Compounds and methods for modulating APOE expression
Oligomeric agents targeting APOE RNA and ApoE protein in cells offer a promising treatment for neurodegenerative diseases by reducing their expression, effectively ameliorating symptoms such as cognitive impairment and memory loss.
Patent Information
- Application Number
- PCT/US2025/029741
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-17
- Filing Date
- 2025-05-16
- Publication Date
- 2025-11-20
AI Technical Summary
Current treatments for neurodegenerative diseases such as Alzheimer's Disease lack effective options for reducing the expression of APOE RNA and ApoE protein, which are associated with disease progression and symptoms.
The use of oligomeric agents, particularly modified oligonucleotides like oligomeric duplexes and antisense oligonucleotides, to reduce the amount or activity of APOE RNA and ApoE protein in cells, thereby ameliorating symptoms of neurodegenerative diseases.
These agents effectively decrease the rate of cognitive impairment, memory loss, and other symptoms of neurodegenerative diseases by targeting and reducing APOE expression, providing a potential therapeutic approach for conditions like Alzheimer's Disease.
Smart Images

Figure IMGF000005_0001 
Figure IMGF000006_0001 
Figure IMGF000010_0001
Abstract
Description
[0001]BIOL0446WO COMPOUNDS AND METHODS FOR MODULATING APOE EXPRESSION Sequence Listing The present application is being filed along with a Sequence Listing in electronic format. The 5 Sequence Listing is provided as a file entitled BIOL0446SEQ.xml, created on April 21, 2025, which is 136 KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Field 10 Provided are oligomeric agents, pharmaceutical compositions, and methods for reducing the amount or activity of APOE RNA in a cell or subject, and in certain instances reducing the amount of apolipoprotein E (ApoE) in a cell or subject. Certain such oligomeric agents, pharmaceutical compositions, and methods are useful to ameliorate at least one symptom of a neurodegenerative disease, e.g., a neurodegenerative disease associated with APOE. Such symptoms include cognitive impairment, progressive memory loss, a decline in 15 language skills, behavioral abnormality, dementia, difficulty performing daily activities, aphasia, agnosia, apraxia, and loss of motor function. In certain embodiments, oligomeric agents, pharmaceutical compositions, and methods are useful to ameliorate amyloid plaques, neurofibrillary tangles, and / or neuroinflammation that are associated with a neurodegenerative disease associated with APOE. Such neurodegenerative diseases include Alzheimer’s Disease. 20 Background Alzheimer’s Disease (AD) is the most common cause of age-associated dementia, affecting an estimated 5.7 million Americans a year (Alzheimer’s Association.2018 Alzheimer’s Disease Facts and Figures. Alzheimer’s Dement.2018;14(3):367-429). Symptoms of AD include cognitive impairment, a 25 decline in memory and language skills, behavioral and psychological symptoms such as apathy and lack of motivation, gait disturbances and seizures, and dementia. Hallmarks of AD include the presence of amyloid plaques and neurofibrillary tangles in the brains of patients. Amyloid plaques are toxic aggregates composed mainly of peptides that are encoded by the amyloid precursor protein gene, APP. Neurofibrillary tangles are hyperphosphorylated, insoluble aggregates of tau proteins. 30 Apolipoprotein E (ApoE) is a fat-binding protein that is associated with lipoprotein particles. ApoE is produced mainly by the liver. ApoE is also produced in the brain by astrocytes, where it plays a role in transporting cholesterol to neurons via APOE receptors. There are three main APOE alleles that encode three different ApoE protein isoforms: APOE-ε2, APOE-ε3, and APOE-ε4. These alleles encode ApoE protein variants having different combinations of amino acids at positions 112 and 158 of the ApoE protein: APOE- 1 BIOL0446WO ε2 (Cys112, Cys158), APOE-ε3 (Cys112, Arg158), and APOE-ε4 (Arg112, Arg158). These amino acid differences result in variable ApoE structure and function. APOE has been linked to pathological hallmarks of AD (e.g., amyloid plaques and neurofibrillary tangles), and to pathways including synaptic plasticity, lipid transport, glucose metabolism, mitochondrial 5 function, and vascular integrity. Polymorphisms in the APOE promoter result in increased APOE promoter activity and ApoE protein levels, and an increased risk of developing AD. The APOE4 allele, encoding isoform ε4, is the strongest genetic risk factor for late-onset Alzheimer’s disease. Patients homozygous for the APOE4 allele account for about 16% of AD population. Currently there is a lack of acceptable options for treating neurodegenerative diseases such as AD. It 10 is therefore an objective herein to provide oligomeric agents, methods, and pharmaceutical compositions for the treatment of such diseases. Summary Provided herein are oligomeric agents, pharmaceutical compositions, and methods for reducing the 15 amount or activity of APOE RNA, and in certain embodiments reducing the amount of ApoE protein in a cell or subject. In certain embodiments, the subject has a neurodegenerative disease. In certain embodiments, the subject has Alzheimer’s Disease (AD). In certain embodiments, oligomeric agents useful for reducing expression of APOE RNA comprise modified oligonucleotides. In certain embodiments, oligomeric agents useful for reducing expression of APOE RNA comprise oligomeric duplexes and / or antisense 20 oligonucleotides. In certain embodiments, oligomeric agents useful for reducing the amount of ApoE protein comprise modified oligonucleotides. In certain embodiments, oligomeric agents useful for reducing the amount of ApoE protein comprise oligomeric duplexes and / or antisense oligonucleotides. Also provided are methods useful for ameliorating at least one symptom of a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is Alzheimer’s Disease. In certain 25 embodiments, the symptom includes cognitive impairment, progressive memory loss, a decline in language skills, behavioral abnormality, dementia, difficulty performing daily activities, aphasia, agnosia, apraxia, and / or loss of motor function. In certain embodiments, amelioration of one or more of these symptoms result in decreasing the rate of cognitive impairment or progressive memory loss, reducing the rate of decline in language skills, reducing the rate of progression of behavioral abnormality, reducing the rate of progression 30 of dementia, improving the performance in daily activities, reducing the rate of progression of aphasia, agnosia, and / or apraxia, and decreasing the rate of decline in motor function. Detailed Description It is to be understood that both the foregoing general description and the following detailed 35 description are explanatory only and are not restrictive. Herein, the use of the singular includes the plural 2 BIOL0446WO unless specifically stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise. 5 DEFINITIONS The following definitions are provided, along with additional definitions throughout the specification, for a complete understanding of the instant disclosure. Unless specific definitions are provided herein, nomenclature used in connection with, and procedures and techniques of, analytical chemistry, synthetic 10 organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Unless otherwise indicated, certain terms have the following meanings: As used herein, a substituent at the “2′-position” means that the substituent is directly attached to the carbon at the 2′-position of a furanosyl sugar moiety. As used herein, “2′-deoxynucleoside” means a nucleoside comprising a 2′-deoxyfuranosyl sugar15 moiety. Unless otherwise indicated, a 2′-deoxynucleoside is a 2′-β-D-deoxynucleoside which comprises a 2′- β-D-deoxyribosyl sugar moiety, and which is in the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acid (DNA). A 2′-deoxynucleoside or a nucleoside comprising an unmodified 2′- deoxyribosyl sugar moiety may be abasic, comprise a modified nucleobase, or may comprise an RNA nucleobase (uracil). 20 As used herein, “2′-deoxy sugar moiety” means a 2′-H(H) deoxyfuranosyl sugar moiety. Unless otherwise indicated, a 2′-deoxy sugar moiety is a 2′-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl stereochemical configuration as found in naturally occurring deoxyribonucleic acid (DNA). As used herein, “2′-MOE” means a 2′-OCH2CH2OCH3group at the 2′-position of a furanosyl sugar moiety. A “2′-MOE sugar moiety” means a sugar moiety with a 2′-OCH2CH2OCH3group at the 2′-position of 25 a furanosyl sugar moiety. Unless otherwise indicated, a 2′-MOE sugar moiety is in the β-D-ribosyl stereochemical configuration. “MOE” means O-methoxyethyl. As used herein, “2′-MOE nucleoside” or “2′-OCH2CH2OCH3nucleoside” means a nucleoside comprising a 2′-MOE sugar moiety (or 2′-OCH2CH2OCH3furanosyl sugar moiety). As used herein, “2′-OMe” means a 2′-OCH3group at the 2′-position of a furanosyl sugar moiety. A 30 “2′-OMe sugar moiety” means a sugar moiety with a 2′-OCH3group at the 2′-position of a furanosyl sugar moiety. Unless otherwise indicated, a 2′-OMe sugar moiety is in the β-D-ribosyl stereochemical configuration. As used herein, “2′-OMe nucleoside” means a nucleoside comprising a 2′-OMe sugar moiety. As used herein, “2′-F” means a 2′-fluoro group at the 2′-position of a furanosyl sugar moiety. A “2′-F sugar moiety” means a sugar moiety with a 2′-F group at the 2′-position of a furanosyl sugar moiety. Unless 35 otherwise indicated, a 2′-F sugar moiety is in the β-D-ribosyl configuration. 3 BIOL0446WO As used herein, “2′-F nucleoside” means a nucleoside comprising a 2′-F sugar moiety. As used herein “2′-NMA” means a 2′-OCH2C(=O)-N(H)CH3group at the 2′-position of a furanosyl sugar moiety. A “2′-NMA sugar moiety” means a sugar moiety with a 2′-OCH2C(=O)-N(H)CH3group at the 2′-position of a furanosyl sugar moiety. 5 As used herein, “2′-NMA nucleoside” means a nucleoside comprising a 2′-NMA sugar moiety. As used herein, “2′-substituted nucleoside” means a modified nucleoside comprising a 2′-substituted furanosyl sugar moiety. As used herein, “2′-substituted sugar moiety” means a modified furanosyl sugar moiety wherein the 2′-position is attached to at least one substituent other than H or OH. A 2′-substituted sugar moiety includes a 10 bicyclic sugar moiety wherein the second ring is joined to the furanosyl ring at the 2′-position. 2′-substituted sugar moieties include, but are not limited to, 2′-OMe sugar moieties, 2′-MOE sugar moieties, 2′-F sugar moieties, 2′-NMA sugar moieties, cEt sugar moieties, and LNA sugar moieties. As used herein, “5-methylcytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5-methylcytosine is a modified nucleobase. 15 As used herein, “abasic nucleoside” means a modified nucleoside in which the sugar moiety is not attached to a nucleobase (i.e., the nucleobase is absent). As used herein, “acyclic sugar surrogate nucleoside” means a nucleoside having Formula II, Formula III, or Formula IIIa: 20 4 BIOL0446WO wherein X is O, S, C(R5R6), N(E1), NC(=O)-(E1); 5 each J1and J2are independently H or C1-C6alkyl; n is 0, 1 or 2; m is 0, 1, or 2; p is 0 or 1; o is 0 or 1; 10 s is 0 or 1; R1is H, OH, halogen, C1-C6alkyl, C1-C6alkoxy, C2-C6alkenyl, C2-C6alkynyl, or (CH2)qR8; R2, R3, and R4are each independently H, OH, halogen, C1-C6alkyl, C1-C6alkoxy, C2-C6alkenyl, C2- C6alkynyl, S-CH3, N(CH3)(CH3), OCH2CH2OCH3, O-alkylamino, or (CH2)qR8; E1is H, C1-C6alkyl or substituted C1-C6alkyl; 15 R5and R6are independently H, OH, C1-C6alkyl, or N(R7); wherein if R5is OH, then R6is not OH; R7is H, C1-C6alkyl, or C(=O)R9, wherein R9is C1-C6alkyl; R8is OH, halogen, methoxy, ethoxy, azido, C2-C6alkenyl, or C2-C6alkynyl, and q is 1, 2, or 3; and Bx is a nucleobase. As used herein, “acyclic sugar surrogate” means the sugar moiety of an acyclic sugar surrogate 20 nucleoside. As used herein, “administration” or “administering” means providing a pharmaceutical agent or composition to a subject. As used herein, “ameliorate” with reference to a symptom of a disease, means improvement in, or lessening of, or preclusion of, at least one symptom of a disease. As used herein, “disease” includes disorders, 25 conditions, and injuries. Amelioration may be reduction in severity or frequency of a symptom or the delayed onset, prevention of occurrence of, or slowing of progression in the severity or frequency of, a symptom. In certain embodiments, the symptom is cognitive impairment, progressive memory loss, a decline in language skills, behavioral abnormality, dementia, difficulty performing daily activities, aphasia, agnosia, apraxia, loss of motor function, amyloid plaque, neurofibrillary tangle, and / or neuroinflammation. Progression, frequency, 30 or severity indicators may be determined by subjective or objective measures known in the art and / or described herein. 5 BIOL0446WO As used herein, “amyloid plaque” means an aggregate of peptides that are encoded by a human amyloid precursor protein gene, APP. As used herein, “antisense activity” means any detectable and / or measurable change attributable (whether directly and / or indirectly) to the hybridization of an antisense oligonucleotide to a target nucleic 5 acid. For example, compounds have antisense activity when they alter the amount or activity of a target nucleic acid by 25% or more in an in vitro assay; or, for example compounds have antisense activity when they alter the amount or activity of a target nucleic acid by 25% or more in an in vivo assay. Antisense activity may be assessed in a standard assay. Herein, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or 10 target protein levels in the absence of the antisense oligonucleotide. As used herein, “antisense agent” means an oligomeric agent comprising an antisense oligonucleotide. As used herein, “antisense oligonucleotide” means an oligonucleotide having at least one region (a “targeting region”) that is complementary to a target nucleic acid (e.g., a target region). An antisense 15 oligonucleotide may be paired with a second oligonucleotide (herein, a “sense oligonucleotide”) that is complementary to the antisense oligonucleotide (for example, forming an “oligomeric duplex”), may be an unpaired antisense oligonucleotide (herein, a single-stranded antisense oligonucleotide), or may be a “hairpin oligonucleotide” that has at least one region that is self-complementary. As used herein, “behavioral abnormality” means a behavior exhibited by a subject that is atypical or 20 out of the ordinary for the subject. In certain embodiments, the behavior abnormality is a dysfunctional or deviant behavior (e.g., causes distress for others). As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety 25 comprising a furanosyl sugar moiety and a second ring, wherein the second ring is formed via a bridge connecting two non-geminal atoms in the ring of the furanosyl sugar moiety, thereby forming a bicyclic structure. Examples of bicyclic sugar moieties include locked nucleic acid (LNA) sugar moieties and constrained ethyl (cEt) sugar moieties as defined herein. As used herein, “blunt” or “blunt ended” in reference to an oligomeric duplex mean that there are no 30 terminal unpaired nucleotides (i.e., no overhanging nucleotides). One or both ends of an oligomeric duplex may be blunt. As used herein, “cell-targeting moiety” means a conjugate moiety or portion of a conjugate moiety that has affinity for a particular cell type or particular cell types. For example, a cell-targeting moiety may have affinity for a cell surface moiety, such as a cell surface receptor on a particular cell type. 6 BIOL0446WO As used herein, “cerebrospinal fluid” or “CSF” means the fluid filling the space around the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties (e.g., osmolarity, pH, and / or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF. 5 As used herein, “cleavable moiety” means a group of atoms comprising at least one bond that is cleaved under physiological conditions, e.g., in a cell and / or a subject. For example, a cleavable moiety cleaved inside a cell or sub-cellular compartment, such as an endosome or lysosome. A cleavable moiety may be cleaved by endogenous enzymes, such as nucleases. As used herein, “complementary nucleobase(s)” or “complementary” in reference to nucleobase(s) 10 means nucleobases that form hydrogen bonds with one another. Complementary nucleobase pairs include, but are not limited to, adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5- methylcytosine (mC) and guanine (G). Certain modified nucleobases that are complementary to unmodified nucleobases or to other modified nucleobases are known in the art. For example, hypoxanthine, the nucleobase of the nucleoside inosine (I), can pair with adenine, cytosine, thymine, or uracil. Herein, 15 hypoxanthine (I) is considered a complementary nucleobase to thymine (T), adenine (A), uracil (U), and cytosine (C). As used herein, “complementary nucleobase sequence(s)” or “complementary” in reference to nucleobase sequence(s) refers to two nucleobase sequences in which some, a majority, or all of the nucleobases in the two nucleobase sequences are complementary nucleobases when the sequences are 20 aligned. A “nucleobase sequence” means the order of nucleobases in a strand of linked nucleosides or a region thereof (e.g., an oligonucleotide or region thereof, or a target nucleic acid or region thereof) independent of any sugar or internucleoside linkage modification or presence of an intervening spacer. Complementary nucleobase sequences may be nucleobase sequences of two separate strands of linked nucleosides or regions thereof (e.g., an oligonucleotide and a region of a target nucleic acid, or an antisense 25 oligonucleotide and its paired sense oligonucleotide) or complementary nucleobase sequences may be nucleobase sequences of two regions of a single strand of linked nucleosides (e.g., self-complementary regions of a hairpin oligonucleotide). As used herein, when a first strand of linked nucleosides (e.g., an oligonucleotide) or region thereof is described as being complementary to a second strand of linked nucleosides or region thereof (e.g., a target nucleic acid or another oligonucleotide), it means that the 30 nucleobase sequence of the first strand of linked nucleosides or region thereof is complementary to the nucleobase sequence of the second strand of linked nucleosides or region thereof when aligned. Not every pair of nucleobases in the aligned nucleobase sequences needs to be complementary for the two sequences to be “complementary.” Rather, some mismatches are tolerated. Where nucleobase sequence complementarity is expressed as a percent, such percent represents the percentage of nucleobases within one nucleobase 35 sequence that are complementary to nucleobases within an equal length second nucleobase sequence when 7 BIOL0446WO the nucleobase sequences are aligned. Unless otherwise specified, “complementary” is assumed to be at least 70%. Complementary nucleobase sequences may be 75%, 80%, 85%, 90%, 95%, or 100% complementary. For example, if a nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is 80% complementary to another nucleobase sequence, then 16 of the nucleobase pairs are complementary 5 nucleobases, and there are 4 mismatches when the sequences are aligned. If a nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is at least 80% complementary to another nucleobase sequence, then 16, 17, 18, 19, or 20 of the nucleobase pairs are complementary nucleobases, and there are 0-4 mismatches when the sequences are aligned. As used herein, “fully complementary” or “100% complementary” means that each nucleobase pair of the two nucleobase sequences is complementary when 10 the equal length sequences are aligned. As used herein, “complementary region” in reference to a strand of linked nucleosides (e.g., an oligonucleotide or a target nucleic acid) is a region of the strand of linked nucleosides in which the nucleobase sequence of the region is complementary with the nucleobase sequence of an equal-length region of a separate strand of linked nucleosides (e.g., an oligonucleotide and a target nucleic acid, or an antisense 15 oligonucleotide and a sense oligonucleotide), or the nucleobase sequence of an equal-length region within the strand of linked nucleosides (e.g., in a “hairpin oligonucleotide”). A complementary region of a strand of linked nucleosides may be a portion of a strand of linked nucleosides or may include the entire strand of linked nucleosides. A complementary region may include a mismatch, but the nucleobases of the terminal nucleosides of a complementary region are complementary to the nucleobases of the terminal nucleosides of 20 the equal-length region of the separate strand of linked nucleosides or to the nucleobases of the terminal nucleosides of the equal-length region within the strand of linked nucleosides. A “targeting region” of an oligonucleotide, is a complementary region in which the nucleobase sequence of the region is complementary to the nucleobase sequence of a target region of a target nucleic acid. A targeting region of a strand of linked nucleosides may be a portion of a strand of linked nucleosides or may include the entire strand of linked 25 nucleosides. A “duplexing region” is a complementary region of an oligonucleotide (e.g., an antisense or sense oligonucleotide) having a nucleobase sequence that is complementary to the nucleobase sequence of a second oligonucleotide or region thereof. A duplexing region may be a portion of a strand of linked nucleosides or may include the entire strand of linked nucleosides. As used herein, “conjugate group” means a group of atoms that is directly or indirectly attached to an 30 oligonucleotide. A conjugate group comprises a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide. As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide. As used herein, “conjugate moiety” means a group of atoms that when covalently bound to a molecule 35 (e.g., an oligonucleotide) modifies one or more properties of such molecule compared to the same molecule 8 BIOL0446WO lacking the conjugate moiety, wherein such properties include, but are not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. As used herein, "contiguous" in the context of an oligonucleotide refers to nucleosides, nucleobases, 5 sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence. As used herein, “constrained ethyl” or “cEt” or “cEt sugar moiety” means a β-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4’-carbon and the 2’-carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2', and 10 wherein the methyl group of the bridge is in the S configuration. As used herein, “cEt nucleoside” means a nucleoside comprising a cEt sugar moiety. As used herein a “cyclic sugar surrogate nucleoside” is a nucleoside having Formula I: 15 wherein J is H, C1-C6alkyl, or C2-C6alkenyl; X is O, S, C(R1R2), N(R3), or X1-X2, wherein X1-X2is C(R1)=C(R2), C(R1R2)-C(R1R2), O-C(R1R2), C(R1R2)-O, S-C(R1R2), C(R1R2)-S, N(R3)-C(R1R2), or C(R1R2)-N(R3); Y is C(R1R2) or Y1-Y2, wherein Y1-Y2is C(R1)=C(R2) or C(R1R2)-C(R1R2); 20 Z is C(G1G2) or Z1-Z2, wherein Z1-Z2is C(G1)=C(R1), C(R1)=C(G1); C(G1G2)-C(R1R2), C(R1R2)- C(G1G2); or Z1-Z2-Z3,wherein Z1-Z2-Z3is C(G1G2)-C(R1R2)-C(R1R2) or C(R1R2)-C(R1R2)-C(G1G2); Q is CH or N; each R1and R2is independently H, OH, C1-C6alkyl, or N(R4); wherein if R1is OH, then R2is not OH; 25 each R3and R4is independently H, C1-C6alkyl, or C(=O)R5, wherein R5is C1-C6alkyl; each G1and G2is independently H, OH, halogen or O-[C(R6)(R7)]q-[(C=O)s-XG]j-R8; wherein if G1is OH, then G2is not OH; each R6and R7is, independently, H, halogen, C1-C6alkyl or substituted C1-C6alkyl; each XGis O, S or N(E1); 30 R8is H, halogen, C1-C6alkyl, substituted C1-C6alkyl, C2-C6alkenyl, substituted C2-C6alkenyl, C2-C6alkynyl, substituted C2-C6alkynyl or N(E2)(E3); 9 BIOL0446WO E1, E2and E3are each, independently, H, C1-C6alkyl or substituted C1-C6alkyl; n is 0 or 1; m is 0 or 1; p is 0 or 1; 5 q is from 1 to 6; s is 0 or 1; j is 0 or 1; Bx is a nucleobase; and provided that if X is O, Z is C(G1G2), and Q is CH, then m is 1. 10 As used herein, “cyclic sugar surrogate” means the sugar moiety of a cyclic sugar surrogate nucleoside. As used herein, “daily activities” mean one or more activities selected from dressing, eating, walking, bathing, cooking, shopping, cleaning, and exercising. As used herein, “dementia” means any combination of symptoms selected from memory loss, difficulty communicating, disorientation, difficulty reasoning, difficulty planning, discoordination, 15 compromised motor function, confusion, disorientation, depression, anxiety, paranoia, agitation, and hallucination. As used herein, “deoxy region” means a region of 5-13 contiguous nucleotides, wherein at least 70% of the nucleosides are DNA nucleosides. Each nucleoside of a deoxy region is selected from a 2′- deoxynucleoside and 2′-substituted nucleoside. A deoxy region supports RNase H activity. 20 As used herein, “DNA nucleoside” means a nucleoside comprising an unmodified DNA sugar moiety. A DNA nucleoside may comprise a modified or unmodified nucleobase. A DNA nucleoside may comprise an uracil nucleobase or a modified nucleobase, or may be an abasic nucleoside. As used herein, “DNA sugar moiety” means an unmodified DNA sugar moiety. As used herein, “diluent” means an ingredient in a composition that lacks pharmacological activity, 25 but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g., aCSF, PBS, or saline solution. As used herein, “double-stranded” refers to hybridized or bound complementary regions, including those between two separate strands of linked nucleosides (e.g., an antisense oligonucleotide and a sense oligonucleotide) and those within a single strand of linked nucleosides (e.g., a hairpin oligonucleotide). 30 Hybridized complementary regions of two separate strands of linked nucleosides form a “duplex” of the separate strands. Hybridized complementary regions of a single strand of linked nucleosides (i.e., a first region of the strand of linked nucleosides and a second region of the strand of linked nucleosides) form a “hairpin.” As used herein, “duplex” means a structure formed by two separate strands of linked nucleosides (e.g., two separate oligonucleotides) or regions thereof, at least a portion of which are complementary to and 10 BIOL0446WO hybridize to each other. For clarity, herein a “hairpin oligonucleotide” is one strand of linked nucleosides that comprises a region that is double stranded and is not a duplex. As used herein, a “furanosyl sugar moiety" is a group of atoms that comprises a furanose ring, and is numbered according to the structure below, with optional additional substituents at any of the 1′, 2′, 3′, 4′, and 5 5′ positions, . “hybridize” or “hybridization” means the act or process of two complementary regions of linked nucleosides (e.g., oligonucleotides, nucleic acids) annealing together to form a double- stranded region. While not limited to a particular mechanism, the most common mechanism of hybridization 10 involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. As used herein, “internucleoside linkage” means the covalent linkage between immediately adjacent (e.g., contiguous) nucleosides in an oligonucleotide. As used herein, “unmodified internucleoside linkage” means a phosphodiester internucleoside linkage. As used herein, “modified internucleoside linkage” means 15 any internucleoside linkage other than a phosphodiester internucleoside linkage. A “phosphorothioate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom. A “mesyl phosphoramidate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with NS(=O)2CH3. Unless otherwise indicated, 20 and in the context of linked nucleosides each comprising a furanosyl sugar moiety, an internucleoside linkage joins the 3′-carbon of one furanosyl sugar moiety to the 5′-carbon of the other furanosyl sugar moiety. As used herein, “inverted nucleoside” means a nucleotide having a 3’ to 3’ and / or 5’ to 5’ internucleoside linkage. As used herein, “inverted sugar moiety” means the sugar moiety of an inverted nucleoside or an 25 abasic sugar moiety having a 3’ to 3’ and / or 5’ to 5’ internucleoside linkage. As used herein, “linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., nucleosides immediately adjacent to one another, no additional nucleosides are present between those that are linked). As used herein, a “mismatch” between two aligned nucleic acid sequences (e.g., nucleic acid 30 sequence of separate strands of linked nucleosides or separate regions of a strand of linked nucleosides) means that the two nucleobases at a specified position of the aligned nucleobase sequences are not complementary nucleobases. 11 BIOL0446WO As used herein, “modified nucleoside” means a compound or subunit comprising a sugar moiety and optionally a nucleobase, wherein the sugar moiety is modified and / or the nucleobase is modified or is absent (i.e., abasic nucleoside). As used herein, “modified sugar moiety” means a sugar moiety other than a β-D-ribosyl sugar moiety 5 in RNA or a β-D-deoxyribosyl sugar moiety in DNA. A modified sugar moiety is selected from a modified furanosyl sugar moiety, a cyclic sugar surrogate, an acyclic sugar surrogate, or a sugar mimic. As used herein, a “modified nucleobase” means a nucleobase other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5-methylcytosine” is a modified nucleobase. Inosine (I) is a nucleoside comprising the modified nucleobase hypoxanthine. 10 As used herein, “motif” means a pattern of independently unmodified and / or independently modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide. As used herein, “neurofibrillary tangles” mean hyperphosphorylated insoluble aggregates of tau protein. Tau protein is encoded by a human MAPT gene. As used herein, “neuroinflammation” means inflammation of the peripheral nervous system or the 15 central nervous system. In certain embodiments, the amount of a cytokine in the cerebrospinal fluid of a subject with neuroinflammation is significantly greater than the amount of the cytokine in the cerebrospinal fluid of a subject that does not have neuroinflammation. In certain embodiments, a subject with neuroinflammation has Alzheimer’s Disease. In certain embodiments, a subject that does not have neuroinflammation does not have Alzheimer’s Disease. 20 As used herein, “non-bicyclic modified sugar moiety” means a modified furanosyl sugar moiety comprising a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring. As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a strand of linked 25 nucleosides independent of any sugar or internucleoside linkage modification. As used herein, “the nucleobase sequence of” a reference SEQ ID NO refers only to the nucleobase sequence provided in such SEQ ID NO and therefore, unless otherwise indicated, includes compounds wherein each sugar moiety and each internucleoside linkage, independently, is modified or unmodified, irrespective of the presence or absence of modifications indicated in the referenced SEQ ID NO. 30 As used herein, “nucleoside” means an “unmodified nucleoside” or a “modified nucleoside”. As used herein, a “nucleoside mimic” means a compound or subunit comprising a sugar mimic, and a nucleobase. As used herein, “nucleoside overhang” or “overhang” refers to unpaired nucleosides at either or both ends of an oligomeric duplex or at an end of a hairpin structure. The nucleosides of an overhang are not part of 35 the “duplexing region” of either of the two strands of linked nucleosides. 12 BIOL0446WO As used herein, "oligomeric agent" means a compound or complex comprising or consisting of at least one modified oligonucleotide and optionally one or more additional associated features selected from: (a) one or more additional modified or unmodified oligonucleotides, each of which may be hybridized to or covalently linked to the at least one modified oligonucleotide and / or to each other; (b) one or more conjugate 5 groups, which may be covalently attached directly or indirectly to any oligonucleotide of such oligomeric agent; and (c) one or more terminal groups. Herein, where two oligonucleotides are described as being covalently attached to one another, such attachment is other than through a direct internucleoside linkage. Thus, a single, unbranched oligonucleotide comprising only direct internucleoside linkages cannot be described as two separate covalently linked oligonucleotides. 10 As used herein, "oligonucleotide" means a strand of linked nucleosides, wherein each nucleoside and / or each internucleoside linkage of the strand of linked nucleosides may be independently modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 12-80 linked nucleosides. Unless otherwise indicated, no more than 10% of the nucleosides of an oligonucleotide are abasic nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside and / or at 15 least one internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide consisting of unmodified nucleosides linked by phosphodiester internucleoside linkages. An oligonucleotide may be paired with a second oligonucleotide that is complementary to the oligonucleotide to form an oligomeric duplex, or it may be unpaired. As used herein, “pharmaceutically acceptable diluent” means an ingredient in a pharmaceutical 20 composition suitable for use in administering to a subject. Typically, a “diluent” lacks pharmacological activity but is desirable in preparing a pharmaceutical composition. As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. 25 As used herein “pharmaceutical composition” means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric agent and a sterile aqueous solution. A pharmaceutical composition may show activity in certain cell lines. As used herein “prodrug” means a therapeutic agent in a first form outside the body that is converted to a second form within a subject or cells thereof. Typically, conversion of a prodrug within the subject is 30 facilitated by the action of an enzyme (e.g., endogenous or viral enzyme) or chemical present in cells or tissues and / or by physiologic conditions. The first form of the prodrug may be less active than the second form. As used herein, “progressive memory loss” means occurrences of forgetfulness (e.g., inability to remember events, names, and facts) that increase in frequency over time. 13 BIOL0446WO As used herein, "reducing or inhibiting the amount or activity" refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity. As used herein, “RNA nucleoside” means a nucleoside comprising an unmodified RNA sugar moiety. 5 An RNA nucleoside may comprise a modified or unmodified nucleobase. An RNA nucleoside may comprise a thymine nucleobase or a modified nucleobase, or may be an abasic nucleoside. As used herein, “RNA sugar moiety” means an unmodified RNA sugar moiety. As used herein, “RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. RNAi agents 10 include, but are not limited to double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and / or terminal groups. In certain embodiments, an RNAi agent modulates the amount and / or activity of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H. As used herein, “RNase H agent” means an antisense agent that acts, at least in part, through RNase 15 H to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNase H agents may be single-stranded or RNase H agents may be double-stranded. RNase H agents may comprise conjugate groups and / or terminal groups. RNase H agents may modulate the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act through RISC / Ago2. As used herein, “single-stranded” in reference to a strand of linked nucleosides (e.g., an20 oligonucleotide) means that the strand of linked nucleosides is not part of a duplex or part of a double- stranded region. Single-stranded nucleic acids (e.g., single-stranded oligonucleotides) are capable of hybridizing to complementary nucleic acids to form duplexes, at which point they are no longer single- stranded. As used herein, “stabilized phosphate group” means a 5’-phosphate analog that is metabolically more 25 stable than a 5’-phosphate as naturally occurs on DNA or RNA. As used herein, “standard in vitro assay” means the assay described in Example 4, 5, or 6, and reasonable variations thereof. As used herein, “standard in vivo assay” means the assay described in Example 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17, and reasonable variations thereof. 30 As used herein, “stereorandom” or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not intentionally controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration at that chiral center. It is understood that a stereorandom chiral center may not be racemic because one absolute configuration predominates following synthesis, e.g., due to steric and electronic interactions of reagents with 14 BIOL0446WO the reactant molecule. The stereorandom chiral center may be at the phosphorous atom of a stereorandom phosphorothioate or stereorandom mesyl phosphoramidate internucleoside linkage. As used herein, a “strand” or “strand of linked nucleosides” means linked nucleosides and / or nucleoside surrogates connected via internucleoside linkages. A strand of linked nucleosides has a 5 nucleobase sequence. As used herein, “subject” means a human or non-human animal. In certain embodiments, the subject is a human. As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “sugar mimic” means a group of atoms forming the portion of a nucleoside 10 corresponding to the β-D-ribosyl sugar in RNA other than a modified furanosyl sugar moiety, a cyclic sugar surrogate, or an acyclic sugar surrogate. As used herein, “sugar surrogate nucleoside” means a cyclic sugar surrogate nucleoside or an acyclic sugar surrogate nucleoside. As used herein, “symptom” of a disease means any manifestation, indication, sign, or evidence of a 15 disease. Symptoms include subjective and objective indicia of a disease and may be perceived, experienced, detected, observed, measured, and / or quantified. A symptom may be apparent only upon invasive diagnostic testing, including, but not limited to, post-mortem tests. A symptom may be an absence of a feature, such as failing to reach expected developmental milestones. Symptoms may include cognitive impairment, progressive memory loss, a decline in language skills, behavioral abnormality, dementia, difficulty 20 performing daily activities, aphasia, agnosia, apraxia, loss of motor function, amyloid plaque, neurofibrillary tangle, and / or neuroinflammation. As used herein, “target nucleic acid” means an APOE nucleic acid that an antisense oligonucleotide is designed to affect. As used herein, “target RNA” means an APOE RNA transcript and includes pre-mRNA and / or mRNA unless otherwise specified. 25 As used herein, “target region” refers to a portion of a target nucleic acid that is complementary to the targeting region of an antisense oligonucleotide. As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide. As used herein, “treating” or “treatment,” with respect to a disease, means administering a compound 30 or agent to a subject having or at risk for developing such disease. Treating a disease may result in amelioration of at least one symptom of such disease. Treatment may reduce, improve, and / or prevent one or more symptom(s) such that a symptom of the disease is diminished, is no longer apparent, or is never apparent. 15 BIOL0446WO As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount ameliorates at least one symptom of a disease. As used herein, “unmodified nucleobase” means unmodified adenine (A), unmodified thymine (T), 5 unmodified cytosine (C), unmodified uracil (U), or unmodified guanine (G). As used herein, an “unmodified nucleoside” means a compound or subunit comprising an unmodified sugar moiety and an unmodified nucleobase. As used herein, “unmodified sugar moiety” means a 2′-OH(H) β-D-ribosyl sugar moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) β-D-deoxyribosyl sugar moiety, as found in DNA 10 (an “unmodified DNA sugar moiety”). Unmodified sugar moieties are furanosyl or deoxyfuranosyl sugar moieties in the β-D-ribosyl stereochemical configuration, and have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, two hydrogens at the 5′ position, and two hydrogens (DNA) or a hydrogen and an OH (RNA) at the 2′ position. 15 CERTAIN EMBODIMENTS The present disclosure provides the following non-limiting numbered embodiments: Embodiment 1. An oligomeric agent comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 80% 20 complementary to an equal length portion of an APOE nucleic acid, and wherein at least one internucleoside linkage of the modified oligonucleotide is a mesyl phosphoramidate internucleoside linkage. Embodiment 2. An oligomeric agent comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contiguous nucleobases of any of the 25 nucleobase sequences of SEQ ID NOs: 22-40, wherein at least one internucleoside linkage of the modified oligonucleotide is a mesyl phosphoramidate internucleoside linkage. Embodiment 3. The oligomeric agent of embodiment 1 or embodiment 2, wherein the modified oligonucleotide has a nucleobase sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of any one of SEQ ID NOs: 1-5 when measured across the entire 30 nucleobase sequence of the modified oligonucleotide. Embodiment 4. The oligomeric agent of any of embodiments 1-3, wherein the modified oligonucleotide consists of 12 to 20, 12 to 21, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 21, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 21, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 21, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 21, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 21, 17 to 25, 17 to 30, 17 to 50, 18 to 16 BIOL0446WO 20, 18 to 21, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 21, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, or 21 to 50 linked nucleosides. Embodiment 5. The oligomeric agent of any of embodiments 1-4, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 15, at least 16, at least 17, at least 18, at least 5 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 22-37. Embodiment 6. The oligomeric agent of any of embodiments 1-4, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 23. Embodiment 7. The oligomeric agent of any of embodiments 1-6, wherein at least one nucleoside of 10 the modified oligonucleotide is a modified nucleoside. Embodiment 8. The oligomeric agent of embodiment 7, wherein the modified nucleoside comprises a modified sugar moiety. Embodiment 9. The oligomeric agent of embodiment 8, wherein the modified sugar moiety comprises a bicyclic sugar moiety. 15 Embodiment 10. The oligomeric agent of embodiment 9, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from -O-CH2-; and -O-CH(CH3)-. Embodiment 11. The oligomeric agent of embodiment 7, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety. Embodiment 12. The oligomeric agent of embodiment 11, wherein the non-bicyclic modified sugar 20 moiety is a 2’-MOE sugar moiety, a 2’-OMe sugar moiety, or a 2’-β-D-deoxyxylosyl sugar moiety. Embodiment 13. The oligomeric agent of embodiment 7, wherein the modified nucleoside comprises a sugar surrogate. Embodiment 14. The oligomeric agent of embodiment 13, wherein the sugar surrogate is any of morpholino, modified morpholino, glycol nucleic acid (GNA), six-membered tetrahydropyran (THP), and F- 25 hexitol nucleic acid (FHNA). Embodiment 15. The oligomeric agent of any of embodiments 1-14, wherein the modified oligonucleotide is a gapmer. Embodiment 16. The oligomeric agent of any of embodiments 1-15, wherein the modified oligonucleotide comprises: 30 a 5’-region consisting of 1-6 linked 5’-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3’-region consisting of 1-6 linked 3’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety. 17 BIOL0446WO Embodiment 17. The oligomeric agent of any of embodiments 1-16, wherein the modified oligonucleotide comprises: a 5’-region consisting of 6 linked 5’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and 5 a 3’-region consisting of 4 linked 3’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety. Embodiment 18. The oligomeric agent of any of embodiments 1-16, wherein the modified oligonucleotide comprises: 10 a 5’-region consisting of 4 linked 5’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3’-region consisting of 6 linked 3’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety. 15 Embodiment 19. The oligomeric agent of any of embodiments 16-18, wherein the modified sugar moiety is a 2’-MOE sugar moiety or a cEt sugar moiety. Embodiment 20. The oligomeric agent of any of embodiments 16-19, wherein the modified oligonucleotide comprises: a 5’-region consisting of 6 linked 5’-region nucleosides; 20 a central region consisting of 10 linked central region nucleosides; and a 3’-region consisting of 4 linked 3’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety selected from the group consisting of a 2’-MOE sugar moiety and a cEt sugar moiety, and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety. 25 Embodiment 21. The oligomeric agent of any of embodiments 16-19, wherein the modified oligonucleotide comprises: a 5’-region consisting of 4 linked 5’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3’-region consisting of 6 linked 3’-region nucleosides; 30 wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety selected from the group consisting of a 2’-MOE sugar moiety and a cEt sugar moiety, and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety. Embodiment 22. An oligomeric agent comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the modified oligonucleotide comprises: 35 a 5’-region consisting of 1-6 linked 5’-region nucleosides; 18 BIOL0446WO a central region consisting of 10-13 linked central region nucleosides; and a 3’-region consisting of 1-5 linked 3’-region nucleosides; wherein: each nucleoside in the 5’-region nucleosides comprises either a modified sugar moiety or a 2’-β-D- 5 deoxyribosyl sugar moiety; each nucleoside in the 3’-region nucleosides comprises either a modified sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; at least one nucleoside in either the 5’-region or the 3’-region is a 2’-β-D-deoxyribosyl sugar moiety; and 10 each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety; and wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an APOE nucleic acid. Embodiment 23. The oligomeric agent of embodiment 22, wherein the modified sugar moiety comprises a bicyclic sugar moiety. 15 Embodiment 24. The oligomeric agent of embodiment 23, wherein the bicyclic sugar moiety is a cEt sugar moiety. Embodiment 25. The oligomeric agent of embodiment 22, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety. Embodiment 26. The oligomeric agent of embodiment 25, wherein the non-bicyclic modified sugar 20 moiety is a 2’-MOE sugar moiety, a 2’-OMe sugar moiety, or a 2’-β-D-deoxyxylosyl sugar moiety. Embodiment 27. The oligomeric agent of embodiment 22, wherein the modified sugar moiety comprises a sugar surrogate. Embodiment 28. The oligomeric agent of embodiment 27, wherein the sugar surrogate is any of morpholino, modified morpholino, glycol nucleic acid (GNA), six-membered tetrahydropyran (THP), and F- 25 hexitol nucleic acid (FHNA). Embodiment 29. The oligomeric agent of any of embodiments 22-28, wherein the modified oligonucleotide comprises: a 5’-region consisting of 3-6 linked 5’-region nucleosides; a central region consisting of 10-13 linked central region nucleosides; and 30 a 3’-region consisting of 3-5 linked 3’-region nucleosides; wherein: each nucleoside in the 5’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; each nucleoside in the 3’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- 35 deoxyribosyl sugar moiety; 19 BIOL0446WO at least one nucleoside in either the 5’-region or the 3’-region is a 2’-β-D-deoxyribosyl sugar moiety; and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety and wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to 5 an equal length portion of an APOE nucleic acid. Embodiment 30. The oligomeric agent of any of embodiments 22-29, wherein the modified oligonucleotide comprises: a 5’-region consisting of 3-6 linked 5’-region nucleosides; a central region consisting of 10-13 linked central region nucleosides; and 10 a 3’-region consisting of 4 linked 3’-region nucleosides; wherein: each nucleoside in the 5’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; each nucleoside in the 3’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- 15 deoxyribosyl sugar moiety; at least one nucleoside in either the 5’-region or the 3’-region is a 2’-β-D-deoxyribosyl sugar moiety; and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety and wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to 20 an equal length portion of an APOE nucleic acid. Embodiment 31. The oligomeric agent of any of embodiments 22-29, wherein the modified oligonucleotide comprises: a 5’-region consisting of 5-6 linked 5’-region nucleosides; a central region consisting of 11-13 linked central region nucleosides; and 25 a 3’-region consisting of 3 linked 3’-region nucleosides; wherein: each nucleoside in the 5’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; each nucleoside in the 3’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- 30 deoxyribosyl sugar moiety; at least one nucleoside in either the 5’-region or the 3’-region is a 2’-β-D-deoxyribosyl sugar moiety; and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety and wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to 35 an equal length portion of an APOE nucleic acid. 20 BIOL0446WO Embodiment 32. The oligomeric agent of any of embodiments 22-30, wherein the modified oligonucleotide comprises: a 5’-region consisting of 3 linked 5’-region nucleosides; a central region consisting of 13 linked central region nucleosides; and 5 a 3’-region consisting of 4 linked 3’-region nucleosides; wherein: each nucleoside in the 5’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; each nucleoside in the 3’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- 10 deoxyribosyl sugar moiety; at least one nucleoside in either the 5’-region or the 3’-region is a 2’-β-D-deoxyribosyl sugar moiety; and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety and wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to 15 an equal length portion of an APOE nucleic acid. Embodiment 33. The oligomeric agent of any of embodiments 22-32, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of an APOE nucleic acid. Embodiment 34. The oligomeric agent of any of embodiments 22-33, wherein the nucleobase 20 sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of any one of SEQ ID NOs: 1-5 when measured across the entire nucleobase sequence of the modified oligonucleotide. Embodiment 35. The oligomeric agent of any of embodiments 1-34, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage. 25 Embodiment 36. The oligomeric agent of any of embodiments 1-35, wherein the modified oligonucleotide comprises at least one phosphorothioate internucleoside linkage. Embodiment 37. The oligomeric agent of embodiment 35 or embodiment 36, wherein the modified oligonucleotide comprises at least one mesyl phosphoramidate internucleoside linkage and each remaining internucleoside linkage is independently selected from a phosphodiester internucleoside linkage, a 30 phosphorothioate internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage. Embodiment 38. The oligomeric agent of embodiment 35 or embodiment 36, wherein the modified oligonucleotide comprises at least one mesyl phosphoramidate internucleoside linkage and each remaining internucleoside linkage is independently selected from a phosphorothioate internucleoside linkage and a mesyl phosphoramidate internucleoside linkage. 21 BIOL0446WO Embodiment 39. The oligomeric agent of any of embodiments 35-38, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or 19 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. 5 Embodiment 40. The oligomeric agent of any of embodiments 35-39, wherein at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 internucleoside linkages of the modified oligonucleotide are mesyl phosphoramidate internucleoside linkages. Embodiment 41. The oligomeric agent of any of embodiments 35-40, wherein the modified oligonucleotide has an internucleoside linkage motif selected from soossssssssssooss, sosssszzzssssszoss, 10 ssoooszzsssssszsooss, ssoooszzzssssszsooss, ssoosszzzssssszsooss, zsoooszzsssssszsoosz, zsossszzzssssszsoosz, soooosszzsssssszoss, sooosssssssssssooss, sooossszzsssssszoss, sooossszzsssssszsss, soooszzzsssssssssss, soooszzzsssszssooss, soooszzzsssszzsooss, soosssszzzssssszsss, soossszzsssssssssss, soossszzzssssszssss, soosszzzssssszsooss, soosszzzssssszsssss, sosssszzzssssszssss, sossszzzzssssszssss, soszsszzzssssszssss, ssoooszzssssssssoos, ssssoszzzssssszssss, sssssozzzssssszssss, ssszzszzzssssszsszz, 15 ssszzzssssszzsssssz, ssszzzssssszzzssssz, ssszzzssszzsssssssz, ssszzzsszzssssssssz, ssszzzszzssssszsssz, ssszzzzzssssssssssz, ssszzzzzzsssssssssz, ssszzzzzzsssssszssz, ssszzzzzzssssszsssz, ssszzzzzzssssszsszs, ssszzzzzzssssszszss, ssszzzzzzzssssssssz, sszszszzzssssszsszz, sszszzzzzssssszsssz, sszszzzzzssssszsszs, sszszzzzzssssszszss, sszzszzzzssssszsssz, sszzszzzzssssszsszs, sszzszzzzssssszszss, sszzzszzzssssszsssz, sszzzszzzssssszsszs, sszzzszzzssssszszss, szsszszzzssssszsszz, szszsszzzssssszszsz, szszszzzzssssszsssz, 20 szszszzzzssssszsszs, szszszzzzssssszszss, szszzszzzssssszsssz, szszzszzzssssszsszs, szszzszzzssssszszss, szzssszzzssssszsszz, szzsszzzzssssszsssz, szzsszzzzssssszsszs, szzsszzzzssssszszss, szzszsszzssssszsssz, szzszszzssssssssssz, szzszszzzsssssszssz, szzszszzzssssszsssz, szzszszzzssssszsszs, szzszszzzssssszszss, szzszszzzzssssssssz, szzzsszzzssssszsssz, szzzsszzzssssszsszs, szzzsszzzssssszszss, zoosszzzssssszsssss, zossszzzssssszsssss, or zossszzzssssszssssz, wherein each “s” represents a phosphorothioate internucleoside 25 linkage, each “o” represents a phosphodiester internucleoside linkage, and each “z” represents a mesyl phosphoramidate internucleoside linkage. Embodiment 42. The oligomeric agent of any of embodiments 35-40, wherein the modified oligonucleotide has an internucleoside linkage motif selected from soooosszzsssssszoss, sooosssssssssssooss, sooossszzsssssszoss, sooossszzsssssszsss, soooszzzsssssssssss, soooszzzsssszssooss, soooszzzsssszzsooss, 30 soosssszzzssssszsss, soossszzsssssssssss, soossszzzssssszssss, soosszzzssssszsooss, soosszzzssssszsssss, sosssszzzssssszssss, sossszzzzssssszssss, soszsszzzssssszssss, ssoooszzssssssssoos, ssssoszzzssssszssss, sssssozzzssssszssss, ssszzszzzssssszsszz, ssszzzssssszzsssssz, ssszzzssssszzzssssz, ssszzzssszzsssssssz, ssszzzsszzssssssssz, ssszzzszzssssszsssz, ssszzzzzssssssssssz, ssszzzzzzsssssssssz, ssszzzzzzsssssszssz, ssszzzzzzssssszsssz, ssszzzzzzssssszsszs, ssszzzzzzssssszszss, ssszzzzzzzssssssssz, sszszszzzssssszsszz, 35 sszszzzzzssssszsssz, sszszzzzzssssszsszs, sszszzzzzssssszszss, sszzszzzzssssszsssz, sszzszzzzssssszsszs, 22 BIOL0446WO sszzszzzzssssszszss, sszzzszzzssssszsssz, sszzzszzzssssszsszs, sszzzszzzssssszszss, szsszszzzssssszsszz, szszsszzzssssszszsz, szszszzzzssssszsssz, szszszzzzssssszsszs, szszszzzzssssszszss, szszzszzzssssszsssz, szszzszzzssssszsszs, szszzszzzssssszszss, szzssszzzssssszsszz, szzsszzzzssssszsssz, szzsszzzzssssszsszs, szzsszzzzssssszszss, szzszsszzssssszsssz, szzszszzssssssssssz, szzszszzzsssssszssz, szzszszzzssssszsssz, 5 szzszszzzssssszsszs, szzszszzzssssszszss, szzszszzzzssssssssz, szzzsszzzssssszsssz, szzzsszzzssssszsszs, szzzsszzzssssszszss, zoosszzzssssszsssss, zossszzzssssszsssss, or zossszzzssssszssssz, wherein each “s” represents a phosphorothioate internucleoside linkage, each “o” represents a phosphodiester internucleoside linkage, and each “z” represents a mesyl phosphoramidate internucleoside linkage. Embodiment 43. The oligomeric agent of any of embodiments 1-42, wherein at least one nucleoside 10 of the modified oligonucleotide comprises a modified nucleobase. Embodiment 44. The oligomeric agent of embodiment 43, wherein the modified nucleobase is a 5- methylcytosine. Embodiment 45. The oligomeric agent of embodiment 44, wherein each cytosine is a 5- methylcytosine. 15 Embodiment 46. The oligomeric agent of any of embodiments 1-45, wherein each nucleoside of the modified oligonucleotide is unmodified adenine, unmodified guanine, unmodified thymine, unmodified cytosine, or 5-methylcytosine. Embodiment 47. The oligomeric agent of any of embodiments 1-46, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-21, 12-20,14-18, 14-20, 14-21, 15-17, 15-21, 15-25, 16-20, 16- 20 21, 18-22, 18-21, or 18-20 linked nucleosides. Embodiment 48. The oligomeric agent of any of embodiments 1-47, wherein the modified oligonucleotide consists of 18 linked nucleosides. Embodiment 49. The oligomeric agent of any of embodiments 1-47, wherein the modified oligonucleotide consists of 19 linked nucleosides. 25 Embodiment 50. The oligomeric agent of any of embodiments 1-47, wherein the modified oligonucleotide consists of 20 linked nucleosides. Embodiment 51. The oligomeric agent of any of embodiments 1-47, wherein the modified oligonucleotide consists of 21 linked nucleosides. Embodiment 52. The oligomeric agent of any of embodiments 1-51, wherein the oligomeric agent 30 consists of the modified oligonucleotide. Embodiment 53. The oligomeric agent of any of embodiments 1-51, wherein the oligomeric agent comprises a conjugate group. Embodiment 54. The oligomeric agent of embodiment 53, wherein the conjugate group comprises a conjugate moiety and a conjugate linker. 23 BIOL0446WO Embodiment 55. The oligomeric agent of embodiment 54, wherein the conjugate linker is a phosphodiester linker. Embodiment 56. The oligomeric agent of embodiment 54, wherein the conjugate linker consists of a single bond. 5 Embodiment 57. The oligomeric agent of any of embodiments 54-56, wherein the conjugate linker is cleavable. Embodiment 58. The oligomeric agent of any of embodiments 54, 55, or 57, wherein the conjugate linker is attached to one or more nucleosides that are attached to the remainder of the modified oligonucleotide through at least one phosphodiester bond. 10 Embodiment 59. The oligomeric agent of any of embodiments 53-58, wherein the conjugate group is attached to the modified oligonucleotide at the 5’-end of the modified oligonucleotide. Embodiment 60. The oligomeric agent of any of embodiments 53-58, wherein the conjugate group is attached to the modified oligonucleotide at the 3’-end of the modified oligonucleotide. Embodiment 61. The oligomeric agent of any of embodiments 1-60, wherein the modified 15 oligonucleotide comprises a terminal group. Embodiment 62. The oligomeric agent of embodiment 61, wherein the terminal group is an abasic sugar moiety. Embodiment 63. The oligomeric agent of any of embodiments 1-62, wherein the oligomeric agent is an antisense agent. 20 Embodiment 64. The oligomeric agent of any of embodiments 1-63, wherein the oligomeric agent is a single-stranded antisense agent. Embodiment 65. The oligomeric agent of any of embodiments 1-64, wherein the oligomeric agent is an RNase H agent. Embodiment 66. The oligomeric agent of any of embodiments 1-51 or 53-63, wherein the oligomeric 25 agent is an RNAi agent. Embodiment 67. The oligomeric agent of any of embodiments 1-51, 53-63, or 66, comprising a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the modified oligonucleotide. 30 Embodiment 68. The oligomeric agent of embodiment 67, wherein the modified oligonucleotide comprises a 5’-stabilized phosphate group. Embodiment 69. The oligomeric agent of embodiment 68, wherein the stabilized phosphate group comprises a cyclopropyl phosphonate or a vinyl phosphonate. Embodiment 70. The oligomeric agent of any of embodiments 67-69, wherein at least one nucleoside 35 of the second modified oligonucleotide comprises a modified sugar moiety. 24 BIOL0446WO Embodiment 71. The oligomeric agent of embodiment 70, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety. Embodiment 72. The oligomeric agent of embodiment 71, wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2’-4’ bridge selected from –O-CH2-; and –O-CH(CH3)-. 5 Embodiment 73. The oligomeric agent of embodiment 70, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety. Embodiment 74. The oligomeric agent of embodiment 73, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2’-MOE sugar moiety, a 2’-F modified sugar moiety, or 2’-OMe modified sugar moiety. 10 Embodiment 75. The oligomeric agent of any of embodiments 67-74, wherein at least one internucleoside linkage of the second modified oligonucleotide is a modified internucleoside linkage. Embodiment 76. The oligomeric agent of embodiment 75, wherein at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage. Embodiment 77. The oligomeric agent of any of embodiments 75-76, wherein at least one 15 internucleoside linkage of the second modified oligonucleotide is a phosphodiester internucleoside linkage. Embodiment 78. The oligomeric agent of any of embodiments 75-77, wherein at least one internucleoside linkage of the second modified oligonucleotide is a mesyl phosphoramidate internucleoside linkage. Embodiment 79. The oligomeric agent of any of embodiments 75-78, wherein each internucleoside 20 linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, or a mesyl phosphoramidate internucleoside linkage. Embodiment 80. The oligomeric agent of any of embodiments 67-79, wherein the second modified oligonucleotide comprises at least one modified nucleobase. 25 Embodiment 81. The oligomeric agent of embodiment 80, wherein the at least one modified nucleobase of the second modified oligonucleotide is 5-methylcytosine. Embodiment 82. The oligomeric agent of any of embodiments 67-81, wherein the second modified oligonucleotide comprises a conjugate group. Embodiment 83. The oligomeric agent of embodiment 82, wherein the conjugate group comprises a 30 conjugate moiety and a conjugate linker. Embodiment 84. The oligomeric agent of embodiment 83, wherein the conjugate linker consists of a single bond. Embodiment 85. The oligomeric agent of embodiment 83 or embodiment 84, wherein the conjugate linker is cleavable. 25 BIOL0446WO Embodiment 86. The oligomeric agent of embodiment 83 or embodiment 85, wherein the conjugate linker is attached to one or more nucleosides that are attached to the remainder of the modified oligonucleotide through at least one phosphodiester bond. Embodiment 87. The oligomeric agent of any of embodiments 83-86, wherein the conjugate linker is 5 a phosphodiester linker. Embodiment 88. The oligomeric agent of any of embodiments 82-87, wherein the conjugate group is attached to the 5’-end of the second modified oligonucleotide. Embodiment 89. The oligomeric agent of any of embodiments 82-87, wherein the conjugate group is attached to the 3’-end of the second modified oligonucleotide. 10 Embodiment 90. The oligomeric agent of any of embodiments 82-87, wherein the conjugate group is attached via the 2’ position of a ribosyl sugar moiety at an internal position of the second modified oligonucleotide. Embodiment 91. The oligomeric agent of any of embodiments 82-90, wherein the conjugate group comprises a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. Embodiment 92. The oligomeric agent of any of embodiments 82-91, wherein the conjugate group 20 comprises a cell-targeting moiety. Embodiment 93. The oligomeric agent of any of embodiments 67-92, wherein the second modified oligonucleotide comprises a terminal group. Embodiment 94. The oligomeric agent of embodiment 93, wherein the terminal group is an abasic sugar moiety. 25 Embodiment 95. An oligomeric agent comprising a modified oligonucleotide according to the following chemical notation: AesmCeoTeoTesGesGksTdsGdzAdzAdzTdsmCdsTdsTdsTdsAdzTksTksAesAe(SEQ ID NO: 45), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, 30 G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety, 35 s = a phosphorothioate internucleoside linkage, 26 BIOL0446WO o = a phosphodiester internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and the oligomeric agent does not include a conjugate group or a terminal group. Embodiment 96. An oligomeric agent comprising a modified oligonucleotide according to the 5 following chemical notation:mCksTksTksGdzGdzTdzGdzAdzAdzTdsmCdsTdsTdsTdsAdsTdsTksAksAdzAk(SEQ ID NO: 46), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, 10 T = a thymine nucleobase, k = a cEt sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and the oligomeric agent does not include a 15 conjugate group or a terminal group. Embodiment 97. An oligomeric agent comprising a modified oligonucleotide according to the following chemical notation: AksmCeoTeoTesGesGksTdsGdzAdzAdzTdsmCdsTdsTdsTdsAdzTksTksAesAe(SEQ ID NO: 47), wherein: A = an adenine nucleobase, 20mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, 25 d = a 2’-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and the oligomeric agent does not include a conjugate group or a terminal group. 30 Embodiment 98. An oligomeric agent comprising a modified oligonucleotide according to the following chemical notation: TezTeoGeoGksTdsGdzAdzAdzTdsmCdsTdsTdsTdsAdzTksTksAesAesAesmCe(SEQ ID NO: 48), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, 35 G = a guanine nucleobase, 27 BIOL0446WO T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety, 5 s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and the oligomeric agent does not include a conjugate group or a terminal group. Embodiment 99. The oligomeric agent of any of embodiments 95-98, wherein the modified 10 oligonucleotide is a pharmaceutically acceptable salt. Embodiment 100. The oligomeric agent of embodiment 99, wherein the pharmaceutically acceptable salt comprises one or more cations selected from sodium, potassium, calcium, and magnesium. Embodiment 101. An oligomeric agent according to the following chemical notation: N1esmCeoTeoTesGesGksTdsGdzAdzAdzTdsmCdsTdsTdsTdsAdzTksTksN3esN2e (SEQ ID NO: 49), wherein: 15 A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, N1= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal 20 group, or is absent, wherein when N1is absent its sugar and internucleoside linkage are also absent, N2= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N2is absent its sugar and internucleoside linkage are also absent, N3= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N3is absent its sugar and internucleoside linkage are also absent, 25 e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and 30 z = a mesyl phosphoramidate internucleoside linkage; and wherein the oligomeric agent optionally comprises a conjugate group. Embodiment 102. An oligomeric agent according to the following chemical notation: N5ksTksTksGdzGdzTdzGdzAdzAdzTdsmCdsTdsTdsTdsAdsTdsTksN4ksN3dzN2k (SEQ ID NO: 50), wherein: A = an adenine nucleobase, 35mC = a 5-methylcytosine nucleobase, 28 BIOL0446WO G = a guanine nucleobase, T = a thymine nucleobase, N2= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N2is absent its sugar and internucleoside linkage are also absent, 5 N3= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N3is absent its sugar and internucleoside linkage are also absent, N4= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N4is absent its sugar and internucleoside linkage are also absent, N5= a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, 10 wherein when N5is absent its sugar is also absent, k = a cEt sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and 15 wherein the oligomeric agent optionally comprises a conjugate group. Embodiment 103. An oligomeric agent according to the following chemical notation: N1ksmCeoTeoTesGesGksTdsGdzAdzAdzTdsmCdsTdsTdsTdsAdzTksTksN3esN2e (SEQ ID NO: 51), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, 20 G = a guanine nucleobase, T = a thymine nucleobase, N1= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N1is absent its sugar and internucleoside linkage are also absent, N2= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal 25 group, or is absent, wherein when N2is absent its sugar and internucleoside linkage are also absent, N3= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N3is absent its sugar and internucleoside linkage are also absent, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, 30 d = a 2’-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and wherein the oligomeric agent optionally comprises a conjugate group. 29 BIOL0446WO Embodiment 104. The oligomeric agent of embodiment 101 or embodiment 103, wherein N1is an adenine nucleobase. Embodiment 105. The oligomeric agent of embodiment 101 or embodiment 103, wherein N1is an unmodified adenine. 5 Embodiment 106. The oligomeric agent of embodiment 101 or embodiment 103, wherein N1is a modified adenine. Embodiment 107. The oligomeric agent of embodiment 101 or embodiment 103, wherein N1is a hypoxanthine. Embodiment 108. The oligomeric agent of embodiment 101 or embodiment 103, wherein N1is an 10 abasic sugar moiety. Embodiment 109. The oligomeric agent of embodiment 101 or embodiment 103, wherein N1is a terminal group. Embodiment 110. The oligomeric agent of embodiment 101 or embodiment 103, wherein N1is absent. 15 Embodiment 111. The oligomeric agent of any of embodiments 101-110, wherein N2is an adenine nucleobase. Embodiment 112. The oligomeric agent of any of embodiments 101-110, wherein N2is an unmodified adenine. Embodiment 113. The oligomeric agent of any of embodiments 101-110, wherein N2is a modified 20 adenine. Embodiment 114. The oligomeric agent of any of embodiments 101-110, wherein N2is a hypoxanthine. Embodiment 115. The oligomeric agent of any of embodiments 101-110, wherein N2is an abasic sugar moiety. 25 Embodiment 116. The oligomeric agent of any of embodiments 101-110, wherein N2is a terminal group. Embodiment 117. The oligomeric agent of any of embodiments 101-110, wherein N2is absent. Embodiment 118. The oligomeric agent of any of embodiments 101-117, wherein N3is an adenine nucleobase. 30 Embodiment 119. The oligomeric agent of any of embodiments 101-117, wherein N3is an unmodified adenine. Embodiment 120. The oligomeric agent of any of embodiments 101-117, wherein N3is a modified adenine. Embodiment 121. The oligomeric agent of any of embodiments 101-117, wherein N3is a 35 hypoxanthine. 30 BIOL0446WO Embodiment 122. The oligomeric agent of any of embodiments 101-117, wherein N3is an abasic sugar moiety. Embodiment 123. The oligomeric agent of any of embodiments 101-117, wherein N3is a terminal group. 5 Embodiment 124. The oligomeric agent of any of embodiments 101-117, wherein N3is absent. Embodiment 125. The oligomeric agent of any of embodiments 102 or 111-124, wherein N4is an adenine nucleobase. Embodiment 126. The oligomeric agent of any of embodiments 102 or 111-124, wherein N4is an unmodified adenine. 10 Embodiment 127. The oligomeric agent of any of embodiments 102 or 111-124, wherein N4is a modified adenine. Embodiment 128. The oligomeric agent of any of embodiments 102 or 111-124, wherein N4is a hypoxanthine. Embodiment 129. The oligomeric agent of any of embodiments 102 or 111-124, wherein N4is an 15 abasic sugar moiety. Embodiment 130. The oligomeric agent of any of embodiments 102 or 111-124, wherein N4is a terminal group. Embodiment 131. The oligomeric agent of any of embodiments 102 or 111-124, wherein N4is absent. 20 Embodiment 132. The oligomeric agent of any of embodiments 102 or 111-131, wherein N5is a modified cytosine. Embodiment 133. The oligomeric agent of any of embodiments 102 or 111-131, wherein N5is 5- methylcytosine. Embodiment 134. The oligomeric agent of any of embodiments 102 or 111-131, wherein N5is an 25 unmodified cytosine. Embodiment 135. The oligomeric agent of any of embodiments 102 or 111-131, wherein N5is an abasic sugar moiety. Embodiment 136. The oligomeric agent of any of embodiments 102 or 111-131, wherein N5is a terminal group. 30 Embodiment 137. The oligomeric agent of any of embodiments 102 or 111-131, wherein N5is absent. Embodiment 138. The oligomeric agent of any of embodiments 101 or 103-117, wherein N1is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N2is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a 35 terminal group, or is absent. 31 BIOL0446WO Embodiment 139. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is an adenine nucleobase and N2is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. Embodiment 140. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is 5 an adenine nucleobase and N2is an unmodified adenine. Embodiment 141. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is an adenine nucleobase and N2is a modified adenine. Embodiment 142. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is an adenine nucleobase and N2is a hypoxanthine. 10 Embodiment 143. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is an adenine nucleobase and N2is an abasic sugar moiety. Embodiment 144. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is an adenine nucleobase and N2is a terminal group. Embodiment 145. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is 15 an adenine nucleobase and N2is absent. Embodiment 146. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is a modified adenine and N2is an unmodified adenine. Embodiment 147. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is a modified adenine and N2is a modified adenine. 20 Embodiment 148. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is a modified adenine and N2is a hypoxanthine. Embodiment 149. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is a modified adenine and N2is an abasic sugar moiety. Embodiment 150. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is a 25 modified adenine and N2is a terminal group. Embodiment 151. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is a modified adenine and N2is absent. Embodiment 152. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is a hypoxanthine and N2is an unmodified adenine. 30 Embodiment 153. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is a hypoxanthine and N2is a modified adenine. Embodiment 154. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is a hypoxanthine and N2is a hypoxanthine. Embodiment 155. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is a 35 hypoxanthine and N2is an abasic sugar moiety. 32 BIOL0446WO Embodiment 156. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is a hypoxanthine and N2is a terminal group. Embodiment 157. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is a hypoxanthine and N2is absent. 5 Embodiment 158. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is an abasic sugar moiety, a terminal group, or is absent, and N2is an unmodified adenine. Embodiment 159. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is an abasic sugar moiety, a terminal group, or is absent, and N2is a modified adenine. Embodiment 160. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is 10 an abasic sugar moiety, a terminal group, or is absent, and N2is a hypoxanthine. Embodiment 161. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is an abasic sugar moiety, a terminal group, or is absent, and N2is an abasic sugar moiety. Embodiment 162. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is an abasic sugar moiety, a terminal group, or is absent, and N2is a terminal group. 15 Embodiment 163. The oligomeric agent of any of embodiments 101, 103-117, or 138, wherein N1is an abasic sugar moiety, a terminal group, or is absent, and N2is absent. Embodiment 164. The oligomeric agent of any of embodiments 101, 103-110, or 117-124, wherein: a) N1is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent; 20 b) N2is absent; and c) N3is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. Embodiment 165. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is an adenine nucleobase, N2is absent, and N3is an unmodified adenine. 25 Embodiment 166. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is an adenine nucleobase, N2is absent, and N3is a modified adenine. Embodiment 167. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is an adenine nucleobase, N2is absent, and N3is a hypoxanthine. Embodiment 168. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, 30 wherein N1is an adenine nucleobase, N2is absent, and N3is an abasic sugar moiety. Embodiment 169. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is an adenine nucleobase, N2is absent, and N3is a terminal group. Embodiment 170. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is an adenine nucleobase, N2is absent, and N3is absent. 33 BIOL0446WO Embodiment 171. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is a modified adenine, N2is absent, and N3is an unmodified adenine. Embodiment 172. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is a modified adenine, N2is absent, and N3is a modified adenine. 5 Embodiment 173. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is a modified adenine, N2is absent, and N3is a hypoxanthine. Embodiment 174. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is a modified adenine, N2is absent, and N3is an abasic sugar moiety. Embodiment 175. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, 10 wherein N1is a modified adenine, N2is absent, and N3is a terminal group. Embodiment 176. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is a modified adenine, N2is absent, and N3is absent. Embodiment 177. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is a hypoxanthine, N2is absent, and N3is an unmodified adenine. 15 Embodiment 178. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is a hypoxanthine, N2is absent, and N3is a modified adenine. Embodiment 179. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is a hypoxanthine, N2is absent, and N3is a hypoxanthine. Embodiment 180. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, 20 wherein N1is a hypoxanthine, N2is absent, and N3is an abasic sugar moiety. Embodiment 181. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is a hypoxanthine, N2is absent, and N3is a terminal group. Embodiment 182. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is a hypoxanthine, N2is absent, and N3is absent. 25 Embodiment 183. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is an unmodified adenine. Embodiment 184. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a modified 30 adenine. Embodiment 185. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a hypoxanthine. Embodiment 186. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is an abasic sugar 35 moiety. 34 BIOL0446WO Embodiment 187. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a terminal group. Embodiment 188. The oligomeric agent of any of embodiments 101, 103-110, 117-124, or 164, wherein N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is absent. 5 Embodiment 189. The oligomeric agent of any of embodiments 102, 111-117, or 132-137, wherein N5is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, and N2is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. Embodiment 190. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, 10 wherein N5is a cytosine nucleobase and N2is an unmodified adenine. Embodiment 191. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, wherein N5is a cytosine nucleobase and N2is a modified adenine. Embodiment 192. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, wherein N5is a cytosine nucleobase and N2is a hypoxanthine. 15 Embodiment 193. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, wherein N5is a cytosine nucleobase and N2is an abasic sugar moiety. Embodiment 194. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, wherein N5is a cytosine nucleobase and N2is a terminal group. Embodiment 195. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, 20 wherein N5is a cytosine nucleobase and N2is absent. Embodiment 196. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, wherein N5is a modified cytosine and N2is an unmodified adenine. Embodiment 197. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, wherein N5is a modified cytosine and N2is a modified adenine. 25 Embodiment 198. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, wherein N5is a modified cytosine and N2is a hypoxanthine. Embodiment 199. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, wherein N5is a modified cytosine and N2is an abasic sugar moiety. Embodiment 200. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, 30 wherein N5is a modified cytosine and N2is a terminal group. Embodiment 201. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, wherein N5is a modified cytosine and N2is absent. Embodiment 202. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, wherein N5is an abasic sugar moiety, a terminal group, or is absent, and N2is an unmodified adenine. 35 BIOL0446WO Embodiment 203. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, wherein N5is an abasic sugar moiety, a terminal group, or is absent, and N2is a modified adenine. Embodiment 204. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, wherein N5is an abasic sugar moiety, a terminal group, or is absent, and N2is a hypoxanthine. 5 Embodiment 205. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, wherein N5is an abasic sugar moiety, a terminal group, or is absent, and N2is an abasic sugar moiety. Embodiment 206. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, wherein N5is an abasic sugar moiety, a terminal group, or is absent, and N2is a terminal group. Embodiment 207. The oligomeric agent of any of embodiments 102, 111-117, 132-137, or 189, 10 wherein N5is an abasic sugar moiety, a terminal group, or is absent, and N2is absent. Embodiment 208. The oligomeric agent of any of embodiments 102, 117-124, or 132-137, wherein: a) N5is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent; b) N2is absent; and 15 c) N3is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. Embodiment 209. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is a cytosine nucleobase, N2is absent, and N3is an unmodified adenine. Embodiment 210. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, 20 wherein N5is a cytosine nucleobase, N2is absent, and N3is a modified adenine. Embodiment 211. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is a cytosine nucleobase, N2is absent, and N3is a hypoxanthine. Embodiment 212. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is a cytosine nucleobase, N2is absent, and N3is an abasic sugar moiety. 25 Embodiment 213. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is a cytosine nucleobase, N2is absent, and N3is a terminal group. Embodiment 214. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is a cytosine nucleobase, N2is absent, and N3is absent. Embodiment 215. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, 30 wherein N5is a modified cytosine, N2is absent, and N3is an unmodified adenine. Embodiment 216. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is a modified cytosine, N2is absent, and N3is a modified adenine. Embodiment 217. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is a modified cytosine, N2is absent, and N3is a hypoxanthine. 36 BIOL0446WO Embodiment 218. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is a modified cytosine, N2is absent, and N3is an abasic sugar moiety. Embodiment 219. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is a modified cytosine, N2is absent, and N3is a terminal group. 5 Embodiment 220. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is a modified cytosine, N2is absent, and N3is absent. Embodiment 221. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is an unmodified adenine. 10 Embodiment 22. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a modified adenine. Embodiment 223. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a hypoxanthine. 15 Embodiment 224. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is an abasic sugar moiety. Embodiment 225. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a terminal group. 20 Embodiment 226. The oligomeric agent of any of embodiments 102, 117-124, 132-137, or 208, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is absent. Embodiment 227. The oligomeric agent of any of embodiments 102, 117, or 124-137, wherein: a) N5is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent; 25 b) N2is absent; c) N3is absent; and d) N4is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. Embodiment 228. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein 30 N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is an unmodified adenine. Embodiment 229. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is a modified adenine. Embodiment 230. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is a hypoxanthine. 37 BIOL0446WO Embodiment 231. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is an abasic sugar moiety. Embodiment 232. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is a terminal group. 5 Embodiment 233. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is absent. Embodiment 234. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein N5is a modified cytosine, N2is absent, N3is absent, and N4is an unmodified adenine. Embodiment 235. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein 10 N5is a modified cytosine, N2is absent, N3is absent, and N4is a modified adenine. Embodiment 236. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein N5is a modified cytosine, N2is absent, N3is absent, and N4is a hypoxanthine. Embodiment 237. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein N5is a modified cytosine, N2is absent, N3is absent, and N4is an abasic sugar moiety. 15 Embodiment 238. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein N5is a modified cytosine, N2is absent, N3is absent, and N4is a terminal group. Embodiment 239. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein N5is a modified cytosine, N2is absent, N3is absent, and N4is absent. Embodiment 240. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein 20 N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is an unmodified adenine. Embodiment 241. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is a modified adenine. 25 Embodiment 242. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is a hypoxanthine. Embodiment 243. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is an abasic 30 sugar moiety. Embodiment 244. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is a terminal group. Embodiment 245. The oligomeric agent of any of embodiments 102, 117, 124-137, or 227, wherein 35 N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is absent. 38 BIOL0446WO Embodiment 246. An oligomeric agent comprising a modified oligonucleotide according to the following chemical structure: 5 wherein R1and R2are each independently 1, 2, or 3 linked nucleosides, an abasic nucleoside, a terminal group, or an H; and wherein the oligomeric agent optionally comprises a conjugate group. 39 BIOL0446WO Embodiment 247. An oligomeric agent comprising a modified oligonucleotide according to the following chemical structure: 5 wherein R3and R4are each independently 1, 2, or 3 linked nucleosides, an abasic nucleoside, a terminal group, or an H; and wherein the oligomeric agent optionally comprises a conjugate group. Embodiment 248. The oligomeric agent of embodiment 246, wherein R1is one nucleoside. Embodiment 249. The oligomeric agent of embodiment 246, wherein R1is 2 linked nucleosides. 10 Embodiment 250. The oligomeric agent of embodiment 246, wherein R1is 3 linked nucleosides. Embodiment 251. The oligomeric agent of any of embodiments 246 or 248-250, wherein R2is one nucleoside. 40 BIOL0446WO Embodiment 252. The oligomeric agent of any of embodiments 246 or 248-250, wherein R2is 2 linked nucleosides. Embodiment 253. The oligomeric agent of any of embodiments 246 or 248-250, wherein R2is 3 linked nucleosides. 5 Embodiment 254. The oligomeric agent of any of embodiments 246, 248, or 252, wherein R1is one nucleoside and R2is 2 linked nucleosides. Embodiment 255. The oligomeric agent of any of embodiments 246, 248, or 253, wherein R1is one nucleoside and R2is 3 linked nucleosides. Embodiment 256. The oligomeric agent of any of embodiments 246, 248, or 252-255, wherein R1is 10 an adenosine, a modified adenosine, an unmodified adenosine, or an inosine; and R2is 2 or 3 linked nucleosides. Embodiment 257. The oligomeric agent of any of embodiments 246, 248, or 252-256, wherein R1is an adenosine and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. Embodiment 258. The oligomeric agent of any of embodiments 246, 248, or 252-256, wherein R1is 15 an adenosine and R2comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines. Embodiment 259. The oligomeric agent of any of embodiments 246, 248, or 252-256, wherein R1is an adenosine and R2is an abasic nucleoside, a terminal group, or an H. Embodiment 260. The oligomeric agent of any of embodiments 246, 248, or 252-256, wherein R1is a 20 modified adenosine and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. Embodiment 261. The oligomeric agent of any of embodiments 246, 248, or 252-256, wherein R1is a modified adenosine and R2comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines. 25 Embodiment 262. The oligomeric agent of any of embodiments 246, 248, or 252-256, wherein R1is a modified adenosine and R2is an abasic nucleoside, a terminal group, or an H. Embodiment 263. The oligomeric agent of any of embodiments 246, 248, or 252-256, wherein R1is an unmodified adenosine and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. 30 Embodiment 264. The oligomeric agent of any of embodiments 246, 248, or 252-256, wherein R1is an unmodified adenosine and R2comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines. Embodiment 265. The oligomeric agent of any of embodiments 246, 248, or 252-256, wherein R1is an unmodified adenosine and R2is an abasic nucleoside, a terminal group, or an H. 41 BIOL0446WO Embodiment 266. The oligomeric agent of any of embodiments 246, 248, or 252-256, wherein R1is an inosine and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. Embodiment 267. The oligomeric agent of any of embodiments 246, 248, or 252-256, wherein R1is an inosine and R2comprises two or more adenosines, two or more modified adenosines, two or more 5 unmodified adenosines, or two or more inosines. Embodiment 268. The oligomeric agent of any of embodiments 246, 248, or 252-256, wherein R1is an inosine and R2is an abasic nucleoside, a terminal group, or an H. Embodiment 269. The oligomeric agent of any of embodiments 246, 248, or 252-255, wherein R1is an abasic nucleoside, a terminal group, or an H; and R2comprises an adenosine, a modified adenosine, an 10 unmodified adenosine, or an inosine. Embodiment 270. The oligomeric agent of any of embodiments 246, 248, or 252-255, wherein R1is an abasic nucleoside, a terminal group, or an H; and R2comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines. Embodiment 271. The oligomeric agent of any of embodiments 246, 248, or 252-255, wherein R1is 15 an abasic nucleoside, a terminal group, or an H; and R2is an abasic nucleoside, a terminal group, or an H. Embodiment 272. The oligomeric agent of any of embodiments 246 or 249-253, wherein R1is 2 or 3 linked nucleosides, optionally comprising an adenosine, a modified adenosine, an unmodified adenosine, or an inosine; and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. Embodiment 273. The oligomeric agent of any of embodiments 246 or 249-253, wherein R1is 2 or 3 20 linked nucleosides, optionally comprising an adenosine, a modified adenosine, an unmodified adenosine, or an inosine; and R2is an abasic nucleoside, a terminal group, or an H. Embodiment 274. The oligomeric agent of embodiment 247, wherein R3is one nucleoside. Embodiment 275. The oligomeric agent of embodiment 247, wherein R3is 2 linked nucleosides. Embodiment 276. The oligomeric agent of embodiment 247, wherein R3is 3 linked nucleosides. 25 Embodiment 277. The oligomeric agent of any of embodiments 247 or 274-276, wherein R4is one nucleoside. Embodiment 278. The oligomeric agent of any of embodiments 247 or 274-276, wherein R4is 2 linked nucleosides. Embodiment 279. The oligomeric agent of any of embodiments 247 or 274-276, wherein R4is 3 30 linked nucleosides. Embodiment 280. The oligomeric agent of any of embodiments 247, 274, or 278-279, wherein R3is one nucleoside and R4is 2 or 3 linked nucleosides. Embodiment 281. The oligomeric agent of any of embodiments 247, 274, or 278-280, wherein R3is a cytidine, a modified cytidine, or an unmodified cytidine, and R4comprises an adenosine, a modified 35 adenosine, an unmodified adenosine, or an inosine. 42 BIOL0446WO Embodiment 282. The oligomeric agent of any of embodiments 247, 274, or 278-281, wherein R3is a cytidine and R4comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. Embodiment 283. The oligomeric agent of any of embodiments 247, 274, or 278-281, wherein R3is a cytidine and R4comprises two or more adenosines, two or more modified adenosines, two or more 5 unmodified adenosines, or two or more inosines. Embodiment 284. The oligomeric agent of any of embodiments 247, 274, or 278-281, wherein R3is a cytidine and R4is an abasic nucleoside, a terminal group, or an H. Embodiment 285. The oligomeric agent of any of embodiments 247, 274, or 278-281, wherein R3is a modified cytidine and R4comprises an adenosine, a modified adenosine, an unmodified adenosine, or an 10 inosine. Embodiment 286. The oligomeric agent of any of embodiments 247, 274, or 278-281, wherein R3is a modified cytidine and R4comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines. Embodiment 287. The oligomeric agent of any of embodiments 247, 274, or 278-281, wherein R3is a 15 modified cytidine and R4is an abasic nucleoside, a terminal group, or an H. Embodiment 288. The oligomeric agent of any of embodiments 247, 274, or 278-281, wherein R3is a 5-methylcytidine and R4comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. Embodiment 289. The oligomeric agent of any of embodiments 247, 274, or 278-281, wherein R3is a 20 5-methylcytidine and R4comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines. Embodiment 290. The oligomeric agent of any of embodiments 247, 274, or 278-281, wherein R3is a 5-methylcytidine and R4is an abasic nucleoside, a terminal group, or an H. Embodiment 291. The oligomeric agent of any of embodiments 247, 274, or 278-281, wherein R3is 25 an unmodified cytidine and R4comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. Embodiment 292. The oligomeric agent of any of embodiments 247, 274, or 278-281, wherein R3is an unmodified cytidine and R4comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines. 30 Embodiment 293. The oligomeric agent of any of embodiments 247, 274, or 278-281, wherein R3is an unmodified cytidine and R4is an abasic nucleoside, a terminal group, or an H. Embodiment 294. The oligomeric agent of any of embodiments 247 or 275-279, wherein R3is 2 or 3 linked nucleosides, optionally comprises a cytidine, a modified cytidine, or an unmodified cytidine, and R4comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. 43 BIOL0446WO Embodiment 295. The oligomeric agent of any of embodiments 247 or 275-279, wherein R3is 2 or 3 linked nucleosides, optionally comprises a cytidine, a modified cytidine, or an unmodified cytidine, and R4is an abasic nucleoside, a terminal group, or an H. Embodiment 296. The oligomeric agent of any of embodiments 246-295, wherein if R1, R2, R3, and 5 R4are each independently 1, 2, or 3 linked nucleosides or are each independently an abasic nucleoside, R1, R2, R3, and R4also include an internucleoside linkage selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage. Embodiment 297. The oligomeric agent of any of embodiments 246-296, wherein the modified oligonucleotide is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, 10 potassium, calcium, and magnesium. Embodiment 298. A modified oligonucleotide according to the following chemical structure: NH2O O N N N NH NH HO NH2N N , . 44 BIOL0446WO Embodiment 299. A modified oligonucleotide according to the following chemical structure: NH2NH2NH2N N N N N HO N O O ONNONNO O O HS P ONH O N O O O HS P OO O O O HS P OO O OHN PS O O OHS O (SEQ ID NO: 46) 45 BIOL0446WO Embodiment 300. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 47) 46 BIOL0446WO Embodiment 301. A modified oligonucleotide according to the following chemical structure: Embodiment 302. The modified oligonucleotide of any one of embodiments 298-301, wherein the 5 modified oligonucleotide is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium. 47 BIOL0446WO Embodiment 303. A modified oligonucleotide according to the following chemical structure: NH2O O N N N NH NH HO ONNN O ONNNH2O O O ONH2Na O SP ONHONHNa2 2N Na O ON P ONS P ON S O N O N N O O O ONNONNO O O O Na ONHNa O O Na2O P ONH O NP ON ON P ONH O S O N S O N O ONNO N O O O O O O O O Na O O O O O NaO P ONa NH ON P O S P OS NH NH O O O N O O N O N O O O O O O O O ONH2O ONH2NaS P ONa NS P ONaS P ON O NH N O O N ONNNH2N O O ONNO O O O O O O O ONH2NaS P ONaS P ONaS P O(SEQ ID N BIOL0446WO Embodiment 304. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 46). 49 BIOL0446WO Embodiment 305. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 47). 50 BIOL0446WO Embodiment 306. A modified oligonucleotide according to the following chemical structure: Embodiment 307. A population of oligomeric agents of any of embodiments 1-297 or a population of 5 modified oligonucleotides of any of embodiments 298-306, wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration. Embodiment 308. The population of embodiment 307, wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having 10 the (Sp) configuration. Embodiment 309. The population of embodiment 307, wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration. 51 BIOL0446WO Embodiment 310. The population of embodiment 307, wherein the population is chirally enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage. Embodiment 311. The population of embodiment 307, wherein the population is chirally enriched for 5 modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage. Embodiment 312. The population of embodiment 307, wherein the population is chirally enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside 10 linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages. Embodiment 313. The population of embodiment 307, wherein the population is chirally enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5’ to 3’ direction. Embodiment 314. A population of oligomeric agents of any of embodiments 1-297 or a population of 15 modified oligonucleotides of any of embodiments 298-306, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom. Embodiment 315. A population of oligomeric agents of any of embodiments 1-297 or a population of modified oligonucleotides of any of embodiments 298-306, wherein all of the mesyl phosphoramidate internucleoside linkages of the modified oligonucleotide are stereorandom. 20 Embodiment 316. A pharmaceutical composition comprising an oligomeric agent of any of embodiments 1-297, a modified oligonucleotide of any of embodiments 298-306, or a population of any of embodiments 307-315, and a pharmaceutically acceptable diluent. Embodiment 317. The pharmaceutical composition of embodiment 316, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline 25 (PBS). Embodiment 318. The pharmaceutical composition of embodiment 317, wherein the pharmaceutical composition consists essentially of the oligomeric agent of any of embodiments 1-297, the modified oligonucleotide of any of embodiments 298-306, or the population of any of embodiments 307-315, and aCSF. 30 Embodiment 319. The pharmaceutical composition of embodiment 317, wherein the pharmaceutical composition consists essentially of the oligomeric agent of any of embodiments 1-297, the modified oligonucleotide of any of embodiments 298-306, or the population of any of embodiments 307-315, and PBS. Embodiment 320. A method comprising administering to a subject an oligomeric agent of any of embodiments 1-297, a modified oligonucleotide of any of embodiments 298-306, a population of any of 35 embodiments 307-315, or a pharmaceutical composition of any of embodiments 316-319. 52 BIOL0446WO Embodiment 321. The method of embodiment 320, wherein the subject has or is at risk of developing Alzheimer’s disease. Embodiment 322. A method of treating a neurodegenerative disease associated with APOE comprising administering to a subject having or at risk of developing a neurodegenerative disease associated 5 with APOE a therapeutically effective amount of an oligomeric agent of any of embodiments 1-297, a modified oligonucleotide of any of embodiments 298-306, a population of any of embodiments 307-315, or a pharmaceutical composition of any of embodiments 316-319. Embodiment 323. The method of embodiment 322, wherein the neurodegenerative disease associated with APOE is Alzheimer’s disease. 10 Embodiment 324. The method of embodiment 322, wherein at least one symptom of the neurodegenerative disease associated with APOE is ameliorated. Embodiment 325. The method of embodiment 324, wherein the symptom is cognitive impairment, progressive memory loss, a decline in language skills, behavioral abnormality, dementia, difficulty performing daily activities, aphasia, agnosia, apraxia, loss of motor function, amyloid plaque, neurofibrillary 15 tangle, and / or neuroinflammation. Embodiment 326. The method of any of embodiments 322-325, wherein administering the oligomeric agent of any of embodiments 1-297, the modified oligonucleotides of any of embodiments 298- 306, the population of any of embodiments 307-315, or the pharmaceutical composition of any of embodiments 316-319 reduces the rate of cognitive impairment or progressive memory loss, reduces the rate 20 of decline in language skills, reduces the rate of progression of behavioral abnormality, reduces the rate of progression of dementia, improves the performance in daily activities, reduces the rate of progression of aphasia, agnosia, and / or apraxia, and / or decreases the rate of decline in motor function in the subject. Embodiment 327. The method of any of embodiments 322-326, wherein administering the oligomeric agent of any of embodiments 1-297, the modified oligonucleotides of any of embodiments 298- 25 306, the population of any of embodiments 307-315, or the pharmaceutical composition of any of embodiments 316-319 reduces amyloid plaques, neurofibrillary tangles, or neuroinflammation in the brain of the subject. Embodiment 328. The method of any of embodiments 320-327, wherein the oligomeric agent of any of embodiments 1-297, the modified oligonucleotides of any of embodiments 298-306, the population of any 30 of embodiments 307-315, or the pharmaceutical composition of any of embodiments 316-319 is administered to the central nervous system or systemically. Embodiment 329. The method of any of embodiments 320-328, wherein the oligomeric agent of any of embodiments 1-297, the modified oligonucleotides of any of embodiments 298-306, the population of any of embodiments 307-315, or the pharmaceutical composition of any of embodiments 316-319 is administered 35 intrathecally. 53 BIOL0446WO Embodiment 330. The method of any of embodiments 320-329, wherein the subject is a human. Embodiment 331. A method of reducing the amount of APOE RNA in a cell comprising contacting the cell with an oligomeric agent of any of embodiments 1-297, a modified oligonucleotide of any of embodiments 298-306, a population of any of embodiments 307-315, or a pharmaceutical composition of any 5 of embodiments 316-319. Embodiment 332. The method of embodiment 331, wherein the cell is a brain cell. Embodiment 333. The method of embodiment 331 or embodiment 332, wherein the cell is a glial cell or a neuron. Embodiment 334. The method of any of embodiments 331-333, wherein the cell is an astrocyte or a 10 microglial cell. Embodiment 335. The method of any of embodiments 331-334, wherein the cell is a human cell. Embodiment 336. Use of an oligomeric agent of any of embodiments 1-297, a modified oligonucleotide of any of embodiments 298-306, a population of any of embodiments 307-315, or a pharmaceutical composition of any of embodiments 316-319 for treating a neurodegenerative disease 15 associated with APOE. Embodiment 337. Use of an oligomeric agent of any of embodiments 1-297, a modified oligonucleotide of any of embodiments 298-306, a population of any of embodiments 307-315, or a pharmaceutical composition of any of embodiments 316-319 in the manufacture of a medicament for treating a neurogenerative disease. 20 Embodiment 338. Use of an oligomeric agent of any of embodiments 1-297, a modified oligonucleotide of any of embodiments 298-306, a population of any of embodiments 307-315, or a pharmaceutical composition of any of embodiments 316-319 in the manufacture of a medicament for treating a neurogenerative disease associated with APOE. Embodiment 339. The use of any of embodiments 336 - 338, wherein the neurodegenerative disease 25 associated with APOE is Alzheimer’s disease. Embodiment 340. An oligomeric agent of any of embodiments 1-297, a modified oligonucleotide of any of embodiments 298-306, or a population of any of embodiments 307-315, for use as a therapeutically active substance. Embodiment 341. An oligomeric agent of any of embodiments 1-297, a modified oligonucleotide of 30 any of embodiments 298-306, a population of any of embodiments 307-315, or a pharmaceutical composition of any of embodiments 316-319, for use in the treatment of a neurodegenerative disease. Embodiment 342. An oligomeric agent of any of embodiments 1-297, a modified oligonucleotide of any of embodiments 298-306, a population of any of embodiments 307-315, or a pharmaceutical composition of any of embodiments 316-319, for use in the treatment of a neurodegenerative disease associated with 35 APOE. 54 BIOL0446WO Embodiment 343. An oligomeric agent of any of embodiments 1-297, a modified oligonucleotide of any of embodiments 298-306, a population of any of embodiments 307-315, or a pharmaceutical composition of any of embodiments 316-319, for use in the treatment of Alzheimer’s disease. 5 I. Oligomeric Agents Provided herein are oligomeric agents comprising or consisting of at least one modified oligonucleotide and optionally one or more additional associated features selected from: (a) one or more additional modified or unmodified oligonucleotides, each of which may be hybridized to or covalently linked to the at least one modified oligonucleotide and / or to each other; (b) one or more conjugate groups, which 10 may be covalently attached to any oligonucleotide of such oligomeric agent; and (c) one or more terminal groups. In some embodiments, provided herein are oligomeric agents comprising or consisting of a modified antisense oligonucleotide complementary to APOE RNA. In certain such embodiments, an oligomeric agent consists of a modified antisense oligonucleotide complementary to APOE RNA and a conjugate group attached to the modified antisense oligonucleotide. In some embodiments, provided herein are oligomeric 15 agents comprising an oligomeric duplex comprising or consisting of an antisense oligonucleotide complementary to APOE RNA, and a sense oligonucleotide complementary to the antisense oligonucleotide, wherein one or both of the antisense and sense oligonucleotides is / are modified. In certain such embodiments, an oligomeric agent consists of an antisense oligonucleotide complementary to APOE RNA, a sense oligonucleotide complementary to the antisense oligonucleotide, and a conjugate group and / or terminal group 20 attached to one or both of the antisense and sense oligonucleotides. Modified antisense and / or sense oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase and / or lacking a nucleobase) and / or at least one modified internucleoside linkage. Examples of certain modified nucleosides and modified internucleoside linkages suitable for use in modified antisense and / or sense oligonucleotides are described herein. 25 A. Modified Nucleosides Modified nucleosides comprise a modified sugar moiety, a modified nucleobase, or a combination thereof. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and / or the following modified nucleobases may be incorporated into oligonucleotides, e.g., into modified 30 antisense and / or sense oligonucleotides described herein. 1. Modified Sugar Moieties Modified sugar moieties include modified furanosyl sugar moieties, cyclic sugar surrogates, acyclic sugar surrogates, and sugar mimics. In certain embodiments, modified sugar moieties are non-bicyclic 35 modified furanosyl sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic 55 BIOL0446WO furanosyl sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties. In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties 5 comprising one or more substituent groups including, but not limited to, substituents at the 2′, 3′, 4′, and / or 5′ positions, as numbered below: . In certain embo odified furanosyl sugar moiety is a ribosyl sugar moiety that is not an unmodified sugar moiety (i.e., an unmodified RNA or unmodified DNA moiety). In certain embodiments, the 10 modified furanosyl sugar moiety is a xylosyl, lyxosyl, or arabinosyl sugar moiety. In certain embodiments, non-bicyclic modified sugar moieties are 2′-substituted sugar moieties and comprise a substituent group at the 2′-position. Examples of substituent groups suitable for the 2′-position of modified sugar moieties include but are not limited to: F, OCH3(“OMe” or “O-methyl”), and O(CH2)2OCH3(“MOE” or “O-methoxyethyl” or OCH2CH2OCH3). In certain embodiments, 2′-substituent groups are 15 selected from: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, C1-C10alkoxy, substituted C1-C10alkoxy, C1-C10alkyl, substituted C1-C10alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10alkyl, O(CH2)2ON(CH3)2(“DMAOE”), or 20 O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”). Synthetic methods for some of these 2′-substituent groups may be found, e.g., in Cook et al., U.S.6,531,584; Cook et al., U.S.5,859,221; and Cook et al., U.S.6,005,087. Certain embodiments of these 2′-substituent groups may be further substituted with one or more substituent groups independently selected from: halo, cyano, ORa2, NO2, NH2, NHRa2, N(Ra2)2, C1-C6alkyl, C1-C6haloalkyl, C2-C6alkenyl, C2-C6alkynyl, C3-C10cycloalkyl, C6-C10aryl, heteroaryl, heterocyclyl, C1-C625 alkylene-NH2, C1-C6alkylene-NHRa2, C1-C6alkylene-N(Ra2)2, C(O)Ra3, C(O)ORa3, C(O)NHRa3, C(O)N(C1- C4alkyl)Ra3, SRa3, S(O)2Ra3, S(O)Ra3, NHC(O)Ra3, N(C1-C4alkyl)C(O)Ra3, NHS(O)Ra3, N(C1- C4alkyl)S(O)Ra3, NHS(O)2Ra3, and N(C1-C4alkyl)S(O)2Ra3; where each Ra2is independently selected from C2-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, C3-C10cycloalkyl, C6-C10aryl, heteroaryl, and heterocyclyl; and each Ra3is independently hydrogen, OH, C1-C6alkyl, C1-C6haloalkyl, C3-C10cycloalkyl, C6-C10aryl, 30 heteroaryl, or heterocyclyl. In certain embodiments, a sugar moiety comprises two of the above substituents at the 2′-position. In certain embodiments, a sugar moiety comprises a 2′-fluoro and a second 2′-substituent. In certain embodiments, a 2′-substituted sugar moiety comprises a non-bridging 2′-substituent group selected from: F, NH2, N3, OCF3,OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, 56 BIOL0446WO O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)- N(Rm)(Rn)), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10alkyl. In certain embodiments, a 2′-substituted sugar moiety comprises a non-bridging 2′-substituent group selected from: F, OCF3,OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)25 (“DMAOE”), O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”), and OCH2C(=O)-N(H)CH3(“NMA”). In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched. In certain embodiments, a 2′-substituted sugar moiety comprises a 2′-substituent group selected from: F, OCH3, and O(CH2)2OCH3. In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such10 modified furanosyl sugar moieties are further defined by stereochemical configuration. For example, a 2′- deoxyfuranosyl sugar moiety (i.e., 2′-(H)H furanosyl sugar moiety) may be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described in, e.g., WO 2020 / 072991. A 2′-modified sugar moiety has an additional stereocenter at the 2′- position relative to a 2′-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen15 possible stereochemical configurations. Modified furanosyl sugar moieties described herein are in the β-D- ribosyl stereochemical configuration unless otherwise specified. In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 4′- position. Examples of substituent groups suitable for the 4′-position of modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. 20 In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 3′- position. Examples of substituent groups suitable for the 3′-position of modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl). In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 5′- position. Examples of substituent groups suitable for the 5′-position of modified sugar moieties include, but 25 are not limited to, vinyl, alkoxy (e.g., methoxy), alkynyl, allyl, and alkyl (e.g., methyl (R or S), ethyl (R or S)). In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties, such as described in Migawa et al., US 2010 / 0190837, or alternative 2′- and 5′-modified sugar moieties as described in Rajeev et al., US 30 2013 / 0203836. Certain modified sugar moieties are bicyclic sugar moieties and comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring. In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. Examples of such 4′ to 2′ bridging sugar substituents include, but are not limited to: 4′-CH2-2′, 4′-(CH2)2-2′, 4′-(CH2)3-2′, 4′-CH2-O-2′ (“LNA”), 4′- 35 CH2-S-2′, 4′-(CH2)2-O-2′ (“ENA”), 4′-CH(CH3)-O-2′ (referred to as “constrained ethyl” or “cEt” when in the 57 BIOL0446WO S configuration), 4′-CH2-O-CH2-2′, 4′-CH2-N(R)-2′, 4′-CH(CH2OCH3)-O-2′ (“constrained MOE” or “cMOE”) and analogs thereof, 4′-C(CH3)(CH3)-O-2′ and analogs thereof, 4′-CH2-N(OCH3)-2′ and analogs thereof, 4′-CH2-O-N(CH3)-2′, 4′-CH2-C(H)(CH3)-2′, 4′-CH2-C(=CH2)-2′ and analogs thereof, 4′-C(RaRb)- N(R)-O-2′, 4′-C(RaRb)-O-N(R)-2′, 4′-CH2-O-N(R)-2′, and 4′-CH2-N(R)-O-2′, wherein each R, Ra, and Rbis, 5 independently, H, a protecting group, or C1-C12alkyl. Representative U.S. patents that teach the preparation of such bicyclic sugar moieties include, but are not limited to: Imanishi et al., U.S.7,427,672; Swayze et al., U.S.7,741,457; Swayze et al., U.S.8,022,193; Seth et al., U.S.8,278,283; Prakash et al., U.S.8,278,425; and Seth et al., U.S.8,278,426. In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups10 independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, - C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and -N(Ra)-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; 15 each Raand Rbis, independently, halo, cyano, ORa2, NO2, NH2, NHRa2, N(Ra2)2, C1-C6alkyl, C1-C6haloalkyl, C2-C6alkenyl, C2-C6alkynyl, C3-C10cycloalkyl, C6-10aryl, heteroaryl, heterocyclyl, C1-C6alkylene- NH2, C1-C6alkylene-NHRa2, C1-C6alkylene-N(Ra2)2, C(O)Ra3, C(O)ORa3, C(O)NHRa3, C(O)N(C1-C4alkyl)Ra3, SRa3, S(O)2Ra3, S(O)Ra3, NHC(O)Ra3, N(C1-C4alkyl)C(O)Ra3, NHS(O)Ra3, N(C1-C4alkyl)S(O)Ra3, NHS(O)2Ra3, and N(C1-C4alkyl)S(O)2Ra3; each Ra2is independently selected from C1-C6alkyl, C2-C6alkenyl, 20 C2-C6alkynyl, C3-C10cycloalkyl, C6-C10aryl, heteroaryl, and heterocyclyl; each Ra3is independently hydrogen, OH, C1-C6alkyl, C1-C6haloalkyl, C3-C10cycloalkyl, C6-C10aryl, heteroaryl, or heterocyclyl. In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 5′ and the 3′ furanose ring atoms. Examples of such 5′ to 3′ bridging sugar substituents include, but are not limited to, 5′- (CH2)2-3′ (bcDNA), 5′-(CH2)3-3′ (bc4,3DNA), 5′-C(F)=CH-CH2-3′, and 5′-CH2-CHQ-3′, wherein Q is an 25 attachment to an internucleoside linkage. Additional bicyclic sugar moieties are known in the art, see, for example: Wan, et al., J. Medicinal Chemistry, 2016, 59, 9645-9667; Wengel et al., U.S.8,080,644; Ramasamy et al., U.S.6,525,191; Seth et al., U.S.7,547,684; and Seth et al., U.S.7,666,854. In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar 30 moieties are further defined by stereochemical configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration. 58 BIOL0446WO Bx O O O Bx LN uration)b -O-2′ α-L-methyleneoxy (4′-CH2-O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al. Nucleic Acids Res. 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown, in certain studies, to increase siRNA stability in 5 serum, and to reduce off-target effects (Elmén, J. et al. Nucleic Acids Res.2005, 33(1), 439-447; Mook, O. R. et al. Mol. Canc. Ther.2007, 6(3), 833-843; Grunweller, A. et al. Nucleic Acids Res.2003, 31(12), 3185- 3193). Herein, general descriptions of bicyclic nucleosides include both stereochemical configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D stereochemical configuration, unless otherwise specified. 10 In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars). In certain embodiments, modified sugar moieties are sugar surrogates, selected from cyclic sugar surrogates and acyclic sugar surrogates. A cyclic sugar surrogate is represented by Formula Ia: 15 wherein: J is H, C1-C6alkyl, or C2-C6alkenyl; X is O, S, C(R1R2), N(R3), or X1-X2, wherein X1-X2is C(R1)=C(R2), C(R1R2)-C(R1R2), O-C(R1R2), 20 C(R1R2)-O, S-C(R1R2), C(R1R2)-S, N(R3)-C(R1R2), or C(R1R2)-N(R3); Y is C(R1R2) or Y1-Y2, wherein Y1-Y2is C(R1)=C(R2), or C(R1R2)-C(R1R2); Z is C(G1G2) or Z1-Z2, wherein Z1-Z2is C(G1)=C(R1), C(R1)=C(G1), C(G1G2)-C(R1R2), C(R1R2)- C(G1G2), C(G1G2)-C(R1R2)-C(R1R2), or C(R1R2)-C(R1R2)-C(G1G2); Q is CH or N; 25 each R1and R2is independently H, OH, C1-C6alkyl, or N(R4); wherein if R1is OH, then R2is not OH; each R3and R4is independently H, C1-C6alkyl, or C(=O)R5, wherein R5is C1-C6alkyl; 59 BIOL0446WO each G1and G2is independently H, OH, halogen or O-[C(R6)(R7)]q-[(C=O)s-XG]j-R8; wherein if G1is OH, then G2is not OH; each R6and R7is, independently, H, halogen, C1-C6alkyl or substituted C1-C6alkyl; each XGis O, S or N(E1); 5 R8is H, halogen, C1-C6alkyl, substituted C1-C6alkyl, C2-C6alkenyl, substituted C2-C6alkenyl, C2-C6alkynyl, substituted C2-C6alkynyl or N(E2)(E3); E1, E2and E3are each, independently, H, C1-C6alkyl or substituted C1-C6alkyl; m is 0 or 1; p is 0 or 1; 10 q is from 1 to 6; s is 0 or 1; j is 0 or 1; and with the proviso that if X is O, Z is C(G1G2), and Q is CH, then m is 1. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, 15 carbon or nitrogen atom (X is S, C(R1R2), or N(R3)). In certain such embodiments, such modified sugar moieties also comprise bridging and / or non-bridging substituents as described herein. For example, certain cyclic sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position and / or the 5′ position. In certain embodiments, cyclic sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a cyclic sugar surrogate comprises a six-membered tetrahydropyran 20 (“THP”), where X in Formula Ia is O-C(R1R2), p is 1, Q is CH, Z is C(G1G2), and m is 0. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), altritol nucleic acid (G1=OH; G2=H; “ANA”), and fluoro HNA (FHNA): 25 (G1=F; G2=H; “FHNA”, see e.g., Egli, M. et al. J. Am. Chem. Soc.2011, 133(41), 16642-16649; Swayze et al., U.S.8,088,904; and Swayze et al., U.S.8,440,803); FHNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran or 3′-FHNA). In certain embodiments, cyclic sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in 30 oligonucleotides have been reported. As used here, the term “morpholino” means a sugar surrogate having Formula Ia, above, wherein X is O, Y and Z are each CH2, and Q is N. 60 BIOL0446WO In certain embodiments, a morpholino is modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.” In certain embodiments, sugar surrogates are acyclic sugar surrogates and have Formula IIa, IIIa, or 5 IVa: 10 wherein: X is O, S, C(R5R6), N(E1), NC(=O)-(E1); each J1and J2are independently H or C1-C6alkyl; 15 n is 0, 1 or 2; m is 0, 1, or 2; p is 0 or 1; o is 0 or 1; s is 0 or 1; 20 R1is H, OH, halogen, C1-C6alkyl, C1-C6alkoxy, C2-C6alkenyl, C2-C6alkynyl, or (CH2)qR8; R2, R3, and R4are each independently H, OH, halogen, C1-C6alkyl, C1-C6alkoxy, C2-C6alkenyl, C2- C6alkynyl, S-CH3, N(CH3)(CH3), OCH2CH2OCH3, O-alkylamino, or (CH2)qR8; 61 BIOL0446WO E1is H, C1-C6alkyl or substituted C1-C6alkyl; R5and R6are independently H, OH, C1-C6alkyl, or N(R7); wherein if R5is OH, then R6is not OH; R7is H, C1-C6alkyl, or C(=O)R9, wherein R9is C1-C6alkyl; R8is OH, halogen, methoxy, ethoxy, azido, C2-C6alkenyl, or C2-C6alkynyl, and q is 1, 2, or 3.In 5 certain embodiments, acyclic sugar surrogates are the “unlocked” sugar structure of UNA (“unlocked nucleic acid”) nucleosides. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Patent Publication No.2011 / 0313020. In certain embodiments, acyclic sugar surrogates are the glycerol as found in GNA (“glycol nucleic acid”) nucleosides, having Formula IIa wherein n is 1, m and o are 0, s is 1, and J2, R2, and R3are each H, or 10 the butyl as found in acyclic butyl nucleic acid, having Formula IIa wherein n is 2, m and o are 0, s is 1, and J2, R2, and R3are each H. In certain embodiments, acyclic sugar surrogates are also known as “C3 spacers” and have Formula IIa wherein n and o are 1; m and s are 0, and J1, J2, R1, and R3are each H. In certain embodiments, GNA is (S)-GNA. Further acyclic sugar surrogates include those described in Manoharan et al., U.S.10,913,767; US 15 patent publication US 2021 / 0238595; and PCT publication WO 2023 / 109940. In certain embodiments, modified oligonucleotides include one or more sugar mimic, in which a group of atoms other than a “furanosyl sugar moiety” or a “sugar surrogate” form the portion of a nucleoside corresponding to the β-D-ribosyl sugar in RNA. In certain embodiments, a sugar mimic is a portion of the backbone of a peptide nucleic acid, while the remainder of the backbone of the peptide nucleic acid is an 20 internucleoside linkage. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos.5,539,082; 5,714,331; and 5,719,262. In certain embodiments, the modified oligonucleotide comprises a modification disclosed in U.S. Patent Nos.10,233,448 or 11,504,391. 25 2. Modified Nucleobases In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside in which the sugar moiety is not attached to a nucleobase (e.g., the nucleoside does not comprise a 30 nucleobase), referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides do not comprise abasic nucleosides. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase). A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. Unless otherwise indicated, modified adenine has structure (I): 62 BIOL0446WO wherein: R1Ais absent or H; R2Ais H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6thioalkyl, or substituted C1-C6thioalkyl, C1-C6alkyloxy, or substituted C1-C6alkyloxy; R6Ais H, N(Ra)(Rb), oxo, acetyl, 5 formyl, or O-phenyl; Y7Ais N and R7Ais absent or is C1-C6alkyl; or Y7Ais C and R7Ais H, C1-C6alkyl, or N(Ra)(Rb); Y8Ais N and R8Ais absent, or Y8Ais C and R8Ais H, a halogen, OH, C1-C6alkyl, or substituted C1- C6alkyl; Raand Rbare each independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R1Ais absent, R2Ais H, and R6Ais NH2(unmodified adenine). 10 Unless otherwise indicated, modified guanine has structure (II): wherein: R2Gis N(Ra)(Rb); R6Gis oxo and R1Gis H, or R6Gis O-C1-C6alkyl or S-C1-C6alkyl and R1Gis absent; Y7Gis N and R7Gis absent or is C1-C6alkyl; or Y7Gis C and R7Gis H, C1-C6alkyl, or N(Ra)(Rb); 15 Y8Gis N and R8Gis absent, or Y8Gis C and R8Gis H, a halogen, OH, C1-C6alkyl, or substituted C1-C6alkyl; Raand Rbare independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where Y7Gis N and R7Gis absent; Y8Gis C, R8Gis H, R2Gis NH2, R6Gis =O, and R1Gis H (unmodified guanine). Unless otherwise indicated, modified thymine or modified uracil has structure (III): 20 wherein: each X is independently O or S and R5Uis H, OH, halogen, O-C1-C20alkyl, O-C1-C12substituted alkyl, C1-C12alkyl, substituted C1-C12alkyl, C1-C12alkenyl, substituted C1-C12alkenyl, C1-C12alkynyl, or substituted C1-C12alkynyl; wherein if each X is O, R5Uis not H or CH3(unmodified uracil and 25 unmodified thymine, respectively). 63 BIOL0446WO Unless otherwise indicated, modified cytosine has structure (IV): wherein: X is O or S; R4Cis N(Ra)(Rb); R5Cis H, OH, halogen, O-C1-C12alkyl, O-C1-C12substituted 5 alkyl, C1-C12alkyl , substituted C1-C12alkyl, C1-C12alkenyl, or substituted C1-C12alkenyl; Raand Rbare independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, C1-C12alkynyl, substituted C1-C12alkynyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where X is O, R4Cis NH2, and R5Cis H (unmodified cytosine). Hypoxanthine has structure (V): 10 Hypoxanthine is considered a modified adenine, where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R1Ais H, R2Ais H, and R6Ais oxo. In certain embodiments, modified nucleobases of a modified oligonucleotide are selected from: 5- 15 substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5-methylcytosine, hypoxanthine, 1-methylpseudouridine, 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6- 20 azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo (particularly 5-bromo), 5-trifluoromethyl, 5- halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7- deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N- isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N- 25 benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3- diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Further 30 nucleobases include those disclosed in Englisch, U. et al., Angew. Chem. Int. Ed.1991, 30, 613; Sanghvi, 64 BIOL0446WO Y.S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443. Preparation of certain of the above noted modified nucleobases, as well as other modified 5 nucleobases, are known in the art and can be readily identified in publications, including, without limitation, Rogers et al., U.S.5,134,066 ; Benner et al., U.S.5,432,272; Matteucci et al., U.S.5,502,177 ; Froehler et al., U.S.5,594,121 ; and Cook et al., U.S.5,681,941. In certain embodiments, at least one nucleobase of a modified oligonucleotide is a modified nucleobase selected from modified adenine (A) having a structure represented by structure I, modified 10 guanine (G) having a structure represented by structure II, modified thymine (T) or modified uracil (U) having a structure represented by structure III, and modified cytosine (C) having a structure represented by structure IV. In certain embodiments, each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, and 5-methylcytosine (mC).5-methylcytosine 15 is a modified nucleobase having structure IV, where X is O, R4Cis NH2, and R5Cis CH3. In certain embodiments, each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, 5-methylcytosine (mC), and hypoxanthine. Hypoxanthine is a modified nucleobase having structure V and is also a modified A represented by structure I, where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R1Ais H, R2Ais H, and R6Ais oxo. 20 In certain embodiments, there are no modified nucleobases in a modified oligonucleotide and each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, and unmodified U. 3. Modified Internucleoside Linkages 25 In certain embodiments, oligomeric agents provided herein comprise or consist of a modified oligonucleotide comprising at least one modified internucleoside linkage. The naturally occurring internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage. Herein, all internucleoside linkages between furanosyl sugar moieties are 3′ to 5′ internucleoside linkages unless otherwise indicated. In certain embodiments, nucleosides of modified oligonucleotides are linked together using one or more 30 modified internucleoside linkages. The two main classes of internucleoside linkages are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P=O”) (also referred to as unmodified linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphorus containing internucleoside linkages35 include but are not limited to methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (- 65 BIOL0446WO O-C(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N′-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages, compared to naturally occurring phosphodiester linkages, may be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, a modified internucleoside linkage is any of those described in WO 5 2021 / 030778. In certain embodiments, a modified internucleoside linkage has the formula: wherein ently for each internucleoside linkage of the modified oligonucleotide: X is selected from O and S; R1is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; and 10 T is selected from SO2R2, C(=O)R3, and P(=O)R4R5, wherein: R2is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a C1-C6alkoxy, C1-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, substituted C1-C6alkyl, substituted C1-C6alkenyl, substituted C1-C6alkynyl, and a conjugate group; 15 R3is selected from an aryl, a substituted aryl, CH3, N(CH3)2, OCH3, and a conjugate group; R4is selected from OCH3, OH, C1-C6alkyl, substituted C1-C6alkyl, and a conjugate group; and R5is selected from OCH3, OH, C1-C6alkyl, and substituted C1-C6alkyl. In certain embodiments, a modified oligonucleotide comprises a mesyl phosphoramidate linkage having a formula: 20 . Certain ide linkages having reduced charge (referred to as “neutral internucleoside linkages”) have been described. Such neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH2-N(CH3)-O-5′), amide-3 (3′-CH2-C(=O)-N(H)-5′), amide-4 (3′-CH2-N(H)-C(=O)-5′), formacetal (3′-O-CH2-O-5′), methoxypropyl (MOP) (see US 9,926,556), 25 and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2component parts. 66 BIOL0446WO In certain embodiments, a modified oligonucleotide comprises an internucleoside linkage comprising a triazole, alkyne, or cyclic guanidine moiety. In certain embodiments, a modified oligonucleotide comprises an internucleoside linkage having a formula: , 5 which m dom or may be enriched for the (Rp) or (Sp) configuration. In certain embodiments, internucleoside linkages are not 3′-to-5′ internucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more inverted nucleoside, where a sugar moiety is linked 3′ to 3′ and / or 5′ to 5′, as shown below: , 10 wherein any nucleobase. In certain embodiments, an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage depicted above will be present. In certain embodiments, additional features (e.g., a conjugate group) are attached to the inverted nucleoside. Such terminal inverted nucleosides may be attached to either or both ends of an oligonucleotide. 15 In certain embodiments, inverted nucleosides lack a nucleobase (are abasic nucleosides). In certain such embodiments, additional features (e.g., a conjugate group) are attached to the inverted abasic nucleoside. A terminal inverted nucleoside may be attached to either or both ends of an oligonucleotide. In certain embodiments, nucleosides are linked 2′ to 5′ rather than the 3′ to 5′ linkage. Such a linkage is illustrated below. 20 67 BIOL0446WO , wherein nucleobase. In certain embodiments, a bicyclic sugar moiety may be linked via an atom on the non-furanosyl ring. In certain such embodiments, a bicyclic sugar moiety is linked 7’ to 5’, as shown below: 5 . ents, internucleoside linkages have at least one chiral center. In such embodiments, a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates, mesyl phosphoramidates, and phosphorothioates. 10 The mesyl phosphoramidate internucleoside linkage comprises a chiral center. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) mesyl phosphoramidates comprise one or more of the following formulas, respectively, wherein “Bx” indicates a nucleobase: 68 BIOL0446WO Bx OBx O Bx. prises a chiral center. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “Bx” indicates a nucleobase: 5 cleoside linkages having a chiral center may be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising internucleoside linkages containing chiral centers in 10 particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise one or more phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, populations of modified oligonucleotides comprise one or more mesyl phosphoramidate internucleoside linkages wherein all of the mesyl phosphoramidate internucleoside linkages are stereorandom. Such modified oligonucleotides can be 15 generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate and / or mesyl phosphoramidate linkage. Nonetheless, each individual phosphorothioate and / or mesyl phosphoramidate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate and / or mesyl phosphoramidate internucleoside linkages 20 in a particular, independently selected stereochemical configuration (e.g., Rp or Sp). In certain embodiments, 69 BIOL0446WO the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in the selected configuration in at least 65%, 70%, 80, 90%, or 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka, N., et al. J. Am. Chem. Soc.2003, 125, 8307-8317; Wan, W. B., et al. Nucleic Acids Res. 5 2014, 42, 13456. and WO 2017 / 015555. As used herein, “chirally enriched” in reference to a population means a plurality of molecules of identical molecular formula, wherein one or more particular chiral centers are not stereorandom as defined herein. Chirally enriched stereocenters are intentionally controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration at that center. Populations of molecules 10 having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorous atom of a phosphorothioate internucleoside linkage. In certain embodiments, the chiral center is at the phosphorous atom of a mesyl phosphoramidate internucleoside linkage. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at 15 least one indicated phosphorothioate and / or mesyl phosphoramidate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate and / or mesyl phosphoramidate in the (Rp) configuration. Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein may be stereorandom or chirally enriched. 20 B. Motifs In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified 25 oligonucleotides comprise one or more modified internucleoside linkage. In certain such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and / or internucleoside linkage motif 30 (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases). 1. Sugar Motifs In certain embodiments, oligonucleotides comprise one or more type of modified sugar and / or 35 unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar 70 BIOL0446WO motif. In certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein. In certain embodiments, the sugar moiety of at least one nucleoside of an antisense oligonucleotide is a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully 5 modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety and the oligonucleotide is referred to as a fully modified oligonucleotide. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the 10 same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide is a 2′-substituted nucleoside comprising the same 2′-substituent. In certain embodiments, every other nucleoside of a fully modified oligonucleotide comprises the same 2′-substitutent, resulting in alternating 2′-substituents. In certain embodiments, a modified oligonucleotide comprises a deoxy region. In certain 15 embodiments, each nucleoside of the deoxy region is a deoxynucleoside. In certain embodiments, each nucleoside of the deoxy region is a 2′-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 5-13, 7-13, or 10-13 linked nucleosides. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, 11, 12, 13, or 6-13 linked nucleosides. In certain embodiments, at least one nucleoside within the deoxy region comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside within the 20 deoxy region comprises a modified sugar moiety. In certain embodiments, two or three nucleosides within the deoxy region comprise a modified sugar moiety. In certain embodiments, the nucleosides within the deoxy region does not comprise a modified sugar moiety. In certain embodiments, the deoxy region is flanked on the 5′-side by a 5′-region consisting of linked 5′-region nucleosides and on the 3′-side by a 3′-region consisting of linked 3′-region nucleosides, wherein the25 3′-most nucleoside of the 5′-region comprises a modified sugar moiety and the 5′-most nucleoside of the 3′- region comprises a modified sugar moiety. The three regions (the 5′-region, the deoxy region, and the 3′- region) form a contiguous sequence of nucleosides. In certain embodiments, the sugar moiety of the 3′-most nucleoside of the 5′-region and the sugar moiety of the 5′-most nucleoside of the 3′-region each differ from the sugar moiety of the respective adjacent nucleoside of the deoxy region, thus defining the boundary30 between the 5′-region, the deoxy region, and the 3′-region. In certain embodiments, each nucleoside of the 5′- region and each nucleoside of the 3′-region comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of the 5′-region and at least two nucleosides of the 3′-region comprise a modified sugar moiety. In certain embodiments, at least three nucleosides of the 5′-region and at least three nucleosides of the 3′-region comprise a modified sugar moiety. In certain embodiments, at least four nucleosides of each 35 nucleoside of the 5′-region and each nucleoside of the 3′-region comprises a modified sugar moiety. In certain 71 BIOL0446WO embodiments, each of the nucleosides within the 5′-region comprise the same modified sugar moiety. In certain embodiments, the nucleosides within the 5′-region comprise two or more different modified sugar moieties. In certain embodiments, each of the nucleosides within the 3′-region comprise the same modified sugar moiety. In certain embodiments, the nucleosides within the 3′-region comprise two or more different 5 modified sugar moieties. In certain embodiments, the 5′-region and the 3′-region of a modified oligonucleotide each consist of 1-8 nucleosides. In certain embodiments, the 5′-region consists of 1-7 nucleosides. In certain embodiments, the 5′-region consists of 1-6, 2-6, 3-6, or 3-5 nucleosides. In certain embodiments, the 5′-region consists of 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, the 3′-region consists of 1-7 nucleosides. In certain 10 embodiments, the 3′-region consist of 1-6, 2-6, 3-6, or 3-5 nucleosides. In certain embodiments, the 3′-region consists of 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, the deoxy region consists of 8, 9, 10, 11, 12, or 13 nucleosides, with each nucleoside comprising a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, such modified oligonucleotides are referred to as “gapmers”. Herein, the lengths (number of nucleosides) of the 5′-region, 15 the deoxy region, and the 3′-region of an oligonucleotide may be provided using the notation [# of nucleosides in the 5′-region] – [# of nucleosides in the deoxy region] – [# of nucleosides in the 3′-region]. Thus, a 3-10-3 gapmer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of the 5′-region and the 3′-region and the gap nucleosides comprise 2′-β-D-deoxyribosyl 20 sugar moieties. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2′-MOE nucleosides in the 5′-region (or “wing”), 10 linked 2′-β-D-deoxynucleosides in the deoxy region (or “gap”), and 5 linked 2′-MOE nucleosides in the 3′-region (or “wing”). A 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5′-region, 8 linked 2′-β-D-deoxynucleosides in the deoxy region, and 5 linked nucleosides comprising a modified sugar moiety in the 3′-region. A 5-8-5 mixed gapmer has at least two differently 25 modified sugar moieties in the 5′- and / or the 3′-regions. In certain embodiments, modified oligonucleotides disclosed herein are modified by two or more sugar modifications. In certain embodiments, modified oligonucleotides are 3-10-3 gapmers, wherein each nucleoside within the 5’- and the 3’-regions comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2’-β-D-deoxyribosyl sugar 30 moieties. In certain embodiments, modified oligonucleotides are 3-10-4 gapmers, wherein each nucleoside within the 5’- and the 3’-regions comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2’-β-D-deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides are 3-10-5 gapmers, wherein each nucleoside within the 5’- and the 3’-regions comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2’-cEt sugar 35 moiety, and the gap nucleosides comprise 2’-β-D-deoxyribosyl sugar moieties. In certain embodiments, 72 BIOL0446WO modified oligonucleotides are 4-9-4 gapmers, wherein each nucleoside within the 5’- and the 3’-regions comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2’-β-D-deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides are 4-10-6 gapmers, wherein each nucleoside within the 5’- and the 3’-regions comprises a 5 modified sugar moiety selected from a 2’-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2’-β-D-deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides are 5-10-4 gapmers, wherein each nucleoside within the 5’- and the 3’-regions comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2’-β-D-deoxyribosyl sugar moieties. In certain embodiments, modified 10 oligonucleotides are 5-10-5 gapmers, wherein each nucleoside within the 5’- and the 3’-regions comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2’-β-D-deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides are 6-10-4 gapmers, wherein each nucleoside within the 5’- and the 3’-regions comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap 15 nucleosides comprise 2’-β-D-deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides disclosed herein are gapmers in which the 5’- and the 3’-regions each independently comprises modified and unmodified nucleosides. In certain embodiments, modified oligonucleotides are 3-13-4 gapmers, wherein each nucleoside within the 5’- and the 3’-regions comprises a modified sugar moiety (e.g., a 2’-MOE sugar moiety or a 2’-cEt sugar moiety) or a 2’-β-D- 20 deoxyribosyl sugar moiety, and the gap nucleosides comprise 2’-β-D-deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides are 5-11-4 gapmers, wherein each nucleoside within the 5’- and the 3’-regions comprises a modified sugar moiety (e.g., a 2’-MOE sugar moiety or a 2’-cEt sugar moiety) or a 2’- β-D-deoxyribosyl sugar moiety, and the gap nucleosides comprise 2’-β-D-deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides are 4-12-4 gapmers, wherein each nucleoside within the 5’- 25 and the 3’-regions comprises a modified sugar moiety (e.g., a 2’-MOE sugar moiety or a 2’-cEt sugar moiety) or a 2’-β-D-deoxyribosyl sugar moiety, and the gap nucleosides comprise 2’-β-D-deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides are 6-10-4 gapmers, wherein each nucleoside within the 5’- and the 3’-regions comprises a modified sugar moiety (e.g., a 2’-MOE sugar moiety or a 2’-cEt sugar moiety) or a 2’-β-D-deoxyribosyl sugar moiety, and the gap nucleosides comprise 2’-β-D-deoxyribosyl 30 sugar moieties. In certain embodiments, modified oligonucleotides are 5-12-3 gapmers, wherein each nucleoside within the 5’- and the 3’-regions comprises a modified sugar moiety (e.g., a 2’-MOE sugar moiety or a 2’-cEt sugar moiety) or a 2’-β-D-deoxyribosyl sugar moiety, and the gap nucleosides comprise 2’-β-D- deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides are 6-11-3 gapmers, wherein each nucleoside within the 5’- and the 3’-regions comprises a modified sugar moiety (e.g., a 2’-MOE sugar 35 moiety or a 2’-cEt sugar moiety) or a 2’-β-D-deoxyribosyl sugar moiety, and the gap nucleosides comprise 73 BIOL0446WO 2’-β-D-deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides are 5-10-5 gapmers, wherein each nucleoside within the 5’- and the 3’-regions comprises a modified sugar moiety (e.g., a 2’-MOE sugar moiety or a 2’-cEt sugar moiety) or a 2’-β-D-deoxyribosyl sugar moiety, and the gap nucleosides comprise 2’-β-D-deoxyribosyl sugar moieties. 5 In certain embodiments, modified oligonucleotides have a sugar motif selected from 5’- eeeeeeddddddddddeeee -3’, 5’- eeeeeddddddddddeeeee -3’, 5’- eeeeeddddddddeekke -3’, 5’- eeeeeddddddddekkee -3’, 5’- eeeekddddddddeeeee -3’, 5’- eeeekddddddddkeeee -3’, 5’- eeeekddddddddkeeke -3’, 5’- eeeekddddddddkekee -3’, 5’- eeeekddddddddkkeee -3’, 5’- eeekkddddddddeeeee -3’, 5’- eeekkddddddddkeeee -3’, 5’- ekeeeddddddddeeeee -3’, 5’- 10 kkeeeddddddddeeeee -3’, 5’- eeeekddddddddddkeek -3’, 5’- eeeekddddddddddkkee -3’, 5’- eeeekddddddddddkkek -3’, 5’- eeeeeddddddddddkeeee -3’, 5’- eeeeeddddddddddkkeee -3’, 5’- eeeeeeddddddddddkeee -3’, 5’- eeeeeeddddddddddkkee -3’, 5’- eeeeekddddddddddeeee -3’, 5’- eeeeekddddddddddkkee -3’, 5’- eeeekddddddddddeeeee -3’, 5’- eeeekddddddddddkkeee -3’, 5’- eeeekkddddddddddeeee -3’, 5’- eeeekkddddddddddkeee -3’, 5’- eeekddddddddddkkeeee -3’, 5’- 15 eeekkddddddddddeeeee -3’, 5’- eeekkddddddddddkeeee -3’, 5’- keeeekddddddddddkkee -3’, 5’- keeeekddddddddddkkek -3’, 5’- keeeekddddddddddkkkk -3’, 5’- eeekkeddddddddddeeee -3’, 5’- eeekkdddddddddddeeee -3’, 5’- eeeeeeddddddddddkkeee -3’, 5’- eeeeekddddddddddeeeee -3’, 5’- eeeekkddddddddddeeeee -3’, 5’- kkkdddddddddddddkkdk -3’, 5’- kdkdkdddddddddddkdkk -3’, 5’- kdkddkddddddddddkdkk -3’, 5’- kdkdkddddddddddddkkk -3’, 5’- kkdkddddddddddddkkdk -3’, 5’- 20 kkddkdddddddddddkkdk -3’, 5’- kkdddkddddddddddkkdk -3’, 5’- kdkdkdddddddddddkkdk -3’, 5’- kdkddkddddddddddkkdk -3’, 5’- kddkkdddddddddddkkdk -3’, 5’- kddkdkddddddddddkkdk -3’, 5’- kdddkkddddddddddkkdk -3’, 5’- kkkdddddddddddddkdkk -3’, 5’- kkdkddddddddddddkdkk -3’, 5’- kkddkdddddddddddkdkk -3’, 5’- kkdddkddddddddddkdkk -3’, 5’- kddkkdddddddddddkdkk -3’, 5’- kdddkkddddddddddkdkk -3’, 5’- kddkdkddddddddddkdkk -3’, 5’- kkkddddddddddddddkkk -3’, 5’- 25 kkdkdddddddddddddkkk -3’, 5’- kkddkddddddddddddkkk -3’, 5’- kkdddkdddddddddddkkk -3’, 5’- kdkddkdddddddddddkkk -3’, 5’- kddkkddddddddddddkkk -3’, 5’- kdddkkdddddddddddkkk -3’, 5’- kddkdkdddddddddddkkk -3’, 5’- kkdkdkddddddddddkddk -3’, 5’- kdkkdkddddddddddkddk -3’, 5’- kddkkkddddddddddkddk -3’, 5’- kdkdkddddddddddkdkdk -3’, or 5’- kkkddkddddddddddkddk -3’, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety, each “e” represents a 2’-MOE sugar moiety, and 30 each “k” represents a cEt sugar moiety. In certain embodiments, modified oligonucleotides have a sugar motif selected from 5’- eeeeeeeeeeeeeeeeee -3’, 5’- eeeeeeddddddddddeeee -3’, 5’- eeeeeddddddddeekke -3’, 5’- eeeeeddddddddekkee -3’, 5’- eeeekddddddddeeeee -3’, 5’- eeeekddddddddkeeee -3’, 5’- eeeekddddddddkeeke -3’, 5’- eeeekddddddddkekee -3’, 5’- eeeekddddddddkkeee -3’, 5’- 35 eeekkddddddddeeeee -3’, 5’- eeekkddddddddkeeee -3’, 5’- ekeeeddddddddeeeee -3’, 5’- 74 BIOL0446WO kkeeeddddddddeeeee -3’, 5’- eeeekddddddddddkeek -3’, 5’- eeeekddddddddddkkee -3’, 5’- eeeekddddddddddkkek -3’, 5’- eeeeeddddddddddkeeee -3’, 5’- eeeeeddddddddddkkeee -3’, 5’- eeeeeeddddddddddkeee -3’, 5’- eeeeeeddddddddddkeek -3’, 5’- eeeeeeddddddddddkkee -3’, 5’- eeeeeeddddddddddkkek -3’, 5’- eeeeekddddddddddeeee -3’, 5’- eeeeekddddddddddkeek -3’, 5’- 5 eeeeekddddddddddkkee -3’, 5’- eeeeekddddddddddkkek -3’, 5’- eeeekddddddddddeeeee -3’, 5’- eeeekddddddddddkkeee -3’, 5’- eeeekkddddddddddeeee -3’, 5’- eeeekkddddddddddkeee -3’, 5’- eeekddddddddddkkeeee -3’, 5’- eeekkdddddddddddeeee -3’, 5’- eeekkddddddddddeeeee -3’, 5’- eeekkddddddddddkeeee -3’, 5’- eeekkeddddddddddeeee -3’, 5’- keeeekddddddddddkeee -3’, 5’- keeeekddddddddddkeek -3’, 5’- keeeekddddddddddkkee -3’, 5’- keeeekddddddddddkkek -3’, 5’- 10 keeeekddddddddddkkkk -3’, 5’- eeeeeeddddddddddkeee -3’, 5’- eeeeeeddddddddddkkee -3’, 5’- eeeeekddddddddddeeee -3’, 5’- eeeekkddddddddddeeee -3’, 5’- eeeeeeddddddddddkkeee -3’, 5’- eeeeekddddddddddeeeee -3’, or 5’- eeeekkddddddddddeeeee -3’, wherein each “d” represents a 2’-β-D- deoxyribosyl sugar moiety, each “e” represents a 2’-MOE sugar moiety, and each “k” represents a cEt sugar moiety. In certain embodiments, modified oligonucleotides have a sugar motif of 5’- keeeekddddddddddkkee 15 -3’, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety, each “e” represents a 2’-MOE sugar moiety, and each “k” represents a cEt sugar moiety. In certain embodiments, modified oligonucleotides have a sugar motif of 5’- eeeeekddddddddddkkee -3’, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety, each “e” represents a 2’-MOE sugar moiety, and each “k” represents a cEt sugar moiety. In certain embodiments, modified oligonucleotides have a sugar motif of 5’- eeekddddddddddkkeeee -3’, wherein each 20 “d” represents a 2’-β-D-deoxyribosyl sugar moiety, each “e” represents a 2’-MOE sugar moiety, and each “k” represents a cEt sugar moiety. In certain embodiments, modified oligonucleotides have a sugar motif selected from 5’- kkkdddddddddddddkkdk -3’, 5’- kdkdkdddddddddddkdkk -3’, 5’- kdkddkddddddddddkdkk -3’, 5’- kdkdkddddddddddddkkk -3’, 5’- kkdkddddddddddddkkdk -3’, 5’- kkddkdddddddddddkkdk -3’, 5’- 25 kkdddkddddddddddkkdk -3’, 5’- kdkdkdddddddddddkkdk -3’, 5’- kdkddkddddddddddkkdk -3’, 5’- kddkkdddddddddddkkdk -3’, 5’- kddkdkddddddddddkkdk -3’, 5’- kdddkkddddddddddkkdk -3’, 5’- kkkdddddddddddddkdkk -3’, 5’- kkdkddddddddddddkdkk -3’, 5’- kkddkdddddddddddkdkk -3’, 5’- kkdddkddddddddddkdkk -3’, 5’- kddkkdddddddddddkdkk -3’, 5’- kdddkkddddddddddkdkk -3’, 5’- kddkdkddddddddddkdkk -3’, 5’- kkkddddddddddddddkkk -3’, 5’- kkdkdddddddddddddkkk -3’, 5’- 30 kkddkddddddddddddkkk -3’, 5’- kkdddkdddddddddddkkk -3’, 5’- kdkddkdddddddddddkkk -3’, 5’- kddkkddddddddddddkkk -3’, 5’- kdddkkdddddddddddkkk -3’, 5’- kddkdkdddddddddddkkk -3’, 5’- kkdkdkddddddddddkddk -3’, 5’- kdkkdkddddddddddkddk -3’, 5’- kddkkkddddddddddkddk -3’, 5’- kdkdkddddddddddkdkdk -3’, 5’- kkkddkddddddddddkddk -3’, 5’- kkkdddddddddddddkkdk -3’, or 5’- kddkdkddddddddddkkdk -3’, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “k” 35 represents a cEt sugar moiety. In certain embodiments, modified oligonucleotides have a sugar motif of 5’- 75 BIOL0446WO kkkdddddddddddddkkdk -3’, wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “k” represents a cEt sugar moiety. 2. Nucleobase Motifs 5 In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, at least one nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, at least one purine and / or at least pyrimidine is modified. In certain embodiments, at least one adenine is modified. In certain embodiments, at least one guanine is modified. In certain embodiments, at 10 least one thymine is modified. In certain embodiments, at least one uracil is modified. In certain embodiments, at least one cytosine is modified. In certain embodiments, at least one of the cytosine nucleobases in a modified oligonucleotide is 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases. In certain embodiments, one or two of the cytosine nucleobases are 5- 15 methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases. In certain embodiments, each nucleobase is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, unmodified guanine, and hypoxanthine. In certain embodiments, each nucleobase is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine. In certain embodiments, each nucleobase is selected 20 from unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, and unmodified guanine. In certain embodiments, each nucleobase is selected from unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine. 3. Internucleoside Linkage Motifs 25 In certain embodiments, oligonucleotides comprise modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is a phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage, a mesyl phosphoramidate 30 internucleoside linkage, and a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a mesyl phosphoramidate internucleoside linkage and a phosphorothioate internucleoside linkage. In certain 35 embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom 76 BIOL0446WO phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, each mesyl phosphoramidate internucleoside linkage is independently selected from a stereorandom mesyl phosphoramidate, a (Sp) mesyl phosphoramidate, and a (Rp) mesyl phosphoramidate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the 5 internucleoside linkages within the gap are all modified. In certain embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is 10 not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp or Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs. 15 In certain embodiments, modified oligonucleotides have an internucleoside linkage motif comprising one or more mesyl phosphoramidate linking groups. In certain embodiments, a modified oligonucleotide described herein has an internucleoside linkage motif comprising at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 mesyl phosphoramidate linking groups. In certain embodiments, a modified oligonucleotide described herein has an internucleoside linkage motif 20 comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mesyl phosphoramidate linking groups. In certain embodiments, a modified oligonucleotide described herein has an internucleoside linkage motif comprising 1, 2, 3, 4, 5, 6, 7, or 8 mesyl phosphoramidate linking groups. In certain embodiments, a modified oligonucleotide described herein has an internucleoside linkage motif comprising 4 mesyl phosphoramidate linking groups. In certain embodiments, a modified oligonucleotide described herein has an internucleoside linkage motif comprising 3 25 mesyl phosphoramidate linking groups. In certain embodiments, a modified oligonucleotide described herein has an internucleoside linkage motif comprising 5 mesyl phosphoramidate linking groups. In certain embodiments, a modified oligonucleotide described herein has an internucleoside linkage motif comprising 6 mesyl phosphoramidate linking groups. In certain embodiments, a modified oligonucleotide described herein has an internucleoside linkage motif comprising 7 mesyl phosphoramidate linking groups. In certain 30 embodiments, a modified oligonucleotide described herein has an internucleoside linkage motif comprising 8 mesyl phosphoramidate linking groups. In certain embodiments, one or more phosphorothioate internucleoside linkages or one or more phosphodiester internucleoside linkages of the internucleoside linkage motifs herein is substituted with a mesyl phosphoramidate linking group. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of 5’- 35 soosssszzzssssszsss -3’, 5’- sossoszzzssssssssss -3’, 5’- sooosszzssssssssoss -3’, 5’- ssoooszzssssssssoss -3’, 77 BIOL0446WO 5’- sssooozzssssssssoss -3’, 5’- sooosszzsssssssssss -3’, 5’- ssoooszzsssssssssss -3’, 5’- sssooozzsssssssssss - 3’, 5’- sooooossssssssssoss -3’, 5’- sssssozzzssssszssss -3’, 5’- ssssoszzzssssszssss -3’, 5’- sosssszzzssssszssss -3’, 5’- soossszzzssssssssss -3’, 5’- sososszzzssssssssss -3’, 5’- sosssszzzsssssssoss -3’, 5’- sooossssssssssssoss -3’, 5’- sooooossssszsszzoss -3’, 5’- sooooozzzsssssssoss -3’, 5’- soooooszzzssssssoss - 5 3’, 5’- sosssszzszssszssoss -3’, 5’- ssossszzszssszssoss -3’, 5’- sssosszzszssszssoss -3’, 5’- ssssoszzszssszssoss -3’, 5’- sssssozzszssszssoss -3’, 5’- ssssoozzszssszsssss -3’, 5’- ssssszzzszsszzsssss -3’, 5’- ssssszzzsssszzsssss -3’, 5’- sssssszzzssssszsoss -3’, 5’- ssossszzzssssszssss -3’, 5’- sssssszzzsssszzssss -3’, 5’- sssssozzzsssszzsoss -3’, 5’- ssssssszzzssssszsss -3’, 5’- sssssoszzzssssszoss -3’, 5’- ssssooszzzssssszsss - 3’, 5’- sssoosszzzssssszsss -3’, 5’- ssoossszzzssssszsss -3’, 5’- s[pn][pn][pn]oossssssssssoss -3’, 5’- 10 s[pn][pn][pn]oosssssszzssoss -3’, 5’- s[pn][pn][pn]oossssssssss[pn]ss -3’, 5’- s[pn][pn][pn]oosssssszzss[pn]ss -3’, 5’- s[pn][pn][pn]oossssssszzsoss -3’, 5’- s[pn][pn][pn]oossssssszzs[pn]ss -3’, 5’- sssosszzzssssszssss -3’, 5’- sssssszzzssssszssss -3’, 5’- sooossszzsssssszsss -3’, 5’- sooossszzsssssszoss -3’, 5’- soooosszzsssssszoss - 3’, 5’- soooszzssssssssooss -3’, 5’- soooszzzsssssssooss -3’, 5’- soooszzzzssssssooss -3’, 5’- sooosszzsssssssooss -3’, 5’- sooosszzzssssssooss -3’, 5’- sooossssssszsszooss -3’, 5’- soooszssssszsszooss -3’, 15 5’- soooszzssssssszooss -3’, 5’- soooszzzsssssszooss -3’, 5’- soooszsssszzszsooss -3’, 5’- ssooszsssszzszsooss -3’, 5’- ssssszsssszzszsssss -3’, 5’- ssssszsssszzszzssss -3’, 5’- zsssszsssszzszssszz -3’, 5’- zsssszsssszzszssssz -3’, 5’- zsssszsssszzssssssz -3’, 5’- sssosszzzssssssooss -3’, 5’- sssosszzzssssssosss -3’, 5’- ssossszzzssssssosss -3’, 5’- sssosszzzssssssssss -3’, 5’- sssoszzzzssssssosss -3’, 5’- sssoszzzzssssssssss -3’, 5’- ssssozzzzssssssssss -3’, 5’- ssssszzzzssssssssss -3’, 5’- sssoszzzzssssszosss -3’, 5’- ssssszzzzssssszosss - 20 3’, 5’- ssssszzzzssssszssss -3’, 5’- soosszzzsssssssosss -3’, 5’- ssosszzzsssssssosss -3’, 5’- sossszzzsssssssosss -3’, 5’- ssssszzzsssssssosss -3’, 5’- sososzzzsssssssosss -3’, 5’- ssosszzzssssszsosss -3’, 5’- ssssszzzssssszsosss -3’, 5’- sssoszzzssssszsosss -3’, 5’- ssssszzzssssszsssss -3’, 5’- ssssszzzsssszzsosss -3’, 5’- sssoszzzsssszzsssss -3’, 5’- ssssozzzsssszzsssss -3’, 5’- soossssszzsssssosss -3’, 5’- soossssszzsssssssss -3’, 5’- sssssssszzsssssooss -3’, 5’- ssosssszzzszsssssss -3’, 5’- sssossszzzszsssssss -3’, 5’- ssssosszzzszsssssss -3’,25 5’- ssssssszzzszsssosss -3’, 5’- ssssssszzzzzsssosss -3’, 5’- ssssosszzzzzsssssss -3’, 5’- sssossszzzzzsssssss - 3’, 5’- ssosssszzzzzsssssss -3’, 5’- ssssssszzzzzsssssss -3’, 5’- soossssssssssooss -3’, 5’- sosssszzzssssszoss - 3’, 5’- sooosssssssssssooss -3’, 5’- soooszzzsssszssooss -3’, 5’- soooszzzsssszzsooss -3’, 5’- ssoooszzssssssssoos -3’, 5’- soosszzzssssszsssss -3’, 5’- zoosszzzssssszsssss -3’, 5’- soosszzzssssszsooss -3’, 5’- soossszzzssssszssss -3’, 5’- sossszzzzssssszssss -3’, 5’- soooszzzsssssssssss -3’, 5’- soszsszzzssssszssss - 30 3’, 5’- soossszzsssssssssss -3’, 5’- zossszzzssssszsssss -3’, 5’- zossszzzssssszssssz -3’, 5’- ssoosszzzssssszsooss -3’, 5’- ssoooszzsssssszsooss -3’, 5’- zsoooszzsssssszsoosz -3’, 5’- ssoooszzzssssszsooss -3’, 5’- zsossszzzssssszsoosz -3’, 5’- ssszzzzzzssssszsssz -3’, 5’- szszszzzzssssszsszs - 3’, 5’- szszzszzzssssszsszs -3’, 5’- szszszzzzssssszszss -3’, 5’- sszszzzzzssssszsssz -3’, 5’- sszzszzzzssssszsssz -3’, 5’- sszzzszzzssssszsssz -3’, 5’- szszszzzzssssszsssz -3’, 5’- szszzszzzssssszsssz -3’,35 5’- szzsszzzzssssszsssz -3’, 5’- szzszszzzssssszsssz -3’, 5’- szzzsszzzssssszsssz -3’, 5’- ssszzzzzzssssszsszs - 78 BIOL0446WO 3’, 5’- sszszzzzzssssszsszs -3’, 5’- sszzszzzzssssszsszs -3’, 5’- sszzzszzzssssszsszs -3’, 5’- szzsszzzzssssszsszs -3’, 5’- szzzsszzzssssszsszs -3’, 5’- szzszszzzssssszsszs -3’, 5’- ssszzzzzzssssszszss -3’, 5’- sszszzzzzssssszszss -3’, 5’- sszzszzzzssssszszss -3’, 5’- sszzzszzzssssszszss -3’, 5’- szszzszzzssssszszss - 3’, 5’- szzsszzzzssssszszss -3’, 5’- szzzsszzzssssszszss -3’, 5’- szzszszzzssssszszss -3’, 5’- 5 sszszszzzssssszsszz -3’, 5’- szsszszzzssssszsszz -3’, 5’- szzssszzzssssszsszz -3’, 5’- szszsszzzssssszszsz -3’, 5’- ssszzszzzssssszsszz -3’, 5’- ssszzzsszzssssssssz -3’, 5’- ssszzzssszzsssssssz -3’, 5’- ssszzzssssszzsssssz - 3’, 5’- ssszzzzzzsssssszssz -3’, 5’- ssszzzzzzzssssssssz -3’, 5’- ssszzzssssszzzssssz -3’, 5’- ssszzzszzssssszsssz -3’, 5’- ssszzzzzzsssssssssz -3’, 5’- szzszszzssssssssssz -3’, 5’- szzszszzzsssssszssz -3’, 5’- szzszszzzzssssssssz -3’, 5’- szzszsszzssssszsssz -3’, or 5’- ssszzzzzssssssssssz -3’, wherein each “s” 10 represents a phosphorothioate internucleoside linkage, each “o” represents a phosphodiester internucleoside linkage, each “z” represents a mesyl phosphoramidate internucleoside linkage, and each “[pn]” represents a cyclic guanidine phosphoramidate internucleoside linkage as shown below: . odiments, modified oligonucleotides have an internucleoside linkage motif of 5’- 15 soossssssssssooss -3’, 5’- sosssszzzssssszoss -3’, 5’- ssoooszzsssssszsooss -3’, 5’-ssoooszzzssssszsooss -3’, 5’-ssoosszzzssssszsooss -3’, 5’-zsoooszzsssssszsoosz -3’, 5’-zsossszzzssssszsoosz -3’, 5’-soooosszzsssssszoss -3’, 5’-sooosssssssssssooss -3’, 5’- sooossszzsssssszoss -3’, 5’- sooossszzsssssszsss -3’, 5’- soooszzzsssssssssss -3’, 5’- soooszzzsssszssooss -3’, 5’- soooszzzsssszzsooss -3’, 5’- soosssszzzssssszsss -3’, 5’- soossszzsssssssssss -3’, 5’- soossszzzssssszssss -3’, 5’- soosszzzssssszsooss -3’, 5’- soosszzzssssszsssss - 20 3’, 5’- sosssszzzssssszssss -3’, 5’- sossszzzzssssszssss -3’, 5’- soszsszzzssssszssss -3’, 5’- ssoooszzssssssssoos -3’, 5’- ssssoszzzssssszssss -3’, 5’- sssssozzzssssszssss -3’, 5’- ssszzszzzssssszsszz -3’, 5’- ssszzzssssszzsssssz -3’, 5’- ssszzzssssszzzssssz -3’, 5’- ssszzzssszzsssssssz -3’, 5’- ssszzzsszzssssssssz -3’, 5’- ssszzzszzssssszsssz -3’, 5’- ssszzzzzssssssssssz -3’, 5’- ssszzzzzzsssssssssz -3’, 5’- ssszzzzzzsssssszssz - 3’, 5’- ssszzzzzzssssszsssz -3’, 5’- ssszzzzzzssssszsszs -3’, 5’- ssszzzzzzssssszszss -3’, 5’- 25 ssszzzzzzzssssssssz -3’, 5’- sszszszzzssssszsszz -3’, 5’- sszszzzzzssssszsssz -3’, 5’- sszszzzzzssssszsszs -3’, 5’- sszszzzzzssssszszss -3’, 5’- sszzszzzzssssszsssz -3’, 5’- sszzszzzzssssszsszs -3’, 5’- sszzszzzzssssszszss - 3’, 5’- sszzzszzzssssszsssz -3’, 5’- sszzzszzzssssszsszs -3’, 5’- sszzzszzzssssszszss -3’, 5’- szsszszzzssssszsszz -3’, 5’- szszsszzzssssszszsz -3’, 5’- szszszzzzssssszsssz -3’, 5’- szszszzzzssssszsszs -3’, 5’- szszszzzzssssszszss -3’, 5’- szszzszzzssssszsssz -3’, 5’- szszzszzzssssszsszs -3’, 5’- szszzszzzssssszszss - 30 3’, 5’- szzssszzzssssszsszz -3’, 5’- szzsszzzzssssszsssz -3’, 5’- szzsszzzzssssszsszs -3’, 5’- szzsszzzzssssszszss -3’, 5’- szzszsszzssssszsssz -3’, 5’- szzszszzssssssssssz -3’, 5’- szzszszzzsssssszssz -3’, 5’- szzszszzzssssszsssz -3’, 5’- szzszszzzssssszsszs -3’, 5’- szzszszzzssssszszss -3’, 5’- szzszszzzzssssssssz - 79 BIOL0446WO 3’, 5’- szzzsszzzssssszsssz -3’, 5’- szzzsszzzssssszsszs -3’, 5’- szzzsszzzssssszszss -3’, 5’- zoosszzzssssszsssss -3’, 5’- zossszzzssssszsssss -3’, or 5’- zossszzzssssszssssz -3’, wherein each “s” represents a phosphorothioate internucleoside linkage, each “o” represents a phosphodiester internucleoside linkage, and each “z” represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, 5 modified oligonucleotides have an internucleoside linkage motif of 5’- soosssszzzssssszsss -3’, wherein each “s” represents a phosphorothioate internucleoside linkage, each “o” represents a phosphodiester internucleoside linkage, and each “z” represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of 5’- zoosszzzssssszsssss -3’, wherein each “s” represents a phosphorothioate internucleoside linkage, each “o” represents a phosphodiester 10 internucleoside linkage, and each “z” represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of 5’- soooosszzsssssszoss -3’, 5’- sooosssssssssssooss -3’, 5’- sooossszzsssssszoss -3’, 5’- sooossszzsssssszsss -3’, 5’- soooszzzsssssssssss -3’, 5’- soooszzzsssszssooss -3’, 5’- soooszzzsssszzsooss -3’, 5’- soosssszzzssssszsss -3’, 5’- soossszzsssssssssss -3’, 5’- soossszzzssssszssss -3’, 5’- soosszzzssssszsooss -3’, 5’- 15 soosszzzssssszsssss -3’, 5’- sosssszzzssssszssss -3’, 5’- sossszzzzssssszssss -3’, 5’- soszsszzzssssszssss -3’, 5’- ssoooszzssssssssoos -3’, 5’- ssssoszzzssssszssss -3’, 5’- sssssozzzssssszssss -3’, 5’- ssszzszzzssssszsszz - 3’, 5’- ssszzzssssszzsssssz -3’, 5’- ssszzzssssszzzssssz -3’, 5’- ssszzzssszzsssssssz -3’, 5’- ssszzzsszzssssssssz -3’, 5’- ssszzzszzssssszsssz -3’, 5’- ssszzzzzssssssssssz -3’, 5’- ssszzzzzzsssssssssz -3’, 5’- ssszzzzzzsssssszssz -3’, 5’- ssszzzzzzssssszsssz -3’, 5’- ssszzzzzzssssszsszs -3’, 5’- ssszzzzzzssssszszss -3’,20 5’- ssszzzzzzzssssssssz -3’, 5’- sszszszzzssssszsszz -3’, 5’- sszszzzzzssssszsssz -3’, 5’- sszszzzzzssssszsszs - 3’, 5’- sszszzzzzssssszszss -3’, 5’- sszzszzzzssssszsssz -3’, 5’- sszzszzzzssssszsszs -3’, 5’- sszzszzzzssssszszss -3’, 5’- sszzzszzzssssszsssz -3’, 5’- sszzzszzzssssszsszs -3’, 5’- sszzzszzzssssszszss -3’, 5’- szsszszzzssssszsszz -3’, 5’- szszsszzzssssszszsz -3’, 5’- szszszzzzssssszsssz -3’, 5’- szszszzzzssssszsszs - 3’, 5’- szszszzzzssssszszss -3’, 5’- szszzszzzssssszsssz -3’, 5’- szszzszzzssssszsszs -3’, 5’- 25 szszzszzzssssszszss -3’, 5’- szzssszzzssssszsszz -3’, 5’- szzsszzzzssssszsssz -3’, 5’- szzsszzzzssssszsszs -3’, 5’- szzsszzzzssssszszss -3’, 5’- szzszsszzssssszsssz -3’, 5’- szzszszzssssssssssz -3’, 5’- szzszszzzsssssszssz - 3’, 5’- szzszszzzssssszsssz -3’, 5’- szzszszzzssssszsszs -3’, 5’- szzszszzzssssszszss -3’, 5’- szzszszzzzssssssssz -3’, 5’- szzzsszzzssssszsssz -3’, 5’- szzzsszzzssssszsszs -3’, 5’- szzzsszzzssssszszss -3’, 5’- zoosszzzssssszsssss -3’, 5’- zossszzzssssszsssss -3’, or 5’- zossszzzssssszssssz -3’, wherein each “s” 30 represents a phosphorothioate internucleoside linkage, each “o” represents a phosphodiester internucleoside linkage, and each “z” represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of 5’- ssszzzzzzsssssssssz -3’, wherein each “s” represents a phosphorothioate internucleoside linkage and each “z” represents a mesyl phosphoramidate internucleoside linkage. 35 80 BIOL0446WO C. Lengths It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. Proc. Natl. Acad. Sci. USA 1992, 89:7305-7309, a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection 5 model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches. In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a 10 variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, 15 oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 20 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 25 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30 30, or 29 to 30 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 16 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 17 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 18 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) 35 consist of 19 linked nucleosides. In certain embodiments, oligonucleotides (including modified 81 BIOL0446WO oligonucleotides) consist of 20 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 21 linked nucleosides. D. Oligomeric Agent Modifications 5 Provided oligomeric agents comprise one or more modifications (e.g., a modified sugar moiety, a modified nucleobase, a modified internucleoside linkage, and / or combinations thereof), incorporated into a modified oligonucleotide. In certain embodiments, a modified oligonucleotide is characterized by modification motif(s) and overall length. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of a modified oligonucleotide 10 having one or more modified sugar moiety and / or sugar motif, independently, is modified or unmodified and may or may not follow the modification pattern of the sugar modifications or sugar motif. For example, internucleoside linkages within a region of a modified oligonucleotide comprising certain sugar modifications may be the same or different from one another and may be the same or different from the internucleoside linkages of the region of the modified oligonucleotide comprising different sugar modifications. Likewise, 15 such modified oligonucleotides may comprise one or more modified nucleobase independent of the pattern of the sugar modifications or sugar motif and independent of the internucleoside linkages or internucleoside linkage motif. Unless specifically indicated, all modifications are independent of nucleobase sequence. E. Nucleobase Sequence 20 In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments, oligonucleotides have a nucleobase sequence that is complementary to a nucleobase sequence of a second strand of linked nucleosides (e.g., another oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid) or a region thereof. In certain embodiments, a region of an oligonucleotide has a nucleobase sequence that is 25 complementary to a nucleobase sequence of a second strand of linked nucleosides or a region thereof. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of a second strand of linked nucleosides or region thereof. 30 F. Oligomeric Duplexes In certain embodiments, an oligomeric agent provided herein comprises a modified oligonucleotide having a targeting region having a nucleobase sequence complementary to a sequence in an APOE nucleic acid paired with a second oligonucleotide to form an oligomeric duplex. In some embodiments, an oligomeric duplex comprises a modified oligonucleotide having a targeting region complementary to a target region of an 35 APOE nucleic acid and a second oligonucleotide having a duplexing region complementary to the modified 82 BIOL0446WO oligonucleotide or a region thereof. In certain embodiments, the second oligonucleotide is a modified oligonucleotide. In some embodiments, an oligomeric duplex comprises a modified oligonucleotide having a targeting region complementary to a target region of an APOE nucleic acid and a second modified oligonucleotide having 5 a duplexing region complementary to the modified oligonucleotide or a region thereof. In certain embodiments, the oligomeric duplex is part of an oligomeric agent, wherein the oligomeric agent comprises or consists of: (1) a first modified oligonucleotide, (2) a second oligonucleotide, and (3) optionally a terminal group and / or a conjugate group. Either or both modified oligonucleotides of an oligomeric duplex may be linked to a conjugate group. Either or both modified oligonucleotides of an oligomeric duplex may comprise a terminal group. Each 10 modified oligonucleotide of an oligomeric duplex may include non-complementary or unpaired overhanging nucleosides. In certain embodiments, the nucleobase of the non-complementary or unpaired overhanging nucleosides is adenine or thymidine. In certain embodiments, the two modified oligonucleotides have at least one mismatch relative to one another. In certain embodiments, an oligomeric agent comprises an oligomeric duplex described herein, which 15 is an antisense agent. In certain embodiments, an oligomeric duplex described herein is an RNAi agent capable of reducing the amount of APOE RNA through the activation of RISC / Ago2. In certain embodiments, an oligomeric agent comprises at least two oligomeric duplexes linked together. In certain embodiments, an oligomeric agent comprises two oligomeric duplexes wherein at least one oligomeric duplex comprises an antisense oligonucleotide that is complementary to a nucleobase 20 sequence of APOE RNA as described herein. In certain embodiments, an oligomeric agent comprises two or more of the same oligomeric duplex, which is any of the oligomeric duplexes described herein. In certain embodiments, the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of two or more oligomeric duplexes are 25 covalently linked together at their 3′ ends. In certain embodiments, the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together at the 3′ end of one to the 5′ end of the other. In certain embodiments, the two or more oligomeric duplexes are covalently linked together by a glycol linker, such as a tetraethylene glycol linker. A structure of oligomeric duplexes covalently linked by a glycol linker is described in, e.g., Alterman, J. F., et al. Nature Biotech.2019, 37, 844-894. In certain embodiments, 30 an oligomeric agent comprises two oligomeric duplexes formed from one antisense oligonucleotide comprising two targeting regions, wherein each targeting region is paired with a sense oligonucleotide. In some embodiments, an oligomeric agent comprises two or more oligomeric duplexes linked, e.g., covalently linked, together in a branched structure, e.g., a di-branched, tri-branched, or tetra-branched structure (see, e.g., WO 2022 / 256565). In some such embodiments, the structure contains a linker (e.g., one or more 35 subunits of an ethylene glycol, alkyl, carbohydrate, block copolymer, peptide, ester, amide, carbamate, 83 BIOL0446WO triazole) and optionally one or more branch point moieties (e.g., phosphoramidite, tosylated solketal, 1,3- diaminopropanol, pentaerythritol). G. Conjugates In certain embodiments, provided herein are oligomeric agents comprising one or more modified 5 oligonucleotides, and one or more conjugate groups and / or one or more terminal groups. In certain embodiments, an oligomeric agent comprises one or more modified oligonucleotides and one or more conjugate groups. In certain embodiments, an oligomeric agent comprises one or more modified oligonucleotides and one or more terminal groups. Conjugate groups comprise or consist of a conjugate moiety and a conjugate linker. A conjugate group may be attached at the 5′ end of an oligonucleotide and / or 10 at the 3′ end of an oligonucleotide and / or at any internal position of an oligonucleotide. In certain embodiments, conjugate groups are attached through a modified sugar moiety or a modified internucleoside linkage. In certain embodiments, oligomeric agents comprise a modified oligonucleotide, a cell-targeting moiety, and a conjugate linker. 1. Conjugate Groups 15 A conjugate group comprises or consists of a conjugate moiety and a conjugate linker. In certain embodiments, a conjugate moiety attached to an oligonucleotide modifies one or more properties of the attached oligonucleotide compared to the same oligonucleotide lacking the conjugate moiety, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, a conjugate moiety 20 imparts a new property on the attached oligonucleotide. In some embodiments, the conjugate group comprises a small molecule drug (e.g., an active pharmaceutical ingredient), an aliphatic chain, a lipid, a peptide, a protein, a hydrocarbon, a polyamine, a polyamide, a polyether, a thioether, an aptamer, an antibody, an antibody fragment, a VHH camelid antibody fragment, a VNAR shark antibody fragment, a vitamin, a fatty acid, a carbohydrate, an intercalator, a reporter 25 molecule, a small molecule, or an alkyl moiety, e.g., a C22 alkyl, C20 alkyl, C17 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, wherein the alkyl chain optionally has one or more unsaturated bonds. In some embodiments, the conjugate group comprises a 6-palmitamidohexyl moiety or a 2-(hydroxymethyl)-6- palmitamidohexyl moiety. In certain embodiments, the conjugate group comprises a cell-targeting moiety. 30 Methods of preparing conjugated oligonucleotides are known in the art and / or described herein. For example, in one non-limiting solid phase method for large-scale synthesis of conjugated oligonucleotides, monomethoxytrityl (MMT)-protected 5′ or (3′)-amino-modified oligonucleotide intermediates are generated using the phosphoramidate monomer coupling method and detritylated as described in U.S. Patent No. 10,450,342. The 5′ (or 3′) MMT-protected amino group may be linked to the oligonucleotide through a linker 84 BIOL0446WO group such as an alkyl phosphate group, and the MMT group may be removed from the oligonucleotide via solution-phase detritylation conducted at certain temperatures and pH. In certain embodiments, the detritylated oligonucleotide is then reacted with a conjugate group (e.g., a GalNAc3) to generate a conjugated oligonucleotide. 5 2. Conjugate Moieties Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), antibodies, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, 10 phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes. In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, 15 chlorothiazide, a diazepine, indomethacin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. In certain embodiments, conjugate moieties are selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 20 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, conjugate moieties are selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, where the alkyl chain has one or more unsaturated bonds. 25 3. Cell-Targeting Moieties In certain embodiments, a conjugate group comprises a cell-targeting moiety. In certain embodiments, the cell-targeting moiety targets neurons. In certain embodiments, the cell-targeting moiety targets a neurotransmitter receptor. In certain embodiments, the cell targeting moiety targets a 30 neurotransmitter transporter. In certain embodiments, the cell targeting moiety targets a GABA transporter. See e.g., WO 2011 / 131693, WO 2014 / 064257. In certain embodiments, conjugate groups comprise cell-targeting moieties that have affinities for transferrin receptor (TfR) (also referred to herein as TfR1 and CD71). In certain embodiments, a conjugate group described herein comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the 35 conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the 85 BIOL0446WO conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the anti-TfR1 antibody or fragment thereof can be any known in the art including but not limited to those described in WO1991 / 004753; WO2013 / 103800; WO2014 / 144060; WO2016 / 081643; WO2016 / 179257; WO2016 / 207240; WO2017 / 221883; WO2018 / 129384; WO2018 / 124121; WO2019 / 151539; 5 WO2020 / 132584; WO2020 / 028864; US 7,208,174; US 9,034,329; US 10,550,188; and US 11,512,136. In certain embodiments, a fragment of an anti-TfR1 antibody is F(ab')2, Fab, Fab', Fv, scFv, VHH, or VNAR. In certain embodiments, an antibody binds to TfR1 through an engineered Fc domain rather than through the antigen-binding portion, as described in, e.g., US 2020 / 0223935. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. 10 In certain embodiments, the protein or peptide capable of binding TfR1 can be any known in the art including but not limited to those described in WO2019 / 140050; WO2020 / 037150; WO2020 / 124032; WO 2022 / 026555; WO 2023 / 027125; WO 2023 / 022234; and US 10,138,483. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the aptamer capable of binding TfR1 can be any known in the art including but not 15 limited to those described in WO2013 / 163303; WO2019 / 033051; and WO2020 / 245198. 4. Conjugate Linkers In certain embodiments, oligomeric agents comprise an oligonucleotide and a conjugate group, wherein the conjugate group consists of a conjugate moiety and a conjugate linker. The conjugate linker links 20 the conjugate moiety to the oligonucleotide. In certain embodiments, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises one or more atoms. In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units. In certain embodiments, the oligonucleotide is a modified 25 oligonucleotide. In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain 30 embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group. In certain embodiments, conjugate linkers, including the conjugate linkers described above, are 35 bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to 86 BIOL0446WO compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups 5 and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl. Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic10 acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1- C10alkyl, substituted or unsubstituted C2-C10alkenyl or substituted or unsubstituted C2-C10alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl. In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. 15 For example, in certain circumstances oligomeric agents comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric agent has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one 20 cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases. In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or 25 both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group. In certain embodiments, a cleavable moiety may be part of the oligonucleotide and comprises or 30 consists of one or more linked nucleosides. In certain such embodiments, the one or more linked nucleosides are linked to one another and / or to the remainder of the oligonucleotide through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2′-deoxynucleoside that is either the 3′ or 5′-terminal nucleoside of an oligonucleotide linked by a phosphodiester internucleoside linkage to an adjacent nucleoside of the oligonucleotide and 87 BIOL0446WO covalently attached to the conjugate linker or conjugate moiety by a phosphodiester or phosphorothioate linkage. In certain such embodiments, the cleavable moiety comprises 2′-deoxyadenosine. In certain embodiments, oligomeric agents described herein comprise an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the oligonucleotide is attached to the conjugate moiety using 5 Click chemistry known in the art. Compounds have been prepared using Click chemistry wherein alkynyl phosphonate internucleoside linkages on an oligonucleotide attached to a solid support are converted into the 1,2,3-triazolylphosphonate internucleoside linkages and then cleaved from the solid support (Krishna, H. et al. J. Am. Chem. Soc.2012, 134(28), 11618-11631). Additional conjugate linkers suitable for oligonucleotide conjugates are prepared by Click chemistry described in “Click Chemistry for Biotechnology and Materials10 Science” Ed. Joerg Lahann, Wiley 2009. Further examples of linking chemistry include an inverse electron demand Diels-Alder reaction, e.g., as described in Argamunt et al., J. Org. Chem.2020, 85, 10, 6593–6604, Sarrett et al., Nat. Protocols 2021, 16, 3348–3381; Handula et al., Molecules, 2021, 26 (15), 4640, Wiessler et al., Int. J. Med. Sci.2010, 7 (1), 19–28; copper-catalyzed azide-alkyne cycloaddition (CuAAC) see, e.g., S. I. Presolski, et al., J. Am. Chem. Soc.2010, 132, 14570–14576; D. Soriano Del Amo, et al., J. Am. Chem. Soc.,15 2010, 132, 16893–16899; Staudinger reaction, see, e.g., Saxon and C. R. Bertozzi, Science, 2000, 287, 2007– 2010; B. L. Nilsson, et al., Org. Lett., 2000, 2, 1939–1941, E. Saxon, et al., Org. Lett., 2000, 2, 2141–2143; formation of hydrazones and oximes, see, e.g., J. Y. Axup, et al., Proc. Natl. Acad. Sci. U. S. A., 2012, 109, 16101–16106; photoclick reactions, see, e.g., W. Song, et al., Angew. Chem., Int. Ed., 2008, 47, 2832–2835, A. Herner and Q. Lin, Top. Curr. Chem., 2016, 374, 1; strain-promoted alkyne-nitrone cycloaddition 20 (SPANC) reactions, see, e.g., D. A. MacKenzie, et al., Curr. Opin. Chem. Biol., 2014, 21, 81–88; transition metal catalyzed cross coupling, see, e.g., M. Chalker, et al., J. Am. Chem. Soc., 2009, 131, 16346–16347; nucleophilic additions, in particular, of a thiol to a maleimide, see, e.g., Kang et al., Chem. Sci., 2021, 12, 13613-13647, Bernardim et al., Nat. Comm.2016, 7, 13128, Jain et al., Pharm. Res.2015, 32 (11), 3526- 3540. 25 H. Terminal Groups In certain embodiments, provided herein are oligomeric agents comprising one or more modified oligonucleotides and one or more terminal groups. As used herein, “terminal group” means a group of atoms that is covalently linked to a terminus of an oligonucleotide. Examples of a terminal group include, but are 30 not limited to, a capping group, a phosphate moiety, a stabilized phosphate group, and a protecting group. In certain embodiments, one or more terminal groups is attached to either or both ends of an oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3′-end and / or at the 5′-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3′-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 5′-end of the 35 oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3′-end of the 88 BIOL0446WO oligonucleotide and one or more terminal groups is attached at the 5′-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3′-end of the oligonucleotide and / or at the 5′-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3′-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 5′-end of the oligonucleotide. In certain 5 embodiments, a terminal group is attached at the 3′-end of the oligonucleotide and a terminal group is attached at the 5′-end of the oligonucleotide. In certain embodiments, an oligonucleotide is linked to a terminal group comprising a stabilized 5’- phosphate. Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but not limited to 5’-vinylphosphonate, 5’-methylphosphonate, and 5’-cyclopropyl phosphonate. 10 In certain embodiments, terminal groups comprise one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, a terminal group comprises an inverted abasic sugar moiety. In certain embodiments, the inverted abasic sugar moiety may be further attached to a conjugate group. In certain embodiments, terminal groups comprise one or more 2’-linked nucleosides or sugar moieties. In certain such embodiments, the 2’-linked group is an abasic sugar moiety. Such terminal abasic sugar moieties can be 15 attached to either or both ends of an oligonucleotide. II. Target Nucleic Acids A. APOE In certain embodiments, oligomeric agents comprise or consist of a modified oligonucleotide 20 comprising a targeting region that is complementary to an equal-length target region of a target nucleic acid, wherein the target nucleic acid is an APOE nucleic acid. In certain embodiments, the APOE nucleic acid has the nucleobase sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NC_000019.10, truncated from nucleotides 44903001 to 44912000), in SEQ ID NO: 2 (GENBANK Accession No. NM_001302688.1), in SEQ ID NO: 3 (GENBANK Accession No. AU126799.1), in SEQ ID NO: 4 (GENBANK Accession No. 25 BI602495.1), in SEQ ID NO: 5 (the complement of GENBANK Accession No. CA306379.1), or in SEQ ID NO: 6 (GENBANK Accession No. NM_000041.2 with T→C at position 471 to result in APOE4 mutant mRNA). In certain embodiments, contacting a cell with an oligomeric agent comprising a modified oligonucleotide comprising a target region that is complementary to an equal-length target region of any of SEQ ID NOs: 1-6 reduces the amount of APOE RNA, and in certain embodiments reduces the amount of 30 ApoE protein in the cell. In certain embodiments, the oligomeric agent consists of a modified oligonucleotide. In certain embodiments, the oligomeric agent consists of a modified oligonucleotide and a conjugate group. In certain embodiments, the modified oligonucleotide of the oligomeric agent is paired with an additional modified oligonucleotide to form an oligomeric duplex. In certain embodiments, the oligomeric duplex comprises a conjugate group. In certain embodiments, the modified oligonucleotide is an antisense 35 oligonucleotide. In certain embodiments, the oligomeric agent consists of an antisense oligonucleotide. In 89 BIOL0446WO certain embodiments, the oligomeric agent consists of an antisense oligonucleotide and a conjugate group. In certain embodiments, the oligomeric agent consists of an antisense oligonucleotide and one or more terminal group(s). In certain embodiments, the oligomeric agent consists of an antisense oligonucleotide, a conjugate group, and one or more terminal group(s). In certain embodiments, the oligomeric agent reduces the amount 5 of APOE RNA and / or the amount of ApoE protein in vitro by at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vitro assay. In certain embodiments, the oligomeric agent reduces the amount of APOE RNA and / or the amount of ApoE protein in vivo by at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vivo assay. In certain 10 embodiments, the oligomeric agent reduces the amount of APOE RNA and / or the amount of ApoE protein in the cell of a subject by at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric agents comprise an antisense oligonucleotide comprising a targeting region that is complementary to a target region of an APOE nucleic acid. In certain embodiments, 15 oligomeric agents comprise an antisense oligonucleotide comprising a targeting region that is complementary to a target region of an APOE nucleic acid, and a sense oligonucleotide comprising a duplexing region that is complementary to the antisense oligonucleotide, or a region thereof. In certain embodiments, the target nucleic acid is an endogenous APOE RNA molecule. In certain embodiments, the APOE nucleic acid encodes an ApoE protein. In certain embodiments, the APOE nucleic 20 acid is a precursor to a nucleic acid that encodes an ApoE protein. In certain such embodiments, the APOE nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic, and untranslated regions. In certain embodiments, the APOE RNA is a mature mRNA. In certain embodiments, the APOE nucleic acid is a pre-mRNA. In certain embodiments, a targeting region is from 6 to 20, 10 to 18, 14 to 18, 16 to 20, or 18 to 20 25 nucleobases in length. In certain embodiments, the targeting region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases. In certain embodiments, the targeting region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 30 contiguous nucleobases. In certain embodiments, the targeting region constitutes at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleosides of a modified oligonucleotide (e.g., an antisense oligonucleotide). In certain embodiments, the targeting region constitutes all of the nucleosides of the modified oligonucleotide (e.g., the antisense oligonucleotide). In certain embodiments, the targeting region of the modified oligonucleotide (e.g., the antisense oligonucleotide) is at least 99%, at least 95%, at least 90%, 35 at least 85%, or at least 80% complementary to a target region of the APOE nucleic acid. In certain 90 BIOL0446WO embodiments, the targeting region of the modified oligonucleotide (e.g., the antisense oligonucleotide) is 100% complementary to a target region of the APOE nucleic acid. In certain embodiments, the targeting region is entirely within an intron. In certain embodiments, the targeting region spans an intron / exon junction. In certain embodiments, modified oligonucleotides (e.g., antisense oligonucleotides) comprise one or 5 more mismatches relative to the target region of the APOE nucleic acid. In certain embodiments, the modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, antisense activity against the target is reduced by such a mismatch, and activity against a non-target is reduced. In certain embodiments, activity against the non-target is reduced by a greater amount than activity against the target. Thus, in certain embodiments selectivity of the antisense oligonucleotides is improved. In certain 10 embodiments, antisense oligonucleotides are at least 80% complementary to the target region of the APOE nucleic acid over the entire length of the antisense oligonucleotide and comprise no more than one to three mismatches with the APOE nucleic acid. In certain embodiments, antisense oligonucleotides comprise a targeting region that is at least 80% complementary to a target region of the APOE nucleic acid over the entire length of the targeting region, and the targeting region comprises no more than one to three mismatches 15 with the target region. In certain embodiments, antisense oligonucleotides comprise a targeting region that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a target region of the APOE nucleic acid over the entire length of the targeting region. In certain embodiments, a mismatch is specifically positioned within an antisense oligonucleotide. In certain embodiments, a mismatch is at position 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5′-end of the antisense oligonucleotide. In certain embodiments, a mismatch is at 20 position 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 from the 3′-end of the antisense oligonucleotide. In certain embodiments, 1-2 additional mismatches may be present at a terminus or at both termini of the antisense oligonucleotide, outside of the targeting region. In certain embodiments, a mismatch is at position 1, 2, 3, or 4 from the 5′-end of the antisense oligonucleotide. In certain embodiments, a mismatch is at position 4, 3, 2, or 1 from the 3′-end of the antisense oligonucleotide. 25 B. Target Nucleic Acids in Certain Tissues In certain embodiments, oligomeric agents comprise or consist of a modified oligonucleotide comprising a targeting region that is complementary to a target region in an APOE nucleic acid, wherein the APOE nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the 30 pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system (CNS). Such tissues include the brain and spinal cord. In certain embodiments, the pharmacological relevant tissues include the cortex, the hippocampus, amygdala, basal ganglia, thalamus, midbrain, cerebellum, choroid plexus, spinal cord, caudate, putamen, and brain stem. In certain embodiments, the cells are brain cells. In certain embodiments, the cells include glial cells. In certain embodiments, glial cells include astrocytes, 35 oligodendrocytes, and microglial cells. In certain embodiments, the cells include astrocytes and microglial 91 BIOL0446WO cells. In certain embodiments, the cells include neurons. In certain embodiments, the cells include endothelial cells in the brain, e.g., brain microvascular endothelial cells (BMEC). In certain embodiments, the cells include pericytes in the brain (or brain pericytes). 5 C. Oligonucleotide Sequences Provided herein are oligomeric agents comprising modified oligonucleotides complementary to a target region in an APOE nucleic acid, such as, for example, a human APOE nucleic acid, such as SEQ ID NO: 1 (GENBANK Accession No. NC_000019.10, truncated from nucleotides 44903001 to 44912000), SEQ ID NO: 2 (GENBANK Accession No. NM_001302688.1), SEQ ID NO: 3 (GENBANK Accession No. 10 AU126799.1), SEQ ID NO: 4 (GENBANK Accession No. BI602495.1), SEQ ID NO: 5 (the complement of GENBANK Accession No. CA306379.1), or SEQ ID NO: 6 (GENBANK Accession No. NM_000041.2 with T→C at position 471 to result in APOE4 mutant mRNA), and compositions comprising such oligomeric agents. In certain embodiments, a modified oligonucleotide has a nucleobase sequence comprising or consisting of a targeting region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% 15 complementary to a region of any of SEQ ID NOs: 1-6. In certain embodiments, a modified oligonucleotide has a complementary region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a targeting region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a target region of any of SEQ ID NOs: 1-6. In certain embodiments, a modified oligonucleotide has a targeting region that is 100% complementary to a target region of any of SEQ ID NOs: 20 1-6. In certain embodiments, a modified oligonucleotide has a nucleobase sequence comprising or consisting of a complementary region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a targeting region that is 100% complementary to a target region of any of SEQ ID NOs: 1- 6. In certain embodiments, a modified oligonucleotide has a nucleobase sequence comprising or consisting of any of SEQ ID NOs: 22-40. 25 III. Methods and Uses A. Antisense Activity In certain embodiments, oligomeric agents provided herein comprise an antisense oligonucleotide that is capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such 30 oligomeric agents are antisense agents. In certain antisense activities, hybridization of an antisense oligonucleotide to a target nucleic acid results in recruitment of a protein, e.g., RNase H or Argonaute, that cleaves the target nucleic acid. Certain antisense agents result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex 35 need not be unmodified DNA. In certain embodiments, oligomeric agents are antisense agents that are 92 BIOL0446WO sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the antisense agent are tolerated and RNase H activity is retained. In certain embodiments, such antisense agents reduce expression of or reduce the amount or activity of a target nucleic acid by 25% or more in the standard in vitro assay. 5 In certain antisense activities, an antisense oligonucleotide is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense oligonucleotides result in cleavage of the target nucleic acid by Argonaute. Antisense agents that comprise an antisense oligonucleotide that is loaded into RISC are RNAi agents. RNAi agents may be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA). In certain embodiments, RNAi agents are capable of RISC- 10 mediated modulation of a target nucleic acid in a cell. In certain embodiments, such RNAi agents reduce the expression of or reduce the amount or activity of a target nucleic acid by 25% or more in the standard in vitro assay. In certain embodiments, RNAi agents selectively affect one or more target nucleic acid. Such RNAi agents comprise a modified oligonucleotide having a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity. In certain embodiments, an RNAi 15 agent comprises a modified oligonucleotide that does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, 20 hybridization of the antisense oligonucleotide to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in exon inclusion or exon exclusion. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in retained intron exclusion. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results 25 in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid (e.g., miRNA, lncRNA, sncRNA). In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in modulation of translation of the target nucleic acid. In certain embodiments, hybridization of an oligomeric agent to a target nucleic acid results in an increase in the amount or activity of a target nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic 30 acid results in increased translation of the target nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in reduced translation of the target nucleic acid. Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a 35 nucleic acid or protein and / or a phenotypic change in a cell or animal. 93 BIOL0446WO B. Treatment In certain embodiments, provided herein are methods of reducing or inhibiting APOE expression or activity, which can be useful for treating or ameliorating a neurodegenerative disease associated with APOE 5 in a subject. In certain embodiments, the neurodegenerative disease associated with APOE is Alzheimer’s disease. In certain embodiments, a method comprises administering to a subject an oligomeric agent, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to an APOE nucleic acid. In certain embodiments, the subject has or is at risk for 10 developing a neurodegenerative disease associated with APOE. In certain embodiments, the subject has or is at risk for developing Alzheimer’s disease. In certain embodiments, the subject has Alzheimer’s disease. In certain embodiments, a method for treating a neurodegenerative disease associated with APOE comprises administering to a subject an oligomeric agent, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to an APOE nucleic acid. 15 In certain embodiments, the subject has or is at risk for developing a neurodegenerative disease. In certain embodiments, the subject has or is at risk for developing Alzheimer’s disease. In certain embodiments, the subject has Alzheimer’s disease. In certain embodiments, at least one symptom of the neurodegenerative disease associated with APOE is ameliorated. In certain embodiments, the symptom is cognitive impairment, progressive memory loss, a decline in language skills, behavioral abnormality, dementia, difficulty 20 performing daily activities, aphasia, agnosia, apraxia, loss of motor function, amyloid plaque, neurofibrillary tangle, and / or neuroinflammation. In certain embodiments, administration of the oligomeric agent, modified oligonucleotide, oligomeric duplex, or antisense agent reduces the rate of cognitive impairment or progressive memory loss, reduces the rate of decline in language skills, reduces the rate of progression of behavioral abnormality, reduces the rate of progression of dementia, improves the performance in daily 25 activities, reduces the rate of progression of aphasia, agnosia, and / or apraxia, and / or decreases the rate of decline in motor function in the subject. In certain embodiments, administration of the oligomeric agent, modified oligonucleotide, oligomeric duplex, or antisense agent reduces amyloid plaques, neurofibrillary tangles, and / or neuroinflammation in the brain of the subject. In certain embodiments, a method of reducing expression of APOE, for example RNA, or reducing 30 the expression of ApoE protein in a cell comprises contacting the cell with an oligomeric agent, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to an APOE nucleic acid. In certain embodiments, the subject has or is at risk for developing a neurodegenerative disease. In certain embodiments, the subject has or is at risk for developing Alzheimer’s disease. In certain embodiments, the subject has Alzheimer’s disease. In certain embodiments, the cell is a 35 brain cell. In certain embodiments, the cell is a glial cell. In certain embodiments, the cell is an astrocyte, an 94 BIOL0446WO oligodendrocyte, or a microglial cell. In certain embodiments, the cell is an astrocyte or a microglial cell. In certain embodiments, the cell is a neuron. In certain embodiments, the cell is an endothelial cell in the brain, e.g., a brain microvascular endothelial cell (BMEC). In certain embodiments, the cell is a pericyte in the brain (or brain pericyte). In certain embodiments, the cell is a human cell. 5 Certain embodiments are drawn to an oligomeric agent, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to an APOE nucleic acid, for use in treating a neurodegenerative disease associated with APOE or for use in the manufacturing of a medicament for treating a neurodegenerative disease associated with APOE. In certain embodiments, the neurodegenerative disease associated with APOE is Alzheimer’s disease. 10 In any of the methods or uses described herein, the oligomeric agent, the modified oligonucleotide, the oligomeric duplex, or the antisense agent can be any described herein. IV. Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more 15 oligomeric agent described herein, wherein each oligomeric agent comprises or consists of a modified oligonucleotide. In certain embodiments, the one or more oligomeric agent consists of or comprises an antisense oligonucleotide. In certain embodiments, a pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric agent. In certain embodiments, 20 the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agent (e.g., a modified oligonucleotide or oligomeric duplex) provided herein and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agent (e.g., a modified oligonucleotide or oligomeric duplex) provided herein and phosphate-buffered saline (PBS). 25 In certain embodiments, sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agent (e.g., a modified oligonucleotide or oligomeric duplex) provided herein and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition comprises an oligomeric agent comprising or 30 consisting of a modified oligonucleotide and sterile saline. In certain such embodiments, a pharmaceutical composition consists of such oligomeric agent and sterile saline. In certain embodiments, a pharmaceutical composition consists essentially of such oligomeric agent and sterile saline. In certain embodiments, the sterile saline is sterile PBS. In certain embodiments, the sterile saline is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises an oligomeric agent and artificial 35 cerebrospinal fluid (aCSF). In certain embodiments, a pharmaceutical composition consists of an oligomeric 95 BIOL0446WO agent and aCSF. In certain embodiments, a pharmaceutical composition consists essentially of an oligomeric agent and aCSF. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade. In certain embodiments, aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride 5 hexahydrate. In certain embodiments, the pH of an aCSF solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7.1-7.3, or to about 7.2. In certain embodiments, pharmaceutical compositions comprise one or more oligomeric agent and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, 10 polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone. In certain embodiments, an oligomeric agent may be admixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of 15 criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. In certain embodiments, pharmaceutical compositions comprising an oligomeric agent encompass any pharmaceutically acceptable salts of the oligomeric agent, esters of the oligomeric agent, or salts of such esters. As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the 20 parent compound and do not impart undesired toxicological effects thereto. In certain embodiments, pharmaceutical compositions comprising an oligomeric agent comprising or consisting of one or more modified oligonucleotide, upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric agents provided herein, prodrugs, 25 pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved, for example by endogenous nucleases, within the 30 body. In certain embodiments, oligomeric agents are lyophilized and isolated, e.g., as sodium salts. In certain embodiments, a sodium salt of an oligomeric agent is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS. In certain embodiments, a sodium salt of an oligomeric agent is mixed with PBS. 96 BIOL0446WO Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain methods, a nucleic acid, such as an oligomeric agent comprising a modified oligonucleotide, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, nucleic acid complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. 5 In certain embodiments, a lipid moiety is selected to increase distribution of an oligomeric agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of an oligomeric agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of an oligomeric agent to muscle tissue. In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of 10 delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used. In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more oligomeric agents to specific tissues or cell types. For15 example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue- specific antibody. In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic 20 compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™ and 65% w / v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of 25 Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose. In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a 30 pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier or diluent and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or 35 serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid 97 BIOL0446WO carriers, diluents, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Certain solvents suitable 5 for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a 10 phosphodiester linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” herein is intended to include all such forms. Drawn structures necessarily depict a single 15 form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated / de- protonated / in association with a cation or a combination of cations. In certain embodiments, one or more specific cation is identified. The cations include, but are not limited to, sodium, potassium, calcium, and 20 magnesium. In certain embodiments, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated / de-protonated / in association with one or more cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, oligomeric agents provided herein are in aqueous solution with sodium. In 25 certain embodiments, oligomeric agents are in aqueous solution with potassium. In certain embodiments, oligomeric agents are in PBS. In certain embodiments, oligomeric agents are in water. In certain such embodiments, the pH of a solution is adjusted with NaOH and / or HCl to achieve a desired pH. Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of an oligomeric agent (e.g., modified oligonucleotide, oligomeric duplex, antisense 30 agent) in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric duplex. As described herein, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that the oligomeric agent (e.g., modified oligonucleotide, oligomeric duplex) exists as a solvent-free, sodium-acetate free, anhydrous, free acid. In certain embodiments, where an oligomeric agent (e.g., modified oligonucleotide, oligomeric duplex) is in 35 solution comprising sodium (e.g., saline), the oligomeric agent may be partially or fully de-protonated and in 98 BIOL0446WO association with sodium ions. However, the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the sodium ions is not counted toward the weight of the dose. When an oligomeric agent comprises a conjugate group, the mass of the conjugate group is included in calculating the dose of such oligomeric agent. If the conjugate group also has an acid, the conjugate group is likewise assumed to be 5 fully protonated for the purpose of calculating dose. In certain embodiments, where a modified oligonucleotide or oligomeric agent is in a solution, such as aCSF, comprising sodium, potassium, calcium, and magnesium, the modified oligonucleotide or oligomeric agent may be partially or fully de-protonated and in association with sodium, potassium, calcium, and / or magnesium. However, the mass of the protons is nevertheless counted toward the weight of the dose, 10 and the mass of the sodium, potassium, calcium, and magnesium ions is not counted toward the weight of the dose. V. Certain Oligomeric Agents In certain embodiments, an oligomeric agent disclosed herein comprises a modified oligonucleotide 15 consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 22-40. In certain such embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, a T nucleobase in the modified 20 oligonucleotide is substituted with a U nucleobase. In certain embodiments, two or more T nucleobases, three or more T nucleobases, or all of the T nucleobases are substituted with U nucleobases in the modified oligonucleotide. In certain embodiments, the oligomeric agent comprises a conjugate group. In certain embodiments, the oligomeric agent does not comprise a conjugate group. In certain embodiments, the oligomeric agent comprises a terminal group. In certain embodiments, the oligomeric agent does not 25 comprise a terminal group. In certain embodiments, the oligomeric agent is single-stranded. In certain embodiments, the oligomeric agent is an antisense agent. In certain embodiments, the oligomeric agent is a single-stranded antisense agent. In certain embodiments, an oligomeric agent disclosed herein comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide 30 comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of 5’- ACTTGGTGAATCTTTATTAA -3’ (SEQ ID NO: 22). In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the modified sugar moiety is selected from a 2’-MOE sugar moiety, a cEt sugar moiety, a 2’-OMe sugar moiety, and a 2’-β-D- 35 deoxyxylosyl sugar moiety. In certain embodiments, the modified internucleoside linkage is selected from a 99 BIOL0446WO phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, a T nucleobase in the modified 5 oligonucleotide is substituted with a U nucleobase. In certain embodiments, two or more T nucleobases, three or more T nucleobases, four or more T nucleobases, five or more T nucleobases, or all of the T nucleobases are substituted with U nucleobases in the modified oligonucleotide. In certain embodiments, the oligomeric agent comprises a conjugate group. In certain embodiments, the oligomeric agent does not comprise a conjugate group. In certain embodiments, the oligomeric agent comprises a terminal group. In certain 10 embodiments, the oligomeric agent does not comprise a terminal group. In certain embodiments, the oligomeric agent is single-stranded. In certain embodiments, the oligomeric agent is an antisense agent. In certain embodiments, the oligomeric agent is a single-stranded antisense agent. In certain embodiments, the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 22. In certain embodiments, the modified oligonucleotide has a modified sugar motif of 5’- 15 eeeeekddddddddddkkee -3’, wherein each “e” is a 2’-MOE sugar moiety, each “k” is a cEt sugar moiety, and each “d” is a 2’-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide comprises a modified internucleoside linkage selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain 20 embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 22, and the modified oligonucleotide has a modified sugar motif of 5’- eeeeekddddddddddkkee -3’, wherein each 25 “e” is a 2’-MOE sugar moiety, each “k” is a cEt sugar moiety, and each “d” is a 2’-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a modified internucleoside linkage motif of 5’- soosssszzzssssszsss -3’, wherein each “s” is a phosphorothioate internucleoside linkage, each “o” is a phosphodiester internucleoside linkage, and each “z” is a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In 30 certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 22, and the modified oligonucleotide has a modified sugar motif of 5’- keeeekddddddddddkkee -3’, wherein each 35 “e” is a 2’-MOE sugar moiety, each “k” is a cEt sugar moiety, and each “d” is a 2’-β-D-deoxyribosyl sugar 100 BIOL0446WO moiety. In certain embodiments, the modified oligonucleotide comprises a modified internucleoside linkage selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified 5 oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 22, and the modified oligonucleotide has a modified sugar motif of 5’- keeeekddddddddddkkee -3’, wherein each 10 “e” is a 2’-MOE sugar moiety, each “k” is a cEt sugar moiety, and each “d” is a 2’-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a modified internucleoside linkage motif of 5’- soosssszzzssssszsss -3’, wherein each “s” is a phosphorothioate internucleoside linkage, each “o” is a phosphodiester internucleoside linkage, and each “z” is a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In 15 certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine. In certain embodiments, an oligomeric agent disclosed herein comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide 20 comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of 5’ – CTTGGTGAATCTTTATTAAA – 3’ (SEQ ID NO: 23). In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the modified sugar moiety is selected from a 2’-MOE sugar moiety, a cEt sugar moiety, a 2’-OMe sugar moiety, and a 2’-β-D- 25 deoxyxylosyl sugar moiety. In certain embodiments, the modified internucleoside linkage is selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, a T nucleobase in the modified 30 oligonucleotide is substituted with a U nucleobase. In certain embodiments, two or more T nucleobases, three or more T nucleobases, four or more T nucleobases, five or more T nucleobases, or all of the T nucleobases are substituted with U nucleobases in the modified oligonucleotide. In certain embodiments, the oligomeric agent comprises a conjugate group. In certain embodiments, the oligomeric agent does not comprise a conjugate group. In certain embodiments, the oligomeric agent comprises a terminal group. In certain 35 embodiments, the oligomeric agent does not comprise a terminal group. In certain embodiments, the 101 BIOL0446WO oligomeric agent is single-stranded. In certain embodiments, the oligomeric agent is an antisense agent. In certain embodiments, the oligomeric agent is a single-stranded antisense agent. In certain embodiments, the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 23. In certain embodiments, the modified oligonucleotide has a modified sugar motif of 5’- 5 kkkdddddddddddddkkdk -3’, wherein each “k” is a cEt sugar moiety, and each “d” is a 2’-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide comprises a modified internucleoside linkage selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the 10 modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 23, and the modified oligonucleotide has a modified sugar motif of 5’- kkkdddddddddddddkkdk -3’, wherein 15 each “k” is a cEt sugar moiety, and each “d” is a 2’-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a modified internucleoside linkage motif of 5’- ssszzzzzzsssssssssz -3’, wherein each “s” is a phosphorothioate internucleoside linkage, and each “z” is a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a 20 modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5- methylcytosine. In certain embodiments, an oligomeric agent disclosed herein comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide 25 comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of 5’ – TTGGTGAATCTTTATTAAAC – 3’ (SEQ ID NO: 27). In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the modified sugar moiety is selected from a 2’-MOE sugar moiety, a cEt sugar moiety, a 2’-OMe sugar moiety, and a 2’-β-D- 30 deoxyxylosyl sugar moiety. In certain embodiments, the modified internucleoside linkage is selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, a T nucleobase in the modified 35 oligonucleotide is substituted with a U nucleobase. In certain embodiments, two or more T nucleobases, three 102 BIOL0446WO or more T nucleobases, four or more T nucleobases, five or more T nucleobases, or all of the T nucleobases are substituted with U nucleobases in the modified oligonucleotide. In certain embodiments, the oligomeric agent comprises a conjugate group. In certain embodiments, the oligomeric agent does not comprise a conjugate group. In certain embodiments, the oligomeric agent comprises a terminal group. In certain 5 embodiments, the oligomeric agent does not comprise a terminal group. In certain embodiments, the oligomeric agent is single-stranded. In certain embodiments, the oligomeric agent is an antisense agent. In certain embodiments, the oligomeric agent is a single-stranded antisense agent. In certain embodiments, the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 27. In certain embodiments, the modified oligonucleotide has a modified sugar motif of 5’- 10 eeekddddddddddkkeeee -3’, wherein each “e” is a 2’-MOE sugar moiety, each “k” is a cEt sugar moiety, and each “d” is a 2’-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide comprises a modified internucleoside linkage selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain 15 embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 27. In certain embodiments, the modified oligonucleotide has a modified sugar motif of 5’- 20 eeekddddddddddkkeeee -3’, wherein each “e” is a 2’-MOE sugar moiety, each “k” is a cEt sugar moiety, and each “d” is a 2’-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a modified internucleoside linkage motif of 5’- zoosszzzssssszsssss -3’, wherein each “s” is a phosphorothioate internucleoside linkage, each “o” is a phosphodiester internucleoside linkage, and each “z” is a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified 25 oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine. In certain embodiments, disclosed herein is an oligomeric agent according to the following chemical 30 notation: N1esmCeoTeoTesGesGksTdsGdzAdzAdzTdsmCdsTdsTdsTdsAdzTksTksN3esN2e (SEQ ID NO: 49), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, 35 N1= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal 103 BIOL0446WO group, or is absent, wherein when N1is absent its sugar and internucleoside linkage are also absent, N2= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N2is absent its sugar and internucleoside linkage are also absent, N3= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal 5 group, or is absent, wherein when N3is absent its sugar and internucleoside linkage are also absent, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, 10 o = a phosphodiester internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and wherein the oligomeric agent optionally comprises a conjugate group. In certain embodiments, N1is an adenine nucleobase. In certain embodiments, N1is an unmodified adenine. In certain embodiments, N1is a modified adenine. In certain embodiments, N1is a hypoxanthine. In certain embodiments, N1is an abasic 15 sugar moiety. In certain embodiments, N1is a terminal group. In certain embodiments, N1is absent. In certain embodiments, N2is an adenine nucleobase. In certain embodiments, N2is an unmodified adenine. In certain embodiments, N2is a modified adenine. In certain embodiments, N2is a hypoxanthine. In certain embodiments, N2is an abasic sugar moiety. In certain embodiments, N2is a terminal group. In certain embodiments, N2is absent. In certain embodiments, N3is an adenine nucleobase. In certain embodiments, N320 is an unmodified adenine. In certain embodiments, N3is a modified adenine. In certain embodiments, N3is a hypoxanthine. In certain embodiments, N3is an abasic sugar moiety. In certain embodiments, N3is a terminal group. In certain embodiments, N3is absent. In certain embodiments, N1is an adenine nucleobase, an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N2is an adenine nucleobase, an unmodified adenine, a modified adenine, a hypoxanthine, an 25 abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1is an adenine nucleobase and N2is an adenine nucleobase, an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1is an adenine nucleobase and N2is an unmodified adenine. In certain embodiments, N1is an adenine nucleobase and N2is a modified adenine. In certain embodiments, N1is an adenine nucleobase and N2is a hypoxanthine. In certain embodiments, N1is an 30 adenine nucleobase and N2is an abasic sugar moiety. In certain embodiments, N1is an adenine nucleobase and N2is a terminal group. In certain embodiments, N1is an adenine nucleobase and N2is absent. In certain embodiments, N1is a modified adenine and N2is an unmodified adenine. In certain embodiments, N1is a modified adenine and N2is a modified adenine. In certain embodiments, N1is a modified adenine and N2is a hypoxanthine. In certain embodiments, N1is a modified adenine and N2is an abasic sugar moiety. In certain 35 embodiments, N1is a modified adenine and N2is a terminal group. In certain embodiments, N1is a modified 104 BIOL0446WO adenine and N2is absent. In certain embodiments, N1is a hypoxanthine and N2is an unmodified adenine. In certain embodiments, N1is a hypoxanthine and N2is a modified adenine. In certain embodiments, N1is a hypoxanthine and N2is a hypoxanthine. In certain embodiments, N1is a hypoxanthine and N2is an abasic sugar moiety. In certain embodiments, N1is a hypoxanthine and N2is a terminal group. In certain 5 embodiments, N1is a hypoxanthine and N2is absent. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, and N2is an unmodified adenine. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, and N2is a modified adenine. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, and N2is a hypoxanthine. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, and N2is an abasic sugar moiety. In certain embodiments, 10 N1is an abasic sugar moiety, a terminal group, or is absent, and N2is a terminal group. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, and N2is absent. In certain embodiments, N1is an adenine nucleobase, an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent; N2is absent; and N3is an adenine nucleobase, an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is 15 absent. In certain embodiments, N1is an adenine nucleobase, N2is absent, and N3is an unmodified adenine. In certain embodiments, N1is an adenine nucleobase, N2is absent, and N3is a modified adenine. In certain embodiments, N1is an adenine nucleobase, N2is absent, and N3is a hypoxanthine. In certain embodiments, N1is an adenine nucleobase, N2is absent, and N3is an abasic sugar moiety. In certain embodiments, N1is an adenine nucleobase, N2is absent, and N3is a terminal group. In certain embodiments, N1is an adenine 20 nucleobase, N2is absent, and N3is absent. In certain embodiments, N1is a modified adenine, N2is absent, and N3is an unmodified adenine. In certain embodiments, N1is a modified adenine, N2is absent, and N3is a modified adenine. In certain embodiments, N1is a modified adenine, N2is absent, and N3is a hypoxanthine. In certain embodiments, N1is a modified adenine, N2is absent, and N3is an abasic sugar moiety. In certain embodiments, N1is a modified adenine, N2is absent, and N3is a terminal group. In certain embodiments, N125 is a modified adenine, N2is absent, and N3is absent. In certain embodiments, N1is a hypoxanthine, N2is absent, and N3is an unmodified adenine. In certain embodiments, N1is a hypoxanthine, N2is absent, and N3is a modified adenine. In certain embodiments, N1is a hypoxanthine, N2is absent, and N3is a hypoxanthine. In certain embodiments, N1is a hypoxanthine, N2is absent, and N3is an abasic sugar moiety. In certain embodiments, N1is a hypoxanthine, N2is absent, and N3is a terminal group. In certain embodiments, N1is a 30 hypoxanthine, N2is absent, and N3is absent. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is an unmodified adenine. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a modified adenine. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a hypoxanthine. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, N2is 35 absent, and N3is an abasic sugar moiety. In certain embodiments, N1is an abasic sugar moiety, a terminal 105 BIOL0446WO group, or is absent, N2is absent, and N3is a terminal group. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is absent. In certain embodiments, N1is a terminal group, N2is absent, and N3is an unmodified adenine. In certain embodiments, N1is a terminal group, N2is absent, and N3is a modified adenine. In certain embodiments, N1is a terminal group, N2is absent, and N3is a 5 hypoxanthine. In certain embodiments, N1is a terminal group, N2is absent, and N3is an abasic sugar moiety. In certain embodiments, N1is a terminal group, N2is absent, and N3is a terminal group. In certain embodiments, N1is a terminal group, N2is absent, and N3is absent. In certain embodiments, N1is absent, N2is absent, and N3is an unmodified adenine. In certain embodiments, N1is absent, N2is absent, and N3is a modified adenine. In certain embodiments, N1is absent, N2is absent, and N3is a hypoxanthine. In certain 10 embodiments, N1is absent, N2is absent, and N3is an abasic sugar moiety. In certain embodiments, N1is absent, N2is absent, and N3is a terminal group. In certain embodiments, N1is absent, N2is absent, and N3is absent. In certain embodiments, the oligomeric agent is single-stranded. In certain embodiments, the oligomeric agent is an antisense agent. In certain embodiments, the oligomeric agent is a single-stranded antisense agent. 15 In certain embodiments, disclosed herein is an oligomeric agent according to the following chemical notation: N5ksTksTksGdzGdzTdzGdzAdzAdzTdsmCdsTdsTdsTdsAdsTdsTksN4ksN3dzN2k (SEQ ID NO: 50), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, 20 T = a thymine nucleobase, N2= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N2is absent its sugar and internucleoside linkage are also absent, N3= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N3is absent its sugar and internucleoside linkage are also absent, 25 N4= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N4is absent its sugar and internucleoside linkage are also absent, N5= a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, wherein when N5is absent its sugar is also absent, k = a cEt sugar moiety, 30 d = a 2’-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and wherein the oligomeric agent optionally comprises a conjugate group. In certain embodiments, N2is an adenine nucleobase. In certain embodiments, N2is an unmodified adenine. In certain embodiments, N2is a 35 modified adenine. In certain embodiments, N2is a hypoxanthine. In certain embodiments, N2is an abasic 106 BIOL0446WO sugar moiety. In certain embodiments, N2is a terminal group. In certain embodiments, N2is absent. In certain embodiments, N3is an adenine nucleobase. In certain embodiments, N3is an unmodified adenine. In certain embodiments, N3is a modified adenine. In certain embodiments, N3is a hypoxanthine. In certain embodiments, N3is an abasic sugar moiety. In certain embodiments, N3is a terminal group. In certain 5 embodiments, N3is absent. In certain embodiments, N4is an adenine nucleobase. In certain embodiments, N4is an unmodified adenine. In certain embodiments, N4is a modified adenine. In certain embodiments, N4is a hypoxanthine. In certain embodiments, N4is an abasic sugar moiety. In certain embodiments, N4is a terminal group. In certain embodiments, N4is absent. In certain embodiments, N5is a modified cytosine. In certain embodiments, N5is 5-methylcytosine. In certain embodiments, N5is an unmodified cytosine. In certain 10 embodiments, N5is an abasic sugar moiety. In certain embodiments, N5is a terminal group. In certain embodiments, N5is absent. In certain embodiments, N5is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, and N2is an adenine nucleobase, an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N5is a cytosine nucleobase and N2is an unmodified adenine. In certain embodiments, N5is a 15 cytosine nucleobase and N2is a modified adenine. In certain embodiments, N5is a cytosine nucleobase and N2is a hypoxanthine. In certain embodiments, N5is a cytosine nucleobase and N2is an abasic sugar moiety. In certain embodiments, N5is a cytosine nucleobase and N2is a terminal group. In certain embodiments, N5is a cytosine nucleobase and N2is absent. In certain embodiments, N5is a modified cytosine and N2is an unmodified adenine. In certain embodiments, N5is a modified cytosine and N2is a modified adenine. In 20 certain embodiments, N5is a modified cytosine and N2is a hypoxanthine. In certain embodiments, N5is a modified cytosine and N2is an abasic sugar moiety. In certain embodiments, N5is a modified cytosine and N2is a terminal group. In certain embodiments, N5is a modified cytosine and N2is absent. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, and N2is an unmodified adenine. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, and N2is a modified 25 adenine. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, and N2is a hypoxanthine. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, and N2is an abasic sugar moiety. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, and N2is a terminal group. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, and N2is absent. In certain embodiments, N5is a cytosine nucleobase, a modified cytosine, an abasic 30 sugar moiety, a terminal group, or is absent; N2is absent; and N3is an adenine nucleobase, an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N5is a cytosine nucleobase, N2is absent, and N3is an unmodified adenine. In certain embodiments, N5is a cytosine nucleobase, N2is absent, and N3is a modified adenine. In certain embodiments, N5is a cytosine nucleobase, N2is absent, and N3is a hypoxanthine. In certain embodiments, 35 N5is a cytosine nucleobase, N2is absent, and N3is an abasic sugar moiety. In certain embodiments, N5is a 107 BIOL0446WO cytosine nucleobase, N2is absent, and N3is a terminal group. In certain embodiments, N5is a cytosine nucleobase, N2is absent, and N3is absent. In certain embodiments, N5is a modified cytosine, N2is absent, and N3is an unmodified adenine. In certain embodiments, N5is a modified cytosine, N2is absent, and N3is a modified adenine. In certain embodiments, N5is a modified cytosine, N2is absent, and N3is a hypoxanthine. 5 In certain embodiments, N5is a modified cytosine, N2is absent, and N3is an abasic sugar moiety. In certain embodiments, N5is a modified cytosine, N2is absent, and N3is a terminal group. In certain embodiments, N5is a modified cytosine, N2is absent, and N3is absent. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is an unmodified adenine. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a modified adenine. In certain 10 embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a hypoxanthine. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is an abasic sugar moiety. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a terminal group. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is absent. In certain embodiments, N5is absent, N215 is absent, and N3is an unmodified adenine. In certain embodiments, N5is absent, N2is absent, and N3is a modified adenine. In certain embodiments, N5is absent, N2is absent, and N3is a hypoxanthine. In certain embodiments, N5is absent, N2is absent, and N3is an abasic sugar moiety. In certain embodiments, N5is absent, N2is absent, and N3is a terminal group. In certain embodiments, N5is absent, N2is absent, and N3is absent. In certain embodiments, N5is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a 20 terminal group, or is absent; N2is absent; N3is absent; and N4is an adenine nucleobase, an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is an unmodified adenine. In certain embodiments, N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is a modified adenine. In certain embodiments, N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is a hypoxanthine. In 25 certain embodiments, N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is an abasic sugar moiety. In certain embodiments, N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is a terminal group. In certain embodiments, N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is absent. In certain embodiments, N5is a modified cytosine, N2is absent, N3is absent, and N4is an unmodified adenine. In certain embodiments, N5is a modified cytosine, N2is absent, N3is absent, and N4is a modified adenine. In 30 certain embodiments, N5is a modified cytosine, N2is absent, N3is absent, and N4is a hypoxanthine. In certain embodiments, N5is a modified cytosine, N2is absent, N3is absent, and N4is an abasic sugar moiety. In certain embodiments, N5is a modified cytosine, N2is absent, N3is absent, and N4is a terminal group. In certain embodiments, N5is a modified cytosine, N2is absent, N3is absent, and N4is absent. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is 35 an unmodified adenine. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, 108 BIOL0446WO N2is absent, N3is absent, and N4is a modified adenine. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is a hypoxanthine. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is an abasic sugar moiety. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, 5 N2is absent, N3is absent, and N4is a terminal group. In certain embodiments, N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is absent. In certain embodiments, N5is absent, N2is absent, N3is absent, and N4is an unmodified adenine. In certain embodiments, N5is absent, N2is absent, N3is absent, and N4is a modified adenine. In certain embodiments, N5is absent, N2is absent, N3is absent, and N4is a hypoxanthine. In certain embodiments, N5is absent, N2is absent, N3is absent, and N4is 10 an abasic sugar moiety. In certain embodiments, N5is absent, N2is absent, N3is absent, and N4is a terminal group. In certain embodiments, N5is absent, N2is absent, N3is absent, and N4is absent. In certain embodiments, the oligomeric agent is single-stranded. In certain embodiments, the oligomeric agent is an antisense agent. In certain embodiments, the oligomeric agent is a single-stranded antisense agent. In certain embodiments, disclosed herein is an oligomeric agent according to the following chemical 15 notation: N1ksmCeoTeoTesGesGksTdsGdzAdzAdzTdsmCdsTdsTdsTdsAdzTksTksN3esN2e (SEQ ID NO: 51), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, 20 N1= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N1is absent its sugar and internucleoside linkage are also absent, N2= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N2is absent its sugar and internucleoside linkage are also absent, N3= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal 25 group, or is absent, wherein when N3is absent its sugar and internucleoside linkage are also absent, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, 30 o = a phosphodiester internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and wherein the oligomeric agent optionally comprises a conjugate group. In certain embodiments, N1is an adenine nucleobase. In certain embodiments, N1is an unmodified adenine. In certain embodiments, N1is a modified adenine. In certain embodiments, N1is a hypoxanthine. In certain embodiments, N1is an abasic 35 sugar moiety. In certain embodiments, N1is a terminal group. In certain embodiments, N1is absent. In certain 109 BIOL0446WO embodiments, N2is an adenine nucleobase. In certain embodiments, N2is an unmodified adenine. In certain embodiments, N2is a modified adenine. In certain embodiments, N2is a hypoxanthine. In certain embodiments, N2is an abasic sugar moiety. In certain embodiments, N2is a terminal group. In certain embodiments, N2is absent. In certain embodiments, N3is an adenine nucleobase. In certain embodiments, N35 is an unmodified adenine. In certain embodiments, N3is a modified adenine. In certain embodiments, N3is a hypoxanthine. In certain embodiments, N3is an abasic sugar moiety. In certain embodiments, N3is a terminal group. In certain embodiments, N3is absent. In certain embodiments, N1is an adenine nucleobase, an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N2is an adenine nucleobase, an unmodified adenine, a modified adenine, a hypoxanthine, an 10 abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1is an adenine nucleobase and N2is an adenine nucleobase, an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1is an adenine nucleobase and N2is an unmodified adenine. In certain embodiments, N1is an adenine nucleobase and N2is a modified adenine. In certain embodiments, N1is an adenine nucleobase and N2is a hypoxanthine. In certain embodiments, N1is an 15 adenine nucleobase and N2is an abasic sugar moiety. In certain embodiments, N1is an adenine nucleobase and N2is a terminal group. In certain embodiments, N1is an adenine nucleobase and N2is absent. In certain embodiments, N1is a modified adenine and N2is an unmodified adenine. In certain embodiments, N1is a modified adenine and N2is a modified adenine. In certain embodiments, N1is a modified adenine and N2is a hypoxanthine. In certain embodiments, N1is a modified adenine and N2is an abasic sugar moiety. In certain 20 embodiments, N1is a modified adenine and N2is a terminal group. In certain embodiments, N1is a modified adenine and N2is absent. In certain embodiments, N1is a hypoxanthine and N2is an unmodified adenine. In certain embodiments, N1is a hypoxanthine and N2is a modified adenine. In certain embodiments, N1is a hypoxanthine and N2is a hypoxanthine. In certain embodiments, N1is a hypoxanthine and N2is an abasic sugar moiety. In certain embodiments, N1is a hypoxanthine and N2is a terminal group. In certain 25 embodiments, N1is a hypoxanthine and N2is absent. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, and N2is an unmodified adenine. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, and N2is a modified adenine. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, and N2is a hypoxanthine. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, and N2is an abasic sugar moiety. In certain embodiments, 30 N1is an abasic sugar moiety, a terminal group, or is absent, and N2is a terminal group. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, and N2is absent. In certain embodiments, N1is an adenine nucleobase, an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent; N2is absent; and N3is an adenine nucleobase, an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is 35 absent. In certain embodiments, N1is an adenine nucleobase, N2is absent, and N3is an unmodified adenine. 110 BIOL0446WO In certain embodiments, N1is an adenine nucleobase, N2is absent, and N3is a modified adenine. In certain embodiments, N1is an adenine nucleobase, N2is absent, and N3is a hypoxanthine. In certain embodiments, N1is an adenine nucleobase, N2is absent, and N3is an abasic sugar moiety. In certain embodiments, N1is an adenine nucleobase, N2is absent, and N3is a terminal group. In certain embodiments, N1is an adenine 5 nucleobase, N2is absent, and N3is absent. In certain embodiments, N1is a modified adenine, N2is absent, and N3is an unmodified adenine. In certain embodiments, N1is a modified adenine, N2is absent, and N3is a modified adenine. In certain embodiments, N1is a modified adenine, N2is absent, and N3is a hypoxanthine. In certain embodiments, N1is a modified adenine, N2is absent, and N3is an abasic sugar moiety. In certain embodiments, N1is a modified adenine, N2is absent, and N3is a terminal group. In certain embodiments, N110 is a modified adenine, N2is absent, and N3is absent. In certain embodiments, N1is a hypoxanthine, N2is absent, and N3is an unmodified adenine. In certain embodiments, N1is a hypoxanthine, N2is absent, and N3is a modified adenine. In certain embodiments, N1is a hypoxanthine, N2is absent, and N3is a hypoxanthine. In certain embodiments, N1is a hypoxanthine, N2is absent, and N3is an abasic sugar moiety. In certain embodiments, N1is a hypoxanthine, N2is absent, and N3is a terminal group. In certain embodiments, N1is a 15 hypoxanthine, N2is absent, and N3is absent. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is an unmodified adenine. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a modified adenine. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a hypoxanthine. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, N2is 20 absent, and N3is an abasic sugar moiety. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a terminal group. In certain embodiments, N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is absent. In certain embodiments, N1is a terminal group, N2is absent, and N3is an unmodified adenine. In certain embodiments, N1is a terminal group, N2is absent, and N3is a modified adenine. In certain embodiments, N1is a terminal group, N2is absent, and N3is a 25 hypoxanthine. In certain embodiments, N1is a terminal group, N2is absent, and N3is an abasic sugar moiety. In certain embodiments, N1is a terminal group, N2is absent, and N3is a terminal group. In certain embodiments, N1is a terminal group, N2is absent, and N3is absent. In certain embodiments, N1is absent, N2is absent, and N3is an unmodified adenine. In certain embodiments, N1is absent, N2is absent, and N3is a modified adenine. In certain embodiments, N1is absent, N2is absent, and N3is a hypoxanthine. In certain 30 embodiments, N1is absent, N2is absent, and N3is an abasic sugar moiety. In certain embodiments, N1is absent, N2is absent, and N3is a terminal group. In certain embodiments, N1is absent, N2is absent, and N3is absent. In certain embodiments, the oligomeric agent is single-stranded. In certain embodiments, the oligomeric agent is an antisense agent. In certain embodiments, the oligomeric agent is a single-stranded antisense agent. 111 BIOL0446WO In certain embodiments, disclosed herein is an oligomeric agent comprising a modified oligonucleotide according to the following chemical structure: 1 and2 R are each 5 independently 1, 2, or 3 linked nucleosides, an abasic nucleoside, a terminal group, or an H; and wherein the oligomeric agent optionally comprises a conjugate group. In certain embodiments, R1is one nucleoside. In certain embodiments, R1is 2 linked nucleosides. In certain embodiments, R1is 3 linked nucleosides. In certain embodiments, R2is one nucleoside. In certain embodiments, R2is 2 linked nucleosides. In certain embodiments, R2is 3 linked nucleosides. In certain embodiments, R1is one nucleoside and R2is 2 linked 10 nucleosides. In certain embodiments, R1is one nucleoside and R2is 3 linked nucleosides. In certain embodiments, R1is an adenosine, a modified adenosine, an unmodified adenosine, or an inosine; and R2is 2 or 3 linked nucleosides. In certain embodiments, R1is an adenosine and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. In certain embodiments, R1is an adenosine and R2comprises two or more adenosines, two or more modified adenosines, two or more unmodified 112 BIOL0446WO adenosines, or two or more inosines. In certain embodiments, R1is an adenosine and R2is an abasic nucleoside, a terminal group, or an H. In certain embodiments, R1is a modified adenosine and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. In certain embodiments, R1is a modified adenosine and R2comprises two or more adenosines, two or more modified adenosines, two or 5 more unmodified adenosines, or two or more inosines. In certain embodiments, R1is a modified adenosine and R2is an abasic nucleoside, a terminal group, or an H. In certain embodiments, R1is an unmodified adenosine and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. In certain embodiments, R1is an unmodified adenosine and R2comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines. In certain embodiments, 10 R1is an unmodified adenosine and R2is an abasic nucleoside, a terminal group, or an H. In certain embodiments, R1is an inosine and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. In certain embodiments, R1is an inosine and R2comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines. In certain embodiments, R1is an inosine and R2is an abasic nucleoside, a terminal group, or an H. In certain 15 embodiments, R1is an abasic nucleoside, a terminal group, or an H; and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. In certain embodiments, R1is an abasic nucleoside, a terminal group, or an H; and R2comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosine...
Claims
BIOL0446WO WHAT IS CLAIMED:
1. An oligomeric agent comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an APOE nucleic acid, and wherein at least one internucleoside linkage of the modified oligonucleotide is a mesyl phosphoramidate internucleoside linkage.
2. An oligomeric agent comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 22-40, wherein at least one internucleoside linkage of the modified oligonucleotide is a mesyl phosphoramidate internucleoside linkage.
3. The oligomeric agent of claim 1 or claim 2, wherein the modified oligonucleotide has a nucleobase sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of any one of SEQ ID NOs: 1-5 when measured across the entire nucleobase sequence of the modified oligonucleotide.
4. The oligomeric agent of any of claims 1-3, wherein the modified oligonucleotide consists of 12 to 20, 12 to 21, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 21, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 21, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 21, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 21, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 21, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 21, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 21, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, or 21 to 50 linked nucleosides.
5. The oligomeric agent of any of claims 1-4, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 22-37.
6. The oligomeric agent of any of claims 1-4, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of the nucleobase sequence of SEQ ID NO:
23.
7. The oligomeric agent of any of claims 1-6, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.
8. The oligomeric agent of claim 7, wherein the modified nucleoside comprises a modified sugar moiety.
9. The oligomeric agent of claim 8, wherein the modified sugar moiety comprises a bicyclic sugar moiety. 181BIOL0446WO 10. The oligomeric agent of claim 9, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from -O-CH2-; and -O-CH(CH3)-.
11. The oligomeric agent of claim 7, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.
12. The oligomeric agent of claim 11, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety, a 2’-OMe sugar moiety, or a 2’-β-D-deoxyxylosyl sugar moiety.
13. The oligomeric agent of claim 7, wherein the modified nucleoside comprises a sugar surrogate.
14. The oligomeric agent of claim 13, wherein the sugar surrogate is any of morpholino, modified morpholino, glycol nucleic acid (GNA), six-membered tetrahydropyran (THP), and F-hexitol nucleic acid (FHNA).
15. The oligomeric agent of any of claims 1-14, wherein the modified oligonucleotide is a gapmer.
16. The oligomeric agent of any of claims 1-15, wherein the modified oligonucleotide comprises: a 5’-region consisting of 1-6 linked 5’-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3’-region consisting of 1-6 linked 3’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety.
17. The oligomeric agent of any of claims 1-16, wherein the modified oligonucleotide comprises: a 5’-region consisting of 6 linked 5’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3’-region consisting of 4 linked 3’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety.
18. The oligomeric agent of any of claims 1-16, wherein the modified oligonucleotide comprises: a 5’-region consisting of 4 linked 5’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3’-region consisting of 6 linked 3’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety.
19. The oligomeric agent of any of claims 16-18, wherein the modified sugar moiety is a 2’-MOE sugar moiety or a cEt sugar moiety.
20. The oligomeric agent of any of claims 16-19, wherein the modified oligonucleotide comprises: a 5’-region consisting of 6 linked 5’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3’-region consisting of 4 linked 3’-region nucleosides; 182BIOL0446WO wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety selected from the group consisting of a 2’-MOE sugar moiety and a cEt sugar moiety, and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety.
21. The oligomeric agent of any of claims 16-19, wherein the modified oligonucleotide comprises: a 5’-region consisting of 4 linked 5’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3’-region consisting of 6 linked 3’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety selected from the group consisting of a 2’-MOE sugar moiety and a cEt sugar moiety, and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety.
22. An oligomeric agent comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the modified oligonucleotide comprises: a 5’-region consisting of 1-6 linked 5’-region nucleosides; a central region consisting of 10-13 linked central region nucleosides; and a 3’-region consisting of 1-5 linked 3’-region nucleosides; wherein: each nucleoside in the 5’-region nucleosides comprises either a modified sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; each nucleoside in the 3’-region nucleosides comprises either a modified sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; at least one nucleoside in either the 5’-region or the 3’-region is a 2’-β-D-deoxyribosyl sugar moiety; and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety; and wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an APOE nucleic acid.
23. The oligomeric agent of claim 22, wherein the modified sugar moiety comprises a bicyclic sugar moiety.
24. The oligomeric agent of claim 23, wherein the bicyclic sugar moiety is a cEt sugar moiety.
25. The oligomeric agent of claim 22, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.
26. The oligomeric agent of claim 25, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety, a 2’-OMe sugar moiety, or a 2’-β-D-deoxyxylosyl sugar moiety.
27. The oligomeric agent of claim 22, wherein the modified sugar moiety comprises a sugar surrogate. 183BIOL0446WO 28. The oligomeric agent of claim 27, wherein the sugar surrogate is any of morpholino, modified morpholino, glycol nucleic acid (GNA), six-membered tetrahydropyran (THP), and F-hexitol nucleic acid (FHNA).
29. The oligomeric agent of any of claims 22-28, wherein the modified oligonucleotide comprises: a 5’-region consisting of 3-6 linked 5’-region nucleosides; a central region consisting of 10-13 linked central region nucleosides; and a 3’-region consisting of 3-5 linked 3’-region nucleosides; wherein: each nucleoside in the 5’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; each nucleoside in the 3’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; at least one nucleoside in either the 5’-region or the 3’-region is a 2’-β-D-deoxyribosyl sugar moiety; and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety and wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an APOE nucleic acid.
30. The oligomeric agent of any of claims 22-29, wherein the modified oligonucleotide comprises: a 5’-region consisting of 3-6 linked 5’-region nucleosides; a central region consisting of 10-13 linked central region nucleosides; and a 3’-region consisting of 4 linked 3’-region nucleosides; wherein: each nucleoside in the 5’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; each nucleoside in the 3’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; at least one nucleoside in either the 5’-region or the 3’-region is a 2’-β-D-deoxyribosyl sugar moiety; and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety and wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an APOE nucleic acid.
31. The oligomeric agent of any of claims 22-29, wherein the modified oligonucleotide comprises: a 5’-region consisting of 5-6 linked 5’-region nucleosides; a central region consisting of 11-13 linked central region nucleosides; and a 3’-region consisting of 3 linked 3’-region nucleosides; 184BIOL0446WO wherein: each nucleoside in the 5’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; each nucleoside in the 3’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; at least one nucleoside in either the 5’-region or the 3’-region is a 2’-β-D-deoxyribosyl sugar moiety; and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety and wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an APOE nucleic acid.
32. The oligomeric agent of any of claims 22-30, wherein the modified oligonucleotide comprises: a 5’-region consisting of 3 linked 5’-region nucleosides; a central region consisting of 13 linked central region nucleosides; and a 3’-region consisting of 4 linked 3’-region nucleosides; wherein: each nucleoside in the 5’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; each nucleoside in the 3’-region nucleosides comprises either a cEt sugar moiety or a 2’-β-D- deoxyribosyl sugar moiety; at least one nucleoside in either the 5’-region or the 3’-region is a 2’-β-D-deoxyribosyl sugar moiety; and each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety and wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an APOE nucleic acid.
33. The oligomeric agent of any of claims 22-32, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of an APOE nucleic acid.
34. The oligomeric agent of any of claims 22-33, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of any one of SEQ ID NOs: 1-5 when measured across the entire nucleobase sequence of the modified oligonucleotide.
35. The oligomeric agent of any of claims 1-34, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.
36. The oligomeric agent of any of claims 1-35, wherein the modified oligonucleotide comprises at least one phosphorothioate internucleoside linkage. 185BIOL0446WO 37. The oligomeric agent of claim 35 or claim 36, wherein the modified oligonucleotide comprises at least one mesyl phosphoramidate internucleoside linkage and each remaining internucleoside linkage is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage.
38. The oligomeric agent of claim 35 or claim 36, wherein the modified oligonucleotide comprises at least one mesyl phosphoramidate internucleoside linkage and each remaining internucleoside linkage is independently selected from a phosphorothioate internucleoside linkage and a mesyl phosphoramidate internucleoside linkage.
39. The oligomeric agent of any of claims 35-38, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or 19 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.
40. The oligomeric agent of any of claims 35-39, wherein at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 internucleoside linkages of the modified oligonucleotide are mesyl phosphoramidate internucleoside linkages.
41. The oligomeric agent of any of claims 35-40, wherein the modified oligonucleotide has an internucleoside linkage motif selected from soossssssssssooss, sosssszzzssssszoss, ssoooszzsssssszsooss, ssoooszzzssssszsooss, ssoosszzzssssszsooss, zsoooszzsssssszsoosz, zsossszzzssssszsoosz, soooosszzsssssszoss, sooosssssssssssooss, sooossszzsssssszoss, sooossszzsssssszsss, soooszzzsssssssssss, soooszzzsssszssooss, soooszzzsssszzsooss, soosssszzzssssszsss, soossszzsssssssssss, soossszzzssssszssss, soosszzzssssszsooss, soosszzzssssszsssss, sosssszzzssssszssss, sossszzzzssssszssss, soszsszzzssssszssss, ssoooszzssssssssoos, ssssoszzzssssszssss, sssssozzzssssszssss, ssszzszzzssssszsszz, ssszzzssssszzsssssz, ssszzzssssszzzssssz, ssszzzssszzsssssssz, ssszzzsszzssssssssz, ssszzzszzssssszsssz, ssszzzzzssssssssssz, ssszzzzzzsssssssssz, ssszzzzzzsssssszssz, ssszzzzzzssssszsssz, ssszzzzzzssssszsszs, ssszzzzzzssssszszss, ssszzzzzzzssssssssz, sszszszzzssssszsszz, sszszzzzzssssszsssz, sszszzzzzssssszsszs, sszszzzzzssssszszss, sszzszzzzssssszsssz, sszzszzzzssssszsszs, sszzszzzzssssszszss, sszzzszzzssssszsssz, sszzzszzzssssszsszs, sszzzszzzssssszszss, szsszszzzssssszsszz, szszsszzzssssszszsz, szszszzzzssssszsssz, szszszzzzssssszsszs, szszszzzzssssszszss, szszzszzzssssszsssz, szszzszzzssssszsszs, szszzszzzssssszszss, szzssszzzssssszsszz, szzsszzzzssssszsssz, szzsszzzzssssszsszs, szzsszzzzssssszszss, szzszsszzssssszsssz, szzszszzssssssssssz, szzszszzzsssssszssz, szzszszzzssssszsssz, szzszszzzssssszsszs, szzszszzzssssszszss, szzszszzzzssssssssz, szzzsszzzssssszsssz, szzzsszzzssssszsszs, szzzsszzzssssszszss, zoosszzzssssszsssss, zossszzzssssszsssss, or zossszzzssssszssssz, wherein each “s” represents a phosphorothioate internucleoside linkage, each “o” represents a phosphodiester internucleoside linkage, and each “z” represents a mesyl phosphoramidate internucleoside linkage. 186BIOL0446WO 42. The oligomeric agent of any of claims 35-40, wherein the modified oligonucleotide has an internucleoside linkage motif selected from soooosszzsssssszoss, sooosssssssssssooss, sooossszzsssssszoss, sooossszzsssssszsss, soooszzzsssssssssss, soooszzzsssszssooss, soooszzzsssszzsooss, soosssszzzssssszsss, soossszzsssssssssss, soossszzzssssszssss, soosszzzssssszsooss, soosszzzssssszsssss, sosssszzzssssszssss, sossszzzzssssszssss, soszsszzzssssszssss, ssoooszzssssssssoos, ssssoszzzssssszssss, sssssozzzssssszssss, ssszzszzzssssszsszz, ssszzzssssszzsssssz, ssszzzssssszzzssssz, ssszzzssszzsssssssz, ssszzzsszzssssssssz, ssszzzszzssssszsssz, ssszzzzzssssssssssz, ssszzzzzzsssssssssz, ssszzzzzzsssssszssz, ssszzzzzzssssszsssz, ssszzzzzzssssszsszs, ssszzzzzzssssszszss, ssszzzzzzzssssssssz, sszszszzzssssszsszz, sszszzzzzssssszsssz, sszszzzzzssssszsszs, sszszzzzzssssszszss, sszzszzzzssssszsssz, sszzszzzzssssszsszs, sszzszzzzssssszszss, sszzzszzzssssszsssz, sszzzszzzssssszsszs, sszzzszzzssssszszss, szsszszzzssssszsszz, szszsszzzssssszszsz, szszszzzzssssszsssz, szszszzzzssssszsszs, szszszzzzssssszszss, szszzszzzssssszsssz, szszzszzzssssszsszs, szszzszzzssssszszss, szzssszzzssssszsszz, szzsszzzzssssszsssz, szzsszzzzssssszsszs, szzsszzzzssssszszss, szzszsszzssssszsssz, szzszszzssssssssssz, szzszszzzsssssszssz, szzszszzzssssszsssz, szzszszzzssssszsszs, szzszszzzssssszszss, szzszszzzzssssssssz, szzzsszzzssssszsssz, szzzsszzzssssszsszs, szzzsszzzssssszszss, zoosszzzssssszsssss, zossszzzssssszsssss, or zossszzzssssszssssz, wherein each “s” represents a phosphorothioate internucleoside linkage, each “o” represents a phosphodiester internucleoside linkage, and each “z” represents a mesyl phosphoramidate internucleoside linkage.
43. The oligomeric agent of any of claims 1-42, wherein at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.
44. The oligomeric agent of claim 43, wherein the modified nucleobase is a 5-methylcytosine.
45. The oligomeric agent of claim 44, wherein each cytosine is a 5-methylcytosine.
46. The oligomeric agent of any of claims 1-45, wherein each nucleoside of the modified oligonucleotide is unmodified adenine, unmodified guanine, unmodified thymine, unmodified cytosine, or 5-methylcytosine.
47. The oligomeric agent of any of claims 1-46, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-21, 12-20,14-18, 14-20, 14-21, 15-17, 15-21, 15-25, 16-20, 16-21, 18-22, 18-21, or 18-20 linked nucleosides.
48. The oligomeric agent of any of claims 1-47, wherein the modified oligonucleotide consists of 18 linked nucleosides.
49. The oligomeric agent of any of claims 1-47, wherein the modified oligonucleotide consists of 19 linked nucleosides.
50. The oligomeric agent of any of claims 1-47, wherein the modified oligonucleotide consists of 20 linked nucleosides.
51. The oligomeric agent of any of claims 1-47, wherein the modified oligonucleotide consists of 21 linked nucleosides. 187BIOL0446WO 52. The oligomeric agent of any of claims 1-51, wherein the oligomeric agent consists of the modified oligonucleotide.
53. The oligomeric agent of any of claims 1-51, wherein the oligomeric agent comprises a conjugate group.
54. The oligomeric agent of claim 53, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.
55. The oligomeric agent of claim 54, wherein the conjugate linker is a phosphodiester linker.
56. The oligomeric agent of claim 54, wherein the conjugate linker consists of a single bond.
57. The oligomeric agent of any of claims 54-56, wherein the conjugate linker is cleavable.
58. The oligomeric agent of any of claims 54, 55, or 57, wherein the conjugate linker is attached to one or more nucleosides that are attached to the remainder of the modified oligonucleotide through at least one phosphodiester bond.
59. The oligomeric agent of any of claims 53-58, wherein the conjugate group is attached to the modified oligonucleotide at the 5’-end of the modified oligonucleotide.
60. The oligomeric agent of any of claims 53-58, wherein the conjugate group is attached to the modified oligonucleotide at the 3’-end of the modified oligonucleotide.
61. The oligomeric agent of any of claims 1-60, wherein the modified oligonucleotide comprises a terminal group.
62. The oligomeric agent of claim 61, wherein the terminal group is an abasic sugar moiety.
63. The oligomeric agent of any of claims 1-62, wherein the oligomeric agent is an antisense agent.
64. The oligomeric agent of any of claims 1-63, wherein the oligomeric agent is a single-stranded antisense agent.
65. The oligomeric agent of any of claims 1-64, wherein the oligomeric agent is an RNase H agent.
66. The oligomeric agent of any of claims 1-51 or 53-63, wherein the oligomeric agent is an RNAi agent.
67. The oligomeric agent of any of claims 1-51, 53-63, or 66, comprising a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the modified oligonucleotide.
68. The oligomeric agent of claim 67, wherein the modified oligonucleotide comprises a 5’-stabilized phosphate group.
69. The oligomeric agent of claim 68, wherein the stabilized phosphate group comprises a cyclopropyl phosphonate or a vinyl phosphonate.
70. The oligomeric agent of any of claims 67-69, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety. 188BIOL0446WO 71. The oligomeric agent of claim 70, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.
72. The oligomeric agent of claim 71, wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2’-4’ bridge selected from –O-CH2-; and –O-CH(CH3)-.
73. The oligomeric agent of claim 70, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.
74. The oligomeric agent of claim 73, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2’-MOE sugar moiety, a 2’-F modified sugar moiety, or 2’-OMe modified sugar moiety.
75. The oligomeric agent of any of claims 67-74, wherein at least one internucleoside linkage of the second modified oligonucleotide is a modified internucleoside linkage.
76. The oligomeric agent of claim 75, wherein at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage.
77. The oligomeric agent of any of claims 75-76, wherein at least one internucleoside linkage of the second modified oligonucleotide is a phosphodiester internucleoside linkage.
78. The oligomeric agent of any of claims 75-77, wherein at least one internucleoside linkage of the second modified oligonucleotide is a mesyl phosphoramidate internucleoside linkage.
79. The oligomeric agent of any of claims 75-78, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, or a mesyl phosphoramidate internucleoside linkage.
80. The oligomeric agent of any of claims 67-79, wherein the second modified oligonucleotide comprises at least one modified nucleobase.
81. The oligomeric agent of claim 80, wherein the at least one modified nucleobase of the second modified oligonucleotide is 5-methylcytosine.
82. The oligomeric agent of any of claims 67-81, wherein the second modified oligonucleotide comprises a conjugate group.
83. The oligomeric agent of claim 82, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.
84. The oligomeric agent of claim 83, wherein the conjugate linker consists of a single bond.
85. The oligomeric agent of claim 83 or claim 84, wherein the conjugate linker is cleavable.
86. The oligomeric agent of claim 83 or claim 85, wherein the conjugate linker is attached to one or more nucleosides that are attached to the remainder of the modified oligonucleotide through at least one phosphodiester bond.
87. The oligomeric agent of any of claims 83-86, wherein the conjugate linker is a phosphodiester linker. 189BIOL0446WO 88. The oligomeric agent of any of claims 82-87, wherein the conjugate group is attached to the 5’-end of the second modified oligonucleotide.
89. The oligomeric agent of any of claims 82-87, wherein the conjugate group is attached to the 3’-end of the second modified oligonucleotide.
90. The oligomeric agent of any of claims 82-87, wherein the conjugate group is attached via the 2’ position of a ribosyl sugar moiety at an internal position of the second modified oligonucleotide.
91. The oligomeric agent of any of claims 82-90, wherein the conjugate group comprises a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
92. The oligomeric agent of any of claims 82-91, wherein the conjugate group comprises a cell-targeting moiety.
93. The oligomeric agent of any of claims 67-92, wherein the second modified oligonucleotide comprises a terminal group.
94. The oligomeric agent of claim 93, wherein the terminal group is an abasic sugar moiety.
95. An oligomeric agent comprising a modified oligonucleotide according to the following chemical notation: AesmCeoTeoTesGesGksTdsGdzAdzAdzTdsmCdsTdsTdsTdsAdzTksTksAesAe(SEQ ID NO: 45), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and the oligomeric agent does not include a conjugate group or a terminal group.
96. An oligomeric agent comprising a modified oligonucleotide according to the following chemical notation:mCksTksTksGdzGdzTdzGdzAdzAdzTdsmCdsTdsTdsTdsAdsTdsTksAksAdzAk(SEQ ID NO: 46), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, 190BIOL0446WO k = a cEt sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and the oligomeric agent does not include a conjugate group or a terminal group.
97. An oligomeric agent comprising a modified oligonucleotide according to the following chemical notation: AksmCeoTeoTesGesGksTdsGdzAdzAdzTdsmCdsTdsTdsTdsAdzTksTksAesAe(SEQ ID NO: 47), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and the oligomeric agent does not include a conjugate group or a terminal group.
98. An oligomeric agent comprising a modified oligonucleotide according to the following chemical notation: TezTeoGeoGksTdsGdzAdzAdzTdsmCdsTdsTdsTdsAdzTksTksAesAesAesmCe(SEQ ID NO: 48), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and the oligomeric agent does not include a conjugate group or a terminal group.
99. The oligomeric agent of any of claims 95-98, wherein the modified oligonucleotide is a pharmaceutically acceptable salt.
100. The oligomeric agent of claim 99, wherein the pharmaceutically acceptable salt comprises one or more cations selected from sodium, potassium, calcium, and magnesium. 191BIOL0446WO 101. An oligomeric agent according to the following chemical notation: N1esmCeoTeoTesGesGksTdsGdzAdzAdzTdsmCdsTdsTdsTdsAdzTksTksN3esN2e (SEQ ID NO: 49), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, N1= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N1is absent its sugar and internucleoside linkage are also absent, N2= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N2is absent its sugar and internucleoside linkage are also absent, N3= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N3is absent its sugar and internucleoside linkage are also absent, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and wherein the oligomeric agent optionally comprises a conjugate group.
102. An oligomeric agent according to the following chemical notation: N5ksTksTksGdzGdzTdzGdzAdzAdzTdsmCdsTdsTdsTdsAdsTdsTksN4ksN3dzN2k (SEQ ID NO: 50), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, N2= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N2is absent its sugar and internucleoside linkage are also absent, N3= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N3is absent its sugar and internucleoside linkage are also absent, N4= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N4is absent its sugar and internucleoside linkage are also absent, N5= a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, wherein when N5is absent its sugar is also absent, k = a cEt sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety, 192BIOL0446WO s = a phosphorothioate internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and wherein the oligomeric agent optionally comprises a conjugate group.
103. An oligomeric agent according to the following chemical notation: N1ksmCeoTeoTesGesGksTdsGdzAdzAdzTdsmCdsTdsTdsTdsAdzTksTksN3esN2e (SEQ ID NO: 51), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, N1= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N1is absent its sugar and internucleoside linkage are also absent, N2= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N2is absent its sugar and internucleoside linkage are also absent, N3= an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N3is absent its sugar and internucleoside linkage are also absent, e = a 2’-MOE sugar moiety, k = a cEt sugar moiety, d = a 2’-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and z = a mesyl phosphoramidate internucleoside linkage; and wherein the oligomeric agent optionally comprises a conjugate group.
104. The oligomeric agent of claim 101 or claim 103, wherein N1is an adenine nucleobase.
105. The oligomeric agent of claim 101 or claim 103, wherein N1is an unmodified adenine.
106. The oligomeric agent of claim 101 or claim 103, wherein N1is a modified adenine.
107. The oligomeric agent of claim 101 or claim 103, wherein N1is a hypoxanthine.
108. The oligomeric agent of claim 101 or claim 103, wherein N1is an abasic sugar moiety.
109. The oligomeric agent of claim 101 or claim 103, wherein N1is a terminal group.
110. The oligomeric agent of claim 101 or claim 103, wherein N1is absent.
111. The oligomeric agent of any of claims 101-110, wherein N2is an adenine nucleobase.
112. The oligomeric agent of any of claims 101-110, wherein N2is an unmodified adenine.
113. The oligomeric agent of any of claims 101-110, wherein N2is a modified adenine.
114. The oligomeric agent of any of claims 101-110, wherein N2is a hypoxanthine.
115. The oligomeric agent of any of claims 101-110, wherein N2is an abasic sugar moiety.
116. The oligomeric agent of any of claims 101-110, wherein N2is a terminal group. 193BIOL0446WO 117. The oligomeric agent of any of claims 101-110, wherein N2is absent.
118. The oligomeric agent of any of claims 101-117, wherein N3is an adenine nucleobase.
119. The oligomeric agent of any of claims 101-117, wherein N3is an unmodified adenine.
120. The oligomeric agent of any of claims 101-117, wherein N3is a modified adenine.
121. The oligomeric agent of any of claims 101-117, wherein N3is a hypoxanthine.
122. The oligomeric agent of any of claims 101-117, wherein N3is an abasic sugar moiety.
123. The oligomeric agent of any of claims 101-117, wherein N3is a terminal group.
124. The oligomeric agent of any of claims 101-117, wherein N3is absent.
125. The oligomeric agent of any of claims 102 or 111-124, wherein N4is an adenine nucleobase.
126. The oligomeric agent of any of claims 102 or 111-124, wherein N4is an unmodified adenine.
127. The oligomeric agent of any of claims 102 or 111-124, wherein N4is a modified adenine.
128. The oligomeric agent of any of claims 102 or 111-124, wherein N4is a hypoxanthine.
129. The oligomeric agent of any of claims 102 or 111-124, wherein N4is an abasic sugar moiety.
130. The oligomeric agent of any of claims 102 or 111-124, wherein N4is a terminal group.
131. The oligomeric agent of any of claims 102 or 111-124, wherein N4is absent.
132. The oligomeric agent of any of claims 102 or 111-131, wherein N5is a modified cytosine.
133. The oligomeric agent of any of claims 102 or 111-131, wherein N5is 5-methylcytosine.
134. The oligomeric agent of any of claims 102 or 111-131, wherein N5is an unmodified cytosine.
135. The oligomeric agent of any of claims 102 or 111-131, wherein N5is an abasic sugar moiety.
136. The oligomeric agent of any of claims 102 or 111-131, wherein N5is a terminal group.
137. The oligomeric agent of any of claims 102 or 111-131, wherein N5is absent.
138. The oligomeric agent of any of claims 101 or 103-117, wherein N1is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, and N2is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.
139. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is an adenine nucleobase and N2is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.
140. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is an adenine nucleobase and N2is an unmodified adenine.
141. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is an adenine nucleobase and N2is a modified adenine.
142. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is an adenine nucleobase and N2is a hypoxanthine. 194BIOL0446WO 143. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is an adenine nucleobase and N2is an abasic sugar moiety.
144. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is an adenine nucleobase and N2is a terminal group.
145. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is an adenine nucleobase and N2is absent.
146. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is a modified adenine and N2is an unmodified adenine.
147. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is a modified adenine and N2is a modified adenine.
148. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is a modified adenine and N2is a hypoxanthine.
149. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is a modified adenine and N2is an abasic sugar moiety.
150. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is a modified adenine and N2is a terminal group.
151. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is a modified adenine and N2is absent.
152. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is a hypoxanthine and N2is an unmodified adenine.
153. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is a hypoxanthine and N2is a modified adenine.
154. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is a hypoxanthine and N2is a hypoxanthine.
155. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is a hypoxanthine and N2is an abasic sugar moiety.
156. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is a hypoxanthine and N2is a terminal group.
157. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is a hypoxanthine and N2is absent.
158. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is an abasic sugar moiety, a terminal group, or is absent, and N2is an unmodified adenine.
159. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is an abasic sugar moiety, a terminal group, or is absent, and N2is a modified adenine. 195BIOL0446WO 160. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is an abasic sugar moiety, a terminal group, or is absent, and N2is a hypoxanthine.
161. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is an abasic sugar moiety, a terminal group, or is absent, and N2is an abasic sugar moiety.
162. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is an abasic sugar moiety, a terminal group, or is absent, and N2is a terminal group.
163. The oligomeric agent of any of claims 101, 103-117, or 138, wherein N1is an abasic sugar moiety, a terminal group, or is absent, and N2is absent.
164. The oligomeric agent of any of claims 101, 103-110, or 117-124, wherein: a) N1is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent; b) N2is absent; and c) N3is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.
165. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is an adenine nucleobase, N2is absent, and N3is an unmodified adenine.
166. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is an adenine nucleobase, N2is absent, and N3is a modified adenine.
167. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is an adenine nucleobase, N2is absent, and N3is a hypoxanthine.
168. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is an adenine nucleobase, N2is absent, and N3is an abasic sugar moiety.
169. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is an adenine nucleobase, N2is absent, and N3is a terminal group.
170. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is an adenine nucleobase, N2is absent, and N3is absent.
171. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is a modified adenine, N2is absent, and N3is an unmodified adenine.
172. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is a modified adenine, N2is absent, and N3is a modified adenine.
173. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is a modified adenine, N2is absent, and N3is a hypoxanthine.
174. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is a modified adenine, N2is absent, and N3is an abasic sugar moiety. 196BIOL0446WO 175. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is a modified adenine, N2is absent, and N3is a terminal group.
176. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is a modified adenine, N2is absent, and N3is absent.
177. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is a hypoxanthine, N2is absent, and N3is an unmodified adenine.
178. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is a hypoxanthine, N2is absent, and N3is a modified adenine.
179. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is a hypoxanthine, N2is absent, and N3is a hypoxanthine.
180. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is a hypoxanthine, N2is absent, and N3is an abasic sugar moiety.
181. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is a hypoxanthine, N2is absent, and N3is a terminal group.
182. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is a hypoxanthine, N2is absent, and N3is absent.
183. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is an unmodified adenine.
184. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a modified adenine.
185. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a hypoxanthine.
186. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is an abasic sugar moiety.
187. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a terminal group.
188. The oligomeric agent of any of claims 101, 103-110, 117-124, or 164, wherein N1is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is absent.
189. The oligomeric agent of any of claims 102, 111-117, or 132-137, wherein N5is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, and N2is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.
190. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is a cytosine nucleobase and N2is an unmodified adenine. 197BIOL0446WO 191. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is a cytosine nucleobase and N2is a modified adenine.
192. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is a cytosine nucleobase and N2is a hypoxanthine.
193. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is a cytosine nucleobase and N2is an abasic sugar moiety.
194. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is a cytosine nucleobase and N2is a terminal group.
195. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is a cytosine nucleobase and N2is absent.
196. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is a modified cytosine and N2is an unmodified adenine.
197. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is a modified cytosine and N2is a modified adenine.
198. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is a modified cytosine and N2is a hypoxanthine.
199. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is a modified cytosine and N2is an abasic sugar moiety.
200. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is a modified cytosine and N2is a terminal group.
201. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is a modified cytosine and N2is absent.
202. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is an abasic sugar moiety, a terminal group, or is absent, and N2is an unmodified adenine.
203. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is an abasic sugar moiety, a terminal group, or is absent, and N2is a modified adenine.
204. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is an abasic sugar moiety, a terminal group, or is absent, and N2is a hypoxanthine.
205. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is an abasic sugar moiety, a terminal group, or is absent, and N2is an abasic sugar moiety.
206. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is an abasic sugar moiety, a terminal group, or is absent, and N2is a terminal group.
207. The oligomeric agent of any of claims 102, 111-117, 132-137, or 189, wherein N5is an abasic sugar moiety, a terminal group, or is absent, and N2is absent.
208. The oligomeric agent of any of claims 102, 117-124, or 132-137, wherein: 198BIOL0446WO a) N5is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent; b) N2is absent; and c) N3is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.
209. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is a cytosine nucleobase, N2is absent, and N3is an unmodified adenine.
210. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is a cytosine nucleobase, N2is absent, and N3is a modified adenine.
211. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is a cytosine nucleobase, N2is absent, and N3is a hypoxanthine.
212. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is a cytosine nucleobase, N2is absent, and N3is an abasic sugar moiety.
213. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is a cytosine nucleobase, N2is absent, and N3is a terminal group.
214. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is a cytosine nucleobase, N2is absent, and N3is absent.
215. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is a modified cytosine, N2is absent, and N3is an unmodified adenine.
216. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is a modified cytosine, N2is absent, and N3is a modified adenine.
217. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is a modified cytosine, N2is absent, and N3is a hypoxanthine.
218. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is a modified cytosine, N2is absent, and N3is an abasic sugar moiety.
219. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is a modified cytosine, N2is absent, and N3is a terminal group.
220. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is a modified cytosine, N2is absent, and N3is absent.
221. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is an unmodified adenine.
222. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a modified adenine.
223. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a hypoxanthine. 199BIOL0446WO 224. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is an abasic sugar moiety.
225. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is a terminal group.
226. The oligomeric agent of any of claims 102, 117-124, 132-137, or 208, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, and N3is absent.
227. The oligomeric agent of any of claims 102, 117, or 124-137, wherein: a) N5is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent; b) N2is absent; c) N3is absent; and d) N4is an unmodified adenine, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.
228. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is an unmodified adenine.
229. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is a modified adenine.
230. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is a hypoxanthine.
231. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is an abasic sugar moiety.
232. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is a terminal group.
233. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is a cytosine nucleobase, N2is absent, N3is absent, and N4is absent.
234. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is a modified cytosine, N2is absent, N3is absent, and N4is an unmodified adenine.
235. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is a modified cytosine, N2is absent, N3is absent, and N4is a modified adenine.
236. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is a modified cytosine, N2is absent, N3is absent, and N4is a hypoxanthine.
237. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is a modified cytosine, N2is absent, N3is absent, and N4is an abasic sugar moiety.
238. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is a modified cytosine, N2is absent, N3is absent, and N4is a terminal group. 200BIOL0446WO 239. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is a modified cytosine, N2is absent, N3is absent, and N4is absent.
240. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is an unmodified adenine.
241. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is a modified adenine.
242. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is a hypoxanthine.
243. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is an abasic sugar moiety.
244. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is a terminal group.
245. The oligomeric agent of any of claims 102, 117, 124-137, or 227, wherein N5is an abasic sugar moiety, a terminal group, or is absent, N2is absent, N3is absent, and N4is absent. 201BIOL0446WO 246. An oligomeric agent comprising a modified oligonucleotide according to the following chemical structure:wherein R1and R2are each independently 1, 2, or 3 linked nucleosides, an abasic nucleoside, a terminal group, or an H; and wherein the oligomeric agent optionally comprises a conjugate group. 202BIOL0446WO 247. An oligomeric agent comprising a modified oligonucleotide according to the following chemical structure:wherein R3and R4are each independently 1, 2, or 3 linked nucleosides, an abasic nucleoside, a terminal group, or an H; and wherein the oligomeric agent optionally comprises a conjugate group.
248. The oligomeric agent of claim 246, wherein R1is one nucleoside.
249. The oligomeric agent of claim 246, wherein R1is 2 linked nucleosides.
250. The oligomeric agent of claim 246, wherein R1is 3 linked nucleosides.
251. The oligomeric agent of any of claims 246 or 248-250, wherein R2is one nucleoside.
252. The oligomeric agent of any of claims 246 or 248-250, wherein R2is 2 linked nucleosides.
253. The oligomeric agent of any of claims 246 or 248-250, wherein R2is 3 linked nucleosides. 203BIOL0446WO 254. The oligomeric agent of any of claims 246, 248, or 252, wherein R1is one nucleoside and R2is 2 linked nucleosides.
255. The oligomeric agent of any of claims 246, 248, or 253, wherein R1is one nucleoside and R2is 3 linked nucleosides.
256. The oligomeric agent of any of claims 246, 248, or 252-255, wherein R1is an adenosine, a modified adenosine, an unmodified adenosine, or an inosine; and R2is 2 or 3 linked nucleosides.
257. The oligomeric agent of any of claims 246, 248, or 252-256, wherein R1is an adenosine and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine.
258. The oligomeric agent of any of claims 246, 248, or 252-256, wherein R1is an adenosine and R2comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines.
259. The oligomeric agent of any of claims 246, 248, or 252-256, wherein R1is an adenosine and R2is an abasic nucleoside, a terminal group, or an H.
260. The oligomeric agent of any of claims 246, 248, or 252-256, wherein R1is a modified adenosine and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine.
261. The oligomeric agent of any of claims 246, 248, or 252-256, wherein R1is a modified adenosine and R2comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines.
262. The oligomeric agent of any of claims 246, 248, or 252-256, wherein R1is a modified adenosine and R2is an abasic nucleoside, a terminal group, or an H.
263. The oligomeric agent of any of claims 246, 248, or 252-256, wherein R1is an unmodified adenosine and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine.
264. The oligomeric agent of any of claims 246, 248, or 252-256, wherein R1is an unmodified adenosine and R2comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines.
265. The oligomeric agent of any of claims 246, 248, or 252-256, wherein R1is an unmodified adenosine and R2is an abasic nucleoside, a terminal group, or an H.
266. The oligomeric agent of any of claims 246, 248, or 252-256, wherein R1is an inosine and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine.
267. The oligomeric agent of any of claims 246, 248, or 252-256, wherein R1is an inosine and R2comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines.
268. The oligomeric agent of any of claims 246, 248, or 252-256, wherein R1is an inosine and R2is an abasic nucleoside, a terminal group, or an H. 204BIOL0446WO 269. The oligomeric agent of any of claims 246, 248, or 252-255, wherein R1is an abasic nucleoside, a terminal group, or an H; and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine.
270. The oligomeric agent of any of claims 246, 248, or 252-255, wherein R1is an abasic nucleoside, a terminal group, or an H; and R2comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines.
271. The oligomeric agent of any of claims 246, 248, or 252-255, wherein R1is an abasic nucleoside, a terminal group, or an H; and R2is an abasic nucleoside, a terminal group, or an H.
272. The oligomeric agent of any of claims 246 or 249-253, wherein R1is 2 or 3 linked nucleosides, optionally comprising an adenosine, a modified adenosine, an unmodified adenosine, or an inosine; and R2comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine.
273. The oligomeric agent of any of claims 246 or 249-253, wherein R1is 2 or 3 linked nucleosides, optionally comprising an adenosine, a modified adenosine, an unmodified adenosine, or an inosine; and R2is an abasic nucleoside, a terminal group, or an H.
274. The oligomeric agent of claim 247, wherein R3is one nucleoside.
275. The oligomeric agent of claim 247, wherein R3is 2 linked nucleosides.
276. The oligomeric agent of claim 247, wherein R3is 3 linked nucleosides.
277. The oligomeric agent of any of claims 247 or 274-276, wherein R4is one nucleoside.
278. The oligomeric agent of any of claims 247 or 274-276, wherein R4is 2 linked nucleosides.
279. The oligomeric agent of any of claims 247 or 274-276, wherein R4is 3 linked nucleosides.
280. The oligomeric agent of any of claims 247, 274, or 278-279, wherein R3is one nucleoside and R4is 2 or 3 linked nucleosides.
281. The oligomeric agent of any of claims 247, 274, or 278-280, wherein R3is a cytidine, a modified cytidine, or an unmodified cytidine, and R4comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine.
282. The oligomeric agent of any of claims 247, 274, or 278-281, wherein R3is a cytidine and R4comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine.
283. The oligomeric agent of any of claims 247, 274, or 278-281, wherein R3is a cytidine and R4comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines.
284. The oligomeric agent of any of claims 247, 274, or 278-281, wherein R3is a cytidine and R4is an abasic nucleoside, a terminal group, or an H.
285. The oligomeric agent of any of claims 247, 274, or 278-281, wherein R3is a modified cytidine and R4comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine. 205BIOL0446WO 286. The oligomeric agent of any of claims 247, 274, or 278-281, wherein R3is a modified cytidine and R4comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines.
287. The oligomeric agent of any of claims 247, 274, or 278-281, wherein R3is a modified cytidine and R4is an abasic nucleoside, a terminal group, or an H.
288. The oligomeric agent of any of claims 247, 274, or 278-281, wherein R3is a 5-methylcytidine and R4comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine.
289. The oligomeric agent of any of claims 247, 274, or 278-281, wherein R3is a 5-methylcytidine and R4comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines.
290. The oligomeric agent of any of claims 247, 274, or 278-281, wherein R3is a 5-methylcytidine and R4is an abasic nucleoside, a terminal group, or an H.
291. The oligomeric agent of any of claims 247, 274, or 278-281, wherein R3is an unmodified cytidine and R4comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine.
292. The oligomeric agent of any of claims 247, 274, or 278-281, wherein R3is an unmodified cytidine and R4comprises two or more adenosines, two or more modified adenosines, two or more unmodified adenosines, or two or more inosines.
293. The oligomeric agent of any of claims 247, 274, or 278-281, wherein R3is an unmodified cytidine and R4is an abasic nucleoside, a terminal group, or an H.
294. The oligomeric agent of any of claims 247 or 275-279, wherein R3is 2 or 3 linked nucleosides, optionally comprises a cytidine, a modified cytidine, or an unmodified cytidine, and R4comprises an adenosine, a modified adenosine, an unmodified adenosine, or an inosine.
295. The oligomeric agent of any of claims 247 or 275-279, wherein R3is 2 or 3 linked nucleosides, optionally comprises a cytidine, a modified cytidine, or an unmodified cytidine, and R4is an abasic nucleoside, a terminal group, or an H.
296. The oligomeric agent of any of claims 246-295, wherein if R1, R2, R3, and R4are each independently 1, 2, or 3 linked nucleosides or are each independently an abasic nucleoside, R1, R2, R3, and R4also include an internucleoside linkage selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage.
297. The oligomeric agent of any of claims 246-296, wherein the modified oligonucleotide is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium. 206BIOL0446WO 298. A modified oligonucleotide according to the following chemical structure: NH2O O N N N NH NH HO NNNN O NH2N N207BIOL0446WO 299. A modified oligonucleotide according to the following chemical structure: NH2NH2NH2N N N N N HO N O O O O O HS P ONH O N O O O HS P OO O O O HS P OO O OHN PS O O OHS O (SEQ ID NO: 46)208BIOL0446WO 300. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 47)209BIOL0446WO 301. A modified oligonucleotide according to the following chemical structure:
302. The modified oligonucleotide of any one of claims 298-301, wherein the modified oligonucleotide is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium. 210BIOL0446WO 303. A modified oligonucleotide according to the following chemical structure: NH2O O N N N NH NH HO ONNNN O O O ONH2NaS P ON O N O O O NaO P OO O O NaO P OO NaSNa (SEQ ID NO: 45).211BIOL0446WO 304. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 46).212BIOL0446WO 305. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 47).213BIOL0446WO 306. A modified oligonucleotide according to the following chemical structure:
307. A population of oligomeric agents of any of claims 1-297 or a population of modified oligonucleotides of any of claims 298-306, wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.
308. The population of claim 307, wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration.
309. The population of claim 307, wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration. 214BIOL0446WO 310. The population of claim 307, wherein the population is chirally enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.
311. The population of claim 307, wherein the population is chirally enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage.
312. The population of claim 307, wherein the population is chirally enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.
313. The population of claim 307, wherein the population is chirally enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5’ to 3’ direction.
314. A population of oligomeric agents of any of claims 1-297 or a population of modified oligonucleotides of any of claims 298-306, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.
315. A population of oligomeric agents of any of claims 1-297 or a population of modified oligonucleotides of any of claims 298-306, wherein all of the mesyl phosphoramidate internucleoside linkages of the modified oligonucleotide are stereorandom.
316. A pharmaceutical composition comprising an oligomeric agent of any of claims 1-297, a modified oligonucleotide of any of claims 298-306, or a population of any of claims 307-315, and a pharmaceutically acceptable diluent.
317. The pharmaceutical composition of claim 316, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).
318. The pharmaceutical composition of claim 317, wherein the pharmaceutical composition consists essentially of the oligomeric agent of any of claims 1-297, the modified oligonucleotide of any of claims 298- 306, or the population of any of claims 307-315, and aCSF.
319. The pharmaceutical composition of claim 317, wherein the pharmaceutical composition consists essentially of the oligomeric agent of any of claims 1-297, the modified oligonucleotide of any of claims 298- 306, or the population of any of claims 307-315, and PBS.
320. A method comprising administering to a subject an oligomeric agent of any of claims 1-297, a modified oligonucleotide of any of claims 298-306, a population of any of claims 307-315, or a pharmaceutical composition of any of claims 316-319.
321. The method of claim 320, wherein the subject has or is at risk of developing Alzheimer’s disease.
322. A method of treating a neurodegenerative disease associated with APOE comprising administering to a subject having or at risk of developing a neurodegenerative disease associated with APOE a therapeutically 215BIOL0446WO effective amount of an oligomeric agent of any of claims 1-297, a modified oligonucleotide of any of claims 298-306, a population of any of claims 307-315, or a pharmaceutical composition of any of claims 316-319.
323. The method of claim 322, wherein the neurodegenerative disease associated with APOE is Alzheimer’s disease.
324. The method of claim 322, wherein at least one symptom of the neurodegenerative disease associated with APOE is ameliorated.
325. The method of claim 324, wherein the symptom is cognitive impairment, progressive memory loss, a decline in language skills, behavioral abnormality, dementia, difficulty performing daily activities, aphasia, agnosia, apraxia, loss of motor function, amyloid plaque, neurofibrillary tangle, and / or neuroinflammation.
326. The method of any of claims 322-325, wherein administering the oligomeric agent of any of claims 1-297, the modified oligonucleotides of any of claims 298-306, the population of any of claims 307-315, or the pharmaceutical composition of any of claims 316-319 reduces the rate of cognitive impairment or progressive memory loss, reduces the rate of decline in language skills, reduces the rate of progression of behavioral abnormality, reduces the rate of progression of dementia, improves the performance in daily activities, reduces the rate of progression of aphasia, agnosia, and / or apraxia, and / or decreases the rate of decline in motor function in the subject.
327. The method of any of claims 322-326, wherein administering the oligomeric agent of any of claims 1-297, the modified oligonucleotides of any of claims 298-306, the population of any of claims 307-315, or the pharmaceutical composition of any of claims 316-319 reduces amyloid plaques, neurofibrillary tangles, or neuroinflammation in the brain of the subject.
328. The method of any of claims 320-327, wherein the oligomeric agent of any of claims 1-297, the modified oligonucleotides of any of claims 298-306, the population of any of claims 307-315, or the pharmaceutical composition of any of claims 316-319 is administered to the central nervous system or systemically.
329. The method of any of claims 320-328, wherein the oligomeric agent of any of claims 1-297, the modified oligonucleotides of any of claims 298-306, the population of any of claims 307-315, or the pharmaceutical composition of any of claims 316-319 is administered intrathecally.
330. The method of any of claims 320-329, wherein the subject is a human.
331. A method of reducing the amount of APOE RNA in a cell comprising contacting the cell with an oligomeric agent of any of claims 1-297, a modified oligonucleotide of any of claims 298-306, a population of any of claims 307-315, or a pharmaceutical composition of any of claims 316-319.
332. The method of claim 331, wherein the cell is a brain cell.
333. The method of claim 331 or claim 332, wherein the cell is a glial cell or a neuron.
334. The method of any of claims 331-333, wherein the cell is an astrocyte or a microglial cell.
335. The method of any of claims 331-334, wherein the cell is a human cell. 216BIOL0446WO 336. Use of an oligomeric agent of any of claims 1-297, a modified oligonucleotide of any of claims 298- 306, a population of any of claims 307-315, or a pharmaceutical composition of any of claims 316-319 for treating a neurodegenerative disease associated with APOE.
337. Use of an oligomeric agent of any of claims 1-297, a modified oligonucleotide of any of claims 298- 306, a population of any of claims 307-315, or a pharmaceutical composition of any of claims 316-319 in the manufacture of a medicament for treating a neurogenerative disease.
338. Use of an oligomeric agent of any of claims 1-297, a modified oligonucleotide of any of claims 298- 306, a population of any of claims 307-315, or a pharmaceutical composition of any of claims 316-319 in the manufacture of a medicament for treating a neurogenerative disease associated with APOE.
339. The use of any of claims 336 - 338, wherein the neurodegenerative disease associated with APOE is Alzheimer’s disease.
340. An oligomeric agent of any of claims 1-297, a modified oligonucleotide of any of claims 298-306, or a population of any of claims 307-315, for use as a therapeutically active substance.
341. An oligomeric agent of any of claims 1-297, a modified oligonucleotide of any of claims 298-306, a population of any of claims 307-315, or a pharmaceutical composition of any of claims 316-319, for use in the treatment of a neurodegenerative disease.
342. An oligomeric agent of any of claims 1-297, a modified oligonucleotide of any of claims 298-306, a population of any of claims 307-315, or a pharmaceutical composition of any of claims 316-319, for use in the treatment of a neurodegenerative disease associated with APOE.
343. An oligomeric agent of any of claims 1-297, a modified oligonucleotide of any of claims 298-306, a population of any of claims 307-315, or a pharmaceutical composition of any of claims 316-319, for use in the treatment of Alzheimer’s disease. 217
Citation Information
Patent Citations
Oligonucleotides for tissue specific APOE modulation
US20200362341A1
Compounds and Methods for Modulating UBE3A-ATS
US20220411793A1
Compounds and methods for reducing APOE expression
US20230357770A1
Linkage modified oligomeric compounds and uses thereof
WO2022174053A1