Thermosensitive hydrogel-nanoparticle systems to enhance collagen production
A thermosensitive hydrogel-nanoparticle system combining senolytic and senomorphic agents with an angiotensin II receptor blocker addresses aging-related collagen reduction, enhancing skin elasticity and wound healing by targeting senescent cells and boosting collagen production.
Patent Information
- Application Number
- PCT/US2025/037544
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-15
- Filing Date
- 2025-07-14
- Publication Date
- 2026-01-22
AI Technical Summary
Aging leads to reduced collagen production in the skin, resulting in diminished skin elasticity and integrity, and chronic wounds, which conventional monotherapies fail to adequately address.
A combination of senolytic and senomorphic agents, such as metformin and dasatinib, along with an angiotensin II receptor blocker like valsartan, is delivered via a thermosensitive hydrogel-nanoparticle system to target senescent cells and enhance collagen production.
The system effectively reduces cellular senescence and increases collagen synthesis, improving skin health and wound healing by rejuvenating aged skin cells and promoting collagen production.
Smart Images

Figure US2025037544_22012026_PF_FP_ABST
Abstract
Description
[0001]Attorney Docket No.: 44807-0475WO1 THERMOSENSITIVE HYDROGEL-NANOPARTICLE SYSTEMS TO ENHANCE COLLAGEN PRODUCTION CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No.63 / 671,457, filed on July 15, 2024, which is incorporated herein by reference in its entirety. FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with government support under grant no. AG021334 awarded by the National Institutes of Health. The government has certain rights in the invention. SEQUENCE LISTING This application contains a Sequence Listing that has been submitted electronically as an XML file named 44807-0475WO1_SL_ST26.xml. The XML file, created on July 14, 2025, is 11,607 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety. TECHNICAL FIELD The present disclosure relates to the field of biotechnology, and more specifically, to methods of increasing proliferation of senescent cells and production of collagen by proliferating and senescent cells. BACKGROUND Changes in skin structure and physiology occur as a natural consequence of aging and results in diminished health and function of the dermis. Wrinkles and reduced skin elasticity are typical phenomena of skin aging and the result of progressive atrophy of the dermis. One of the main mechanisms that causes dermal atrophy is believed to be a reduction in the amount of extracellular matrix (ECM), particularly collagen, in the dermis. Fibroblasts are a key resident cell type in the dermis and are responsible for the synthesis and degradation of ECM proteins. Factors such as increased oxidative stress from UV radiation result in increased collagen- degrading matrix metalloproteinases (MMPs) and fragmented collagen present in the dermis, Attorney Docket No.: 44807-0475WO1 both of which do not support the level of mechanical tension necessary for effective collagen synthesis. These resulting changes in collagen matrix properties have been proposed to explain this decrease in overall collagen levels in aged skin. Impaired collagen production also stalls the wound healing process in a chronic, non-healing state that requires some type of intervention to resolve. In addition to ECM changes, aging also leads to changes in cellular processes. Cellular senescence is a state where cells cease to divide, while continuing to produce chemicals that can trigger inflammation. Cellular senescence is correlated with age, as senescent fibroblasts accumulate in the skin and promote tissue dysfunction through the senescence-associated secretory phenotype (SASP), resulting in decreased thickness and regenerative capacity. Senescent fibroblasts, characterized by growth-arrest metabolic changes and SASP, have been linked to the progression of several skin aging-related diseases such as seborrheic keratosis, senile lentigo, and melasma. Furthermore, it has been demonstrated that the selective clearance of senescent dermal fibroblasts reduces MMP production and increases collagen synthesis. These findings indicate that senescent fibroblasts are a promising target for therapeutic intervention to improve skin function. By regulating senescent fibroblasts, skin function could be improved. SUMMARY Provided herein are pharmaceutical compositions that include (a) a lipid nanoparticle comprising (i) a senolytic agent, (ii) a senomorphic agent, or any combinations thereof; (b) an angiotensin II receptor blocker; and (c) a hydrogel comprising a thermosensitive and biodegradable polymer. In some embodiments, the lipid nanoparticle targets a5β1 integrin. In some embodiments, the lipid nanoparticle comprises a fibronectin-mimetic peptide (PR_b) on a surface of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises a liposome. In some embodiments, the lipid nanoparticle comprises a micelle. In some embodiments, the senolytic agent comprises one or more senolytic agent(s). In some embodiments, the senolytic agent comprises a BCL-2 family inhibitor. In some embodiments, the senolytic agent comprises dasatinib, quercetin, ABT-263 (Navitoclax), ABT- 737, A-1331852, A-1155463, Fisetin, EF-24 (curcumin analogue), or PZ15227. In some embodiments, the senolytic agent comprises dasatanib and quercetin. Attorney Docket No.: 44807-0475WO1 In some embodiments, the senomorphic agent comprises one or more senomorphic agent(s). In some embodiments, the senomorphic agent comprises metformin. In some embodiments, the senolytic agent and / or the senomorphic agent are encapsulated in the lipid nanoparticle. In some embodiments, the angiotensin II receptor blocker comprising valsartan. In some embodiments, the angiotensin II receptor blocker is encapsulated in the thermosensitive and biodegradable hydrogel. In some embodiments, the angiotensin II receptor blocker is conjugated to the polymer. In some embodiments, the thermosensitive and biodegradable polymer comprises a PVLA-PEG-PVLA triblock copolymer. In some embodiments, the lipid nanoparticle is encapsulated in the hydrogel. Also provided herein are methods of increasing collagen synthesis in a cell from a subject that include administering to the subject a therapeutically effective amount of any one of the pharmaceutical compositions described herein. Also provided herein are methods of reducing cellular senescence in a cell from a subject that include administering to the subject a therapeutically effective amount of any one of the pharmaceutical compositions described herein. In some embodiments, the cell expresses a5β1 integrin on the cell surface. Also provided herein are methods of treating a chronic diabetic wound in a subject that include administering to the subject a therapeutically effective amount of any one of the pharmaceutical compositions described herein. In some embodiments, the administration comprises transdermal or topical administration. In some embodiments, the subject is a human. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Attorney Docket No.: 44807-0475WO1 The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. BRIEF DESCRIPTION OF DRAWINGS FIG.1A shows representative brightfield color microscopy images of SA-β-gal stained GT22 cells, scale bar is 200 μm. FIG.1B shows an exemplary schematic illustration of the PR_b liposomes for delivery of metformin. FIG.1C shows uptake of non-targeted and PR_b functionalized liposomes via flow cytometry. All data are presented as the mean ± SD (n = 3). Statistical significance was determined using a two-sided unpaired t test. For all plots, **P<0.01, ***P<0.001. FIGs.1D-1E show representative confocal laser scanning microscopy images of (FIG.1D) senescent and (FIG.1E) proliferating GT22 cells. Nuclei are shown in blue, cell membrane in red, and liposomes in green, scale bars are 50 μm. FIG.2A shows change in cell number of senescent GT22 cells in response to 2 mM free metformin (Met) or liposomal metformin (NP(Met)) after 48 h treatment. A second group of cells was washed after the 48-h treatment and assessed after an additional 24 h in culture media. FIG.2B shows representative brightfield color microscopy images of SA-β-gal staining after 48 h treatment, scale bars are 200 μm. FIG.2C shows quantification of cells positive for SA-β-gal stain. FIGs.2D-2E show mRNA expression of p16, p21, and p53 genes as measured by RT-qPCR after 48 h treatment (FIG.2D) and after 48 h treatment with an additional 24 h rest after removal of treatment (FIG.2E). All data are presented as the mean ± SD (n = 3). Statistical significance was determined via one-way ANOVA with Tukey’s HSD post-hoc analysis with *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. For all other pairs, P>0.05. P-values are shown in comparison to the metformin-free senescent sample at corresponding timepoints. FIG.3A shows change in cell number of senescent GT83 cells in response to 2 mM free metformin (Met) or liposomal metformin (NP(Met)) after 48 h treatment. A second group of cells was washed after the 48-h treatment and assessed after an additional 24 h in culture media. FIG.3B shows quantification of cells positive for SA-β-gal stain. Attorney Docket No.: 44807-0475WO1 FIGs.3C-3D show mRNA expression of p16, p21, and p53 genes as measured by RT-qPCR after 48 h treatment (FIG.3C), and after 48 h treatment with an additional 24 h rest after removal of treatment (FIG.3D). All data are presented as mean ± SD (n = 3). Statistical significance determined via one-way ANOVA with Tukey’s HSD post-hoc analysis with *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. For all other pairs, P>0.05. P-values are shown in comparison to the metformin-free senescent sample at corresponding timepoints. FIG.4A shows representative fluorescence images of proliferating GT22 cells after 48 h treatment. Cell nuclei are shown in blue and collagen type I alpha 1 chain in red. Scale bars are 200 μm and inset scale bars are 100 μm. FIG.4B shows quantification of fluorescent signal from collagen type I alpha 1 chain (COLIA1) in fluorescent microscopy images. FIG.4C shows cell viability of proliferating GT22 cells treated with different valsartan concentrations after 48 h treatment. All data are presented as the mean ± SD (n = 3). Statistical significance was determined via one-way ANOVA with Tukey’s HSD post-hoc analysis. P- values in (b) are shown in comparison to control (0 µM valsartan) with ****P<0.0001. For all pairs in (c), P>0.05. FIG.5A shows 30% w / v PVLA-PEG-PVLA polymer dissolved in serum-free DMEM as a liquid at 25 °C and a gel at 30 °C and 37 °C as confirmed by tube inversion. FIG.5B shows an exemplary schematic illustration of the PVLA-PEG-PVLA hydrogel with entrapped liposomes and valsartan, not drawn to scale, demonstrating that gelation of the polymer is caused by a phase transition of the polymer from spherical micelles to cylindrical micelles. FIG.5C shows release profile of metformin loaded in PR_b liposomes (NP(Met)) and valsartan (Val) as a free drug, both placed in the 30% w / v hydrogel in PBS at 37 °C. Data are presented as the mean ± SD (n = 3). FIG.6A shows an exemplary schematic of a transwell insert containing hydrogel formulations used to treat cells. FIG.6B shows change in cell number of senescent GT22 cells after 72 h treatment with transwell inserts that had empty hydrogel (Gel), hydrogel with entrapped PR_b liposomes encapsulating metformin (Gel-NP(Met)), hydrogel loaded with valsartan (Gel-Val), or hydrogel that had both valsartan and metformin liposomes (Gel-Val-NP(Met)). Attorney Docket No.: 44807-0475WO1 FIG.6C shows representative fluorescence microscopy images of senescent GT22 cells treated for 72 h with transwell inserts. Cell nuclei are shown in blue, and collagen type I alpha 1 chain in red. Scale bars are 200 μm and inset scale bars are 100 μm. FIG.6D shows quantification of fluorescent signal from collagen type I alpha 1 chain (COLIA1) in fluorescent microscopy images. FIG.6E shows mRNA expression of COLIA1 gene as measured by RT-qPCR. All data are presented as the mean ± SD (n = 3). Statistical significance determined via one-way ANOVA with Tukey’s HSD post-hoc analysis with *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. For all other pairs, P>0.05. In (e), P-values are shown in comparison to the proliferating control. FIG.7A shows representative fluorescence microscopy images of senescent GT83 cells treated with transwell inserts for 72 h that had empty hydrogel (Gel), hydrogel loaded with valsartan (Gel-Val), hydrogel with entrapped PR_b liposomes encapsulating metformin (Gel-NP(Met)), or hydrogel that had both valsartan and metformin liposomes (Gel-Val-NP(Met)). Cell nuclei are shown in blue, and collagen type I alpha 1 chain in red. Scale bars are 200 μm and inset scale bars are 100 μm. FIG.7B shows quantification of fluorescent signal from collagen type I alpha 1 chain (COLIA1) in fluorescent microscopy images. FIG.7C shows mRNA expression of COLIA1 gene in GT83 cells as measured by RT-qPCR after 72 h treatment. FIG.7D shows change in cell number of senescent GT83 cells after 72 h treatment. All data are presented as the mean ± SD (n = 3). Statistical significance determined via one-way ANOVA with Tukey’s HSD post-hoc analysis with *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. For all other pairs, P>0.05. In (d), P-values are shown in comparison to the proliferating control. FIGs.8A-8B show change in GT22 cell number at different concentrations of free metformin in proliferating (FIG.8A) and senescent cells (FIG.8B), treated for 48 h. FIG.8C shows representative brightfield color microscopy images of SA-β-gal staining after 48 h treatment, scale bars are 200 μm. FIG.8D shows quantification of cells positive for SA-β-gal stain. All data are presented as the mean ± SD (n = 3). Statistical significance was determined via one-way ANOVA with Tukey’s HSD post-hoc analysis with *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. For all other pairs, Attorney Docket No.: 44807-0475WO1 P>0.05. In graphs (FIG.8B) and (FIG.8D), P-values are shown in comparison to the senescent control (0 mM metformin). FIG.9 shows change in cell number of senescent GT83 cells at different concentrations of free metformin for 48 h. Data are presented as mean ± SD (n =3). Statistical significance was determined using one-way ANOVA with Tukey’s HSD post-hoc analysis, *P<0.05, **P<0.01. P-values are shown in comparison to control (0 mM metformin). FIG.10 shows representative brightfield color microscopy images of SA-β-gal stained GT83 cells after 48 h of treatment, scale bars are 200 μm. FIG.11 shows 22% w / v PVLA-PEG-PVLA polymer as a liquid in serum-free DMEM at 25 °C and 30 °C, and a gel at 37 °C as confirmed by tube inversion. FIG.12 shows images of 22% w / v and 30% w / v PVLA-PEG-PVLA on mouse skin after 10 min. Red arrows indicate locations of solution placement. FIG.13 shows release profile of metformin loaded in PR_b liposomes (NP(Met)) and valsartan (Val) as a free drug, both placed in the 22% w / v hydrogel in PBS at 37 °C. Results are reported as mean ± SD (n=3). FIG.14 shows cell viability of proliferating GT22 cells exposed to transwell inserts for 72 h. Data are presented as the mean ± SD (n = 3). One-way ANOVA with Tukey’s HSD post-hoc analysis showed no statistical significance between groups (P>0.05). FIG.15A shows representative fluorescence microscopy images of proliferating GT22 cells treated with transwell inserts for 72 h. Cell nuclei are shown in blue and collagen type I alpha 1 chain in red. Scale bars are 200 μm and inset scale bars are 100 μm. FIG.15B shows quantification of fluorescent signal from collagen type I alpha 1 chain (COLIA1) in fluorescent microscopy images. Data are presented as the mean ± SD (n = 3). Statistical significance was determined via one-way ANOVA with Tukey’s HSD post-hoc analysis with ***P<0.001. For all other pairs, P>0.05. FIG.16 shows quantification of collagen type I alpha 1 chain (COLIA1) fluorescence of senescent GT83 cells at different valsartan concentrations treated for 48 h. Data are presented as mean ± SD (n =3). Statistical significance was determined via one-way ANOVA with Tukey’s HSD post-hoc analysis with **P<0.01, ***P<0.001. For all other pairs, P>0.05. DETAILED DESCRIPTION Attorney Docket No.: 44807-0475WO1 Aging has detrimental effects on skin health, with the senescent cell phenotype being particularly concerning. These senescent cells exhibit reduced collagen production, which compromises skin elasticity and integrity. The outcome is a thinner, more fragile skin layer, heightening vulnerability to injuries and increasing the risk of chronic wounds. Given the multifaceted nature of aging, monotherapy may not be sufficient to address the complexities of aging skin. As described herein, in some embodiments, the combination of a senotherapeutic (e.g., a senomorphic (e.g., metformin), a senolytic (e.g., Dasatinib, Quercetin)) and an angiotensin receptor blocker (e.g., valsartan) can provide a two-pronged approach to address age-related skin issues. A senomorphic (e.g., metformin) can reverse aspects of cellular senescence and rejuvenating the function of aged skin cells, and a senolytic (e.g., Dasatinib, Quercetin) can clear senescent cells by killing them. Meanwhile, an angiotensin receptor blocker (e.g., valsartan), promotes collagen production, essential for skin elasticity and resilience, thereby enhancing overall skin health and appearance. This disclosure describes a design of a drug delivery system that allows for the local and extended release of therapeutics to proliferating and senescent cells, as well as methods of using the same. Provided herein are pharmaceutical compositions comprising (a) a lipid nanoparticle comprising (i) a senolytic agent, (ii) a senomorphic agent, or any combinations thereof; (b) an angiotensin II receptor blocker; and (c) a hydrogel comprising a thermosensitive and biodegradable polymer. Also provided herein are methods of increasing collagen synthesis and / or reducing cellular senescence in a cell from a subject that include administering to the subject a therapeutically effective amount of any of the pharmaceutical compositions described herein. Also provided herein are methods of treating a chronic diabetic wound in a subject that include administering to the subject a therapeutically effective amount of any of the pharmaceutical compositions described herein. Various non-limiting aspects of such methods are described herein, and can be used in any combination without limitation. It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Attorney Docket No.: 44807-0475WO1 As used herein, the term “about”, when used herein in reference to a value, refers to a value that is similar, in context to the referenced value. In general, those skilled in the art, familiar with the context, will appreciate the relevant degree of variance encompassed by “about” in that context. For example, in some embodiments, the term “about” may encompass a range of values that are within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the referred value. As used herein, a “cell” can refer to either a prokaryotic or eukaryotic cell, optionally obtained from a subject or a commercially available source. As used herein, the term “subject” refers an organism, typically a mammal (e.g., a human). In some embodiments, a subject is suffering from a relevant disease, disorder, or condition. In some embodiments, a subject is susceptible to a disease, disorder, or condition. In some embodiments, a subject displays one or more signs or symptoms or characteristics of a disease, disorder, or condition. In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition. In some embodiments, a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition. In some embodiments, a subject is a patient. In some embodiments, a subject is an individual to whom diagnosis and / or therapy is and / or has been administered. Pharmaceutical Compositions Provided herein are pharmaceutical compositions that include (a) a lipid nanoparticle comprising (i) a senolytic agent, (ii) a senomorphic agent, or any combinations thereof; (b) an angiotensin II receptor blocker; and (c) a hydrogel comprising a thermosensitive and biodegradable polymer. In some embodiments, a hydrogel comprising a thermosensitive and biodegradable polymer includes (a) a lipid nanoparticle can include (i) a senolytic agent, (ii) a senomorphic agent, or any combinations thereof, and (ii) an angiotensin II receptor blocker within the hydrogel. As used herein, the term “pharmaceutical composition” refers to a composition in which an active agent is formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, a pharmaceutical composition is suitable for administration to a human or animal subject, e.g., via a particular route of administration (e.g., topical). In some embodiments, an active agent is present in a pharmaceutical composition in unit dose amount Attorney Docket No.: 44807-0475WO1 appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. Lipid Nanoparticle including a Senolytic / Senomorphic Agent In some embodiments, a senolytic agent, a senomorphic agent, or any combination thereof is encapsulated in a lipid nanoparticle. As used herein, a “lipid nanoparticle” refers to a nanoparticle composed of lipids, wherein a lipid nanoparticle comprises a lipid membrane or a lipid outer layer and an aqueous core. Lipid nanoparticle (LNP) synthesis comprises (i) lipid component preparation, which involves the combination of different types of lipids to achieve the desired lipid composition; and (ii) aqueous phase preparation, which includes the hydrophilic substance to be encapsulated by the LNP. In some embodiments, a hydrophobic substance can be encapsulated in the lipid membrane. In some embodiments, a lipid nanoparticle can include a liposome, lipid nanoparticle, solid lipid nanoparticle, nanostructured lipid carrier, or cationic lipid-nucleic acid complex. In some embodiments, lipid nanoparticles can be used as a pharmaceutical drug delivery system. In some embodiments, a lipid nanoparticle comprises a lipid. In some embodiments, the lipid nanoparticle comprises cholesterol, ALC-0315, ALC-0159, SM-102, D-Lin-MC3-DMA, D- Lin-DMA, D-Lin-D-DMA, D-Lin-KC2-DMA, DODMA, DOTAP, L319, MC3, amino alcohol lipids, DPPC, DSPC, DPPE, DSPE, DPPS, DSPS, DMG-PEG, DSG-PEG, DOPE-PEG, DSPE- PEG, DPPE-PEG, 1,2 DSPC, or PEG lipids where the PEG is modified to include any of the following end groups -COOH, -OH, -SH, -NHS, -mal, -amine, -azide, -alkyne, -DBCO, - aldehyde, -biotin, -vinylsulfone, or any combinations thereof. In some embodiments, a lipid nanoparticle comprises phosphatidylserine (PS), phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylglycerol (PG), phosphatidic acid (PA), phosphatidylinositol (PI), dimyristoyl phosphatidylglyerol (DMPG) and sphingomyelin (SM), 1,2-dioleoyl-3-trimethylammoniumpropane (DOTAP), 1,2-dioleoyloxy-3- dimethylammoniumpropane (DODAP) and analogues, 1,2-di-(9Z-octadecenoyl)-sn-glycero-3- phosphoethanolamine (DOPE), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), phosphatidylcholine (PC) and dimyristoyl phosphatidylcholine (DMPC), 1,2-di-O-octadecenyl- 3-trimethylammoniumpropane (DOTMA), 1,2-dioleyloxy-N,N-dimethylaminopropane Attorney Docket No.: 44807-0475WO1 (DODMA), dioctadecyldi-methylammonium (DODA(Br) / DDAB), dioctadecyldimethylammoniumchloride (DODAC), 1,2-dimyristoyloxypropyl-1,3- dimethylhydroxyethylammonium (DMRIE), 2,3-dioleoyloxy-N-[2(spermine carboxamide)ethyl]-N,N-dimethyl-1-propanamium trifluoroacetate (DOSPA) analogues, cholesterol, sphingomyelin (SM), or any combinations thereof. In some embodiments, a lipid nanoparticle can include a mixture of lipids suitable to form lipid nanoparticles and / or liposomes for encapsulation of a therapeutic agent (e.g., a senotherapeutic agent (e.g., a senolytic, a senomorphic)). In some embodiments, a suitable lipid solution is chloroform based. For example, a suitable lipid solution may contain a mixture of desired lipids dissolved in pure chloroform (i.e., 100% chloroform). In some embodiments, a suitable lipid solution is ethanol based. In some embodiments, a suitable lipid solution is isopropyl alcohol based. In some embodiments, a suitable lipid solution is dimethylsulfoxide- based. In some embodiments, a suitable lipid solution is a mixture of suitable solvents including, but not limited to, chloroform, ethanol, isopropyl alcohol and dimethylsulfoxide. In some embodiments, a suitable lipid solution may contain a mixture of desired lipids at various concentrations. For example, a suitable lipid solution may contain a mixture of desired lipids at a total concentration of about 0.01 mg / ml, 0.02 mg / ml, 0.03 mg / ml, 0.04 mg / ml, 0.05 mg / ml, 0.06 mg / ml, 0.07 mg / ml, 0.08 mg / ml, 0.09 mg / ml, 0.1 mg / ml, 0.5 mg / ml, 1.0 mg / ml, 2.0 mg / ml, 3.0 mg / ml, 4.0 mg / ml, 5.0 mg / ml, 6.0 mg / ml, 7.0 mg / ml, 8.0 mg / ml, 9.0 mg / ml, 10 mg / ml, 15 mg / ml, 20 mg / ml, 30 mg / ml, 40 mg / ml, 50 mg / ml, or 100 mg / ml. In some embodiments, a suitable lipid solution may contain a mixture of desired lipids at a total concentration ranging from about 0.1-100 mg / ml, 0.5-90 mg / ml, 1.0-80 mg / ml, 1.0-70 mg / ml, 1.0-60 mg / ml, 1.0-50 mg / ml, 1.0-40 mg / ml, 1.0-30 mg / ml, 1.0-20 mg / ml, 1.0-15 mg / ml, 1.0-10 mg / ml, 1.0-9 mg / ml, 1.0-8 mg / ml, 1.0-7 mg / ml, 1.0-6 mg / ml, or 1.0-5 mg / ml. In some embodiments, a suitable lipid solution may contain a mixture of desired lipids at a total concentration up to about 100 mg / ml, 90 mg / ml, 80 mg / ml, 70 mg / ml, 60 mg / ml, 50 mg / ml, 40 mg / ml, 30 mg / ml, 20 mg / ml, or 10 mg / ml. In some embodiments, a suitable lipid solution may contain a mixture of desired lipids at a molar ratio, wherein the mixture of desired lipids comprises DPPC:cholesterol:DPPE-PEG750 in chloroform at a molar ratio of 64:35:1. In some embodiments, any desired lipids may be mixed at any ratios suitable for encapsulating therapeutic agents (e.g., senotherapeutic agents (e.g., a senolytic, a senomorphic)). Attorney Docket No.: 44807-0475WO1 In some embodiments, the lipid nanoparticle targets a5β1 integrin. In some embodiments, a lipid nanoparticle includes a fibronectin mimetic peptide, wherein the fibronectin mimetic peptide specifically binds to a5β1 integrin. In some embodiments, a lipid nanoparticle comprises a fibronectin-mimetic peptide on a surface of the lipid nanoparticle, wherein the fibronectin-mimetic peptide is a PR_b peptide. In some embodiments, a lipid nanoparticle comprises a liposome. In some embodiments, a lipid nanoparticle comprises a micelle. As used herein, a “senotherapeutic agent” refers to a therapeutic agent or therapy to specifically target cellular senescence, an altered cell state associated with aging and age-related diseases. Senotherapeutics can be classified into three development categories that include, (i) senolytics that selectively eliminate senescent cells, (ii) senomorphics that induce senescent cells to obtain the functions and morphology of proliferating cells or delay the progression of proliferating cells to senescent cells, and (iii) senescence-targeting immunotherapeutics that mediate the clearance of senescent cells. In some embodiments, LNPs can be used as a delivery vehicle for senotherapeutic agents (e.g., senolytics and senomorphics). In some embodiments, an LNP can include a senolytic agent, wherein the senolytic agent comprises one or more senolytic agent(s). In some embodiments, an example of a senolytic agent can include, but is not limited to, dasatinib, quercetin, venetoclax, ABT-263 (Navitoclax), ABT-737, A-1331852, A-1155463, 17-AAG (tanespimycin), ganetespib, geldanamycin, 17-DMAG (alvespimycin), fisetin, luteolin, apigenin, curcumin, curcumin analog EF24, o-vanillin (curcumin metabolite), silybum marianum (commonly known as milk thistle), epigallo-catechin-gallate (EGCG), piperlongumine and its analogues, quercetin-3-D-galactose, galactose modified prodrugs (e.g., SSK1, pro-drug A (JHB75B), Nav-Gal, 5FURGa), UBX0101, UBX1967, UBX1325, PZ15227, ARV825, RG7112 (RO5045337), P5091, P22077, GL-V9, FOXO4-related peptide, FOXO4-DRI, cardiac glycosides (e.g., ouabain, ouabagenin, proscillaridin A, digoxin, bufalin, K-stropanthin, strophanthidin), or Azithromycin, Roxithromycin, Tamatinib (R406), MitoTam, AT-406 panobinostat. In some embodiments, a senolytic agent is a BCL-2 family inhibitor. In some embodiments, a senolytic agent comprises dasatinib, quercetin, ABT-263, ABT-737, A-1331852, A-1155463, fisetin, EF24, or PZ15227. In some embodiments, a senolytic agent comprises Attorney Docket No.: 44807-0475WO1 dasatinib and / or quercetin. In some embodiments, a senolytic agent comprises dasatanib and quercetin. In some embodiments, an LNP can include a senomorphic agent, wherein the senomorphic agent comprises one or more senomorphic agent(s). In some embodiments, an example of a senomorphic agent can include, but is not limited to, ruxolitinib, 8K-NBD peptide, metformin, rapamycin, ruxolitinib, resveratrol, atorvastatin, pravastatin, pitavastatin, simvastatin, apigenin, kaempferol, quercetin, quercetin caprylate, STACs, epigallocatechin gallate (EGCG), aspirin, genistein, oleuropein aglycone, hydroxytyrosol, SR12343, UR13756, BIRB796, SB203580, UR13756, MK2.III, PF-3644022, KU-55933, KU-60019, nutlin-3a (MI-63), MABp1 Ab, Mab-IL-6.8 Ab (olokizumab), or ABX-IL-8 Ab. In some embodiments, a senomorphic agent comprises metformin. Hydrogel including an Angiotensin Receptor Blocker In some embodiments, any of the pharmaceutical compositions described herein can include a hydrogel comprising a thermosensitive and biodegradable polymer, wherein the hydrogel comprises an angiotensin II receptor blocker. As used herein, a “hydrogel” refers to a 3D network of amphiphilic polymer chains. A hydrogel includes a polymer that will self- assemble to form a three-dimensional (3D) hydrogel network. In some embodiments, a hydrogel polymer can include any convenient hydrogel polymers, such as, but not limited to, acrylamide and derivatives thereof (e.g., alkyl acrylamide), bis-acrylamide and derivatives thereof (e.g., N,N'-alkylene bis-acrylamide, such as N,N'-methylenebisacrylamide), acrylate and derivatives thereof (e.g., sodium acrylate or alkyl acrylate), methacrylate and derivatives thereof (e.g., alkyl methacrylate or methacryloyl), bis-acrylate and derivatives thereof, polyacrylamide and derivatives thereof, poly(ethylene glycol) (PEG) and derivatives thereof (e.g., PEG-acrylate (PEG-DA), PEG methacrylate (PEGMA), PEG-RGD), polyethylene oxide (PEO) and derivatives thereof, gelatin-methacryloyl (GelMA), methacrylated hyaluronic acid (MeHA), polyaliphatic polyurethanes, polyether polyurethanes, polyester polyurethanes, polyethylene copolymers, polyamides, polyvinyl alcohols (PVA) and derivatives thereof, polycaprolactone (PCL) and derivatives thereof, poly(propylene fumarate) (PPF) and derivatives thereof, poly(lactic-co- glycolic) acid (PLGA or PLG) and derivatives thereof, poly(lactic acid) (PLA, PDLA, PDLLA, PLLA) and derivatives thereof, poly(valerolactone) (PVL) and derivatives thereof, Attorney Docket No.: 44807-0475WO1 poly(aldehyde guluronate) and derivatives thereof, polyanhydrides and derivatives thereof, polypropylene glycol and derivatives thereof, polytetramethylene oxide, polyvinyl pyrrolidone, poly(hydroxyethyl acrylate), and poly(hydroxyethyl methacrylate), cellulose, collagen, hyaluronic acid, chitosan, dextran, agarose, gelatin, heparin, fibrin, alginate, glutaraldehyde, protein polymers, methylcellulose, and the like, or combinations thereof. For any compounds described herein (e.g., monomers, catalysts, etc.), salt forms may be employed (e.g., sodium salts, hydrochloride salts, and the like), and ionic forms may be employed (e.g., anionic or cationic forms). In some embodiments, a hydrogel polymer comprises a poly(δ-valerolactone-co- lactide)-b-poly(ethylene-glycol)-b-poly(δ-valerolactone-co-lactide) PVLA-PEG-PVLA triblock copolymer. In some embodiments, a hydrogel is a thermosensitive and biodegradable hydrogel. As used herein, a “thermosensitive hydrogel” refers to a hydrogel that responds to changes in temperature and usually undergoes a sol-gel phase transition when the temperature changes from room to physiological temperature. In some embodiments, a thermosensitive hydrogel comprises triblock copolymers made up from poly(ethylene glycol) (PEG) linked to hydrophobic polymer blocks. As used herein, a “biodegradable hydrogel” refers to a hydrogel that has the capability to be degraded into biocompatible, nontoxic, and less complex materials that can be easily eliminated from a subject’s body. In some embodiments, a biodegradable hydrogel comprises a biodegradable polymer derived from various natural, semisynthetic, and synthetic sources. In some embodiments, a biodegradable hydrogel comprises a hydrogel polymer that can include, but not limited to, collagen / gelatin, chitosan, hyaluronic acid, chondroitin sulfate, alginate, agar / agarose, fibrin, PEG / PEO, PVA, PPF / OPF, PNIPAAm, PEO-PPO-PEO, PLGA-PEG- PLGA, PEG-PLLA-PEG, poly(aldehyde guluronate), or polyanhydrides. Examples of hydrogels suitable for use in any one of the pharmaceutical compositions described herein are described in U.S. Patent Application Serial No.63 / 180,995, U.S. Patent Application Serial No.63 / 214,056, Vidyasagar et al., ACS Macro Lett.2017 Oct 17;6(10):1134- 1139, and Shabana et al., Int J Pharm.2021 Jan 25:593:120139, the entire contents of each of which are incorporate herein by reference. In some embodiments, a hydrogel comprising a thermosensitive and biodegradable polymer includes (a) a lipid nanoparticle that includes (i) a senolytic agent, (ii) a senomorphic agent, or any combinations thereof, and (ii) an angiotensin II receptor blocker. In some Attorney Docket No.: 44807-0475WO1 embodiments, the lipid nanoparticle is encapsulated in the hydrogel. In some embodiments, the angiotensin II receptor blocker is encapsulated in the hydrogel. In some embodiments, the angiotensin II receptor blocker is conjugated to a thermosensitive and biodegradable polymer of the hydrogel. In some embodiments, the angiotensin II receptor blocker is valsartan (Diovan and Prexxartan), azilsartan (Edarbi), candesartan (Atacand), irbesartan (Avapro), losartan (Cozaar), olmesartan (Benicar), telmisartan (Micardis), or eprosartan (Teveten). Methods of Increasing Collagen Synthesis / Reducing Cellular Senescence in a Cell Also provided herein are methods of increasing collagen synthesis in a cell from a subject that include administering to the subject a therapeutically effective amount of any of the pharmaceutical compositions described herein. Also provided herein are methods of reducing cellular senescence in a cell from a subject that include administering to the subject a therapeutically effective amount of any of the pharmaceutical compositions described herein. In some embodiments, the cell expresses a5β1 integrin on the cell surface. As used herein, the term “administration” typically refers to the administration of a composition to a subject or system to achieve delivery of an agent that is, or is included in, the composition. Those of ordinary skill in the art will be aware of a variety of routes that may, in appropriate circumstances, be utilized for administration to a subject, for example a human. For example, in some embodiments, administration may be parenteral, intra-arterial, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, within a specific organ (e.g., intrahepatic), etc. In some embodiments, administration can be transdermal or topical. In some embodiments, administration may involve only a single dose. In some embodiments, administration may involve application of a fixed number of doses. In some embodiments, administration may involve dosing that is intermittent (e.g., a plurality of doses separated in time) and / or periodic (e.g., individual doses separated by a common period of time) dosing. In some embodiments, administration may involve continuous dosing (e.g., perfusion) for at least a selected period of time. As used herein, “collagen synthesis” refers to a process that occurs in cells such as fibroblasts. Collagen synthesis occurs both intracellularly and extracellularly. One of the main mechanisms that causes dermal atrophy is believed to be a reduction in the amount of extracellular matrix (ECM), particularly collagen, in the dermis, wherein fibroblasts are a key Attorney Docket No.: 44807-0475WO1 resident cell type in the dermis and are responsible for the synthesis and degradation of ECM proteins. In some embodiments, impaired collagen production can also stall the wound healing process in a chronic, non-healing state that requires some type of intervention to resolve. In some embodiments, in addition to ECM changes, aging also leads to changes in cellular processes. As used herein, “cellular senescence” refers to stable cell cycle arrest that can be triggered in normal cells in response to various intrinsic and extrinsic stimuli, as well as developmental signals. Senescence is a form of irreversible growth arrest accompanied by phenotypic changes, resistance to apoptosis and activation of damage-sensing signaling pathways. Senescence is also considered a stress response that can be induced by a wide range of intrinsic and extrinsic insults, including oxidative and genotoxic stress, DNA damage, telomere attrition, oncogenic activation, mitochondrial dysfunction, or chemotherapeutic agents. Senescent cells remain metabolically active and can influence the tissue hemostasis, disease and aging through their secretory phenotype. Senescence is considered as a physiologic process and is important in promoting wound healing, tissue homeostasis, regeneration, and fibrosis regulation. For instance, transient induction of senescent cells is observed during wound healing and contributes to wound resolution. Furthermore, cellular senescence is correlated with age, as senescent fibroblasts accumulate in the skin and promote tissue dysfunction through the senescence-associated secretory phenotype (SASP), resulting in decreased thickness and regenerative capacity. Senescent fibroblasts, characterized by growth-arrest metabolic changes and SASP, have been linked to the progression of several skin aging-related diseases such as seborrheic keratosis, senile lentigo, and melasma. In some embodiments, regulating senescent fibroblasts can result in skin function being improved. Methods of Treating a Chronic Diabetic Wound Also provided herein are methods of treating a chronic diabetic wound in a subject that include administering to the subject a therapeutically effective amount of any of the pharmaceutical compositions described herein. As used herein, the term “treatment” (also “treat” or “treating”) refers to administration of a therapy or composition that partially or completely alleviates, ameliorates, relives, inhibits, delays onset of, reduces severity of, and / or reduces incidence of one or more symptoms, features, Attorney Docket No.: 44807-0475WO1 and / or causes of a particular disease, disorder, and / or condition. In some embodiments, such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and / or condition and / or of a subject who exhibits only early signs of the disease, disorder, and / or condition. Alternatively or additionally, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and / or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and / or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and / or condition. Thus, in some embodiments, treatment may be prophylactic; in some embodiments, treatment may be therapeutic. As used herein, a “chronic diabetic wound” refers to a chronic wound that occurs in a subject with diabetes mellitus due to the impairment of wound healing. Wound healing is a physiologic, complex phenomenon that occurs when skin integrity is lost and consequently also the barrier function of the skin is impaired. In some embodiments, in the events driving wound closure, fibroblasts start to rebuild the wounded area through the release of collagen. However, the healing process in diabetes can be mainly characterized by chronicization of inflammatory conditions, disrupted angiogenic process, reduction of endothelial progenitor cells, and an imbalance in extracellular matrix regulation. In some embodiments, the administration comprises transdermal administration. In some embodiments, the subject is a human. EXAMPLES The disclosure is further described in the following examples, which do not limit the scope of the disclosure described in the claims. Materials - Polyethylene glycol 1500 (PEG1500) was purchased from Millipore Sigma, D,L- lactide was purchased from Acros Organics, δ-valerolactone was purchased from Alfa Aesar, stannous octoate, Sephadex G-50 and calcein were purchased from Sigma-Aldrich. Dipalmitoylphosphatidylcholine (DPPC), cholesterol and 1,2-dipalmitoyl-sn-glycero-3- phosphoethanolamine-N-[methoxy(polyethylene glycol)-750] (DPPE-PEG750) (ammonium salt) and extruder membranes were purchased from Avanti Polar Lipids. CellTiter-Glo assay was Attorney Docket No.: 44807-0475WO1 purchased from Promega. All organic solvents (HPLC grade) were purchased from Sigma- Aldrich and Fisher Scientific. All other chemicals and materials were purchased from Sigma- Aldrich. Synthesis of PVLA-PEG-PVLA Triblock Copolymer - The PVLA-PEG-PVLA triblock copolymer was synthesized using bulk ring-opening polymerization of !-valerolactone and D, L- lactide with PEG1500 as a macro-initiator and stannous octoate as a catalyst. First, PEG1500 was purified by drying at 50 °C overnight in a vacuum oven, and !-valerolactone was vacuum distilled to remove polymer that may have formed from self-polymerization. D,L-lactide was purified by recrystallization in ethyl acetate three times. For the polymer synthesis, 10.94 g of PEG1500 were transferred to a Schlenk flask along with 5.10 g of !-valerolactone, 20.41 g of D, L-lactide, and stannous octoate (0.02 g / mL). The reaction was carried out at 130 °C for 14 h under argon atmosphere. The reaction mixture was cooled to room temperature then dissolved in dichloromethane and precipitated in ice cold ethyl ether two times. The precipitate was dried in a vacuum oven with no heat for 7 days and stored at -20 °C until further use. The final polymer product had PVLA blocks of 1574 g / mol with a VL to LA ratio of 19:81 and an internal PEG block of 1500 g / mol. Preparation and Characterization of Liposomes - Liposomes were prepared using the dry lipid film technique. Stock solutions of DPPC, cholesterol, and DPPE-PEG750 in chloroform were mixed in a molar ratio of 64:35:1. The lipid mixture was placed on a round bottom flask attached to a rotary evaporator at 55 °C to remove the organic solvent and then placed in a vacuum oven overnight to generate a uniform lipid film. For calcein liposomes, used for internalization studies, the lipid film was rehydrated in 2 mM calcein solution in phosphate buffered saline (PBS) for 1 h at 55 °C. The solution was then put through two freeze-anneal-thaw cycles by flash freezing the solution in liquid nitrogen, followed by annealing on ice for 30 min, and finally thawed at 55 °C. The vesicles were extruded through a 100 nm polycarbonate membrane for 21 cycles at 55°C. Unencapsulated calcein was removed by gel permeation chromatography using a Sephadex G-50 packed column. PR_b functionalized liposomes were prepared using a PR_b peptide-amphiphile and added to the lipid mixture at 5 mol%. Lipid concentration was determined using a Stewart Assay, Attorney Docket No.: 44807-0475WO1 and final concentration of the peptide on the liposome surface was determined by the BCA protein assay (Thermo Fisher Scientific) according to the manufacture’s protocol. The particle size and zeta potential of liposomes were determined by a Zetasizer (Malvern Panalytical). Metformin loaded PR_b liposomes were prepared using an active loading procedure. The lipid film was first rehydrated in 250 mM ammonium sulfate solution for 1 h at 55 °C. The liposomes were freeze-anneal-thawed and extruded as before and the unencapsulated ammonium sulfate removed through 3.5 kDA MWCO dialysis at 4 °C overnight. The liposome solution was then mixed with stock solution of metformin hydrochloride in PBS for 2 h at 55 °C. Unencapsulated metformin was removed through further dialysis at 4 °C overnight. To assess the encapsulation efficiency of metformin, the drug loaded liposomes were ruptured with 2% v / v triton X-100, diluted with acetonitrile and centrifuged at 10,000 RPM to pellet down the lipids. The supernatant was analyzed using high performance liquid chromatography (HPLC) on an Agilent 1260 Infinity II system (Agilent Technologies) equipped with a C18 column (Zorbax SB) using a mobile phase of acetonitrile and water (65:35, v / v) modified with 0.1% (v / v) trifluoroacetic acid. Preparation of Hydrogel Encapsulating Valsartan and Liposomes - A polymer solution of PVLA-PEG-PVLA in media was prepared at a concentration of 34% w / v at 4 °C in fetal bovine serum (FBS)-free Dulbecco’s Modified Eagle Medium (DMEM) (Gibco). Liposomes loaded with metformin in PBS were mixed with the polymer solution, and valsartan was also added to the polymer by adding a stock solution of the drug in PBS to the liposome gel mixture followed by stirring at 4 °C for 2 h. For every 100 μL gel 88 μL of 34% w / v polymer, 8 μL of liposome mixture, and 4 μL of valsartan drug stock were mixed. The resulting mixtures had a final polymer concentration of 30% w / v, liposomes at 1.5 mM of lipids, and valsartan at varying concentrations. Solutions were placed in an incubator at 37 °C to form the hydrogel-nanoparticle system. Gelation was observed in less than 1 min and gels were allowed to form for 1 h before use. Drug Release Studies - To study the release of drugs from hydrogels encapsulating metformin- loaded PR_b liposomes and free valsartan, the hydrogel system was first prepared as described above.1 mL of the hydrogel was then placed in a 7 mL scintillation vial (Fisher Scientific) and Attorney Docket No.: 44807-0475WO1 allowed to gel at 37 °C for 1 h. After the formation of the gel, 3 mL of prewarmed PBS was placed on top of the gel and the vial was maintained at 37 °C for the duration of the experiment. At different time points 1 mL of the PBS was removed and replaced with fresh prewarmed PBS. The collected PBS was then treated with 1% v / v tween 80 to fully rupture any intact liposomes in the release media. The samples were analyzed using HPLC equipped with a C18 column using the same method that was used to assess drug encapsulation. Senescence Induction in Human Fibroblasts - GT22 primary dermal fibroblasts from a 22-year- old male and GT83 primary dermal fibroblasts from an 80-year-old female were kindly gifted from the Wirtz lab (Johns Hopkins University). Fibroblasts were grown in cell culture media consisting of DMEM supplemented with 15% FBS and 1% penicillin / streptomycin. Cells were incubated at 37 °C in a humidified incubator with 5% CO2. Cells were detached with 0.25% trypsin and platted on 10 cm dishes for induction of senescence. Bleomycin sulfate was then used to induce senescence. Briefly, bleomycin was added to a final concentration of 50 μM in the culture media for 4 h. After which the media was removed, cells washed once with PBS, and fresh media added to the plate. Cells were then rested for 7 days changing the media every three days before being plated for further experiments. Liposome Internalization in Cell Monolayers via Confocal Microscopy - GT22 fibroblasts were seeded at a density of 300 cells / well in a glass bottom 96-well plate and allowed to adhere overnight at 37 °C. The next day cells were treated with 2 mM calcein-loaded PR_b liposomes in 1 mL of cell culture media with 150 μM lipids for 3 h and 24 h. Following treatment, cells were washed with PBS and fixed using 4% paraformaldehyde solution for 20 min. Membranes were then stained with AlexaFluor 647 wheat germ agglutinin (Thermo Fisher Scientific) for 15 min followed by nuclear stain Hoechst (Thermo Fisher Scientific) for 15 min, both stains were used at 5 μg / mL. Cells were then imaged with a Carl Zeiss LSM790 confocal microscope (Integrated imaging Center, Institute for Nanobiotechnology). Cytotoxicity Studies - Cells were seeded at a density of 300 cells / well in a 96-well plate and allowed to attach overnight. The next day cells were treated for 48 h with cell culture media containing different treatments and cell viability was determined by CellTiter-Glo 2.0 assay Attorney Docket No.: 44807-0475WO1 according to manufacturer’s protocol (Promega). Cell viability was calculated by comparing to a nontreated control plated in parallel. The cytotoxicity of hydrogels encapsulating different treatments was carried out using a 24-well transwell plate (Cornig). Cells were seeded at a density of 1000 cells / well in the lower chamber of a transwell plate, while 30% w / v polymer solution was added to the upper inserts and allowed to gel at 37°C for 30 min before being placed on top of cells. After incubating with the hydrogels for 72 h the CellTiter-Glo assay was carried out. Senescence-associated-β-galactosidase (SA-β-gal) Assay - SA-β-gal activity was evaluated after induction and treatment using the cellular senescence assay kit (CS0030, Millipore). Briefly, 500 GT22 or GT83 cells were seeded in 96-well plates, washed twice with PBS, and then fixed with supplied fixation buffer. Cells were then treated with the staining solution overnight at 37 °C in a CO2 free incubator. Cells were then imaged using an EVOS M5000 microscope. Cells were randomly imaged at 10 different locations within each well and positively stained cells manually counted. RNA Extraction and Reverse Transcriptase Quantitative Polymerase Chain Reaction (RT-qPCR) To isolate mRNA, 200,000 cells for each condition and cell line were first collected by detachment with 0.25% trypsin reagent and then centrifuged for 5 min at 200 RPM to obtain a cell pellet. TriZol reagent (Invitrogen) was then added to the cell pellet and vortexed until the pellet was completely dissolved. Direct-zol Mini Prep kit (Zymo) was used according to the manufacturer’s protocol to complete RNA extraction. cDNA was synthesized from the mRNA using the Bio-Rad iScript kit (Bio-Rad) using the manufacturer’s protocol to make 1000 ng of cDNA in a 20 μL reaction volume. RT-qPCR was conducted with iTaq-SYBR Green (Bio-Rad) using the Bio-Rad CFX384 Touch Real-Time PCR detection system. Primers were obtained from Integrated DNA Technologies and are listed in Table 1. Table 1. Sequences of RT-qPCR Primers Target Oligonucleotide Sequence SEQ ID NO GAPDH Forward GTGGCTGGCTCAGAAAAAGG 1 Reverse GGGGAGATTCAGTGTGGTGG 2 β-actin Forward TGACGTGGACATCCGCAAAG 3 Attorney Docket No.: 44807-0475WO1 Reverse CTGGAAGGTGGACAGCGAGG 4 p16(CDKN2A) Forward TTTCAATGCCGGTAGGGACG 5 Reverse CCCTGTAGGACCTTCGGTGA 6 p21(CDKN1A) Forward CCTGTCACTGTCTTGTACCCT 7 Reverse GCGTTTGGAGTGGTAGAAATCT 8 p53 Forward CAGCACATGACGGAGGTTGT 9 Reverse TCATCCAAATACTCCACACGC 10 COLIA1 Forward GAGGGCCAAGACGAAGACATC 11 Reverse CAGATCACGTCATCGCACAAC 12 Evaluating the Effect of Metformin on Cells - Cells were treated with free metformin or metformin encapsulated in PR_b liposomes in PBS for 48 h. Following treatment, cell viability, SA-β-gal activity and RT-qPCR results were assessed as described above. An extra group was also treated for 48 h and then washed and assessed after an additional 24 h in culture media. Collagen Immunofluorescence Staining - To assess the impact of valsartan and liposomal metformin on the production of collagen, treated wells were stained for collagen type I alpha 1 chain (COLIA1).1,000 GT22 or GT83 cells were first plated in a 24-well transwell system and treatments delivered via the transwell insert containing a hydrogel as described above. After 72 h the insert was removed, cells were washed twice with PBS and fixed with ice cold methanol for 5 min. Cells treated with free valsartan, in the absence of a hydrogel, were incubated in 96-well plates for 48 h, washed twice with PBS and fixed with ice cold methanol for 5 min. All cells were then washed two times with PBS and blocked in 2% bovine serum albumin (BSA) for 1 h at room temperature. Cells were then stained with a 1:200 dilution of anti-human COLIA1 (Sigma, cat. HPA011795) overnight at 4 °C. The following day cells were washed three times with PBS and stained with Hoechst and Goat anti-Rabbit Alexa Fluor 568 secondary antibody (Thermo, cat. A11011) simultaneously.5 µg / mL Hoechst and a 1:500 dilution of the anti-rabbit secondary antibody was added to the wells in 1% BSA and allowed to stain for 1 h. The wells were then washed twice with cold PBS followed by immediate imaging. Images were captured on a Nikon Ti2 equipped with epifluorescence. For each n (n=3 total) experiments were done in triplicate and 5 images were randomly taken per well. Example 1 - Senescent and Proliferating Dermal Fibroblasts Express "5β1 Integrin and PR_b Peptide Improves Nanoparticle Uptake Attorney Docket No.: 44807-0475WO1 Cellular senescence is a state where cells cease to divide and function optimally, often linked to aging and related complications. Due to these altered functionalities, senescent cells may not uptake drugs as efficiently, necessitating targeted delivery strategies to enhance cellular drug absorption. To augment cellular binding and intracellular uptake of liposomes by proliferating and senescent cells, the surface of the liposomes was functionalized with the PR_b peptide that binds to integrin "5β1 with high affinity and specificity. It was first verified that bleomycin could generate senescent GT22 fibroblasts by staining for SA-β-gAL, which showed successful induction as observed by the presence of blue stained cells (FIG.1A). To prepare PR_b functionalized liposomes (FIG.1B), PR_b peptide-amphiphiles were synthesized and incorporated into the lipid bilayer, resulting in a 123 ± 1.1 nm nanoparticle with a surface charge of 9.5 ± 0.3 mV and 3.2 ± 0.6 mol% PR_b on the surface (Table 2). The cell association of PR_b functionalized and non-targeted liposomes with both senescent and proliferating GT22 cells was investigated by flow cytometry (FIG.1C). The fluorescence signal from non-targeted liposomes was minimal after 3 h of incubation and barely increased after 24 h. In contrast, the PR_b functionalized liposomes showed significant fluorescent signal after 3 h that increased over 3- fold after 24 h of incubation in both senescent and proliferating cells. Cell internalization of fluorescently loaded liposomes was further investigated with confocal microscopy. After 3 h both the senescent and proliferating fibroblasts showed liposome internalization that continued to increase after 24 h (FIGs.1D-1E). At the same time points, non-targeting liposomes showed no observable internalization. The confocal results confirmed the observations from the flow cytometry experiments and robustly demonstrate that the PR_b peptide can significantly improve binding and cell uptake of the liposomes by GT22 cells in both the proliferating and senescent state. With the importance of the PR_b peptide established, PR_b liposomes were utilized in subsequent experiments. Table 2. Liposome Characterization Attorney Docket No.: 44807-0475WO1 Example 2 - Liposomal Metformin Improves Senescent Phenotype in GT22 and GT83 Primary Dermal Fibroblasts Having established the enhanced uptake of PR_b-functionalized liposomes in both senescent and proliferating GT22 fibroblasts, the therapeutic potential of these liposomes was then determined. Specifically, metformin, an antidiabetic drug with promising senomorphic effects, was used to investigate its ability to modulate the senescent phenotype and promote cell division, using the liposomal delivery system for efficient drug transport. Intuitively, one might surmise that eliminating these senescent cells could mitigate such age-related issues. However, topical applications aiming to remove these cells might not produce the desired outcomes due to the intricate nature of skin biology and cellular interactions and strategies that improve the senescent phenotype without cytotoxic effects may be more effective. A range of concentrations of free metformin was first tested on proliferating GT22 cells and it was verified that there were no cytotoxic affects (FIG.8A). Next, the same concentration range of free metformin was tested on senescent GT22 cells and a concentration dependent increase in cell number was found that leveled off at 2 mM (FIG.8B). Senescent cells do not proliferate, so this increase in cell number can be interpreted as a partial reversal of the senescent phenotype. To further verify this reversal of the senescent phenotype due to the metformin treatment, SA-β-gal staining was performed of the various treatment conditions and the number of positively stained cells (i.e., senescent) was quantified. As anticipated, the proliferating GT22 cells had a low number of β-galactosidase positive cells, with only 12% being positive compared to 86% positive in the untreated senescent condition (FIGs.8C-8D). Metformin was able to reduce the number of SA-β-gal positive cells in a concentration dependent manner, followed by a plateau at 2 mM metformin and a reduction to 44% remaining positively stained cells (FIG.8D). Therefore, further experiments with liposomal metformin utilized the 2 mM metformin concentration. One approach for achieving high encapsulation efficiency for hydrophilic drugs, such as metformin, is the use of ammonium sulfate gradient method, which forms a pH gradient between the inside of the liposome and outer solution, creating a driving force for the loading of drugs. Metformin was encapsulated with 93% encapsulation efficiency (mole drug encapsulated / total mole drug) in PR_b functionalized liposomes (Table 3). The performance of PR_b liposomes loaded with 2 mM metformin was tested and compared to the performance of free drug dissolved Attorney Docket No.: 44807-0475WO1 in PBS. After treatment with the respective conditions for 48 h, senescent GT22 cells were either immediately assessed or washed and given fresh media and assessed after an additional 24 h. Immediately after treatment, both the free metformin and the metformin loaded liposomes increased cell number by 1.3-fold and 1.2-fold respectively (FIG.2A). After the additional 24 h recovery period, the cell viability was the same for the free metformin group (1.3-fold increase compared to the control), whereas it increased further in the liposomal metformin group (1.4-fold increase compared to the control). One potential explanation for the increased cell viability in the liposomal metformin group after the wash step and the additional rest time, is the potential presence of PR_b liposomes bound to the integrin that continue to be internalized during the recovery period, while in the free drug condition no metformin remains after exchange of the media. Another factor contributing to this observation is that after liposomes are internalized it may still take some time for the payload to be released so the additional incubation time allows for more metformin to escape and exert a therapeutic effect. To further examine the effect of metformin loaded liposomes on the senescence phenotype, SA-β-gal staining was performed post treatment and the number of positively stained cells (FIGs.2B-2C) was quantified. The number of β-galactosidase positive cells decreased from 90% in the untreated condition to 45% positive cells in the free metformin condition and 55% positive cells in the metformin liposomes (FIG.2C). Similar to the trend seen in the previous experiment, the number of SA-β-gal positive cells continued to decrease to 32% after the 24 h recovery in the PR_b liposome condition while it remained stable in the free metformin condition. RT-qPCR was used to evaluate p16, p21 and p53, three common genetic markers of senescence. As expected, the bleomycin induced senescence phenotype increased the expression of these three genes compared to the proliferating cells (FIG.2D), which remained elevated for an additional 24 h, after treatment ended (FIG.2E). Interestingly, the metformin loaded liposomes reduced the expression of these genes more than the free drug condition both with and without the 24 h recovery period. Table 3. Metformin Encapsulation Efficiency (EE) _ Attorney Docket No.: 44807-0475WO1 With promising results of metformin treatment in senescent cells from a young adult, the ability of our system to treat senescent dermal fibroblasts from an older adult was tested, as previous research has identified accumulation of senescent cells as a key dysregulation that progresses with aging. The concentration dependent effects of free metformin was also investigated (FIG.9). Results showed that 2 mM was still the most effective concentration, and it improved cell viability of senescent GT83 cells by 1.1-fold compared to untreated controls. In comparison, 2 mM metformin improved cell viability of senescent GT22 cells 1.5-fold (FIG. 8B). Experiments comparing free and liposomal metformin were repeated with GT83 dermal fibroblasts derived from an older adult. Using an identical induction method of senescence, with SA-β-gal staining, the ability to turn GT83 cells senescent under all conditions was confirmed (FIG.10). Using 2 mM metformin, the efficacy of the free drug versus metformin loaded PR_b functionalized liposomes was tested. In the groups that received an additional 24 h recovery period after the 48 h treatment was washed away, cell viability was increased 1.1-fold in response to the metformin loaded liposomes (FIG.3A). The metformin liposomes were also able to reduce the number of β-galactosidase positive cells by 44% after the 24 h recovery (FIG.3B). The reduction of the senescent phenotype was also seen at the mRNA level, where the liposomal metformin reduced expression of key senescent phenotype markers (FIGs.3C-3D). Taken together these results suggest that encapsulation of metformin in the PR_b functionalized liposomes extended the duration of metformin’s therapeutic effect, and that liposomal metformin can successfully act as a senomorphic, improving cell proliferation of senescent cells and reducing hallmarks of cellular senescence, such as β-galactosidase and associated senescence genes. Example 3 - Valsartan Improves Collagen Production in Proliferating Fibroblasts The efficacy of valsartan, an FDA-approved hypertensive drug, was evaluated in enhancing collagen synthesis in proliferating GT22 fibroblasts, thereby addressing another aspect of cellular aging and regeneration. Several concentrations of valsartan were tested delivered directly to cells in culture media and then assessed collagen production in cells via immunofluorescence staining (FIGs.4A-4B). The fluorescence staining of collagen type I alpha 1 chain was quantified and revealed that collagen production increased in a concentration Attorney Docket No.: 44807-0475WO1 dependent manner, with 50 μM valsartan improving collagen production at a statistically significant amount over the control and other concentrations tested (FIG.4B). Furthermore, it was found that there was no impact on cell viability at any of the tested concentrations (FIG. 4C). Based on these findings, 50 μM valsartan was used for further experiments. Overall, these results agree with previous results showing that valsartan can promote collagen production in vitro and in vivo. Example 4 - PVLA-PEG-PVLA is a Thermosensitive and Biodegradable Hydrogel That Can Provide Extended Release of Encapsulated Payloads In order to synergistically harness the benefits of both metformin and valsartan for optimal treatment of aging-related changes in dermal fibroblasts, a drug delivery method was used that allowed combination of the senomorphic effects of metformin with the collagen production enhancement of valsartan, delivering these topical drugs in a more efficient and targeted manner. The PVLA-PEG-PVLA thermosensitive and biodegradable hydrogel can serve to provide an extended, controlled release of encapsulated therapeutic agents, including metformin and valsartan. This hydrogel has been previously utilized to deliver liposomes carrying chemotherapeutics for the treatment of pancreatic cancer. The triblock copolymer has been shown to undergo a solution-gel phase transition upon heating to 37 °C via a spherical-to- wormlike micelle transformation. Furthermore, the polymer degrades in approximately 45 days in vitro with a moderate pH drop. For this polymer to be tested in vivo in the future it has to gel on the skin of mice at temperatures between 29-33 °C, which is the common skin temperature of laboratory mice. To that end, different concentrations of PVLA-PEG-PVLA were dissolved in DMEM, and the ability of the polymer to gel was tested via Eppendorf tube inversion. It was found that at 30% w / v the polymer was able to form a gel at 30 °C and 37 °C (FIG.5A), while the 22% w / v polymer formed a hydrogel at 37 °C but was not able to gel at 30 °C (FIG.11). Both concentrations were further evaluated on the skin of mice. After allowing the polymers to sit on the skin for 10 min, the 22% w / v polymer did not form a gel, visualized by its ability to flow and deform when probed, whereas the 30% w / v polymer showed a clear gel with no flow and resistance to shape deformation (FIG.12). These results demonstrate that the 30% w / v PVLA-PEG-PVLA is an effective formulation for gelation to occur on mouse skin. Attorney Docket No.: 44807-0475WO1 PR_b liposomes loaded with metformin and free valsartan were encapsulated in the 30% w / v hydrogel (FIG.5B), and the release profile of metformin and valsartan from the same hydrogel-nanoparticle system was investigated at 37 °C in PBS. The encapsulation of metformin-loaded liposomes and free valsartan in the hydrogel resulted in a burst release profile with 35% of valsartan and 28% of metformin releasing in the first 24 h, followed by a sustained release with 96% of valsartan and 80% of metformin released after 30 days (FIG.5C). The experiment was repeated by encapsulating the metformin liposomes and free valsartan in a 22% w / v hydrogel. The release profile of metformin was similar, with 31% releasing in the first 24 h and 81% after 30 days. Valsartan however, released a bit faster from the 22% w / v hydrogel in the first 24 h (46% release), followed by 93% release after 30 days (FIG.13). Example 5 - Delivery of Valsartan and Liposomal Metformin via the PVLA-PEG-PVLA Hydrogel Improves Collagen Production of Senescent Dermal Fibroblasts The ability of valsartan encapsulated in the PVLA-PEG-PVLA hydrogel was first tested to improve collagen production in proliferating fibroblasts. Valsartan was mixed with liquid polymer solution, placed in a transwell insert and allowed to gel. The transwell insert containing the hydrogel was then placed on top of GT22 proliferating cells in a multi-well culture plate (FIG.6A). Neither the hydrogel alone, nor the hydrogel encapsulating valsartan caused a reduction in cell viability, confirming that the hydrogel is a biocompatible system for the treatment of dermal fibroblasts (FIG.14). The ability of valsartan released from the hydrogel to promote collagen production was analyzed by immunofluorescence staining of cells treated with the hydrogel inserts. The valsartan-hydrogel group showed improved collagen production compared to the control group, whereas the empty hydrogel had no effect on collagen production (FIG.15). Metformin loaded PR_b liposomes and / or free form valsartan were mixed with liquid polymer solution, placed in a transwell insert, allowed to gel, and the transwell insert was then placed on top of GT22 senescent cells (FIG.6A). Liposomal metformin released from the hydrogel alone or in combination with valsartan increased cell number 1.2-fold, whereas valsartan on its own had no effect on the proliferation of senescent cells (FIG.6B). Immunofluorescence imaging revealed that both the valsartan and the combination of valsartan plus liposomal metformin were able to increase collagen production, while liposomal metformin Attorney Docket No.: 44807-0475WO1 alone had no impact (FIGs.6C-6D). Quantification of these images demonstrates that the combination treatment was more effective than valsartan, increasing collagen production 2.5-fold compared to the empty gel. The valsartan treatment on its own increased collagen production 2- fold (FIG.6D). These results can be understood as the additive effect of metformin increasing the number of cells present, which then allows for more cells to be impacted by the valsartan and further increases of collagen levels than valsartan alone. The improved collagen production was further verified by looking at the mRNA expression levels of COLIA1 in the different treatment groups and observed an increase in collagen mRNA expression in both the valsartan and the valsartan plus metformin groups (FIG.6E). The combination of valsartan and liposomal metformin on senescent cells resulted in a 7.3-fold increase in COLIA1 mRNA expression compared to senescent cells that did not receive these drugs, and 4.4-fold increase in mRNA expression compared to the proliferating control, which was close to the 5.3-fold increase induced when treating proliferating cells with valsartan (P>0.05 between Gel-Val proliferating cells and Gel-Val-NP(Met) senescent cells). These results show that the valsartan plus metformin combination can result in the partial reversal of the senescent phenotype and that these cells can show a similar functional response, i.e., the production of collagen, as proliferating cells. To verify that the metformin loaded liposomes and valsartan combination could improve senescent cell function in GT83 cells derived from an older adult, the same transwell experiment was performed as was done above. Since the response of the senescent GT83 cells to metformin was not as strong as in the senescent GT22 cells, first, a range of valsartan concentrations were tested to determine the best conditions that can promote collagen production. Interestingly, an increase of valsartan concentration to 75 μM was observed to be most effective at increasing collagen production in senescent GT83 cells (FIG.16). This may be due to alterations in the skin angiotensin system, resulting in an impaired response. Employing valsartan at 75 μM, valsartan and metformin liposomes were co-delivered from the PVLA-PEG-PVLA hydrogel. Immunofluorescence staining revealed a similar trend to GT22 senescent cells, with the valsartan and valsartan plus liposomal metformin condition showing improved collagen production and the combination treatment being superior to all other treatments (FIGs.7A-7B). The valsartan treatment in senescent GT83 cells increased collagen I production by 2-fold and the combination treatment caused a 2.5-fold increase compared to the empty gel group (FIG.7B). The same increases were observed in the senescent GT22 cells (FIG.6D). Thus, the response of the Attorney Docket No.: 44807-0475WO1 senescent GT83 cells to the two treatments is very promising for cells from an older adult. The improved collagen production was further verified by RT-qPCR, which showed that mRNA expression of COLIA1 was also improved by both the valsartan and valsartan / metformin combination treatment (FIG.7C). The GT83 senescent cells treated with valsartan and liposomal metformin showed a 6.6-fold increase in collagen I mRNA expression compared to the senescent group that did not receive the drugs, and 2.2-fold increase compared to the proliferating control sample. The combination treatment also resulted in 1.1-fold increase in the number of senescent GT83 cells (FIG.7D). Taken together, the data show that the additive properties of these drugs are promising, demonstrating that the co-delivery treatment can improve collagen production 2.5-fold in senescent cells from a younger and older adult, making this a promising treatment option for dermal dysregulation due to low collagen production.
Claims
Attorney Docket No.: 44807-0475WO1 WHAT IS CLAIMED IS:
1. A pharmaceutical composition comprising: (a) a lipid nanoparticle comprising (i) a senolytic agent, (ii) a senomorphic agent, or any combinations thereof; (b) an angiotensin II receptor blocker; and (c) a hydrogel comprising a thermosensitive and biodegradable polymer.
2. The pharmaceutical composition of claim 1, wherein the lipid nanoparticle targets a5β1integrin.
3. The pharmaceutical composition of claim 1 or 2, wherein the lipid nanoparticle comprises a fibronectin-mimetic peptide (PR_b) on a surface of the lipid nanoparticle.
4. The pharmaceutical composition of any one of claims 1-3, wherein the lipid nanoparticle comprises a liposome.
5. The pharmaceutical composition of any one of claims 1-3, wherein the lipid nanoparticle comprises a micelle.
6. The pharmaceutical composition of any one of claims 1-5, wherein the senolytic agent comprises one or more senolytic agent(s).
7. The pharmaceutical composition of any one of claims 1-6, wherein the senolytic agent comprises a BCL-2 family inhibitor.
8. The pharmaceutical composition of any one of claims 1-6, wherein the senolytic agent comprises dasatinib, quercetin, ABT-263 (Navitoclax), ABT-737, A-1331852, A- 1155463, Fisetin, EF-24 (curcumin analogue), or PZ15227.
9. The pharmaceutical composition of claim 8, wherein the senolytic agent comprises dasatanib and quercetin.Attorney Docket No.: 44807-0475WO1 10. The pharmaceutical composition of any one of claims 1-9, wherein the senomorphic agent comprises one or more senomorphic agent(s).
11. The pharmaceutical composition of any one of claims 1-10, wherein the senomorphic agent comprises metformin.
12. The pharmaceutical composition of any one of claims 1-11, wherein the senolytic agent and / or the senomorphic agent are encapsulated in the lipid nanoparticle.
13. The pharmaceutical composition of any one of claims 1-12, wherein the angiotensin II receptor blocker comprising valsartan.
14. The pharmaceutical composition of any one of claims 1-13, wherein the angiotensin II receptor blocker is encapsulated in the thermosensitive and biodegradable hydrogel.
15. The pharmaceutical composition of any one of claims 1-13, wherein the angiotensin II receptor blocker is conjugated to the polymer.
16. The pharmaceutical composition of any one of claims 1-15, wherein the thermosensitive and biodegradable polymer comprises a PVLA-PEG-PVLA triblock copolymer.
17. The pharmaceutical composition of any one of claims 1-16, wherein the lipid nanoparticle is encapsulated in the hydrogel.
18. A method of increasing collagen synthesis in a cell from a subject, the method comprising: administering to the subject a therapeutically effective amount of the pharmaceutical composition of any one of claims 1-17.Attorney Docket No.: 44807-0475WO1 19. A method of reducing cellular senescence in a cell from a subject, the method comprising: administering to the subject a therapeutically effective amount of the pharmaceutical composition of any one of claims 1-17.
20. The method of claim 18 or 19, wherein the cell expresses a5β1 integrin on the cell surface.
21. A method of treating a chronic diabetic wound in a subject, the method comprising: administering to the subject a therapeutically effective amount of the pharmaceutical composition of any one of claims 1-17.
22. The method of any one of claims 18-21, wherein the administration comprises transdermal or topical administration.
23. The method of any one of claims 18-22, wherein the subject is a human.
Citation Information
Patent Citations
Use of PDE iii inhibitors for the reduction of heart size in mammals suffering from heart disease
US20180185402A1
Particle containing lipid nanoparticles and method for producing same
US20230210767A1