T cells can also kill normal patient or host hematopoietic and immune cells, which both creates space for engrafting cells and reduces immunologic rejection of the donor cells. However, donor T cells can also attack normal non- hematopoietic recipient tissues, causing GVHD. Therefore, patients receiving alloSCT alone receive some type of systemic immunosuppression to reduce the frequency and severity of GVHD.

[0060] Despite the GVL effect, relapsed malignancy is the largest single cause of treatment failure and death in recipients of an alloSCT in treatment of a blood neoplasm. There is good reason to believe that relapse can be reduced by engineering a more effective alloreactive T cell response. GVHD and the consequences of systemic immunosuppression (such as infection) are the other major causes of morbidity and mortality. These too could be mitigated if the allo- response were better engineered to focus on hematopoietic cells and not normal host tissues. Despite these limitations, alloSCT is the worldwide standard of care for patients with moderate to high-risk hematologic malignancies supported by data from multiple sources that support higher rates of survival with than without a transplant.

[0061] In HLA-matched or haploidentical alloSCT, alloreactive donor T cells target miHAs expressed in the recipient. MiHAs are the peptide products of coding polymorphisms that distinguish recipients from donors. These polymorphisms are present in stable known frequencies in the population and are inherited by Mendelian genetics. Some of the genes that encode miHAs are similarly expressed in a wide spectrum of tissues, whereas others are relatively restricted to hematopoietic cells. As currently practiced, there is no control over which miHAs will be targeted in an alloSCT. Because T cell responses against miHAs expressed on normal tissues are nearly always generated, severe GVHD is a major risk, and therefore immunosuppression is required. In contrast, miHAs with expression relatively limited to hematopoietic cells are considered ideal targets for immunotherapy with donor derived CD8+ T cells, in conjunction with an alloSCT. CD8+ T cells that target such antigens can kill recipient malignant blood cells mediating the GVL effect. T cells that target relatively hematopoietically restricted antigen can mediate graft-versus-leukemia and promote engraftment with a low risk for graft-vs-host disease. They can also kill nonmalignant recipient hematopoietic cells, including immune cells, thereby promoting engraftment and reducing the risk of immunologic rejection. Interestingly, CD8+ T cells that target relatively hematopoietically restricted miHAs have a low risk of causing GVHD.

[0062] CD8+ T cells recognize their targets through their antigen receptors (TCRs). The process that generates these receptors creates a highly diverse repertoire of unique TCRs with each person estimated to contain T cells expressing more than 107unique receptors. This diversity allows people to respond not only to a wide range of pathogens but also to miHAs. Unlike antibodies, which bind to intact proteins, TCRs recognize short peptides, usually about 8-12 amino acids in length, embedded in the surface of MHC molecules, which are expressed on the surface of cells.

[0063] An advantage of this system of antigen detection is that T cells can recognize peptides derived from any protein, even those that are not expressed on the cell surface. Through evolution, MHC molecules have become diverse in the population with most of the variation being in the parts of the MHC molecule that bind peptide, and which present or display the peptide to the TCR. This allows for a large diversity of peptides that can be presented to T cells by MHC molecules with preference or restriction of certain peptides to specific MHC molecules. A consequence of this is that the presentation and recognition by T cells of each miHA is generally restricted to a single MHC type. Importantly, over the last several decades, more than 50 relatively hematopoietically-restricted miHAs have been identified, a number more than sufficient such that nearly every donor / recipient combination, regardless of MHC type, would have a targetable relatively hematopoietically-restricted miHA.B. Histocompatibility Antigen ACC-1

[0064] ACC-1 can be recognized and responded to in the context of bone marrow transplantation under certain genetic contexts. The antigenic peptide that arises from ACC-1 results from a single nucleotide difference between the non-immunogenic (“C peptide”) comprising the amino acid sequence DYLQCVLQI (SEQ ID NO:2) and the immunogenic (“Y peptide”) comprising the amino acid sequence DYLQYVLQI (SEQ ID NO: 1). The immunogenic peptide can be presented in the context of Class I MHC molecule, HLA- A*24:02. In some embodiments, the subject has received, is eligible for, or is to receive an allogeneic hematopoietic stem cell transplantation (HSCT) from a donor that does not express the (Y’ peptide). Such donor cells would not be recognized by any T cell carrying a TCR that recognizes the Y peptide version of ACC-1 and so would not be eliminated by such engineered cells.

[0065] In some examples, the miHA ACC-1 Y peptide (DYLQYVLQI; SEQ ID NO: 1) is targeted, and not the non-immunogenic C peptide (DYLQCVLQI; SEQ ID NO:2). ACC-1 is a suitable target because its expression is relatively limited to hematopoietic cells .

[0066] In some aspects, the TCR recognizes or binds an ACC-1 epitope in the context of an MHC molecule, such as an MHC Class I molecule. In some aspects, the MHC Class I molecule is an HLA-A2 molecule, including any one or more subtypes thereof, e.g., HLA- A*24:02.

[0067] In some aspects, the provided TCRs or antigen-binding fragments thereof recognize or bind to an immunogenic epitope or domain of ACC-1, such as the immunogenic Y peptide comprising the amino acid sequence DYLQYVLQI (SEQ ID NO: 1). In some embodiments, the TCR is derived from a TCR donor subject that is HLA-A*24:02+and is for use in combination with alloSCT of an HLA-A*24:02+recipient subject, wherein the alloSCT transplant is from a transplant donor that is HLA-A*24:02 .

[0068] In some embodiments, the TCR, or antigen-binding fragment thereof, is isolated or purified or is recombinant. In particular embodiments, any of the provided TCRs, or antigenbinding fragments thereof, are recombinant. In some aspects, the TCR, or antigen-binding fragment thereof, is human. In some aspects, the TCR is a single chain. In other embodiments, the TCR contains two chains. In some embodiments, the TCR, or antigen-binding fragment thereof, is expressed on the surface of a cell (e.g., a T cell such as a T cell designed to lack expression of endogenous TCRs).

[0069] In some aspects, the provided TCRs have one or more specified functional features, such as binding properties, including binding to particular epitopes, and / or particular binding affinities, for example, as described herein. In some aspects, engineered cells, such as T cells, expressing the provided TCRs have one or more specified functional features, such as binding properties, including binding to particular epitopes, particular binding affinities, activation or stimulation of cell signaling, such as T cell signaling or TCR signaling, secretion of cytokines, and / or killing of target cells expressing or presenting the antigen, for example, as described herein.

[0070] In some embodiments, the provided binding molecule is a TCR or antigen-binding fragment thereof. In some embodiments, a TCR is a molecule that contains an alpha chain comprising a Va region and a beta chain comprising a VP region (also known as TCRa and TCRP, respectively) or a gamma chain comprising a Vy region and a delta chain comprising a V5 region (also known as TCRy and TCRS, respectively), or antigen-binding portions thereof, which is capable of specifically binding to an antigen, e.g., a peptide antigen or peptide epitope bound to an MHC molecule. In some embodiments, the TCR is in the aP form (e.g., is an aP TCR). In some embodiments, the TCR is in the yS form (e.g., is an yS TCR). Typically, TCRsthat exist in aP or y5 forms are generally structurally similar, but T cells expressing them may have distinct anatomical locations or functions. A TCR can be found on the surface of a cell or in soluble form. Generally, a TCR is found on the surface of T cells where it is generally responsible for recognizing antigens, such as peptides bound to MHC molecules.

[0071] In some embodiments, a TCR provided herein can be an intact or full-length TCR, such as a TCR containing a full length a chain and a full length P chain, or a TCR containing a full length y chain and a full length 5 chain. In some embodiments, an antigen-binding portion of a TCR provided herein can be less than a full-length TCR provided that it binds to a specific peptide bound in an MHC molecule, such as it binds to an MHC -peptide complex. In some cases, an antigen-binding portion or fragment of a TCR can contain only a portion of the structural domains of a full-length or intact TCR, but yet is able to bind the peptide epitope, such as MHC -peptide complex, to which the full-length TCR binds. In some cases, an antigenbinding portion contains the variable domains of a TCR, such as a Va region and a VP region of a TCR, or a Vy region and a V5 region of a TCR provided herein provided that that antigenbinding portion is sufficient to form a binding site for binding to a specific MHC-peptide complex.

[0072] In some embodiments, the variable domains of the TCR contain CDRs, which generally are contributors to antigen recognition and binding capabilities and specificity of the peptide, MHC molecule, and / or MHC-peptide complex. In some embodiments, a CDR of a TCR or combination thereof forms all or substantially all of the antigen-binding site of a given TCR molecule. The various CDRs within a variable region of a TCR chain generally are separated by framework regions (FRs), which generally display less variability among TCRs as compared to the CDRs (see, e.g., lores et al., Proc. Nat'l Acad. Sci. U.S.A. 57:9138, 1990; Chothia et al., EMBO J. 7:3745, 1988; see also Lefranc et al., Dev. Comp. Immunol. 27:55, 2003). In some embodiments, CDR-3 is the main CDR responsible for antigen binding or specificity, or is the most important among the three CDRs on a given TCR variable region for antigen recognition, and / or for interaction with the processed peptide portion of the peptide- MHC complex. In some contexts, CDR-1 of the alpha chain can interact with the N-terminal part of certain antigenic peptides. In some contexts, CDR-1 of the beta chain can interact with the C-terminal part of the peptide. In some contexts, CDR-2 contributes most strongly to or is the primary CDR responsible for the interaction with or recognition of the MHC portion of the MHC-peptide complex. In some embodiments, the variable region of the P-chain can contain a further hypervariable region (e.g., CDR4 or HVR4), which generally is involved insuperantigen binding and not antigen recognition (Kotb (1995) Clinical Microbiology Reviews, 8:411-426).

[0073] In some embodiments, the a chain and / or the P chain of a TCR, or the y chain and / or the 5 chain of a TCR, also can contain a constant domain, a transmembrane domain and / or a short cytoplasmic tail (see, e.g. , Janeway et al., Immunobiology: The Immune System in Health and Disease, 3rdEd., Current Biology Publications, p. 4:33, 1997). In some aspects, each chain (e.g., alpha or beta) of the TCR can possess one N-terminal immunoglobulin variable domain, one immunoglobulin constant domain, a transmembrane region, and a short cytoplasmic tail at the C-terminal end. In some embodiments, a TCR, for example via the cytoplasmic tail, is associated with invariant proteins of the CD3 complex involved in mediating signal transduction. In some cases, the structure allows the TCR to associate with other molecules like CD3 and subunits thereof. For example, a TCR containing constant domains with a transmembrane region may anchor the protein in the cell membrane and associate with invariant subunits of the CD3 signaling apparatus or complex. The intracellular tails of CD3 signaling subunits (e.g, CD3y, CD35, CD3s and CD3(^ chains) contain one or more immunoreceptor tyrosine-based activation motif or ITAM and generally are involved in the signaling capacity of the TCR complex.

[0074] In some embodiments, a TCR is domain swapped when forming a full length TCR, wherein an a variable region is fused to a P constant region and a P variable region is fused to an a constant region (or y variable region is fused to a 5 constant region and a 5 variable region is fused to an y constant region). In some embodiments, a TCR is domain swapped when forming a full length TCR, wherein an a variable region is fused to a y or 5 constant region and a P variable region is fused to an 5 or y constant region (or y variable region is fused to an a or P constant region and a 5 variable region is fused to an p or a constant region). Domain swapping can reduce or eliminate mispairing with an endogenous TCR thereby eliminating the need to knock out the endogenous TCR with forming an engineered T cell (Bethune MT et al. “Domain-swapped T cell receptors improve the safety of TCR gene therapy” eLife. 2016 (November 8) 5:el9095).

[0075] The various domains or regions of a TCR can be identified. In some cases, the exact locus of a domain or region can vary depending on the particular structural or homology modeling or other features used to describe a particular domain. It is understood that reference to amino acids, including to a specific sequence set forth as a SEQ ID NO: used to describe domain organization of a TCR are for illustrative purposes and are not meant to limit the scopeof the embodiments provided. In some cases, the specific domain e.g., variable or constant) can be several amino acids (such as one, two, three or four) longer or shorter. In some aspects, residues of a TCR are known or can be identified according to the International Immunogenetics Information System (IMGT) numbering system (see e.g., www.imgt.org; see also, Lefranc et al. (2003) Developmental and Comparative Immunology, 27(l);55-77; and The T Cell Factsbook 2nd Edition, Lefranc and LeFranc Academic Press 2001). Using this system, CDR-1 sequences within a TCR Va region and / or VP region in some cases correspond to the amino acids present between residue numbers 27-38, inclusive, CDR-2 sequences within a TCR Va region and / or VP region in some cases correspond to the amino acids present between residue numbers 56-65, inclusive, and CDR-3 sequences within a TCR Va region and / or VP region in some cases correspond to the amino acids present between residue numbers 105-117, inclusive.

[0076] In some embodiments, among the TCRs or antigen-binding fragments thereof provided herein are those that bind to or recognize a relatively hematopoietically restricted minor histocompatibility antigen, such as ACC-1, in the context of an MHC molecule. In some embodiments, among the TCRs or antigen-binding fragments thereof provided herein are those that recognize or bind to an immunogenic epitope or domain of ACC-1, such as the immunogenic Y peptide comprising the amino acid sequence DYLQYVLQI (SEQ ID NO: 1). In some embodiments, among the TCRs or antigen-binding fragments thereof provided herein are those that do not recognize or bind to a non-immunogenic epitope or domain of ACC-1, such as the non-immunogenic C peptide comprising the amino acid sequence DYLQCVLQI (SEQ ID NO:2). In some embodiments, among the TCRs or antigen-binding fragments thereof provided herein are those that preferentially or selectively recognize or bind to an immunogenic epitope or domain of ACC-1, such as the immunogenic Y peptide comprising the amino acid sequence DYLQYVLQI (SEQ ID NO: 1), and do not recognize or bind to a non-immunogenic epitope or domain of ACC-1, such as the non-immunogenic C peptide comprising the amino acid sequence DYLQCVLQI (SEQ ID NO:2), or exhibits a reduced affinity for binding to the non-immunogenic epitope and thus an increased relative selectivity for binding to the immunogenic epitope.

[0077] In some aspects, among the TCRs or antigen-binding fragments thereof provided herein are those that bind to or recognize an epitope of ACC-1, such as the immunogenic Y peptide comprising the amino acid sequence DYLQYVLQI (SEQ ID NO: 1), that is complexed with an MHC molecule of a particular HLA type, such as HLA-A*24:02.

[0078] In some embodiments, a TCR provided herein is a full-length TCR. In some embodiments, a TCR provided herein is a dimeric TCR (dTCR). In some embodiments, TCR provided herein is a single-chain TCR (scTCR). A TCR provided herein may be cell-bound or in soluble form. In some embodiments, a TCR provided herein is in cell-bound form expressed on the surface of a cell (e.g., a T cell such as a T cell designed to lack expression of endogenous TCRs).

[0079] In some embodiments, a TCR provided herein is a scTCR, which is a single amino acid strand containing an a chain and a P chain that is able to bind to MHC-peptide complexes. Typically, a scTCR can be generated as described elsewhere, see, e.g., WO 96 / 13593, WO 96 / 18105, WO99 / 18129, WO 04 / 033685, W02006 / 037960, WO2011 / 044186; U.S. Patent No. 7,569,664; and Schlueter, C. J. et al. J. Mol. Biol. 256, 859 (1996).C. Exemplary Variable Domains

[0080] Provided herein are TCRs or antigen-binding fragments thereof that recognize or bind an epitope or region of a relatively hematopoietically restricted minor histocompatibility antigen, such as ACC-1, in the context of an MHC molecule. In some aspects, the ACC-1 peptide is an DYLQYVLQI (SEQ ID NO: 1) peptide. The ACC-1 antigen is encoded by the BCL2A1 gene. Provided are exemplary sequences (e.g., CDRs, Va and / or VP, or Vy and / or V5, and constant region sequences) of ACC-l-specific TCRs.

[0081] In some embodiments, a TCR or antigen-binding fragment thereof provided herein binds to or recognizes an immunogenic ACC-1 allele presented on the surface of leukemia cells of the recipient of an alloSCT. In some aspects, cytotoxic activity of T cells expressing the anti- ACC-1 TCRs, is stimulated upon contact of the T cells with target cells presenting or expressing the antigen, such as an immunogenic ACC-1 peptide. In some embodiments, among the provided TCRs or antigen-binding fragments thereof provided herein are those that bind or recognize a peptide epitope of ACC-1 (e.g., a peptide epitope of an immunogenic allele of ACC-1) in the context of an MHC, such as a particular MHC or a particular HLA subtype.

[0082] Among such TCRs or antigen-binding fragments thereof are TCRs or antigenbinding fragments thereof that contain any of the Va region and VP region, or Vy region and V5 region, sequences as described, individually, or a sufficient antigen-binding portion of such sequences. In some embodiments, the provided TCRs or antigen-binding fragments thereof (e.g., anti-ACC-1 TCRs) contain a Va or Vy region sequence or sufficient antigen-binding portion thereof that contains a CDR-1, a CDR-2 and / or a CDR-3 as described herein. In some embodiments, the provided TCRs or antigen-binding fragments thereof (e.g., anti -ACC- 1TCRs) contain a VP or V5 region sequence or sufficient antigen-binding portion thereof that contains a CDR-1, a CDR-2 and / or a CDR-3 as described herein. In some embodiments, the TCRs or antigen-binding fragments thereof (e.g., anti-ACC-1 TCRs) contain a Va or Vy region sequence that contains a CDR-1, a CDR-2 and / or a CDR-3 as described herein and contain a VP or V5 region sequence that contains a CDR-1, a CDR-2 and / or a CDR-3 as described herein. Also among the provided TCRs are those having sequences at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such a sequence.

[0083] In some embodiments, a TCR or antigen-binding fragment thereof provided herein contains a Va or Vy region containing a CDR-3 comprising an amino acid sequence set forth in any of SEQ ID NOs: 13, 31, 49, 67, 85, and 103, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such a sequence.

[0084] In some aspects, a TCR or antigen-binding fragment thereof provided herein contains a Va or Vy region containing a CDR-3 contained within the amino acid sequence set forth in any of SEQ ID NOs: 14, 32, 50, 68, 86, and 104, or a sequence at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical with such a sequence.

[0085] In some embodiments, the Va or Vy region contains a CDR-1 comprising an amino acid sequence set forth in any of SEQ ID NOs: 11, 29, 47, 65, 83, and 101, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such a sequence. In some aspects, the Va or Vy region contains a CDR-1 contained within the amino acid sequence set forth in any of SEQ ID NOs: 14, 32, 50, 68, 86, and 104, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such a sequence. In some embodiments, the Va or Vy region contains a CDR-2 comprising an amino acid sequence set forth in any of SEQ ID NOs: 12, 30, 48, 66, 84, and 102, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such a sequence. In some embodiments, the Va or Vy region contains a CDR-2 contained within the amino acid sequence set forth in any of SEQ ID NOs: 14, 32, 50, 68, 86, and 104, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such a sequence.

[0086] In some instances, a TCR or antigen-binding fragment thereof provided herein contains a VP or V5 region containing a CDR-3 comprising an amino acid sequence set forth in any of SEQ ID NOs:21, 39, 57, 75, 93, and 111, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such a sequence. In some embodiments, a TCR or antigen-binding fragment thereof provided herein contains a VP or V5region containing a CDR-3 contained within the amino acid sequence set forth in any of SEQ ID NOs:22, 40, 58, 76, 94, and 112, or a sequence at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical with such a sequence.

[0087] In some instances, the VP or V5 region contains a CDR-1 comprising an amino acid sequence set forth in any or SEQ ID NO: 19, 37, 55, 73, 91, and 109, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such a sequence. In some aspects, the VP or V5 region contains a CDR-1 contained within the amino acid sequence set forth in any of SEQ ID NOs:22, 40, 58, 76, 94, and 112, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such a sequence. In some embodiments, the VP or V5 region contains a CDR-2 comprising an amino acid sequence set forth in SEQ ID NO:20, 38, 56, 74, 92, and 110, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such a sequence. In some embodiments, the VP or V5 region contains a CDR-2 contained within the amino acid sequence set forth in any of SEQ ID NOs:22, 40, 58, 76, 94, and 112, or a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such a sequence.

[0088] In some embodiments, the Va or Vy region contains the amino acid sequence set forth in any of SEQ ID NOs: 14, 32, 50, 68, 86, and 104, or a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some instances, the VP or V5 region contains the amino acid sequence set forth in any of SEQ ID NOs:22, 40, 58, 76, 94, and 112, or a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the TCR contains an alpha chain comprising any of such Va or Vy region sequences and any of such VP or V5 region sequences.

[0089] In some embodiments, a TCR or antigen binding fragment thereof provided herein having the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule can include an alpha chain (or gamma chain) having a CDR- 1 having the amino acid sequence set forth in SEQ ID NO: 11 (or a variant of SEQ ID NO: 11 with one or two amino acid modifications), a CDR-2 having the amino acid sequence set forth in SEQ ID NO: 12 (or a variant of SEQ ID NO: 12 with one or two amino acid modifications), and a CDR-3 having the amino acid sequence set forth in SEQ ID NO: 13 (or a variant of SEQ ID NO: 13 with one or two amino acid modifications) and a beta chain (or delta chain) having a CDR-1 having the amino acid sequence set forth in SEQ ID NO: 19 (or a variant of SEQ IDNO: 19 with one or two amino acid modifications), a CDR-2 having the amino acid sequence set forth in SEQ ID NO:20 (or a variant of SEQ ID NO:20 with one or two amino acid modifications), and a CDR-3 having the amino acid sequence set forth in SEQ ID NO:21 (or a variant of SEQ ID NO:21 with one or two amino acid modifications). An example of such a TCR having these CDRs and the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule includes, without limitation, TCR A. The CDR-1, CDR-2, and CDR-3 sequences of any of TCR B through F, as identified in Table 1, can be substituted for listed TCR A CDR-1, CDR-2, and CDR-3 sequences listed above.

[0090] In some cases, a TCR or antigen binding fragment thereof provided herein having the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule and having an alpha chain (or gamma chain) having a CDR-1 having the amino acid sequence set forth in SEQ ID NO: 11 (or a variant of SEQ ID NO: 11 with one or two amino acid modifications), a CDR-2 having the amino acid sequence set forth in SEQ ID NO: 12 (or a variant of SEQ ID NO: 12 with one or two amino acid modifications), and a CDR-3 having the amino acid sequence set forth in SEQ ID NO: 13 (or a variant of SEQ ID NO: 13 with one or two amino acid modifications) and a beta chain (or delta chain) having a CDR-1 having the amino acid sequence set forth in SEQ ID NO: 19 (or a variant of SEQ ID NO: 19 with one or two amino acid modifications), a CDR-2 having the amino acid sequence set forth in SEQ ID NO:20 (or a variant of SEQ ID NO:20 with one or two amino acid modifications), and a CDR-3 having the amino acid sequence set forth in SEQ ID NO:21 (or a variant of SEQ ID NO:21 with one or two amino acid modifications) can include any appropriate framework regions. For example, such a TCR or antigen binding fragment thereof can include an alpha chain that includes a framework region 1 having the entire amino acid sequence set forth in SEQ ID NO: 14 that is upstream of the amino acid sequence of SEQ ID NO: 11 (or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications), a framework region 2 having the entire amino acid sequence set forth in SEQ ID NO: 14 that is between the amino acid sequences of SEQ ID NOs: 11 and 12 (or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications), a framework region 3 having the entire amino acid sequence set forth in SEQ ID NO: 14 that is between the amino acid sequences of SEQ ID NOs: 12 and 13 (or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications), and a framework region 4 having the entire aminoacid sequence set forth in SEQ ID NO: 14 that is downstream of the amino acid sequence of SEQ ID NO: 13 (or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications) and a beta chain that includes a framework region 1 having the entire amino acid sequence set forth in SEQ ID NO:22 that is upstream of the amino acid sequence of SEQ ID NO: 19 (or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications), a framework region 2 having the entire amino acid sequence set forth in SEQ ID NO:22 that is between the amino acid sequences of SEQ ID NOs: 19 and 20 (or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications), a framework region 3 having the entire amino acid sequence set forth in SEQ ID NO:22 that is between the amino acid sequences of SEQ ID NOs:20 and 21 (or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications), and a framework region 4 having the entire amino acid sequence set forth in SEQ ID NO:22 that is downstream of the amino acid sequence of SEQ ID NO:21 (or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications). The CDR-1, CDR-2, CDR-3, and variable region sequences of any of TCR B through F, as identified in Table 1, can be substituted for listed TCR A CDR-1, CDR-2, CDR-3, and variable region sequences listed above.

[0091] In some cases, a TCR or antigen binding fragment thereof provided herein having the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule can include an alpha chain that includes an amino acid sequence having at least 90 percent identity to the amino acid sequence set forth in SEQ ID NO: 14 and a beta chain that includes an amino acid sequence having at least 90 percent identity to the amino acid sequence set forth in SEQ ID NO:22. For example, a TCR or antigen binding fragment thereof provided herein can include an alpha chain that includes an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to the amino acid sequence set forth in SEQ ID NO: 14 and a beta chain that includes an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to the amino acid sequence set forth in SEQ ID NO:22. In some cases, a TCR or antigen binding fragment thereof provided herein can include (a) an alpha chain that includes an amino acid sequence having 100 percent identity to the amino acid sequence set forth in SEQ ID NO: 14, and (b) a beta chain that includes an amino acid sequence having 100 percent identity to the amino acid sequence set forth in SEQ ID NO:22. The variable region sequences of any of TCR B throughF, as identified in Table 1, can be substituted for listed TCR A variable region sequences listed above.

[0092] In some cases, a TCR or antigen binding fragment thereof provided herein having the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule can include (a) an alpha chain that includes an amino acid sequence having at least 90 percent identity to the amino acid sequence set forth in SEQ ID NO: 14, provided that the alpha chain includes the amino acid sequences set forth in SEQ ID NOs: 11, 12, and 13 and (b) a beta chain that includes an amino acid sequence having at least 90 percent identity to the amino acid sequence set forth in SEQ ID NO:22, provided that the beta chain includes the amino acid sequences set forth in SEQ ID NOs: 19, 20, and 21. For example, a TCR or antigen binding fragment thereof provided herein can include (a) an alpha chain that includes an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to the amino acid sequence set forth in SEQ ID NO: 14, provided that the alpha chain includes the amino acid sequences set forth in SEQ ID NOs: 11, 12, and 13 and (b) a beta chain that includes an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to the amino acid sequence set forth in SEQ ID NO:22, provided that the beta chain includes the amino acid sequences set forth in SEQ ID NOs: 19, 20, and 21. The CDR-1, CDR-2, CDR-3 and variable region sequences of any of TCR B through F, as identified in Table 1, can be substituted for listed TCR A CDR-1, CDR-2, CDR-3 and variable region sequences listed above.

[0093] In some cases, a TCR or antigen binding fragment thereof provided herein having the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule can include (a) an alpha chain having the amino acid sequence set forth in SEQ ID NO: 14 or the amino acid set forth in SEQ ID NO: 14 with one, two, three, four, five, six, seven, eight, nine, or 10 amino acid modifications (e.g., amino acid substitutions, amino acid deletions, and / or amino acid additions) and (b) a beta chain having the amino acid sequence set forth in SEQ ID NO:22 or the amino acid set forth in SEQ ID NO:22 with one, two, three, four, five, six, seven, eight, nine, or 10 amino acid modifications (e.g., amino acid substitutions, amino acid deletions, and / or amino acid additions). For example, a TCR or antigen binding fragment thereof provided herein (a) can have the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule, (b) can include an alpha chain having the amino acid sequence set forth in SEQ ID NO: 14 with one, two, three, four, five, six, seven, eight, nine, or 10 amino acid modifications (e.g., aminoacid substitutions, amino acid deletions, and / or amino acid additions), provided that the alpha chain includes the amino acid sequences set forth in SEQ ID NOs: 11, 12, and 13, and (c) can include a beta chain having the amino acid sequence set forth in SEQ ID NO:22 with one, two, three, four, five, six, seven, eight, nine, or 10 amino acid modifications (e.g., amino acid substitutions, amino acid deletions, and / or amino acid additions), provided that the beta chain includes the amino acid sequences set forth in SEQ ID NOs: 19, 20, and 21. The CDR-1, CDR- 2, CDR-3 and variable region sequences of any of TCR B through F, as identified in Table 1, can be substituted for listed TCR A CDR-1, CDR-2, CDR-3 and variable region sequences listed above.

[0094] In some embodiments, a TCR or antigen binding fragment thereof provided herein having the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule can include an alpha chain (or gamma chain) and a beta chain (or delta chain), having the CDR sequences (alpha or gamma chain CDR-1, CDR-2 and CDR- 3 and beta of delta chain CDR-1, CDR-2, and CDR-3) as set forth in any of the TCRs in Table 1. In some embodiments, a TCR or antigen binding fragment thereof provided herein having the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule can include an alpha chain (or gamma chain) and a beta chain (or delta chain) having the CDR sequences (alpha or gamma chain CDR-1, CDR-2 and CDR-3 and beta of delta chain CDR-1, CDR-2, and CDR-3) as set forth in any of the TCRs in Table 1, wherein any one or more of the CDRs can independently be a variant CDR having one or two amino acid modifications from the CDR sequence listed of Table 1. Exemplary TCRs having these CDRs and the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule includes, without limitation, TCR A, TCR B, TRC C, TRC D, TRC E, and TRC F. As an example, a TCR or antigen binding fragment thereof provided herein having the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule can include an alpha chain (or gamma chain) having a CDR-1 having the amino acid sequence set forth in SEQ ID NO:29 (or a variant of SEQ ID NO:29 with one or two amino acid modifications), a CDR-2 having the amino acid sequence set forth in SEQ ID NO:30 (or a variant of SEQ ID NO:30 with one or two amino acid modifications), and a CDR-3 having the amino acid sequence set forth in SEQ ID NO:31 (or a variant of SEQ ID NO:31 with one or two amino acid modifications) and a beta chain (or delta chain) having a CDR-1 having the amino acid sequence set forth in SEQ ID NO:37 (or a variant of SEQ ID NO:37 with one or two aminoacid modifications), a CDR-2 having the amino acid sequence set forth in SEQ ID NO:38 (or a variant of SEQ ID NO:38 with one or two amino acid modifications), and a CDR-3 having the amino acid sequence set forth in SEQ ID NO:39 (or a variant of SEQ ID NO:39 with one or two amino acid modifications).

[0095] In some cases, a TCR or antigen binding fragment thereof provided herein having the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule and having an alpha chain (or gamma chain) and a beta chain (or delta chain), having the CDR sequences (alpha or gamma chain CDR-1, CDR-2 and CDR-3 and beta of delta chain CDR-1, CDR-2, and CDR-3) as set forth in any of the TCRs in Table 1 can include any appropriate framework regions. In some cases, a TCR or antigen binding fragment thereof provided herein having the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule and having an alpha chain (or gamma chain) and a beta chain (or delta chain), having the CDR sequences (alpha or gamma chain CDR-1, CDR-2 and CDR-3 and beta of delta chain CDR-1, CDR-2, and CDR- 3) as set forth in any of the TCRs in Table 1, wherein any one or more of the CDRs can independently be a variant CDR having one or two amino acid modifications from the CDR sequence listed of Table 1, can include any appropriate framework regions (z.e., alpha chain and beta chain framework 1, 2, 3, and 4 regions). An alpha chain framework region 1 can have the amino acid sequence of any of the alpha variable (V) region amino acid sequences of any of the TCRs set forth in Table 1 that is upstream of the corresponding CDR-1 sequence, or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications. An alpha chain framework region 2 can have the amino acid sequence of any of the alpha variable (V) region amino acid sequences of any of the TCRs set forth in Table 1 that is between the corresponding CDR-1 and CDR-2 sequences, or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications. An alpha chain framework region 3 can have the amino acid sequence of any of the alpha variable (V) region amino acid sequences of any of the TCRs set forth in Table 1 that is between the corresponding CDR-2 and CDR-3 sequences, or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications. An alpha chain framework region 4 can have the amino acid sequence of any of the alpha variable (V) region amino acid sequences of any of the TCRs set forth in Table 1 that is downstream of the corresponding CDR-3 sequence, or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications. A beta chain frameworkregion 1 can have the amino acid sequence of any of the beta variable (V) region amino acid sequences of any of the TCRs set forth in Table 1 that is upstream of the corresponding CDR- 1 sequence, or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications. A beta chain framework region 2 can have the amino acid sequence of any of the beta variable (V) region amino acid sequences of any of the TCRs set forth in Table 1 that is between the corresponding CDR-1 and CDR-2 sequences, or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications. A beta chain framework region 3 can have the amino acid sequence of any of the beta variable (V) region amino acid sequences of any of the TCRs set forth in Table 1 that is between the corresponding CDR-2 and CDR-3 sequences, or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications. A beta chain framework region 4 can have the amino acid sequence of any of the beta variable (V) region amino acid sequences of any of the TCRs set forth in Table 1 that is downstream of the corresponding CDR-3 sequence, or a variant of that sequence with one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid modifications. A TCR or antigen binding fragment thereof can have the alpha chain framework regions 1, 2, 3, and 4 and the corresponding beta chain framework regions 1, 2, 3, and 4 of any of the TCRs set forth in Table 1. As an example, a TCE can have the alpha chain framework regions 1, 2, 3, and 4 of SEQ ID NO:32 and the beta chain framework regions 1, 2, 3, and 4 of SEQ ID NO:40.

[0096] In some cases, a TCR or antigen binding fragment thereof provided herein having the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule can include an alpha chain that includes an amino acid sequence having at least 90 percent identity to an amino acid sequence of an alpha chain variable (V) region of any of the TCRs set forth in Table 1, and a beta chain that includes an amino acid sequence having at least 90 percent identity to an amino acid sequence of a corresponding beta chain variable (V) region as set forth in Table 1. A TCR or antigen binding fragment thereof provided herein can include an alpha chain that includes an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to an amino acid sequence of an alpha chain variable (V) region of any of the TCRs set forth in Table 1, and a beta chain that includes an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to an amino acid sequence of a corresponding beta chain variable (V) region as set forth in Table 1. In some cases, a TCR or antigen binding fragment thereof provided herein can include (a) an alpha chain that includes an amino acid sequence having 100 percent identity to an aminoacid sequence of an alpha chain variable (V) region of any of the TCRs set forth in Table 1, and (b) a beta chain that includes an amino acid sequence having 100 percent identity to an amino acid sequence of a corresponding beta chain variable (V) region as set forth in Table 1. As an example, a TCR or antigen binding fragment thereof provided herein can include an alpha chain that includes an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 percent identity to the amino acid sequence SEQ ID NO: 32, and a beta chain that includes an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 percent identity to an amino acid sequence SEQ ID NO:40.

[0097] In some cases, a TCR or antigen binding fragment thereof provided herein having the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule can include (a) an alpha chain that includes an amino acid sequence having at least 90 percent identity to an amino acid sequence of an alpha chain variable (V) region of any of the TCRs set forth in Table 1, provided that the alpha chain includes CDR-1, CDR-2, and CDR-3 amino acid sequences that are 100% identical to the corresponding alpha chain CDR-1, CDR-2, and CDR-3 sequences set forth in Table 1, and (b) a beta chain that includes an amino acid sequence having at least 90 percent identity to an amino acid sequence of a corresponding beta chain variable (V) region as set forth in Table 1, provided that the beta chain includes CDR-1, CDR-2, and CDR-3 amino acid sequences that are 100% identical to the corresponding beta chain CDR-1, CDR-2, and CDR-3 sequences set forth in Table 1. A TCR or antigen binding fragment thereof provided herein can include (a) an alpha chain that includes an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to an amino acid sequence of an alpha chain variable (V) region of any of the TCRs set forth in Table 1, provided that the alpha chain includes CDR-1, CDR- 2, and CDR-3 amino acid sequences that are 100% identical to the corresponding alpha chain CDR-1, CDR-2, and CDR-3 sequences set forth in Table 1, and (b) a beta chain that includes an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to an amino acid sequence of a corresponding beta chain variable (V) region as set forth in Table 1, provided that the beta chain includes CDR-1, CDR-2, and CDR-3 amino acid sequences that are 100% identical to the corresponding beta chain CDR-1, CDR-2, and CDR- 3 sequences set forth in Table 1. As an example, a TCR or antigen binding fragment thereof provided herein can include an alpha chain that includes an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to the amino acid sequence of SEQ ID NO:32, provided that the alpha chain includes CDR-1, CDR-2, and CDR-3 amino acidsequences as set forth in SEQ ID NOs:29, 30, and 31, respectively, and a beta chain that includes an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to an amino acid sequence of SEQ ID NO:40, provided that the beta chain includes CDR-1, CDR-2, and CDR-3 amino acid sequences as set forth in SEQ ID NOs:37, 38, and 39, respectively.

[0098] In some cases, a TCR or antigen binding fragment thereof provided herein having the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule can include (a) an alpha chain having an amino acid sequence of an alpha chain variable (V) region of any of the TCRs set forth in Table 1 or an amino acid of an alpha chain variable (V) region of any of the TCRs set forth in Table 1 with one, two, three, four, five, six, seven, eight, nine, or 10 amino acid modifications (e.g., amino acid substitutions, amino acid deletions, and / or amino acid additions) and (b) a beta chain having the amino acid sequence of a corresponding beta chain variable (V) region as set forth in Table 1 or an amino acid of a corresponding beta chain variable (V) region as set forth in Table 1 with one, two, three, four, five, six, seven, eight, nine, or 10 amino acid modifications (e.g., amino acid substitutions, amino acid deletions, and / or amino acid additions). A TCR or antigen binding fragment thereof provided herein (a) can have the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule, (b) can include an alpha chain having the amino acid sequence set forth in SEQ ID NO: 14, 32, 50, 68, 86, or 104 with zero, one, two, three, four, five, six, seven, eight, nine, or ten amino acid modifications (e.g., amino acid substitutions, amino acid deletions, and / or amino acid additions), provided that the alpha chain includes CDR-1, CDR-2, and CDR-3 amino acid sequences that are 100% identical to the corresponding alpha chain CDR-1, CDR-2, and CDR-3 sequences set forth in Table 1, and (c) can include a beta chain having the amino acid sequence set forth in SEQ ID NO: 22, 40, 58, 76, 94, and 112, respectively, with one, two, three, four, five, six, seven, eight, nine, or 10 amino acid modifications (e.g., amino acid substitutions, amino acid deletions, and / or amino acid additions), provided that the beta chain includes CDR-1, CDR-2, and CDR-3 amino acid sequences that are 100% identical to the corresponding beta chain CDR-1, CDR-2, and CDR- 3 sequences set forth in Table 1. As an example, a TCR or antigen binding fragment thereof provided herein having the ability to bind to a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule, can include an alpha chain having the amino acid sequence set forth in SEQ ID NO:32 with zero, one, two, three, four, five, six, seven, eight, nine, or ten amino acid modifications (e.g., amino acid substitutions, amino aciddeletions, and / or amino acid additions), provided that the alpha chain includes CDR-1, CDR- 2, and CDR-3 amino acid sequences as set forth in SEQ ID NOs:29, 30, and 31, respectively, and a beta chain having the amino acid sequence set forth in SEQ ID NO: 40, respectively, with one, two, three, four, five, six, seven, eight, nine, or 10 amino acid modifications (e.g., amino acid substitutions, amino acid deletions, and / or amino acid additions), provided that the beta chain includes CDR-1, CDR-2, and CDR-3 amino acid sequences as set forth in SEQ ID NOs:37, 38, and 39, respectively.

[0099] In some embodiments, a TCR or antigen-binding fragment thereof provided herein contains a Va or Vy region that contains:(a) a CDR-1, a CDR-2, and a CDR-3, comprising SEQ ID NOs: l l, 12, and 13, respectively;(b) a CDR-1, a CDR-2, and a CDR-3, comprising SEQ ID NOs:29, 30, and 31, respectively;(c) a CDR-1, a CDR-2, and a CDR-3, comprising SEQ ID NOs:47, 48, and 49, respectively;(d) a CDR-1, a CDR-2, and a CDR-3, comprising SEQ ID NOs:65, 66, and 67, respectively;(e) a CDR-1, a CDR-2, and a CDR-3, comprising SEQ ID NOs:83, 84, and 85 respectively; or(f) a CDR-1, a CDR-2, and a CDR-3, comprising SEQ ID NOs: 101, 102, and 103, respectively.Also among the provided TCRs are those having sequences at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences.

[0100] In some embodiments, a TCR or antigen-binding fragment thereof provided herein contains a VP or V5 region that contains:(a) a CDR-1, CDR-2, and CDR-3 comprising the SEQ ID NOs: 19, 20, and 21, respectively;(b) a CDR-1, a CDR-2, and a CDR-3, comprising SEQ ID NOs:37, 38, and 39, respectively;(c) a CDR-1, a CDR-2, and a CDR-3, comprising SEQ ID NOs:55, 56, and 57, respectively;(d) a CDR-1, a CDR-2, and a CDR-3, comprising SEQ ID NOs:73, 74, and 75, respectively;(e) a CDR-1, a CDR-2, and a CDR-3, comprising SEQ ID NOs:91, 92, and 93, respectively; or(f) a CDR-1, a CDR-2, and a CDR-3, comprising SEQ ID NOs: 109, 110, and 111, respectively.Also among the provided TCRs are those having sequences at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences.

[0101] In some embodiments, a TCR or antigen-binding fragment thereof provided herein includes a Va or Vy region that contains a CDR-1, a CDR-2, and a CDR-3, comprising a CDR- 1, a CDR-2, and a CDR-3 amino acid sequence, respectively, set forth in Table 1, such as in each row therein and a VP or V5 region that contains a CDR-1, a CDR-2, and a CDR-3, comprising a CDR-1, a CDR-2, and a CDR-3 amino acid sequence, respectively, set forth in Table 1, such as in each row therein. In some embodiments, a TCR or antigen-binding fragment thereof provided herein includes a Va or Vy region that contains a CDR-1, a CDR-2, and a CDR-3, comprising a CDR-1, a CDR-2, and a CDR-3 amino acid sequence, respectively, contained within a Va or Vy region amino acid sequence set forth in Table 1, such as in each row therein, and a VP or V5 region that contains a CDR-1, a CDR-2, and a CDR-3, comprising a CDR-1, a CDR-2, and a CDR-3 amino acid sequence, respectively, contained within a Va or Vy region amino acid sequence set forth in Table 1, such as in each row therein. In some embodiments, a TCR or antigen-binding fragment thereof provided herein includes a Va or Vy region amino acid sequence and a corresponding Va or Vy region amino acid sequence as set forth in Table 1, such as in each row therein. Also among the provided TCRs are those containing sequences at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences. Exemplary TCRs containing such CDRs, or their modified versions as described elsewhere herein, also are set forth in the Table 1, such as in each row therein.Table 1. SEQ ID NOs of Amino Acid Sequences of CDRs and Variable Regions of ACC-1Specific TCRs.

[0102] In some examples, a TCR or antigen binding fragment thereof provided herein can be designed to include an alpha chain (or gamma chain) that includes a set of three CDRs (e.g., a CDR-1, CDR-2, and CDR-3) as set forth in Table 1 (e.g., SEQ ID NOs: 11-13; SEQ ID NOs:29-31; SEQ ID NOs:47-49; SEQ ID NOs:65-67; SEQ ID NOs:83-85; or SEQ ID NOs: 101-103) and a beta chain (or delta chain) that includes a set of three CDRs (e.g., a CDR- 1, CDR-2, and CDR-3) as set forth in Table 1 (e.g., SEQ ID NOs: 19-21; SEQ ID NOs:37-39; SEQ ID NOs: 55-57; SEQ ID NOs:73-75; SEQ ID NOs:91-93; or SEQ ID NOs: 109-111).

[0103] In some embodiments, the Va region comprises a CDR-1 comprising SEQ ID NO: 11, a CDR-2 comprising SEQ ID NO: 12, and a CDR-3 comprising SEQ ID NO: 12, and the VP region comprises a CDR-1 comprising SEQ ID NO: 19, a CDR-2 comprising SEQ ID NO:20, and a CDR-3 comprising SEQ ID NO:21. In some embodiments, the Va region comprises a CDR-1 comprising SEQ ID NO:29, a CDR-2 comprising SEQ ID NO:30, and a CDR-3 comprising SEQ ID NO:31, and the VP region comprises a CDR-1 comprising SEQ ID NO:37, a CDR-2 comprising SEQ ID NO:38, and a CDR-3 comprising SEQ ID NO:39. In some embodiments, the Va region comprises a CDR-1 comprising SEQ ID NO:47, a CDR-2 comprising SEQ ID NO:48, and a CDR-3 comprising SEQ ID NO:49, and the VP region comprises a CDR-1 comprising SEQ ID NO: 55, a CDR-2 comprising SEQ ID NO: 56, and a CDR-3 comprising SEQ ID NO:57. In some embodiments, the Va region comprises a CDR-1 comprising SEQ ID NO:65, a CDR-2 comprising SEQ ID NO:66, and a CDR-3 comprising SEQ ID NO:67, and the VP region comprises a CDR-1 comprising SEQ ID NO:73, a CDR-2 comprising SEQ ID NO:74, and a CDR-3 comprising SEQ ID NO:75. In some embodiments, the Va region comprises a CDR-1 comprising SEQ ID NO:83, a CDR-2 comprising SEQ ID NO:84, and a CDR-3 comprising SEQ ID NO:85, and the VP region comprises a CDR-1 comprising SEQ ID NO:91, a CDR-2 comprising SEQ ID NO:92, and a CDR-3 comprising SEQ ID NO:93. In some embodiments, the Va region comprises a CDR-1 comprising SEQ ID NO: 101, a CDR-2 comprising SEQ ID NO: 102, and a CDR-3 comprising SEQ ID NO: 103, and the VP region comprises a CDR-1 comprising SEQ ID NO: 109, a CDR-2 comprising SEQ ID NO: 110, and a CDR-3 comprising SEQ ID NO: 111.

[0104] In some embodiments, the Va region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va region sequence of SEQ ID NO: 14, and the VP region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP region sequence of SEQ ID NO:22.In some embodiments, the Va region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va region sequence of SEQ ID NO:32, and the VP region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP region sequence of SEQ ID NO:40. In some embodiments, the Va region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va region sequence of SEQ ID NO:50, and the VP region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP region sequence of SEQ ID NO:58. In some embodiments, the Va region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va region sequence of SEQ ID NO:68, and the VP region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP region sequence of SEQ ID NO:76. In some embodiments, the Va region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va region sequence of SEQ ID NO:86, and the VP region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP region sequence of SEQ ID NO:94. In some embodiments, the Va region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va region sequence of SEQ ID NO: 104, and the VP region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP region sequence of SEQ ID NO: 112.

[0105] In some embodiments, the Va region comprises SEQ ID NO: 14 or a sequence that has at least 90% sequence identity thereto, and the VP region comprises SEQ ID NO:22 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the Va region comprises SEQ ID NO:32 or a sequence that has at least 90% sequence identity thereto, and the VP region comprises SEQ ID NO:40 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the Va region comprises SEQ ID NO:50 or a sequence that has at least 90% sequence identity thereto, and the VP region comprises SEQ ID NO:58 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the Va region comprises SEQ ID NO:68 or a sequence that has at least 90% sequence identity thereto, and the VP region comprises SEQ ID NO:76 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the Va region comprises SEQ ID NO: 86 or a sequence that has at least 90% sequence identity thereto, and the VP region comprises SEQ ID NO:94 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the Va region comprises SEQ ID NO: 104 or a sequence that has at least 90% sequence identity thereto, and the VP region comprises SEQ ID NO: 112 or a sequence that has at least 90% sequence identity thereto.

[0106] In some embodiments, the Va region comprises SEQ ID NO: 14, and the VP region comprises SEQ ID NO:22. In some embodiments, the Va region comprises SEQ ID NO:32,and the VP region comprises SEQ ID NO:40. In some embodiments, the Va region comprises SEQ ID NO:50, and the VP region comprises SEQ ID NO:58. In some embodiments, the Va region comprises SEQ ID NO:68, and the VP region comprises SEQ ID NO:76. In some embodiments, the Va region comprises SEQ ID NO:86, and the VP region comprises SEQ ID NO:94. In some embodiments, the Va region comprises SEQ ID NO: 104, and the VP region comprises SEQ ID NO: 112.D. Exemplary Constant Domains

[0107] In some embodiments, the alpha chain of a TCR or antigen-binding fragment thereof provided herein further contains an alpha constant (Ca) region or portion thereof. In some aspects, the beta chain further contains a beta constant (CP) region or portion thereof. Thus, in some embodiments, a TCR provided herein (e.g., an anti-ACC-1 TCR provided herein) or an antigen-binding fragment thereof contains an alpha chain comprising a Va region and a Ca domain or portion thereof and / or a beta chain comprising a VP region and a CP domain or portion thereof. In some embodiments, the gamma chain of a TCR or antigenbinding fragment thereof provided herein further contains a gamma constant (Cy) region or portion thereof. In some aspects, the delta chain further contains a delta constant (C5) region or portion thereof. Thus, in some embodiments, a TCR provided herein (e.g., an anti-ACC-1 TCR provided herein) or an antigen-binding fragment thereof contains a gamma chain comprising a Vy region and a Cy domain or portion thereof and / or a delta chain comprising a V5 region and a C5 domain or portion thereof.

[0108] In some embodiments, the a chain and the P chain, or the y chain and the 5 chain, of a TCR provided herein each further contain a constant domain. In some embodiments, the Ca domain and CP domain, or the Cy domain and C5 domain, individually are mammalian (e.g., a human or murine constant domain). In some embodiments, the constant domain is adjacent to the cell membrane. For example, in some cases, the extracellular portion of the TCR formed by the two chains contains two membrane-proximal constant domains, and two membrane-distal variable domains, which variable domains each contain CDRs.

[0109] In some aspects, provided herein are TCRs that contain a human constant domain, such as an alpha chain containing a human Ca domain and a beta chain containing a human CP domain, or a gamma chain containing a human Cy domain and a delta chain containing a human C5 domain. In some embodiments, the provided TCRs are fully human. Among the provided TCRs are TCRs containing a human constant domain, such as fully human TCRs, whose expression and / or activity, such as when expressed in human cells, e.g., human T cells, such asprimary human T cells, are not impacted by or are not substantially impacted by the presence of an endogenous human TCR.

[0110] In some embodiments, each of the Ca and the CP domains, or each of the Cy and the C5 domains, is human. In some embodiments, the Ca is encoded by the TRAC gene (IMGT nomenclature) or is a variant thereof. In some embodiments, the CP is encoded by TRBC1 or TRBC2 genes (IMGT nomenclature) or is a variant thereof. In some embodiments, the Cy is encoded by the TRGC1 or TRGC2 genes (IMGT nomenclature) or is a variant thereof. In some embodiments, the C5 is encoded by TRDC genes (IMGT nomenclature) or is a variant thereof.[OHl] In some embodiments, the Ca domain or a variant thereof has or comprises the sequence of amino acids set forth in SEQ ID NO:3 or 5, or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 3 or 5. In some embodiments, the Ca domain has or comprises the sequence of amino acids set forth in SEQ ID NO:3. In some embodiments, the Ca domain has or comprises the sequence of amino acids set forth in SEQ ID NO:5. In some embodiments, the CP domain or variant thereof has or comprises the sequence of amino acids set forth in SEQ ID NO: 7 or 9, or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 7 or 9. In some embodiments, the CP domain has or comprises the sequence of amino acids set forth in SEQ ID NO: 7. In some embodiments, the CP domain has or comprises the sequence of amino acids set forth in SEQ ID NO:9. In some embodiments, the TCR comprises a Ca domain and a CP domain set forth in SEQ ID NO:3 and 7, respectively. In some embodiments, the TCR comprises a Ca domain and a CP domain set forth in SEQ ID NO:5 and 7, respectively. In some embodiments, the TCR comprises a Ca domain and a CP domain set forth in SEQ ID NO:3 and 9, respectively. In some embodiments, the TCR comprises a Ca domain and a CP domain set forth in SEQ ID NO: 5 and 9, respectively.

[0112] In some embodiments, the Cy domain or a variant thereof has or comprises the sequence of amino acids set forth in SEQ ID NO: 131 or 132, or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 131 or 132. In some embodiments, the Cy domain has or comprises the sequence of amino acids set forth in SEQ ID NO: 131. In some embodiments, the Cy domain has or comprises the sequence of amino acids set forth in SEQ ID NO: 132. In some embodiments, the C5 domain or variant thereof has or comprises thesequence of amino acids set forth in SEQ ID NO: 132 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 132. In some embodiments, the TCR comprises a Cy domain and a C5 domain set forth in SEQ ID NO: 131 and 133, respectively. In some embodiments, the TCR comprises a Cy domain and a C5 domain set forth in SEQ ID NO: 132 and 133, respectively.

[0113] In some embodiments, the variant of a Ca domain contains replacement of at least one non-native cysteine, such as any replacement described herein. In some embodiments, the variant of a CP domain contains replacement of at least one non-native cysteine, such as any replacement described herein.

[0114] In some embodiments, any of the provided TCRs or antigen-binding fragments thereof can be a human / mouse chimeric TCR. In some cases, a TCR or antigen-binding fragment thereof provided herein comprises an alpha chain and / or a beta chain, or a gamma chain and / or a delta chain, comprising a mouse constant domain. In some embodiments, the Ca domain and / or the CP domain, or the Cy domain and / or the C5 domain, are a mouse Ca domain and / or a mouse CP domain, or a mouse Cy domain and / or a mouse C5 domain. In some embodiments, the Ca domain and / or the CP domain, or the Cy domain and / or the C5 domain, is or comprises any Ca domain and / or CP domain, or Cy domain and / or C5 domain described in WO2015 / 184228, WO2015 / 009604, or WO2015 / 009606.

[0115] In some embodiments, a TCR or antigen-binding fragment thereof provided herein comprises a variant of an alpha chain and / or a beta chain, or a gamma chain and / or a delta chain. In some embodiments, the variant comprises the amino acid sequence of any of the TCRs described herein with one, two, three, or four or more amino acid substitution(s) in the constant domain of the alpha or beta chain. In some embodiments, the TCRs (or functional portions thereof) comprising the substituted amino acid sequence(s) advantageously provide one or more of decreased mis-pairing with an endogenous TCR chain(s), increased expression by a host cell, increased recognition of ACC-1 targets, and increased anti-tumor activity as compared to the parent TCR comprising an unsubstituted amino acid sequence.

[0116] In some embodiments, the constant domain contains substituted amino acid sequences of the mouse constant domains of the TCR a and P chains, or TCR y and 5 chains corresponding with all or portions of the unsubstituted mouse Ca domain and mouse CP domain, or mouse Cy domain and mouse C5 domain. In some embodiments, the TCR may be a heterodimer of the a and P chains, or the y and 5 chains that are linked, such as by a disulfidebond or disulfide bonds. In some embodiments, the constant domain of the TCR may contain short connecting sequences in which a cysteine residue forms a disulfide bond, thereby linking the two chains of the TCR. In some embodiments, a TCR may have an additional cysteine residue in each of the a and P chains, or the y and 5 chains, such that the TCR contains two disulfide bonds in the constant domains. In some embodiments, each of the constant and variable domains contains disulfide bonds formed by cysteine residues.

[0117] In some embodiments, a TCR provided herein can contain an introduced disulfide bond or bonds. In some embodiments, the native disulfide bonds are not present. In some embodiments, the one or more of the native cysteines (e.g., in the constant domain of the a chain and the P chain, or the y chain and the 5 chain) that form a native interchain disulfide bond are substituted to another residue, such as to a serine or alanine. In some embodiments, an introduced disulfide bond can be formed by mutating non-cysteine residues on the alpha and beta chains, such as in the constant domain of the a chain and the P chain, or the y chain and the 5 chain, to cysteine. Opposing cysteines in the TCR a and P chains, or TCR y and 5 chains provide a disulfide bond that links the constant domains of TCR a and P chains, or TCR y and 5 chains of the substituted TCR to one another and which is not present in a TCR comprising the unsubstituted constant domain in which the native disulfide bonds are present, such as unsubstituted native human constant domain or the unsubstituted native mouse constant domain. In some embodiments, the presence of non-native cysteine residues (e.g., resulting in one or more non-native disulfide bonds) in a recombinant TCR can favor production of the desired recombinant TCR in a cell in which it is introduced over expression of a mismatched TCR pair containing a native TCR chain.

[0118] Exemplary non-native disulfide bonds of a TCR are described in published International PCT Patent Application Nos. W02006 / 000830 and W02006 / 037960. In some embodiments, cysteines can be introduced or substituted at a residue corresponding to Thr48 of the Ca domain and Ser57 of the CP domain, at residue Thr45 of the Ca domain and Ser77 of the CP domain, at residue TyrlO of the Ca domain and Seri 7 of the CP domain, at residue Thr45 of the Ca domain and Asp59 of the CP domain and / or at residue Seri 5 of the Ca domain and Glut 5 of the CP domain.

[0119] In some embodiments, any of the provided cysteine mutations can be made at a corresponding position in another sequence, for example, in a human or mouse Ca domain and / or CP domain, or Cy domain and / or C5 domain, sequence described above. The term “corresponding” with reference to positions of a protein, such as recitation that amino acidpositions “correspond to” amino acid positions in a disclosed sequence, such as set forth in the Sequence Listing, refers to amino acid positions identified upon alignment with the disclosed sequence based on structural sequence alignment or using a standard alignment algorithm, such as the GAP algorithm. For example, corresponding residues can be determined by alignment of a reference sequence with the Ca sequence set forth in any of SEQ ID NO:3 or 5, or the CP sequence set forth in SEQ ID NO: 7 or 9, by structural alignment methods as described herein. By aligning the sequences, one can identify corresponding residues, for example, using conserved and identical amino acid residues as guides.

[0120] In some embodiments, a TCR or antigen-binding fragment thereof provided herein comprises an alpha or gamma chain that is or comprises the sequence of amino acids set forth in any of SEQ ID NOs: 17, 35, 53, 71, 89, and 107, or a sequence that has at least 90% sequence identity thereto, such as a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such a sequence and / or a beta or delta chain that is or comprises the sequence of amino acids set forth in any of SEQ ID NO:25, 43, 61, 79, 97, and 115, or a sequence that has at least 90% sequence identity thereto, such as a sequence having at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with such a sequence.

[0121] Exemplary TCRs or antigen-binding fragments include those set forth in Table 2, such as in each row therein. In some embodiments, the Va and VP region, or the Vy and V5 region, contain the amino acid sequences corresponding to the SEQ ID NOs: set forth in Table 2, such as in each row therein. In some embodiments, the Va and VP region, or the Vy and V5 region, contain the CDR-1, the CDR-2 and the CDR-3 sequences contained within the Va and VP region, set forth in Table 2, such as in each row therein. In some aspects, the TCR contains constant alpha and constant beta domain sequences, such as those corresponding to the SEQ ID NOs: set forth in Table 2, such as in each row therein. In some cases, the TCR contains a full sequence comprising the variable and constant domains, such as a sequence corresponding to the SEQ ID NOs: set forth in Table 2 (“Full alpha-P2A-beta”), such as in each row therein. Each of the TCRs of Table 2 can also be provided in a beta-P2A-alpha format (z.e., wherein beta full chain amino acid sequence is at the amino terminal end followed by the P2A sequence and then the alpha full chain amino acid sequence; e.g., SEQ ID NO:314, 316, or318). Also among the provided TCRs are those containing sequences at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences. Exemplary TCRs containing such sequences, or their modified versions as described elsewhere herein, also areset forth in the Table 2, respectively, such as in each row therein. In some aspects, the provided exemplary TCRs, when expressed as a mature protein, comprises the mature Va and / or mature VP region, or the mature Vy and / or V5 mature region, for example, without the signal sequence (e.g., from cleavage of the signal sequence) when fully processed and expressed.Table 2: SEQ ID NOs of Amino Acid Sequences of Variable and Constant Regions of ACC- 1 Specific TCRs.*Altematively the sequence may also be constructed as beta-P2A-alpha.

[0122] In some embodiments, the alpha or gamma chain comprises SEQ ID NO: 17, or a sequence that has at least 90% sequence identity thereto, and the beta or delta chain comprises SEQ ID NO:25, or a sequence that has at least 90% sequence identity thereto. In some embodiments, the alpha or gamma chain comprises SEQ ID NO:35, or a sequence that has at least 90% sequence identity thereto, and the beta or delta chain comprises SEQ ID NO:43, or a sequence that has at least 90% sequence identity thereto. In some embodiments, the alpha or gamma chain comprises SEQ ID NO:53, or a sequence that has at least 90% sequence identity thereto, and the beta or delta chain comprises SEQ ID NO:61, or a sequence that has at least 90% sequence identity thereto. In some embodiments, the alpha or gamma chain comprises SEQ ID NO:71, or a sequence that has at least 90% sequence identity thereto, and the beta or delta chain comprises SEQ ID NO:79, or a sequence that has at least 90% sequence identity thereto. In some embodiments, the alpha or gamma chain comprises SEQ ID NO:89, or a sequence that has at least 90% sequence identity thereto, and the beta or delta chain comprises SEQ ID NO: 97, or a sequence that has at least 90% sequence identity thereto. In some embodiments, the alpha or gamma chain comprises SEQ ID NO: 107, or a sequence that has at least 90% sequence identity thereto, and the beta or delta chain comprises SEQ ID NO: 115, or a sequence that has at least 90% sequence identity thereto.

[0123] In some embodiments, the alpha or gamma chain comprises SEQ ID NO: 17, and the beta or delta chain comprises SEQ ID NO:25. In some embodiments, the alpha or gamma chain comprises SEQ ID NO:35, and the beta or delta chain comprises SEQ ID NO:43. In some embodiments, the alpha or gamma chain comprises SEQ ID NO:53, and the beta or delta chain comprises SEQ ID NO:61. In some embodiments, the alpha or gamma chain comprises SEQ ID NO:71, and the beta or delta chain comprises SEQ ID NO:79. In some embodiments, the alpha or gamma chain comprises SEQ ID NO:89, and the beta or delta chain comprises SEQ ID NO:97. In some embodiments, the alpha or gamma chain comprises SEQ ID NO: 107, and the beta or delta chain comprises SEQ ID NO: 115.

[0124] In some embodiments, the TCR comprises the amino acid sequence of any of SEQ ID NO: 27, 45, 63, 81, 99, and 117, or an amino acid sequence having at least 90% sequence identity to the amino acid sequence of any of SEQ ID NO: 27, 45, 63, 81, 99, and 117.E. anti-ACC-1 TCR single chain variable fragments

[0125] Any of the anti-ACC-1 TCRCDRs or variable regions described herein can be used in the formation of single chain variable fragments (scFv’s), bispecific T cell engagers (BiTEs), chimeric T cell receptors (CARs), or other proteins containing scFv’s, BiTEs or CARs.

[0126] An “scFv” is a fusion protein comprising a variable heavy chain region (VH) and a variable light chain region (VL) of an immunoglobulin or a variable alpha region (Va) and a variable beta region (VP) of a TCR connected with a short linker peptide. An scFv retains the antigen binding properties of the intact immunoglobulin or TCR from with the variable regions are derived. Nucleic acids encoding the anti-ACC-1 scFv’s are also contemplated.

[0127] In some embodiments, anti -ACC- 1 scFvs are described comprising a Va region and a VP region of any of the described ACC-1 TCRs, wherein the Va region and the VP region are linked via a linker peptide and wherein the anti -ACC- 1 scFv retains the antigen binding properties of the ACC-1 TCR from which the variable regions are derived. Nucleic acids encoding the anti-ACC-1 scFvs are also contemplated. An anti-ACC-1 scFv can be formed by linking the C terminus of the Va chain with the N terminus of the VP chain. Alternatively, the C terminus of the VP can be linked to the N-terminus of the Va chain. The peptide linker can be about 10 to about 25 amino acids. In some embodiments, the scFv peptide linker is rich in glycine. An scFv peptide linker can be, but is not limited to, (G4S)Xwhere x is an integer from 2 to 5 (inclusive). In some embodiments, the scFv peptide linked comprises Gly-Gly-Gly-Gly- Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Ser (i.e., also termed [(Gly)4Ser]3, (G4S)3 or G4S (x3)). In some embodiments, the scFv peptide linker consists of G4S (x3).

[0128] Bispecific T cell engagers (BiTEs) are recombinant molecules comprising two flexibly linked antigen binding domains, such as scFv’s. In a typical BiTE, one antigen binding domain of BiTE is specific for CD3 or other activating antigen on an immune cell, and the second antigen binding domain has affinity for a second antigen, such as a tumor antigen or antigen on a target cell. BiTEs can be used to target T cells, which contain a CD3 receptor with a target cell (as described in WO99054440, W02005040220, and W02008119567). BiTEs are capable of binding T cells transiently to target cells and, at the same time, activating the cytolytic activity of the T cells.

[0129] In some embodiments, anti-ACC-1 BiTE molecules are described comprising a first antigen binding domain (e.g., scFv) specific for an activating antigen on an immune cell and a second antigen binding domain comprising an ACC-1 binding domain or scFv comprising the variable regions or CDRs of any of the described TCRs. In some embodiments, a BiTE comprises an anti-CD3 scFv and an anti-ACC-1 scFv comprising the Va region and a VP region of any of the described ACC-1 TCRs. Nucleic acids encoding the anti-ACC-1 BiTEs are also contemplated.

[0130] A “chimeric antigen receptor” or “CAR” is a recombinant protein comprising an antigen-binding domain (e.g., an antigen-binding fragment of any of the described TCRs) linked to a cell signaling and / or cell activation domain via a transmembrane domain. The cellsignaling domain can be, but is not limited to, a T-cell signaling domain. When utilized in a CAR, the antigen-binding fragment of a described TCR can be provided as an scFv. The CAR can be a first generation CAR T cell, a second generation CAR T cell, a third generation CAR T cell, a fourth generation CAR T cell, dual-antigen receptor CAR T cell, or a CAR T cell having an inducible suicide gene, or a combination thereof. The CAR can have a single signaling and / or cell activation domain, multiple signaling and / or cell activation domains, or one or more signaling and / or cell activation domains and one or more co- stimulation domains. The signaling and / or cell activation domain or co-stimulation domains can be, but are not limited to, CD3zeta domain, CD28 domain, a CD 137 domain, an ICOS domain, a CD27 domain, an 0X40 domain, a LFA1 domain, a PD-1 domain, a CD150 domain, a CD244 domain, a NKG2D domain, and A DAP 10 domain.

[0131] In some embodiments, anti -ACC- 1 CARs are described comprising an antigen binding fragment of any of the described ACC-1 TCRs or an scFv comprising the variable regions or CDRs of any of the described TCRs, a transmembrane domain, and a signaling and / or cell activation domain. In some embodiments, the antigen binding fragment of any ofthe described ACC-1 TCRs comprises an anti -ACC- 1 scFv, wherein the anti ACC-1 scFv comprises a Va region and a VP region of any of the described ACC-1 TCRs. The anti-ACC- 1 CAR can be, but is not limited to a first generation CAR T cell, a second generation CAR T cell, a third generation CAR T cell, a fourth generation CAR T cell, dual -antigen receptor CAR T cell, or a CAR T cell having an inducible suicide gene, or a combination thereof. Nucleic acids encoding the anti-ACC-1 CARs are also contemplated.II. NUCLEIC ACIDS ENCODING TCRs

[0132] Also provided herein are nucleic acids, such as polynucleotides or nucleic acid molecules, encoding any of the provided TCRs or antigen-binding fragments thereof. The nucleic acids may include those encompassing natural and / or non-naturally occurring nucleotides and bases, e.g., including those with backbone modifications. The terms “nucleic acid molecule,” “nucleic acid,” and “polynucleotide” may be used interchangeably, and refer to a polymer of nucleotides. Such polymers of nucleotides may contain natural and / or nonnatural nucleotides, and include, but are not limited to, DNA, RNA, and PNA. “Nucleic acid sequence” refers to the linear sequence of nucleotides that comprise the nucleic acid molecule or polynucleotide.

[0133] In some embodiments, a TCR or antigen binding portion thereof provided herein may be a recombinantly produced natural protein or mutated form thereof in which one or more properties, such as a binding characteristic, has been altered. In some aspects, the nucleic acid is synthetic. In some cases, the nucleic acid is or contains cDNA. In some aspects, the polynucleotide can be modified for use in a construct described herein, such as for codon optimization. In some cases, the sequences can be designed to contain terminal restriction site sequences for purposes of cloning into vectors.

[0134] In some embodiments, a TCR or antigen-binding portion thereof provided herein can be synthetically generated from knowledge of the sequence of the TCR.

[0135] In some embodiments, the polynucleotide contains a nucleic acid sequence encoding an alpha chain and / or a nucleotide sequence encoding a beta chain. In some embodiments, the polynucleotide contains a nucleic acid sequence encoding a gamma chain and / or a nucleotide sequence encoding a delta chain.

[0136] In some embodiments, the nucleotide sequence encoding the alpha or gamma chain and / or the nucleotide sequence encoding the beta or delta chain, or any domains, regions, or portion thereof, is codon-optimized. Typically, codon optimization involves balancing the percentages of codons selected with the published abundance of human transfer RNAs so thatnone is overloaded or limiting. Most amino acids are encoded by more than one codon, and codon usage varies from organism to organism. Differences in codon usage between transfected genes and host cells can have effects on protein expression and immunogenicity of a nucleic acid construct. In general, for codon optimization, codons are chosen to select for those codons that are in balance with human usage frequency. Typically, the redundancy of the codons for amino acids is such that different codons code for one amino acid. In some embodiments, in selecting a codon for replacement, it may be desired that the resulting mutation is a silent mutation such that the codon change does not affect the amino acid sequence. Generally, the last nucleotide of the codon can be changed without affecting the amino acid sequence.

[0137] In some embodiments, the nucleotide sequence encoding the Va region comprises SEQ ID NO: 15 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP region comprises SEQ ID NO:23 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the nucleotide sequence encoding the Va region comprises SEQ ID NO:33 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP region comprises SEQ ID NO:41 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the nucleotide sequence encoding the Va region comprises SEQ ID NO:51 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP region comprises SEQ ID NO:59 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the nucleotide sequence encoding the Va region comprises SEQ ID NO:69 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP region comprises SEQ ID NO:77 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the nucleotide sequence encoding the Va region comprises SEQ ID NO:87 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP region comprises SEQ ID NO:95 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the nucleotide sequence encoding the Va region comprises SEQ ID NO: 105 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP region comprises SEQ ID NO: 113 or a sequence that has at least 90% sequence identity thereto.

[0138] In some embodiments, the nucleotide sequence encoding the Va region comprises SEQ ID NO: 16 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP region comprises SEQ ID NO:24 or a sequence that has at least 90%sequence identity thereto. In some embodiments, the nucleotide sequence encoding the Va region comprises SEQ ID NO:34 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP region comprises SEQ ID NO:42 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the nucleotide sequence encoding the Va region comprises SEQ ID NO:52 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP region comprises SEQ ID NO:60 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the nucleotide sequence encoding the Va region comprises SEQ ID NO:70 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP region comprises SEQ ID NO:78 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the nucleotide sequence encoding the Va region comprises SEQ ID NO:88 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP region comprises SEQ ID NO:96 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the nucleotide sequence encoding the Va region comprises SEQ ID NO: 106 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP region comprises SEQ ID NO: 114 or a sequence that has at least 90% sequence identity thereto.

[0139] In some embodiments, the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 18 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:26 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:36 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:44 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 54 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:62 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:72 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO: 80 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NOVO or a sequence that has at least 90% sequence identity thereto, and the nucleotidesequence encoding the beta or delta chain comprises SEQ ID NO:98 or a sequence that has at least 90% sequence identity thereto. In some embodiments, the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 108 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO: 116 or a sequence that has at least 90% sequence identity thereto.

[0140] In some embodiments, the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 18, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:26. In some embodiments, the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:36, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:44. In some embodiments, the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:54, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:62. In some embodiments, the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:72, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:80. In some embodiments, the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 90, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO: 98. In some embodiments, the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 108, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO: 116..

[0141] In some embodiments, the nucleic acid sequence encoding the alpha or gamma chain comprises any of: SEQ ID NO: 15, 33, 51, 69, 87, and 105, a degenerate sequence thereof, or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto. In some aspects, the nucleotide sequence encoding the beta or delta chain comprises any of: SEQ ID NO: 23, 41, 59, 77, 95, and 113, a degenerate sequence thereof, or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto.

[0142] In some embodiments, the alpha or gamma chain and / or beta or delta chain of the TCR is encoded by a sequence of nucleotides comprising a signal peptide (also called a leader sequence). Non-limiting examples of such a signal peptide are signal peptides that have or comprise the sequence of amino acids set forth in any of SEQ ID NOs: 119-128.

[0143] In some embodiments, the nucleic acid encoding the alpha or gamma chain and the nucleic acid encoding the beta or delta chain can be connected via a linker, such as any described elsewhere herein.

[0144] In some embodiments, the nucleic acid encoding the alpha or gamma chain and the nucleic acid encoding the beta or delta chain can be connected via a cleavable linker sequence or a peptide that causes ribosome skipping (e.g., T2A or P2A), such as any described elsewhere herein. The P2A amino acid sequence can be, but is not limited to, the sequence of SEQ ID NO: 129. The nucleic acid sequence encoding the P2A sequence can be, but is not limited to, the nucleic acid sequence of SEQ ID NO: 130, a nucleic acid sequence encoding a P2A peptide that is at least 90% identical to the amino acid sequence of SEQ ID NO: 129, or a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 129.

[0145] In some embodiments, the nucleic acid sequence encoding the alpha and beta TCR chains connected via a cleavable linker sequence comprises: a nucleotide sequence of any of SEQ ID NO:28, 46, 64, 82, 100, 118; a nucleotide sequence having at least 90% identify to the nucleic acid sequence of any of SEQ ID NO:28, 46, 64, 82, 100, 118; a nucleotide sequence encoding a polypeptide having the amino acid sequence of any of SEQ ID NO: 27, 45, 63, 81, 99, 117; or a nucleotide sequence encoding a polypeptide having at least 90% identity to the amino acid sequence of any of SEQ ID NO:27, 45, 63, 81, 99, 117.

[0146] Also provided herein are vectors or constructs containing such nucleotide sequences. In some embodiments, the vectors or constructs contain one or more heterologous promoters operatively linked to the nucleotide encoding the alpha or gamma chain and / or the beta or delta chain. In some embodiments, the heterologous promoter is operatively linked to one or more than one nucleotide sequence.

[0147] In some embodiments, the vector or construct can contain a single heterologous promoter that drives the expression of one or more nucleotide sequences. In some embodiments, such promoters can be multi ci stronic (e.g., bicistronic or tricistronic, see e.g., U.S. Patent No. 6,060,273). For example, in some embodiments, transcription units can be engineered as a bicistronic unit containing an IRES (internal ribosome entry site), which allows coexpression of gene products (e.g., encoding an alpha or gamma chain and / or a beta or delta chain of a TCR) by a message from a single promoter. Alternatively, in some cases, a single promoter may direct expression of an RNA that contains, in a single open reading frame (ORF), two or three genes (e.g., encoding an alpha or gamma chain and / or a beta or delta chain of a TCR) separated from one another by sequences encoding a self-cleavage peptide (e.g., a 2 A peptide, e.g., a P2A peptide) or a protease recognition site (e.g., furin). An ORF can encode a single polyprotein, which, either during (in the case of 2A e.g., P2A) or after translation, is cleaved into the individual proteins. In some cases, the peptide, such as P2A, can cause theribosome to skip (ribosome skipping) synthesis of a peptide bond at the C-terminus of a 2A element, leading to separation between the end of the 2A sequence and the next peptide downstream (see, for example, de Felipe. Genetic Vaccines and Ther. 2: 13 (2004) and deFelipe et al. Traffic 5:616-626 (2004)). Examples of 2A cleavage peptides, including those that can induce ribosome skipping, include Thosea asigna virus (T2A), porcine teschovirus-1 (P2A, e.g., SEQ ID NO: 129), equine rhinitis A virus (E2A), and 2A sequences from the foot-and- mouth disease virus (F2A) as described in U.S. Patent Publication No. 2007 / 0116690. In some embodiments, the peptide that causes ribosome skipping is a P2A peptide and / or contains the sequence of amino acids set forth in SEQ ID NO: 129.

[0148] In a bicistronic vector, a nucleic acid sequence encoding the alpha or gamma chain and a nucleotide sequence encoding the beta or delta chain can be present in any order and are separated by a nucleotide sequence encoding a self-cleaving peptide or a peptide sequence that causes ribosome skipping (e.g., a P2A sequence). For example, in some embodiments, the nucleotide sequence comprises, in order, a nucleic acid sequence encoding a beta or delta chain, a nucleic acid sequence encoding a self-cleaving peptide or a peptide sequence that causes ribosome skipping (e.g., a P2A sequence as described herein), and a nucleic acid sequence that encodes an alpha or gamma chain. In other embodiments, the nucleotide sequence contains, in order, a nucleic acid sequence that encodes an alpha or gamma chain, a nucleic acid sequence that encodes a self-cleaving peptide or a peptide sequence that causes ribosome skipping (e.g., a P2A sequence as described herein), and a nucleic acid sequence that encodes a beta or delta chain.

[0149] In some embodiments, the nucleotide sequence encoding an alpha or gamma chain and / or a beta or delta chain of a TCR comprises a nucleic acid sequence corresponding to a SEQ ID NO: set forth in Table 3. Also among the provided nucleotide sequences encoding a TCR are those containing sequences at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to such sequences. Also provided are any of the mature TCR alpha or gamma chains encoded by any of the sequences set forth in Table 3, such as in each row therein. Also provided are any of the mature TCR beta or delta chains encoded by any of the sequences set forth in Table 3, such as in each row therein. Also provided are any of the mature TCR alpha and beta chains, or mature gamma and delta chains, encoded by any of the sequences set forth in Table 3, such as in each row therein. In some aspects, the nucleotide sequences contain sequences encoding a signal sequence, and the encoded exemplary TCRs, when expressed as a mature protein, comprise the mature Va and / or mature VP region, or themature Vy and / or V5 mature region, for example, without the signal sequence (e.g., from cleavage of the signal sequence) when fully processed and expressed.

[0150] In some embodiments, the nucleotide sequence encodes a polypeptide containing an amino acid sequence set forth in Table 3, such as in each row therein, or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the nucleotide sequence encodes a mature polypeptide set forth herein, for example, in Table 3, such as in each row therein, or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. SEQ ID NOs: 28, 46, 64, 82, 100, and 118 encode, in order, an alpha chain, a P2A peptide, and a beta chain. In some embodiments, the nucleic acid sequence encodes, in order, a beta chain, a P2A peptide, and an alpha chain (e.g., SEQ ID NO:314, 316, or 318).Table 3: SEQ ID NOs of Nucleotide Sequences of ACC-1 Specific TCRs.*Altematively the sequence may also be constructed as beta-P2A-alpha

[0151] Also provided herein are vectors, such as those containing any of the nucleic acids described herein. In some embodiments, nucleic acid or nucleic acids encoding one or both chains of a TCR, are cloned or assembled into a suitable expression vector or vectors. The expression vector can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host. Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses. In some embodiments, the vector is an expression vector.III. METHODS FOR ISOLATING, ASSESSING, AND IDENTIFYING T CELL RECEPTORS

[0152] In some aspects, provided herein are methods for isolating a plurality of nucleic acid sequences encoding the provided TCRs specific for minor histocompatibility antigenACC-1. In some aspects, the provided ACC-1 specific TCRs are identified based on the methods described herein. In some aspects, the methods also include isolating nucleic acid sequences, assembling the nucleic acid sequences into vectors, assessing the expression and / or activity of the TCRs, and screening and identifying particular TCRs of interest, in some cases, using a high-throughput method.

[0153] The methods described herein also relate to determining the binding activity and functional capacity of candidate TCRs.A. TCR Donor criteria and methods for isolating miHA-specific T cell candidates

[0154] In some embodiments, whole exome sequencing is used to type donors for their HLA repertoire and / or haplotype and for polymorphisms that encode the miHA ACC-1 antigen or a nonimmunogenic variant thereof. In some embodiments, the donor subject is a healthy donor. In some embodiments, the donor subject has cancer. In some embodiments, the donor subject is a recovered cancer patient. In some embodiments, the donor subject has or had cancer of a type that is to be treated with the engineered T cells. Those subjects with an appropriate HLA type are selected for blood collection. Anti-ACC-1 reactive T cells from the donor subject(s) are identified on the basis of their binding an HLA-multimer folded with the antigenic ACC-1 peptide. These cells are single cell sorted and their TCRs are screened for anti-ACC-1 reactivity. In some embodiments, the donor is ACC-1 (Y peptide) and HLA- A*24:02+.B. High-Throughput Isolation, Amplification and Assembly of Nucleic AcidSequences Encoding TCRs

[0155] In some aspects, nucleic acid molecules encoding a TCR can be obtained or identified from a variety of sources. In some aspects, TCRs can be obtained or identified using a high-throughput TCR isolation and screening method. Examples of such methods that can be used include those described in, for example, WO2018 / 102473, which is incorporated by reference in its entirety. In some aspects, the high-throughput TCR isolation and screening methods involve the amplification of nucleic acids encoding TCR alpha and / or beta chains, or TCR gamma and / or delta chains, from a plurality of different cells, such as T cells, isolated from a donor. Also provided herein are such methods related to isolating or screening a plurality of different TCRs to obtain TCRs that are specific for a relatively hematopoietically restricted minor histocompatibility antigen, such as an ACC-1 peptide.

[0156] In some embodiments, nucleic acid molecules encoding a TCR can be obtained from a variety of sources, such as by polymerase chain reaction (PCR) amplification ofencoding nucleic acids within or isolated from a given cell or cells. In some embodiments, a TCR is obtained from a biological source, such as from cells such as from T cells (e.g., cytotoxic T cells), T cell hybridomas, or other publicly available sources. In some embodiments, a TCR may be derived from one of various animal species, such as a human, mouse, rat, or other mammal. In some embodiments, the T cells can be obtained from in vivo isolated cells, such as from normal (or healthy) subjects or diseased subjects, including T cells present in peripheral blood mononuclear cells (PBMCs) or tumor-infiltrating lymphocytes (TILs). In some embodiments, the T cells can be a cultured T cell hybridoma or clone. For example, in some embodiments, to generate a vector encoding a TCR, the a and P chains can be PCR amplified from total cDNA isolated from a T cell clone expressing the TCR of interest and cloned into an expression vector. In some embodiments, the a and P chains can be synthetically generated. In some embodiments, the a and P chains are cloned into the same vector.

[0157] As described herein, the methods and materials provided herein can allow users to capture successfully most, if not all, functional TCRs from a sorted T cell population. For example, an amplification (e.g., nested amplification procedure such as a nested PCR) procedure can include using primer collections designed to amplify every known functional V segment of the two variable chains of a particular TCR (e.g., any of the known functional V segments of the a variable and P variable chains of a particular aP TCR or any of the known functional V segments of the y variable and 5 variable chains of a particular y5 TCR) of a mammal (e.g., a human). For humans, an amplification procedure can include a primer collection designed to amplify all 45 V segments of the a chain currently known to be functional and all 48 V segments of the P chain currently known to be functional. When referring to TCR V segments of the a chain herein, the shorthand abbreviation TRAV can be used. Likewise, when referring to TCR V segments of the P chain herein, the shorthand abbreviation TRBV can be used. The same is true for TCR V segments of the y and 5 chains, which can be referred to as TRGV and TRDV, respectively.

[0158] In some aspects, this document provides methods and materials involved in cloning functional TCRs from single T cells. For example, in some aspects, this document provides methods and materials for obtaining nucleic acid encoding a TCR from a single T cell and arranging that nucleic acid to form nucleic acid vectors successfully designed to express a TCR (e.g., a fully intact TCR such as a fully intact TCR having the variable chain combination as present in that single T cell), kits for obtaining nucleic acid encoding a TCR from a single Tcell and arranging that nucleic acid to form nucleic acid vectors successfully designed to express a TCR (e.g., a fully intact TCR such as a fully intact TCR having the variable chain combination as present in that single T cell), and methods for making such kits. A cloned aP TCR having the variable chain combination as present in a single T cell used to clone that TCR can include the VJ a segment combination as present in that single T cell, the VDJ p segment combination as present in that single T cell, the nucleotide sequence of the entire a variable region as present in that single T cell, and the nucleotide sequence of the entire P variable region as present in that single T cell. Likewise, a cloned y5 TCR having the variable chain combination as present in a single T cell used to clone that TCR can include the VJ y segment combination as present in that single T cell, the VDJ 5 segment combination as present in that single T cell, the nucleotide sequence of the entire y variable region as present in that single T cell, and the nucleotide sequence of the entire 5 variable region as present in that single T cell.

[0159] In some aspects, this document provides collections of nucleic acid primers designed to amplify the entire coding sequence of both variable regions (e.g., the a variable region and P variable region, or the y variable region and 5 variable region) for each expressed V segment (e.g., each expressed a V segment and P V segment, or each expressed y V segment and 5 V segment) for functional aP or y5 TCRs of a particular mammalian species (e.g., a mouse or a human), methods for using such collections of nucleic acid primers to clone functional TCRs from single T cells, and kits containing such collections of nucleic acid primers to clone functional TCRs from single T cells.

[0160] In some aspects, the methods and materials provided herein can allow one to perform highly multiplexed reactions to clone many different TCRs (e.g., hundreds to thousands or more different TCRs) directly from single T cells quickly (e.g., simultaneously in some cases) and in a manner that misses few, if any, a / p variable chain combinations (or y / 5 variable chain combinations). For example, the methods and materials provided herein can be performed to clone many different aP TCRs (e.g., hundreds to thousands or more different aP TCRs) directly from single aP T cells in a manner that misses less than 10 percent (e.g., less than 9 percent, less than 8 percent, less than 7 percent, less than 6 percent, less than 5 percent, less than 4 percent, less than 3 percent, less than 2 percent, or less than 1 percent) of the a variable chains and less than 10 percent (e.g., less than 9 percent, less than 8 percent, less than 7 percent, less than 6 percent, less than 5 percent, less than 4 percent, less than 3 percent, less than 2 percent, or less than 1 percent) of the P variable chains possible for a / p variable chain combinations of a species (e.g., mice or human species). Likewise, the methods and materialsprovided herein can be performed to clone many different y5 TCRs (e.g., hundreds to thousands or more different y5 TCRs) directly from single y5 T cells in a manner that misses less than 10 percent (e.g., less than 9 percent, less than 8 percent, less than 7 percent, less than 6 percent, less than 5 percent, less than 4 percent, less than 3 percent, less than 2 percent, or less than 1 percent) of the y variable chains and less than 10 percent (e.g., less than 9 percent, less than 8 percent, less than 7 percent, less than 6 percent, less than 5 percent, less than 4 percent, less than 3 percent, less than 2 percent, or less than 1 percent) of the 5 variable chains possible for y / 5 variable chain combinations of a species (e.g., mice or human species). In some cases, the methods and materials provided herein can include (a) obtaining a sample of T cells, (b) sorting those T cells into isolated locations (e.g., wells) such that most, if not all, isolated locations (e.g., each well) contain a single T cell, (c) lysing (e.g., simultaneously lysing) the single T cells located in separate isolated locations (e.g., separate wells) to release the RNA of each single T cell, (d) performing (e.g., simultaneously performing) reverse transcription using the released RNA as template, appropriate primers for cDNA synthesis from RNA, and a reverse transcriptase enzyme to produce cDNA within each isolated location (e.g., each well); that cDNA representing the RNA expressed by the single T cell that was located in that isolated location (e.g., well), (e) performing (e.g., simultaneously performing), for each isolated location, a first round amplification reaction (e.g., a first round polymerase chain reaction (PCR)) of an amplification procedure (e.g., such as a nested amplification procedure such as a nested PCR) using the produced cDNA as template, a first round primer collection (e.g., a first round PCR primer collection), and a polymerase (e.g., Taq polymerase) to produce at least an amplification product containing a nucleic acid sequence of the a variable chain (or y variable chain) of the TCR of the single T cell of that isolated location and an amplification product containing a nucleic acid sequence of the P variable chain (or 5 variable chain) of the TCR of that same single T cell of that same isolated location, (f) performing (e.g., simultaneously performing), for each isolated location, a second round amplification reaction (e.g., a second round PCR) of a nested amplification procedure (e.g., a nested PCR procedure) using the amplification products of the first round amplification reaction as template, a second round primer collection (e.g., a second round PCR primer collection), and a polymerase (e.g., Taq polymerase) to produce at least a first amplification product containing a nucleic acid sequence of the a variable chain (or y variable chain) of the TCR of the single T cell of that isolated location and a second amplification product containing a nucleic acid sequence of the P variable chain (or 5 variable chain) of the TCR of that same single T cell of that same isolated location,and (g) cloning, for each isolated location, the first and second amplification products into an expression vector designed to express a functional TCR having the a / p or y / 8 variable chain combination (or a portion thereof such as the V segments of the a / p or y / 8 variable chain combination) as was present in the single T cell used to generate the amplification products.

[0161] The resulting expression vectors can be introduced into cells such that those cells express the cloned TCRs. Such cells and / or the TCRs they express from the introduced expression vectors can be screened to identify TCRs with desired capabilities. For example, cells expressing cloned TCRs that recognize particular antigens (e.g., peptides derived from tumor polypeptides) can be identified, and those cells, the TCR expression vectors they contain, or the cloned TCR constructs can be used for further analysis or for therapeutic applications.

[0162] In some cases, expression of cloned TCRs on the surface and expression of functional TCRs can be assessed by introducing the expression vectors into TCR-negative reporter cells designed to express a measurable marker signal or marker polypeptide once the signaling apparatus of a functional TCR is engaged. In these cases, an antibody designed to non-specifically activate TCRs (e.g. , an anti-CD3 antibody) can be used to screen for functional TCRs. In some cases, the cloned TCRs can be screened for antigen specificity. For example, reporter cells expressing cloned TCRs can be screened for the recognition of particular antigens (e.g., peptides derived from tumor polypeptides). In some cases, primary T cells (e.g., human primary T cells) can be transfected with expression vectors and screened for antigen specificity via T cell proliferation assays.

[0163] The methods and materials provided herein can allow clinicians, medical professionals, laboratory personnel, and researchers to use a collection of T cells having different TCRs to generate collections of expression vectors that express functional versions of those different TCRs that have the same variable chain combinations or portions thereof (e.g., the same a / p variable chain combination or the same y / 5 variable chain combination) as present in original T cells used to generate the collection. Such collections of expression vectors can be obtained quickly, efficiently, inexpensively, and effectively. For example, in some cases, using the methods and materials provided herein, a collection of expression vectors that express functional versions of many different TCRs with authentic variable chain combinations as found in T cells obtained from a mammal (e.g., a human) can be generated within less than 12 days (e.g., from 4 to 11 days, from 5 to 11 days, from 6 to 11 days, from 7 to 11 days, from 8 to 11 days, from 4 to 10 days, from 5 to 10 days, from 6 to 10 days, from 7 to 10 days, from 8 to 10 days, from 4 to 9 days, from 5 to 9 days, from 6 to 9 days, from 7 to 9 days, from 4 to 8days, from 5 to 8 days, from 6 to 8 days, or from 7 to 8 days), using less than 12 steps (e.g., from 5 to 11 steps, from 6 to 11 steps, from 7 to 11 steps, from 8 to 11 steps, from 5 to 10 steps, from 6 to 10 steps, from 7 to 10 steps, from 8 to 10 steps, from 5 to 9 steps, from 6 to 9 steps, from 7 to 9 steps, or from 8 to 9 steps), for less than about 10 dollars per TCR, and with greater than about 80 percent (e.g., greater than about 85, 90, or 95 percent) effectiveness (based on sorting a single T cell into each of 384 wells of 384-well plate). In some cases, the methods and materials provided herein can be performed without performing nucleic acid sequencing, without performing restriction endonuclease cleavage steps, without performing other steps or techniques as described herein, and / or without using particular reagents or materials as described herein.

[0164] The methods and materials provided herein also can allow users to capture successfully most, if not all, functional TCRs from a sorted T cell population. For example, in some cases, the methods and materials provided herein can include a nested amplification procedure (e.g., a nested PCR procedure) that includes primer collections designed to amplify every known functional V segment of the two variable chains of a particular TCR (e.g., any of the known functional V segments of the a variable and P variable chains of a particular aP TCR or any of the known functional V segments of the y variable and 5 variable chains of a particular y5 TCR) of a mammal (e.g., a human). Having the ability to clone most, if not all, functional TCRs from a sorted T cell population can allow users to identify particular TCRs, including rare TCRs, that might otherwise be missed. It is these rare TCRs that might be missed that could provide a rich source of new cloned TCRs for effective therapies such as cancer therapies involving the delivery of effective T cells.

[0165] In some cases, the methods and materials provided herein can allow users to obtain additional information about the single T cells from which functional TCR clones are generated. In some cases, the flow cytometry techniques used for single cell sorting described herein can be used to distinguish activated and experienced cells from naive T cells by staining those cells for activation markers. When applying the methods and materials provided herein in methods for treating a particular disease (e.g., cancer), T cells can be isolated from a patient that have already been activated and expanded within that patient. Once these T cells are isolated, and cDNA is generated from single cell RNA, an additional level of selection can be applied. For example, in addition to using cDNA produced from the RNA of a single T cell to amplify and clone the variable chains (or portions thereof) of that T cell’s TCR, that cDNA also can be used to assess RNA expression and / or RNA expression levels within that T cell.

[0166] In the case of CD8+T cells, TCRs associated with polyfunctional (e.g., multicytokine producers) effector cells or TCRs associated with quiescent or exhausted long-lived memory cells can be identified by examining the relative mRNA levels for expression of transcription factors such as Eomesodermin and T-bet (McLane et al., J. Immunol., 190(7):3207-3215 (2013); and Buggert etal., PLoS Pathog., 10(7):el 004251 (2014)).

[0167] In some cases, T cells can be stimulated (e.g., in vitro stimulated) prior to sorting, and then RNA expression can be assessed (via, e.g., qPCR) to determine which T cells responded to the stimulation. Any appropriate type of stimulation can be used including, without limitation, non-specific stimulation such as stimulation with concanavalin A, phytohemagglutinin-P, phorbol esters plus ionomycin, phorbol myristate acetate plus calcium ionophores, or antibodies having the ability to cross link TCRs (e.g., anti-CD3 antibodies plus anti-CD28 antibodies, or anti-TCR P antibodies) or antigen-specific stimulation such as stimulation with one or more particular antigens as described elsewhere (Downward et al., Nature, 346:719-23 (1990); and Dasgupta et al., Proc. Natl. Acad. Sci. USA, 84: 1094-8 (1987)). In some cases, cytokine expression levels such as TNF-a, IFN-y, IL-2, IL-4, IL-5, IL- 10, IL-13, or IL-17 expression levels can be determined and compared to non-stimulated populations. Once single T cells are sorted, the methods provided herein can be used to determine which T cells were making particular cytokines in response to the stimulation (e.g., in response to a peptide antigen used to stimulate the T cells). In these cases, antigen specific T cells can be determined without laborious methods of expanding reactive T cells or the destructive methods of paraformaldehyde fixation and intracellular cytokine staining, which can reduce the ability to clone TCRs effectively. In such cases, particular TCRs generated from active and antigen specific T cells, as opposed to inactive bystander T cells, can be quickly identified.

[0168] In some cases, cytokine expression levels such as TNF-a, IFN-y, IL-2, IL-4, IL-5, IL-10, IL-13, or IL-17 expression levels can be determined for the single T cells used to clone functional TCRs, thereby allowing a particular TCR to be identified based on the particular phenotype (e.g., elevated IFN-y expression) of the T cell that provided the variable chains (or portions thereof) of that particular TCR. In such cases, particular TCRs generated from active, as opposed to inactive, T cells can be quickly identified. In some cases, particular TCRs generated from inactive, as opposed to active, T cells can be quickly identified.

[0169] In some cases, the absence of cytokine production by a T cell does not necessarily reflect an absence of TCR specificity. TCR initiated signals to a cell can be subverted and / orrepressed by numerous inhibitory co-receptors (Sheppard et al., FEBS Lett., 574(l-3):37-41 (2004); and Yokosuka et al., J. Exp. Med., 209(6): 1201-1217 (2012)). In some cases, TCRs can be obtained using T cells refractory to stimulation, and the specificity of the cloned TCR can be tested or screened in cells where canonical TCR signaling is not repressed.

[0170] In some cases, a MHC -peptide complex (or an HLA-peptide complex) can be used to identify cloned TCRs that recognize such a complex. In these cases, it is possible that clonal exclusion during an immune response and / or a lack of antigen priming may result in TCRs with this specificity not being present in the activated and / or expanded TCR pool. In such cases, the methods and materials provided herein, which in some cases only requires a single T cell to be present, can be used to clone a naive or inactivated TCR that recognizes such a complex. In some cases, pools of naive T cells can be stained with MHC-peptide tetramers (or HLA- peptide tetramers), and any MHC-peptide (or HLA-peptide) responsive TCRs among the naive T cells can be used to clone those TCRs using the methods and materials provided herein.

[0171] In some aspects, the methods provided herein include methods for obtaining a plurality of nucleic acid vectors containing nucleic acid encoding functional T cell receptors. The method comprises, or consists essentially of, (a) obtaining a device comprising a plurality of separate locations, wherein each of the separate locations contains cDNA generated from RNA obtained from a single T cell that was sorted into the separate locations, (b) performing a nested amplification procedure using the cDNA of each of the plurality of separate locations as template to obtain a first amplification product and a second amplification product for the cDNA of each of the plurality of separate locations, wherein the first amplification product comprises nucleic acid encoding a Va or Vy segment, and wherein the second amplification product comprises nucleic acid encoding a VP or V5 segment, and (c) assembling the first amplification product and the second amplification product for the cDNA of each of the plurality of separate locations into a nucleic acid vector to obtain an assembled nucleic acid vector for the cDNA of each of the plurality of separate locations, wherein the assembled nucleic acid vectors for the cDNA of each of the plurality of separate locations comprises nucleic acid encoding a functional T cell receptor. The plurality can be greater than 50. The plurality can be greater than 500. The plurality can be greater than 5000. The plurality of nucleic acid vectors can be a plurality of nucleic acid expression vectors. The device can comprise a multi -well plate. The multi -well plate can be a 96-well plate, a 384-well plate, or a 1536-well plate. The cDNA generated from RNA obtained from a single T cell single can comprise cDNA generated from RNA obtained from a single human T cell. The firstamplification product can comprise nucleic acid encoding an L sequence of a Va or Vy segment. The first amplification product can comprise nucleic acid encoding a Ja or Jy segment. The first amplification product can comprise nucleic acid encoding a 5’ portion of a Ca or Cy region. The first amplification product can comprise nucleic acid encoding an L sequence of a Va or Vy segment, a Ja or Jy segment, and a 5’ portion of a Ca or Cy region. The second amplification product can comprise nucleic acid encoding an L sequence of a VP or V5 segment. The second amplification product can comprise nucleic acid encoding a Dp or D5 segment. The second amplification product can comprise nucleic acid encoding a jp or J5 segment. The second amplification product can comprise nucleic acid encoding a 5’ portion of a CP or C5 region. The second amplification product can comprise nucleic acid encoding an L sequence of a VP or V5 segment, a Dp or D5 segment, a jp or J5 segment, and a 5’ portion of a CP or C5 region. The first amplification product can comprise an adapter sequence added to an amplified template sequence of the cDNA via a second round amplification of the nested amplification procedure. The second amplification product can comprise an adapter sequence added to an amplified template sequence of the cDNA via a second round amplification of the nested amplification procedure. The first amplification product can comprise a first adapter sequence added to an amplified template sequence of the cDNA via a second round amplification of the nested amplification procedure, and the second amplification product can comprise a second adapter sequence added to an amplified template sequence of the cDNA via a second round amplification of the nested amplification procedure, wherein the first and second adapter sequence are different. The functional T cell receptor of each of the assembled nucleic acid vectors can comprise a Va / VP combination or Vy / V5 combination as present in the single T cell originating the RNA. The functional T cell receptor of each of the assembled nucleic acid vectors can comprise (a) a full-length a variable region and a full-length p variable region or (b) a full-length y variable region and a full-length 5 variable region. The functional T cell receptor of each of the assembled nucleic acid vectors can comprise (a) a full-length a variable region and a full-length P variable region as present in the single T cell originating the RNA or (b) a full-length y variable region and a full-length 5 variable region as present in the single T cell originating the RNA. The functional T cell receptor of each of the assembled nucleic acid vectors can comprise (a) a full-length a constant region and a full-length p constant region or (b) a full-length y constant region and a full-length 5 constant region. Each of the assembled nucleic acid vectors can comprise a nucleic acid sequence encoding a self-cleaving peptide or an internal ribosome entry site (IRES). The method can comprise sorting single Tcells into the separate locations. The method can comprise performing a reverse transcription reaction to obtain the cDNA. The assembling step can comprise seamless cloning. Each of the assembled nucleic acid vectors can be obtained without performing nucleic acid sequencing. Each of the assembled nucleic acid vectors can be obtained without performing a restriction endonuclease cleavage reaction.C. Assessing Minor Histocompatibility Antigen Specific T Cell ReceptorExpression, Activity and Function

[0172] Exemplary assays can be used to assess the activity, expression and / or function of the TCRs and antigen-binding fragments described herein. The assays described herein, which are not to be construed as limiting, may be used to assess the functional capacity of candidate miHA-specific TCRs.

[0173] Functional characterization of TCRs can be performed by binding assays utilizing fluorescent labeled MHC molecules carrying specific target peptides (tetramer / pentamer / dextramer), or activation assays by co-culturing TCR expressing cells with antigen presenting cells (APCs) presenting the corresponding MHC / peptide complexes.

[0174] A cytokine release assay can evaluate the ability of a candidate TCR to produce the cytokines IL-2 and / or IFN-y following exposure to cells presenting the target antigen. T cells are incubated with T2 cells (ACC-l(neg) / HLA-A*24:02(pos)) loaded with the target ACC-1 “Y” peptide. As a control, T2 cells are loaded with the non-target ACC-1 “C” peptide or an irrelevant peptide control. IL-2 and / or IFN-y responses of the T cells are followed by intracellular cytokine staining and analysis by FACS.

[0175] A T cell activation / degranulation marker assay can be used evaluate the ability of candidate TCRs to express the surface marker CD 107a following exposure to cells presenting the target antigen. CD 107a is a marker of T cell degranulation, which is part of the cell killing response. T cells are incubated with T2 cells loaded with the target ACC-1 “Y” peptide, or a control peptide, such as a non-target ACC-1 “C” peptide or an irrelevant peptide. Degranulation responses are followed on the T cells by CD107a surface staining and analysis by FACS.

[0176] A killing assay can evaluate the ability of candidate TCRs to lyse cells presenting the target antigen. T cells are incubated with a mixture of fluorescent-tag labeled T2 cells differentially loaded with target and control peptides to allow on-target and off-target cytotoxicity to be examined within a single test sample. Fluorescent cell counting beads are included as a normalization / count control. Fluorescently tagged T2 cells are loaded with the target ACC-1 “Y” peptide. As a control, T2 cells labeled with a different fluorescent-tag areloaded with the non-target ACC-1 “C” peptide or an irrelevant peptide control. Gated cell counts of ACC-1 “Y” peptide loaded T2 cells a control peptide loaded T2 cells remaining after incubation with T cells are followed by FACS.

[0177] The CD34 marker may be used as a surrogate potency measurement. See Philip et al. (2014) Blood 124(8): 1277-1287. Detection of CD34, a marker of transduction efficiency, may correlate with the functional potency measurements described herein.

[0178] In some aspects, expanded and unexpanded screens are performed using the exact same donor for a direct comparison of methods. With certain methods, expansion may be performed. A method that yields candidate TCRs without expansion processes can be advantageous in some contexts in view of the time sensitivity of screening for TCRs with desired specificity. Reduced sample processing may also offer advantages in different contexts.IV. ENGINEERED CELLS

[0179] Also provided herein are cells such as cells that have been engineered to contain a TCR described herein. Also provided herein are populations of such cells and compositions containing such cells and / or enriched for such cells, such as in which cells expressing the TCR make up at least 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more percent of the total cells in the composition. In some embodiments, the cells are primary T cells or cells of a certain type such as T cells or CD8+or CD4+cells. Among the compositions are pharmaceutical compositions and formulations for administration, such as for adoptive cell therapy. Also provided herein are therapeutic methods for administering the cells and compositions to subjects, e.g., patients.

[0180] Thus, also provided herein are genetically engineered cells expressing a TCR provided herein. The cells generally are eukaryotic cells, such as mammalian cells, and typically are human cells. In some embodiments, the cells are derived from the blood, bone marrow, lymph, or lymphoid organs, and are cells of the immune system, such as cells of the innate or adaptive immune system, e.g., myeloid or lymphoid cells, including lymphocytes, typically T cells and / or NK cells. Other exemplary cells include stem cells, such as multipotent and pluripotent stem cells, including induced pluripotent stem cells (iPSCs). The cells typically are primary cells (e.g., primary T cells), such as those isolated directly from a subject (e.g., a donor subject) and / or isolated from a subject and frozen. In some embodiments, the cells include one or more subsets of T cells or other cell types, such as whole T cell populations, CD4+ cells, CD8+ cells, and subpopulations thereof, such as those defined by function, activation state, maturity, potential for differentiation, expansion, recirculation, localization,and / or persistence capacities, antigen-specificity, type of antigen receptor, presence in a particular organ or compartment, marker or cytokine secretion profile, and / or degree of differentiation. With reference to the subject to be treated, the cells may be allogeneic and / or autologous. Among the methods provided herein include off-the-shelf methods. In some aspects, such as for off-the-shelf technologies, the cells are pluripotent and / or multipotent, such as stem cells (e.g., iPSCs). In some embodiments, the methods provided herein include isolating cells from the subject, preparing, processing, culturing, and / or engineering them, as described herein, and re-introducing them into the same patient, before or after cry opreservation.

[0181] Among the sub-types and subpopulations of T cells (including primary T cells) and / or of CD4+and / or of CD8+T cells (including primary CD4+and / or of CD8+T cells) included herein are naive T (TN) cells, effector T cells (TEFF), memory T cells and sub-types thereof, such as stem cell memory T (TSCM), central memory T (TCM), effector memory T (TEM), or terminally differentiated effector memory T cells, tumor-infiltrating lymphocytes (TIL), immature T cells, mature T cells, helper T cells, cytotoxic T cells, mucosa-associated invariant T (MAIT) cells, naturally occurring and adaptive regulatory T (Treg) cells, helper T cells, such as TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells, follicular helper T cells, alpha / beta T cells, and delta / gamma T cells.

[0182] In some embodiments, the cells are NK cells. In some embodiments, the cells are monocytes or granulocytes, e.g., myeloid cells, macrophages, neutrophils, dendritic cells, mast cells, eosinophils, and / or basophils.

[0183] In some embodiments, the cells include one or more nucleic acids introduced via genetic engineering, and thereby express recombinant or genetically engineered products of such nucleic acids. In some embodiments, the nucleic acids are heterologous, z.e., normally not present in a cell or sample obtained from the cell, such as one obtained from another organism or cell, which for example, is not ordinarily found in the cell being engineered and / or an organism from which such cell is derived. In some embodiments, the nucleic acids are not naturally occurring, such as a nucleic acid not found in nature, including one comprising chimeric combinations of nucleic acids encoding various domains from multiple different cell types.

[0184] In some embodiments, the expression of the endogenous TCR chains of the engineered cell is reduced or eliminated, for example, to reduce the risk or chance of mispairing between chains of the engineered TCR and the endogenous TCR. Such mispairing could createa new TCR that could potentially result in a higher risk of undesired or unintended antigen recognition and / or side effects and / or could reduce expression levels of the desired exogenous TCR. Exemplary methods for reducing or preventing endogenous TCR expression are described elsewhere, see e.g., U.S. Patent No. 9,273,283; U.S. publication no. US2014 / 0301990.

[0185] In some embodiments, a nucleic acid encoding an anti-ACC-1 CAR is transfected into a T cell to form an anti-ACC-1 CAR T cell. The T cell can be, but is not limited to, a primary T cell, a culture T cell, a autologous T cell, an allogeneic T cell, a T cell obtained from bone marrow, a T cell obtained from a lymph node, a T cell obtained from a thymus, a tumor infiltrating lymphocyte, a T cell obtained from a spleen, a T cell from umbilical cord blood, a universal allogenic T cell, a universal CAR T cell, a CAR T cell, a naive T cell, an effector T cell, an effector memory T cell, a CD4+ / CD8+ T cell, a helper T cell, a CD4+ T cell, a CD4+ helper T cell, a Thl T cell, a Th2 T cell, a cytotoxic T cell, a CD8+ T cell, peripheral blood mononuclear cell (PBMC), a peripheral blood leukocyte (PBL), a memory T cell, a central memory T cell, a regulatory T cell, an aP T cell, a y5 T cell, a modified T cell, a T cell for use in adoptive cell transfer therapy, or a TCR-engineered T cell. The CAR T cell can be a first generation CAR T cell, a second generation CAR T cell, a third generation CAR T cell, a fourth generation CAR T cell, dual -antigen receptor CAR T cell, or a CAR T cell having an inducible suicide gene, or a combination thereof.A. Preparation of cells for genetic engineering

[0186] In some embodiments, preparation of the engineered cells includes one or more culture and / or preparation steps. The cells for introduction of the TCR may be isolated from a sample, such as a biological sample, e.g., one obtained from or derived from a subject. In some embodiments, the subject from which the cell is isolated is one having the disease or condition or in need of a cell therapy or to which cell therapy will be administered. The subject in some embodiments is a human in need of a particular therapeutic intervention, such as the adoptive cell therapy for which cells are being isolated, processed, and / or engineered.

[0187] In some embodiments, the engineered cells are derived from a donor subject that is not the subject having the disease or condition or in need of a cell therapy or to which cell therapy will be administered (i.e., the donor subject is not the recipient subject). In some embodiments, the donor subject is HLA matched to the recipient subject. In some embodiments, the donor subject does not express the mi ACC- 1 “Y” antigen.

[0188] Accordingly, the cells in some embodiments are primary cells, e.g., primary human cells. The samples include tissue, fluid, and other samples taken directly from the subject, as well as samples resulting from one or more processing steps, such as separation, centrifugation, genetic engineering (e.g., transduction with viral vector), washing, and / or incubation. The biological sample can be a sample obtained directly from a biological source or a sample that is processed. Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples, including processed samples derived therefrom.

[0189] In some aspects, the sample from which the cells are derived or isolated is blood or a blood-derived sample, or is or is derived from an apheresis or leukapheresis product. Exemplary samples include whole blood, PBMCs, leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, gut associated lymphoid tissue, mucosa associated lymphoid tissue, spleen, other lymphoid tissues, liver, lung, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsil, or other organ, and / or cells derived therefrom. Samples include, in the context of cell therapy, e.g., adoptive cell therapy, samples from autologous and allogeneic sources.

[0190] In some embodiments, the cells are derived from cell lines, e.g., T cell lines. The cells in some embodiments are obtained from a xenogeneic source, for example, from mouse, rat, non-human primate, or pig.B. Vectors and methods for genetic engineering

[0191] Also provided herein are methods, nucleic acids, compositions, and kits for expressing a TCR or antigen-binding fragment thereof provided herein, in cells (e.g., genetically engineered cells) and for producing genetically engineered cells expressing such TCR or antigen-binding fragment thereof. The genetic engineering generally involves introduction of a nucleic acid encoding the TCR (or antigen-binding fragment thereof) into the cell, such as by retroviral transduction, transfection, or transformation.

[0192] In some embodiments, gene transfer is accomplished by first stimulating the cell, such as by combining it with a stimulus that induces a response such as proliferation, survival, and / or activation (e.g., as measured by expression of a cytokine or activation marker) followed by transduction of the activated cells, and expansion in culture to numbers sufficient for clinical applications.

[0193] Various methods for the introduction of genetically engineered components are well known and may be used with the provided methods and compositions. Exemplary methodsinclude those for transfer of nucleic acids encoding a TCR or antigen-binding fragment thereof provided herein, including via viral vectros (e.g., retroviral or lentiviral), transduction, transposons, and electroporation.

[0194] In some embodiments, recombinant nucleic acids are transferred into cells using recombinant infectious virus particles. In some embodiments, recombinant nucleic acids are transferred into T cells using recombinant lentiviral vectors or retroviral vectors, such as gamma-retroviral vectors (see, e.g., Koste et al. (2014) Gene Therapy 2014 Apr 3; Carlens et al. (2000) Exp Hematol 28(10): 1137-46; Alonso-Camino et al. (2013) Mol Ther Nucl Acids 2, e93; Park et al., Trends Biotechnol. 2011 November 29(11): 550-557).

[0195] In some embodiments, the retroviral vector has a long terminal repeat sequence (LTR), e.g., a retroviral vector derived from the Moloney murine leukemia virus (MoMLV), myeloproliferative sarcoma virus (MPSV), murine embryonic stem cell virus (MESV), murine stem cell virus (MSCV), or spleen focus forming virus (SFFV). In some embodiments, the retroviruses include those derived from any avian or mammalian cell source. The retroviruses typically are amphotropic, meaning that they are capable of infecting host cells of several species, including humans. In some embodiments, the nucleic acid to be expressed replaces the retroviral gag, pol and / or env sequences. A number of illustrative retroviral systems have been described elsewhere (see, e.g., U.S. Pat. Nos. 5,219,740; 6,207,453; 5,219,740; Miller and Rosman (1989) BioTechniques 7:980-990; Miller, A. D. (1990) Human Gene Therapy 1 :5-14; Scarpa et al. (1991) Virology 180:849-852; Bums et al. (1993) Proc. Natl. Acad. Sci. USA 90:8033-8037; and Boris-Lawrie and Temin (1993) Cur. Opin. Genet. Develop. 3: 102-109).

[0196] Methods of lentiviral transduction are known. Exemplary methods are described in, e.g, Wang et al. (2012) J. Immunother. 35(9): 689-701; Cooper et al. (2003) Blood. 101 : 1637- 1644; Verhoeyen et al. (2009) Methods Mol Biol. 506: 97-114; and Cavalieri et al. (2003) Blood. 102(2): 497-505.

[0197] In some embodiments, recombinant nucleic acids are transferred into T cells via electroporation (see, e.g., Chicaybam et al, (2013) PLoS ONE 8(3): e60298 and Van Tedeloo et al. (2000) Gene Therapy 7(16): 1431-1437). In some embodiments, recombinant nucleic acids are transferred into T cells via transposition (see, e.g., Manuri et al. (2010) Hum Gene Ther 21(4): 427-437; Sharma et al. (2013) Molec Ther Nucl Acids 2, e74; and Huang et al. (2009) Methods Mol Biol 506: 115-126). Other methods of introducing and expressing nucleic acid provided herein in immune cells include calcium phosphate transfection (e.g, as described in Current Protocols in Molecular Biology, John Wiley & Sons, New York. N.Y.), protoplastfusion, cationic liposome-mediated transfection, tungsten particle-facilitated microparticle bombardment (Johnston, Nature, 346: 776-777 (1990)), and strontium phosphate DNA coprecipitation (Brash et al., Mol. Cell Biol., 7: 2031-2034 (1987)).

[0198] Other approaches and vectors for transfer of nucleic acid encoding a TCR, antigenbinding fragment thereof, or recombinant product provided herein include those described elsewhere. See, e.g., International Patent Application Publication No. WO2014 / 055668 andU.S. Patent No. 7,446,190.

[0199] In some cases, one or more additional nucleic acids can be introduced into a cell concurrently with or sequentially with nucleic acid encoding a TCR or antigen-binding fragment thereof provided herein. In some cases, such an additional nucleic acid for introduction can be those that improve the efficacy of therapy, such as by promoting viability and / or function of transferred cells; those that provide a genetic marker for selection and / or evaluation of the cells, such as to assess in vivo survival or localization; and / or those that improve safety, for example, by making the cell susceptible to negative selection in vivo as described elsewhere (Lupton S. D. et al., Mol. and Cell Biol., 11 :6 (1991); and Riddell et al., Human Gene Therapy 3:319-338 (1992)). See, also, (a) the publications of PCT / US91 / 08442 and PCT / US94 / 05601 by Lupton et al. describing the use of bifunctional selectable fusion genes derived from fusing a dominant positive selectable marker with a negative selectable marker, and (b) Riddell et al., U.S. Patent No. 6,040,177, at columns 14-17.

[0200] Thus, provided in some embodiments are engineered cells, such as those containing a TCR or antigen-binding fragment thereof, nucleic acid, or vector as described herein. In some aspects, the cell is produced by transducing the cell in vitro or ex vivo with a vector described herein. In some aspects, the cell is a T cell, such as a CD8+ or CD4+ T cell. In some embodiments, the TCR is heterologous to the cell.V. THERAPEUTIC AND PROPHYLACTIC METHODS AND USES

[0201] Also provided herein are methods of administering and uses, such as therapeutic and prophylactic uses, of the TCRs and antigen-binding fragments thereof provided herein and / or engineered cells expressing the TCRs or antigen-binding fragments thereof. Such methods and uses include therapeutic methods and uses, for example, involving administration of the molecules, cells, or compositions containing the same, to a subject having a miHA ACC- 1 DYLQYVLQI allele. In some embodiments, such methods and uses include therapeutic methods and uses, for example, involving administration of the molecules, cells, or compositions containing the same, to a subject having a hematological disease, condition, ordisorder to which alloSCT is a treatment option. In some embodiments, the alloSCT comprises transplantation of hematopoietic cells invulnerable to the engineered T cells expressing any of the described anti- ACC- 1 TCRs. In some embodiments, such methods and uses include therapeutic methods and uses, for example, involving administration of the molecules, cells, or compositions containing the same, to a subject having a hematological disease, condition, or disorder to which alloSCT is not a treatment option. In some embodiments, the molecule, cell, and / or composition is administered in an effective amount to effect treatment of the disease or disorder. Uses include uses of the TCRs and cells in such methods and treatments, and in the preparation of a medicament in order to carry out such therapeutic methods. In some embodiments, the methods are carried out by administering the TCRs or cells, or compositions comprising the same, to the subject having, having had, or suspected of having the disease or condition (e.g., a hematopoietic cancer). In some embodiments, the methods thereby treat the disease or condition or disorder in the subject.

[0202] The described TCRs and engineered T cells expressing the described TCRs can be used to kill or eliminate autologous bone marrow derived cells in a subject having a miHA ACC-1 DYLQYVLQI allele. Killing or eliminating autologous bone marrow derived cells in a subject having a miHA ACC-1 DYLQYVLQI allele can be used to augment alloSCT, to treat a hematologic malignancy, or to a treat non-hematologic disease or condition (e.g., an autoimmunity disorder or a hematologic ailment). In some embodiments, the alloSCT comprises transplantation of hematopoietic cells invulnerable to the engineered T cells expressing any of the described anti -ACC- 1 TCRs.

[0203] As used herein, “treatment” (and grammatical variations thereof such as “treat” or “treating”) refers to complete or partial amelioration or reduction of a disease or condition or disorder, or a symptom, adverse effect or outcome, or phenotype associated therewith. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. The terms do not imply complete curing of a disease or complete elimination of any symptom or effect(s) on all symptoms or outcomes.

[0204] As used herein, “delaying development of a disease” means to defer, hinder, slow, retard, stabilize, suppress and / or postpone development of the disease (such as cancer). This delay can be of varying lengths of time, depending on the history of the disease and / orindividual being treated. As is evident to one skilled in the art, a sufficient or significant delay can, in effect, encompass prevention, in that the individual does not develop the disease. For example, a late stage cancer, such as development of metastasis, may be delayed.

[0205] “Preventing,” as used herein, includes providing prophylaxis with respect to the occurrence or recurrence of a disease in a subject that may be predisposed to the disease but has not yet been diagnosed with the disease. In some embodiments, the provided molecules and compositions are used to delay development of a disease or to slow the progression of a disease.

[0206] As used herein, to “suppress” a function or activity is to reduce the function or activity when compared to otherwise same conditions except for a condition or parameter of interest, or alternatively, as compared to another condition. For example, a TCR or composition or cell which suppresses tumor growth reduces the rate of growth of the tumor compared to the rate of growth of the tumor in the absence of the TCR or composition or cell.

[0207] An “effective amount” of an agent, e.g., a pharmaceutical formulation, TCR, cells, or composition, in the context of administration, refers to an amount effective, at dosages / amounts and for periods of time necessary, to achieve a desired result, such as a therapeutic or prophylactic result.

[0208] A “therapeutically effective amount” of an agent, e.g., a pharmaceutical formulation, TCR, or cells, refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result, such as for treatment of a disease, condition, or disorder, and / or pharmacokinetic or pharmacodynamic effect of the treatment. The therapeutically effective amount may vary according to factors such as the disease state, age, sex, and weight of the subject, and the populations of cells administered. In some embodiments, the provided methods involve administering the TCRs, cells, and / or compositions at effective amounts, e.g., therapeutically effective amounts.

[0209] A “prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, but not necessarily, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.

[0210] As used herein, a “subject” is a mammal, such as a human or other animal, and typically is human.

[0211] Among the diseases to be treated are cancers. In some embodiments, the disease or condition to be treated is a liquid tumor. In some embodiments, the disease or condition to betreated is a hematopoietic tumor. In some embodiments, the disease or condition to be treated is a lymphoma. In some embodiments, the disease or condition to be treated is acute myeloid leukemia (AML), a myelodysplastic syndrome (MDS), or acute lymphoblastic leukemia (ALL). In some embodiments, the disease or condition to be treated is chronic myeloid leukemia (CML).

[0212] In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs can be used to treat non-malignant blood disorders (e.g., hemoglobinopathies and thalassemias) and autoimmune disease.

[0213] In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs can be used to treat an inherited disorder of blood cells. The inherited disorders of blood cells can be, but is not limited to, thalassemia and hemaglobinopathy.

[0214] In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs can be used in stem cell replacement. In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs can be used to facilitate establishing tolerance for solid organ transplant.

[0215] In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs can be used to facilitate bone marrow engraftment at lower and less toxic doses of irradiation and chemotherapy for the recipient.

[0216] In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs can be used to facilitate a lower intensity conditioning regimen alloSCT. In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs can be used to facilitate a lower intensity conditioning regimen alloSCT for use in treating an autoimmune disease or an inherited disorder of blood cells (e.g., non-malignant blood disorders; e.g., thalassemia or hemaglobinopathy).A. Exemplary Hematological Malignancies, Allogeneic Stem Cell Transplantation1. Acute Myeloid Leukemia (AML)

[0217] Although AML is the most common indication for alloSCT, only half of the patients with early to intermediate disease and one third of patients with advanced disease survived at 3 years after transplant. See D’Souza et al. (2020) Biol Blood Marrow Transplant J Am Soc Blood Marrow Transplant 26(8):el77-el82. The most common cause of death in both early and late disease is relapse of primary disease. The recipient with overt active AML (z.e., >5% morphologically evident disease in the bone marrow) or measurable residual disease (MRD) at the time of alloSCT have a worse post-transplant prognosis than patients without MRD at thetime of alloSCT. Methods for determining the presence or absence of MRD have evolved significantly and include evaluation for morphologic remission, multiparameter flow cytometry (MFC) and next-generation sequencing (NGS). MFC and NGS allow for determining presence of MRD down to lxl04-l :106cells versus 1 :20 in morphology-based determinations. See Schuurhuis et al. (2018) Blood 131(12): 1275-1291 and Getta et al. (2017) Biol Blood Marrow Transpl. 23(7): 1064-1071.

[0218] Longer term outcomes for patients with MRD are poor, with relapse occurring in 65% of subjects, resulting in RFS of 13% and overall survival (OS) of 19-23% at three years. See Araki et al. (2016) J Clin Oncol. 34(4):329-336 and Duval et al. (2010) J Clin Oncol. 28(23):3730-3738. The three-year relapse rate in one retrospective study for MRD-positive patients was 67% (similar to the 65% relapse rate found in those with active AML), compared to 22% relapse in patients with MRD-negative remission. See Araki et al. (2016) J Clin Oncol. 34(4):329-336. Other published studies have yielded similar results. See Mohty et al. (2017) Haematologica. 102(1): 184- 191 , Decroocq et al. (2018) Am J Hematol. 93(3):416-423, and Walter et al. (2013) B / c 122(10): 1813-1821. Despite very poor outcomes, one retrospective study demonstrated the benefit of alloSCT for MRD-positive patients in comparison to a no transplant option, chemotherapy. See Jurjen et al. (2017) JCO Precis Oncol. (1): 1-13.

[0219] Therapies targeting specific mutations, such as IDH or FLT3 inhibitors, have been used in salvage regimens and increasingly up front. See Lai et al. (2019) J Hematol Oncol 12(1): 100. But despite these agents, which are active in only a minority of leukemias, relapsed / refractory disease will remain a major clinical problem. Likewise, post-transplant hypomethylating agents are currently used, but have an uncertain effect on long term survival. See Platzbecker et al. (2Q ) Leukemia 26(3):381-389, Craddock et al. (2019) J Clin Oncol Off J Am Soc Clin Oncol. 37(7):580-588, and Rautenberg et al. (2020) Bone Marrow Transplant 1-9.

[0220] AlloSCT has been used for AML with active disease or with MRD, despite a disappointing 60% of recipients relapsing during the first year, and less than one-third of patients becoming long-term survivors. See D’ Souza et al. (Biol Blood Marrow Transplant J Am Soc Blood Marrow Transplant 2020, 26(8):el77-el82). Most patients with overt disease are typically not offered alloSCT due to this likelihood of relapse during the first year. There is an urgent unmet medical need to extend the length of time before relapse (e.g., to extend the time to relapse beyond 1, 2, 3, 4, or 5 years) in MRD-positive patients who undergo alloSCT. There also is an urgent unmet medical need to prevent relapse in MRD-positive patients whoundergo alloSCT. In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs provide an improved treatment option for these patients.2. Myelodysplastic Syndrome

[0221] The risk of having an MDS relapse after alloSCT is greater in patients transplanted with higher risk disease as measured by the Revised International Prognostic Scoring System (IPSS-R). Approximately 50-60% of very-poor risk MDS patients relapsed in 2 years after alloSCT. Monosomy cytogenetic abnormalities are also associated with a higher risk of relapse independent of IPSS score. See Koenecke et al. (2015) Haematologica. 100(3):400-408 and Deeg et al. (2012) Blood 120(7): 1398-1408. More recently, specific somatic mutation profiles were shown to predict for relapse of MDS post-alloSCT. Pre-transplant TP53 mutations were associated with a very poor outcome with 3 -year overall survival of less than 20% and a median survival time of 0.7 years. See Lindsley et al. (2017) N Engl J Med. 376(6):536-547 and Ciurea et al. (2018) Blood 131(26):2989-2992. Other mutations related to the RAS-pathway, JAK2, RUNX1, and ASXL1 were also associated with poor outcome after alloSCT. See Lindsley et al. (2017) N Engl J Med. 376(6):536-547 and Della Porta et al. (2016) J Clin Oncol. 34(30):3627-3637.3. Acute Lymphoblastic Leukemia (ALL)

[0222] AlloSCT for ALL with active disease or primary induction failure only achieved 16% long-term survival at three years, as 41% of patients died before six months from relapsed ALL. See Duval et al. (2010) J Clin Oncol. 28(23):3730-3738.4. Chronic Myeloid Leukemia (CML)

[0223] In some embodiments, the TCRs and / or engineered T cells expressing the TCRs can be used to treat CML. In some embodiments, the TCRs and / or engineered T cells expressing the TCRs can be used to treat CML in subjects that receive bone marrow transplant (e.g., SCT), or CML in subjects that have blast crisis or accelerated phase blast crisis.5. Additional diseased and conditions

[0224] Additional diseases or condition to be treated using the described TCRs, T cells, and methods. The diseases or conditions include, but are not limited to, liquid tumors, hematopoietic tumors, and lymphomas.

[0225] In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs may be used in bone marrow transplantations, such as for autoimmune disorders, non-malignant blood disorders (e.g., thalassemia or hemaglobinopathy), solid tumor treatments, and immune system replacements. The described T cells may be combined withother adoptive cell therapies that are targeted to solid tumors, non-malignant blood disorders, or autoimmune diseases or conditions. The described T cells may be used as a preliminary or concurrent treatment or additive to reduce, inhibit, or eliminate the recipient's natural immune response or immune cells.

[0226] In some embodiments, the described TCRs may be isolated and administered to a subject as soluble TCRs. In some embodiments, the described TCRs may be isolated and conjugated to a molecule, such as a therapeutic molecule or an antibody. The conjugated TCRs may then be administered to a subject.6. Immune cell depletion

[0227] In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs are administered to a subject to deplete the subject’s immune cells. The subject may or may not have received a transplant. The subject may or may not be scheduled to receive a transplant. The subject may or may not be eligible for a transplant. In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs are administered to a subject prior to the subject receiving a transplant. In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs are administered to a subject subsequent to the subject receiving a transplant. In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs are administered to a subject concomitantly with the administration of a transplant. In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs are administered to a subject that has not received a transplant. In some embodiments, the described TCRs and / or engineered T cells expressing the described TCRs are administered to a subject that has not received a transplant and is not scheduled to receive a transplant. The transplant can be, but is not limited to, a hematopoietic transplant, a stem cell transplant, or an alloSCT. In some embodiments, the subject has cancer. The cancer can be, but is not limited to, a hemopoietic cancer. In some embodiments, the subject does not have cancer. In some embodiments, the subject has a non- malignant blood disorder. In some embodiments, the subject has an autoimmune disorder.B. Allogeneic Stem Cell Transplantation and Risk of Relapse

[0228] Over 9000 alloSCTs were performed in the United States in 2019, mostly as a potentially curative treatment for patients with various hematologic malignancies. See D’ Souza et al. (2020) Biol Blood Marrow Transplant J Am Soc Blood Marrow Transplant 26(8): el 77- el82. Post-transplant relapse remains the major cause of transplant failure occurring in 20-40% of standard risk and in 40-80% of high-risk patients, accounting for more than half of deathsafter alloSCT. See Horowitz et al. (2018) Bone Marrow Transpl. 53(11): 1379-1389. There is an urgent need to prolong recurrence-free survival (RFS) times through new strategies to enhance GVL without causing severe GVHD. There also is an urgent need to prevent and treat post-transplant relapse through new strategies to enhance GVL without causing severe GVHD.

[0229] The number of relapses in patients currently transplanted likely underestimates the unmet needs. An analysis of patients with AML is illustrative of this point. In 2018, more than 3,000 alloSCTs were performed for AML in the United States. However, during the same period, there were approximately 21,450 new cases of AML, with an estimated 11,000 yearly deaths. The decision to refer a patient for an alloSCT depends on the benefit of relapse control relative to the risks of treatment-related mortality (TRM). If a new therapy results in a lower rate of relapse without an increase in significant toxi cities and TRM, then more subjects would likely be referred for that therapy.

[0230] Relapse is the most common cause of death after alloSCT in every type of hematologic malignancy. Since the outcome of post-transplant relapse is extremely poor, RFS or cumulative relapse can be used as reliable surrogate endpoints for survival in alloSCT. The most powerful predictor for relapse is measurable residual disease (MRD) at the time of alloSCT. Even if the disease burden is low (i.e., less than 5% of the bone marrow), the outcomes are as poor as in the patients with overt active disease. See Araki et al. (2016) J Clin Oncol. 34(4):329-336.C. Additional Therapy Considerations

[0231] In some aspects, although unlikely, it is possible for miHA TCRs to display a lack of specificity or exhibit on target / off tumor effects. The latter may emerge when the ACC-1 target is sufficiently expressed in nonhematopoietic tissues. Strategies and methods, which should not be construed as limiting, are provided herein to address such occurrences.

[0232] If GVHD occurs following administration of a miHA TCR, standard of care immunosuppressive therapies would be initiated. As a built-in safety mechanism, the engineered cells described herein may comprise an extracellular membrane-bound marker containing a CD20 epitope. The CD20 epitope is recognized by certain antibodies, including, for example, the monoclonal antibody RITUXAN® (rituximab). Recognition of the CD20 epitope may allow for selective deletion of the engineered cells. This strategy may be employed in combination with standard of care interventions to reduce GVHD.

[0233] While cytokine release syndrome (CRS) has occurred after CAR-T cell infusions, the risk of CRS is less likely for TCR cell therapy. Even so, CRS remains a possibility,especially if transduced cells are rapidly and synchronously activated. If CRS occurs, as defined by the American Society for Transplantation and Cellular Therapy (ASTCT) consensus grading guidelines, standard of care therapies would be initiated. Such treatments include, for example, administration of antibodies that block IL-6 function and / or corticosteroids. See Lee et al. (2019) Biol Blood Marrow Transpl. 25(4):625-638.

[0234] The described anti-ACC-1 BiTEs and anti-ACC-1 CARs can be used in the treatment of cancer. Also described are methods of treating cancer in a subject comprising administering to the subject any of the described anti-ACC-1 BiTEs or anti-ACC-1 CAR T cells. The anti -ACC- 1 BiTEs or anti -ACC- 1 CAR T cells can be administered to a subject to induce an immune response, increase T cell infiltration of the tumor, reduce or inhibit cancer cell growth, reduce or inhibit tumor growth, reduce tumor progression, reduce tumor mass, inhibit or reduce metastasis, reduce or inhibit the development of metastatic cancer, increase survival or prolong life of the subject, treat a non-malignant blood disorder, or reduce or attenuate an autoimmune response.VI. DEFINITIONS

[0235] Unless defined otherwise, all terms of art, notations and other technical and scientific terms or terminology used herein are intended to have the same meaning as is commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.

[0236] “Relatively hematopoietically restricted,” with respect to an antigen, such at the ACC-1 antigen, indicates that the antigen is expressed by cells of hematopoietic origin and there is substantially less, little, or no expression of the antigen in most other cells of the subject.

[0237] The terms “polypeptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues, and are not limited to a minimum length. Polypeptides, including the provided T cell receptors, antigen binding fragments thereof and other peptides, e.g., linkers, may include amino acid residues including natural and / or non-natural amino acid residues. The terms also include post-expression modifications of the polypeptide, for example, glycosylation, sialylation, acetylation, phosphorylation, and the like. In some aspects, the polypeptides may contain modifications with respect to a native or natural sequence, as long as the protein maintains the desired activity. These modifications may be deliberate, as throughsite-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.

[0238] An “isolated” nucleic acid refers to a nucleic acid molecule that has been separated from a component of its natural environment. An isolated nucleic acid includes a nucleic acid molecule contained in cells that ordinarily contain the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.

[0239] “An isolated nucleic acid molecule encoding a TCR” refers to a single nucleic acid molecule (e.g., single vector) that encodes a TCR such as a functional a / p TCR or a functional y / 5 TCR.

[0240] “An isolated nucleic acid molecule encoding an antigen binding fragment of a TCR” refers to a single nucleic acid molecule (e.g., single vector) that encodes an antigen binding fragment of a TCR.

[0241] “Isolated nucleic acid molecules encoding a TCR” refers to two or more separate nucleic acid molecules (e.g., two or more vectors) that together encode a TCR such as a functional a / p TCR or a functional y / 8 TCR. Each of such two or more nucleic acid molecules can be present at different locations within a host cell.

[0242] “ Isolated nucleic acid molecules encoding an antigen binding fragment of a TCR” refers to two or more nucleic acid molecules (e.g., two or more vectors) that together encode an antigen binding fragment of a TCR. Each of such two or more nucleic acid molecules can be present at different locations within a host cell.

[0243] The terms “host cell,” “host cell line,” and “host cell culture” are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include “transformants” and “transformed cells,” which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. Progeny may not be completely identical in nucleic acid content to a parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein.

[0244] As used herein, “percent (%) amino acid sequence identity” and “percent identity” when used with respect to an amino acid sequence (reference polypeptide sequence) is defined as the percentage of amino acid residues in a candidate sequence (e.g., the subject T cell receptor or fragment) that are identical with the amino acid residues in the referencepolypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0245] An amino acid substitution may include replacement of one amino acid in a polypeptide with another amino acid. Amino acid substitutions may be introduced into a TCR or antigen binding fragment thereof, of interest and the products screened for a desired activity, e.g., retained / improved antigen binding, decreased immunogenicity, or improved cytolytic activity.

[0246] Amino acids generally can be grouped according to the following common sidechain properties:(1) hydrophobic: Norleucine, Met, Ala, Vai, Leu, He;(2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gin;(3) acidic: Asp, Glu;(4) basic: His, Lys, Arg;(5) residues that influence chain orientation: Gly, Pro; and(6) aromatic: Trp, Tyr, Phe.

[0247] In some embodiments, conservative substitutions can involve the exchange of a member of one of these classes for another member of the same class. In some embodiments, non-conservative amino acid substitutions can involve exchanging a member of one of these classes for another class.

[0248] The term “plasmid” or “vector” includes any known delivery vector including a bacterial delivery vector, a viral vector delivery vector, a peptide immunotherapy delivery vector, a DNA immunotherapy delivery vector, an episomal plasmid, an integrative plasmid, or a phage vector. The term “vector” refers to a construct which is capable of delivering, and, optionally, expressing, one or more fusion polypeptides in a host cell. In some embodiments, a vector capable of propagating another nucleic acid to which it is linked. The term includes the vector as a self-replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced. Certain vectors are capable of directingthe expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as “expression vectors.”

[0249] As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. For example, “a” or “an” means “at least one” or “one or more.” It is understood that aspects and variations described herein include “consisting” and / or “consisting essentially of’ aspects and variations.

[0250] Throughout this disclosure, various aspects of the claimed subject matter are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the claimed subject matter. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, where a range of values is provided, it is understood that each intervening value, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the claimed subject matter. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the claimed subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the claimed subject matter. This applies regardless of the breadth of the range.

[0251] The term “about” as used herein refers to the usual error range for the respective value readily known to the skilled person in this technical field. Reference to “about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X”.

[0252] A composition can refers to any mixture of two or more products, substances, or compounds, including cells. It may be a solution, a suspension, liquid, powder, a paste, aqueous, non-aqueous or any combination thereof.

[0253] As used herein, a statement that a cell or population of cells is “positive” for a particular marker refers to the detectable presence on or in the cell of the particular marker, typically a surface marker. When referring to a surface marker, the term refers to the presence of surface expression as detected by flow cytometry, for example, by staining with an antibody that specifically binds to the marker and detecting said antibody, wherein the staining is detectable by flow cytometry at a level substantially above the staining detected carrying out the same procedure with an isotype-matched control under otherwise identical conditionsand / or at a level substantially similar to that for cell known to be positive for the marker, and / or at a level substantially higher than that for a cell known to be negative for the marker.

[0254] As used herein, a statement that a cell or population of cells is “negative” for a particular marker refers to the absence of substantial detectable presence on or in the cell of the particular marker, typically a surface marker. When referring to a surface marker, the term refers to the absence of surface expression as detected by flow cytometry, for example, by staining with an antibody that specifically binds to the marker and detecting said antibody, wherein the staining is not detected by flow cytometry at a level substantially above the staining detected carrying out the same procedure with an isotype-matched control under otherwise identical conditions, and / or at a level substantially lower than that for cell known to be positive for the marker, and / or at a level substantially similar as compared to that for a cell known to be negative for the marker.VII. EXEMPLARY EMBODIMENTS

[0255] Among the provided embodiments are:1. A T cell receptor (TCR) or antigen-binding fragment thereof, comprising: an alpha chain comprising a variable alpha (Va) region and a beta chain comprising a variable beta (VP) region; or a gamma chain comprising a variable gamma (Vy) region and a delta chain comprising a variable delta (V5) region; wherein:(a) the Va or Vy region comprises a complementarity determining region 3 (CDR-3) comprising SEQ ID NO: 13, and the V or V5 region comprises a CDR-3 comprising SEQ ID NO:21;(b) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO:31, and the VP or V5 region comprises a CDR-3 comprising SEQ ID NO:39;(c) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO:49, and the VP or V5 region comprises a CDR-3 comprising SEQ ID NO:57;(d) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO:67, and the VP or V5 region comprises a CDR-3 comprising SEQ ID NO:75;(e) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO: 85, and the VP or V5 region comprises a CDR-3 comprising SEQ ID NO:93; or(f) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO: 103, and the VP or V5 region comprises a CDR-3 comprising SEQ ID NO: 111.2. The TCR or antigen-binding fragment thereof of embodiment 1, wherein:(a) the Va or Vy region comprises a complementarity determining region 1 (CDR-1) comprising SEQ ID NO: 11, and a complementarity determining region 2 (CDR-2) comprising SEQ ID NO: 12, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO: 19, and a CDR-2 comprising SEQ ID NO:20;(b) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:29, and a CDR-2 comprising SEQ ID NO:30, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:37, and a CDR-2 comprising SEQ ID NO:38;(c) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:47, and a CDR-2 comprising SEQ ID NO:48, and the V or V5 region comprises a CDR-1 comprising SEQ ID NO:55, and a CDR-2 comprising SEQ ID NO:56;(d) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:65, and a CDR-2 comprising SEQ ID NO:66, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:73, and a CDR-2 comprising SEQ ID NO:74;(e) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:83, and a CDR-2 comprising SEQ ID NO:84, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:91, and a CDR-2 comprising SEQ ID NO:92; or(f) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO: 101, and a CDR-2 comprising SEQ ID NO: 102, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO: 109, and a CDR-2 comprising SEQ ID NO: 110.3. A T cell receptor (TCR) or antigen-binding fragment thereof, comprising: an alpha chain comprising a variable alpha (Va) region and a beta chain comprising a variable beta (VP) region; or a gamma chain comprising a variable gamma (Vy) region and a delta chain comprising a variable delta (V5) region; wherein:(a) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO: 11, a CDR-2 comprising SEQ ID NO: 12, and a CDR-3 comprising SEQ ID NO: 13, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO: 19, a CDR-2 comprising SEQ ID NO:20, and a CDR-3 comprising SEQ ID NO:21;(b) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:29, a CDR-2 comprising SEQ ID NO:30, and a CDR-3 comprising SEQ ID NO:31, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:37, a CDR-2 comprising SEQ ID NO:38, and a CDR-3 comprising SEQ ID NO:38;(c) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:47, a CDR-2 comprising SEQ ID NO:48, and a CDR-3 comprising SEQ ID NO:49, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:55, a CDR-2 comprising SEQ ID NO:56, and a CDR-3 comprising SEQ ID NO:57;(d) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:65, a CDR-2 comprising SEQ ID NO:66, and a CDR-3 comprising SEQ ID NO:67, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:73, a CDR-2 comprising SEQ ID NO:74, and a CDR-3 comprising SEQ ID NO:75;(e) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:83, a CDR-2 comprising SEQ ID NO: 84, and a CDR-3 comprising SEQ ID NO: 85, and the VP or V5 regioncomprises a CDR-1 comprising SEQ ID NO:91, a CDR-2 comprising SEQ ID NO:92, and a CDR-3 comprising SEQ ID NO:93; or(f) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO: 101, a CDR-2 comprising SEQ ID NO: 102, and a CDR-3 comprising SEQ ID NO: 103, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO: 109, a CDR-2 comprising SEQ ID NO: 110, and a CDR-3 comprising SEQ ID NO: 111.4. A T cell receptor (TCR) or antigen-binding fragment thereof, comprising: an alpha chain comprising a variable alpha (Va) region and a beta chain comprising a variable beta (V ) region; or a gamma chain comprising a variable gamma (Vy) region and a delta chain comprising a variable delta (V5) region; wherein:(a) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 14, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:22;(b) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:32, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:40;(c) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:50, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:58;(d) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:68, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:76;(e) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 86, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:94; or(f) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 104, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO: 112.5. The TCR or antigen-binding fragment thereof of embodiment 4, wherein:(a) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO: 14, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO:22;(b) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO:32, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO:40;(c) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO:50, and the VP or V5 region comprises a CDR-1 and a CDR-2 ascontained within the VP or V5 region sequence of SEQ ID NO:58;(d) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO:68, and the V or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO:76;(e) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO:86, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO:94; or(f) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO: 104, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO: 112.6. A T cell receptor (TCR) or antigen-binding fragment thereof, comprising: an alpha chain comprising a variable alpha (Va) region and a beta chain comprising a variable beta (VP) region; or a gamma chain comprising a variable gamma (Vy) region and a delta chain comprising a variable delta (V5) region; wherein:(a) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 14, and the VP or V5 region comprises a CDR-1, a CDR- 2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:22;(b) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:32, and the VP or V5 region comprises a CDR-1, a CDR- 2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:40;(c) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:50, and the VP or V5 region comprises a CDR-1, a CDR- 2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:58;(d) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:68, and the VP or V5 region comprises a CDR-1, a CDR- 2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:76;(e) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:86, and the VP or V5 region comprises a CDR-1, a CDR- 2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:94; or(f) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 104, and the VP or V5 region comprises a CDR-1, a CDR- 2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO: 112.7. A T cell receptor (TCR) or antigen-binding fragment thereof, comprising: an alpha chain comprising a variable alpha (Va) region and a beta chain comprising a variable beta (VP) region; or a gamma chain comprising a variable gamma (Vy) region and a delta chain comprising a variable delta (V5) region; wherein:(a) the Va or Vy region comprises SEQ ID NO: 14 or a sequence that has at least 90%sequence identity thereto, and the VP or V5 region comprises SEQ ID NO: 22 or a sequence that has at least 90% sequence identity thereto;(b) the Va or Vy region comprises SEQ ID NO:32 or a sequence that has at least 90% sequence identity thereto, and the V or V5 region comprises SEQ ID NO: 40 or a sequence that has at least 90% sequence identity thereto;(c) the Va or Vy region comprises SEQ ID NO:50 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO: 58 or a sequence that has at least 90% sequence identity thereto;(d) the Va or Vy region comprises SEQ ID NO:68 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO: 76 or a sequence that has at least 90% sequence identity thereto;(e) the Va or Vy region comprises SEQ ID NO: 86 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO: 94 or a sequence that has at least 90% sequence identity thereto; or(f) the Va or Vy region comprises SEQ ID NO: 104 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO: 112 or a sequence that has at least 90% sequence identity thereto.8. The TCR or antigen-binding fragment thereof of any of embodiments 1-7, wherein:(a) the Va or Vy region comprises SEQ ID NO: 14, and the VP or V5 region comprises SEQ ID NO:22;(b) the Va or Vy region comprises SEQ ID NO:32, and the VP or V5 region comprises SEQ ID NO:40;(c) the Va or Vy region comprises SEQ ID NO:50, and the VP or V5 region comprises SEQ ID NO:58;(d) the Va or Vy region comprises SEQ ID NO:68, and the VP or V5 region comprises SEQ ID NO:76;(e) the Va or Vy region comprises SEQ ID NO: 86, and the VP or V5 region comprises SEQ ID NO:94; or(f) the Va or Vy region comprises SEQ ID NO: 104, and the VP or V5 region comprises SEQ ID NO: 112.9. The TCR or antigen-binding fragment thereof of any of embodiments 1-8, wherein: the alpha chain further comprises an alpha constant (Ca) region and the beta chain further comprises a beta constant (CP) region; or the gamma chain further comprises a gamma constant (Cy) region and the delta chain further comprises a delta constant (C5) region.10. The TCR or antigen-binding fragment thereof of embodiment 9, wherein: the Ca comprises SEQ ID NO:3 or 5 and the Cp comprises SEQ ID NO:7 or 9.11. The TCR or antigen-binding fragment thereof of any of embodiments 1-10, wherein:(a) the alpha or gamma chain comprises SEQ ID NO: 17, and the beta or delta chain comprises SEQ ID NO:25;(b) the alpha or gamma chain comprises SEQ ID NO:35, and the beta or delta chain comprises SEQ ID NO:43;(c) the alpha or gamma chain comprises SEQ ID NO:53, and the beta or delta chain comprises SEQ ID NO:61;(d) the alpha or gamma chain comprises SEQ ID NO:71, and the beta or delta chain comprises SEQ ID NO:79;(e) the alpha or gamma chain comprises SEQ ID NO: 89, and the beta or delta chain comprises SEQ ID NO:97; or(f) the alpha or gamma chain comprises SEQ ID NO: 107, and the beta or delta chain comprises SEQ ID NO: 115.12. The TCR or antigen-binding fragment thereof of any of embodiments 1-11, wherein the TCR or antigen-binding fragment thereof recognizes a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule.13. The TCR or antigen-binding fragment thereof of embodiment 12, wherein the MHC molecule is a human leukocyte antigens (HLA)-A molecule.14. The TCR or antigen-binding fragment thereof of embodiment 13, wherein the HLA- A molecule is of serotype HLA-A*24:02.15. The TCR or antigen-binding fragment thereof of any of embodiments 12-14, wherein the peptide epitope of ACC-1 is set forth in SEQ ID NO: 1.16. A polynucleotide encoding the TCR or antigen-binding fragment thereof of any of embodiments 1-15, or an alpha chain, a beta chain, a gamma chain, or a delta chain thereof.17. The polynucleotide of embodiment 16, wherein the polynucleotide comprises a nucleotide sequence encoding the Va region and a nucleotide sequence encoding the VP region; or a nucleotide sequence encoding the Vy region and a nucleotide sequence encoding the V5 region; wherein:(a) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 15 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the V or V5 region comprises SEQ ID NO:23 or a sequence that has at least 90% sequence identity thereto;(b) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:33 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:41 or a sequence that has at least 90% sequence identity thereto;(c) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:51 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:59 or a sequence that has at least 90% sequence identity thereto;(d) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:69 or asequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:77 or a sequence that has at least 90% sequence identity thereto;(e) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 87 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the V or V5 region comprises SEQ ID NO:95 or a sequence that has at least 90% sequence identity thereto; or(f) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 105 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO: 113 or a sequence that has at least 90% sequence identity thereto.18. The polynucleotide of embodiment 16 or 17, wherein:(a) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 16 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:24 or a sequence that has at least 90% sequence identity thereto;(b) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:34 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:42 or a sequence that has at least 90% sequence identity thereto;(c) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:52 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:60 or a sequence that has at least 90% sequence identity thereto(d) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:70 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:78 or a sequence that has at least 90% sequence identity thereto;(e) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 88 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:96 or a sequence that has at least 90% sequence identity thereto; or(f) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 106 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO: 114 or a sequence that has at least 90% sequence identity thereto.19. The polynucleotide of any one of embodiments 16-18, wherein:(a) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 18or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:26 or a sequence that has at least 90% sequence identity thereto;(b) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:36 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:44 or a sequence that has at least 90% sequence identity thereto;(c) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:54 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:62 or a sequence that has at least 90% sequence identity thereto;(d) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:72 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO: 80 or a sequence that has at least 90% sequence identity thereto;(e) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:90 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:98 or a sequence that has at least 90% sequence identity thereto; or(f) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 108 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO: 116 or a sequence that has at least 90% sequence identity thereto.20. The polynucleotide of any of embodiments 16-19, wherein the nucleotide sequence encoding the alpha chain and the nucleotide sequence encoding the beta chain present on same expression vector and expressed from a single promoter.21. The polynucleotide of any of embodiment 20, wherein the nucleotide sequence encoding the alpha chain and the nucleotide sequence encoding the beta chain are separated by a nucleotide sequence encoding a peptide sequence that causes ribosome skipping.22. The polynucleotide of embodiment 21, wherein the peptide that causes ribosome skipping is a P2A peptide.23. The polynucleotide of embodiment 22, wherein the P2A peptide comprises SEQ ID NO: 129.24. The polynucleotide of embodiment 23 or 24, wherein the sequence encoding the P2A peptide is set forth in SEQ ID NO: 130.25. The polynucleotide of any one of embodiments 16-25, wherein the polynucleotide encodes the amino acid sequence of SEQ ID NO:27, 45, 63, 81, 99, or 117.26. The polynucleotide of any one of embodiments 16-25, wherein polynucleotide comprised the nucleic acid sequence of SEQ ID NO:28, 46, 64, 82, 100, or 118.27. A vector comprising the polynucleotide of any of embodiments 16-26.28. The vector of embodiment 27, wherein the vector is a viral vector.29. The vector of embodiment 28, wherein the viral vector is a lentiviral vector.30. An engineered cell, comprising the TCR or antigen-binding fragment thereof of any of embodiments 1-15.31. An engineered cell, comprising the polynucleotide of any of embodiments 16-26 or the vector of any of embodiments 29-29.32. The engineered cell of embodiment 30 or 31, wherein the TCR or antigen-binding fragment thereof is heterologous to the cell.33. The engineered cell of any of embodiments 30-32, wherein the engineered cell is derived from a cell line.34. The engineered cell of any of embodiments 30-32, wherein the engineered cell is derived from a primary cell obtained from a subject.35. The engineered cell of any of embodiments 30-34, wherein the engineered cell is a T cell.36. A method for producing an engineered cell comprising introducing the polynucleotide of any of embodiments 16-26 or the vector of any of embodiments 27-29 into a cell in vitro or ex vivo.37. A composition comprising the TCR or antigen-binding fragment thereof of any of embodiments 1-15, the polynucleotide of any of embodiments 16-26, the vector of any of embodiments 27-29, or the engineered cell of any of embodiments 30-35.38. The composition of embodiment 37, further comprising a pharmaceutically acceptable excipient.39. A method for identifying a T cell receptor (TCR) targeting a relatively hematopoietically restricted minor histocompatibility antigen (miHA) , the method comprising: identifying a functional TCR that recognizes a relatively hematopoietically-restricted miHA from among a plurality of functional TCRs, wherein said plurality of functional TCRs are encoded by a plurality of functional TCR-encoding nucleic acid vectors generated by a high-throughput nucleic acid amplification and assembly method using nucleic acids each obtained from a single T cell from among a plurality of T cells; wherein said plurality of T cells is from a donor subject.40. A method for identifying a T cell receptor (TCR) targeting a relatively hematopoietically restricted minor histocompatibility antigen (miHA), the method comprising:(a) generating a plurality of functional TCR-encoding nucleic acid vectors by a high- throughput nucleic acid amplification and assembly method using nucleic acid obtained from a single T cell from among a plurality of T cells; wherein said T cell is from a donor subject; and(b) identifying a functional TCRthat recognizes a relatively hematopoietically-restricted miHA from among a plurality functional TCRs encoded by the plurality of functional TCR-encoding nucleic acid vectors.41. The method of embodiment 39 or 40, wherein the relatively hematopoietically restricted miHA is a minor histocompatibility antigen HA-1.42. The method of any of embodiments 39-41, wherein the identified functional TCR recognizes a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule.43. The method of embodiment 42, wherein the MHC molecule is a human leukocyte antigens (HLA)-A molecule.44. The method of embodiment 43, wherein the HLA-A molecule is of serotype HLA- A*24:02.45. The method of any of embodiments 42-44, wherein the peptide epitope of ACC-1 is set forth in SEQ ID NO: 1.46. The method of any of embodiments 39-45, wherein the T cell from the human donor subject is cultured under conditions for cell expansion of the T cell prior to the generating of the plurality of functional TCR-encoding nucleic acid vectors.47. The method of any of embodiments 39-45, wherein the T cell from the donor subject is not cultured under conditions for cell expansion of the T cell prior to the generating of the plurality of functional TCR-encoding nucleic acid vectors.48. The method of any of embodiments 39-47, wherein the high-throughput nucleic acid amplification and assembly method comprises:(a) amplifying a first amplification product and a second amplification product from complementary DNA (cDNA) generated from RNA obtained from the single T cell among the plurality of T cells sorted into each of a plurality of separate locations of a device, wherein: said first amplification product comprises a nucleotide sequence encoding a full- length variable alpha (Va) region or a full-length variable gamma (Vy) region of a TCR, and said second amplification product comprises a nucleotide sequence encoding a full-length variable beta (VP) region or a full-length variable delta (V5) region of a TCR; and(b) assembling said first amplification product and said second amplification product from each of said plurality of separate locations into a nucleic acid vector to obtain an assembled nucleic acid vector comprising a nucleotide sequence encoding a functional TCR for each of said plurality of separate locations; wherein said functional TCR comprises (i) a full-length Va region and a full-length V region from said single T cell or (ii) a full-length Vy region and a full-length V5 region from said single T cell.49. An engineered cell comprising the TCR identified by the method of any of embodiments 39-48.50. A composition comprising the engineered cell of embodiment 49.51. The composition of embodiment 50, further comprising a pharmaceutically acceptable excipient.52. A method of treatment, the method comprising administering the TCR or antigenbinding fragment thereof of any of embodiments 1-15, the polynucleotide of any of embodiments 16- 26, the vector of any of embodiments 27-29, the engineered cell of any of embodiments 30-35 and 49, or the composition of any of embodiments 37, 38, 50, and 51, to a subject having a disease or a disorder.53. The method of embodiment 52, wherein the subject is eligible for or is to receive an allogeneic hematopoietic stem cell transplantation (HSCT).54. The method of embodiment 52 or 53, wherein the subject has or has been diagnosed with a malignant hematologic disorder.55. The method of any of embodiments 52-54, wherein the subject has or has been diagnosed with acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), or acute lymphoblastic leukemia (ALL).56. The method of any of embodiments 52-55, wherein the treatment induces or enhances cell death of cells associated with the malignant hematologic disorder, or induces or enhances a graft versus leukemia effect (GVL) in the subject.57. The TCR or antigen-binding fragment thereof of any of embodiments 1-15, the polynucleotide of any of embodiments 16-26, the vector of any of embodiments 27-29, the engineered cell of any of embodiments 30-35 and 49, or the composition of any of embodiments 37, 38, 50, and51, for use in the treatment of a disease or a disorder in a subject.58. Use of the TCR or antigen-binding fragment thereof of any of embodiments 1-15, the polynucleotide of any of embodiments 16-26, the vector of any of embodiments 27-29, the engineered cell of any of embodiments 30-35 and 49, or the composition of any of embodiments 37, 38, 50, and51, in the manufacture of a medicament for the treatment of a disease or a disorder in a subject.59. Use of the TCR or antigen-binding fragment thereof of any of embodiments 1-15, the polynucleotide of any of embodiments 16-26, the vector of any of embodiments 27-29, the engineered cell of any of embodiments 30-35 and 49, or the composition of any of embodiments 37, 38, 50, and 51, for the treatment of a disease or a disorder in a subject.EXAMPLES

[0256] The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention.Example 1. Donor Selection and Candidate T Cell Receptor Screening

[0257] T cells expressing TCRs that can target relatively hematopoietically restricted miHA ACC- 1 were obtained from a donor subj ect, and screened for binding to particular ACC- 1 peptide variants.A. Donor Criteria

[0258] T cells expressing a TCR that can target an immunogenic allele of a miHA were obtained from a donor subject. Donor T cells were isolated and screened for their ability to specifically target an immunogenic allele of the relatively hematopoietically-restricted miHA ACC-1.

[0259] Blood of donors was analyzed using whole exome sequencing to determine their HLA repertoire and polymorphisms encoding the HLA-A*24:02 restricted ACC-1 peptide (DYLQYVLQI; SEQ ID NO: 1) or the non-immunogenic “C” variant (DYLQCVLQI; SEQ ID NO:2). Donors having appropriate HLA type or HLA haplotype, e.g., an HLA-A*24:02 restricted ACC-1 C / C phenotype, were selected as potential donors. PBMCs were drawn from donors who met the described criteria.B. PBMC Screening to Identify ACC- 1 -Targeting T Cells

[0260] Collected PBMCs were either directly screened for the presence of ACC- 1 -specific T cells or first expanded in vitro. Using cells from the same donor, unexpanded and expanded cultures were compared to inform future screening strategies.1. Direct Sample Screening

[0261] Donor cells were stained with an allophycocyanin (ape) A*24:02 / ACC-1 fluorescent labeled dextramer, then sorted using fluorescence-activated cell sorting (FACS). The CD8+ ACC-1 reactive cells were then added to a 384-well plate for further processing.2. Expanded Culture Screening

[0262] PBMCs from the same donor were expanded in vitro using either the naked peptide or the peptide in the presence of donor antigen presenting cells (APCs). In the first approach, resident APCs in the PBMC sample were stimulated by adding 10 pg / mL of the ACC-1 “Y” peptide. The cells were then cultured in the presence of cytokines for 10 days. In the second approach, CD19+ B cells (B-APCs) were similarly co-cultured for 10 days at a 1 : 10 B- APC / PBMC ratio, again in the presence of cytokines.

[0263] At day 10, samples from both cultures were analyzed by FACS for expansion. Cells were stained with an irrelevant A*24:02 dextramer for counter-selection. Two ACC-l / A*24:02dextramers, one labeled with ape, the other with FITC, were used to detect reactive TCRs. Double positive cells were identified in both expanded cell cultures, indicating the potential presence of specific ACC-1 TCRs. CD8+ T cells were added to 384-well plates for amplification, cloning and assessment based on a high-throughput TCR amplification and assessment methods as described in Example 2 below.Example 2. High-Throughput TCR Chain Amplification and Expression

[0264] Sorted T cells that potentially express TCRs specific for an immunogenic allele of ACC-1 obtained from a donor subject, as described in Example 1 above, were assessed using a high-throughput TCR cloning and identification method.A. TRAV / TRBV Amplification

[0265] Cells in 384-well plates were stained with a FITC / apc ACC-1 dextramer prior to analysis. Cells that stained double-positive for FITC / apc ACC-1 dextramer were single cell sorted using FACS.

[0266] The T cell receptor alpha variable (TRAV) and T cell receptor beta variable (TRB V) chains of the sorted cells were amplified using a high throughput method, generally as described in WO2018102473. TRAV and TRBV were efficiently amplified (concentrations of more than 5 ng / pL DNA), resulting in amplification of TCR alpha / beta pairs. Amplified TRAV / TRBV from each of the sorted cells were assembled into a lentivirus plasmid vector, resulting in the generation of positive bacterial cultures, an indication of proper plasmid assembly.B. Cell Surface Expression and Target Binding

[0267] Plasmids were extracted using an automated platform, and were transfected at once using robotics into an HEK293 cell line engineered to permit surface TCR expression by cells expression of human CD3y, CD35, CD3s, CD3(^ (polyCD3) and human CD8 a / p.

[0268] After 24 hours, cells were stained with both an anti-CD3 antibody, to determine surface TCR expression, and an ACC-1 dextramer to screen for specific T cell receptors. A model ACC-1 receptor identified from non-expanded screen was used as a positive control showing both CD3 and ACC-1 dextramer staining. An ACC-1 TCR derived from a separate screen was used as a negative control, exhibiting surface TCR expression by the CD3 staining but no specific binding to the ACC-1 dextramer.

[0269] FACS analysis after the transient expression of clones into HEK293 cells showed demonstrated surface TCR expression in the transfected cells.

[0270] For T cells that stained positive for ACC-1 obtained from direct sample screening (Example 1B1), the sequences encoding the TCR were assembled into lentivirus vectors that co-expressed a red fluorescent marker (mCherry) as a transfection efficiency control. The plasmids were directly transiently transfected into the engineered HEK293 cells permissive for surface expression of TCRs.

[0271] After overnight incubation, cells were assessed by FACS. A high transfection efficiency was observed in HEK cells transfected with TCRs from unexpanded cells. Transfections resulted in TCR expression as determined by staining with a monoclonal antibody IP26 that detects TCR surface expression.C. TRBV Sequencing

[0272] TRBVs were sequenced in parallel with the expression screen described above to assess expansion and clonality.

[0273] This result indicated significant enrichment via successful expansion of specific ACC-1 T cells. 9 different TRBV genes were detected.D. TCR Attributes of Unexpanded and Expanded Donor PBMCs

[0274] The TCRs from T cells from unexpanded and expanded screens as described in Example 1 were analyzed to assess clonal distribution and sensitivity of the high-throughput TCR identification method.

[0275] 9 distinct clones, based on their unique TRAV and TRBV sequences were isolated.Example 3. Exemplary Identified TCRs

[0276] The Examples describe the successful isolation, cloning, screening, identification, sequence determination, and characterization of minor histocompatibility ACC- 1 -specific TCRs. The TCRs were obtained from a donor subject and screened using a high-throughput method to obtain full length TCRs. 5 TCRs exhibited an ECso below 200 nM against the immunogenic ACC-1 peptide Y peptide.

[0277] Table 4 lists the sequence identifiers (SEQ ID NOs) for amino acid (aa) or nucleotide (nt) sequences for ACC-1 specific TCRs that were isolated, assessed, and sequenced using methods described above. The table also lists the sequence identifier (SEQ ID NOs) corresponding to an exemplary full-length, including the constant domains, amino acid sequence containing the alpha and beta chain sequences of each respective TCR, separated by a sequence encoding a ribosome-skip P2A sequence (P2A linker set forth in SEQ ID NO: 129 encoded by the nucleotides set forth in SEQ ID NO: 130) (designated “alpha-P2A-beta”). In some embodiments, the full length TCR comprises a beta-P2A-alpha configuration.Table 4: Amino Acid and Nucleotide Sequences of ACC-1 Specific TCRs*Altematively the sequence may also be constructed as beta-P2A-alphaExample 4. Characterization of Exemplary ACC-1 Specific TCRs

[0278] As described herein, minor histocompatibility antigens (miHAs) relatively restricted to hematopoietic cells are ideal targets for adoptive T cell immunotherapy in the context of stem cell transplantation (SCT), as T cells that target them can mediate graft-versus- leukemia and promote engraftment with a low risk for graft-vs-host disease. Multiple exemplary TCRs reactive against the hematopoietic cell-restricted miHA ACC-1, isolated from a donor subject, were identified using the high-throughput screening method generally as described in Examples 1-3 above, were characterized.

[0279] In summary, an HLA-A*24:02 subject homozygous or heterozygous for the Y peptide of the ACC-1 antigen was identified. TCRs were cloned from single-cell-sorted ACC- 1 dextramer+ (dexACC'1+) CD8+T cells from unstimulated peripheral blood mononuclear cells (PBMCs) and subsequently from the CD8+T cells co-cultured for one week with ACC-1 peptide-pulsed antigen-presenting cells (APCs). TCRs were re-expressed in reporter cells using lentivirus vectors and analyzed for dextramer binding and CD69 upregulation after culture with ACC-l(Y) peptide-pulsed APCs. Cloned TCRs were sequenced to characterize TCR diversity.

[0280] 6 unique ACC- 1 -reactive TCRs were identified from sorted dexACC'1+CD8+T cells from unstimulated PBMCs. When re-expressed, all 6 bound Y peptide dextramer with various intensities (Table 5).

[0281] The results are consistent with the isolation of various TCRs exhibiting affinities against a single allopeptide / HLA complex (DYLQYVLQI / HLA-A*24:02).Example 5. Binding Specificity of Exemplary ACC-1 Specific TCR

[0282] Binding specificity of the ACC-1 specific TCRs is determined using dextramers complexed with immunogenic or non-immunogenic ACC-1 peptides.

[0283] HEK293 suspension cells engineered to express human CD3y, CD35, CD3s, CD3(^ (polyCD3) and human CD8 a / p. CD3 and CD8 are cloned from pooled PBMCs from two healthy blood donors and introduced into HEK293 cells using separate expression plasmids. Suspension HEK293-CD3-CD8 cells are transiently transfected with plasmid DNA containing an anti-ACC-1 TCR and the fluorescent protein mCherry, as a transfection efficiency control.

[0284] Twenty-four hours after transfection, cells are stained with an amine-reactive viability dye (violet 510 Ghost dye), anti-CD3 and the immunogenic ACC-1 “Y” peptide dextramer or non-immunogenic ACC-1 “C” peptide dextramer. Cells are acquired and analyzed by flow cytometry.

[0285] Double positive fluorescence of mCherry and specific binding of HLA-dextramers complexed with the ACC-1 “Y” peptide indicate a functional and desirably reactive TCR.Example 6. In vitro Evaluation of Engineered T Cell Reactivity to Relatively Hematopoietically Restricted Minor Histocompatibility Antigen ACC-1

[0286] TCRs isolated and identified as described in Examples 1-3 above were recombinantly expressed in a cell line, and further characterized and assessed for function, including EC50 determination. Cytokine secretion, T cell activation and binding specificity can also be determined for each of the TCRs.A. Cytokine Secretion

[0287] To assess the function of anti-ACC-1 TCR-bearing T cells, the secretion of IL-2, an activation-induced cytokine, in response to co-culture with peptide-loaded APCs is investigated using an enzyme-linked immune absorbent spot (ELISpot) assay.

[0288] A Jurkat J.RT3-T3.5-CD8 T-cell stable cell line is engineered to express human CD8a / p. CD8 is cloned from mixed PBMCs from two healthy donors. The cell line is then transduced with a lentivirus (pLVX-Puro, Clontech Laboratories, Inc.) expressing the various ACC-1 TCRs identified as described above.

[0289] The transduced Jurkat T cells are co-incubated overnight with A*24:02 HLA Lymphoblastoid Cell Lines (LCLs) that are used for presentation into various MHC molecules and serve as APCs, at a 1 : 1 effector to target ratio (E / T) in the presence or absence of the immunogenic ACC-1 Y peptide (DYLQYVLQI). Analysis of cell mixtures using ELISpot is performed according to the manufacturer’s instructions (Human IL-2 ELISpotbasic, MabTech)to assess the ability of the Jurkat T cells to secrete IL-2 in the presence of APCs presenting the target ACC-1 peptide.

[0290] For an exemplary ACC-1 specific TCR, Jurkat T cells expressing the ACC-1 TCR are co-cultured with T2 lymphoblast cells pulsed with ACC-1 “Y” or ACC-1 “C” peptide. Equal numbers of Jurkat T cells and T2 cells loaded with increasing concentrations (e.g., 0.1- 31.6 ng / ml) of either ACC-1 peptide are co-cultured for 16 hours. IL-2 secretion is assessed by ELISpot analysis. Jurkat T cells without T2 APCs and T2 APCs without Jurkat T cells serve as negative controls.B. Assessment of Early Activation Marker CD69

[0291] Expression of CD69, a marker of T cell activation and function, was assessed following co-culture of Jurkat T cells expressing an ACC-1 TCR with APCs loaded with ACC- 1 (Y) peptides.

[0292] Jurkat J.RT3-T3.5-CD8 T cells expressing various anti-ACC-1 TCRs were prepared as described above in Example 4A. Jurkat cells transduced with anti-ACC-1 TCRs were incubated overnight with A*24:02 LCLs at a 1 : 1 E / T ratio in the presence of increasing concentrations of ACC-1. The ECso values were calculated based on XLfit (ID Business Solutions) on plots of the percentage of CD69+ cells (y-axis) vs. peptide concentration (logarithmic x-axis). Table 5 lists the determined ECso values for CD69 expression for the listed ACC- 1 -specific TCRs. Several clones were found to exhibit an ECso of less than 50 nM, indicating high affinity binding to LCLs loaded with cognate peptides.

[0293] Anti-ACC-1 TCR-expressing T cells were co-cultured in duplicate at a 1 : 1 effector- to-target ratio with LCL HG0017 antigen presenting cells or peptide-loaded T2 antigen presenting cells. After 16-24 hours of culture, cells were washed and stained with Ghost Dye, anti-CD3 and anti-CD69 and assessed by flow cytometry. Data are analyzed by XLFit (Table 5). The estimated ECso of experimental runs was determined by assessing the ratio of CD69 positive Jurkat cells to total live cells. For tetramer binding, tetramer conjugated with fhiorophore was incubated with T cells and analyzed by flow cytometry.Table 5. ECso for CD69 Expression in Exemplary ACC-1 Specific TCRsC. Assessment of T Cell Receptor Specificity

[0294] Specificity of the candidate ACC-1 targeting TCRs against the ACC-1 “Y” versus “C” peptide presented by the restricting HLA, or potentially other HLA molecules, or other HLA molecules presenting other peptides, is also assessed.1. LCL and Target Specificity

[0295] The specificity against the immunogenic ACC-1 “Y” allele compared to the non- immunogenic “C” allele is assessed based on a CD69 expression assay using various LCLs displaying different ACC-1 alleles.

[0296] Jurkat J.RT3-T3.5-CD8 T cells expressing the various anti-ACC-1 TCR are cocultured for 16 hours at a 1 : 1 effector to target ratio with HLA-A*24:02 restricted LCLs that display various ACC-1 haplotypes (Astarte Biologies). Different LCLs, characterized by the presence or absence of the ACC-1 “Y” peptide, are used in the study. Following co-incubation, cells are stained with violet 510 Ghost dye and apc-conjugated anti-CD69. Cells are assessed by flow cytometry.

[0297] CD69 activation in T cells expressing the described TCRs is measured when the cells are co-cultured with LCLs that both express HLA-A*24:02 and are loaded with the immunogenic allele of ACC-1. Activation of CD69 indicates the anti-ACC-1 TCR expressed by the engineered T cell recognizes ACC-1 that is naturally processed by a target cell.2. Alloreactivity

[0298] Candidate TCRs are screened against a panel of HLA-typed LCLs to assess possible alloreactivity. Using a method similar to the CD69 activation assay described in Example 6B above, ACC-1 TCRs are assessed for alloreactivity against the panel of HLA Class I and Class II molecules.Example 7. Target Cell Killing of Primary Cells Transduced with ACC-l-Specific TCRs

[0299] To determine the potential for inducing a graft-versus-leukemia (GvL) effect, the anti-leukemia target cell killing activity of primary T cells transduced with an anti-ACC-1 TCRs was assessed.A. Expression of ACC-1 Specific TCRs in Primary Cells

[0300] Primary human CD8+T cells were enriched from PBMCs by negative selection. The endogenous TCR of the CD8+T cells was knocked out via CRISPR. The CD8+T cells were then transduced with a lentivirus vector (pLVG.M containing an MNDU3 promoter) encoding an anti-ACC-1 TCR and a RQR8 (CD34 and CD20 synthetic marker) tag. The percentage of the transduced T cells was evaluated the by expression of RQR8, using an anti- CD34 antibody, by flowcytometry at day 5 post-transduction.B. Target Cell Killing

[0301] The target cell killing specificity of TCR A and TCR D were assessed. LCL (LCL17968, immunogenic) cells that were HLA typed and determined positive for the A*24: 02 MHC class I molecule was used as immunogenic APCs. The ACC-1 genotype was Y / Y. LCL19901 cells were used as non-immunogenic APCs (C / C genotype). The LCL cells were stained with 5(6)-carboxyfluorescein diacetate N-succinimidyl ester (CFSE). CFSE labels target cells by binding of the dye to intracellular protein, and indicates T cell-mediated target cell killing. Apoptosis of labeled cells results in the loss of their detection in the live cell gate in flow cytometry. Primary human T cells expressing an anti -ACC- 1 TCR A or TCR D were co-cultured with the LCLs for 18 hours at E:T ratios of 20: 1, 10: 1. 5: 1, 2.5: 1, 1.25: 1, 0.62: 1, 0.31 :1, and 0: 1 (or 10: 1. 5: 1, 2.5: 1, 1.25: 1, 0.62: 1, 0.31 : 1, 0.15: 1, and 0: 1. Cells were stained with 7-AAD (to evaluate the cell viability), acquired, and assessed by flow cytometry. Target cell killing results are shown in Table 6.Table 6. Target cell killing.Example 8. Target Cell Killing Activity

[0302] The target cell killing activity by engineered T cells expressing various heterologous TCRs was assessed at different effectortarget (E:T) ratios.

[0303] LCLs were genotyped for the ACC-1 haplotypes C / C (DYLQCVLQI) (LCL19901) or Y / Y (DYLQYVLQI) (LCL17698). In order to distinguish cell populations, LCLs presenting the “C” peptide were labeled with a low concentration of 5(6)-carboxyfluorescein diacetate N- succinimidyl ester (CFSE) (0.025 pM), while LCLs presenting the “Y” peptide were labeled with a high concentration (0.5 pM) of CFSE. LCLs were stained with CFSE for 15 minutes at 37°C. ACC-1 “Y” or “C”-peptide-bearing LCLs were mixed together in a 1 : 1 ratio prior to incubation with increasing numbers of engineered primary T cells expressing an anti -ACC- 1 TCRs.

[0304] LCLs were co-cultured with increasing numbers of primary T cells for 16 hours (E:T ratios 0: 1, 0.15: 1, 0.31 : 1, 0.62: 1, 1.25: 1, 2.5: 1, 5: 1, and 10: 1 or 0: 1, 0.31 : 1, 0.62: 1, 1.25: 1, 2.5: 1, 5:1, 10: 1, and 20: 1). Cell mixtures were stained with LIVE / DEAD Fixable Violet Dead Cell Stain Kit (Thermo Fisher Scientific), anti-CD8 and anti-CD19, to assess the two distinct target cell populations by CFSE staining levels. Cells were acquired and analyzed by flow cytometry, to assess CD8- cells (to exclude effector cells) and the CFSE high versus CFSE low populations.

[0305] Live cell counts of LCLs presenting either ACC-1 “Y” peptide or “C” peptide following incubation with non-transduced T cells and an exemplary anti-ACC-1 TCR transduced T cells. Loss of viable cells presenting ACC-1 “Y” peptide (high CFSE staining), with concomitant observation of retention of viable cells presenting ACC-1 “C” peptide (low CFSE staining) as the effector to target (E:T) ratio increased indicates selective killing of target cells presenting the immunogenic ACC-1 “Y” peptide by T cells genetically engineered to express an ACC-1 specific TCR. Engineered T cells expressing TCR A was observed to kill target Y / Y cells at a lower ratio of effector cells to target cells relative to non-target C / C cells and / or were less cytotoxic to non-target C / C cells.Example 9. Engineered T cell therapy cytotoxicity

[0306] I. Methods

[0307] A. Cell culture conditions. All cells were maintained in a tissue culture incubator at 37°C 5% CO2 unless stated otherwise. Jurkat, tumor cells were cultured in Roswell Park Memorial Institute Medium (RPMI) 1640 supplemented with 10% heat inactivated fetal bovine serum (HI-FBS) and penicillin / streptomycin. 293T and 293F cells were grown in Dulbecco’s modified Eagle Medium (DMEM) culture medium was supplemented with 10% HI-FBS, penicillin / streptomycin (100 lU / mL; 100 mg / mL). 293F cells were stably transfected to express human CD3gdez chains (poly-CD3) and CD8P isoform M4 to present transfected-TCRs on thecell surface. Jurkat clone J.RT3-T3.5 TIB-153 with cluster of differentiation 8b-M4 (CD8b- M4) was utilized for surface expression and functional analyses of cloned TCRs. K562 were maintained in Iscove's Modified Dulbecco's Medium (IMDM) 1640 supplemented with 20% HI-FBS and penicillin / streptomycin. Lymphoblastoid cell line (LCL) lines were maintained in RPMI 20% HI-FBS and penicillin / streptomycin. Cells were maintained as recommended by ATCC and the Cori ell Institute of Medical Research.

[0308] B. Fluorescence-activated cell Sorting (FACS) Analysis. For cell line and edited T- TCR analyses, cells were washed and resuspended in 100 pL of FACS buffer (PBS, and 2% FBS) with surface staining antibodies. For functional assays, cells were stained in 96 well plates, washed and stained in a final volume of 100 pL. Cells were stained at 4°C for 30 min, washed and resuspended in FACS buffer prior to FACS analysis. For violet proliferation dye 450 (VPD450), cells were stained with 0.5 pM of VPD450 for 15 min at 37°C then washed 2* in media prior to coculture. For tetramer staining, cells were stained at a 1 :40 dilution for 1 h at room temperature (staining volume of 100 pL to 1 mL FACS buffer). All cells were washed 1 X prior to staining and 2x following staining in 2x staining volume with wash buffer (unless stated differently). FACS analysis was performed using the NovacyteQuanteon.

[0309] C. Generation of TCR plasmid constructs. Next Generation Sequencing (NGS) results data was curated by the identification of complementary determining region 3 P (CDR3B) sequences to identify expanded clones. One TCR clone was identified per well. For selection of potential TCR candidates expanded clones identified by NGS were cross- referenced with TCXpress tetramer binding data. Sequencing data was further validated by confirmation of high-quality alpha / beta and SUM reads (previously validated by NGS). Subsequently, the sequence for multiple expanded alpha and beta clones were aligned using the BSB BIX platform and curated for quality alignment. The consensus TCR alpha and beta sequences were aligned against the human IMGT database TCR reference sequences. The T cell receptor a variable domain (TRAV) and T cell receptor p variable domain (TRBV) human references sequences were then utilized for the final construct design. The final gene block architecture was as follows 5' overhang (tgatcagactgtcacccgtctccc, SEQ ID NO: 134) - TRBV - TRBC - GSG linker - P2A linker - TRAV 3' overhang (attcatgagacgggtgtcatgtcagact; SEQ ID NO: 135). For TRAV and TRBV, GeneArt was utilized to codon optimize the construct and the original and optimized sequences were confirmed by alignment. The gene block TCR insert was subsequently synthesized by IDT. For golden gate cloning, the synthesized gene block insert and RQR8 reporter were cloned into the MNDU3 vector. The MNDU3 vector(containing an irrelevant TRAC and RQR8) and TCR insert were restricted by BSMBI according to manufactures instructions. The linear vector and insert were cloned utilizing NEBridge Golden Gate Enzyme Mix per manufactures instructions. Alternatively, vector and insert were PacCI restriction digested utilizing Pact activator and ligated with T4 ligase (RQR8 insert present in the entry vector). The ligated construct was transformed into Mix & Go DH5a competent cells and recovered in S.O.C. medium and selected utilizing Luria-Bertani (LB) kanamycin plates. After 16 to 24 h incubation 3 colonies were selected and a colony PCR was performed to confirm successful cloning. Colonies were cultured for 16 h prior to plasmid min- prep. Plasmids were subsequently sequenced to confirm successful golden gate cloning of the TCR.

[0310] D. Lentiviral particle production. Recombinant lentiviruses were produced by transient co-transfection of293T suspension cells as follows: a total of 30>< 106293T suspension cells were resuspended at l >< 106 / mL in 293 Freestyle media and seeded in a 125 mL shaker flask with ventilated cap prior to transfection and incubated at 37°C and 8% of CO2 on shaker.

[0311] Two 15 ml tubes were prepared. In the first tube was used to mix 1 : 1 : 1 : 1 molar ratio of pPack-GPK : pPack-RK : pPack-VSVg : gDNA plasmid (summarized above) in 1.5 mL of Opti-MEM; in the second tubes polyethylenimine (PEI) was added at 1.5 ml of Opti-MEM. The tubes with deoxyribonucleic acid (DNA) or PEI tubes were incubated at room temperature for 5 minutes before mixing. Once the two tubes were combined, the tube with the mix was gently inverted 3-4 times and incubate for 30 min at room temperature in the dark. The transfection mix was added over the suspension cells (the total volume of the mix was 10% of the total volume transfected) and incubated at 37°C and 8% of CO2 for 48 h on shaker at 135 rpm.

[0312] After 48 h the culture of transduced cells was collected into 50 mL tubes and centrifuge at 4°C at 500xg to pellet cells and to collect the viral supernatant. For initial screens, unconcentrated virus was used to transduce Jurkat cells as described below. For primary cell transductions, a separate tube, 1 volume of Takara lenti-x concentrator was added to 3 volumes of lentivirus supernatant mixed by inversion (5 times) and incubated for 16-24 h at 4°C. After incubation the tubes were centrifugated at 1500xg for 60 minutes. Without disturbing the pellet, the supernatant was removed. The pellet was resuspended in 100x concentrated volume. The virus was resuspended 25 pL of virus was aliquoted in pre-labeled tubes.

[0313] E. Transient transfection of 293T cells and evaluation of TCR multimer binding. Glycerol stocks were grown for 16 h at 37°C in LB broth with Kanmycin. Maxi preps of theplasmids were prepared and validated by sequencing. For transient transfection, 293T cells were washed twice and separated from plates with TryplE Express. DMEM + 10% FBS was added to the cells and washed twice with media. Cells were resuspended in supplemented DMEM, counted and adjusted to 500,000 cells / mL. 100 ng of plasmid DNA was added to 9 pL of Opti-MEM, mixed and pulse spun to sediment the DNA preparation. To each tube, 0.3 pL TransIT-X2 transfection reagent was added, mixed gently and pulse spun prior to room temperature incubation between 15 and 30 min. 100 pL 293T cells were added to 96-well plates. After 30 min incubation the cells and transfection mix were added together and incubated at 37°C 5% CO2 for 24-48 h. After 48 h, transfected cells were stained with relevant MHCI-multimers, anti-TCR antibody (Ab) (clone IP26) and anti-CD3, followed by flow cytometry analysis.

[0314] F. Creation of TCR-expressing Jurkat cell lines. TCRs validated through deconvolution and cloned into lentiviral donor plasmids using gene blocks had VSV-g- pseudotyped lentivirus created for each construct. TCR-encoding lentivirus was used to transduce Jurkat lines that were modified to lack endogenous TCR expression and to express the CD8b M4 isoform (MOI 2.5). In some experiments, transduced Jurkat cells were subjected to puromycin selection to enrich TCR-transduced cells as the constructs encode a puroR gene.

[0315] G. TCR-T engineering and expansion. CD8+ T cells were purified from an apheresis product collected from a male donor who never received a blood transfusion. Peripheral blood mononuclear cells (PBMCs) were purified from the apheresis by Ficoll density gradient separation. PBMCs were washed and subsequently frozen in CryStor at 50* 106cells / mL. Following rapid defrosting PBMCs were adjusted to a density between 5- 18* 106cells / mL in complete CTS medium supplemented with 50 U IL-2 and 10 ng / mL IL-7. PBMCs were activated with 60 ng / mL of OTK-3 anti-CD3 antibody overnight. CD8 cells were isolated by magnetic separation (CD8 positive selection kit). Activated CD8+ T cells were edited for deletion of endogenous TCRa and TCRP genes by electroporation (4D nucleofector) with Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / Cas9 ribonucleoprotein complexes with TRAC gRNA (gagaatcaaaatcggtgaat, SEQ ID NO: 136) and TRBC gRNA (cacccagatcgtcagcgccg, SEQ ID NO: 137). Following electroporation recovery for 2 h, the cells were engineered to express anti-miHA TCRs tagged with truncated CD34, by lentiviral transduction at an MOI of 2.5. Engineered CD8+ T cells were expanded in CTS medium supplemented with interleukin (IL)-2 and IL-7 for 6-8 days. At the end of culture between 50-70% of CD8 cells were CD34+. CD8 cells from control cultures that were CRISPR-edited but not lenti virus-transduced were <10% TCR+or CD3+indicating efficient TCRa or TCRP editing. TCR-T (T Cell Receptor therapy) cells were purified by CD34+ magnetic separation for >90% CD34+ positive TCR-T.

[0316] H. Stimulation of TCR-expressing Jurkat cells to estimate EC 50s. TCRs were evaluated for the ability to induce T cell signaling by HLA presented target peptide (DYLQYVLQI or DYLQCVLQI). In brief, Jurkats were engineered to express the relevant TCR, K562 peptide matched HLA cells were pulsed with a serial dilution of the relevant target peptide and control peptide. Peptide pulsed non-immunogenic LKT-3 (ACC-1) and Jurkat reporter cells subsequently co-cultured at an effector to target (E:T) ratio of 1 : 1 (50,000:50,000 cells per well in a 96 well plate) for 16-18 h to evaluate TCR signaling. Expression of CD69 on Jurkat cells was evaluated as a surrogate marker of T cell activation by the target peptide. Jurkat and LCL cell lines were cultured in RPMI and IMDM, respectively. Peptides were diluted in phosphate buffered saline (PBS) prior to peptide pulse. Cells were pulsed with diluted peptide 1 h prior to co-culture. CD8+ Jurkat cells were lentivirally transduced with TCRs and purified by FACS based sorting on TCR positive cells. LCLs were generated via pan HLA class I knock out (KO), lentivirally transduced with the relevant HLA and purified by FACS sorting prior to performing reporter assays. Cells were stained with fixable violet live-dead dye and antibodies against CD3, CD34 and were assessed for CD69 upregulation using NovacyteQuanteon. The fraction of cells that upregulated CD69 at each peptide concentration was plotted to estimate the EC50 (peptide concentration that provoked a response midway between the baseline and the maximum) of each TCR after fitting logistic dose-response curves (Prism GraphPad).

[0317] I. Exogenous cytotoxicity assay (peptide pulse). Relevant TCRs were evaluated for cytotoxicity in non-immunogenic HLA matched LCL19901, LCL17995, or LKT3 cells. Non- immunogenic cells lines were peptide pulsed with serial dilution of irrelevant control peptide or target peptide (5000 ng / mL (high), 158 ng / mL (intermediate), or 5 ng / mL (low), as described for Jurkat report assays described above. In brief, primary CD8+ T cells from relevant HLA negative healthy donors were engineered to knock-out the endogenous TCR a and P constant chain domains. Subsequently, the CD8+ cells transduced with the relevant TCR were cocultured with the matched cell line pulse with control and target peptides at a 1 : 1 ratio (35,000- 50,000 effector / target cells per well in a 96 well plate). Additionally, irrelevant TCRs and knockout (KO) transduced control cells were used as negative controls. In some experiments, previously published miHA TCRs were used as positive controls. After 16-18 h, the co-culturedcells were stained with fluorescently tagged or cell dyes for CD8 (primary T cell specific marker), VPD450 and live / dead staining. Cells were analyzed utilizing the NovacyteQuanteon.

[0318] J. Endogenous cytotoxicity assay. CD8 cells, isolated from a healthy relevant HLA- A negative donors (BioIVT), were edited to knock down endogenous TCRa and TCRP by CRISPR / Cas9 and transduced by lentivirus encoding relevant TCRs. Transduced CD8 cells were cocultured at different E:T ratios (10: 1 (high), 2.5: 1 (intermediate), or 0.62: 1 (low)) with immunogenic or non-immunogenic cells in 96 well plates for 16 h Effectors were enumerated based on being CD8+CD3+CD34+. Target cells were stained with VPD450 to enable discrimination of target / control and CD8 cells by flow cytometry. Cultures were harvested, stained with 7- Aminoactinomycin D (7-AAD) and viable target cells were enumerated by flow cytometry. Normalized viability was calculated based on the following formula: (number of viable targets in the presence of effectors / mean of viable target cells of the three wells without T cells) xlOO. Relevant anti-miHA TCRs were evaluated for cytotoxicity in immunogenic HLA matched LCL 17968 or LCL436 target cells atE:T ratios of 0.15-20: 1. In brief, transduced CD8 cells were cocultured at E:T ratios with immunogenic or non-immunogenic target cells in 96 well plates for 16 hours. Engineered CD8+ TCR-T cells were co-cultured with immunogenic (target) or non-immunogenic cells (negative control cells) at varying E:T ratios in 96 well plates. For TCR-T negative control conditions, irrelevant TCR-T or untransduced control (UTC) KO cells were included. After co-culture the cells were stained with fluorescently tagged antibodies or cell dyes for CD8 (primary T cell specific marker), and live / dead staining. Target cells were stained with VPD450 prior to co-culture. Cells were analyzed utilizing the NovacyteQuanteon. Data is presented as the percent of immunogenic cells (sensitive to immunogenic killing) vs non-immunogenic cells with effective concentration 50 (EC50) of E:T ratios being calculated in GraphPad.

[0319] II. Results

[0320] Tetramer binding and reporter CD69% assays are shown in FIG. 1 . For functional cytotoxicity assays example data are summarized for endogenous killing assays presented as a percentage of immunogenic and non-immunogenic cells following incubation with lead TCRs and as line graphs representing E:T ratio EC50 cytotoxicity. Additionally, peptide pulse assays are represented by bar graphs.

[0321] Tetramer binding above 50% in CD3+ expressing 293T and Jurkat cells were observed for 15 anti-ACC-1 TCRs. Example tetramer binding FACs plots for an exemplary anti-ACC-1 TCRs are shown below (FIG. 1). Jurkat reporter assays were also performed. Themajority of TCRs demonstrated a Jurkat CD69% expression peptide concentration EC50 below 100 ng / mL. Of note, ACC-1 TCR E had a peptide EC50 concentration of 1349 ng / mL. Lead TCRs demonstrated cytotoxicity EC50 E:T and pulse peptide cytotoxicity peptide EC50 concentrations of <1 : 1 and < 5 ng / mL. As can be seen for ACC-1 TCR C (FIG. 2), this TCR had clear potent in vitro cytotoxicity. When comparing Jurkat reporter assays to pulse peptide cytotoxicity assays, TCR activation and killing are correlated though not necessarily dependent leading to difference in peptide concentrations to induce either T cell process. Cytotoxicity is also illustrated in FIGs. 4-9.

[0322] For primary TCR-T generation, endogenous TCR KO and functional engineered TCR expression was determined by FACS analysis (FIG. 3).

[0323] Tetramer binding and CD69 expression validation data are shown in Table 7.

[0324] Table 8 summarizes primary TCR-T cytotoxicity assays. TCRs A and C had E:T ratios of less than 1 in replicate assays. Tetramer binding was consistently >80%, and EC50 CD69% reporter assay and peptide pulse cytotoxicity assay peptide concentration less than 100 ng / mL.

[0325] Endogenous killing assays have identified TCRs with the capacity to kill target cells at sub-1 : 1 TCR-T to target ratios for ACC-1 TCRs.Table 7. Tetramer binding and CD69 expression validation data.Table 8. Summary of TCR cytotoxicity assay results.

[0326] The present invention is not intended to be limited in scope to the particular disclosed embodiments, which are provided, for example, to illustrate various aspects of the invention. Various modifications to the compositions and methods described will become apparent from the description and teachings herein. Such variations may be practiced without departing from the true scope and spirit of the disclosure and are intended to fall within the scope of the present disclosure.Table 9. Sequences

Claims

Claims1. A T cell receptor (TCR) or antigen-binding fragment thereof, comprising: an alpha chain comprising a variable alpha (Va) region and a beta chain comprising a variable beta (VP) region; or a gamma chain comprising a variable gamma (Vy) region and a delta chain comprising a variable delta (V5) region; wherein:(a) the Va or Vy region comprises a complementarity determining region 3 (CDR- 3) comprising SEQ ID NO: 13, and the VP or V5 region comprises a CDR-3 comprising SEQ ID N0:21;(b) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO:31, and the VP or V5 region comprises a CDR-3 comprising SEQ ID NO:39;(c) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO:49, and the VP or V5 region comprises a CDR-3 comprising SEQ ID NO:57;(d) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO:67, and the VP or V5 region comprises a CDR-3 comprising SEQ ID NO:75;(e) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO:85, and the VP or V5 region comprises a CDR-3 comprising SEQ ID NO:93; or(f) the Va or Vy region comprises a CDR-3 comprising SEQ ID NO: 103, and the VP or V5 region comprises a CDR-3 comprising SEQ ID NO: 111.

2. The TCR or antigen-binding fragment thereof of claim 1, wherein:(a) the Va or Vy region comprises a complementarity determining region 1 (CDR- 1) comprising SEQ ID NO: 11, and a complementarity determining region 2 (CDR-2) comprising SEQ ID NO: 12, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO: 19, and a CDR-2 comprising SEQ ID NO:20;(b) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:29, and a CDR-2 comprising SEQ ID NO:30, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:37, and a CDR-2 comprising SEQ ID NO:38;(c) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:47, and a CDR-2 comprising SEQ ID NO:48, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:55, and a CDR-2 comprising SEQ ID NO:56;(d) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:65, and a CDR-2 comprising SEQ ID NO:66, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:73, and a CDR-2 comprising SEQ ID NO:74;(e) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:83, and a CDR-2 comprising SEQ ID NO:84, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:91, and a CDR-2 comprising SEQ ID NO:92; or(f) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO: 101, and a CDR-2 comprising SEQ ID NO: 102, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO: 109, and a CDR-2 comprising SEQ ID NO: 110.

3. A T cell receptor (TCR) or antigen-binding fragment thereof, comprising: an alpha chain comprising a variable alpha (Va) region and a beta chain comprising a variable beta (VP) region; or a gamma chain comprising a variable gamma (Vy) region and a delta chain comprising a variable delta (V5) region; wherein:(a) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO: 11, a CDR-2 comprising SEQ ID NO: 12, and a CDR-3 comprising SEQ ID NO: 13, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO: 19, a CDR-2 comprising SEQ ID NO:20, and a CDR-3 comprising SEQ ID NO:21;(b) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:29, a CDR-2 comprising SEQ ID NO:30, and a CDR-3 comprising SEQ ID NO:31, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:37, a CDR-2 comprising SEQ ID NO:38, and a CDR-3 comprising SEQ ID NO:38;(c) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:47, a CDR-2 comprising SEQ ID NO:48, and a CDR-3 comprising SEQ ID NO:49, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:55, a CDR-2 comprising SEQ ID NO:56, and a CDR-3 comprising SEQ ID NO:57;(d) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:65, a CDR-2 comprising SEQ ID NO:66, and a CDR-3 comprising SEQ ID NO:67, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:73, a CDR-2 comprising SEQ ID NO:74, and a CDR-3 comprising SEQ ID NO:75;(e) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO:83, a CDR-2 comprising SEQ ID NO:84, and a CDR-3 comprising SEQ ID NO:85, and the VP or V5 region comprises a CDR-1 comprising SEQ ID NO:91, a CDR-2 comprising SEQ ID NO:92, and a CDR-3 comprising SEQ ID NO:93; or(f) the Va or Vy region comprises a CDR-1 comprising SEQ ID NO: 101, a CDR-2 comprising SEQ ID NO: 102, and a CDR-3 comprising SEQ ID NO: 103, and the VP or V5region comprises a CDR-1 comprising SEQ ID NO: 109, a CDR-2 comprising SEQ IDNO: 110, and a CDR-3 comprising SEQ ID NO: 111.

4. A T cell receptor (TCR) or antigen-binding fragment thereof, comprising: an alpha chain comprising a variable alpha (Va) region and a beta chain comprising a variable beta (VP) region; or a gamma chain comprising a variable gamma (Vy) region and a delta chain comprising a variable delta (V5) region; wherein:(a) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 14, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:22;(b) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:32, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:40;(c) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 50, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:58;(d) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:68, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:76;(e) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 86, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO: 94; or(f) the Va or Vy region comprises a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 104, and the VP or V5 region comprises a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO: 112.

5. The TCR or antigen-binding fragment thereof of claim 4, wherein:(a) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO: 14, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO:22;(b) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO:32, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO:40;(c) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO:50, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO:58;(d) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO:68, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO:76;(e) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO:86, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO:94; or(f) the Va or Vy region comprises a CDR-1 and a CDR-2 as contained within the Va or Vy region sequence of SEQ ID NO: 104, and the VP or V5 region comprises a CDR-1 and a CDR-2 as contained within the VP or V5 region sequence of SEQ ID NO: 112.

6. A T cell receptor (TCR) or antigen-binding fragment thereof, comprising: an alpha chain comprising a variable alpha (Va) region and a beta chain comprising a variable beta (VP) region; or a gamma chain comprising a variable gamma (Vy) region and a delta chain comprising a variable delta (V5) region; wherein:(a) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 14, and the VP or V5 region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:22;(b) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:32, and the VP or V5 region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:40;(c) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:50, and the VP or V5 region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:58;(d) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:68, and the VP or V5 region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:76;(e) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO:86, and the VP or V5 region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO:94; or(f) the Va or Vy region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the Va or Vy region sequence of SEQ ID NO: 104, and the VP or V5 region comprises a CDR-1, a CDR-2, and a CDR-3 as contained within the VP or V5 region sequence of SEQ ID NO: 112.

7. A T cell receptor (TCR) or antigen-binding fragment thereof, comprising: an alpha chain comprising a variable alpha (Va) region and a beta chain comprising a variable beta (VP) region; or a gamma chain comprising a variable gamma (Vy) region and a delta chain comprising a variable delta (V5) region; wherein:(a) the Va or Vy region comprises SEQ ID NO: 14 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO:22 or a sequence that has at least 90% sequence identity thereto;(b) the Va or Vy region comprises SEQ ID NO:32 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO:40 or a sequence that has at least 90% sequence identity thereto;(c) the Va or Vy region comprises SEQ ID NO:50 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO:58 or a sequence that has at least 90% sequence identity thereto;(d) the Va or Vy region comprises SEQ ID NO:68 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO:76 or a sequence that has at least 90% sequence identity thereto;(e) the Va or Vy region comprises SEQ ID NO:86 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO:94 or a sequence that has at least 90% sequence identity thereto; or(f) the Va or Vy region comprises SEQ ID NO: 104 or a sequence that has at least 90% sequence identity thereto, and the VP or V5 region comprises SEQ ID NO: 112 or a sequence that has at least 90% sequence identity thereto.

8. The TCR or antigen-binding fragment thereof of any one of claims 1-7, wherein:(a) the Va or Vy region comprises SEQ ID NO: 14, and the VP or V5 region comprises SEQ ID NO:22;(b) the Va or Vy region comprises SEQ ID NO:32, and the VP or V5 region comprises SEQ ID NO:40;(c) the Va or Vy region comprises SEQ ID NO:50, and the VP or V5 region comprises SEQ ID NO:58;(d) the Va or Vy region comprises SEQ ID NO:68, and the VP or V5 region comprises SEQ ID NO:76;(e) the Va or Vy region comprises SEQ ID NO:86, and the VP or V5 region comprises SEQ ID NO:94; or(f) the Va or Vy region comprises SEQ ID NO: 104, and the VP or V5 region comprises SEQ ID NO: 112.

9. The TCR or antigen-binding fragment thereof of any one of claims 1-8, wherein:(a) the alpha chain further comprises an alpha constant (Ca) region and the beta chain further comprises a beta constant (CP) region, or the gamma chain further comprises a gamma constant (Cy) region and the delta chain further comprises a delta constant (C5) region;(b) the alpha chain further comprises an CP region and the beta chain further comprises a Ca region, or the gamma chain further comprises a C5 region and the delta chain further comprises a Cy region; or(c) the alpha chain further comprises an Cy or C5 region and the beta chain further comprises a C5 od Cy region, or the gamma chain further comprises a Ca or CP region and the delta chain further comprises a CP or Caregion.

10. The TCR or antigen-binding fragment thereof of claim 9, wherein the Ca comprises SEQ ID NO: 3 or 5 and the CP comprises SEQ ID NO:7 or 9.

11. The TCR or antigen-binding fragment thereof of any one of claims 1-10, wherein:(a) the alpha or gamma chain comprises SEQ ID NO: 17, and the beta or delta chain comprises SEQ ID NO:25;(b) the alpha or gamma chain comprises SEQ ID NO:35, and the beta or delta chain comprises SEQ ID NO:43;(c) the alpha or gamma chain comprises SEQ ID NO:53, and the beta or delta chain comprises SEQ ID NO:61;(d) the alpha or gamma chain comprises SEQ ID NO:71, and the beta or delta chain comprises SEQ ID NO:79;(e) the alpha or gamma chain comprises SEQ ID NO:89, and the beta or delta chain comprises SEQ ID NO:97; or(f) the alpha or gamma chain comprises SEQ ID NO: 107, and the beta or delta chain comprises SEQ ID NO: 115.

12. The TCR or antigen-binding fragment thereof of any one of claims 1-11, wherein the TCR or antigen-binding fragment thereof recognizes a peptide epitope of a minor histocompatibility antigen ACC-1 in the context of an MHC molecule.

13. The TCR or antigen-binding fragment thereof of claim 12, wherein the MHC molecule is a human leukocyte antigens (HLA)-A molecule.

14. The TCR or antigen-binding fragment thereof of claim 13, wherein the HLA- A molecule is of serotype HLA-A*24:02.

15. The TCR or antigen-binding fragment thereof of any one of claims 12-14, wherein the peptide epitope of ACC-1 is set forth in SEQ ID NO: 1.

16. The TCR or antigen-binding fragment thereof of 15, wherein the TCR or antigen-binding fragment thereof recognizes an ACC-1 peptide comprising SEQ ID NO: 1 with higher affinity than an ACC-1 peptide comprising SEQ ID NO:2.

17. A polynucleotide encoding the TCR or antigen-binding fragment thereof of any one of claims 1-16, or an alpha chain, a beta chain, a gamma chain, or a delta chain thereof.

18. The polynucleotide of claim 17, wherein the polynucleotide comprises a nucleotide sequence encoding the Va region and a nucleotide sequence encoding the VP region; or a nucleotide sequence encoding the Vy region and a nucleotide sequence encoding the V5 region; wherein:(a) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 15 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:23 or a sequence that has at least 90% sequence identity thereto;(b) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:33 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:41 or a sequence that has at least 90% sequence identity thereto;(c) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:51 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:59 or a sequence that has at least 90% sequence identity thereto;(d) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 69 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:77 or a sequence that has at least 90% sequence identity thereto;(e) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 87 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:95 or a sequence that has at least 90% sequence identity thereto; or(f) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 105 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO: 113 or a sequence that has at least 90% sequence identity thereto.

19. The polynucleotide of claim 17 or 18, wherein:(a) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 16 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:24 or a sequence that has at least 90% sequence identity thereto;(b) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:34 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:42 or a sequence that has at least 90% sequence identity thereto;(c) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 52 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:60 or a sequence that has at least 90% sequence identity thereto(d) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:70 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:78 or a sequence that has at least 90% sequence identity thereto;(e) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO:88 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO:96 or a sequence that has at least 90% sequence identity thereto; or(f) the nucleotide sequence encoding the Va or Vy region comprises SEQ ID NO: 106 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the VP or V5 region comprises SEQ ID NO: 114 or a sequence that has at least 90% sequence identity thereto.

20. The polynucleotide of claim 17 or 18, wherein:(a) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 18 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:26 or a sequence that has at least 90% sequence identity thereto;(b) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO:36 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:44 or a sequence that has at least 90% sequence identity thereto;(c) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 54 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:62 or a sequence that has at least 90% sequence identity thereto;(d) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 72 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:80 or a sequence that has at least 90% sequence identity thereto;(e) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 90 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO:98 or a sequence that has at least 90% sequence identity thereto; or(f) the nucleotide sequence encoding the alpha or gamma chain comprises SEQ ID NO: 108 or a sequence that has at least 90% sequence identity thereto, and the nucleotide sequence encoding the beta or delta chain comprises SEQ ID NO: 116 or a sequence that has at least 90% sequence identity thereto.

21. The polynucleotide of any one of claims 17-20 wherein the nucleotide sequence encoding the alpha chain and the nucleotide sequence encoding the beta chain present on same expression vector and expressed from a single promoter.

22. The polynucleotide of any one of claims 17-21, wherein the nucleotide sequence encoding the alpha chain and the nucleotide sequence encoding the beta chain are separated by a peptide sequence that causes ribosome skipping.

23. The polynucleotide of claim 22, wherein the peptide that causes ribosome skipping is a P2A peptide.

24. The polynucleotide of claim 23, wherein the P2A peptide comprises SEQ ID NO: 129.

25. The polynucleotide of claim 24, wherein the sequence encoding the P2A peptide is set forth in SEQ ID NO: 130.

26. The polynucleotide of any one of claims 17-25, wherein the polynucleotide encodes the amino acid sequence of SEQ ID NO:27, 45, 63, 81, 99, or 117.

27. The polynucleotide of any one of claims 17-26, wherein polynucleotide comprised the nucleic acid sequence of SEQ ID NO:28, 46, 64, 82, 100, or 118.

28. A vector comprising the polynucleotide of any one of claims 17-27.

29. The vector of claim 28, wherein the vector is a viral vector.

30. The vector of claim 29, wherein the viral vector is a lentiviral vector.

31. An engineered cell, comprising the TCR, or antigen-binding fragment thereof, of any one of claims 1-16.

32. An engineered cell, comprising a TCR or antigen-binding fragment thereof, wherein the TCR or antigen-binding fragment thereof is encoded by the polynucleotide of any one of claims 17-27.

33. The engineered cell of claim 31 or 32, wherein the TCR or antigen-binding fragment thereof is heterologous to the cell.

34. The engineered cell of any one of claims 31-33, wherein the engineered cell is derived from a cell line.

35. The engineered cell of any one of claims 31-33, wherein the engineered cell is derived from a primary cell obtained from a subject.

36. The engineered cell of any one of claims 31-35, wherein the engineered cell is a T cell, optionally wherein the T cell is a primary T cell, a natural killer T cell or a cytotoxic T cell.

37. The engineered cell of any one of claims 31-36, wherein expression of one or more endogenous TCR chains of the T cell has been reduced or eliminated, optionally wherein expression of an endogenous TRAC gene and an endogenous TRBC gene of the T cell have been knocked out.

38. The engineered cell of any one of claims 31-37, wherein the engineered cell has cytotoxic activity against cells expressing the minor histocompatibility antigen (miHA) ACC-1 in the context of an MHC molecule.

39. The engineered cell of claim 38, wherein the MHC molecule is a human leukocyte antigens (HLA)-A molecule.

40. The engineered cell of claim 39, wherein the HLA-A molecule is of serotype HLA-A*24:02.

41. The engineered cell of any one of claims 38-40, wherein the ACC-1 comprises SEQ ID NO: !.

42. The engineered cell of any one of claims 38-41, wherein the engineered cell has increased cytotoxic activity against cells expressing an ACC-1 peptide comprising SEQ ID NO: 1 relative to cytotoxic activity against cells expressing an ACC-1 peptide comprising SEQ ID NO:2.

43. A method for producing an engineered cell, comprising introducing the polynucleotide of any one of claims 17-27 or the vector of any one of claims 28-30 into a cell in vitro or ex vivo, optionally wherein the cell is a T cell, optionally wherein the T cell is a primary T cell, a natural killer T cell or a cytotoxic T cell.

44. The method of claim 43, wherein the method further comprises knocking out expression of one or more endogenous TCR genes in the T cell.

45. A composition comprising the TCR or antigen-binding fragment thereof of any one of claims 1-16, the polynucleotide of any one of claims 17-27, or the vector of any one of claims 28-30.

46. A composition comprising the engineered cell of any one of claims 31-42.

47. The composition of claim 45 or 46, further comprising a pharmaceutically acceptable excipient.

48. A method for identifying a T cell receptor (TCR) targeting a relatively hematopoietically restricted miHA ACC-1 antigen, the method comprising:(i) generating a plurality of functional TCR-encoding nucleic acid vectors by a high- throughput nucleic acid amplification and assembly method using nucleic acids obtained from a plurality of single T cell; wherein said plurality of single T cells is from a donor subject; and(ii) identifying a functional TCR that recognizes a relatively hematopoietically- restricted miHA, among a plurality functional TCRs encoded by the plurality of functional TCR-encoding nucleic acid vectors.

49. The method of claim 48, wherein the donor subject is a healthy donor, a cancer patient, a recovered cancer patient, a stem cell transplant recipient, or a parous woman.

50. The method of claim 48 or 49, wherein the donor subject does not express the relatively hematopoietically restricted miHA ACC-1 antigen, and T cells from the donor subject have been stimulated in vitro with peptide and antigen presenting cells prior to step (i).

51. The method of any one of claims 48-50, wherein the identified functional TCR recognizes a peptide epitope of a miHA ACC-1 in the context of an MHC molecule.

52. The method of claim 51, wherein the MHC molecule is a human leukocyte antigen (HLA)-A molecule.

53. The method of claim 52, wherein the HLA-A molecule is of serotype HLA- A*24:02.

54. The method of any one of claims 48-53, wherein the peptide epitope of ACC-1 comprises SEQ ID NO: 1.

55. The method of any one of claims 48-54, wherein the T cell from the donor subject is cultured under conditions for cell expansion of the T cell prior to the generating of the plurality of functional TCR-encoding nucleic acid vectors.

56. The method of any one of claims 48-54, wherein the T cell from the donor subject is not cultured under conditions for cell expansion of the T cell prior to the generating of the plurality of functional TCR-encoding nucleic acid vectors.

57. The method of any one of claims 48-56, wherein the high-throughput nucleic acid amplification and assembly method comprises:(1) amplifying a first amplification product and a second amplification product from complementary DNA (cDNA) generated from RNA obtained from the single T cell among the plurality of T cells sorted into each of a plurality of separate locations of a device, wherein: said first amplification product comprises a nucleotide sequence encoding a full- length variable alpha (Va) region or a full-length variable gamma (Vy) region of a TCR, and said second amplification product comprises a nucleotide sequence encoding a full-length variable beta (VP) region or a full-length variable delta (V5) region of a TCR; and(2) assembling said first amplification product and said second amplification product from each of said plurality of separate locations into a nucleic acid vector to obtain an assembled nucleic acid vector comprising a nucleotide sequence encoding a functional TCR for each of said plurality of separate locations; and said functional TCR comprises (i) a full-length Va region and a full-length VP region from said single T cell or (ii) a full-length Vy region and a full-length V5 region from said single T cell.

58. An engineered cell, comprising the TCR identified by the method of any one of claims 1-16 or the polynucleotide of any one of claims 17-27.

59. The engineered cell of claim 58, wherein the engineered cell has increased cytotoxic activity against cells expressing an ACC-1 peptide comprising SEQ ID NO: 1 relative to cytotoxic activity against cells expressing an ACC-1 peptide comprising SEQ ID NO:2.

60. A composition comprising the engineered cell of claim 58 or 59.

61. The composition of claim 55, further comprising a pharmaceutically acceptable excipient.

62. A method of treatment, the method comprising administering to a subject having a disease or disorder, the composition of any one of claims 46, 47, 60, or 61, the engineered T cell of any one of claims 31-42, or an engineered T cell expressing the TCR or antigen-binding fragment thereof of any one of claims 1-16 or the polynucleotide of any one of claims 17-27.

63. A method of treatment, the method comprising administering to a subject having a disease or disorder,(a) the TCR or the antigen binding fragment of any one of claims 1-16,(b) a cell expressing the TCR or the antigen binding fragment of any one of claims 1-16,(c) a protein comprising the TCR or the antigen binding fragment of any one of claims 1-16, or(d) a cell expressing the protein comprising the TCR or the antigen binding fragment of any one of claim 1-16.

64. The method of claim 62 or 63, wherein the protein comprising the TCR or the antigen binding fragment of any one of claims 1-16 comprises a bispecific T cell engager or a chimeric T cell receptor.

65. The method of any one of claims 62-64, wherein the subject is eligible for or is to receive an allogeneic hematopoietic stem cell transplantation (HSCT).

66. The method of any one of claims 62-65, wherein the subject has or has been diagnosed with a malignant hematologic disorder.

67. The method of any one of claims 62-66, wherein the subject has or has been diagnosed with acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), or acute lymphoblastic leukemia (ALL).

68. The method of any one of claims 62-67, wherein the subject has or has been diagnosed a liquid tumor, a hematopoietic tumor, a lymphoma, or chronic myeloid leukemia.

69. The method of any one of claims 64-68 wherein the treatment induces or enhances cell death of cells associated with the malignant hematologic disorder, or induces or enhances a graft versus leukemia effect (GVL) in the subject.

70. The method of any one of claims 62 or 63, wherein the disease or disorder is a non-malignant blood disorder or an autoimmune disorder.

71. The method of claim 70, wherein the non-malignant blood disorder is a hemoglobinopathy or a thalassemia.

72. A method for treating a subject having a hematopoietic malignancy comprising administering the engineered T cells of any one of claims 31-42 to the subject in combination with allogeneic stem cell transplant (alloSCT), wherein the engineered T cells are administered to the subject within 24 hours of administering the alloSCT graft to the subject, and wherein no immunosuppression agent that targets graft-versus-host disease or suppresses the immune activity of T cells is administered to the subject following administration of the alloSCT graft to the subject.

73. A method for treating a subject having a hematopoietic malignancy comprising administering the engineered T cells of any one of claims 31-42 to the subject in the absence of alloSCT.

74. A method for facilitating establishment of a solid organ transplant or facilitating bone marrow engraftment comprising administering the engineered T cells of any one of claims 31-42 to the subject.

75. A method for reducing irradiation dose or chemotherapy dose in a subject in need of irradiation or chemotherapy to treat a hematopoietic malignancy, an autoimmune disease, or an inherited disorder of blood cells comprising administering the engineered T cells of any one of claims 31-42 to the subject.

Images