Modular linked chimeric antigen receptors

WO2026024468A1PCT designated stage Publication Date: 2026-01-29CARIBOU BIOSCIENCES INC
View PDF 26 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/037092
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-26
Filing Date
2025-07-10
Publication Date
2026-01-29

Smart Images

  • Figure US2025037092_29012026_PF_FP_ABST
    Figure US2025037092_29012026_PF_FP_ABST
Patent Text Reader

Abstract

The invention comprises modular linked chimeric antigen receptors (MODL-CARs), cells expressing the MODL-CARs, compositions comprising the cells and methods of making and using the same, including methods of treatment with MODL-CAR expressing engineered cells.
Need to check novelty before this filing date? Find Prior Art

Description

MODULAR LINKED CHIMERIC ANTIGEN RECEPTORSCROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims priority to a U.S. provisional patent application Serial No.63 / 676,169 filed on July 26, 2024, and is incorporated herein by reference in its entirety.FIELD OF THE INVENTION

[0002] The invention related to the field of cell therapy and more specifically, to celltherapy with immune cells genetically engineered to express antigen receptors.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0003] None.SEQUENCE LISTING

[0004] The instant application contains a Sequence Listing which has been submittedelectronically in XML format and is hereby incorporated by reference in its entirety. Said XMLcopy, created on June 17, 2025, is named CBI059_30_SL.xml and is 190,746 bytes in size.BACKGROUND OF THE INVENTION

[0005] The natural immune system has evolved a variety of binding molecules recognizingeach antigen. In humans, immunoglobulins exist in five classes IgA, IgD, IgE, IgG and IgM, withIgG and IgA classes further broken into subclasses. T cell receptors exist in four different forms:the aß receptor and the γδ receptor, the γδ receptor having three different forms. In contrast, thestate-of-the-art cell therapies are engineered as homogenous products having a single type ofantigen-binding molecule that produces a small range of effects within the cell. For example, FDAapproved autologous CAR-T cell therapies YESCARTA®, KYMRIAH®, and BREYANZI® allinvolve a chimeric antigen receptor (CAR) capable of binding the CD19 antigen and having a verysimilar receptor structure. Each of the receptors includes the CD3( activation domain as part of thecytoplasmic portion of the CAR. Upon binding the CD19 antigen, the immunoreceptor tyrosine-based activation motif (ITAM) of the CD36 domain starts a phosphorylation cascade within theCAR-T cell leading to cell activation. While the CAR-T cell utilizes this single pathway, a varietyof pathways are active in target tumor cells. With innate heterogeneity of tumor cells, it is notsurprising that complete response rate for the state-of-the-art autologous "single-agent" CAR-Tcell therapies has not exceeded 65-66%.

[0006] There is a need for a multi-prong tool approach to heterogeneity of targets withinthe tumor. The instant disclosure comprises modular antigen receptors where more than oneantigen binding moiety is combined with more than one intracellular domain to create a populationof cells comprising several chimeric antigen receptors with varying properties.SUMMARY OF THE INVENITON

[0007] In one embodiment, the invention is a chassis for a modular chimeric antigenreceptor (MODL-CAR) comprising: an intracellular component comprising a signaling domain; atransmembrane component, and a connector component comprising a first association domaincomponent and a second association domain conjugated to the intracellular component, whereinthe first association domain is capable of specific association with the second association domain.In some embodiments, the first association domain comprises at least a portion of the constantregion of an immunoglobulin heavy chain (CH1) and the second association domain comprises atleast a portion of the constant region of an immunoglobulin light chain (CL). In some embodiments,the first association domain comprises or consists essentially of SEQ ID NO: 01, and the secondassociation domain comprises or consists essentially of SEQ ID NO: 02.

[0008] In some embodiments, the first and second association domains comprise at least aportion of the Fc region, i.e., the constant region of an immunoglobulin heavy chain (CH2 or CH3),the Fc region. In some embodiments, the first and second association domains derived from the Fcregion comprise the following amino acid changes: 1) Y407T in the first association domain andT366Y in the second association domain; or 2) Y407A in the first association domain and T366Win the second association domain; or 3) F405A in the first association domain and T394W in thesecond association domain; or 4) F405W in the first association domain and T394S in the secondassociation domain; or 5) Y407T in the first association domain and T366Y in the secondassociation domain; or 6) T366Y and F405A in the first association domain and T394W andY407T in the second association domain; or 7) T366W and F405W in the first association domainand T394S and Y407A in the second association domain; or 8) F405W and Y407A in the firstassociation domain and T366W and T394S in the second association domain; or 9) T366W in thefirst association domain and T366S, L368A, and Y407V in the second association domain;wherein the amino acid numbering is according to Kabat EU index numbering system. In someembodiments, the first and second association domains derived from the Fc region comprise thefollowing amino acid changes: 1) Y349C in the first association domain and $354C in the secondassociation domain; or 2) Y349C in the first association domain and E356C in the secondassociation domain; or 3) Y349C in the first association domain and E357C in the secondassociation domain; or 4) L351C in the first association domain and $354C in the secondassociation domain; or 5) T394C in the first association domain and E397C in the secondassociation domain; or 6) D399C in the first association domain and K392C in the secondassociation domain; wherein the amino acid numbering is according to Kabat EU index numberingsystem.. In some embodiments, the first and second association domains derived from the Fcregion comprise the following amino acid changes: 1) K409D or K409E in the first associationdomain and D399K or D399R in the second association domain; or 2) K392D or K392E in thefirst association domain and D399K or D399R in the second association domain; or 3) K439D orK439E in the first association domain and E356K or E356R in the second association domain; or4) K370D or K370E in the first association domain and E357K or E357R in the second associationdomain; or 5) K409D and K360D in the first association domain and D399K and E356K in thesecond association domain; or 6) K409D and K370D in the first association domain and D399Kand E357K in the second association domain; or 7) K409D and K392D in the first associationdomain and D399K, E356K, and E357K in the second association domain, or 8) K409D andK392D in the first association domain and D399K in the second association domain; or 9) K409Dand K392D in the first association domain and D399K and E356K in the second associationdomain; or 10) K409D and K392D in the first association domain and D399K and D357K in thesecond association domain; or 11) K409D and K370D in the first association domain and D399Kand D357K in the second association domain; or 12) D399K in the first association domain andK409D and K360D in the second association domain; or 13) K409D and K439D in the firstassociation domain and D399K and E356K in the second association domain; wherein the aminoacid numbering is according to Kabat EU index numbering system.

[0009] In some embodiments, the first and second association domains are complementarycoiled-coil domains. In some embodiments, the first association domain comprises or consistsessentially of SEQ ID NO: 17, and second association domain comprises or consists essentially ofSEQ ID NO: 18, or first association domain comprises or consists essentially of SEQ ID NO: 19,and second association domain comprises or consists essentially of SEQ ID NO: 20.

[0010] In some embodiments, the first and second association domains are complementaryleucine zipper domains. In some embodiments, the dissociation constant (Ka) between the first andthe second leucine zipper association domains is between 10 nM and 30 nM. In someembodiments, the first association domain comprises or consists essentially of SEQ ID NO: 8, andsecond association domain comprises or consists essentially of SEQ ID NO: 10, or the firstassociation domain comprises or consists essentially of SEQ ID NO: 9, and second associationdomain comprises or consists essentially of SEQ ID NO: 11.

[0011] In some embodiments, the first and second association domains are halves of a splitintein. In some embodiments, a C-terminus of the transmembrane component is conjugated to anintein-N and a N-terminus of the intracellular component is conjugated to intein-C. In someembodiments, the intein-N and the intein-C interact to covalently connect the C-terminus of thetransmembrane component to the N-terminus of the intracellular component. In someembodiments, the sequence of the halves of the split intein is derived from the DNA PolymeraseIII sequence from Nostoc punctiforme PCC73102 or from the DNA Polymerase III sequence fromSynechocystis sp. PCC6803. In some embodiments, the first association domain comprises orconsists essentially of SEQ ID NO: 12, and second association domain comprises or consistsessentially of SEQ ID NO: 13, or the first association domain comprises or consists essentially ofSEQ ID NO: 14, and second association domain comprises or consists essentially of SEQ ID NO:15, or the first association domain comprises or consists essentially of SEQ ID NO: 14, and secondassociation domain comprises or consists essentially of SEQ ID NO: 16.

[0012] In some embodiments, the first and second association domains are cross-ẞ motifdomains. In some embodiments, the first and second cross-ẞ motif domains comprise amino acidchanges not present in cross-ẞ motif domains of a wild-type Fc structure resulting in additionaldisulfide bonds between the association domains in the connector component. In someembodiments, first and second cross-ẞ motif domains comprise amino acids changes not presentin cross-ẞ motif domains of a wild-type Fc structure resulting in additional electrostaticinteractions between the association domains in the connector component.

[0013] In some embodiments, the transmembrane domain is the transmembrane domain ofa protein selected from the group consisting of T cell receptor alpha chain, T cell receptor beta-chain, CD2, CD3, CD4, CD5, CD8, CD9, CD16, CD22, CD27, CD28, CD33, CD37, CD45, CD64,CD80, CD86, CD134, CD137, CD154, DNAM1, ICOS, NKp44, NKp46, NKG2A, NKG2C,NKG2D, 2B4, TMIG2, TLR1, TLR2, TLR4, TLR5, TLR6, and GITR.

[0014] In some embodiments, the intracellular component comprises an activation domain,e.g., an activation domain is selected from the group consisting of CD3%, CD3ɛ, CD28, CD27,OX40 (CD134), 4-1BB (CD137), ICOS (CD278), IL-2Rẞ (CD122), IL-2Ra (CD132), DAP10,DAP12, DNAM1, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, MyD88,IL18R, and CD40.

[0015] In some embodiments, the intracellular component comprises a costimulatorydomain, i.e., a costimulatory domain selected from the group consisting of CD28, 4-1BB, OX40,ICOS, DAP-10, CD27, CD30, CD40, NKGD2, CD2, FN14, HVEM, LTBR, CD28H, TNFR1,TNFR2, BAFF-R, BCMA, TACI, TROY, RANK, EDAR, XEDAR, GITR, DR6, and NGFR.

[0016] In some embodiments, the activation domain comprises a binding motif for anintracellular signal transduction protein, e.g., a JAK binding motif comprising SEQ ID NO: 112,or a STAT binding comprising a sequence selected from the group consisting of SEQ ID NO: 108-111.

[0017] In one embodiment, the invention is a MODL-CAR comprising the chassis for aMODL-CAR described above, further comprising an extracellular component that comprises anantigen binding domain. In some embodiments, the antigen binding domain is selected from anantibody variable fragment (Fv), an antibody single-chain variable fragment (scFv), aproteolytically-cleaved antibody-binding fragment (Fab), a bi-specific Fab F(ab)2, and a nanobody(Ѵнн antibody). In some embodiments, the MODL-CAR comprises a linker, such a linkercomprising a formula (GxSy)n, where G is glycine and S is serine, e.g., G4S (SEQ ID NO: 113). Insome embodiments, the MODL-CAR further comprises a signal sequence, e.g., a signal sequenceis selected from a CD8 signal sequence and a CD28 signal sequence.

[0018] In some embodiments, the antigen binding domain is capable of binding an antigenselected from the group consisting of CD4, CD16V, CD19, CD22, CD20, CD28, CD30, CD33,CD37, CD38, CD44, CD47, CD70, CD73, CD79b, CD112, CD123, CD133, CD137, GD2,DNAM-1, IL-11Ra, IL-13RA, IL-13RA2, BCMA, CD138, NKG2-D, HER2 / Neu, B7-H3(CD276), B7-H6, CA-125, MUC-1, MUC-16, mutated TP53, mutated Ras, ERBB2 (HER2), folatebinding protein (FBP), L1CAM (CD171), CLL1 (CD371), CEA, Claudin 18.1, Claudin 18.2, CS-1, CSPG4, mutated EGFR, EFGRvIII, ENPP3, EpCAM, EphA2, ErbB, FAP, FLT-3, FRα, GD3,Glypican 3, LewisY / LeY, c-Met, mesothelin, MG7, Nectin-4, NGFR, PD1, PD-L1, PD-L2, PSCA,PSMA, PTK7, ROR1, SLAMF7, STEAP, STEAP2, TACI, TAG72, TROP2, ULBP, MICA / B,VEGFR2, PDGFR, ULBP1-6, and WT1.

[0019] In some embodiments, the MODL-CAR comprises the structure SEQ ID NO: 21-SEQ ID NO: 01-SEQ ID NO:02-SEQ ID NO: 22. In some embodiments, the MODL-CARcomprises the structure SEQ ID NO: 21-SEQ ID NO: 02-SEQ ID NO:01-SEQ ID NO: 22. In someembodiments, the MODL-CAR is encoded by a nucleic acid comprising SEQ ID NO: 51 or SEQID NO: 52.

[0020] In some embodiments, the MODL-CAR comprises the structure SEQ ID NO: 21-SEQ ID NO: 8-SEQ ID NO: 10-SEQ ID NO: 22. In some embodiments, the MODL-CARcomprises the structure SEQ ID NO: 21-SEQ ID NO: 9-SEQ ID NO: 11-SEQ ID NO: 22. In someembodiments, the MODL-CAR is encoded by a nucleic acid comprising SEQ ID NO: 53 or SEQID NO: 54.

[0021] In some embodiments, the MODL-CAR comprises the structure SEQ ID NO: 21-SEQ ID NO: 17-SEQ ID NO: 18-SEQ ID NO: 22. In some embodiments, the MODL-CARcomprises the structure SEQ ID NO: 21-SEQ ID NO: 19-SEQ ID NO: 20-SEQ ID NO: 22. Insome embodiments, the MODL-CAR is encoded by a nucleic acid comprising SEQ ID NO: 58 orSEQ ID NO: 59.

[0022] In some embodiments, the MODL-CAR comprises the structure SEQ ID NO: 21-SEQ ID NO: 12-SEQ ID NO: 13-SEQ ID NO: 22. In some embodiments, the MODL-CARcomprises the structure SEQ ID NO: 21-SEQ ID NO: 14-SEQ ID NO: 15-SEQ ID NO: 22. Insome embodiments, the MODL-CAR comprises the structure SEQ ID NO: 21-SEQ ID NO: 14-SEQ ID NO: 16-SEQ ID NO: 22. In some embodiments, the MODL-CAR is encoded by a nucleicacid comprising SEQ ID NO: 55, or SEQ ID NO: 56, or SEQ ID NO: 57.

[0023] In one embodiment, the invention is an isolated nucleic acid comprising a sequenceencoding the MODL-CAR described above. In some embodiments, the isolated nucleic acidfurther comprises homology arms flanking the sequence encoding the MODL-CAR, wherein thehomology arms are capable of hybridizing to a sequence of a genomic locus selected from thegroup consisting of TRAC, B2M, PDCD1, CBLB, CISH, TIGIT, TIM3, LAG3, CIITA, DNMT3Aand a safe harbor locus. In some embodiments, the isolated nucleic acid further comprises apromoter selected from the group consisting of a U6 promoter, a H1 promoter, a dihydrofolatereductase (DHFR) promoter, an MND promoter, a human ubiquitin C (UBC) promoter, a CAGpromoter, a CaMKIIa promoter, an SV40 early promoter, an SV40 late promoter, acytomegalovirus (CMV) immediate early promoter, a Rous sarcoma virus long terminal repeat(RSV-LTR) promoter, a mouse mammary tumor virus long terminal repeat (MMTV-LTR)promoter, a spleen focus-forming virus (SFFV) promoter, a murine embryonic stem cell virus(MSCV) promoter, a ẞ-interferon promoter, a hsp70 promoter, an EF-la promoter, an EFlapromoter, an EFla core (EFC) promoter, a CBA promoter, a ẞ-actin promoter, amyeloproliferative sarcoma virus (MPSV) promoter, a mouse or human phosphoglycerate kinase1 (PGK1) promoter, and an interferon gamma (IFNy) promoter. In some embodiments, the isolatednucleic acid further comprises a vector sequence. In some embodiments, the vector comprises aplasmid vector or a viral vector derived from a virus selected from the group consisting of anadenovirus type 2 and an adenovirus type 5, a retrovirus, a lentivirus, an adeno-associated virus(AAV), a simian virus 40 (SV40), vaccinia virus, Sendai virus, Epstein-Barr virus (EBV), andherpes simplex virus (HSV). In some embodiments, the isolated nucleic acid comprises a sequenceselected from the group consisting of SEQ ID NOs: 51-59.

[0024] In one embodiment, the invention is an immune cell comprising the MODL-CARdescribed herein. In some embodiments, the immune cell is selected from the group consisting ofa T cell, a natural killer (NK) cell, an induced natural killer (iNK) cell, a monocyte, and amacrophage. In some embodiments, the immune cell comprises a nucleic acid sequence selectedfrom the group consisting of SEQ ID NOs: 51-59. In some embodiments, the immune cellcomprises two or more MODL-CARs, wherein the MODL-CARs differ in at least one of theantigen-binding domain, and the cytoplasmic component. In some embodiments, the first MODL-CAR comprises an antigen-binding domain targeting the CD19 antigen and a cytoplasmiccomponent comprising a 4-1BB costimulatory domain, and a second MODL-CAR comprises andantigen-binding domain targeting the BCMA antigen and a cytoplasmic component comprising aCD28 costimulatory domain.

[0025] In some embodiments, the immune cell comprises inactivation of one or moreimmune checkpoint genes or regulatory genes selected from the group consisting of PDCD1,CIITA, CTLA-4, LAG3, Tim3, BTLA, BY55, TIGIT, B7H5, LAIRI, SIGLEC10, B2M, CISH, CBLBand 2B4. In some embodiments, immune cell comprises inactivation of the B2M gene and furthercomprising insertion of a HLA-E-B2M fusion into the B2M locus.

[0026] In one embodiment, the invention is a method of making the immune cell describedabove, the method comprising introducing a nucleic acid encoding a MODL-CAR into a cellselected from the group consisting of a T cell, a natural killer (NK) cell, an induced natural killer(iNK) cell, a monocyte, and a macrophage. In some embodiments, the nucleic acid encoding theMODL-CAR comprises a sequence selected from SEQ ID NOs: 51-59. In some embodiments, theintroducing step comprises introducing into the cell a sequence-dependent endonuclease. In someembodiments, the sequence-dependent endonuclease is a nucleic acid-guided endonuclease. Insome embodiments, the nucleic acid-guided endonuclease is a CRISPR endonuclease. In someembodiments, the CRISPR endonuclease is selected from Cas9, Cas12a and CASCADE. In someembodiments, the CRISPR endonuclease comprises a catalytically inactive CRISPR endonucleaseconjugated to the cleavage domain of the restriction endonuclease Fok I. In some embodiments,the endonuclease is selected from the group consisting of a zinc finger nuclease (ZFN), a ZFN-Fok I fusion, a transcription activator-like effector nuclease (TALEN), and a TALEN-Fok I fusion.In some embodiments, the endonuclease cleaves the genome of the cell at a locus selected fromthe group consisting of TRAC, B2M, PDCD1, CBLB, CISH, TIGIT, TIM3, LAG3, CIITA, andDNMT3A. In some embodiments, the nucleic acid encoding the MODL-CAR is present in a vectorselected from the group consisting of a plasmid vector, an adenovirus type 2 and an adenovirustype 5, a retrovirus, a lentivirus, an adeno-associated virus (AAV), a simian virus 40 (SV40),vaccinia virus, Sendai virus, Epstein-Barr virus (EBV), and herpes simplex virus (HSV).

[0027] In one embodiment, the invention is a composition comprising the immune cellsdescribed herein and a pharmaceutically acceptable excipient. In some embodiments, the immunecells are MODL-CAR-T cells in the amount of between 1×106 and 2×108 cells. In someembodiments, the immune cells are MODL-CAR-NK cells in the amount of between 1×107 and2×10º cells. In some embodiments, the immune cells are a mixture of MODL-CAR-T cells andMODL-CAR-NK cells present at a ratio of approximately 1:10 MODL-CAR-T to MODL-CAR-NK. In some embodiments, the pharmaceutically acceptable excipient comprises one or more ofcarbohydrates, inorganic salts, antimicrobial agents, antioxidants, surfactants, buffers, acids,bases, water, alcohols, polyols, glycerin, vegetable oils, phospholipids, surfactants, sugars,derivatized sugars, alditols, mannitol, xylitol, maltitol, lactitol, xylitol, sorbitol, pyranosyl sorbitol,myoinositol, aldonic acid, esterified sugars, sugar polymers, monosaccharides, fructose, maltose,galactose, glucose, D-mannose, sorbose, disaccharides, lactose, sucrose, trehalose, cellobiose,polysaccharides, raffinose, melezitose, maltodextrins, dextrans, starches, citric acid, sodiumchloride, potassium chloride, sodium sulfate, potassium nitrate, and sodium phosphate. In someembodiments, the antimicrobial agent comprises one or more of benzalkonium chloride,benzethonium chloride, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol,phenylethyl alcohol, phenylmercuric nitrate, and thimerosal. In some embodiments, thecomposition further comprises an antioxidant selected from ascorbyl palmitate, butylatedhydroxyanisole, butylated hydroxytoluene, hypophosphorous acid, monothioglycerol, propylgallate, sodium bisulfite, sodium formaldehyde sulfoxylate, and sodium metabisulfite. In someembodiments, the composition further comprises a surfactant selected from polysorbates, sorbitanesters, lecithin, phosphatidylcholines, phosphatidylethanolamines, fatty acids, fatty acid esters andcholesterol. In some embodiments, the composition further comprises a freezing agent selectedfrom 3% to 12% dimethylsulfoxide (DMSO) and 1% to 5% human albumin. In someembodiments, the composition further comprises a preservative selected from one or more ofmethylparaben, propylparaben, sodium benzoate, benzalkonium chloride, antioxidants, chelatingagents, parabens, chlorobutanol, phenol, and sorbic acid. In some embodiments, the compositionfurther comprises a delivery-timing component that enables time-release, delayed release, orsustained release of the composition. In some embodiments, the delivery-timing component isselected from monostearate, gelatin, a semipermeable matrix, and a solid hydrophobic polymer.

[0028] In one embodiment, the invention is a method of inhibiting the growth of a tumorin a patient comprising administering to the patient the composition described above. In someembodiments, the tumor is a solid tumor selected from ovarian cancer, triple negative breastcancer, colorectal cancer, non-small cell lung cancer, lung adenocarcinoma, pancreatic cancer,gastric cancer, melanoma, and endometrial carcinoma, or a hematological tumor selected fromMCL, CLL, SLL, B-ALL, B-NHL, and AML. In some embodiments, the method furthercomprises, prior to administering to the patient, applying to the immune cells a quality controlmeasure comprising assessing one or more properties selected from presence of the MODL-CARin the cellular genome, surface expression of the MODL-CAR, antigen-dependent lysis of antigen-expressing target cells, proliferation in the presence of antigen-expressing target cells, cytokine orchemokine secretion in the presence of antigen-expressing target cells, reducing tumor burden inexperimental animals harboring antigen-expressing tumors, and persistence in circulation ofexperimental animals harboring antigen-expressing tumors upon administration of the immunecells to the animals. In some embodiments, the presence of the MODL-CAR in the cellular genomeis assessed by a method selected from nucleic acid hybridization, nucleic acid sequencing,polymerase chain reaction (PCR), quantitative PCR (qPCR), real-time PCR (rtPCR) and dropletdigital PCR (ddPCR). In some embodiments, the surface expression of the MODL-CAR isassessed by flow cytometry, fluorescence-activated cell sorting (FACS), microfluidics-basedscreening, ELISA, or Western blot. In some embodiments, the immune cell population with thehighest surface expression of the MODL-CAR is selected for administration to the patient. In someembodiments, the antigen-dependent lysis of antigen-harboring target cells is assessed by co-culturing the immune cells with antigen-expressing target cells at an effector:target ratio betweenabout 0.1 and about 10 and assessing target cell lysis. In some embodiments, the immune cellpopulation with the highest rate of lysis of antigen-harboring target cells is selected foradministration to the patient. In some embodiments, the antigen-dependent proliferation isassessed by co-culturing the immune cells with antigen-expressing target cells and assessing theproliferation of the immune cells. In some embodiments, the immune cell population with thehighest rate of proliferation in the presence of antigen-expressing target cells is selected foradministration to the patient. In some embodiments, the cytokine or chemokine is selected fromIFN-γ, TNF-α, GM-CSF, IL-10, IL-5, and IL-13, MIP-1α, MIP-1ẞ, IL-8, and RANTES. In someembodiments, the cytokine secretion is assessed by co-culturing the immune cells with antigen-expressing target cells and measuring the amount of cytokines in the co-culture supernatant. Insome embodiments, the immune cell population with the highest cytokine secretion is selected foradministration to the patient. In some embodiments, the reducing tumor burden in experimentalanimals harboring antigen-expressing tumors is measured as change bioluminescence of thebioluminescent tumor cells in a time period after the animals have been injected with the immunecells. In some embodiments, the change in bioluminescence is expressed as area under the curve(AUC) and the immune cell population with the smallest AUC is selected for administration to thepatient. In some embodiments, the persistence in circulation of experimental animals harboringantigen-expressing tumors upon administration of the immune cells to the animals is measured bycounting human CD8-expressing cells in the circulation of the animals. In some embodiments, theimmune cell population with the highest counts of human CD8-expressing cells in the circulationof the animals is selected for administration to the patient.

[0029] In one embodiment, the invention is a modular chimeric antigen receptor (MODL-CAR) comprising an extracellular component comprising an antigen-binding domain; anintracellular component comprising a signaling domain; a transmembrane component, and aconnector component comprising a first association domain conjugated to the extracellularcomponent and a second association domain conjugated to the intracellular component, whereinthe first association domain is capable of specific association with the second association domain.BRIEF DESCRIPTION OF THE DRAWINGS

[0030] FIGURE 1 is a depiction of one example of a modular linked CAR (MODL-CAR),its components and method of association.

[0031] FIGURE 2 is a schematic representation of various arrangements of MODL-CARcomponents.

[0032] FIGURE 3 is a depiction of polycistronic MODL-CAR expression construct andresulting polypeptide components of MODL-CARS.

[0033] FIGURE 4 shows the assembly of MODL-CARs from polypeptide componentsshown in FIGURE 3.DETAILED DESCRIPTION OF THE INVENTION

[0034] Definitions

[0035] The following definitions are provided to aid in understanding of the disclosure.Unless defined in this section, technical and scientific terms used in this disclosure have themeaning commonly understood by a person of ordinary skill in the art. See, e.g., Sambrook et al.,Molecular Cloning, A Laboratory Manual, 4th Ed. Cold Spring Harbor Lab. Press (2012).

[0036] The term "domain" refers to one region in a polypeptide which is folded into aparticular structure independently of other regions.

[0037] The term "component" as used herein in connection with a modular chimericantigen receptor (MODL-CAR) refers to a region of the protein that has a certain characteristic,location within a cell, or function and may comprise one or more polypeptide domains. Thedomains within a component may be covalently linked or may associate by other means, i.e.,electrostatic, or hydrophobic interactions. For example, a cytoplasmic component may comprisean activation domain and may also comprise a co-stimulatory domain. The activation domain andthe co-stimulatory domain may be covalently linked to form a cytoplasmic component. Anextracellular component may comprise one or more antigen binding domains, and further comprisea hinge domain. The one or more antigen binding domains and the hinge domain may be covalentlylinked to form an extracellular component. A connector component may comprise two associationdomains. The association domains may be covalently linked or may associate by other means toform a connector component.

[0038] The term "chassis" as used herein in connection with a chimeric antigen receptor(CAR) or a modular linked chimeric antigen receptor (MODL-CAR) refers to the portion of theprotein less the antigen binding component. Two CARs (or two MODL-CARs) are said to havethe same chassis if the CARs (or MODL-CARs) differ only with respect to their antigen-bindingcomponents. A chassis may comprise a transmembrane component and a cytoplasmic component.A chassis may also comprise an extracellular component such as a hinge domain.

[0039] The term "activation" refers to the state of a T cell that includes one or both of cellproliferation and cytokine secretion by the cell. Activation may occur in response to the targetantigen.

[0040] The term "antibody" refers to an immunoglobulin molecule which specifically bindsto an antigen. The term also refers to antibody fragments including Fv, Fab and F(ab)2, scFv andother forms described e.g., in Antibodies: A Laboratory Manual, 2nd Ed. Greenfield, E., ed., ColdSpring Harbor Lab. Press, N.Y. (2013) and a nanobody (VIII camelid antibody).

[0041] The term "co-stimulatory domain" refers to a part of a chimeric T cell receptor(CAR) which is a binding partner that specifically binds a co-stimulatory ligand, thereby mediatinga co-stimulatory response of the T cell, proliferation, and cytokine secretion. Examples of co-stimulatory ligands include CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L,ICOS-L, ICAM, CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, and HVEM. Examples ofco-stimulatory domains include CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, LFA-1,CD2, CD7, LIGHT, NKG2C, and B7-H3.

[0042] The term "therapeutic benefit" refers to an effect that improves the condition of thesubject with respect to the medical treatment of this condition. This includes, but is not limited to,a reduction in the frequency or severity of the signs or symptoms of a disease. For example,treatment of cancer may involve, for example, a reduction in the size of a tumor, a reduction in theinvasiveness of a tumor, reduction in the growth rate of the tumor, or prevention of metastasis, orprolonging overall survival (OS) or progression free survival (PFS) of a subject with cancer.

[0043] The terms "pharmaceutically acceptable” and “pharmacologically acceptable” referto molecular entities and compositions that do not produce an adverse, allergic, or other deleteriousreaction in a patient. For example, the pharmaceutically and pharmacologically acceptablepreparations should meet the standards set forth by the FDA Office of Biological Standards.

[0044] The term "pharmaceutically acceptable carrier" and "excipient" refer to aqueoussolvents (e.g., water, aqueous solutions of alcohols, saline solutions, sodium chloride, Ringer'ssolution, etc.), non-aqueous solvents (e.g., propylene glycol, polyethylene glycol, vegetable oil,and injectable organic esters), as well as dispersion media, coatings, surfactants, gels, antioxidants,preservatives (e.g., antibacterial or antifungal agents, anti-oxidants, chelating agents, and inertgases), isotonic agents, absorption delaying agents, stabilizers, binders, disintegration agents,lubricants, sweetening agents, flavoring agents, and dyes. The concentration and pH of the variouscomponents in a pharmaceutical composition are adjusted according to well-known parameters foreach component.

[0045] The term "effector function" refers to a specialized function of a differentiated cell,such as a T cell or a natural killer (NK) cell.

[0046] The term "adoptive cell" refers to a cell that can be genetically modified for use ina cell therapy treatment. Examples of adoptive cells include T cells, monocytes, macrophages, andnatural killer (NK) cells.

[0047] The term "cell therapy" refers to the treatment of a disease or disorder that utilizesgenetically modified cells. The term “adoptive cell therapy (ACT)" refers to a therapy that usesgenetically modified adoptive cells. Examples of ACT include T cell therapies, CAR-T celltherapies, natural killer (NK) cell therapies and CAR-NK cell therapies.

[0048] The term "lymphocyte" refers to a leukocyte that is part of the vertebrate immunesystem. Lymphocytes include T cells such as CD4+ and / or CD8+ cytotoxic T cells, alpha / beta Tcells, gamma / delta T cells, and regulatory T cells. Lymphocytes also include natural killer (NK)cells, natural killer T (NKT) cells, cytokine induced killer (CIK) cells, and antigen presenting cells(APCs), such as dendritic cells. Lymphocytes also include tumor infiltrating lymphocytes (TILs).

[0049] The terms "effective amount" and "therapeutically effective amount" of acomposition such as a cell therapy composition, refer to a sufficient amount of the composition toprovide the desired response in the patient to whom the composition is administered.

[0050] The terms "peptide,” “polypeptide,” and “protein" are interchangeable and refer topolymers of amino acids, including natural and synthetic (unnatural) amino acids, as well as aminoacids not found in naturally occurring proteins, e.g., peptidomimetics, and D optical isomers. Apolypeptide may be branched or linear and be interrupted by non-amino acid residues. The termsalso encompass amino acid polymers that have been modified through acetylation, disulfide bondformation, glycosylation, lipidation, phosphorylation, cross-linking, or conjugation (e.g., with alabel). The polypeptide need not include the full-length amino acid sequence of the referencemolecule but can include only so much of the reference molecule as necessary in order for thepolypeptide to retain its desired activity. For example, polypeptides comprising full-lengthproteins, fragments thereof, polypeptides with amino acid deletions, additions, and substitutionsare encompassed by the terms "protein" and "polypeptide," as long as the desired activity isretained. For example, polypeptides with 95%, 90%, 80%, or less of sequence identity with thereference polypeptide are included as long the desired activity is retained by the polypeptides.

[0051] The terms "CRISPR" (clustered regularly interspaced short palindromic repeats),“Cas” (CRISPR-associated protein) “CRISPR-Cas” and “CRISPR system” refer to the genomeediting tool derived from prokaryotic organisms and comprising a nucleic acid guide molecule anda sequence-specific nucleic acid-guided endonuclease capable of cleaving a target nucleic acidstrand at a site complementary to a sequence in the nucleic acid guide.

[0052] The terms "guide” and “CRISPR guide" refer to a nucleic acid guide molecule ofthe CRISPR system. The guide may be comprised two nucleic acid targeting polynucleotides("dual guide") including a CRISPR RNA (crRNA) and transactivating CRISPR RNA (tracrRNA).The guide may be comprised a single nucleic acid targeting polynucleotide ("single guide")comprising crRNA and tracrRNA connected by a fusion region (linker). The crRNA may comprisea targeting region and an activating region. The tracrRNA may comprise a region capable ofhybridizing to the activating region of the crRNA. The term "targeting region" refers to a regionthat is capable of hybridizing to a sequence in a target nucleic acid. The term “activating region"refers to a region that interacts with a polypeptide, e.g., a CRISPR nuclease. Although sometimesreferred to as "RNA,” and comprising mostly ribonucleotides, the guide may also comprisedeoxyribonucleotides and chemically modified nucleotides as described herein.

[0053] Adoptive cell therapy and more specifically, therapy with engineered chimericantigen receptor (CAR) cells has found success especially in hematologic malignancies. Severaltreatments have been approved by the US FDA: YESCARTA®, KYMRIAH®, TECARTUS®,ABECMA®, CARVYKTI®, and BREYANZI®. However, even with hematologic malignancies,response rate is often unsatisfactory. For solid tumors, any CAR-T cell therapy is yet to reach theclinic. A recent review identified three main obstacles to advancement of CAR-T cell therapy: lackof safe targets (i.e., truly tumor-specific antigens), heterogeneity of tumor cells, and barriers to Tcell expansion and persistence, including within the tumor microenvironment (TME), see Blum,P., and Kayser, S. (2024) Chimeric Antigen receptor (CAR) T cell therapy in hematologicmalignancies: clinical implications and limitations, Cancers (Basel) 16(8):1599.

[0054] It is not surprising that the existing therapies relying on a single CAR design arelimited by tumor heterogeneity and poor adaptability of the CAR-T cell. All the six approvedtherapies target only one antigen with only one kind of antigen receptor (CAR). Furthermore, allthe CARs share the same intracellular design: a co-stimulatory domain (CD28 or 4-1BB) joinedwith the CD3% activation domain.

[0055] The instant disclosure presents a modular design of the chimeric antigen receptor(MODular Linked CAR or MODL-CAR) that allows the engineered cell to target more than oneantigen and access more than one intracellular signaling pathway making a cell with the MODL-CAR more adaptable to the tumor environment.

[0056] Following its success in oncology, CAR-T cell therapy was expanded into treatingautoimmune diseases. Initial reports of treating lupus (systemic lupus erythematosus, SLE) havebeen promising. Targeting CD19-expressing immune cells with CAR-Ts has resulted in alleviationof autoimmunity and long-term remission in lupus patients. A unique challenge that distinguishesautoimmune disease from cancer is preventing severe damage to the B cell compartment (thesource of autoimmune cells) in younger and otherwise healthy patients, see Lyu, X., et al., (2024)Chimeric antigen receptor T cell therapy: a new emerging landscape in autoimmune rheumaticdiseases, Rheumatology (Oxford) 63:1206. For this reason, a single-target CAR-T cell armed witha powerful activation signal (e.g., CD28 or 4-1BB co-stimulatory domain coupled with CD35) maynot be ideal for autoimmune disease. The model CAR design disclosed herein allows developinga CAR-T cell composition for autoimmune disease that targets more than one antigen in a moreattenuated manner.

[0057] The invention comprises a chassis for a modular linked chimeric antigen receptor(MODL-CAR) and a MODL-CAR.

[0058] A typical chimeric antigen receptor (CAR) comprises an extracellular domaincomprising an antigen binding region, a transmembrane domain, and one or more intracellularactivation (co-stimulatory) domains. Some CARs also comprise a hinge domain and a leaderpeptide directing the CAR to the cell membrane. A typical chassis for a chimeric antigen receptor(CAR) comprises a transmembrane domain, and one or more intracellular activation (co-stimulatory) domains. A hinge domain and a leader peptide directing the CAR to the cellmembrane can also be parts of a CAR chassis.

[0059] It is known in the art that the same chassis is effective in a chimeric antigen receptor(CAR) with different antigen-binding domains. For example, KYMRIAH® and BREYANZI®,the FDA-approved CAR-T therapies with a CD19-targeting CAR, and ABECMA® andCARVYKTI®, the FDA-approved CAR-T therapies targeting B cell maturation antigen (BCMA)share the same chassis comprising CD8 hinge, CD8 transmembrane domain, 4-1BB co-stimulatorydomain and CD35 activation domain. Furthermore, CARs with different structures of the antigenbinding domain are also capable of sharing a chassis. While KYMRIAH®, BREYANZI® andABECMA® have an antigen-binding domain comprised of an antibody single-chain variablefragment (scFv) having the structure VH-VL, CARVYKTI® has an antigen-binding domaincomprised of a camelid antibody (also known as nanobody) having the structure VHH.

[0060] The modular linked CAR (MODL-CAR) disclosed herein has the structure shownin FIGURES 1, 2 and 3. The MODL-CAR comprises an extracellular component comprising anantigen binding domain; an intracellular component comprising a signaling domain; and aconnector component comprising a first association domain conjugated (for example) to theextracellular component and a second association domain conjugated (for example) to theintracellular component, wherein the first association domain is capable of specific associationwith the second association domain thereby forming a connector component.

[0061] The chassis for a MODL-CAR comprises an intracellular component comprising asignaling domain; and a connector component comprising a first association domain that can beconjugated (for example) to the extracellular component of a MODL-CAR, and a secondassociation domain conjugated (for example) to the intracellular component of the chassis, whereinthe first association domain is capable of specific association with the second association domainthereby forming a connector component. The chassis can be combined with an extracellularcomponent comprising an antigen binding domain targeting the antigen of interest to form aMODL-CAR.

[0062] FIGURE 1 details the structure of the MODL-CAR system. Panel A shows aMODL-CAR component comprising an antigen-binding domain, a hinge and transmembranedomain, and a first association domain. Panel B shows a MODL-CAR component comprising asecond association domain, a costimulatory domain, and a stimulatory (or activation) domain.Panel C shows assembly of the MODL-CAR through the association domains, where the antigenbinding domain is in the extracellular space and the stimulatory (activation) domains are in theintracellular space. FIGURE 2 shows alternative forms of MODL-CAR architecture and modesof association. Panel A shows a MODL-CAR system where the association domain binding occursin the intracellular space. Panel B shows a MODL-CAR system where the association domainbinding occurs in the extracellular space. Panel C shows a MODL-CAR system where theassociation domain binding occurs within the cell membrane. Panel D shows a MODL-CARsystem where the association domain binding occurs in the intracellular space and each of the twoMODL-CAR components has an independent transmembrane domain. Panel E shows a MODL-CAR system where the association domain binding occurs in the intracellular space and thecostimulatory domains and stimulatory domain are in separate MODL-CAR components. Panel Fshows a MODL-CAR system where the association domain binding occurs within the cellmembrane and the costimulatory domains and stimulatory domain are in separate MODL-CARcomponents. Panel G shows a MODL-CAR system where the association domain binding occurswithin the cell membrane, the costimulatory domains and stimulatory domain are in separateMODL-CAR components, and each MODL-CAR component has a unique antigen bindingdomain (e.g., scFv). Panel H shows a MODL-CAR system where the association domain bindingoccurs within the cell membrane, and the antigen binding domain is assembled as part of theMODL-CAR assembly, e.g., the antigen binding domain is an scFv, and the variable light chain(VL) and variable heavy chain (VH) are in separate MODL-CAR components.

[0063] FIGURE 3 depicts the expression of MODL-CAR components from a polycistronicnucleic acid construct. Panel A shows the design of a MODL-CAR expression construct where theexpression of multiple antigen-binding domains is driven by a single promoter, and each antigen-binding domain is a separate polypeptide. Panel B shows the design of a MODL-CAR expressionconstruct where the expression of multiple costimulatory and stimulatory domains is driven by asingle promoter and each domain is a separate polypeptide. To facilitate the translation of eachantigen-binding domain and each stimulatory and costimulatory domain as an individualpolypeptide, the sequences are separated by a ribosomal skipping 2A DNA sequence (SEQ IDNOs: 71 - 74).

[0064] In some embodiments, each of the polycistronic expression constructs is introducedinto a cell separately. Transcription and translation of the polycistronic constructs results insynthesis of individual protein domains or MODL-CAR components.

[0065] FIGURE 4 shows the association of the various antigen-binding domains andcostimulatory and stimulatory domains depicted in FIGURE 3 into a MODL-CAR. Panel A showsthe association of three unique antigen-binding domains with the same combination ofcostimulatory and stimulatory domains. Panel B shows the association of three unique antigen-binding domains with the same stimulatory domain different from that depicted in Panel A. PanelC shows the association of three unique antigen-binding domains with the same stimulatorydomain different from that depicted in Panel A and Panel B. In this example, because the connectorcomponents are made of the same pair of association domains, each of the extracellularcomponents 1-3 can pair with any of the intracellular components 1-3 to form nine differentMODL-CARs. This allows a single cell to pair an array of antigen-binding domains with an arrayof stimulatory domains to produce a more complex response to antigen engagement whencompared to a traditional single-polypeptide CAR. For example, a cell may express a first MODL-CAR comprising an antigen-binding domain targeting the CD19 antigen and a cytoplasmiccomponent comprising a 4-1BB costimulatory domain, and a second MODL-CAR comprising anantigen-binding domain targeting the BCMA antigen and a cytoplasmic component comprising aCD28 costimulatory domain.

[0066] In some embodiments, the connector component comprises association domainscapable of specific interaction and specific association with each other. In some embodiments, theassociation domains are engineered based on naturally occurring proteins or protein domainscapable of specific protein-protein interaction and association. In some embodiments, theconnector component comprises a structure selected from an F(ab) constant region, an antibodyFc region (association domains comprise one or both of CH2 or CH3 or fragments thereof), a coiled-coil structure, an orthogonal synthetic zipper, an intervening protein ("intein") spliced protein(association domains comprise components of a split intein), an Ig fold (cross-ẞ motif), and areceptor-ligand interaction. In some embodiments, the association domains are from a humanprotein to minimize immunogenicity of the engineered MODL-CAR when the MODL-CARexpressing cell is administered to a human patient.

[0067] In some embodiments, the connector component comprises at least a portion of theantigen-binding domain of the immunoglobulin (Fab). The human (or mouse) immunoglobulinFab region consists of a variable region and a constant region. The variable region is comprised ofthe variable regions of the light chain (VL) and heavy chain (VH), which constitute the antigenbinding interface of the immunoglobulin protein. The constant region is comprised of the constantregions of the light chain (CL) and heavy chain (CH1). In some embodiments, the connectorcomponent comprises at least a portion of the CL region as the first association domain and, a atleast a portion of the CH1 as the second association domain. In some embodiments, the CLassociation domain is a C₁kappa (CLK) domain. In some embodiments, the CL association domainis a Clambda (CLA) domain. In certain embodiments, the first association domain comprises orconsists essentially of SEQ ID NO:01 and the second association domain comprises or consistsessentially of SEQ ID NO:02.

[0068] In some embodiments, the association domains are modified to introduce additionalcysteines capable of forming additional disulfide bonds (i.e., disulfide bonds not present in thewild-type Fab structure) when the first and the second association domains associate to form aconnector component.

[0069] In some embodiments, the association domains are modified to form charge pairsof oppositely charged amino acid residues (the charge pairs not present in the wild-type Fabstructure) when the first and the second association domains associate to form a connectorcomponent.

[0070] In some embodiments, the connector component comprises a domain of theimmunoglobulin Fc region. In a human (or mouse) immunoglobulin the Fc region consists of anassociation between the two constant regions of the two immunoglobulin heavy chains (CH2 andCH3 domains of each heavy chain). In some embodiments, the association domains comprise atleast a part of the immunoglobulin heavy chain involved in the Fc formation. In someembodiments, the association domains comprise at least a portion of modified immunoglobulinheavy chains modified to increase the stability of the heterodimer formed by the associationdomains (the connector component). In some embodiments, the association domains are modified(e.g., as described in U.S. Patent No. 11,091,541) to improve steric interactions betweenassociation domains, to create additional disulfide bonds between association domains, or to createcharge pairs between amino acids of association domains.

[0071] In some embodiments, the association domains are modified to formcomplementary shapes at the corresponding interfaces ("knobs and holes"). In some embodiments,the first association domain is modified to replace at least one amino acid residue with an aminoacid residue having a larger side chain volume, thereby generating a protuberance ("knob"), whilethe second association domain is modified to replace at least one amino acid residue with an aminoacid residue having a smaller side chain volume thereby generating a cavity ("hole”), wherein theprotuberance is positioned within the cavity when the first and the second association domainsassociate to form a connector component.

[0072] In some embodiments, one of the following pair of modifications to theimmunoglobulin heavy chain constant regions forming the association domains is made to formknobs and holes association in the connector component: 1) Y407T in one chain and T366Y in theother chain; or 2) Y407A in one chain and T366W in the other chain; or 3) F405A in one chainand T394W in the other chain; or 4) F405W in one chain and T394S in the other chain; or 5)Y407T in one chain and T366Y in the other chain; or 6) T366Y and F405A in one chain andT394W and Y407T in the other chain; or 7) T366W and F405W in one chain and T394S andY407A in the other chain; or 8) F405W and Y407A in one chain and T366W and T394S in theother chain; or 9) T366W in one chain and T366S, L368A, and Y407V in the other chain (aminoacid numbering according to Kabat EU index numbering system).

[0073] In some embodiments, the association domains are modified to introduce additionalcysteines capable of forming additional disulfide bonds (i.e., disulfide bonds not present in thewild-type Fc structure) when the first and the second association domains associate to form aconnector component.

[0074] In some embodiments, one of the following pairs of modifications to theimmunoglobulin heavy chain constant regions forming the association domains is made to formdisulfide bonds in the connector component: 1) Y349C in one chain and $354C in the other chain;or 2) Y349C in one chain and E356C in the other chain, or 3) Y349C in one chain and E357C inthe other chain, or 4) L351C in one chain and $354C in the other chain, or 5) T394C in one chainand E397C in the other chain; or 6) D399C in one chain and K392C in the other chain (amino acidnumbering according to Kabat EU index numbering system).

[0075] In some embodiments, the association domains are modified to form charge pairsof oppositely charged amino acid residues when the first and the second association domainsassociate to form a connector component.

[0076] In some embodiments, one of the following pairs of modifications to theimmunoglobulin heavy chain constant regions forming the association domains is made to formcharged pairs in the connector component: 1) K409D or K409E in one chain and D399K or D399Rin the other chain; or 2) K392D or K392E in one chain and D399K or D399R in the other chain;or 3) K439D or K439E in one chain and E356K or E356R in the other chain; or 4) K370D orK370E in one chain and E357K or E357R in the other chain; or 5) K409D and K360D in one chainplus D399K and E356K in the other chain, or 6) K409D and K370D in one chain plus D399K andE357K in the other chain, or 7) K409D and K392D in one chain plus D399K, E356K, and E357Kin the other chain; or 8) K409D and K392D in one chain and D399K in the other chain; or 9)K409D and K392D in one chain and D399K and E356K in the other chain; or 10) K409D andK392D in one chain and D399K and D357K in the other chain; or 11) K409D and K370D in onechain and D399K and D357K in the other chain, or 12) D399K in one chain and K409D andK360D in the other chain; or 13) K409D and K439D in one chain and D399K and E356K on theother chain (amino acid numbering according to Kabat EU index numbering system).

[0077] In some embodiments, a MODL-CAR comprises an antibody-based connectorcomponent where the first association domain is SEQ ID NO: 01, and the second associationdomain is SEQ ID NO: 02. In some embodiments, the MODL-CAR comprises an antibody-basedconnector component where the first association domain is SEQ ID NO: 02, and the secondassociation domain is SEQ ID NO: 01. In some embodiments, the MODL-CAR comprising anantibody-based connector component has a structure of SEQ ID NOs: 21 - SEQ ID NO: 01 - SEQID NO: 02 - SEQ ID NO: 22. In some embodiments, the MODL-CAR comprising an antibody-based connector component has a structure of SEQ ID NOS: 21 - SEQ ID NO: 02 - SEQ ID NO:01 - SEQ ID NO: 22. In some embodiments, the MODL-CAR comprising an antibody-basedconnector component is encoded by a nucleic acid comprising SEQ ID NO: 51 or SEQ ID NO:52.

[0078] In some embodiments, the connector component comprises a coiled coil. A coiledcoil is an o-helical protein structure wherein each of the association domains capable ofspecifically forming the coiled coil comprises heptad repeats of certain hydrophobic residues(alanine and leucine) and certain polar residues (glutamine and lysine). The polar residues formelectrostatic attractions between association domains. Specificity results from placement of thepolar residues (e.g., glutamine and lysine) within the association domains that allows for alignmentof the polypeptide chains within the coiled coil. In some embodiments, each association domainfurther comprises at least one cysteine and the connector component comprises one of moredisulfide bonds between the association domains.

[0079] In some embodiments, each of the association domains comprises up to 5 heptads(up to 35 amino acids), each heptad having the sequence (A / L)GALEKE (SEQ ID NO: 114) or(A / L)GALKEK (SEQ ID NO: 115) as described in Monera O.D., et al., (1996) Formation ofparallel and antiparallel coiled-coils controlled by the relative positions of alanine residues in thehydrophobic core, J. Bio. Chem. 271(8):3995. In some embodiments, each of the associationdomains further comprises a cysteine at or near the N-terminus or the C-terminus.

[0080] In some embodiments, the association domains capable of specifically forming acoiled coil connector component are designed using a bioinformatic tool exemplified by SCORERand CCBuilder (see Armstrong, C., et al., (2011) SCORER 2.0: an algorithm for distinguishingparallel dimeric and trimeric coiled-coil sequences, Bioinformatics, 27(14):1908, and WoodC.W., and Woolfson, D. N., (2018) CCBuilder 2.0: Powerful and accessible coiled-coil modeling,Protein Sci. 27(1)103.

[0081] In some embodiments the connector component is comprised of two parallel coiledcoil domains. In some embodiments the connector component is comprised of two anti-parallelcoiled coil domains.

[0082] In some embodiments, a MODL-CAR comprises a coiled-coil connectorcomponent where the first association domain is SEQ ID NO: 17, and the second associationdomain is SEQ ID NO: 18. In some embodiments, the MODL-CAR comprises a coiled-coilconnector component where the first association domain is SEQ ID NO: 19, and the secondassociation domain is SEQ ID NO: 20. In some embodiments, the MODL-CAR comprising acoiled-coil connector component has a structure of SEQ ID NOS: 21 - SEQ ID NO: 17 - SEQ IDNO: 18 - SEQ ID NO: 22. In some embodiments, the MODL-CAR comprising a coiled-coilconnector component has a structure of SEQ ID NOs: 21 - SEQ ID NO: 19 - SEQ ID NO: 20 -SEQ ID NO: 22. In some embodiments, the MODL-CAR comprising a coiled-coil connectorcomponent is encoded by a nucleic acid comprising SEQ ID NO: 58 or SEQ ID NO: 59.

[0083] In some embodiments, the connector component comprises a "zipper”. A proteinzipper is an orthogonal synthetic coiled coil where zipper domains form a heterodimer only witha specific partner zipper domain and not with any other zipper domain. Furthermore, the specificassociation occurs regardless of the position of the association domain (zipper) within the protein(e.g., N-terminus, C-terminus or internal).

[0084] In some embodiments, the association domain pair is a leucine zipper described inAnderson, G.P., et al., (2018) Orthogonal synthetic zippers as protein scaffolds, ACS Omega3:4810. In some embodiments, the leucine zipper domain is selected from the group of proteinzipper pairs consisting of A-1 / D-2, A-2 / D-1, A-2 / D-1-3, A-2 / D-3-1, A-3 / D-4, A-4 / D-3, A-4 / D-1-3, A-4 / D-3-1, 1-A / D-2, 3-A / D-4, 4-A / D-3, 4-A / D-1-3, 4-A / D-3-1, A-1-A / D-2 described inAnderson et al., (2018) supra. In some embodiments, the association domains are parallel leucinezippers. In some embodiments, the association domains are anti-parallel leucine zippers. In someembodiments, the dissociation constant (Ka) of the connector component comprised of the twoassociation domains that are zipper domains is between 10 nM and 30 nM.

[0085] In some embodiments, a MODL-CAR comprises a leucine zipper connectorcomponent where the first association domain is SEQ ID NO: 8, and the second association domainis SEQ ID NO: 10. In some embodiments, the MODL-CAR comprises a leucine zipper connectorcomponent where the first association domain is SEQ ID NO: 9, and the second association domainis SEQ ID NO: 11. In some embodiments, the MODL-CAR comprising a leucine zipper connectorcomponent has a structure of SEQ ID NOs: 21 - SEQ ID NO: 8 - SEQ ID NO: 9 -- SEQ ID NO:22. In some embodiments, the MODL-CAR comprising a leucine zipper connector component hasa structure of SEQ ID NOs: 21 - SEQ ID NO: 10 - SEQ ID NO: 11 - SEQ ID NO: 22. In someembodiments, the MODL-CAR comprising a leucine zipper connector component is encoded bya nucleic acid comprising SEQ ID NO: 53 or SEQ ID NO: 54.

[0086] In some embodiments, the connector component comprises an intein and each of theassociation domains prior to forming the connector component comprises a split intein amino acidsequence. Inteins are self-splicing protein "introns" capable of auto-catalytically excisingthemselves (at the N-terminus and C-terminus of an intein) from a precursor protein and fusingthe two intein-flanking polypeptides to each other so that the connector component no longercontains the intein sequence. An intein is also capable of separately cleaving its N-terminus andits C-terminus when two intein halves are fused to separate polypeptides. A polypeptideconjugated to a half of a split intein (e.g., intein-N) becomes covalently linked to anotherpolypeptide conjugated to the other half of a split intein (e.g., intein-C), while the polypeptideintein-N-C is excised, see U.S. Patent No. 6,849,428. Inteins have been successfully used toaccomplish protein ligation in vitro and in living cells. (Yamada, et al., (2023) Construction ofIgG-Fab2 bispecific antibody via intein-mediated protein trans-splicing reaction, Iwai, et al.,(2006) Highly efficient protein trans-splicing by a naturally split DnaE intein from Nostocpunctiforme, FEBS Letters 580:1853).

[0087] Intein proteins may be derived from a variety of organisms such as bacteria, viruses,and yeast, including any organism selected from the list of organisms provided in U.S. Patent No.11,066,657. In some embodiments, the intein sequence is derived from the DNA Polymerase IIIsequence from Nostoc punctiforme PCC73102 ("Npu"). In some embodiments, the intein sequenceis derived from the DNA Polymerase III sequence from Synechocystis species PCC6803 (“Ssp").In certain embodiments, the intein sequence is derived from a combination of the Npu and Sspsequences. Examples of synthetic inteins can be found e.g., in Pinot et al., (2020) An expandedlibrary of orthogonal split inteins enables modular multi-peptide assemblies, Nat Commun 11,1529.

[0088] In some embodiments, the intein domains are modified at the active sites tomodulate the kinetics of splicing. Certain modifications may also be introduced into the regionadjacent the active site to improve splicing activity (Stevens et al., (2016) Design of a Split Inteinwith Exceptional Protein Splicing Activity, J. Am. Chem. Soc., 138, 7, 2162-2165), Pinot et a,l.(2020) supra, Stevens et al., (2017), A promiscuous split intein with expanded protein engineeringapplications, PNAS 114 (32) 8538-8543.)

[0089] In some embodiments, a MODL-CAR comprises an intein connector componentwhere the first association domain is SEQ ID NO: 12, and the second association domain is SEQID NO: 13. In some embodiments, the MODL-CAR comprises an intein connector componentwhere the first association domain is SEQ ID NO: 14, and the second association domain is SEQID NO: 15. In some embodiments, the MODL-CAR comprises an intein connector componentwhere the first association domain is SEQ ID NO: 14, and the second association domain is SEQID NO: 16. In some embodiments, the MODL-CAR comprising an intein connector componenthas a structure of SEQ ID NOs: 21 - SEQ ID NO: 12 - SEQ ID NO: 13 - SEQ ID NO: 22. Insome embodiments, the MODL-CAR comprising an intein connector component has a structureof SEQ ID NOS: 21 – SEQ ID NO: 14 - SEQ ID NO: 15 - SEQ ID NO: 22. In some embodiments,the MODL-CAR comprising an intein connector component has a structure of SEQ ID NOs: 21 –SEQ ID NO: 14 - SEQ ID NO: 16 - SEQ ID NO: 22. In some embodiments, the MODL-CARcomprising an intein connector component is encoded by a nucleic acid comprising SEQ ID NO:55, or SEQ ID NO: 56, or SEQ ID NO: 57.

[0090] In some embodiments, the connector component comprises an immunoglobulin fold(Ig fold) also known as a cross-ẞ motif. The cross-ẞ motif is created by two beta sheets"sandwiched" together, with each beta sheer comprising seven to nine beta strands, and can befurther stabilized by disulfide bond formation. In the case of a cross-ẞ motif, each associationdomain comprises one or more ẞ arch loops.

[0091] In some embodiments, the association domains comprising beta-arch loops aredesigned using a bioinformatic tool exemplified by Rosetta Commons Modeling (Marcos, E., etal., (2018) De novo design of a non-local ẞ-sheet protein with high stability and accuracy, NatureStructural and Mol. Biol. 25:1028).

[0092] In some embodiments, the Ig fold (cross-ẞ motif) further comprisescomplementarity determining regions ("CDR") capable of recognizing a target antigen. In someembodiments, the interaction of the parts of Ig fold connector component is stabilized throughinteraction between the Ig fold CDR and the target antigen. In some embodiments, the CDRsinteract with a tyrosine kinase such as lymphocyte-specific protein tyrosine kinase (LCK), Zeta-chain-associated protein kinase 70 (ZAP70), a SRC family kinase, or a SRC-like adaptor protein(SLAP).

[0093] In some embodiments, the association of the Ig fold (cross-ẞ motif) domains aremodified to introduce additional cysteines capable of forming additional disulfide bonds (i.e.,disulfide bonds not present in the wild-type Fc structure) when the first and the second associationdomains associate to form a connector component (Chidyausiku, T.M., et al., (2022) De novodesign of immunoglobulin-like domains, Nature Comm. 13, art. 5661.).

[0094] In some embodiments, the association of the Ig fold (cross-ẞ motif) domains aremodified to form charge pairs of oppositely charged amino acid residues (i.e., charge pairs notpresent in the wild-type Fc structure) when the first and the second association domains associateto form a connector component.

[0095] In some embodiments, The MODL-CAR disclosed herein comprises an extracellularportion comprising an antigen binding domain. In some embodiments, the antigen binding domainis derived from an antibody. In some embodiments, the antigen binding domain is derived from amonoclonal antibody. In various embodiments, the antigen binding domain is selected fromvariable fragment (Fv), single-chain variable fragment (scFv), proteolytically-cleaved antibody-binding fragment (Fab), bi-specific Fab F(ab)2, and a nanobody (Ѵнн antibody).

[0096] In some embodiments, the antigen binding domain comprises a mouse (murine)sequence. In some embodiments, the antigen binding domain comprises a human sequence. Insome embodiments, the antigen binding domain is humanized, i.e., comprises murinecomplementarity determining regions (CDRs) and some or all non-CDR sequences are replacedwith human antibody sequences.

[0097] In some embodiments, the antigen binding region comprises a single-chain variablefragment (scFv). An scFv comprises a variable region of an antibody light chain (VL) linked to avariable region of an antibody heavy chain (VH). In some embodiments, the VL is linked to the VHvia a peptide linker.

[0098] In some embodiments, the antigen is a tumor antigen. In some embodiments, theantigen is selected from the group consisting of CD4, CD16V, CD19, CD22, CD20, CD28, CD30,CD33, CD37, CD38, CD44, CD47, CD70, CD73, CD79b, CD112, CD123, CD133, CD137, GD2,DNAM-1, IL-11Ra, IL-13RA, IL-13RA2, BCMA, CD138, NKG2-D, HER2 / Neu, B7-H3(CD276), B7-H6, CA-125, MUC-1, MUC-16, mutated TP53, mutated Ras, ERBB2 (HER2), folatebinding protein (FBP), L1CAM (CD171), CLL1 (CD371), CEA, Claudin 18.1, Claudin 18.2, CS-1, CSPG4, mutated EGFR, EFGRvIII, ENPP3, EpCAM, EphA2, ErbB, FAP, FLT-3, FRa, GD3,Glypican 3, LewisY / LeY, c-Met, mesothelin, MG7, Nectin-4, NGFR, PD1, PD-L1, PD-L2, PSCA,PSMA, PTK7, ROR1, SLAMF7, STEAP, STEAP2, TACI, TAG72, TROP2, ULBP, MICA / B,VEGFR2, PDGFR, ULBP1-6, and WT1.

[0099] One of skill in the art can easily obtain ready-made and custom-made antibodiesspecific for the targets listed above suitable for inserting into chimeric antigen receptors includingMODL-CARS. For example, Bio-Rad (Hercules, Cal.) offers HuCAL® monoclonal antibodygeneration services specifically for CAR building. Promab Biotechnologies (Richmond, Cal.)also provides custom antibody development service as well as a panel of pre-made antibodies.Many other companies offer a large menu of existing antibodies and antibody generatingservices.

[0100] In some embodiments, the MODL-CAR comprises the scFv targeting ROR1. In suchembodiments, the scFv may comprise or consist essentially of any of the scFvs disclosed in theInternational Application Pub. No. WO2023230447 Anti-ROR1 antibody and ROR1-targetingengineered cells.

[0101] In some embodiments, the MODL-CAR comprises the scFv targeting CD19. In suchembodiments, the scFv may comprise or consist essentially of the sequence of FMC63 disclosed inNicholson et al., (1997) Construction and characterization of a functional CD19-scpecific singlechain Fv fragment for immunotherapy of B lineage leukaemia and lymphoma, Mol. Immunol.34:1157, or a humanized version thereof.

[0102] In some embodiments, the MODL-CAR comprises the scFv targeting CLL1 (CD371).In such embodiments, the scFv may comprise or consist essentially of any of the scFvs disclosed inthe International Application Pub. No. WO2021050857 Anti-CD371 antibodies and uses thereof.

[0103] In some embodiments, the MODL-CAR comprises the scFv targeting BCMA. In suchembodiments, the scFv may comprise or consist essentially of any of the scFvs disclosed in theInternational Application Pub. No. WO2020150339 Humanized BCMA antibody and BCMA CAR-Tcells.

[0104] In some embodiments, the antigen binding domain comprises two or morepolypeptides (e.g., variable domains of the light and heavy chains VL and VH) connected via apeptide linker. A peptide linker generally comprises from about 5 to about 40 amino acids. Thelinker can be a naturally occurring sequence or an engineered sequence. For example, in someembodiments, the linker is derived from a human protein, e.g., an immunoglobulin selected fromIgG, IgA, I IgD, IgE, or IgM. In some embodiments, the linker comprises 5-40 amino acids fromthe CH1, CH2, or CH3 domain of an immunoglobulin heavy chain. In some embodiments, thelinker is a glycine and serine rich linker having the sequence (GxSy)n. Additional linker examplesand sequences are disclosed in the U.S. Patent No. 5,525,491 Serine-rich peptide linkers, U.S.Patent No. 5,482,858 Polypeptide linkers for production of biosynthetic proteins, and a publicationWO2014087010 Improved polypeptides directed against IgE.

[0105] In some embodiments, the sequence of the scFv is further optimized for binding to theantigen. In some embodiments, the optimization process comprises varying the linker between theheavy chain (VH) and the light chain (VL) of the scFv. It has been reported that the linker sequencecan influence the antigen-scFv binding (Navabi, et al., (2021) Designing and optimization of asingle-chain fragment variable (scFv) antibody against IL2Ra (CD25): An in silico and in vitrostudy, Iran J Basic Med Sci 24:1.). Specifically, it has been shown that in silico design of the linker'samino acid sequence within the context of the known crystal structure of the scFv-antibody complexcan yield linker sequences than impart better antigen affinity to the scFv. It has also been shown thatthe linker length can be optimized for binding to the antigen, where the linker comprises a variablenumber of repeats of the same sequence. Singh et al. (2021) Antigen-independent activation enhancesthe efficacy of 41BB co-stimulated CD22 CAR T cells, Nat. Med. 27(5):842. In some embodiments,the repeated sequence is GxSy and the linker has the general formula (GxSy)n.

[0106] In some embodiments, the MODL-CAR comprises a signal peptide (a signalsequence) that enables trafficking of the MODL-CAR to the cell membrane. In someembodiments, the signal sequence comprises a CD28 signal sequence. In some embodiments, thesignal sequence consists essentially of a CD28 signal sequence. In some embodiments, the signalsequence comprises a CD8 signal sequence. In some embodiments, the signal sequence consistsessentially of a CD8 signal sequence.

[0107] In some embodiments, the transmembrane domain of the MODL-CAR is derivedfrom a membrane-bound or transmembrane protein. In some embodiments, the transmembranedomain of the MODL-CAR is a transmembrane domain of a protein selected from the groupconsisting of a T cell receptor a chain or ẞ chain, a CD36 chain, CD28, CD3ɛ chain, CD45, CD2,CD4, CD5, CD8, CD9, CD16, CD22, CD27, CD33, CD37, CD64, CD80, CD86, CD134, CD137,ICOS, CD154, DNAM1, NKp44, NKp46, NKG2A, NKG2C, NKG2D, 2B4, TMIG2, TLR1,TLR2, TLR4, TLR5, TLR6, and GITR. In some embodiments, the transmembrane domain is theCD8 transmembrane domain.

[0108] The cytoplasmic or intracellular signaling domain also referred to as the signalingdomain of a MODL-CAR is responsible for activation of one or more effector functions of theimmune cell expressing the MODL-CAR. In some embodiments, the cytoplasmic domaincomprises an activation domain. In some embodiments, the cytoplasmic domain comprises anactivation domain and further comprises a co-stimulatory domain. In some embodiments, theactivation domain is selected from the group consisting of CD30 chain, CD3ɛ chain, CD28, CD27,OX40 (CD134), 4-1BB (CD137), ICOS (CD278), IL-2Rẞ (CD122), IL-2Ra (CD132), DAP10,DAP12, DNAM1, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, MyD88,IL18R, CD40 or a combination thereof.

[0109] In some embodiments, the co-stimulatory domain is selected from the groupconsisting of CD28, 4-1BB, OX40, ICOS, DAP-10, CD27, CD30, CD40, NKGD2, CD2, FN14,HVEM, LTBR, CD28H, TNFR1, TNFR2, BAFF-R, BCMA, TACI, TROY, RANK, EDAR,XEDAR, GITR, DR6, and NGFR.

[0110] In some embodiments, the cytoplasmic domain of the MODL-CAR comprises oneor more additional elements that enhance intracellular signal transduction by the MODL-CAR. Insome embodiments, the cytoplasmic domain comprises one or more protein association motifs thatbind and recruit one or more intracellular signal transduction proteins. For example, U.S. PatentNo. 10,336,810 discloses increased cytotoxic activity of anti-CD19 CAR-T cells having CARSenhanced with JAK and STAT binding motifs in the cytoplasmic region. Similarly, InternationalApplication Pub. No. WO2023230447 discloses increased cytotoxic activity of anti-ROR1 CAR-T cells having CARs enhanced with JAK and STAT binding motifs in the cytoplasmic region.

[0111] In some embodiments, the intracellular signal transduction protein is SignalTransducer and Activator of Transcription 3 or STAT3. The STAT3 association motif is naturallypresent in IL-6 and IL-10. In some embodiments, the STAT3 association motif is YXXQ. In someembodiments, the STAT3 association motif is YRHQ (SEQ ID NO: 109). In some embodiments,the STAT3 association motif is engineered into the intracellular signaling domain of the MODL-CAR.

[0112] In some embodiments, the intracellular signal transduction protein is SignalTransducer and Activator of Transcription 5 or STAT5. In some embodiments, the STAT5association motif is YXXL. The STAT5 association motif is naturally present in IL-2R ẞ chain. Insome embodiments, the STAT5 association motif is YLSL (SEQ ID NO: 111). In someembodiments, the STAT5 association motif is engineered into the intracellular signaling domainof the MODL-CAR.

[0113] In some embodiments, the intracellular signal transduction protein is a Janus kinasesuch as JAK1. In some embodiments, the JAK association motif is LKCNTPDPS (SEQ ID NO:112). In some embodiments, the JAK association motif is selected from the JAK association motifspresent in a protein selected from the group consisting of IL2Ry (IL2RG), Erythropoietin receptor(EpoR), thrombopoietin receptor (TpoR), granulocyte macrophage colony stimulating factorreceptor (GM-CSFR), or growth hormone receptor (GHR). In some embodiments, the JAKassociation motif is engineered into the intracellular signaling domain of the MODL-CAR.

[0114] The nucleic acid encoding the MODL-CAR may be introduced into a cell as agenomic DNA sequence or a cDNA sequence. The cDNA sequence comprises an open readingframe for the translation of the protein (e.g., MODL-CAR), lacks introns and in someembodiments, further comprises untranslated regions (UTRs) that improve for example, thestability or the rate of translation of the MODL-CAR mRNA.

[0115] In some embodiments, the CAR coding sequence is inserted into the genome of acell (T cell, NK cell, monocyte, or macrophage). In some embodiments, the insertion is at a locusselected from TRAC, B2M, PDCD1, CBLB, CISH, TIGIT, TIM3, LAG3, CIITA, and DNMT3A.

[0116] In some embodiments, the insertion of the MODL-CAR is reliant on the cell'sendogenous homologous recombination systems. In such embodiments, the MODL-CAR codingsequence may be introduced into the cell via chemical delivery system (e.g., a lipid nanoparticle,LNP) or electrochemical means (e.g., electroporation) as “naked" nucleic acids as described e.g.,in U.S. Patent No. 6,410,319. The MODL-CAR coding sequence can also be introduced into thecell using vectors such as viral vectors including adenoviral and lentiviral vectors as discussed indetail elsewhere in this disclosure.

[0117] In some embodiments, the nucleic acid encoding the MODL-CAR is introducedinto a target cell where expression of the MODL-CAR is desired. In some embodiments, theintroduced nucleic acid is selected from a stable expression vector containing the MODL-CAR-encoding sequence, an mRNA encoding the MODL-CAR, and a delivery vector containing theMODL-CAR-encoding donor sequence to be inserted into the cellular genome. In someembodiments, the target cells are contacted with the nucleic acid encoding the MODL-CAR invitro, in vivo, or ex vivo.

[0118] In some embodiments, the vector used to deliver the MODL-CAR-encodingnucleic acid is a viral vector (e.g., a retroviral vector, adenoviral vector, adeno-associated viralvector, or lentiviral vector). In some embodiments, the viral vector is derived from a virus that isnon-replicating in target cells. In some embodiments, the vector is selected from or designed basedon SV40, EBV, HSV, or BPV. In some embodiments, the vector is a lentiviral vector or any othersuitable viral vector capable of delivering an adequate-size payload. In some embodiments, thelentivirus formed by a packaging system that includes a host cell where one or more plasmidsencoding the sequence of interest (e.g., a MODL-CAR-coding sequence) are introduced togetherwith the lentiviral genes. The transfected host cells then generate lentivirus with the MODL-CARsequence payload.

[0119] In some embodiments, to facilitate homologous recombination, the codingsequence (e.g., the MODL-CAR-coding sequence) is joined to homology arms located 5'(upstream) and 3' (downstream) of the insertion site in the desired insertion site in the genome. Insome embodiments, the homology arms are about 500 bp long. In some embodiments, in the caseof the CRISPR endonuclease used for gene insertion, the upstream homology arm contains thefirst ten nucleotides of the targeting region sequence of the nucleic acid targeting nucleic acid(NATNA) and the downstream homology arm contains the remaining ten nucleotides of thecorresponding targeting region of the NATNA.

[0120] Certain viruses such as adeno-associated virus (AAV) can be engineered to safelydeliver DNA donor elements to mammalian cells for stable integration into the cellular genome.If AAV delivery is combined with a genomic cleavage event, and the DNA donor element in theAAV is flanked by homology arms, the DNA donor element can be seamlessly inserted into thegenomic cut site by homology-directed repair (HDR), see, e.g., Eyquem et al. (Nature, 2017,543:113-117). In some embodiments, the MODL-CAR coding sequence is delivered into a cellvia AAV. In some embodiments, the MODL-CAR CAR construct comprises at least two portions:the antigen-binding portion and the stimulatory portion. To encode polypeptides shown inFIGURE 1, panel C, the nucleic acid comprises sequences coding for the antigen-binding portioncontaining an N-terminal secretion signal (such as a CD8a signal peptide), a portion specific forthe antigen target (e.g., an antibody or a fragment of an antibody such as scFv), a hinge region atransmembrane domain, and a first association domain, and further comprises sequences codingfor the stimulatory portion containing a second association domain, a costimulatory domain (suchas 4-1BB or CD28), and an activation domain (such as CD3 chain), and further comprises apolyadenylation signal. In some embodiments, the sequence coding for the antigen-binding portionof the MODL-CAR and the sequence coding for the stimulatory portion of the MODL-CAR areexpressed from a single promoter and separated by a ribosome skipping sequence (such as 2A), aninternal ribosomal entry sequences (IRES), or a proteolytic cleavage sequence (such as a Furinsequence). In some embodiments, the MODL-CAR encoding sequences are under the control ofmammalian promoter.

[0121] In some embodiments, the donor nucleic acid includes the MODL-CAR codingsequence described above flanked by homology arms. In some embodiments, the donor sequenceis synthesized into a suitable recombinant AAV (rAAV) plasmid which is packaged into an AAV6virus by a suitable host cell. In some embodiments, the immune cells (e.g., T cells, NK cells,monocytes, or macrophages) are contacted by AAV at a suitable multiplicity of infection (MOI)e.g., MOI of 2 x 105 and incubated in suitable medium (e.g., supplemented with IL-2).

[0122] In some embodiments, the MODL-CAR is targeted for insertion into the T cellreceptor alpha constant (TRAC) locus. See Eyquem J., et al. (2017) Targeting a CAR to the TRAClocus with CRISPR / Cas9 enhances tumor rejection, Nature, 543:113-117. In some embodiments,In some embodiments, the MODL-CAR is targeted for insertion into a locus selected from beta-2microglobulin (B2M), programmed cell death protein 1 (PDCDI), Cbl proto-oncogene B (CBLB),cytokine-inducible SH2 protein (CISH), T cell immunoreceptor with Ig and ITIM domains(TIGIT), T-cell immunoglobulin and mucin-domain containing-3 (TIM3), lymphocyte activationgene 3 (LAG3), class II, major histocompatibility complex, transactivator (CIITA), and DNA(cytosine-5)-methyltransferase 3A (DNMT3A).

[0123] In some embodiments, the MODL-CAR is targeted for insertion into a “safe harborlocus" defined as a locus that supports sustained gene expression with minimal silencing. Safeharbor loci in the human genome are enumerated e.g., in publications WO2011104382,WO2020206162, WO2021152086, US20230416747 and US20200370067.

[0124] In some embodiments, the sequence coding for the MODL-CAR together with thehomology arms are cloned into a viral vector plasmid. The plasmid is used to package thesequences into a virus.

[0125] A typical plasmid or virus-based expression or delivery construct incorporates acoding sequence along with other sequences required for protein expression. In someembodiments, the coding sequences (e.g., the MODL-CAR-coding sequence) are codon-optimizedfor expression in mammalian cells. In some embodiments, the vector also incorporates regulatorysequences including transcriptional activator binding sequences, transcriptional repressor bindingsequences, enhancers, introns, and the like. In some embodiments, the viral vector supplies aconstitutive promoter or an inducible promoter. In some embodiments, the promoter is selectedfrom U6 promoter, a H1 promoter, a dihydrofolate reductase (DHFR) promoter, an MNDpromoter, a human ubiquitin C (UBC) promoter, a CAG promoter, a CaMKIIa promoter, an SV40early promoter, an SV40 late promoter, a cytomegalovirus (CMV) immediate early promoter, aRous sarcoma virus long terminal repeat (RSV-LTR) promoter, mouse mammary tumor virus longterminal repeat (MMTV-LTR) promoter, a spleen focus-forming virus (SFFV) promoter, a murineembryonic stem cell virus (MSCV) promoter, a ẞ-interferon promoter, a hsp70 promoter, an EF-la promoter, an EFla, promoter, an EF-la core (EFC) promoter, a ẞ-Actin promoter, a СВАpromoter, a ẞ-actin promoter, a myeloproliferative sarcoma virus (MPSV) promoter, a mouse orhuman phosphoglycerate kinase 1 (PGK1) promoter, and an interferon gamma (IFNy) promoter.

[0126] In some embodiments, the vector further supplies a transcription terminator. Insome embodiments, the expression vector comprises polyadenylation signals. In someembodiments, the polyadenylation sites are SV-40 polyadenylation signals.

[0127] In some embodiments, the nucleic acid comprises more than one coding sequenceand encodes a polycistronic transcript. In some embodiments, one of the coding sequences in thepolycistronic transcript encodes a MODL-CAR.

[0128] In some embodiments, the vector is a plasmid selected from a prokaryotic plasmid,a eukaryotic plasmid, and a shuttle plasmid.

[0129] In some embodiments, the MODL-CAR is expressed in a eukaryotic cell, such as ahuman cell of a particular type (e.g., T cell, NK cell, monocyte, or macrophage) and the vector isa plasmid comprising a eukaryotic promoter active in the desired cell type, a secretion signal, apolyadenylation signal, and a stop codon, and, optionally, one or more regulatory elements suchas enhancer elements.

[0130] In some embodiments, the target cells are contacted with a viral vector so that thegenetic material delivered by the vector is integrated into the genome of the target cell and thenexpressed in the cell or on the cell surface. In such embodiments, the transduced and transfectedcells can be tested to confirm transgene expression in the cell or on the cell surface using methodswell known in the art such as fluorescence-activated cell sorting (FACS), microfluidics-basedscreening, ELISA, or Western blot. For example, the cells can be tested by staining or by flowcytometry with antibodies specific to a portion of the MODL-CAR.

[0131] The present invention involves manipulating nucleic acids, including genomicDNA and plasmid DNA that were isolated or extracted from a sample. Methods of nucleic acidextraction are well known in the art. See Sambrook, J., et al., Molecular Cloning, A LaboratoryManual, 4th Ed. Cold Spring Harbor Lab. Press (2012). A variety of reagent and kits arecommercially available for extracting nucleic acids (DNA or RNA) from biological samples,including products from BD Biosciences (San Jose, Cal.), Clontech (TaKaRa Bio.); EpicentreTechnologies (Madison, Wisc.); Gentra Systems, (Minneapolis, Minn.); Qiagen (Valencia, Cal.);Ambion (Austin, Tex.); BioRad Laboratories (Hercules, Cal.); KAPA Biosystems (RocheSequencing Solutions, Pleasanton, Cal.) and more.

[0132] In some embodiments, the invention involves intermediate purification orseparation steps for nucleic acids, e.g., to remove unused reactants from the DNA. The purificationor separation may be performed by a size selection method selected from gel electrophoresis,affinity chromatography and size exclusion chromatography. In some embodiments, size selectioncan be performed using Solid Phase Reversible Immobilization (SPRI) technology from BeckmanCoulter (Brea, Cal.).

[0133] In some embodiments, the nucleic acid sequences encoding the MODL CRdescribed herein are introduced into the cell for integration into the cellular genome. In someembodiments, integration at a specific locus is accomplished via cleavage with a sequence-specificor sequence-guided endonuclease.

[0134] In some embodiments, the sequence-guided endonuclease is a CRISPRendonuclease.

[0135] The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)genomic locus is found in many prokaryotic genomes and provides resistance to invasion offoreign nucleic acids. Structure, nomenclature, and classification of CRISPR loci are reviewed inMakarova et al., Evolution and classification of the CRISPR-Cas systems. Nature ReviewsMicrobiology. 2011 June; 9(6): 467-477.

[0136] A typical CRISPR locus includes a number of short repeats regularly interspacedwith spacers. The CRISPR locus also includes coding sequences for CRISPR-associated (Cas)genes. A spacer-repeat sequence unit encodes a CRISPR RNA (crRNA). In vivo, mature crRNAsare processed from a polycistronic transcript referred to as pre-crRNA or pre-crRNA array. Therepeats in the pre-crRNA array are recognized by Cas-encoded proteins that bind to and cleave therepeats liberating mature crRNAs. CRISPR systems perform cleavage of a target nucleic acidwherein Cas proteins and crRNA form CRISPR ribonucleoproteins (crRNP). The crRNA moleculeguides the crRNP to the target nucleic acid (e.g., a foreign nucleic acid invading a bacterial cell)and the Cas nuclease proteins cleave the target nucleic acid.

[0137] Type I CRISPR systems include means for processing the pre-crRNA array thatinclude a multi-protein complex called CASCADE (CRISPR-associated complex for antiviraldefense) comprised of subunits CasA, B, C, D and E. The Cascade-crRNA complex recognizesthe target nucleic acid through hybridization of the target nucleic acid with crRNA. The boundnucleoprotein complex recruits the Cas3 helicase / nuclease to facilitate cleavage of target nucleicacid.

[0138] Type II CRISPR systems include a trans-activating CRISPR RNA (tracrRNA). ThetracrRNA hybridizes to a crRNA repeat in the pre-crRNA array and recruits endogenous RNaseIIIto cleave the pre-crRNA array. The tracrRNA / crRNA complex can associate with a nuclease, e.g.,Cas9. The crRNA-tracrRNA-Cas9 complex recognizes the target nucleic acid throughhybridization of the target nucleic acid with crRNA. Hybridization of the crRNA to the targetnucleic acid activates the Cas9 nuclease for target nucleic acid cleavage.

[0139] Type III CRISPR systems include the RAMP superfamily of endoribonucleases(e.g., Cas6) that cleave the pre-crRNA array with the help of one or more CRISPR polymerase-like proteins.

[0140] Type VI CRISPR systems comprise a different set of Cas-like genes, includingCsfl, Csf2, Csf3, and Csf4 which are distant homologues of Cas genes in Type I-III CRISPRsystems.

[0141] Type V CRISPR systems are classified into several different subtypes, including,e.g., V-A, V-B, V-C, V-D, V-E, V-F, V-G, V-H, V-I, V-J, V-K, and V-U. See, e.g., Makarova etal. (Nat. Rev. Microbiol., 2020, 18:67-83) and Pausch et al. (Science, 2020, 369(6501):333-337).The V-A subtype encodes the Cas12a protein (formerly known as Cpf1). Cas12a has a RuvC-likenuclease domain that is homologous to the respective domain of Cas9 but lacks the HNH nucleasedomain that is present in Cas9 proteins. Type V systems can comprise a single crRNA sufficientfor targeting of the Cas12 to a target site, or a crRNA-tracrRNA guide pair for targeting of theCas12 to a target site.

[0142] CRISPR endonucleases require a nucleic acid targeting nucleic acid (NATNA) alsoknown as guide RNAs. The endonuclease is capable of forming a ribonucleoprotein complex(RNP) with one or more guide RNAs. In some embodiments, the endonuclease is a Type IICRISPR endonuclease and NATNA comprises tracrRNA and crRNA.

[0143] In some embodiments, NATNA is selected from the embodiments described in U.S.Patent No. 9,260,752. Briefly, a NATNA can comprise, in the order of 5' to 3', a spacer extension,a spacer, a minimum CRISPR repeat, a single guide connector, a minimum tracrRNA, a 3'tracrRNA sequence, and a tracrRNA extension. In some instances, a nucleic acid-targeting nucleicacid can comprise, a tracrRNA extension, a 3' tracrRNA sequence, a minimum tracrRNA, a singleguide connector, a minimum CRISPR repeat, a spacer, and a spacer extension in any order.

[0144] In some embodiments, the guide nucleic acid-targeting nucleic acid can comprisea single guide NATNA. The NATNA comprises a spacer sequence which can be engineered tohybridize to the target nucleic acid sequence. The NATNA further comprises a CRISPR repeatcomprising a sequence that can hybridize to a tracrRNA sequence. Optionally, NATNA can havea spacer extension and a tracrRNA extension. These elements can include elements that cancontribute to stability of NATNA. The CRISPR repeat and the tracrRNA sequence can interact, toform a base-paired, double-stranded structure. The structure can facilitate binding of theendonuclease to the NATNA.

[0145] In some embodiments, the single guide NATNA comprises a spacer sequencelocated 5' of a first duplex which comprises a region of hybridization between a minimum CRISPRrepeat and minimum tracrRNA sequence. The first duplex can be interrupted by a bulge. Thebulge facilitates recruitment of the endonuclease to the NATNA. The bulge can be followed by afirst stem comprising a linker connecting the minimum CRISPR repeat and the minimumtracrRNA sequence. The last paired nucleotide at the 3' end of the first duplex can be connectedto a second linker connecting the first duplex to a mid-tracrRNA. The mid-tracrRNA can compriseone or more additional hairpins.

[0146] In some embodiments, the NATNA can comprise a double guide nucleic acidstructure. The double guide NATNA comprises a spacer extension, a spacer, a minimum CRISPRrepeat, a minimum tracrRNA sequence, a 3' tracrRNA sequence, and a tracrRNA extension. Thedouble guide NATNA does not include the single guide connector. Instead, the minimum CRISPRrepeat sequence comprises a 3' CRISPR repeat sequence and the minimum tracrRNAsequence comprises a 5' tracrRNA sequence and the double guide NATNAs can hybridize via theminimum CRISPR repeat and the minimum tracrRNA sequence.

[0147] In some embodiments, NATNA is an engineered guide RNA comprising one ormore DNA residues (CRISPR hybrid RNA-DNA or chRDNA). In some embodiments, NATNAis selected from the embodiments described in U.S. Patent No. 9,650,617. In some embodiments,NATNA is selected from the embodiments described in International Application Pub. No.WO2022086846 DNA-containing polynucleotides and guides for CRSIPR Type V systems, andmethods of making and using the same. Briefly, some chRDNA for use with a Type II CRISPRsystem may be composed of two strands forming a secondary structure that includes an activatingregion composed of an upper duplex region, a lower duplex region, a bulge, a targeting region, anexus, and one or more hairpins. A nucleotide sequence immediately downstream of a targetingregion may comprise various proportions of DNA and RNA. Other chRDNA may be a single guideD(R)NA for use with a Type II CRISPR system comprising a targeting region, and an activatingregion composed of a lower duplex region, an upper duplex region, a fusion region, a bulge, anexus, and one or more hairpins. A nucleotide sequence immediately downstream of a targetingregion may comprise various proportions of DNA and RNA. For example, the targeting regionmay comprise DNA or a mixture of DNA and RNA, and an activating region may comprise RNAor a mixture of DNA and RNA.

[0148] In some embodiments, the NATNA comprises one or more chemical modificationsthat improve performance of the NATNA. In some embodiments, the improved performanceconstitutes improved accuracy of cleavage of the target nucleic acid by the endonuclease guidedby the NATNA. In some embodiments the chemical modification constitutes one or more abasicsites. In some embodiments the chemical modification constitutes one or more base analogs asdescribed in the U.S. Patent Application Publication No. US20220348929 CRISPR abasicrestricted nucleotides and CRISPR accuracy via analogs. Examples of abasic sites includeapurinic and apyrimidinic sites. Examples of base analogs include inosine, deoxyinosine,deoxyuridine, xanthosine, C3 spacer, 5-methyl dC, 5-hydroxybutynl-2'-deoxyuridine, 5-nitroindole, 5-methyl iso-deoxycytidine, iso deoxyguanosine, and iso deoxycytidine. In someembodiments the chemical modification constitutes a combination of one or more abasic sites andone or more base analogs.

[0149] In some embodiments, the components of the CRISPR system are introduced intothe target cells in the form of a plasmid comprising DNA encoding the nucleic acid-guidedendonuclease and DNA encoding CRISPR nucleic acid guides.

[0150] In some embodiments, the components of the CRISPR system are introduced intothe target cells in the form of RNA encoding the nucleic acid-guided endonuclease and RNA-containing CRISPR nucleic acid guides.

[0151] In some embodiments, the components of the CRISPR system are introduced intothe target cells in the form of a preassembled nucleoprotein complex. In some embodiments, thecomponents of the CRISPR system are introduced into the target cells via electroporation ornucleofection. In some embodiments, the components of the CRISPR system are introduced intothe target cells in the form of nucleic acids to be transcribed and, for proteins, translated inside thecell.

[0152] In some embodiments, the CRISPR endonuclease is Cas12a. In some embodiments,the Cas12a is the Acidaminococcus spp. (strain BV3L6) catalytically active Cas12a protein,AsCas12a (SEQ ID NO: 67).

[0153] In some embodiments, the CRISPR endonuclease coding sequence is codonoptimized for expression in E. coli cells. In some embodiments, CRISPR endonuclease comprisesa nuclear localization signal (NLS) suitable for mammalian cells. In some embodiments, the NLSis SEQ ID NO: 68. In some embodiments, the NLS is at the C-terminus of the CRISPRendonuclease protein. In some embodiments, the CRISPR endonuclease protein is expressed in E.coli and purified using affinity chromatography, ion exchange, and size exclusionchromatography, essentially as described in, for example, Swarts et al. (Molecular Cell, 2017,66:221-233).

[0154] In some embodiments, CRISPR endonuclease utilizes a suitable nucleic acidtargeting nucleic acid (NATNA) or "guide" comprising a targeting region and an activating regioncapable of interacting with the endonuclease. In some embodiments, the targeting regioncomprises a 20-nucleotide sequence capable of hybridizing to a target sequence that occurrsdownstream (in the 3' direction) of a PAM sequence. (e.g., 5'-TTTV-3'or 5'-TTTN-3' forCas12a).

[0155] In some embodiments, the NATNA is all-RNA and can be produced by in vitrotranscription (e.g., T7 Quick High Yield RNA Synthesis Kit; New England Biolabs, Ipswich,Mass.) from double-stranded (ds) DNA templates by incorporating a T7 promoter at the 5' end ofthe dsDNA template sequences. In some embodiments, the NATNA is a hybrid RNA-DNAmolecule and is produced by chemical synthesis.

[0156] In some embodiments, the ribonucleoprotein complex (RNP) comprising theCRISPR endonuclease and the NATNA is assembled outside the cell. Nucleoprotein complexeswere formed by combining the CRISPR endonuclease and the NATNA at a molar ration 1:3, e.g.,at a concentration of 80 pmol protein:240 pmol NATNA.

[0157] In some embodiments, the endonuclease used to introduce one or more of thegenetic modifications described herein (e.g., gene inactivation or insertion of the MODL-CAR-coding sequences) into the genome of a cell is a restriction endonuclease, e.g., a Type II restrictionendonuclease.

[0158] In some embodiments, the endonuclease used to introduce one or more of thegenetic modifications described herein is a catalytically inactive CRISPR endonuclease (e.g.,catalytically inactive Cas9 or Cas12a) conjugated to the cleavage domain of the restrictionendonuclease Fok I. (see e.g., Guilinger, J. P., et al., (2014). Fusion of catalytically inactive Cas9to Fokl nuclease improves the specificity of genome modification, Nature biotechnology, 32(6),577-582.

[0159] In some embodiments, the endonuclease used to introduce one or more of thegenetic modifications described herein is a CRISPR Type 1 (CASCADE) complex comprising anicking endonuclease, e.g., mutant Cas3 (mCas3) or a Fokl subunit (see e.g., InternationalApplications Pub. Nos. WO2013098244 and WO2019241452).

[0160] In some embodiments the endonuclease used to introduce one or more of thegenetic modifications described herein is a zinc finger nuclease (ZFN), or a ZFN-Fok I fusion. Insuch embodiments, the target sequence is about 22-52 bases long and comprises a pair of ZFNrecognition sequences, each 9-18 nucleotides long, separated by a spacer, which is 4-18nucleotides long. (See e.g.., Kim Y.G., et al., (1996). Hybrid restriction enzymes: zinc fingerfusions to Fok I cleavage domain, Proc Natl Acad Sci USA. 93(3): 1156–1160.

[0161] In some embodiments, the endonuclease used to introduce one or more of thegenetic modifications described herein is a transcription activator-like effector nuclease (TALEN),or a TALEN-Fok I fusion. In such embodiments, the target sequence is about 48-85 nucleotideslong and comprises a pair of TALEN recognition sequences, each 18-30 bases long, separated bya spacer, which is 12-25 bases long. (See e.g., Christian M. et al., (2010) Targeting DNA double-strand breaks with TAL effector nucleases, Genetics. 186 (2): 757–61.

[0162] In some embodiments, the invention comprises adoptive cells and the use ofadoptive cells in cellular immunotherapy. Adoptive cells of the instant invention include T cells,natural killer (NK) cells, induced natural killer (iNK) cells, and their precursors, monocytes,macrophages, and other immune cells capable of expressing the engineered receptor describedherein.

[0163] In some embodiments, the cells of the instant invention are allogeneic cells, i.e.,cells isolated from a donor, such as a healthy human donor of either gender.

[0164] In some embodiments, the cells are isolated from a healthy donor using standardtechniques. For example, lymphocytes can be isolated from blood, including peripheral blood andcord blood, or from lymphoid organs such as the thymus, bone marrow, lymph nodes, andmucosal-associated lymphoid tissues (MALT). Techniques for isolating lymphocytes from suchtissues are well known in the art, see, e.g., Smith, J.W. (1997) Apheresis techniques and cellularimmunomodulation, Ther. Apher. 1:203-206. In some embodiments, T cells are isolated using apositive selection or a negative selection using antibodies specific for cell surface proteins. In someembodiments, said antibodies are conjugated to magnetic particles allowing magnet-basedseparation of certain cell types.

[0165] In some embodiments, isolated lymphocytes are characterized in terms ofspecificity, frequency, and function. In some embodiments, the isolated lymphocyte population isenriched for specific subsets of cells, such as T cells or NK cells.

[0166] In some embodiments, the isolated lymphocyte population is enriched for specificsubsets of T cells, such as CD4+, CD8+, CD25+, or CD62L+. See, e.g., Wang et al., Mol. Therapy- Oncolytics (2016) 3:16015. In some embodiments, after isolation, the lymphocytes are activatedin order to promote proliferation and differentiation into specialized lymphocytes. For example, Tcells can be activated using soluble CD3 / 28 activators, or magnetic beads coated with anti-CD3 / anti-CD28 monoclonal antibodies.

[0167] In some embodiments, the isolated lymphocyte population is enriched for CD56+phenotype representing NK cells.

[0168] In some embodiments, NK cells are produced by differentiating stem cells such asembryonic stem cell (ESCc) and induced pluripotent stem cells (iPSCs). See e.g., T. Cheng (ed.),Hematopoietic Differentiation of Human Pluripotent Stem Cells, SpringerBriefs in Stem Cells,DOI 10.1007 / 978-94-017-7312-6_5, Hermanson, et al., Chapter 5, Human Pluripotent Stem Cellsas a Renewable Source of Natural Killer Cells.; Woll, et al., (2016) Human embryonic stem cellsdifferentiate into a homogeneous population of natural killer cells with potent in vivo antitumoractivity, Blood, 113(24) 6094; and Denman, et al., (2012) Membrane-Bound IL-21 PromotesSustained Ex Vivo Proliferation of Human Natural Killer Cells, PloS One, 7(1):e30264.

[0169] The differentiation process typically comprises two and optionally, three steps:differentiating stem cells into hematopoietic progenitor cells (HPC), differentiating HPC intonatural killer cells (NK), and optional expansion of NK cells. The products of differentiation (orexpansion) may also be tested for the presence of NK phenotype such as NK-specific geneexpression patterns, including expression of NK-specific cell surface markers, e.g., CD45 andCD56.

[0170] In some embodiments, the step of forming hematopoietic progenitor cells (HPC)comprises forming spheroids by allowing cells to aggregate (optionally assisted by low-speedcentrifugation) and incubating the spheroids in presence of one or more cytokines selected fromBMP4, VEGF, SCF, IL3, IL6, and TPO. In some embodiments, the combination of BMP4, VEGF,and SCF is used. In some embodiments, the combination of BMP4, VEGF, SCF, IL3, IL6, andTPO is used. In some embodiments, HPC are formed by incubation in the presence of feeder cellssuch as bone marrow stromal cells.

[0171] In some embodiments, the step of forming NK cells comprises incubating spheroidsin the presence of one or more cytokines selected from IL-3, IL-15, IL-7, SCT, and FLT3L. Insome embodiments, the combination of IL-3, IL-15, IL-7, SCT, and FLT3L is used. In someembodiments, feeder cells (stromal cells) are used. In some embodiments, fetal liver stromal cellsare used as feeders. In some embodiments, the HPC fraction is enriched for the CD34+ cells priorto initiating the NK-differentiation step. In some embodiments, at the completion of thedifferentiation stage, the cell fraction is tested for surface expression of NK-specific markers suchas CD45 and CD56.

[0172] In some embodiments, the step of NK cell expansion comprises incubating NKcells in the presence of cytokines and antigen presenting cells (APCs). In some embodiments, theAPCs are engineered to express cytokines on the cell surface. In some embodiments, APCsoverexpress 4-1BBL and membrane bound IL-21. In some embodiments, APCs overexpressmembrane bound IL-15. In some embodiments, APCs overexpress cytokine-receptor fusions. Insome embodiments, APCs overexpress an IL-15-IL-15R fusion. In some embodiments, APCSoverexpress an IL-21-IL-21R fusion. In some embodiments, exogenous cytokines are also added.In some embodiments, IL-2 is added. In some embodiments, the final expanded iNK product wasevaluated in in vitro and in vivo functional assays.

[0173] In some embodiments, the cells are macrophages. Macrophages can be isolated fromperipheral blood e.g., as described in Klichinsky M. et al., (2020) Human chimeric antigenreceptor macrophages for cancer immunotherapy, Nat. Biotechnol. 38(8):947. In someembodiments, the method comprises a step of apheresis applied to a human donor (or humanpatient) to obtain blood cells without retrieving a blood sample. In some embodiments, the methodcomprises isolating a cellular fraction (peripheral blood mononuclear cells (PBMCs) from a bloodsample (e.g., by density gradient centrifugation). In some embodiments, the method comprises thestep of elutriation applied to the cellular fraction to reduce the presence of erythrocytes, platelets,lymphocytes, and granulocytes in the cellular fraction. In some embodiments, the methodcomprises a step of enriching monocytes, e.g., by positive selection for cell surface proteinsselectively expressed in monocytes. The positive selection may utilize fluorescent-activated cellsorting (FACS) or magnetic-activated cell sorting (MACS). In some embodiments, monocytes areenriched by FACS or MACS as CD14+ cells. In some embodiments, monocytes are enriched onthe basis of surface expression of one or more of CD4, CD9, CD13, CD14, and CD36 to obtain asample of isolated monocytes or enriched monocytes.

[0174] The isolated monocytes are differentiated into macrophages by the addition of acolony-stimulating factor (CSF) such as granulocyte macrophage colony stimulating factor (GM-CSF) or macrophage colony stimulating factor (M-CSF), e.g., at 10-50 ng / mL. Differentiation maybe enhanced by the addition of cytokines, e.g., IL-4, IL-10 or TGFẞ, e.g., at 5-20 ng / mL.

[0175] The present invention comprises allogeneic engineered immune cells including Tcells, NK cells (including NK cells and induced NK (iNK) cells), monocytes, and macrophagesengineered to express a MODL-CAR construct designed as disclosed herein.

[0176] In some embodiments, only one of the MODL-CAR-T cells, the MODL-CAR-NKcells, and the MODL-CAR-macrophages are administered to a patient. In some embodiments, acombination or a mixture of two or more of the MODL-CAR-T cells, the MODL-CAR-NK cellsand the MODL-CAR-macrophages is administered to a patient.

[0177] In some embodiments, the cells used in the invention are engineered to express theMODL-CAR and further comprise a genome modification resulting in armoring of the cells againstan attack by the immune system of a recipient of the allogeneic immune cells. In someembodiments, the armoring modification comprises protection from recognition by the cytotoxicT cells of the recipient. Cytotoxic T cells recognize MHC Class I antigens. An MHC Class Imolecule is a cell surface molecule comprised of beta-2 microglobulin (B2M) associated withheavy chains of HLA-I proteins (selected from HLA-A, HLA-B, HLA-C, HLA-E, HLA-F andHLA-G). The B2M / HLA-I complex on the surface of the allogeneic cell is recognized by cytotoxicCD8+ T cells and, if HLA-I is recognized as non-self, the allogeneic cell is killed by the T cells. Insome embodiments, the cells of the invention comprise an armoring genomic modificationcomprising a disruption of the B2M gene and therefore, disruption of the MHC Class I cell surface-bound complex. This disruption eliminates the MHC Class I antigen recognition that normallystimulates a cytotoxic T cell attack.

[0178] In some embodiments, the armoring modification comprises protection fromcytotoxic T cells' recognition of MHC Class II antigens. An MHC Class II molecule is a cellsurface molecule comprised of HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, andHLA-DR. The HLA-II complex on the surface of the allogeneic cell is recognized by T helperCD4+ T cells and NK cells, if HLA-II is recognized as non-self, the allogeneic cell is killed by thecells or NK cells. In some embodiments, the cells of the invention comprise an armoring genomicmodification comprising a disruption of the MHC II transcriptional activator CIITA gene andtherefore, disruption of the MHC Class II expression. This disruption eliminates the MHC ClassII antigen recognition that normally stimulates a T cell or NK cell attack.

[0179] In some embodiments, the armoring genome modification comprises disruption ofrecognition of the engineered MODL-CAR-expressing cells by the natural killer (NK) cells of thehost. NK cells recognize cells without any MHC-I protein as "missing self" and kill such cells.NK cells are inhibited by MHC-I proteins, including HLA-E, a minimally polymorphic MHC-Iprotein. In some embodiments, the cells of the invention comprise a first armoring genomicmodification comprising a disruption of the B2M gene and therefore, disruption of the MHC ClassI cell surface-bound complex, disruption of the MHC Class I antigen recognition that stimulates acytotoxic T cell attack, and further comprise a second armoring genomic modification comprisingan insertion of an HLA-E gene fused to the beta-2-microglobulin (B2M) gene, and therefore,expression of the B2M-HLA-E construct designed to cloak the cells from an attack by NK cells.See, e.g., Gornalusse et al., (2017) HLA-E-expressing pluripotent stem cells escape allogeneicresponses and lysis by NK cells, Nat. Biotechnol. (2017) 35:765-772.

[0180] In some embodiments, the cells used in the invention are engineered to express theMODL-CAR and further comprise a genome modification resulting in transcriptionally silencingor disrupting one or more immune checkpoint or immuno-regulatory genes. In some embodiments,the checkpoint or regulatory gene is selected from PDCD1, CBLB, CISH (ISH), ADAM17,PRDM1, CTLA-4, LAG3, Tim3, BTLA, BY55, TIGIT, B7H5, LAIRI, SIGLEC10, B2M, and 2B4.

[0181] In some embodiments, the silenced or disrupted immune checkpoint gene is CBLB.CBLB protein is an immune checkpoint controlling activity of NK cells. Upon its phosphorylation,CBLB binds to activating downstream effectors of NK cells and downregulates them throughproteasome-mediated degradation. CBLB negatively affects NK cell cytotoxicity, cytokineproduction and persistence, and suppressing CBLB activity in NK cells enhances the antitumorfunction of NK cells. See Lu et al., (2021) Cbl-b Is Upregulated and Plays a Negative Role inActivated Human NK Cells, J Immunol. 206 (4): 677–685; Lametschwandtner et al., (2015) Cbl-b silenced human NK cells respond stronger to cytokine stimulation, J ImmunoTher. of Cancer, 3(Suppl.2):P230; Guo, et al., (2021) CBLB ablation with CRISPR / Cas9 enhances cytotoxicity ofhuman placental stem cell-derived NK cells for cancer immunotherapy. J ImmunoTher. of Cancer9:e001975.

[0182] In some embodiments, the silenced or disrupted regulatory gene is CISH. CISH orCIS (cytokine-induced SH2 protein) is a negative regulator of T cells and NK cells. Inhibition ofCISH has been shown to enhance the potency of NK cells against certain cancers and infections(U.S. Patent No. 11,104,375).

[0183] In some embodiments, the silenced or disrupted immune checkpoint gene is LAG3.Lymphocyte activation gene 3 (LAG3, also known as CD223) is an immune checkpoint receptorexpressed on activated or exhausted T cells. LAG3 interacts with MHC class II molecules to inhibitT cell function and contributes to T cell exhaustion. Chronic lymphocytic leukemia (CLL) cellsboth express and secrete LAG3 which is thought to contribute to CLL tumor growth and escapefrom T cell attack. Shapiro et al., (2017) Lymphocyte activation gene 3: a novel therapeutic targetin chronic lymphocytic leukemia, Haematologica, 102(5):874.

[0184] In some embodiments, the silenced or disrupted immune checkpoint gene is TIM3.T cell immunoglobulin mucin 3 (TIM3) is a negative regulator of T cell function. Tim3 binds toits receptor Galectin-9 on the surface of T cells and inhibits the function of various types of T cellsincluding CD4+ T cells, CD8+ T cells, Tregs and T helper cells. In hematologic malignanciesincluding chronic lymphocytic leukemia (CLL), high levels of expression of Tim3 upregulateinhibitory Treg cells, inhibit T helper cell function and correlate with poor prognosis. Pang et al.,(2021) Activated Galectin-9 / Tim3 promotes Treg and suppresses Th1 effector function in chroniclymphocytic leukemia, FASEB J. 35:e21556.

[0185] In some embodiments, the silenced or disrupted immune checkpoint gene is TIGIT.T cell immunoreceptor with immunoglobulin and ITIM domain (TIGIT) is expressed by activatedCD8+ T and CD4+ T cells, natural killer (NK) cells, regulatory T cells (Tregs), and follicular Thelper cells. High levels of TIGIT expression in CAR-T cells are associated with poor response toCAR-T cell therapy, se ie Jackson et al., (2022) Sequential Single-Cell Transcriptional andProtein Marker Profiling Reveals TIGIT as a Marker of CD19 CAR-T Cell Dysfunction in Patientswith Non-Hodgkin Lymphoma, Cancer Discov. 12(8):1886.

[0186] In some embodiments, the immune checkpoint gene or the regulatory gene isdisrupted using an endonuclease that specifically cleaves nucleic acid strands within a targetsequence of the gene to be disrupted. The strand cleavage by the sequence-specific endonucleaseresults in nucleic acid strand breaks that may be repaired by non-homologous end joining (NHEJ).NHEJ is an imperfect repair process that may result in direct re-ligation but more often, results indeletion, insertion, or substitution of one or more nucleotides in the target sequence. Suchdeletions, insertions, or substitutions of one or more nucleotides in the target sequence may resultin missense or nonsense mutations in the protein coding sequence and eliminate production of anyprotein or cause production of a non-functional protein.

[0187] In some embodiments, the immune checkpoint gene is disrupted by contacting thecell with a sequence-specific endonuclease and triggering the NHEJ process within the cellresulting in gene mutation and elimination of protein expression of the immune checkpoint gene.

[0188] In some embodiments, the sequence-specific endonuclease is selected from a rare-cutting restriction enzyme, a TALEN, a Zinc-finger nuclease (ZFN) and a CRISPR endonuclease.

[0189] In some embodiments, the sequence-specific endonuclease is a CRISPRendonuclease (e.g., Cas9 or Cas12a) as described elsewhere in this disclosure.

[0190] In some embodiments, a quality control measure assessing one or more propertiesof the cells engineered to express the MODL-CAR is applied to the cells prior to administering thecells to a patient.

[0191] In some embodiments, the assessed property of the engineered cells is the presenceof the MODL-CAR nucleic acid in the cellular genome. The presence of the MODL-CAR nucleicacid in the cellular genome may be assessed by a method selected from nucleic acid hybridization,nucleic acid sequencing, and specific amplification including polymerase chain reaction (PCR),quantitative PCR (qPCR), real-time PCR (rtPCR) and droplet digital PCR (ddPCR). In someembodiments, the presence of the MODL-CAR sequence in the cellular genome is assessed byddPCR with amplification primers specific for one or both CAR insertion sites. In someembodiments, ddPCR further enables assessment of the number of cells in the cell population thathas been successfully engineered.

[0192] In some embodiments, the assessed property of the engineered cells is surfaceexpression of the MODL-CAR. The surface expression of the MODL-CAR may be assessed byfluorescence-activated cell sorting (FACS), microfluidics-based screening, ELISA, or Westernblot. In some embodiments, the surface expression of the MODL-CAR is assessed by flowcytometry with an anti-Fab2 antibody or labeled purified antigen. In some embodiments, thesurface expression of the MODL-CAR is assessed by flow cytometry with the antigen capable ofbinding to the antigen-binding domain of the MOLD-CAR. In some embodiments, the engineeredcell population with the highest surface expression of the MODL-CAR is selected foradministration to a patient.

[0193] In some embodiments, the fraction of cells in the cell population harboring theMODL-CAR in the genome, or the fraction of cells in the cell population expressing the MODL-CAR on the cell surface is used to determine the total number of cells of the cell populationconstituting a therapeutically effective dose.

[0194] In some embodiments, the properties of the engineered cells are assessed in vitroand are selected from antigen-dependent lysis of antigen-expressing target cells (antigen-specificlysis); proliferation in the presence of antigen-expressing target cells (antigen-dependentproliferation); and cytokine secretion in the presence of antigen-expressing target cells, cellexhaustion, and the presence of a memory cell phenotype.

[0195] In some embodiments, the in vitro assessment of the engineered cells utilizes targetcells or target cell lines. In some embodiments, the target cells are tumor cells selected fromprimary tumor cells and established tumor cell lines with high expression of the antigen capableof binding to the antigen-binding domain of the MOLD-CAR.

[0196] In some embodiments, the assessed property is antigen-dependent lysis of antigen-harboring target cells. The antigen-dependent cell lysis may be assessed by co-culturing thepopulation comprising engineered cells expressing the MODL-CAR (effector cells or effectors)with antigen-expressing cells (targets). In some embodiments, the target cells are primary cellsfrom patients suffering from tumors known to express the antigen. The co-culture may beestablished at different effector:target ratios (E:T ratios). In some embodiments, the E:T ratios arein the range of about 0.1 and about 10. In some embodiments, two or more E:T ratios in the selectedrange are evaluated. In some embodiments, the antigen-expressing target cells are labelled with acell tracing dye (e.g., CellTracетм Violet dye (CTV)) in advance and co-cultured with MODL-CAR expressing effector cells at a range of E:T ratios. At the analysis timepoints, a dead cell stain(e.g., 7-aminoactinomycin (7AAD) stain) is added to the cultures. The number of live target cellsis then counted e.g., by flow cytometry as the number of trace stain / no dead stain (e.g.,CTV+7AAD) cells remaining. In some embodiments, the number of the live target cells isnormalized against the number of live target cells in a control culture of non-engineered cells.

[0197] In some embodiments, the assessed property is repeated antigen-dependent lysis ofantigen-harboring target cells. The antigen-dependent cell lysis may be assessed by successivechallenges of the same population of engineered MODL-CAR expressing cells with two or morefresh aliquots of target cells.

[0198] In some embodiments, the MODL-CAR-expressing cell population effecting thehighest percentage of target cell lysis is selected for administration to a patient. In someembodiments, the MODL-CAR-expressing cell population effecting a high percentage of targetcell lysis but having low non-specific cell lysis is selected for administration to a patient. In someembodiments, the MODL-CAR-expressing cell population effecting the highest percentage ofrepeated target cell lysis is selected for administration to a patient.

[0199] In some embodiments, the assessed property is antigen-dependent proliferation ofMODL-CAR-expressing cells. Proliferation may be assessed by co-culturing a populationcomprising MODL-CAR-expressing cells (effectors) with target cells (targets). In someembodiments, the co-culture is at E:T ratio of about 1. In some embodiments, cell proliferation isdetected by labeling effector cells with cell permeant stable fluorescent dyes (e.g., CellTracemViolet) and measuring dye dilution within the effector cell population.

[0200] In some embodiments, MODL-CAR-expressing cells population exhibiting thehighest rate of proliferation in the presence of target cells is selected for administration to a patient.

[0201] In some embodiments, the assessed property is cytokine or chemokine secretion bythe MODL-CAR-expressing cells. In some embodiments, secretion of one or more cytokines orchemokines is assessed. The one or more cytokines are selected from IFN-γ, TNF-α, GM-CSF,IL-10, IL-5, and IL-13 and chemokines such as MIP-1α, MIP-1ẞ, IL-8, and RANTES. Cytokineor chemokine secretion may be assessed by co-culturing a population comprising engineeredMODL-CAR-expressing cells (effectors) with target cells (targets). In some embodiments, the co-culture is at E:T ratio of about 1. In some embodiments, the cytokines or chemokines in the co-culture supernatant can be detected or quantitatively detected by an antibody-based or antibodyconjugate-based assay such as Western blotting or ELISA and similar secondary antibody-basedmethods with colorimetric or fluorescent detection methods.

[0202] In some embodiments, the MODL-CAR-expressing cell population exhibiting thehighest level of cytokine or chemokine secretion in the presence of target cells is selected foradministration to a patient.

[0203] In some embodiments, the properties of MODL-CAR-expressing cells are assessedin vivo and are selected from affecting characteristics of experimental animals carrying targettumor cells. In some embodiments, the target cells are tumor cells known to express the antigencapable of binding the antigen-binding domain of the MODL-CAR and experimental animals aremice engrafted with the tumor cells prior to being administered a dose of the MODL-CAR-expressing cells. In some embodiments, the experimental animals are NGS mice. In someembodiments, the assessment of MODL-CAR-expressing cells comprises monitoring bodyweight, overall survival, and tumor burden of the mice engrafted with the tumor cells andadministered a dose of the MODL-CAR-expressing cells.

[0204] In some embodiments, the animals are engrafted with a fluorescently labeled tumorcell line and tumor burden is assessed by measuring in vivo fluorescence (and other mousemeasurements). In some embodiments, the experimental animals are immunodeficient NGS miceengrafted with JeKo-1-GFPluc luciferase-expressing tumor cells. In some embodiments, theresults are expressed as change in fluorescence of the tumors (or animals) over time and evaluatedas area under the curve (AUC).

[0205] In some embodiments, the MODL-CAR-expressing cell population exhibiting themost reduction in tumor burden in experimental animals engrafted with target antigen-expressingtumors and injected with the MODL-CAR-expressing cells is selected for administration to apatient.

[0206] In some embodiments, the assessed property is persistence of MODL-CAR-expressing cells in the circulation of an experimental animal engrafted with a target antigen-expressing tumor and injected with MODL-CAR-expressing cells. In some embodiments, thepersistence of MODL-CAR-expressing cells is assessed as the presence and / or number of CD56+cells in a volume of the animal's blood. In some embodiments, the persistence of MODL-CAR-expressing cells is assessed as the presence and / or number of CD8+ cells in a volume of theanimal's blood. In some embodiments, the qualitative and / or quantitative assessment of MODL-CAR-expressing cells in blood samples is performed by flow cytometry with anti-CD56 antibodiesor with anti-CD8 antibodies respectively. In some embodiments, the antibodies are the anti-humanCD56 antibody and the anti-human CD8 antibody.

[0207] In some embodiments, the MODL-CAR-expressing cell population exhibiting thehighest persistence in circulation of experimental animals engrafted with target antigen-expressingtumors and injected with the MODL-CAR-expressing cells is selected for administration to apatient.

[0208] In some embodiments, the assessed property is continued expression of the MODL-CAR in the engineered cells in the circulation of an experimental animal engrafted with an antigen-expressing tumor and injected with MODL-CAR-expressing cells. In some embodiments, theexpression of the MODL-CAR is assessed by flow cytometry and compared or normalized to theexpression of one or more genes selected from CD45 (or hCD45), and CD56.

[0209] In some embodiments, MODL-CAR-expressing cell population exhibiting thehighest level of MODL-CAR expression among the cells recovered from circulation ofexperimental animals engrafted with antigen-expressing tumors and injected with the MODL-CAR-expressing cells is selected for administration to a patient.

[0210] In some embodiments, the invention comprises compositions including MODL-CAR-expressing cells exhibiting at least one anti-tumor property. In some embodiments, theinvention comprises compositions including MODL-CAR-expressing cells assessed for having asatisfactory property or a satisfactory level of a parameter selected from one or more of: thepresence of the CAR in the cellular genome, surface expression of the CAR, antigen-dependentcytotoxicity in vitro, anti-tumor activity in vivo, antigen-dependent proliferation in vivo or in vitro,and cytokine secretion in vivo or in vitro.

[0211] Once produced and (optionally) assessed by quality control (QC) measures for thedesired properties as described elsewhere in this disclosure, the engineered cells can be formulatedinto compositions for delivery to a human subject to be treated. The compositions include theengineered lymphocytes, and one or more pharmaceutically acceptable excipients. Exemplaryexcipients include, without limitation, carbohydrates, inorganic salts, antimicrobial agents,antioxidants, surfactants, buffers, acids, bases, and combinations thereof. Excipients suitable forinjectable compositions include water, alcohols, polyols, glycerin, vegetable oils, phospholipids,and surfactants. A carbohydrate such as a sugar, a derivatized sugar such as an alditol, aldonicacid, an esterified sugar, and / or a sugar polymer may be present as an excipient. Specificcarbohydrate excipients include, for example, monosaccharides, such as fructose, maltose,galactose, glucose, D-mannose, sorbose, and the like; disaccharides, such as lactose, sucrose,trehalose, cellobiose, and the like; polysaccharides, such as raffinose, melezitose, maltodextrins,dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol,sorbitol (glucitol), pyranosyl sorbitol, myoinositol, and the like. The excipient can also include aninorganic salt or buffer such as citric acid, sodium chloride, potassium chloride, sodium sulfate,potassium nitrate, sodium phosphate monobasic, sodium phosphate dibasic, and the like, andcombinations thereof.

[0212] In some embodiments, the composition further comprises an antimicrobial agentfor preventing or deterring microbial growth. In some embodiments, the antimicrobial agent isselected from benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetylpyridiniumchloride, chlorobutanol, phenol, phenylethyl alcohol, phenylmercuric nitrate, thimerosal, and thelike, and combinations thereof.

[0213] In some embodiments, the composition further comprises an antioxidant added toprevent the deterioration of the lymphocytes. In some embodiments, the antioxidant is selectedfrom ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, hypophosphorousacid, monothioglycerol, propyl gallate, sodium bisulfite, sodium formaldehyde sulfoxylate,sodium metabisulfite, and the like, and combinations thereof.

[0214] In some embodiments, the composition further comprises a surfactant. In someembodiments, the surfactant is selected from polysorbates, sorbitan esters, lipids, such asphospholipids (lecithin and other phosphatidylcholines), phosphatidylethanolamines, fatty acidsand fatty esters; steroids, such as cholesterol, and the like.

[0215] In some embodiments, the composition further comprises a freezing agent such as3% to 12% dimethylsulfoxide (DMSO) or 1% to 5% human albumin.

[0216] The number of MODL-CAR-expressing cells in the composition will varydepending on several factors but will optimally comprise a therapeutically effective dose per vial.A therapeutically effective dose can be determined experimentally by repeated administration ofincreasing amounts of the MODL-CAR-expressing cells-containing composition in order todetermine which amount produces a clinically desired endpoint.

[0217] In some embodiments, where the subject is a human, the number of MODL-CAR-expressing cells per dose is no fewer than about 107 cells and no greater than 1010 cells.

[0218] In some embodiments, the total number of cells in the dose is adjusted based on thepercentage or MODL-CAR-expressing cells among all the cells in the cell composition. In someembodiments, the total number of cells administered is multiplied by 100 / N where N is thepercentage of CAR-expressing cells in the cell composition. The multiplication yields the totalnumber of cells that must be administered to the patient in order to administer the desired numberof MODL-CAR-expressing cells.

[0219] In some embodiments, the invention is a method of treating, preventing, orameliorating a disease associated with expression of an antigen comprising administering apopulation of immune cells expressing a MODL-CAR described herein. In some embodiments,the invention comprises a method of inhibiting the growth of a tumor in a patient, the methodcomprising administering to the patient an engineered immune cell expressing a modular chimericantigen receptor (MODL-CAR) comprising: an extracellular component comprising an antigenbinding domain, an intracellular component comprising a signaling domain; a transmembranecomponent, and a connector component comprising a first association domain conjugated to theextracellular component and a second association domain conjugated to the intracellularcomponent, wherein the first association domain is capable of specific association with the secondassociation domain.

[0220] In some embodiments, the population of immune cells administered to a patient hasbeen assessed for having a satisfactory property or a satisfactory level of a parameter selected fromone or more of: the presence of the MODL-CAR in the cellular genome, surface expression of theCAR, antigen-dependent cytotoxicity in vitro, anti-tumor activity in vivo, antigen-dependentproliferation, and cytokine secretion.

[0221] In some embodiments, the diseases or conditions that can be treated by the immunecells of the disclosure include various malignancies including tumors expressing the antigentargeted by the MODL-CAR. Depending on the targeted antigen, the targeted tumor is selectedfrom a solid tumor and hematological malignancy. In some embodiments, the diseases orconditions that can be treated by the immune cells of the disclosure include a solid tumor selectedfrom ovarian cancer, triple negative breast cancer, colorectal cancer, non-small cell lung cancer,lung adenocarcinoma, pancreatic cancer, gastric cancer, melanoma, and endometrial carcinoma,or a hematological tumor selected from MCL, CLL, SLL, B-ALL, B-NHL, and AML.

[0222] In some embodiments, the invention is a method of inhibiting the growth of a tumorin a patient. In some embodiments, the tumor is selected from ovarian cancer, triple negative breastcancer, colorectal cancer, non-small cell lung cancer, lung adenocarcinoma, pancreatic cancer,gastric cancer, melanoma, and endometrial carcinoma, or a hematological tumor selected fromMCL, CLL, SLL, B-ALL, B-NHL, and AML.

[0223] In some embodiments, the invention comprises a method of administering to asubject or patient a therapeutically effective number of immune cells expressing the MODL-CARdescribed herein. In some embodiments, the immune cells are pre-activated and expanded prior toadministration. In some embodiments, the administration of the immune cells according to theinvention results in treating, preventing, or ameliorating the disease or condition in the subject orpatient. In some embodiments, the disease or disorder is selected from cancers or tumors,infections and autoimmune conditions that can be treated by administration of the immune cellsthat elicit an immune response against target cells.

[0224] A pharmaceutical composition comprising MODL-CAR expressing cells of thepresent disclosure can be delivered via various routes and delivery methods such as local orsystemic delivery, including parenteral delivery, intramuscular, intravenous, subcutaneous, orintradermal delivery.

[0225] In some embodiments, the dose or amount of the composition administered to thepatient comprises between 10,000 and 100,000,000 of the MODL-CAR-expressing engineeredimmune cells. In some embodiments, the amount of the composition administered to the patientcomprises between 100 and 1,000,000 of the MODL-CAR-expressing engineered immune cellsper kilogram of body weight of the patient.

[0226] In some embodiments, the administering is performed intravenously. In someembodiments, prior to the administering, the patient undergoes lymphodepletion. In someembodiments, the lymphodepletion comprises administration of a compound selected from a groupconsisting of cyclophosphamide, fludarabine, azathioprine, methotrexate, mycophenolate, acalcineurin inhibitor, and volcosporin. In some embodiments, the lymphodepletion comprisesadministering cyclophosphamide at 300 mg / m² per day for up to 3 days. In some embodiments,the lymphodepletion further comprises administering fludarabine at 30 mg / m² per day for up to 3days.

[0227] In some embodiments, the composition or formulation for administering to thepatient is a pharmaceutical composition or formulation which permits the biological activity of anactive ingredient and contains only non-toxic additional components such as pharmaceuticallyacceptable carriers. In some embodiments, pharmaceutically acceptable carriers include buffers,excipients, stabilizers, and preservatives.

[0228] In some embodiments, a preservative is used. In some embodiments, thepreservative comprises one or more of methylparaben, propylparaben, sodium benzoate,benzalkonium chloride, antioxidants, chelating agents, parabens, chlorobutanol, phenol, and sorbicacid. In some embodiments, the preservative is present at about 0.0001% to about 2% by weightof the total composition.

[0229] In some embodiments, a carrier is used. In some embodiments, the carriercomprises a buffer, antioxidants including ascorbic acid and methionine; proteins, such as serumalbumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; aminoacids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; carbohydrates such asmonosaccharides, disaccharides, glucose, mannose, or dextrins; chelating agents such as EDTA;sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium;metal complexes (e.g., Zn-protein complexes); and / or non-ionic surfactants such as polyethyleneglycol (PEG).

[0230] In some embodiments, the carrier comprises a buffer. In some embodiments, thebuffer comprises citric acid, sodium citrate, phosphoric acid, potassium phosphate, and variousother acids and salts. In some embodiments, the buffer is present at about 0.001% to about 4% byweight of the total composition.

[0231] In some embodiments, the method comprises administering a pharmaceuticalcomposition comprising delivery systems such that the delivery of the composition occurs overtime. In such embodiments the pharmaceutical composition comprises time-release components.In some embodiments, the pharmaceutical composition comprises aluminum monostearate orgelatin. In some embodiments, the pharmaceutical composition comprises semipermeablematrices of solid hydrophobic polymers. In some embodiments, the matrices are in the form offilms or microcapsules.

[0232] In some embodiments, the method comprises administering a pharmaceuticalcomposition comprising a sterile liquid such as an isotonic aqueous solution, suspension, emulsion,dispersions, or viscous composition, which may be buffered to a selected pH. In someembodiments, the pharmaceutical composition is a sterile injectable solution prepared byincorporating the cells in a solvent such as sterile water, physiological saline, or solutions orglucose, dextrose, or the like. In some embodiments, the pharmaceutical composition furthercomprises dispersing, or emulsifying agents, pH buffering agents, gelling or viscosity enhancingadditives, preservatives, flavoring agents, colors, and the like, depending upon the route ofadministration and the preparation desired.

[0233] In some embodiments, the T cells, monocytes, macrophages, or NK cellsexpressing the MODL-CAR described herein are co-administered with cytokines. In someembodiments, the cytokines are selected from IL-2, IL-12, IL-15, IL-18, and IL-21. In someembodiments, the cytokines are administered at a dose per kg of body weight of a human that isequivalent to 10 ng / mouse for IL-15, 100,000 units / mouse for IL-2, and 10 µg / mouse for IL-21.

[0234] In some embodiments, the T cells, monocytes, macrophages, or NK cellsexpressing the MODL-CAR described herein are engineered to constitutively express cytokines.In some embodiments, the cytokines are human cytokines. In some embodiments, theconstitutively expressed cytokines are membrane-bound. In some embodiments, the constitutivelyexpressed membrane-bound cytokine is selected from IL-15 (mbIL-15) and IL-21 (mbIL-21). Insome embodiments, the constitutively expressed membrane-bound cytokine comprises a fusion ofthe cytokine to its receptor (cytokine-receptor fusion). In some embodiments, the membrane-bound cytokine-receptor fusion is selected from IL-15-IL-15 receptor fusion (IL-15-IL15RAfusion) and IL-21-IL-21 receptor fusion (IL-21-IL-21RA fusion). In some embodiments, the fusionalso comprises a signal peptide. In some embodiments, the leader peptide is selected from IL-2signal peptide and CD2 signal peptide.

[0235] Using a mouse model, Rowley, J. et al., ((2009) Expression of IL-15RA or an IL-15 / IL-15RA fusion on CD8 T cells modifies adoptively transferred T cell function in cis. Eur. J.Immunol. 39:491) have successfully fused IL-15 with IL-15R via a serine-glycine linker,expressed the fusion in T cells, and demonstrated improved viability and proliferation of mouseCD8+ T cells expressing the fusion.

[0236] Fusing human IL-21 with its receptor is described in provisional U.S. applicationSerial No. 63 / 346,045 Cytokine-receptor fusions for immune cell stimulation filed on May 26,2022.

[0237] In some embodiments, the coding sequence for the membrane-bound cytokine isintroduced into cells via chemical or electrochemical means (such as lipid nanoparticle orelectroporation). In some embodiments, the coding sequence for the membrane-bound cytokine isintroduced into cells using vectors such as lentiviral vectors.

[0238] In some embodiments, a lentiviral vector includes an expression constructcomprising a promoter and coding sequences for the cytokine and its receptor. In someembodiments, the cytokine and its receptor are joined by a serine-glycine linker. In someembodiments, the promoter is selected from EF1α, PGK1, MND, Ubc, CAG, CaMKIIa, ẞ-actin,SV40 early and late promoters, the cytomegalovirus (CMV) immediate early promoter, and theRous sarcoma virus long terminal repeat (RSV-LTR) promoter, mouse mammary tumor virus longterminal repeat (MMTV-LTR) promoter, the ẞ-interferon promoter, and the hsp70 promoter. Insome embodiments, the promoter is an EF-la promoter.

[0239] In some embodiments, the lentiviral construct described herein is introduced into Tcells, macrophages, or NK cells.

[0240] In some embodiments, the T cells, monocytes, macrophages, or NK cells areassessed for surface expression of the membrane-bound cytokine. The surface expression of themembrane-bound cytokine may be assessed by fluorescence-activated cell sorting (FACS),microfluidics-based screening, ELISA, or Western blot. In some embodiments, the surfaceexpression of the membrane-bound cytokine is assessed by flow cytometry with an anti-cytokineantibody. In some embodiments, the T cell, monocyte, macrophage, or NK cell population withthe highest surface expression of the membrane-bound cytokine is selected for administration to apatient. In some embodiments, the iPSC cell population with the highest surface expression of themembrane-bound cytokine is selected for differentiation into iNK cells.

[0241] In some embodiments, the T cells, monocytes, macrophages, or NK cellsexpressing the membrane-bound cytokine are assessed for cytotoxic properties. In someembodiments, the cytotoxic properties are assessed by in co-culturing with human tumor cells. Insome embodiments, the membrane-bound cytokine-expressing T cell, monocyte, macrophage, orNK cell population with the highest cytotoxic activity is selected for administration to a patient.EXAMPLES

[0242] Example 1. Preparation of Cytotoxic T Cells (CD4+ and CD8+) from PBMCs andCulture of Primary Cells

[0243] This Example illustrates the preparation of CD4+ and CD8+ T cells from donorperipheral blood mononuclear cells (PBMCs) in preparation of engineering the cells to expressMODL-CARS.

[0244] CD4+ and CD8+ T cells were prepared from donor PBMCs essentially as follows.T cells were isolated from peripheral blood mononuclear cells (PBMCs) using RoboSep-S andEasy Ѕертм Ниman T cell Isolation Kit (both STEMCELL Technologies, Cambridge, Mass.) andactivated for 3 days in the presence of anti-CD3 / CD28 beads (Dynabeads™™; Gibco 11132D) inImmunoCult-XF complete medium (ImmunoCult-XF T Cell Expansion Medium (STEMCELLTechnologies), CTS Immune Cell SR (Gibco A2596102), Antibiotics-Antimycotics (100X,Corning 30-004-Cl)) supplemented with recombinant human (rh) IL-2 (100 units / mL). After 3days, beads were removed via magnetic separation and cells were expanded for 1 day inImmunoCult-XF complete medium supplemented with IL-2 (100 units / mL).

[0245] Example 2. Cloning, expression, production, and assembly of Cas12a / guidenucleoprotein Complexes

[0246] This Example describes a method for cloning, expressing, and purifying Cas12a / guide nucleoprotein complexes, as well as methods of producing Cas12a guide components thatcan be used for inserting MODL-Car coding sequences into the cellular genome.

[0247] A. Cloning of a Cas12 protein

[0248] The Acidaminococcus spp. (strain BV3L6) catalytically active Cas12a proteinsequence (SEQ ID NO: 67) was codon optimized for expression in E. coli cells. At the C-terminus,a glycine-serine linker and one nuclear localization sequence (NLS) (SEQ ID NO: 68) was added.Oligonucleotide sequences coding for the Cas12a-NLS protein (referred to as the AsCas12a andCas12a protein in the following Examples) were provided to commercial manufacturers forsynthesis. DNA sequences were then cloned into suitable bacterial expression vectors usingstandard cloning methods.

[0249] B. Expression and purification of a Cas12a protein

[0250] The AsCas12a protein was expressed in E. coli using an expression vector andpurified using affinity chromatography, ion exchange, and size exclusion chromatography,essentially as described in, for example, Swarts et al. (Molecular Cell, 2017, 66:221-233).

[0251] C. Production of Cas12a guide components

[0252] Cas12a guides were produced by linking a targeting region to a particular Cas12aguide activating region. A targeting region, or spacer, preferably comprised a 20-nucleotide targetbinding sequence. The target binding sequence was complementary to a target sequence thatoccurred downstream (in a 3' direction) of a 5'- TTTV or 5' - TTTN PAM. Exemplary Cas12aguide activating region sequences is SEQ ID NO: 63. An exemplary Cas12a guide sequence witha spacer is SEQ ID NO: 64, where the "N" nucleotides represent the targeting region withhomology to the target sequence.

[0253] Cas 12a guide sequences (such as crRNAs and chRDNA) were provided to acommercial manufacturer for synthesis.

[0254] Guide RNA components (such as crRNAs) can be produced by in vitrotranscription (e.g., T7 Quick High Yield RNA Synthesis Kit; New England Biolabs, Ipswich,Mass.) from double-stranded (ds) DNA templates by incorporating a T7 promoter at the 5' end ofthe dsDNA template sequences.

[0255] D. Assembly of a Cas12a guide / nucleoprotein complex

[0256] Acidaminococcus spp. Cas12a (AsCas12a) tagged with a C-terminal nuclearlocalization sequence (NLS) was recombinantly expressed in E. coli and purified usingchromatographic methods. Nucleoprotein complexes were formed at a concentration of 80 pmolCas12a protein:240 pmol guide, unless otherwise stated. Prior to assembly with Cas12a protein,each of the guide components (e.g., crRNA or chRDNA) was adjusted to the desired totalconcentration (240 pmol) in a final volume of 1 µl, incubated for 2 minutes at 95°C, removed froma thermocycler, and allowed to equilibrate to room temperature. The Cas12a protein was dilutedto an appropriate concentration in binding buffer (60mM TRIS-acetate, 150 mM potassiumacetate, 30 mM magnesium acetate, at pH 7.9) to a final volume of 1.5 µl and mixed with the 1 ulof the guide components, followed by incubation at 37°C for 10 minutes.

[0257] Example 3. Nucleofection of T Cells (CD4- and CD8+) from PBMCs withCas12a / guide nucleoprotein complexes

[0258] This Example describes the nucleofection of activated T cells with a Cas12a / guidenucleoprotein complex.

[0259] The Cas12a guide / nucleoprotein complexes of Example 2 were transfected intoprimary activated T cells (CD4+ and CD8+) (prepared as described in Example 1) using theNucleofectorTM 96-well Shuttle System (Lonza, Allendale, N.J). The Cas12a guide / nucleoproteincomplex were dispensed in a 2.5 µl final volume into individual wells of a 96-well plate. Thesuspended T cells were pelleted by centrifugation for 10 minutes at 200 x g, washed with calciumand magnesium-free phosphate buffered saline (PBS), and the cell pellet was resuspended in 10ml of calcium and magnesium-free PBS. The cells were counted using the Countess® II AutomatedCell Counter (Life Technologies; Grand Island, N.Y.).

[0260] 2.2 x 107 cells were transferred to a 15 ml conical tube and pelleted. The PBS wasaspirated, and the cells resuspended in NucleofectorTM P4 or P3 (Lonza) solution to a density of 2x 105 - 106 cells / ml per sample. 20 µl of the cell suspension was then added to each well containing2.5 µl of the Cas12a guide / nucleoprotein complexes, and the entire volume from each well wastransferred to a well of a 96-well NucleocuvetteTM Plate (Lonza). The plate was loaded onto theNucleofectorTM 96-well Shuttle (Lonza) and cells nucleofected using the CA137 NucleofectorTMprogram (Lonza). Post-nucleofection, 77.5 µl of ImmunoCult-XF complete medium supplementedwith IL-2 (100 units / mL) was added to each well, and the entire volume of transfected cellsuspension was transferred to a 96-well cell culture plate containing 100 µl pre-warmedImmunoCult-XF complete medium supplemented with IL-2 (100 units / mL). The plate wastransferred to a tissue culture incubator and maintained at 37°C in 5% CO2 for 48 hours beforedownstream analysis.

[0261] Example 4. Editing of human genes with Cas12a / guide nucleoprotein complexesThis Example describes the design and use of Cas12a / guide nucleoprotein complexes to target theDNA sequences in human T cells in order to insert MODL-Car coding sequences.

[0262] A. Designing the AsCas12a crRNA guides

[0263] A 20-nucleotide sequence downstream (in a 3' direction) of a 5'- TTTV PAM motifin the human genomic sequence of interest is identified and selected for targeting. Target selectioncriteria included, but were not limited to, position in coding or non-coding regions of the genome;homology to other regions in the genome; percent G-C content; melting temperature; and presenceof homopolymer within the spacer.

[0264] The identified 20-nucleotide sequences were appended downstream (in a 3'direction) to the AsCas12a activating region sequence (SEQ ID NO: 63)

[0265] Sequences were provided to commercial manufacturers for synthesis. Then,individual Cas12a guide / nucleoprotein complexes were prepared as described in Example 2 andtransfected into primary T cells as described in Example 3.

[0266] B. Determining genome editing efficiency

[0267] (1) Target dsDNA sequence generation for deep sequencinggDNA was isolated from the nucleofected primary T cells 48 hours after transfection using theCas12a guide / nucleoprotein complexes and 50 µL QuickExtractTM DNA extraction solution(Epicentre, Madison, Wisc.) per well, followed by incubation at 37°C for 10 minutes, 65°C for 30minutes, and 95°C for 3 minutes to stop the reaction. The isolated gDNA was diluted with 50 µLsterile water and samples were stored at -80°C.

[0268] Using the isolated gDNA, a first PCR was performed using Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, Mass.) at 1x concentration, primersdesigned to amplify the region around the Cas12a target were used at 0.5 µM each, and 3.75 µL ofgDNA was used in a final volume of 10 µL. Amplification was conducted by an initial cycle at98°C for 1 minute, 35 cycles of 10s at 98°C, and 20 seconds at 60°C, 30 seconds at 72°C; and afinal extension at 72°C for 2 minutes. The PCR reactions were diluted 1:100 in water.

[0269] A unique set of index primers for a barcoding PCR were used to facilitate multiplexsequencing for each sample. Barcoding PCRs were performed using a reaction mix comprising Q5Hot Start High-Fidelity 2X Master Mix (New England Biolabs) at 1x concentration, primers at 0.5µM each, and 1 µL of 1:100 diluted first PCR in a final volume of 10 µL. The reaction mixtureswere amplified as follows: 98°C for 1 minute; followed by 12 cycles of 10s at 98°C, 20 secondsat 60°C, and 30 seconds at 72°C; with a final extension reaction at 72°C for 2 minutes.

[0270] (2) SPRIselect clean-up

[0271] The PCR reactions were pooled and transferred into a single microfuge tube forSPRIselect (Beckman Coulter, Pasadena, Cal.) bead-based cleanup of amplicons for sequencing.

[0272] To the amplicon, 0.9x volumes of SPRIselect beads were added, mixed, andincubated at room temperature for 10 minutes. The microfuge tube was placed on a magnetic tubestand until the solution cleared. Supernatant was removed and discarded, the residual beads werewashed with 1 volume of 85% ethanol, and the beads were incubated at room temperature for 30seconds. After incubation, ethanol was aspirated, and the beads were air-dried at room temperaturefor 10 minutes. The microfuge tube was removed from the magnetic stand and 0.25x volumes ofQiagen EB buffer (Qiagen, Valencia, Cal.) was added to the beads, mixed vigorously, andincubated for 2 minutes at room temperature. The microfuge tube was returned to the magnet,incubated until the solution had cleared, and supernatant containing the purified amplicons wasdispensed into a clean microfuge tube. The purified amplicons were quantified using theNanodropTM 2000 System (Thermo Scientific, Wilmington, Del.) and library quality analyzedusing the Fragment Analyzer™™ System (Advanced Analytical Technologies, Ames, IA) and theDNF-910 dsDNA Reagent Kit (Advanced Analytical Technologies, Ames, Iowa).

[0273] (3) Deep sequencing set-up

[0274] The pooled amplicons were normalized to a 4 nM concentration as calculated fromthe NanodropTM 2000 System values and the average size of the amplicons. The library wasanalyzed on a MiSeq Sequencer (Illumina, San Diego, Cal.) with MiSeq Reagent Kit v2 (Illumina)for 300 cycles with two 151-cycle paired-end runs and two 8-cycle index reads.

[0275] (4) Deep sequencing data analysis

[0276] The identities of products in the sequencing data were determined based on theindex barcode sequences adapted onto the amplicons in the barcoding PCR. A computational scriptwas used to process the MiSeq data that executes, for example, the following tasks:a. Reads were aligned to the human genome (build GRCh38 / 38) using Bowtie (bowtie-bio.sourceforge.net / index.shtml) software;b. Aligned reads were compared to the expected wild type genomic locus sequence, andreads not aligning to any part of the wild type locus discarded;c. Reads matching wild type sequence were tallied;d. Reads with indels (insertion or deletion of bases) were categorized by indel type andtallied; ande. Total indel reads were divided by the sum of wild type reads and indel reads to givepercent-mutated reads.

[0277] Through the identification of indel sequences at regions targeted by the Cas12aguide / nucleoprotein complexes, the resulting genome editing efficiency of the Cas12aguide / nucleoprotein complexes was determined.

[0278] Example 5. Design of a MODL-CAR construct

[0279] The following example describes the design and generation of a modular linkedCAR (MODL-CAR) construct for use in human T cells.

[0280] A. Selection of Association domain

[0281] Multiple association domains were selected for the design of MODL-CAR from acollection of leucine zippers, inteins, coiled-coils, and F(ab) elements. Sequences were identifiedthrough literature searches, human genome databases, procaryote genomic databases, and intein-specific databases. Association domains were selected based on criteria such as validatedexpression in eukaryotic cells, overall size of domains, domain affinity, heterodimeric properties,homodimeric properties, parallel or antiparallel configuration, presence or absence of disulfidebonds, hydrophobic properties of domains, immunogenic properties, covalent and ionic bondingcharacteristics, and homology to native human sequences.

[0282] Leucine zipper association domains were identified from Anderson, G.P., et al.,(2018) Orthogonal synthetic zippers as protein scaffolds, ACS Omega 3:4810, and selected basedon heterodimeric paring of each association domain. Both a parallel and antiparallel leucine zipperconfiguration were selected. The paired leucine zipper association domains are shown in Table 1Table 1Leucine Zipper Association Domain ComponentsSEQ ID NO | First Association Domain | SEQ ID NO | Second Association Domain-------------|--------------------------|------------|---------------------------SEQ ID NO:08 | LeuZip-parallel_D1 | SEQ ID NO:09 | LeuZip-parallel_A2SEQ ID NO:10 | LeuZip-antiparallel_D3 | SEQ ID NO:11 | LeuZip-antiparallel_4A

[0283] Intein association domains were identified in the DNA polymerase III sequencesfrom Nostoc punctiforme PCC73102 (“Npu") and Synechocystis species PCC6803 ("Ssp")species. The n-terminal and c-terminal portion of the intein of the DNA polymerase III sequencewas identified and paired together. A mutant version of the Npu n-terminal and c-terminal inteinsequences was generated based on the teaching of Pinot et al. (2020) An expanded library oforthogonal split inteins enables modular multi-peptide assemblies, Nat Commun 11, 1529. Thepaired intein association domains are shown in Table 2.Table 2Intein Association domainsSEQ ID NO | First Association Domain | SEQ ID NO | Second Association Domain---------------|--------------------------|----------------|--------------------------SEQ ID NO:12 | Npu-N | SEQ ID NO:13 | NpuCSEQ ID NO:14 | Mutated Npu-N | SEQ ID NO:15 | Mutated Npu-CSEQ ID NO:14 | Mutated Npu-N | SEQ ID NO:16 | Ssp-C

[0284] F(ab) association domains were identified from the human IgG4 consensussequences. The light chain constant region ("CL") and the heavy chain constant region 1 (“CHI”)sequences were isolated from the human genome (genomic build hg38) and used in thepembrolizumab antibody. CL and CH1 sequences were paired in both orientations for the connectordesign and are shown in Table 3.Table 3F(ab) Association domainsSEQ ID NO | First Association Domain | SEQ ID NO | Second Association Domain--------------|--------------------------|---------------|---------------------------SEQ ID NO:01 | F(ab) CL | SEQ ID NO:02 | F(ab) CH1SEQ ID NO:02 | F(ab) CH1 | SEQ ID NO:01 | F(ab) CL

[0285] Coiled-coil sequences were identified from Monera O.D., et al., (1996) Formationof parallel and antiparallel coiled-coils controlled by the relative positions of alanine residues inthe hydrophobic core, J. Bio. Chem. 271(8):3995. Sequences were selected based on the affinityof the domains from one another, the propensity to only associate in a heterodimer pair, paralleland antiparallel characteristics, and reported disulfide bond formation between the two connectorelements. Coiled-coil connector sequences are shown in Table 4.Table 4Coiled Coil Association DomainsSEQ ID NO | First Association Domain | SEQ ID NO | Second Association Domain-------------|-----------------------------------|--------------|-----------------------------------SEQ ID NO:17 | CoiledCoil_antiparallel_33E16 | SEQ ID NO:18 | CoiledCoil_antiparallel_2K16SEQ ID NO:19 | CoiledCoil_parallel_2K16 | SEQ ID NO:20 | CoiledCoil_parallel_2E19

[0286] B. Selection of CAR chassis components

[0287] An antigen-binding domain CAR sequence was assembled from the anti-CD19FMC63 single-chain variable fragment (scFv) sequence (Nicholson I.C., et al., (1997) MolecularImmunology 34(16-17):1157) and converted into a single-chain variable fragment comprising theVL and VH chains connected by a (G4S)3 linker sequence (SEQ ID NO: 116). The FMC63 scFvwas appended with the human CD8 hinge and transmembrane domains sequence (SEQ ID NO:21).A stimulatory domain CAR sequence was assembled using the intracellular signaling domain ofthe human tumor necrosis factor receptor superfamily member 9 (4-1BB) was appended with theCD3% signaling domain (SEQ ID NO:22).

[0288] C. Assembly of MODL-CAR Sequences

[0289] For assembly of the MODL-CAR sequences, the antigen-binding domain CARsequence was appended with a first association domain sequence and the stimulatory domain CARsequence was appended with the matched second association domain sequence. This was repeatedfor each association domain sequence pair described in Section A of this example. The matchedMODL-CAR component pairs are shown in Table 5.Table 5MODL-CAR Components PairsAntigen-binding domain CAR Sequence | SEQ ID NO: | First association domain | SEQ ID NO: | Second association domain | SEQ ID NO: | Stimulatory domain CAR sequence | SEQ ID NO:------------------------------------|------------|--------------------------|------------|---------------------------|------------|---------------------------------|------------anti-CD19 CAR with CD8 H / TM | SEQ ID NO: 21 | LueZip-parallel D1 | SEQ ID NO:08 | LueZip-parallel A2 | SEQ ID NO:09 | 4-1BB with CD3ζ | SEQ ID NO: 22anti-CD19 CAR with CD8 H / TM | SEQ ID NO: 21 | LueZip-antiparallel D3 | SEQ ID NO:10 | LueZip-antiparallel 4A | SEQ ID NO:11 | 4-1BB with CD3ζ | SEQ ID NO: 22anti-CD19 CAR with CD8 H / TM | SEQ ID NO: 21 | Npu-N | SEQ ID NO:12 | NpuC | SEQ ID NO:13 | 4-1BB with CD3ζ | SEQ ID NO: 22anti-CD19 CAR with CD8 H / TM | SEQ ID NO: 21 | Mutated Npu-N | SEQ ID NO:14 | Mutated Npu-C | SEQ ID NO:15 | 4-1BB with CD3ζ | SEQ ID NO: 22anti-CD19 CAR with CD8 H / TM | SEQ ID NO: 21 | Mutated Npu-N | SEQ ID NO:14 | Ssp-C | SEQ ID NO:16 | 4-1BB with CD3ζ | SEQ ID NO: 22anti-CD19 CAR with CD8 H / TM | SEQ ID NO: 21 | F(ab) CL | SEQ ID NO:01 | F(ab) CH1 | SEQ ID NO:02 | 4-1BB with CD3ζ | SEQ ID NO: 22anti-CD19 CAR with CD8 H / TM | SEQ ID NO: 21 | F(ab) CH1 | SEQ ID NO:02 | F(ab) CL | SEQ ID NO:01 | 4-1BB with CD3ζ | SEQ ID NO: 22anti-CD19 CAR with CD8 H / TM | SEQ ID NO: 21 | CoiledCoil_antiparallel_33E16 | SEQ ID NO:17 | CoiledCoil_antiparallel_2K16 | SEQ ID NO:18 | 4-1BB with CD3ζ | SEQ ID NO: 22anti-CD19 CAR with CD8 H / TM | SEQ ID NO: 21 | CoiledCoil_parallel_2K16 | SEQ ID NO:19 | CoiledCoil_parallel_2E19 | SEQ ID NO:20 | anti-CD19 CAR with CD8 H / TM | SEQ ID NO: 21

[0290] The combined antigen-binding domain CAR sequences and first associationdomain as well the stimulatory domain CAR sequences and second association domain for theCD19 CAR are presented in Table 6.Table 6Paired MODL-CAR ComponentsSEQ ID NO:23 | CD19 antigen-binding domain CAR sequence NpuN-NpuC | SEQ ID NO:24 | CD19 Stimulatory domain CAR sequence NpuN-NpuCSEQ ID NO:25 | CD19 Antigen-binding domain CAR sequence NpuC-NpuN | SEQ ID NO:26 | CD19 Stimulatory domain CAR sequence NpuC-NpuNSEQ ID NO:27 | CD19 Antigen-binding domain CAR sequence NpuN-SspC | SEQ ID NO:28 | CD19 Stimulatory domain CAR sequence NpuN-SspCSEQ ID NO:29 | CD19 Antigen-binding domain CAR sequence 2K16-2E19 | SEQ ID NO:30 | CD19 Stimulatory domain CAR sequence 2K16-2E19SEQ ID NO:31 | CD19 Antigen-binding domain CAR sequence 33E16-2K16 | SEQ ID NO:32 | CD19 Stimulatory domain CAR sequence 33E16-2K16SEQ ID NO:33 | CD19 Antigen-binding domain CAR sequence D1-A2 | SEQ ID NO:34 | CD19 Stimulatory domain CAR sequence D1-A2SEQ ID NO:35 | CD19 Antigen-binding domain CAR sequence D3-4A | SEQ ID NO:36 | CD19 Stimulatory domain CAR sequence D3-4ASEQ ID NO:37 | CD19 Antigen-binding domain CAR sequence NpuN-NpuC | SEQ ID NO:38 | CD19 Stimulatory domain CAR sequence NpuN-NpuCSEQ ID NO:39 | CD19 Antigen-binding domain CAR sequence NpuC-NpuN | SEQ ID NO:40 | CD19 Stimulatory domain CAR sequence NpuC-NpuNSEQ ID NO:41 | CD19 Antigen-binding domain CAR sequence NpuN-SspC | SEQ ID NO:42 | CD19 Stimulatory domain CAR sequence NpuN-SspCSEQ ID NO:43 | CD19 Antigen-binding domain CAR sequence CL-CH1 | SEQ ID NO:44 | CD19 Stimulatory domain CAR sequence CH1-CLSEQ ID NO:45 | CD19 Antigen-binding domain CAR sequence CL-CH1 | SEQ ID NO:46 | CD19 Stimulatory domain CAR sequence CH1-CLSEQ ID NO:47 | CD19 antigen-binding domain CAR sequence 2K16-2E19 | SEQ ID NO:48 | CD19 Stimulatory domain CAR sequence 2K16-2E19SEQ ID NO:49 | CD19 antigen-binding domain CAR sequence 33E16-2K16 | SEQ ID NO:50 | CD19 Stimulatory domain CAR sequence 33E16-2K16

[0291] Each of the DNA sequences of the MODL-CAR components presented in Table 6were concatenated together and separated by a ribosomal skipping P2A sequence (SEQ ID NO:71). An EFla promoter sequence (SEQ ID NO: 75) was added upstream of the antigen-bindingdomain CAR sequence and a BGH terminator sequence (SEQ ID NO: 76) was added downstreamof the Stimulatory domain CAR sequence. Table 7 presents the MODL-CAR sequences de, alongwith a control CD19 targeting CAR construct with a 4-1BB costimulatory domain (SEQ IDNO:60), a control CD19 targeting CAR construct with a CD28 costimulatory domain (SEQ IDNO:61), and a 4 CD19 targeting CAR construct with a P2A linker sequence between antigen-binding domain CAR sequence and Stimulatory domain CAR sequence but not containing anycomprising any association domains (SEQ ID NO:62),.Table 7MODL-CAR ComponentsSEQ ID NO: | Name | Association domain Type---------------|------------------------------|------------------------SEQ ID NO:51 | MODL-CAR CD19 Fab-C-LH | F(ab)SEQ ID NO:52 | MODL-CAR CD19 Fab-C-HL | F(ab)SEQ ID NO:53 | MODL-CAR CD19 LZ-P | Leucine ZipperSEQ ID NO:54 | MODL-CAR CD19 LZ-AP | Leucine ZipperSEQ ID NO:55 | MODL-CAR CD19 NpuN-C | InteinSEQ ID NO:56 | MODL-CAR CD19 NpuN-C_Mut | InteinSEQ ID NO:57 | MODL-CAR CD19 NpuN-SspC | InteinSEQ ID NO:58 | MODL-CAR CD19 CC-P | Coiled-coilSEQ ID NO:59 | MODL-CAR CD19 CC-Ap | Coiled-coilSEQ ID NO:60 | CD19 CAR 4-1BB CD3z | -SEQ ID NO:61 | CD19 CAR CD28 CD3z | -SEQ ID NO:62 | CD19 CAR P2A 4-1BB CD3z | -

[0292] MODL-CAR and control CAR sequences presented in Table 7 were provided to acommercial entity for synthesis and cloning into a AAV6 compatible plasmid backbone. Theresulting rAAV plasmid containing CAR donor elements are provided to a commercialmanufacturer for packaging into an AAV6 virus.

[0293] Example 6. Cloning of AAV donor cassette, AAV production and AAV transductionof primary cells

[0294] This Example describes the design and cloning of a DNA donor element cassetteinto an AAV vector, production of AAV, and codelivery of Cas12a RNP and AAV transductionof primary cells with AAV for site-specific integration of a CAR expression cassette into primarycells.

[0295] AAV can be engineered to deliver DNA donor elements to mammalian cells. IfAAV delivery is combined with a genomic cleavage event, and the DNA donor element in theAAV is flanked by homology arms, the DNA donor element can be seamlessly inserted into thegenomic cut site by HDR, see, e.g., Eyquem et al. (Nature, 2017, 543:113-117).

[0296] A. In silico design of AAV donor element cassettes and rAAV production

[0297] The design of CAR receptors has been described. See, e.g., Kochenderfer et al. (J.Immunotherapy, 2009, 32:689-702). A method for designing MODL-CAR constructs is describedin Example 5 herein. A MODL-CAR CAR construct is designed to comprise at least two CARsequences, wherein the antigen-binding domain CAR sequence contains an N-terminal secretionsignal (such as a CD8a signal peptide), an scFv portion specific for the antigen target, followed bya hinge region and transmembrane domain, and a first association domain sequences; thestimulatory domain CAR sequence contains a second association domain sequence, acostimulatory effector region (such as 4-1BB or CD28), a CD36 effector region, and apolyadenylation signal sequence. The first and second association domain sequences are designedto associate with one another via ionic, hydrophobic, a combination of ionic and hydrophobic, orcovalent bond(s). The antigen-binding domain CAR sequence and stimulatory domain CARsequence can be expressed off a single promoter and separated by a ribosome skipping sequence(such as 2A), an internal ribosomal entry sequences (IRES), or a proteolytic cleavage sequence(such as a Furin sequence). A mammalian promoter sequence is inserted upstream of the CARelement, such as an EFla promoter, a MND promoter, a CAG promoter, an MSCV promoter, orequivalent.

[0298] In order to site-specifically insert a MODL-CAR donor sequence into the host cellgenome after site-specific cleavage, a target site is chosen in the endogenous TRAC locus (SEQID NO: 69). Then, 500 bp long homology arms 5' and 3' of the cut site are identified. Exemplaryhomology arm sequences in the TRAC locus are SEQ ID NO:65 and SEQ ID NO:66, for the left(or 5') and right (or 3') homology arms respectively. The 5' and 3' homology arms are appendedto the end of the MODL-CAR donor sequence, wherein the DNA donor elements are orientated ina reverse orientation (i.e., 3' to 5') relative to the homology arms. The resulting sequence codingfor MODL-CAR donor sequence is provided to a commercial manufacturer for synthesis into asuitable recombinant AAV (rAAV) plasmid. The resulting rAAV plasmid containing MODL-CAR donor sequence are provided to a commercial manufacturer for packaging into an AAV6virus.

[0299] B. Primary T cell transduction with rAAV

[0300] Primary activated T cells are obtained from PBMCs as described in Example 1.Cas12a guide / nucleoprotein complexes targeting the genes encoding TRAC (SEQ ID NO: 69) areprepared as described in Example 2. T cells are transfected with TRAC (SEQ ID NO: 70)-targetingCas12a chRDNA guide / nucleoprotein complexes, and between 1 minute and 4 hours afternucleofection, cells are infected with the AAV6 virus packaged with CAR donor sequence at anMOI of 2 x 105. T cells are cultured in ImmunoCult-XF complete medium (STEMCELLTechnologies, Cambridge, Mass.) supplemented with IL-2 (100 units / mL) for 24 hours after thetransductions. The next day, the transduced T cells are transferred to 50 mL conical tubes andcentrifuged at 300 x g for approximately 7-10 minutes to pellet cells. The supernatant is discarded,and the pellet is gently resuspended, and the T cells pooled in an appropriate volume ofImmunoCult-XF complete medium (STEMCELL Technologies) supplemented with IL-2 (100units / mL).

[0301] The enumerated T cells are resuspended at 1 x 106 cells / mL in ImmunoCult-XFcomplete medium STEMCELL Technologies) supplemented with IL-2 (100 units / mL), and platedinto as many T-175 suspension flasks as required (max volume per flask is 250 mL).

[0302] Example 7. In vitro cytotoxicity of MODL-CAR-T cells (prophetic)

[0303] The cytotoxicity of MODL-CAR-T cells of Example 6 are evaluated in vitro againsta target cells line, which present the cognate antigen target to the MODL-CAR scFv. TRAC KOT cells are used as a control for CAR-mediated killing. Briefly, target cells are labeled withCellTrace™ Violet (CTV; Thermo Fisher C34557) to distinguish them from effector MODL-CAR-T cells, and cells are co-cultured at E:T ratios of 0:1, 1:20, 1:10, 1:5, 1:3, 1:1, 3:1, and 10:1(3 co-culture wells / E:T ratio). Cytotoxicity is measured by gating on CTV cell population (targetcells) and live cells as measured by propidium iodide (PI) after 48 hours in co-culture. Data isanalyzed by flow cytometry (Intellicyt iQue Screener Plus). Specific lysis is calculated using thefollowing equation for each well: Specific lysis = 1 - (number of live target cells in the testsample / number of live target cells in the control sample).

[0304] The results from the in vitro cytotoxicity assay demonstrate the efficacy of MODL-CAR T cells to kill antigen presenting cells.

[0305] Example 8. In vivo anti-tumor activity of MODL-CAR-T cells (prophetic)

[0306] In this experiment in vivo anti-tumor activity of the MODL-CAR-T cells ofExample 6 is assessed in experimental animals that can host human tumors (e.g., NGS mice) wherethe tumor cells express the antigen capable of binding the MODL-CAR. Animals are engraftedwith a luciferase-expressing tumor cells (e.g., 5x105) and after three days, injected with MODL-CAR T cells (e.g., 107). Changes in tumor burden are measured over time, e.g., with an in vivoimaging system such as IVIS Spectrum in vivo imaging system.

[0307] Example 9. Cas12a-mediated knock-in of CAR transgene for high CAR expression

[0308] The following example describes the site-specific insertion of three CARtransgenes into a plurality of genomic sites in primary human T cells.

[0309] A. Selection of insertion sites and homology arms

[0310] The genes Beta-2 microglobulin (B2M), Programmed cell death protein 1(PDCD1), Cbl proto-oncogene B(CBLB), cytokine-inducible SH2 protein (CISH), T cellimmunoreceptor with Ig and ITIM domains (TIGIT), T-cell immunoglobulin and mucin-domaincontaining-3 (TIM3), Lymphocyte Activation Gene 3 (LAG3), class II, major histocompatibilitycomplex, transactivator (CIITA), and DNA (cytosine-5)-methyltransferase 3A (DNMT3A) wereselected for targeting.

[0311] Cas12a target sequences were identified as described in Example 4 herein, and theselected target sequences are presented in Table 8.Table 8Cas12a Target SitesSEQ ID NO | Name | Sequence | Chromosome location----------|-------------|----------------------|----------------------------SEQ ID NO:77 | B2M-tgt12 | TTTCAGTGGGGGTGAATTCAGTGT | chr15:44715615-44715638SEQ ID NO:78 | PDCD1-tgt19 | TTTAGCACGAAGCTCTCCGATGTG | chr15:44715615-44715638SEQ ID NO:79 | CBLB-tgt6 | TTTGCCTGATACATATCAGCATTT | chr3:105853579-105853602SEQ ID NO:80 | CISH-tgt3 | TTTAGGTGTACAGCAGTGGCTGGT | chr3:50607758-50607781SEQ ID NO:81 | TIGIT-tgt20 | TTTGTCCTCCCTCTAGTGGCTGAG | chr3:114299581-114299604SEQ ID NO:82 | TIM3-tgt15 | TTTCCAAGGATGCTTACCACCAGG | chr5:157104679-157104702SEQ ID NO:83 | LAG3-tgt4 | TTTGGGGTGCATACCTGTCTGGCT | chr12:6773330-6773353SEQ ID NO:84 | CIITA-tgt38 | TTTGGGGAAAGCCTGGGGGCCTGA | chr16:10915583-10915606SEQ ID NO:85 | DNMT3A-tgt23 | TTTGGCTGGTGGAGGTGGTGCGTA | chr2:25246224-25246247

[0312] The homology arms for each target site were designed by identifying the 500 basepairs upstream and the 500 base pairs downstream of the target sequence, such that the upstreamhomology arm contained the first ten nucleotides of the corresponding targeting region sequenceand the downstream homology arm contained the remaining ten nucleotides of the correspondingtargeting region sequence. The chromosomal location of each 500 base pair homology arm paircomprising the upstream (left homology arm, “LHA”) and downstream (right homology arm,"RHA") homology arm are presented in Table 9.Table 9Cas12a Target Site Homology ArmsSEQ ID NO | Name | Chromosome location--------------|-------------|----------------------------SEQ ID NO:86 | B2M-LHA | chr15:44715125-44715624SEQ ID NO:87 | B2M-RHA | chr15:44715625-44716124SEQ ID NO:88 | PDCD1-LHA | chr2:241852874-241853373SEQ ID NO:89 | PDCD1-RHA | chr2:241852374-241852873SEQ ID NO:90 | CBLB-LHA | chr3:105853589-105854088SEQ ID NO:91 | CBLB-RHА | chr3:105853089-105853588SEQ ID NO:92 | CISH-LHA | chr3:50607772-50608271SEQ ID NO:93 | CISH-RHA | chr3:50607272-50607771SEQ ID NO:94 | TIGIT-LHA | chr3:114299095-114299594SEQ ID NO:95 | TIGIT-RHА | chr3:114299595-114300094SEQ ID NO:96 | TIM3-LHA | chr5:157104689-157105188SEQ ID NO:97 | TIM3-RHA | chr5:157104189-157104688SEQ ID NO:98 | LAG3-LHA | chr12:6772840-6773339SEQ ID NO:99 | LAG3-RHA | chr12:6773340-6773839SEQ ID NO:100 | CIITA-LHA | chr16:10915093-10915592SEQ ID NO:101 | CIITA-RHА | chr16:10915593-10916092SEQ ID NO:102 | DNMT3A-LHA | chr2:25246238-25246737SEQ ID NO:103 | DNMT3A-RHA | chr2:25245738-25246237

[0313] B. Design of CAR Transgene Constructs

[0314] A DNA donor polynucleotide comprising an EFla promoter driving a CD19targeting CAR (SEQ ID NO:104), an MND promoter driving a CD19 targeting CAR (SEQ IDNO:105), An EFla promoter driving a BCMA targeting CAR (SEQ ID NO:106), and an MNDpromoter driving a BCMA target CAR (SEQ ID NO:107) were designed.

[0315] The 500 base pair long homology arms presented in Table 9 were appended to the5' and 3' ends of the DNA donor polynucleotides, wherein the DNA donor polynucleotides wereorientated in a reverse orientation (i.e., 5' to 3') relative to the homology arms. The TRAC target(SEQ ID NO:69) and homology arms (SEQ ID NO:65 and (SEQ ID NO:66) were previouslypresented in Example 6. The resulting homology arm and CAR containing DNA donorpolynucleotides are presented in Table 10.Table 10Insertion Site and CAR PairsPromoter | Insertion Site | CAR Antigen Target---------|----------------|--------------------EFla | TRAC | CD19EFla | B2M | CD19EFla | PDCD1 | CD19EFla | CBLB | CD19EFla | CISH | CD19EFla | TIGIT | CD19EFla | TIM3 | CD19EFla | LAG3 | CD19EFla | CIITA | CD19EFla | DNMT3A | CD19MND | B2M | CD19MND | PDCD1 | CD19MND | CBLB | CD19MND | CISH | CD19MND | TIGIT | CD19MND | TIM3 | CD19MND | LAG3 | CD19MND | CIITA | CD19MND | DNMT3A | CD19EFla | B2M | ВСМАEFla | CISH | BCMAMND | TRAC | ВСМАMND | B2M | BCMAMND | PDCD1 | BCMAMND | CBLB | ВСМАMND | CISH | BCMAMND | TIGIT | ВСМАMND | TIM3 | ВСМАMND | LAG3 | ВСМАMND | CIITA | ВСМАMND | DNMT3A | ВСМА

[0316] The homology arm and CAR pairs were synthesized by a commercial manufacturersimilar to the process described in Example 5 and packaged in AAV6 particles as detailed inExample 6 herein.

[0317] C. Transfection and Transduction of CAR Constructs

[0318] Human T cells were prepared as described in Example 1, Cas12 NPC for each targetregion were built as described in Example 2, and T cells were transfected with Cas12a NPC andtransduced with AAV6 particles for the construct detailed in Table 10 as described in Example 6.

[0319] T cells were expanded for six days after transfection and transduction and CARpositivity was measured for each culture in duplicate via flow cytometry. The resulting CARexpression of each design is presented in Table 11.Table 11CAR Positivity Across Genomic Insertion SitesInsertion Site | Promoter | CAR Antigen Target | CAR Positive (%) Replicate 1 | Replicate 2--------------|----------|--------------------|--------------------------------|------------TRAC | EFla | CD19 | 80.7 | 79.8CISH | EFla | CD19 | 75.2 | 76.9LAG3 | MND | CD19 | 68.9 | 68.5CISH | MND | CD19 | 69.2 | 67.6PDCD1 | EFla | CD19 | 67.9 | 67.7LAG3 | EFla | CD19 | 67.6 | 67.1DNMT3A | MND | CD19 | 64.6 | 66.8PDCD1 | MND | CD19 | 63.8 | 65.9B2M | EFla | CD19 | 63.4 | 62DNMT3A | EFla | CD19 | 58.6 | 58.6CBLB | EFla | CD19 | 56.2 | 57TIGIT | EFla | CD19 | 55.1 | 56TIGIT | MND | CD19 | 55.1 | 55.7CBLB | MND | CD19 | 49.6 | 52.3CIITA | EFla | CD19 | 50.7 | 50.2CIITA | MND | CD19 | 41.7 | 43.8B2M | MND | CD19 | 19.5 | 20.2TIM3 | EFla | CD19 | 4.94 | 5.37TIM3 | MND | CD19 | 4.16 | 3.05TRAC | MND | ВСМА | 65.9 | 67.9CISH | MND | ВСМА | 52.6 | 54.4LAG3 | MND | ВСМА | 53.5 | 51.1TIGIT | MND | ВСМА | 50.5F | 48.4PDCD1 | MND | ВСМА | 44.4 | 46.1DNMT3A | MND | ВСМА | 33.8 | 31.3CISH | EFla | ВСМА | 27.7 | 25.7CBLB | MND | ВСМА | 24.4 | 22.3CIITA | MND | ВСМА | 9.38 | 8.76B2M | MND | ВСМА | 0 | 0PDCD1 | EFla | BCMA | 0 | 0TIM3 | MND | BCMA | 0 | 0

[0320] The results are presented in this example and Table 11 demonstrate the expressionof CD19 targeting or BCMA targeting CAR constructs across a multitude of genomic sites inhuman T cells. Different combinations of CAR construct, promoter, and site of insertion impactthe expression rates of the tested CAR constructs. This example provides teaching on how todetermine preferred design parameters to tune CAR expression levels.

[0321] While the invention has been described in detail with reference to specificexamples, it will be apparent to one skilled in the art that various modifications can be made withinthe scope of this invention. Thus, the scope of the invention should not be limited by the examplesdescribed herein, but by the claims presented below.

Claims

What is claimed is:

1. A chassis for a modular chimeric antigen receptor (MODL-CAR) comprising:(i) an intracellular component comprising a signaling domain;(ii) a transmembrane component, and(iii) a connector component comprising a first association domain component and asecond association domain conjugated to the intracellular component, wherein the firstassociation domain is capable of specific association with the second association domain.

2. The chassis for a MODL-CAR of claim 1, wherein the first association domaincomprises at least a portion of the constant region of an immunoglobulin heavy chain (CH1)and the second association domain comprises at least a portion of the constant region of animmunoglobulin light chain (CL).

3. The chassis for a MODL-CAR of claim 2, wherein the first association domaincomprises or consists essentially of SEQ ID NO: 01, and the second association domaincomprises or consists essentially of SEQ ID NO: 02.

4. The chassis for a MODL-CAR of claim 1, wherein the first and secondassociation domains comprise at least a portion of the constant region of an immunoglobulinheavy chain (CH2 or CH3).

5. The chassis for a MODL-CAR of claim 4, wherein the first and secondassociation domains comprise the following amino acid changes: 1) Y407T in the firstassociation domain and T366Y in the second association domain; or 2) Y407A in the firstassociation domain and T366W in the second association domain; or 3) F405A in the firstassociation domain and T394W in the second association domain; or 4) F405W in the firstassociation domain and T394S in the second association domain; or 5) Y407T in the firstassociation domain and T366Y in the second association domain; or 6) T366Y and F405A inthe first association domain and T394W and Y407T in the second association domain; or 7)T366W and F405W in the first association domain and T394S and Y407A in the secondassociation domain; or 8) F405W and Y407A in the first association domain and T366W andT394S in the second association domain; or 9) T366W in the first association domain andT366S, L368A, and Y407V in the second association domain; wherein the amino acidnumbering is according to Kabat EU index numbering system.

6. The chassis for a MODL-CAR of claim 4, wherein the first and secondassociation domains comprise the following amino acid changes: 1) Y349C in the firstassociation domain and S354C in the second association domain; or 2) Y349C in the firstassociation domain and E356C in the second association domain; or 3) Y349C in the firstassociation domain and E357C in the second association domain; or 4) L351C in the firstassociation domain and S354C in the second association domain; or 5) T394C in the firstassociation domain and E397C in the second association domain; or 6) D399C in the firstassociation domain and K392C in the second association domain; wherein the amino acidnumbering is according to Kabat EU index numbering system.

7. The chassis for a MODL-CAR of claim 4, wherein the first and secondassociation domains comprise the following amino acid changes: 1) K409D or K409E in thefirst association domain and D399K or D399R in the second association domain; or 2)K392D or K.392E in the first association domain and D399K or D399R in the secondassociation domain, or 3) K439D or K439E in the first association domain and E356K. orE356R in the second association domain; or 4) K370D or K370E in the first associationdomain and E357K or E357R in the second association domain; or 5) K409D and K360D inthe first association domain and D399K and E356K in the second association domain; or 6)K409D and K370D in the first association domain and D399K and E357K in the secondassociation domain; or 7) K409D and K392D in the first association domain and D399K,E356K, and E357K in the second association domain; or 8) K409D and K392D in the firstassociation domain and D399K in the second association domain; or 9) K409D and K392Din the first association domain and D399K and E356K in the second association domain; or10) K409D and K392D in the first association domain and D399K and D357K in the secondassociation domain; or 11) K409D and K370D in the first association domain and D399Kand D357K in the second association domain; or 12) D399K in the first association domainand K409D and K360D in the second association domain; or 13) K409D and K439D in thefirst association domain and D399K and E356K in the second association domain, whereinthe amino acid numbering is according to Kabat EU index numbering system.

8. The chassis for a MODL-CAR of claim 1, wherein the first and secondassociation domains are complementary coiled-coil domains.

9. The chassis for a MODL-CAR of claim 8, wherein the first association domaincomprises or consists essentially of SEQ ID NO: 17, and second association domaincomprises or consists essentially of SEQ ID NO: 18.

10. The chassis for a MODL-CAR of claim 8, wherein the first association domaincomprises or consists essentially of SEQ ID NO: 19, and second association domaincomprises or consists essentially of SEQ ID NO: 20.

11. The chassis for a MODL-CAR of claim 1, wherein the first and secondassociation domains are complementary leucine zipper domains.

12. The chassis for a MODL-CAR of claim 11, wherein the dissociation constant (Ka)between the first and the second leucine zipper association domains is between 10 nM and 30nM.

13. The chassis for a MODL-CAR of claim 11, wherein the first association domaincomprises or consists essentially of SEQ ID NO: 8, and second association domain comprisesor consists essentially of SEQ ID NO: 10.

14. The chassis for a MODL-CAR of claim 11, wherein the first association domaincomprises or consists essentially of SEQ ID NO: 9, and second association domain comprisesor consists essentially of SEQ ID NO: 11.

15. The chassis for a MODL-CAR of claim 1, wherein the first and secondassociation domains are halves of a split intein.

16. The chassis for a MODL-CAR of claim 15, wherein a C-terminus of thetransmembrane component is conjugated to an intein-N and a N-terminus of the intracellularcomponent is conjugated to intein-C.

17. The chassis for a MODL-CAR of claim 16, wherein the intein-N and the intein-Cinteract to covalently connect the C-terminus of the transmembrane component to the N-terminus of the intracellular component.

18. The chassis for a MODL-CAR of claim 15, wherein the sequence of the halves ofthe split intein is derived from the DNA Polymerase III sequence from Nostoc punctiformePCC73102.

19. The chassis for a MODL-CAR of claim 15, wherein the sequence of the halves ofthe split intein is derived from the DNA Polymerase III sequence from Synechocystis sp.PCC6803.

20. The chassis for a MODL-CAR of claim 15, wherein the first association domaincomprises or consists essentially of SEQ ID NO: 12, and second association domaincomprises or consists essentially of SEQ ID NO: 13.

21. The chassis for a MODL-CAR of claim 15, wherein the first association domaincomprises or consists essentially of SEQ ID NO: 14, and second association domaincomprises or consists essentially of SEQ ID NO: 15.

22. The chassis for a MODL-CAR of claim 15, wherein the first association domaincomprises or consists essentially of SEQ ID NO: 14, and second association domaincomprises or consists essentially of SEQ ID NO: 16.

23. The chassis for a MODL-CAR of claim 1, wherein the first and secondassociation domains are cross-ẞ motif domains.

24. The chassis for a MODL-CAR of claim 23, wherein the first and second cross-ẞmotif domains comprise amino acid changes not present in cross-ẞ motif domains of a wild-type Fc structure resulting in additional disulfide bonds between the association domains inthe connector component.

25. The chassis for a MODL-CAR of claim 23, wherein the first and second cross-ẞmotif domains comprise amino acids changes not present in cross-ẞ motif domains of a wild-type Fc structure resulting in additional electrostatic interactions between the associationdomains in the connector component.

26. The chassis for a MODL-CAR of claim 1, wherein the transmembrane domain isthe transmembrane domain of a protein selected from the group consisting of T cell receptoralpha chain, T cell receptor beta-chain, CD2, CD3, CD4, CD5, CD8, CD9, CD16, CD22,CD27, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, DNAM1,ICOS, NKp44, NKp46, NKG2A, NKG2C, NKG2D, 2B4, TMIG2, TLR1, TLR2, TLR4,TLR5, TLR6, and GITR.

27. The chassis for a MODL-CAR of claim 1, wherein the intracellular componentcomprises an activation domain.

28. The chassis for a MODL-CAR of claim 27, wherein the activation domain isselected from the group consisting of CD3%, CD3ɛ, CD28, CD27, OX40 (CD134), 4-1BB(CD137), ICOS (CD278), IL-2Rẞ (CD122), IL-2Ra (CD132), DAP10, DAP12, DNAM1,TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, MyD88, IL18R, and CD40.

29. The chassis for a MODL-CAR of claim 1, wherein the intracellular componentcomprises a costimulatory domain.

30. The chassis for a MODL-CAR of claim 29, wherein the costimulatory domain isselected from the group consisting of CD28, 4-1BB, OX40, ICOS, DAP-10, CD27, CD30,CD40, NKGD2, CD2, FN14, HVEM, LIBR, CD28H, TNFR1, INFR2, BAFF-R, BCMA,TACI, TROY, RANK, EDAR, XEDAR, GITR, DR6, and NGFR.

31. The chassis for a MODL-CAR of claim 1, wherein the activation domaincomprises a binding motif for an intracellular signal transduction protein.

32. The chassis for a MODL-CAR of claim 31, wherein the binding motif is a JAKbinding motif comprising SEQ ID NO: 112.

33. The chassis for a MODL-CAR of claim 31, wherein the binding motif is a STATbinding comprising a sequence selected from the group consisting of SEQ ID NO: 108-111.

34. A MODL-CAR comprising the chassis for a MODL-CAR of claim 1, furthercomprising an extracellular component that comprises an antigen binding domain.

35. The MODL-CAR of claim 34, wherein the antigen binding domain is selectedfrom an antibody variable fragment (Fv), an antibody single-chain variable fragment (scFv),a proteolytically-cleaved antibody-binding fragment (Fab), a bi-specific Fab F(ab)2, and ananobody (Ѵнн antibody).

36. The MODL-CAR of claim 35, comprising a linker.

37. The MODL-CAR of claim 36, wherein the linker comprises a formula (GxSy)n,where G is glycine and S is serine.

38. The MODL-CAR of claim 37, wherein the linker comprises G4S (SEQ ID NO:113).

39. The MODL-CAR of claim 34, further comprising a signal sequence.

40. The MODL-CAR of claim 39, wherein the signal sequence is selected from aCD8 signal sequence and a CD28 signal sequence.

41. The MODL-CAR of claim 34, wherein the antigen binding domain is capable ofbinding an antigen selected from the group consisting of CD4, CD16V, CD19, CD22, CD20,CD28, CD30, CD33, CD37, CD38, CD44, CD47, CD70, CD73, CD79b, CD112, CD123,CD133, CD137, GD2, DNAM-1, IL-11Ra, IL-13RA, IL-13RA2, BCMA, CD138, NKG2-D,HER2 / Neu, B7-H3 (CD276), B7-H6, CA-125, MUC-1, MUC-16, mutated TP53, mutatedRas, ERBB2 (HER2), folate binding protein (FBP), L1CAM (CD171), CLL1 (CD371),CEA, Claudin 18.1, Claudin 18.2, CS-1, CSPG4, mutated EGFR, EFGRvIII, ENPP3,EpCAM, EphA2, ErbB, FAP, FLT-3, FRα, GD3, Glypican 3, LewisY / LeY, c-Met,mesothelin, MG7, Nectin-4, NGFR, PD1, PD-L1, PD-L2, PSCA, PSMA, PTK7, ROR1,SLAMF7, STEAP, STEAP2, TACI, TAG72, TROP2, ULBP, MICA / B, VEGFR2, PDGFR,ULBP1-6, and WT1.

42. The MODL-CAR of claim 34, comprising the structure SEQ ID NO: 21-SEQ IDNO: 01-SEQ ID NO:02-SEQ ID NO: 22.

43. The MODL-CAR of claim 34, comprising the structure SEQ ID NO: 21-SEQ IDNO: 02-SEQ ID NO:01-SEQ ID NO: 22.

44. The MODL-CAR of claim 34, encoded by a nucleic acid comprising SEQ ID NO:51 or SEQ ID NO: 52.

45. The MODL-CAR of claim 34, comprising the structure SEQ ID NO: 21-SEQ IDNO: 8-SEQ ID NO: 10-SEQ ID NO: 22.

46. The MODL-CAR of claim 34, comprising the structure SEQ ID NO: 21-SEQ IDNO: 9-SEQ ID NO: 11-SEQ ID NO: 22.

47. The MODL-CAR of claim 34, encoded by a nucleic acid comprising SEQ ID NO:53 or SEQ ID NO: 54.

48. The MODL-CAR of claim 34, comprising the structure SEQ ID NO: 21-SEQ IDNO: 17-SEQ ID NO: 18-SEQ ID NO: 22.

49. The MODL-CAR of claim 34, comprising the structure SEQ ID NO: 21-SEQ IDNO: 19-SEQ ID NO: 20-SEQ ID NO: 22.

50. The MODL-CAR of claim 34, encoded by a nucleic acid comprising SEQ ID NO:58 or SEQ ID NO: 59.

51. The MODL-CAR of claim 34, comprising the structure SEQ ID NO: 21-SEQ IDNO: 12-SEQ ID NO: 13-SEQ ID NO: 22.

52. The MODL-CAR of claim 34, comprising the structure SEQ ID NO: 21-SEQ IDNO: 14-SEQ ID NO: 15-SEQ ID NO: 22.

53. The MODL-CAR of claim 34, comprising the structure SEQ ID NO: 21-SEQ IDNO: 14-SEQ ID NO: 16-SEQ ID NO: 22.

54. The MODL-CAR of claim 34, encoded by a nucleic acid comprising SEQ ID NO:55, or SEQ ID NO: 56, or SEQ ID NO: 57.

55. An isolated nucleic acid comprising a sequence encoding the MODL-CAR ofclaim 34.

56. The isolated nucleic acid of claim 55, further comprising homology arms flankingthe sequence encoding the MODL-CAR, wherein the homology arms are capable ofhybridizing to a sequence of a genomic locus selected from the group consisting of TRAC,B2M, PDCD1, CBLB, CISH, TIGIT, TIM3, LAG3, CIITA, DNMT3A and a safe harbor locus.

57. The isolated nucleic acid of claim 55, further comprising a promoter selectedfrom the group consisting of a U6 promoter, a H1 promoter, a dihydrofolate reductase(DHFR) promoter, an MND promoter, a human ubiquitin C (UBC) promoter, a CAGpromoter, a CaMKIIa promoter, an SV40 early promoter, an SV40 late promoter, acytomegalovirus (CMV) immediate early promoter, a Rous sarcoma virus long terminalrepeat (RSV-LTR) promoter, a mouse mammary tumor virus long terminal repeat (MMTV-LTR) promoter, a spleen focus-forming virus (SFFV) promoter, a murine embryonic stemcell virus (MSCV) promoter, a ẞ-interferon promoter, a hsp70 promoter, an EF-1αpromoter, an EFla promoter, an EFla core (EFC) promoter, a CBA promoter, a ẞ-actinpromoter, a myeloproliferative sarcoma virus (MPSV) promoter, a mouse or humanphosphoglycerate kinase 1 (PGK1) promoter, and an interferon gamma (IFNy) promoter.

58. The isolated nucleic acid of claim 55, further comprising a vector sequence.

59. The isolated nucleic acid of claim 58, wherein the vector comprises a plasmidvector or a viral vector derived from a virus selected from the group consisting of anadenovirus type 2 and an adenovirus type 5, a retrovirus, a lentivirus, an adeno-associatedvirus (AAV), a simian virus 40 (SV40), vaccinia virus, Sendai virus, Epstein-Barr virus(EBV), and herpes simplex virus (HSV).

60. The isolated nucleic acid of claim 55, comprising a sequence selected from thegroup consisting of SEQ ID NOs: 51-59.

61. An immune cell comprising the MODL-CAR of claim 34.

62. The immune cell of claim 61, selected from the group consisting of a T cell, anatural killer (NK) cell, an induced natural killer (iNK) cell, a monocyte, and a macrophage.

63. The immune cell of claim 61, comprising a nucleic acid sequence selected fromthe group consisting of SEQ ID NOs: 51-59.

64. The immune cell of claim 61 comprising two or more MODL-CARs of claim 34,wherein the MODL-CARs differ in at least one of the antigen-binding domain, and thecytoplasmic component.

65. The immune cell of claim 64, wherein a first MODL-CAR comprises an antigen-binding domain targeting the CD19 antigen and a cytoplasmic component comprising a 4-1BB costimulatory domain, and a second MODL-CAR comprises and antigen-bindingdomain targeting the BCMA antigen and a cytoplasmic component comprising a CD28costimulatory domain.

66. The immune cell of claim 61, comprising inactivation of one or more immunecheckpoint genes or regulatory genes selected from the group consisting of PDCD1, CIITA,CTLA-4, LAG3, Tim3, BTLA, BY55, TIGIT, B7H5, LAIRI, SIGLEC10, B2M, CISH, CBLBand 2B4.

67. The immune cell of claim 66, comprising inactivation of the B2M gene and furthercomprising insertion of a HLA-E-B2M fusion into the B2M locus.

68. A method of making the immune cell of claim 61, the method comprisingintroducing a nucleic acid encoding a MODL-CAR into a cell selected from the groupconsisting of a T cell, a natural killer (NK) cell, an induced natural killer (iNK) cell, amonocyte, and a macrophage.

69. The method of claim 68, wherein the nucleic acid encoding the MODL-CARcomprises a sequence selected from SEQ ID NOs: 51-59.

70. The method of claim 68, wherein the introducing step comprises introducing intothe cell a sequence-dependent endonuclease.

71. The method of claim 70, wherein the sequence-dependent endonuclease is anucleic acid-guided endonuclease.

72. The method of claim 71, wherein the nucleic acid-guided endonuclease is aCRISPR endonuclease.

73. The method of claim 72, wherein the CRISPR endonuclease is selected fromCas9, Cas12a and CASCADE.

74. The method of claim 72, wherein the CRISPR endonuclease comprises acatalytically inactive CRISPR endonuclease conjugated to the cleavage domain of therestriction endonuclease Fok I.

75. The method of claim 70, wherein the endonuclease is selected from the groupconsisting of a zinc finger nuclease (ZFN), a ZFN-Fok I fusion, a transcription activator-likeeffector nuclease (TALEN), and a TALEN-Fok I fusion.

76. The method of claim 70, wherein the endonuclease cleaves the genome of the cellat a locus selected from the group consisting of TRAC, B2M, PDCD1, CBLB, CISH, TIGIT,TIM3, LAG3, CIITA, and DNMT3A.

77. The method of claim 68, wherein the nucleic acid encoding the MODL-CAR ispresent in a vector selected from the group consisting of a plasmid vector, an adenovirus type2 and an adenovirus type 5, a retrovirus, a lentivirus, an adeno-associated virus (AAV), asimian virus 40 (SV40), vaccinia virus, Sendai virus, Epstein-Barr virus (EBV), and herpessimplex virus (HSV).

78. A composition comprising the immune cells of claim 61 and a pharmaceuticallyacceptable excipient.

79. The composition of claim 78, wherein the immune cells are MODL-CAR-T cellsin the amount of between 1×106 and 2×108 cells.

80. The composition of claim 78, wherein the immune cells are MODL-CAR-NKcells in the amount of between 1×107 and 2×10º cells.

81. The composition of claim 78, wherein the immune cells are a mixture of MODL-CAR-T cells and MODL-CAR-NK cells present at a ratio of approximately 1:10 MODL-CAR-T to MODL-CAR-NK.

82. The composition of claim 78, wherein the pharmaceutically acceptable excipientcomprises one or more of carbohydrates, inorganic salts, antimicrobial agents, antioxidants,surfactants, buffers, acids, bases, water, alcohols, polyols, glycerin, vegetable oils,phospholipids, surfactants, sugars, derivatized sugars, alditols, mannitol, xylitol, maltitol,lactitol, xylitol, sorbitol, pyranosyl sorbitol, myoinositol, aldonic acid, esterified sugars,sugar polymers, monosaccharides, fructose, maltose, galactose, glucose, D-mannose,sorbose, disaccharides, lactose, sucrose, trehalose, cellobiose, polysaccharides, raffinose,melezitose, maltodextrins, dextrans, starches, citric acid, sodium chloride, potassiumchloride, sodium sulfate, potassium nitrate, and sodium phosphate.

83. The composition of claim 82, wherein the antimicrobial agent comprises one ormore of benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetylpyridiniumchloride, chlorobutanol, phenol, phenylethyl alcohol, phenylmercuric nitrate, and thimerosal.

84. The composition of claim 78 further comprising an antioxidant selected fromascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, hypophosphorousacid, monothioglycerol, propyl gallate, sodium bisulfite, sodium formaldehyde sulfoxylate,and sodium metabisulfite.

85. The composition of claim 78 further comprising a surfactant selected frompolysorbates, sorbitan esters, lecithin, phosphatidylcholines, phosphatidylethanolamines,fatty acids, fatty acid esters and cholesterol.

86. The composition of claim 78 further comprising a freezing agent selected from3% to 12% dimethylsulfoxide (DMSO) and 1% to 5% human albumin.

87. The composition of claim 78 further comprising a preservative selected from oneor more of methylparaben, propylparaben, sodium benzoate, benzalkonium chloride,antioxidants, chelating agents, parabens, chlorobutanol, phenol, and sorbic acid.

88. The composition of claim 78 further comprising a delivery-timing component thatenables time-release, delayed release, or sustained release of the composition.

89. The composition of claim 88, wherein the delivery-timing component is selectedfrom monostearate, gelatin, a semipermeable matrix, and a solid hydrophobic polymer.

90. A method of inhibiting the growth of a tumor in a patient comprisingadministering to the patient the composition of claim 78.

91. The method of claim 90, wherein the tumor is a solid tumor selected from ovariancancer, triple negative breast cancer, colorectal cancer, non-small cell lung cancer, lungadenocarcinoma, pancreatic cancer, gastric cancer, melanoma, and endometrial carcinoma, ora hematological tumor selected from MCL, CLL, SLL, B-ALL, B-NHL, and AML.

92. The method of claim 90 further comprising, prior to administering to the patient,applying to the immune cells a quality control measure comprising assessing one or moreproperties selected from presence of the MODL-CAR in the cellular genome, surfaceexpression of the MODL-CAR, antigen-dependent lysis of antigen-expressing target cells,proliferation in the presence of antigen-expressing target cells, cytokine or chemokinesecretion in the presence of antigen-expressing target cells, reducing tumor burden inexperimental animals harboring antigen-expressing tumors, and persistence in circulation ofexperimental animals harboring antigen-expressing tumors upon administration of the immunecells to the animals.

93. The method of claim 92, wherein the presence of the MODL-CAR in the cellulargenome is assessed by a method selected from nucleic acid hybridization, nucleic acidsequencing, polymerase chain reaction (PCR), quantitative PCR (qPCR), real-time PCR(rtPCR) and droplet digital PCR (ddPCR).

94. The method of claim 92, wherein the surface expression of the MODL-CAR isassessed by flow cytometry, fluorescence-activated cell sorting (FACS), microfluidics-basedscreening, ELISA, or Western blot.

95. The method of claim 94, wherein the immune cell population with the highestsurface expression of the MODL-CAR is selected for administration to the patient.

96. The method of claim 92, wherein the antigen-dependent lysis of antigen-harboring target cells is assessed by co-culturing the immune cells of claim 26 with antigen-expressing target cells at an effector:target ratio between about 0.1 and about 10 andassessing target cell lysis.

97. The method of claim 96, wherein the immune cell population with the highest rateof lysis of antigen-harboring target cells is selected for administration to the patient.

98. The method of claim 92, wherein the antigen-dependent proliferation is assessedby co-culturing the immune cells with antigen-expressing target cells and assessing theproliferation of the immune cells.

99. The method of claim 98, wherein the immune cell population with the highest rateof proliferation in the presence of antigen-expressing target cells is selected foradministration to the patient.

100. The method of claim 92, wherein the cytokine or chemokine is selected from IFN-γ, TNF-α, GM-CSF, IL-10, IL-5, and IL-13, ΜΙΡ-1α, ΜΙP-1ẞ, IL-8, and RANTES.

101. The method of claim 100, wherein the cytokine secretion is assessed by co-culturing the immune cells with antigen-expressing target cells and measuring the amount ofcytokines in the co-culture supernatant.

102. The method of claim 101, wherein the immune cell population with the highestcytokine secretion is selected for administration to the patient.

103. The method of claim 92, wherein the reducing tumor burden in experimentalanimals harboring antigen-expressing tumors is measured as change bioluminescence of thebioluminescent tumor cells in a time period after the animals have been injected with theimmune cells.

104. The method of claim 103, wherein the change in bioluminescence is expressed asarea under the curve (AUC) and the immune cell population with the smallest AUC isselected for administration to the patient.

105. The method of claim 92, wherein the persistence in circulation of experimentalanimals harboring antigen-expressing tumors upon administration of the immune cells to theanimals is measured by counting human CD8-expressing cells in the circulation of theanimals.

106. The method of claim 105, wherein the immune cell population with the highestcounts of human CD8-expressing cells in the circulation of the animals is selected foradministration to the patient.

107. A modular chimeric antigen receptor (MODL-CAR) comprising:(i) an extracellular component comprising an antigen-binding domain;(ii) an intracellular component comprising a signaling domain;(iii)a transmembrane component, and(iv) a connector component comprising a first association domain conjugated to theextracellular component and a second association domain conjugated to the intracellularcomponent, wherein the first association domain is capable of specific association with thesecond association domain.

Citation Information

Patent Citations

  • Chimeric antigen receptors, encoding nucleic acids and methods of use thereof

    US10336810B2

  • Methods and compositions for stabilizing trans-splicing intein modified proteases

    US11066657B2

  • Human FcRn-binding modified antibodies and methods of use

    US11091541B2

  • Rotary electric machine control device and electric power steering apparatus using the same

    US11104375B2

  • Method to identify and validate genomic safe harbor sites for targeted genome engineering

    US20200370067A1