Method for producing berberine or glycosylated derivative thereof and use thereof

Abstract

A method for producing berberine or a glycosylated derivative thereof and use thereof. In view of the characteristics of a plant chassis, a new method for detecting endogenous tyrosine in a plant is established, and a compound library for rapidly screening benzylisoquinoline alkaloids and derivatives thereof is established. On this basis, an effective target for enhancing the supply of endogenous tyrosine is obtained by screening, and for the first time, the synthesis of berberine and the glycosylated derivative thereof is achieved in Nicotiana plants, thereby providing a new way for industrial production of berberine compounds. Moreover, the glycosylated derivative can improve the bioavailability of berberine, which is of great significance for the research and development of new drugs.

Description

Method for producing berberine or glycosylated derivatives thereof and applications thereof TECHNICAL FIELD

[0001] The present application belongs to the field of bioengineering, and more specifically, the present application relates to a novel method for producing berberine or glycosylated derivatives thereof using Nicotiana plants as a chassis and applications thereof. BACKGROUND

[0002] Berberine belongs to the class of benzylisoquinoline quaternary ammonium alkaloids, and is found in the roots, stems, and barks of plants in the Berberidaceae (barberry family), Ranunculaceae (crowfoot family), and Papaveraceae (poppy family). It is a non-prescription drug unique to China and was originally used to treat infectious diarrhea. Recent research has found its significant effects in regulating glucose and lipid metabolism disorders. After entering the intestine, a small part of berberine is converted into dihydroberberine by nitroreductase in the intestine and is absorbed into the blood, and further transported to the liver, where it exerts its effects on lowering blood lipids and blood glucose. Most of the berberine remains in the intestine and interacts with the intestinal flora, exhibiting anti-inflammatory properties, reducing the risk of infection, improving the structure of the intestinal flora, generating beneficial metabolites, and maintaining the health of the intestinal mucosa. Berberine, through biochemical action and enzymatic conversion by intestinal bacteria, cooperates with the part that enters the blood to produce better therapeutic effects in the human body.

[0003] The synthesis of berberine starts with the condensation of two molecules of tyrosine derivatives (4-HPAA and dopamine), forming the parent nucleus psicose, which is then modified through multiple methylation and hydroxylation to form the common precursor reticulate jacaran-dine of most BIAs. Then, through cyclization, methylation, and oxidation, berberine is formed.

[0004] Currently, berberine is mainly prepared by plant extraction process, using the barks or mature roots of plants such as Phellodendron or Coptis as raw materials. However, taking Coptis planting as an example, to make the berberine extracted from the roots meet the content standard specified in the Chinese Pharmacopoeia, which is not less than 5%, it is also necessary to meet the conditions of high-quality germplasm resources, cultivation environment of cool, humid, and slightly acidic soil, and at least 5 years of planting period. Under the constraints of the above factors, the production efficiency and product quality of berberine are often difficult to effectively guarantee.

[0005] Therefore, it is particularly necessary to seek innovation in the production method. In recent years, due to the characteristics of environmental friendliness, low investment cost, and high efficiency of production capacity, synthetic biology has been considered as an ideal alternative to the heterologous synthesis of natural products. The inventors have realized the efficient synthesis of protoberberine in Escherichia coli by constructing a high-yield tyrosine chassis, relieving the inhibition of tyrosine hydroxylase, improving the functional expression of membrane proteins, and high-density cultivation in a reactor.

[0006] Although the inventors have achieved the highest level of production of protopine in E. coli, the low efficiency of membrane protein expression and the bacteriostatic nature of the product to some extent limit the further development of E. coli chassis. Therefore, there is a need for further optimization and improvement of the production of berberine.

[0007] SUMMARY

[0008] The present application aims to provide a novel method for producing berberine or glycosylated derivatives thereof using Nicotiana plants as chassis and applications thereof.

[0009] In a first aspect of the present application, a method for synthesizing berberine, precursors, intermediates or derivatives thereof using Nicotiana plants as chassis is provided, comprising expressing exogenous Rs1A-TyrA fbr , Rs1A-TyrB, and strengthening the supply of endogenous tyrosine in the chassis.

[0010] In one or more embodiments, the method further comprises strengthening the synthesis pathway of dopamine and aldehyde in the chassis; preferably, expressing exogenous CYP76AD5, DDC, MAO, and strengthening the synthesis pathway of dopamine and aldehyde; preferably, further comprising expressing exogenous PR10A or NCS1 in the chassis, and strengthening the supply of precursor norlaudanosoline in the chassis.

[0011] In one or more embodiments, the method further comprises expressing exogenous reticuline (an intermediate in the synthesis of berberine) synthesis-related enzymes, thereby synthesizing reticuline; wherein the reticuline synthesis-related enzymes comprise 60MT, CNMT, CYP80B2, and 4'OMT.

[0012] In one or more embodiments, the method further comprises expressing exogenous protopine (including an intermediate in the synthesis of berberine or berberine itself), or jatrorrhizine or derivative synthesis-related enzymes, comprising:

[0013] (a) expressing exogenous BBE1, thereby synthesizing chelirubine;

[0014] (b) expressing exogenous BBE1 and 9OMT, thereby synthesizing tetrahydrocolumbamine;

[0015] (c) expressing exogenous BBE1, 9OMT and CYP719A1, thereby synthesizing tetrahydroberberine;

[0016] (d) expressing exogenous BBE1, 9OMT, CYP719A1 and STOX, thereby synthesizing berberine;

[0017] (e) expressing an exogenous BBE1, CYP719A1 or CYP719A42, thereby synthesizing a berberine red alkali derivative; preferably, the berberine red alkali derivative comprises: nortanghinine, 9-O-glycosyl-nortanghinine, 9-O-glycosyl- chonkinine.

[0018] In one or more embodiments, various intermediates or products are obtained according to the reaction methods provided in Figure 15.

[0019] In one or more embodiments, the derivative is a glycosylated derivative of berberine.

[0020] In one or more embodiments, the "plant chassis expressing... enzyme" comprises introducing an exogenous gene encoding the enzyme into the plant chassis, thereby enabling expression.

[0021] In one or more embodiments, the gene encoding the enzyme is operably linked to one or more constructs, introduced into the plant chassis, when expression is performed.

[0022] In one or more embodiments, if the synthesized product is an optically active compound, it is in the S-configuration (a left-handed compound).

[0023] In one or more embodiments, the PR10A is a truncated PR10A, truncated by 20-28 (preferably 21-27, more preferably 22-26 or 23-25, more preferably 24) amino acids from the N-terminus of PR10A.

[0024] In one or more embodiments, the Rs1A-TyrA fbr or Rs1A-TyrB, the Rs1A is a truncation of the N-terminal 80 amino acids of Rs1A.

[0025] In another aspect of the application, there is provided a plant chassis (comprising chassis cells) for synthesizing berberine, a precursor, intermediate or derivative thereof, the plant chassis expressing an exogenous Rs1A-TyrA fbr , Rs1A-TyrB; wherein the supply of endogenous tyrosine is enhanced; the plant is a Nicotiana plant.

[0026] In one or more embodiments, the plant chassis further has an enhanced dopamine and aldehyde synthesis pathway; preferably, the plant chassis expresses an exogenous CYP76AD5, DDC, MAO, thereby the dopamine and aldehyde synthesis pathway is enhanced; preferably, the plant chassis expresses an exogenous PR10A or NCS1, thereby the supply of the precursor norlaudanosoline is enhanced.

[0027] In one or more embodiments, the plant chassis further expresses an exogenous reticuline (an intermediate in the synthesis of berberine) synthesis-related enzyme, thereby synthesizing reticuline; wherein the reticuline synthesis-related enzyme comprises: 60MT, CNMT, CYP80B2, 4'OMT.

[0028] In one or more embodiments, the plant chassis further expresses an exogenous protoberberine (including an intermediate in the synthesis of berberine or berberine itself), or jatrorrhizine or derivative synthesis-related enzyme, comprising:

[0029] (a) an exogenous BBE1, thereby the plant chassis can synthesize epiberberine;

[0030] (b) an exogenous BBE1 and 90MT, thereby the plant chassis can synthesize tetrahydrocolumbamine;

[0031] (c) an exogenous BBE1, 90MT and CYP719A1, thereby the plant chassis can synthesize tetrahydroberberine;

[0032] (d) an exogenous BBE1, 90MT, CYP719A1 and STOX, thereby the plant chassis can synthesize berberine;

[0033] (e) an exogenous BBE1, CYP719A1 or CYP719A42, thereby the plant chassis can synthesize jatrorrhizine derivatives; preferably, the jatrorrhizine derivatives comprise: nortanghinine, 9-O-glycosyl-nortanghinine, 9-O-glycosyl-epiberberine.

[0034] In another aspect of the present application, there is provided use of the plant chassis of any one of the preceding descriptions for synthesizing berberine, a precursor, an intermediate or a derivative thereof.

[0035] In one or more embodiments, the precursor comprises: nortanghinine.

[0036] In one or more embodiments, the intermediate comprises: reticuline, epiberberine, tetrahydrocolumbamine, tetrahydroberberine.

[0037] In one or more embodiments, the derivative comprises: nortanghinine, 9-O-glycosyl-nortanghinine, 9-O-glycosyl-epiberberine.

[0038] In another aspect of the present application, there is provided a kit comprising the plant chassis of any one of the preceding descriptions; the plant is Nicotiana.

[0039] In another aspect of the present application, a kit is provided, comprising: a construct (including an expression cassette or an expression vector) comprising a coding gene of an enzyme (one or more enzymes, one or more groups of enzymes) selected from the group consisting of Rs1A-TyrA fbr , Rs1A-TyrB, CYP76AD5, DDC, MAO, PR10A or NCS1, 6OMT, CNMT, CYP80B2, 4'OMT, BBE1, 9OMT, CYP719A1, STOX, CYP719A42.

[0040] In one or more embodiments, the PR10A is a truncated PR10A, with 20-28 (preferably 21-27, more preferably 22-26 or 23-25, more preferably 24) N-terminal amino acids removed.

[0041] In one or more embodiments, the Rs1A-TyrA fbr or Rs1A-TyrB, Rs1A is a truncated N-terminal 80 amino acids of Rs1A.

[0042] In one or more embodiments, the coding gene of the enzyme is operably linked to one or more constructs.

[0043] In another aspect of the present application, a method for characterizing the content of tyrosine in a plant body of Nicotiana is provided, comprising: analyzing the content of betalain in the plant body, and using the content of betalain to characterize the content of tyrosine (i.e., using the betalain quantification system as a biosensor for characterizing the content of tyrosine in vivo).

[0044] In another aspect of the present application, a method for screening a plant of Nicotiana with increased content of tyrosine is provided, comprising: analyzing the content of betalain in the plant body, and using the increased accumulation of betalain to indicate the increased content of tyrosine; preferably, using the betalain in vivo imaging method to analyze the content of betalain in the plant body; more preferably, setting the excitation wavelength at 535±5nm (such as 535±3nm, 535±2nm, 535±1nm), and testing the absorption light wavelength at 600±5nm (such as 600±3nm, 600±2nm, 600±1nm), and collecting the signal of the fluorescence picture to quantify the generation of betalain.

[0045] Other aspects of the present application will be apparent to those skilled in the art from consideration of the disclosure herein. BRIEF DESCRIPTION OF DRAWINGS

[0046] FIG. 1, standard curves of intermediates or products in the present application, including (S)-reticuline, (S)-tetrahydrocolumbamine, (S)-chondodendrine, (S)-tetrahydroberberine, and berberine.

[0047] Figure 2, Betalain in vivo imaging method for characterizing endogenous tyrosine content changes. Betalain is a secondary metabolite produced from tyrosine under the catalysis of cytochrome P450 enzyme (CYP76AD1), dopa dioxygenase (DODA) and glycosyltransferase (cDODA-5GT) (a); according to the absorption wavelength of betalain, the excitation wavelength is set to 535 nm, the absorption light wavelength is tested to be 600 nm, and the generation of betalain is quantified by collecting the signal of the fluorescence picture (b-c).

[0048] Figure 3, unified arrangement of oxidized and methylated BIAs products starting from the parent nucleus of BIAs (S)-reticuline.

[0049] Figure 4, partial structures of BIAs modified product library (showing the expected conformation of glycosylated and acetylated modified isocorydine).

[0050] Figure 5, simplified target compound screening process after LC-MS / MS detection results combined with BIAs modified product library.

[0051] Figure 6, results of detecting the dynamic changes of exogenous enzyme accumulation amount with infection time through FLAG tag.

[0052] Figure 7, analysis of subcellular localization of target proteins by mixing the marker proteins located in the endoplasmic reticulum to infect tobacco.

[0053] Figure 8, LC-MS / MS identification results of (S)-holaphylline synthesized by N. benthamiana.

[0054] Figure 9, subcellular localization results of a series of enzymes in mesophyll cells of N. benthamiana.

[0055] Figure 10, subcellular localization results of CM2, TyrA fbr , TyrB and CAT6 after fusing known plastid transit peptide signals to the N-terminus.

[0056] Figure 11, combination of betalain synthesis pathway with tyrosine gain pathway (a), evaluation of the effectiveness of plastid engineering strategy by observing the accumulation of betalain within 3 days after infection (b-c).

[0057] Figure 12, schematic diagram of complete compartmentalization design strategy.

[0058] Figure 13, LC-MS / MS detection results of reticuline synthesized by N. benthamiana.

[0059] Figure 14, LC-MS / MS detection results of products of protopine synthesized by N. benthamiana.

[0060] Figure 15. Synthesis of berberrubine and derivatives (a), and in vitro activity of CAS from different sources (b).

[0061] Figure 16. LC-MS / MS detection of berberrubine derivatives synthesized in N. benthamiana (a-c). DETAILED DESCRIPTION

[0062] The present inventors have made in-depth research, combined with the characteristics of plant chassis, established a new method for detecting endogenous tyrosine in plants, established a compound library for rapid screening of benzylisoquinoline alkaloids and their derivatives, and screened effective target points for strengthening endogenous tyrosine supply, which is the first time to synthesize berberine and its glycosylated derivatives in Nicotiana plants, provides a new way for industrial production of berberine compounds, and the glycosylated derivatives can improve the bioavailability of berberine, which has important significance for new drug research and development.

[0063] TERMS

[0064] As used herein, the term "berberine" also includes berberine compounds. The term "berberine compounds" can also be variations based on the compound berberine disclosed in the present application, including precursors thereof such as tetrahydroberberine, or derivatives thereof. For example, the parent structure of the compound remains unchanged, but substitution of groups (such as aliphatic hydrocarbon groups containing 1-4 carbon atoms (preferably 1-2 carbon atoms)) occurs at individual (such as 1-3, 1-2) positions.

[0065] As used herein, the term "chassis" means a host (such as a plant or a cell) in which a designed genetic program can function.

[0066] As used herein, the terms "exogenous" or "heterologous" refer to the relationship between two or more nucleic acid or protein (polypeptide) sequences from different sources, or the relationship between nucleic acids or proteins from different sources and a host cell. For example, if the combination of nucleic acids / proteins and host cells is not normally found in nature, the nucleic acids are exogenous to the host cell. A particular nucleic acid sequence is "exogenous" to the cell or organism into which it is inserted.

[0067] As used herein, the term "expression construct" or "expression construct" refers to a recombinant DNA molecule that contains a nucleic acid coding sequence of interest, which can contain one or more gene expression cassettes. The "construct" is usually contained in an expression vector.

[0068] As used herein, the "expression cassette" or "gene expression cassette" refers to a gene expression system comprising all necessary elements required for expression of a polypeptide of interest, which generally includes the following elements: a promoter, a gene sequence encoding a polypeptide, a terminator; and optionally further includes a signal peptide coding sequence, etc.; and these elements are operatively linked.

[0069] As used herein, the "operably linked" or "operatively linked" refers to the functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example: a promoter region is placed in a specific position relative to a nucleic acid sequence of a gene of interest, so that the transcription of the nucleic acid sequence is guided by the promoter region, and thus the promoter region is "operably linked" to the nucleic acid sequence.

[0070] As used herein, the "Nicotiana plant" includes Nicotiana benthamiana and plants having the same in vivo metabolic mechanism (especially the in vivo metabolic mechanism disclosed in the embodiments of the present application).

[0071] Expression system

[0072] In the present application, the tobacco plant is used as a plant chassis for the first time to realize the synthesis of berberine, its upstream precursor compounds, intermediates, or its downstream derivatives. The optimized plant chassis in the present application has abundant endomembranes and mature post-translational modifications, ensuring efficient expression of membrane proteins; has a fine compartmentalization and transport mechanism, which helps to relieve the toxicity of the product; has a rich pool of modification enzymes, which is conducive to the further modification of the product and the improvement of biological activity.

[0073] By means of betalain in vivo imaging technology, the inventors screened and obtained effective target points for strengthening the supply of endogenous tyrosine (including Rs1A-TyrA fbr or Rs1A-TyrB), and realized the synthesis of the parent nucleus (S)-allnorlaudanosine by increasing the expression of a group of enzymes (including CYP76AD5, DDC, MAO, NCS1).

[0074] In a preferred mode, in the chassis, the inventors replace NCS1 with truncated PR10A, and combine three elements (Rs1A-TyrA fbr and Rs1A-TyrB) for strengthening the supply of tyrosine, to realize the synthesis of berberine and its derivatives (9-O-glycosyl-(S)-nortanghinine and 9-O-glycosyl-(S)-gold yellow corydine).

[0075] In a preferred mode, reticulate ichthyolaudanosine (an intermediate for the synthesis of berberine) synthesis-related enzymes are further expressed to synthesize reticulate ichthyolaudanosine; wherein the reticulate ichthyolaudanosine synthesis-related enzymes include: 6OMT, CNMT, CYP80B2, and 4'OMT.

[0076] In a preferred manner, further by expressing an exogenous protoberberine (including an intermediate of berberine synthesis or berberine itself), or jatrorrhizine or derivative synthesis related enzymes, including: (a) expression of exogenous BBE1, thereby synthesizing epiberberine; (b) expression of exogenous BBE1 and 90MT, thereby synthesizing tetrahydrocolumbamine; (c) expression of exogenous BBE1, 90MT and CYP719A1, thereby synthesizing tetrahydroberberine; (d) expression of exogenous BBE1, 90MT, CYP719A1 and STOX, thereby synthesizing berberine; (e) expression of exogenous BBE1, CYP719A1 or CYP719A42, thereby synthesizing jatrorrhizine derivatives; preferably, the jatrorrhizine derivatives include: nortracheline, 9-O-glycosyl-nortracheline, 9-O-glycosyl-epiberberine.

[0077] The gene encoding the enzyme of the present application can be naturally occurring, such as it can be isolated or purified from a plant or microorganism. In addition, the gene can also be artificially prepared, such as it can be obtained according to conventional genetic engineering recombination techniques, or it can be obtained by artificial synthesis.

[0078] The sequence information of the enzyme or its encoding nucleic acid of the present application can be the same as the sequence information provided in Tables 1-2 of the examples of the present application, or it can be a variant or degenerate sequence thereof. "Degenerate sequence" in the present application refers to a nucleic acid sequence that encodes a protein having the same function, but differs from the sequence information provided in the examples of the present application. The natural sequence encoding the enzyme can be used in the present application, or a sequence that has been codon-optimized can also be used. The encoding nucleic acid of the enzyme can include: a coding sequence that only encodes a mature polypeptide; a coding sequence of a mature polypeptide and various additional coding sequences; a coding sequence of a mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0079] The present application also relates to variants of the enzymes involved in the reactions of the present application, which differ from their corresponding wild-type polypeptides in amino acid sequence by virtue of one or more substitutions, deletions or insertions of amino acid residues. Such nucleotide variants can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is an alternative form of a polynucleotide, which can exist within a population. The alternative form can be a substitution, deletion or insertion, but does not substantially alter the functional properties of the polypeptide encoded by the polynucleotide.

[0080] It should be understood that the yield of the berberine compounds (including berberine, its upstream precursor compounds, intermediates, or its downstream derivatives) can be further improved by optimization using some codon optimization methods, protein variant screening methods, enzyme activity promotion methods, etc., and by establishing optimized engineering bacteria. These further optimization techniques based on the schemes of the present application should also be covered in the technical schemes of the present application.

[0081] In the preferred embodiments of the present application, the enzymes are from a series of species. The present application can also include the use of such enzymes from other microorganisms, animals or plants, as long as they are highly homologous (such as having more than 80%, such as 85%, 90%, 95%, or even 98% sequence identity) to the enzymes listed in the embodiments of the present application. Methods and tools for comparing sequence identity are also well known in the art, such as BLAST. "Identity" refers to the level of similarity (i.e. sequence homology, similarity or identity) between two or more nucleic acids in terms of percentage of positions that are identical. However, it should be understood that the corresponding sequence positions of the corresponding enzymes specifically optimized in the present application to overcome technical defects are relatively conserved, such as specifically designed truncations.

[0082] The full-length sequence of the coding nucleic acid of each enzyme of the present application or a fragment thereof can generally be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed according to the nucleotide sequences disclosed in the present application, especially the open reading frame sequences, to amplify the relevant sequences. When the sequence is long, two or more PCR amplifications can be performed, and then the fragments amplified in each amplification are spliced together in the correct order.

[0083] The present application also relates to vectors containing the coding nucleic acid, and host cells genetically engineered with the vectors.

[0084] In the present application, the sequence of the coding nucleic acid of each enzyme can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses or other vectors well known in the art. In general, any plasmid and vector can be used as long as it can replicate and be stable in the host. An important feature of the expression vector is that it usually contains a replication origin, a promoter, a marker gene and a translation control element.

[0085] The sequences of the nucleic acids encoding the enzymes can be inserted into separate recombinant expression vectors, and the recombinant expression vectors are co-transfected into the host cells; or the expression cassettes of the genes can be inserted into the same recombinant expression vector in a tandem manner, and the recombinant expression vector is transfected into the host cells. The recombinant expression vector can further comprise an expression regulatory sequence operatively linked to the sequence of the gene, so as to facilitate the expression of the protein. It should be understood that the recombinant expression vector can be conveniently constructed by those skilled in the art based on the technical content of the present application. The obtained recombinant expression vector is also comprised in the present application.

[0086] In the expression regulatory sequence or the expression cassette, an inducible or constitutive promoter can be used according to different needs, and the inducible promoter can achieve more controllable protein expression and compound production, which is beneficial to industrial application.

[0087] As a preferred mode of the present application, an expression cassette or a recombinant construct (such as an expression vector) is provided, which comprises the enzymes described in the present application.

[0088] The establishment of the expression vector (expression construct) can be performed by using the techniques familiar to those skilled in the art. After the desired enzymes are known and the desired cell system is known, those skilled in the art can establish the expression construct. The gene sequence can be inserted into different expression constructs (such as expression vectors) or inserted into the same expression construct, as long as the polypeptide encoded by the gene sequence can be effectively expressed and exhibit activity after being transfected into the cell.

[0089] The vector comprising the appropriate gene sequence and the appropriate promoter or control sequence described above can be used to transform a Nicotiana plant, so that the Nicotiana plant can express the protein. The transformation of the host with the recombinant DNA can be performed by using the techniques known to those skilled in the art.

[0090] The present application also provides a kit for biosynthesizing a berberine compound, which comprises: the plant chassis constructed in the present application; or the kit comprises: the expression cassette or the recombinant construct constructed in the present application.

[0091] In a more preferred embodiment, the kit further comprises an instruction manual for the method of biosynthesis, so as to facilitate the operation of those skilled in the art.

[0092] The plant chassis constructed in the present application has good adaptability, compatibility, expression activity and catalytic activity with each enzyme introduced from outside, and has development and application potential. It should be understood that the technical solutions obtained by further improving the structure or function of the enzyme on the basis of the present application should also be comprised in the present application.

[0093] Based on the new findings of the inventor, the application also discloses a method for heterologous synthesis of berberine compounds by using the plant chassis. The method comprises culturing the plant chassis constructed in the application.

[0094] After obtaining the fermentation product, the berberine compounds can be extracted from the fermentation product by using the known technology of the application. Some known technologies such as high performance liquid chromatography can be used to analyze and identify the product to determine whether the desired compound is obtained.

[0095] Screening system

[0096] The application also provides a method for characterizing the content of tyrosine in a plant of the genus Nicotiana, comprising: analyzing the content of betalain in the plant, and using the content of betalain to characterize the content of tyrosine. That is, the scheme uses a betalain quantification system as a biosensor for characterizing the content of tyrosine in vivo.

[0097] The basic principle of the method for characterizing tyrosine is that tyrosine in plants is involved in the synthesis of various secondary metabolites. The inventors have analyzed that betalain is a secondary metabolite generated from tyrosine under the catalysis of cytochrome P450 enzyme (CYP76AD1), dopa dioxygenase (DODA) and glycosyltransferase (cDODA-5GT). The DODA and 5GT do not have isozymes in N. benthamiana, so the content of betalain as a characterization result has orthogonality, and thus can be used as a biosensor for characterizing the content of tyrosine in vivo, for rapidly screening functional elements that effectively increase the content of tyrosine. The treatment with the most betalain accumulation represents the best tyrosine strengthening strategy.

[0098] Betalain has specific spectral absorption, and the content of betalain in a plant in vivo can be analyzed in real time by using in vivo imaging method. The fluorescence signal is collected at a specific excitation wavelength and absorption wavelength to quantify the generation of betalain. It should be understood that although the in vivo imaging method is a preferred method, other methods that can rapidly analyze the accumulation of betalain can also be covered in the application.

[0099] The application will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the application and not to limit the scope of the application. The experimental methods not specified in the following examples are generally carried out according to the conventional conditions, such as the conditions described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition, Science Press, or the conditions recommended by the manufacturer.

[0100] Materials and methods

[0101] 1. Plasmid construction

[0102] All plasmids were constructed based on pEAQ-HT according to the principle of homologous recombination. Linearized vector and target fragment containing homologous arm (homologous arm length about 15-20bp) were connected with the participation of in vitro recombination enzyme, then transformed into cloning host (such as E. coli DH10B), and then replicated with the proliferation of host cells.

[0103] Plasmids for detecting metabolite synthesis, each containing a single enzyme gene, the linearized vector was obtained by double digestion of pEAQ-HT with XmaI and XhoI and then gel recovery; the target fragment containing homologous arm was obtained by PCR with the target gene as template and by adding homologous arm sequence to the 5' end of upstream and downstream primers.

[0104] Plasmids for detecting the accumulation of enzymes over time, the linearized vector was obtained by double digestion of pEAQ-HT with XmaI and XhoI and then gel recovery; the target fragment containing homologous arm was obtained by PCR with the target gene as template and by adding homologous arm sequence to the 5' end of upstream and downstream primers (FLAG tag was added to the C-terminal of downstream primer by PCR).

[0105] Construction of plasmids for detecting the subcellular localization of heterologous enzymes, pQZ66-70, the linearized vector was obtained by double digestion of pEAQ-HT with XmaI and XhoI and then gel recovery; the sequence containing homologous arm was obtained by overlap extension PCR, the template of overlap extension PCR was the product of PCR amplification of the target gene and GFP with primers containing linkers and homologous arms, respectively. The subsequent plasmid containing GFP, the linearized vector containing GFP was obtained by PCR amplification of the pQZ66 vector as template with primers linearEAQ-GFP-F (5'-3': ggaggaggaggaggaggaatg) and linearEAQ-GFP-R (5'-3': cccgggatgatggtgatggtg); the target fragment containing homologous arm was obtained by PCR with the target gene as template and by adding homologous arm sequence to the 5' end of upstream and downstream primers. See Table 1 for plasmid information and Table 2 for gene modification instructions.

[0106] Table 1, detailed information of plasmids

[0107] >NbAAAD nucleotide sequence (SEQ ID NO: 1)

[0108] >NbAAAD amino acid sequence (SEQ ID NO: 2)

[0109] > NbPAO nucleotide sequence (SEQ ID NO: 3)

[0110] > NbPAO amino acid sequence (SEQ ID NO: 4)

[0111] > Amino acid sequence of Rs1A truncated by the first 80 amino acids (SEQ ID NO: 5):

[0112] Table 2

[0113] 2. Cloning of endogenous genes in N. benthamiana and A. thaliana

[0114] A liquid nitrogen pre-cooled sterile mortar was used to grind 50 mg of N. benthamiana or A. thaliana leaves into a fine powder. Total RNA was then extracted from the leaf tissue according to the kit instructions (TIANGEN RNA simple Total RNA kit). 1 μΐ of the RNA solution was used to assess the concentration and purity using a Thermo Scientific Nano Drop 2000C (concentration > 200 ng / μΐ; purity index 260 / 280 between 1.9-2.0, 260 / 230 > 2.0) and then reverse transcribed into cDNA using the PrimeScript RT (Takara) kit.

[0115] Cloning of genes involved in the synthesis of (S)-norlaudanosine precursor in N. benthamiana. Primers were designed based on the full-length CDS sequences of the genes provided in the tobacco tyrosine metabolism network in KEGG. Cloning of genes involved in the synthesis of tyrosine in A. thaliana. Primers were designed based on the sequence information known in the literature. PCR amplification was performed using PrimerSTAR Max DNA Polymerase (Takara) and then constructed in the pEAQ-HT plasmid. The constructs were then verified by liquid bacterial PCR and sequencing.

[0116] 3. Agroinfiltration-mediated transient transformation

[0117] The plasmid containing the target gene is transformed into GV3101 competent cells, and after plating, it is incubated at 28°C for 2 days. Then the transformants are verified by PCR. The positive clones are transferred to a test tube and cultured at 28°C, 250 rpm, to an OD of 0.8-1.0, then centrifuged at 6000xg for 5 min, and the bacteria are collected. An equal volume of resuspension is added to resuspend the bacteria, centrifuged at 6000xg for 5 min, and the supernatant is discarded. An equal volume of resuspension (same volume as the culture medium) is added to resuspend the bacteria, and the bacteria are incubated at room temperature in the dark for 2 h. Then, the bacterial suspension is injected into the tobacco from the back of the leaf using a 1 mL syringe (without the needle tip). When mixing more than 5 bacteria, the concentration of each bacterial solution is between 1.0 and 1.2, and the bacterial suspension is mixed in equal volumes and incubated for 2 h before injection into the tobacco. Each combination is tested on 3 leaves (3 different tobacco plants), and the samples for subcellular localization are prepared on the 3rd day after infection, while the samples for metabolites are prepared on the 6th day after infection.

[0118] Resuspension (100 mL) formula: 0.213 g MES, 0.2035 g MgCl2·6H2O, adjust pH to 5.6 with KOH, 100 μL (1‰) acetyl vanillin, add ultrapure water to 100 mL.

[0119] 4. Subcellular localization

[0120] The recombinant Agrobacterium containing the endoplasmic reticulum-localized mCherry is mixed with an equal volume of bacterial suspension containing the recombinant Agrobacterium carrying the target gene GFP, and then injected into the tobacco leaf. On the 3rd day, cut 1 cm x 1 cm of leaf tissue and select the location to avoid uneven surfaces. Add 1 drop of water to the center of the slide, place the leaf on the water, add water above the leaf, and gently place the cover glass on the leaf from one side to guide the water. Avoid air bubbles and try to fill the entire cover glass with water.

[0121] For samples with weak fluorescence in the leaf, prepare protoplasts from the leaf, and use a cut-off syringe tip to suck an appropriate amount of enzyme solution containing protoplasts onto the slide, and then gently cover the cover glass for detection.

[0122] The preparation method of protoplasts is as follows:

[0123] (1) Prepare the enzyme solution: 10 mL containing 0.7287 g mannitol, 0.0149 g potassium chloride, 0.0427 g MES, 0.0111 g calcium chloride, cellulase R10 0.15 g, and lyticase R10 0.04 g. Mix well and place on ice;

[0124] (2) Carefully tear the lower epidermis of the leaf with tweezers and immerse it in the enzyme solution. Avoid light, incubate at 25°C, 40 rpm, for 1 h.

[0125] 5. Heterologous expression of enzymes

[0126] 5.1 Sampling time and sampling method

[0127] After injection (D2-D9), 8 samples were taken in total, and 3 leaves were sampled with a puncher (6 mm in diameter) to get 1 hole per leaf per time, and 10 steel beads (1 mm in diameter) were put into each EP tube. The samples were frozen in liquid nitrogen and stored at -80°C. The last day of sampling, all samples were treated together.

[0128] 5.2 Lysis of plant tissue and Western Blot

[0129] Lysis buffer (sterilized after preparation, stored at 4°C, and 1 mM PMSF was added before use): 100 mM Tris-HCl (pH-8.0), 150 mM NaCl, 1 mM EDTA (pH-8.0), 10% (v / v) glycerol. After grinding at 55 HZ, 100 μL of lysis buffer was added to each EP tube, and the mixture was quickly mixed and centrifuged at 12000 rpm for 10 min at 4°C. The supernatant was transferred to obtain the crude protein sample.

[0130] After the total protein content was determined by the Bradford method, the protein sample was added with sample buffer, boiled in boiling water for 5 min, and centrifuged at 12000 rpm for 3 min to prepare the protein sample. Then, SDS-PAGE was performed (50 μg of each sample was loaded on a 10% acrylamide gel).

[0131] The specific process of Western Blot was as follows: 1) Preparation: PVDF membrane was activated in methanol for 1 min and then soaked in transfer buffer; 2) Membrane transfer: from bottom to top, the lower sponge, PVDF membrane, PAGE gel, and upper sponge were placed in sequence, and the program was set (mini x 1, 15 min); 3) Blocking: the PVDF membrane was blocked in blocking solution (PBST containing 5% skim milk) for 2 h; 4) Primary antibody incubation: the PVDF membrane was incubated in the diluted primary antibody at working concentration for 1 h at room temperature (or overnight at 4°C), and the membrane was washed with PBST; 5) Secondary antibody incubation: the PVDF membrane was incubated in the diluted secondary antibody at working concentration for 1 h at room temperature, and the membrane was washed with PBST; 6) CCD imaging: color developing solution was prepared, and after the instrument was ready, the color developing solution was added, the parameters were adjusted, and the photograph was taken.

[0132] 6. Sample processing and metabolite detection

[0133] 6.1 Sample processing

[0134] Fresh leaves were cut into 0.05 g and added to 1.5 mL EP tubes containing 10 steel beads (1 mm in diameter) that had been prepared in advance (the steel beads were stored in 75% ethanol and evaporated to remove the alcohol before use). The samples were rapidly frozen in liquid nitrogen.

[0135] (1) Grinding: The adapter was pre-cooled in liquid nitrogen, and the rapidly frozen sample was added. The oscillation frequency of the automatic tissue grinder was set to 55 Hz, and the sample was ground for 1 min.

[0136] (2) Extraction: 250 μL of analytical grade methanol was added to each sample, and the oscillation frequency of the automatic tissue grinder was set to 55 Hz. The sample was ground for 1 min at room temperature, and the supernatant was transferred at 12000 rpm for 5 min. The above operation was repeated, and the supernatants were combined. The combined supernatant was centrifuged at 12000 rpm for 5 min, filtered through a 0.22 μm nylon membrane, and evaporated to dryness at room temperature.

[0137] (3) Resuspension: The dried sample was resuspended in 50 μL of analytical grade methanol, and the sample was transferred to an inner liner tube at 12000 rpm for 5 min. The sample was ready for detection.

[0138] 6.2 Qualitative and quantitative detection of benzylisoquinoline alkaloids

[0139] Instrument: Agilent 1260 HPLC (Reversed-phase liquid chromatography) / Agilent 6545 Q-TOF, Column: Agilent 300 extend-C18 column 4.6x150mm 3.5μm, Mobile phase: A: deionized water (0.1% formic acid), B: acetonitrile (0.1% formic acid). Detection conditions: temperature 30℃, flow rate: 0.35 mL / min, injection 1 μL. Method: 0-1 min, 5% B; 1-20 min, 5-98% B; 20-25 min, 98% B; 25-26 min, 98-5% B; continue to collect for 3 min. Mass spectrometry settings: ion source Dual AJS ESI, positive ion mode, impact energy 0v, 10v, 20v, 40v, m / z range collected 100-1700.

[0140] LC-MS / MS quantitative method, mixed standard of (S)-reticuline, (S)-scoulerine, (S)-tetrahydro-ocoteine, (S)-tetrahydroberberine, berberine was configured at the concentration of 1 ng / μL, 0.2 ng / μL, 0.04 ng / μL, 0.008 ng / μL, 0.0016 ng / μL and 0.00032 ng / μL, and the category was set as standard during detection. After detection, 6 detected standards were imported into MassHunter Quantitative. The level of standard concentration was set in turn, the method was edited, the compound was selected according to the MS result in TIC, the retention time was set, and after checking the standard curve, the fitting mode of response and concentration was selected, and the outliers 0.04 mg / L and 0.0016 mg / L were deleted to ensure the R 2 ≥0.999 of the equation. The standard curve is shown in Figure 1. According to this method, the content of the five compounds in all samples was batch processed.

[0141] Example 1, betalain in vivo imaging method for characterizing endogenous tyrosine content change

[0142] Tyrosine in plants is involved in the synthesis of various secondary metabolites, which prompts the inventors to develop a biosensor for characterizing the content of tyrosine in vivo for rapid screening of functional elements that effectively increase the content of tyrosine. Betalain is a secondary metabolite generated by tyrosine under the catalysis of cytochrome P450 enzyme (CYP76AD1), dopa dioxygenase (DODA) and glycosyltransferase (cDODA-5GT) (Figure 2a). DODA and 5GT have no isozyme in N. benthamiana, so the content of betalain is orthogonal as a characterization result. The treatment with the highest betalain accumulation represents the best tyrosine strengthening strategy.

[0143] At the same time, in order to quantify the content of betalain, plant in vivo imaging test was performed on tobacco leaves synthesizing betalain. According to the absorption wavelength of betalain, the excitation wavelength was set to 535 nm, the absorption light wavelength was tested to be 600 nm, and the generation of betalain was quantified by collecting the signal of fluorescence picture (Figures 2b-c).

[0144] Example 2, construction and screening of benzylisoquinoline alkaloid modified product library

[0145] There are many metabolite-modifying enzymes in N. benthamiana cells, including oxidation, methylation, acetylation, and glycosylation, etc. Here, starting from the parent nucleus of BIAs, (S)-reticuline, the oxidation and methylation products of BIAs are sorted out as shown in Figure 3. On this basis, according to the principle that the substituent group is hydroxyl, acetylation, glycosylation and sulfonation modification can be carried out, and according to the principle that the substituent group is oxygen methyl or nitrogen methyl, glycosylation modification can be carried out, a BIAs modification product library is sorted out (Figure 4, which shows the expected conformation of glycosylation and acetylation modified isorotenine). The library contains information on compound molecular formula, accurate molecular weight and compound name. At the same time, isomers with the same molecular formula are displayed uniformly by adding different compound names. In addition, the information of charged compounds (such as berberine) needs to subtract one hydrogen atom and hydrogen atom mass to represent its molecular formula and molecular weight. Matters needing attention when editing this library: ## needs to be added before Formula, the font of the table must be English, and after all the sorting is completed, save it as CSV (comma separated) format.

[0146] In Agilent MassHunter Qualitative Analysis Workflows, load the information of the self-built compound library, and limit the search conditions (absolute peak height, retention time, ion mode, charge type, etc.). Import the file collected by mass spectrometry in positive / negative ion mode, and preliminarily screen the compounds that meet the requirements. The preliminary screening results are exported as a ".cef" file. Then, in Agilent Mass Profiler Professional software, determine the candidate compounds common to the three parallel samples of the same treatment by Venn analysis. Combine standard samples and known structural information, etc. to further confirm the candidate compounds, help quickly realize the screening and identification of compounds, and the complete process is shown in Figure 5.

[0147] Example 3, the lack of dopamine and aldehyde limits the synthesis of benzylisoquinoline alkaloids

[0148] Due to the spatiotemporal characteristics of the plant chassis, the localization difference of enzymes (for example, two enzymes in the upper and lower streams of the metabolic pathway are distributed in different organelles, and the product in the upper stream needs to cross the membranes of different organelles in succession to participate in the synthesis of the product), and the difference in expression time (there is no overlapping area in the accumulation and degradation time of different enzymes) will limit the synthesis of the target product. Therefore, first, the accumulation amount of the exogenous enzyme is detected by the FLAG tag, and the dynamic change with the infection time is detected.

[0149] The results show that although there are differences in the accumulation amount and time of the enzyme, all the proteins are accumulated at 6 days after infection, as shown in Figure 6. Based on this result, the sample is prepared at 6 days in the subsequent experiment.

[0150] Subsequently, the subcellular localization of the target protein was analyzed by mixing the marker protein localized in the endoplasmic reticulum and infecting tobacco, and the results showed that all the genes were localized in the cytoplasm and endoplasmic reticulum, and there was no difference in organelle localization. The subcellular localization results of the genes are shown in Figure 7.

[0151] Based on the above results, (S)-Norcoclaurine (or (S)-norlaudanosoline) was taken as the target product, and each group of vectors was introduced into N. benthamiana as the host by comparing experimental group 1 (N1) which did not enhance endogenous dopamine and aldehyde synthesis, experimental group 2 (N2) which enhanced endogenous dopamine and aldehyde synthesis (overexpressed enzymes DDC and MAO of exogenous enhancer precursors), and experimental group 3 (N3) which enhanced endogenous enhancer precursors of N. benthamiana (overexpressed enzymes AAAD and PAO of endogenous enhancer precursors) with the control group (NCK) containing empty vectors. The production of the parent nucleus was analyzed.

[0152] The analysis results of (S)-norlaudanosoline as the target product are shown in Table 3 and Figure 8.

[0153] Table 3, Effect of precursor supply on the synthesis of benzylisoquinoline alkaloids

[0154] It can be seen that only the synthesis pathway capable of introducing exogenous dopamine and aldehyde (experimental group 2, N2) can realize the synthesis of the parent nucleus (Table 2, Figure 8). Therefore, by increasing the expression of 3 enzymes (CYP76AD5, DDC, MAO) in N. benthamiana, the synthesis of the parent nucleus (S)-norlaudanosoline was realized.

[0155] Example 4, Plastid engineering to enhance the supply of endogenous tyrosine

[0156] To improve the synthesis of BIAs, the inventors screened the target points that regulate the endogenous tyrosine supply, and used the generation of betalains as the screening result. In plant cells, the main synthesis compartment of tyrosine is plastid, and the intermediate of partial shikimic acid pathway in cytoplasm can synthesize tyrosine. The synthesis process of tyrosine in cytoplasm is as follows: after the shikimic acid synthesized in plastid is transported to cytoplasm, it is catalyzed by cytoplasmic shikimate mutase (CM2), prephenate dehydrogenase (PDH) and tyrosine aminotransferase (TAT) to form tyrosine. This process is similar to the synthesis of tyrosine in microorganisms. The difference is that in microorganisms, the same gene tyrA plays the role of shikimate mutase and prephenate dehydrogenase, and the gene with aminotransferase catalytic activity is tyrB. Although 3-deoxy-D-arabino-heptulosonic acid-7-phosphate synthase (DAHPS) plays an important role in the synthesis of aromatic amino acids, DAHPS in plants is regulated by many factors. In order to make the flow more to the synthesis of tyrosine, the inventors selected the key nodes downstream, such as shikimate mutase (CM1) catalyzing shikimic acid to generate prephenate, prephenate aminotransferase (PPT) catalyzing prephenate to generate aroic acid, and aroic acid dehydrase (ADH) catalyzing aroic acid to generate tyrosine. After understanding the synthesis process of tyrosine in plants, it is expected to enhance the accumulation of endogenous tyrosine through plastid engineering or cytoplasmic engineering strategy, so as to promote the synthesis of target products.

[0157] Firstly, according to the substrate affinity and the degree of feedback regulation of the enzymes in the literature, the inventors selected CM2 of Arabidopsis thaliana (the affinity of CM2 in cytoplasm to substrate shikimic acid is higher than that of CM1 in plastid, and it is not easy to be feedback regulated by product), ADH1 (ADH2 has poor activity and has the activity of catalyzing prephenate), and CAT6 (a reported cationic amino acid transporter protein that can transport tyrosine in plastid to cytoplasm), as well as feedback-inhibited TyrA and TyrB from microorganisms.

[0158] Subsequently, the subcellular localization of the above-mentioned enzymes in leaf mesophyll cells of N. benthamiana was detected, and it was determined that ADH1 was located in plastid and other enzymes were located in cytoplasm, and the results are shown in Figure 9.

[0159] Subsequently, the enzymes in cytoplasm were located in plastid by fusing the known plastid transit peptide signal (from Arabidopsis thaliana Rubisco small subunit 1A, abbreviated as Rs1A, the first 80 amino acids) to the nitrogen end of CM2, TyrA fbr , TyrB and CAT6, and the subcellular localization results of the enzymes fused with transit peptide are shown in Figure 10.

[0160] In order to strengthen the synthesis of tyrosine in plastid, the inventors designed two ways after in-depth analysis, which are as follows:

[0161] P1: Rs1A-CM2, ADH1 (wherein Rs1A represents a truncation of the first 80 amino acids thereof); and

[0162] P2: Rs1A-TyrA fbr , Rs1A-TyrB (wherein Rs1A represents a truncation of the first 80 amino acids thereof).

[0163] The betalain synthesis pathway was combined with the tyrosine gain pathway, respectively, and the effectiveness of the plastid engineering strategy was evaluated by observing the accumulation of betalains within 3 days after infection. The inventors found that the positive control of Rs1A-TyrA fbr was significantly superior compared to Rs1A-TyrB, and was better than the effect of overexpressing Rs1A-CM2 and ADH1, which may be related to the good orthogonality of the microbe-derived enzyme that relieves feedback inhibition, and is not easily regulated, as shown in Figure 11.

[0164] Based on the results of plastid engineering and CAT6 subcellular localization, two pathways were subsequently designed, which are:

[0165] C1: TyrA fbr , TyrB; and

[0166] C2: Rs1A-TyrA fbr , Rs1A-TyrB, Rs1A-CAT6.

[0167] The cytoplasmic engineering strategy had no significant difference compared with the positive control, and C1 and C2 could not achieve the synthesis of tyrosine in the cytoplasm, as shown in Figure 11. The complete compartmentalization design strategy is shown in Figure 12.

[0168] Example 5, Synthesis of Berberine and Its Derivatives in N. benthamiana

[0169] 1. Optimization of enzymes for intermediate synthesis

[0170] In order to achieve the synthesis of the intermediate (S)-reticuline, the inventors first solved the problem of NCS. After in-depth research and screening, it was determined to use PR10A (PR10A) derived from Japanese coptis with the first 24 amino acids truncated instead of NCS1 for the synthesis of (S)-reticuline, and on this basis, the tyrosine gain element was added for testing. The experimental design of the expression construct is shown in Table 4, which is introduced into N. benthamiana for expression, and the product is analyzed.

[0171] Table 4, Experimental design for synthesis of reticuline in N. benthamiana

[0172] (S)-reticuline was detected in both control 2 (RCK2) and experiment 2 (R2) by metabolite detection, and the yield was 0.024 μg / g FW and 0.13 μg / g FW, respectively.

[0173] The results of the relevant LC-MS / MS detection are shown in Figure 13. It is thus confirmed that the strategy of truncating NCS and strengthening the supply of tyrosine can effectively improve the synthesis of BIAs.

[0174] 2. Synthesis of protoberberine

[0175] After the synthesis of (S)-reticuline, the synthesis of berberine was attempted. Berberine is a representative of protoberberine alkaloids. The enzymes for synthesizing berberine from (S)-reticuline include BBE1 from Papaver somniferum, 90MT from Coptis japonica, CAS (CYP719A1) from Coptis japonica, and STOX from Berberis julianae (Ikezawa et al., 2003; Facchini et al., 1996; Takeshita et al., 1995; Gesell et al., 2011).

[0176] The expression constructs in Table 5 were designed for introduction into N. benthamiana for expression and product analysis.

[0177] Table 5, Experimental design for synthesis of protoberberine in N. benthamiana

[0178] According to the results in Table 5, by sequentially increasing the enzymes in the synthesis pathway, a series of protoberberines were finally synthesized in N. benthamiana, including 0.031 μg / g FW of (S)-tetrahydrochelerythrine, 0.007 μg / g FW of (S)-tetrahydroberberine, and 0.004 μg / g FW of berberine. The LC-MS / MS results are shown in Figure 14.

[0179] 3. Synthesis of berberrubine and derivatives

[0180] The inventors' analysis shows that there are many modifications and changes in the 9 position of berberine C, and the pharmacological activities are rich, such as 9- lipidated derivatives have broad-spectrum antitumor activity and higher therapeutic index, 9- nitrogen substituted derivatives (amino or nitrogen heterocyclic substitution) have higher toxicity to tumor cells, 9-acyl and alkyl substituted derivatives have stronger antibacterial activity, and 9-O-glycosyl berberine can significantly improve the bioavailability of berberine.

[0181] Most of the substitution reactions at position 9 of the small fold base are realized through berberine red base. It can be seen from the structure comparison that berberine red base is the product of demethylation at position 9 of berberine. In the synthesis pathway of berberine, (S)-chondodendrine is first modified by 90MT to form (S)-tetrahydrocanadine, and then is oxidized by CAS (a brief for (S)-canadine synthase, including the following CYP719 series) to form (S)-tetrahydroberberine containing a methylene dioxy bridge, and finally is dehydrogenated under the participation of STOX to form berberine.

[0182] If the oxygen methyltransferase is removed, can berberine red base be synthesized? Can CAS oxidize (S)-chondodendrine to generate (S)-nantening base? In order to answer these two questions, the inventors first tested the in vitro activity of CYP719A1 from Japanese coptis and two CYP719A41 and CYP719A42 from fumitory with (S)-chondodendrine as the substrate. The results show that CYP719A1 and CYP719A42 have the ability to catalyze (S)-nantening base, and the activity of CYP719A1 is the best (Fig. 15(a), Fig. 15(b)).

[0183] After verifying the function of CYP719A1, the inventors introduced the elements of berberine red base synthesis pathway and strong precursors, and with the help of modification library and neutral loss characteristics (glucosylation (m / z (NL) = 162.0528), acetylation (m / z (NL) = 42.0106, sulfonation (m / z (N L) = 79.9568)), all samples were rapidly searched, combined with the comparison of secondary characteristic fragments, and finally the synthesis of (S)-nantening base, 9-O-glycosyl-(S)-nantening base and 9-O-glycosyl-(S)-chondodendrine was detected, which shows that Nicotiana benthamiana is an ideal chassis for glycosylation modification of natural products, and endogenous glycosyltransferases with broad substrate specificity can realize glycosylation modification of alkaloids (Fig. 16).

[0184] The above examples only express several embodiments of the present application, and the description is more specific and detailed, but it cannot be understood as a limitation on the scope of the patent of the present application. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims. At the same time, all the documents mentioned in the present application are cited as references, just as each document is cited as a reference.

Claims

1. A method for synthesizing berberine, its precursors, intermediates, or derivatives using tobacco plants as a chassis, comprising expressing exogenous Rs1A-TyrA fbr Rs1A-TyrB enhances the supply of endogenous tyrosine in the chassis.

2. The method as described in claim 1, characterized in that, It also includes enhancing the synthesis pathways of dopamine and aldehydes in the chassis; preferably, expressing exogenous CYP76AD5, DDC, and MAO to enhance the synthesis pathways of dopamine and aldehydes; preferably, it also includes expressing exogenous PR10A or NCS1 in the chassis to enhance the supply of the precursor allodeladanine in the chassis.

3. The method as described in claim 2, characterized in that, Also includes: The enzymes involved in the synthesis of reticuloantholine are expressed to synthesize reticuloantholine; wherein the enzymes involved in the synthesis of reticuloantholine include: 6OMT, CNMT, CYP80B2, and 4'OMT.

4. The method as described in claim 3, characterized in that, Also includes: Enzymes expressing exogenous proberberine, berberine, or derivatives that synthesize related enzymes include: (a) Expression of exogenous BBE1, thereby synthesizing corydaline; (b) Expression of exogenous BBE1 and 9OMT to synthesize tetrahydroafrican tetrahexine; (c) Expression of exogenous BBE1, 9OMT and CYP719A1 to synthesize tetrahydroberberine; (d) Expression of exogenous BBE1, 9OMT, CYP719A1 and STOX to synthesize berberine; (e) Expressing exogenous BBE1, CYP719A1 or CYP719A42 to synthesize berberine derivatives; preferably, the berberine derivatives include: nantylingine, 9-O-glycosyl-nantylingine, 9-O-glycosyl-corydaline.

5. The method according to any one of claims 1-4, characterized in that, The PR10A is a truncated PR10A, with 20-28 amino acids removed from its N-terminus; or The Rs1A-TyrA fbr In Rs1A-TyrB, Rs1A is a truncated form of the first 80 amino acids at the N-terminus of Rs1A.

6. A plant chassis for synthesizing berberine, its precursors, intermediates, or derivatives, said plant chassis expressing exogenous Rs1A-TyrA fbr Rs1A-TyrB; wherein the supply of endogenous tyrosine is enhanced; the plant is a member of the genus *Nicotiana*.

7. The plant tray as described in claim 6, characterized in that, The plant chassis also has an enhanced pathway for the synthesis of dopamine and aldehydes; preferably, the plant chassis expresses exogenous CYP76AD5, DDC, and MAO, thereby enhancing the pathway for the synthesis of dopamine and aldehydes; preferably, the plant chassis expresses exogenous PR10A or NCS1, thereby enhancing the supply of the precursor allodeladanine.

8. The plant tray as described in claim 7, characterized in that, The plant chassis also expresses exogenous reticuloantholine synthesis-related enzymes, thereby synthesizing reticuloantholine; wherein, the reticuloantholine synthesis-related enzymes include: 6OMT, CNMT, CYP80B2, 4'OMT.

9. The plant tray as described in claim 8, characterized in that, The plant chassis also expresses enzymes related to the synthesis of exogenous proberberine, berberine, or its derivatives, including: (a) Exogenous BBE1, thereby enabling the plant chassis to synthesize corydaline; (b) Exogenous BBE1 and 9OMT, thereby enabling the synthesis of tetrahydroafrican tetrahexane from the plant chassis; (c) Exogenous BBE1, 9OMT and CYP719A1, thereby enabling the synthesis of tetrahydroberberine from the plant chassis; (d) Exogenous BBE1, 9OMT, CYP719A1 and STOX, thereby enabling the plant chassis to synthesize berberine; (e) Exogenous BBE1, CYP719A1 or CYP719A42, thereby enabling the synthesis of berberine derivatives from the plant chassis; preferably, the berberine derivatives include: nantynine, 9-O-glycosyl-nantynine, 9-O-glycosyl-corydaline.

10. The application of the plant chassis according to any one of claims 6 to 9 for the synthesis of berberine, its precursors, intermediates or derivatives; Preferably, the precursor comprises: norlactanine; Preferably, the intermediate comprises: reticuloacetine, corydaline, tetrahydroafricanine, and tetrahydroberberine. Preferably, the derivatives include: nantynine, 9-O-glycosyl-nantynine, and 9-O-glycosyl-corydaline.

11. A kit comprising a plant substrate as described in any one of claims 6 to 9; wherein the plant is a plant of the genus *Nicotiana*.

12. A reagent kit comprising: A construct containing the encoding gene of an enzyme selected from the following group: Rs1A-TyrA fbr , Rs1A-TyrB, CYP76AD5, DDC, MAO, PR10A or NCS1, 6OMT, CNMT, CYP80B2, 4'OMT, BBE1, 9OMT, CYP719A1, STOX, CYP719A42; Preferably, the PR10A is a truncated PR10A, with 20-28 amino acids removed from its N-terminus; Preferably, the Rs1A-TyrA fbr In Rs1A-TyrB, Rs1A is a truncated version of the first 80 amino acids at the N-terminus of Rs1A.

13. A method for characterizing the tyrosine content in plants of the genus *Nicotiana*, comprising: The content of betalain in plants was analyzed, and the content of betalain was used to characterize the content of tyrosine.

14. A method for screening Nicotiana species with increased tyrosine content, comprising: The content of betalain in plants was analyzed. Increased betalain accumulation indicates increased tyrosine content. Preferably, the content of betalain in plants was analyzed using in vivo betalain imaging. More preferably, the excitation wavelength was set to 535±5nm, and the absorption wavelength was measured to be 600±5nm. The formation of betalain was quantified by acquiring the signal of the fluorescence image.

Images