Microrna knockdown of MSH3
Artificial miRNA molecules targeting MSH3 mRNA via AAV vectors provide a therapeutic approach to inhibit MSH3 expression, effectively addressing the underlying cause of HD and slowing disease progression.
Patent Information
- Application Number
- PCT/US2025/043974
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-28
- Filing Date
- 2025-08-28
- Publication Date
- 2026-03-05
AI Technical Summary
Current therapies for Huntington's disease (HD) only provide symptomatic relief and fail to address the underlying cause or halt disease progression, despite the identification of the genetic cause in 1993.
Artificial microRNA (miRNA) molecules targeting messenger RNA encoding human MutS Homolog 3 (MSH3) are used to inhibit MSH3 expression, delivered via adeno-associated virus (AAV) vectors, to treat HD and related conditions.
Inhibiting MSH3 expression effectively slows down somatic CAG repeat expansion and shows promise in treating HD symptoms and progression.
Smart Images

Figure US2025043974_05032026_PF_FP_ABST
Abstract
Description
[0001] Attorney Docket No.: 086013-0585293
[0002] MTCRORNA KNOCKDOWN OF MSH3
[0003] Cross-Reference to Related Application
[0004] This Application claims priority to U.S. Provisional Patent Application No. 63 / 688,007, filed on August 28, 2024, the entire content of which is incorporated herein by reference.
[0005] Field of the Invention
[0006] The invention relates to artificial microRNA (miRNA) molecules.
[0007] Introduction
[0008] Huntington’s disease (HD) is a fatal, neurodegenerative disorder affecting the striatum, cerebral cortex and other subcortical structures. HD onset appears around midlife in most cases and is characterized by a combination of symptoms: movement abnormalities, emotional disturbances and cognitive impairments. The most characteristic feature in HD patients is the uncoordinated irregular movements. In most cases, HD symptoms begin at 35-50 years of age and end with death 15-20 years later.
[0009] HD is an autosomal dominant genetic disorder caused by the trinucleotide repeat expansion of CAGin the huntingtin gene. The CAG repeat is unstable, and can result in expansions of hundreds of CAGs in subjects with HD. The age of disease onset can be predicted partially from the length of the CAG repeat as measured in blood and in genetic modifiers, which may involve variation in DNA mismatch repair pathways genes.
[0010] Despite the identification of the genetic cause of HD in 1993, no approved therapy has yet been developed. Current pharmaceuticals can only provide symptomatic amelioration but fail to treat the underlying cause or stop disease progression.
[0011] Summary
[0012] Provided herein are nucleic acid molecules, viral vectors, compositions, and methods related to artificial microRNA (miRNA) sequences that target messenger RNA (mRNA) encoding human MutS Homolog 3 (MSH3). The nucleic acid molecules and vectors disclosed herein are useful for inhibiting MSH3 expression and treating Huntington’s Disease (HD) and related conditions. Attorney Docket No.: 086013-0585293
[0013] In some embodiments, provided herein is a nucleic acid molecule comprising a primary microRNA (pri-miRNA) scaffold and a guide sequence within the scaffold that targets an MSH3 transcript. In some embodiments, the guide sequence comprises a sequence having 90% or more sequence identity to any one of SEQ ID NOs: 1-29, as described in Table 1. In some embodiments, the guide sequence comprises a sequence having 95% or more sequence identity to any one of SEQ ID NOs: 1-29. In some embodiments, the guide sequence comprises a sequence having 100% sequence identity to any one of SEQ ID NOs: 1-29.
[0014] In some embodiments, the nucleic acid molecule comprises, in order, a first scaffold sequence, the guide sequence, a loop scaffold sequence, a passenger sequence to the guide sequence, and a second scaffold sequence. In some embodiments, the passenger sequence comprises a sequence having 90% or more sequence identity to any one of SEQ ID NOs: 30-58, as described in Table 1. In some embodiments, the passenger sequence comprises a sequence having 95% or more sequence identity to any one of SEQ ID NOs: 30-58. In some embodiments, the passenger sequence comprises a sequence having 100% sequence identity to any one of SEQ ID NOs: 30-58.
[0015] Table 1: MSH3 RNAi guide and passenger strand sequences Attorney Docket No.: 086013-0585293 Attorney Docket No.: 086013-0585293 Attorney Docket No.: 086013-0585293
[0016] In some embodiments, the loop scaffold sequence, first scaffold sequence, and / or second scaffold sequence are selected from Table 2, including hairpin loop sequences (SEQ ID NOs: 59-88, as described in Table 2), first scaffold sequences (SEQ ID NOs: 89-119, as described in Table 2), and second scaffold sequences (SEQ ID NOs: 120-151, as described in Table 2). In some embodiments, the nucleic acid comprises a scaffold backbone. In some embodiments, the scaffold backbone is selected from miR-30 or miR-451.
[0017] Table 2: MSH3 RNAi oligos scaffold Attorney Docket No.: 086013-0585293 Attorney Docket No.: 086013-0585293 Attorney Docket No.: 086013-0585293 Attorney Docket No.: 086013-0585293 Attorney Docket No.: 086013-0585293 Attorney Docket No.: 086013-0585293 Attorney Docket No.: 086013-0585293
[0018] In some embodiments, the nucleic acid molecule comprises specific sequence combinations, such as a first scaffold sequence comprising SEQ ID NO: 94, a guide sequence comprising SEQ ID NO: 6, a loop scaffold sequence comprising SEQ ID NO: 64, a passenger sequence comprising SEQ ID NO: 35, and a second scaffold sequence comprising SEQ ID NO: 125. In another embodiment, the nucleic acid molecule comprises a first scaffold sequence comprising SEQ ID NO: 99, a guide sequence comprising SEQ ID NO: 11, a loop scaffold sequence comprising SEQ ID NO: 69, a passenger sequence comprising SEQ ID NO: 40, and a second scaffold sequence comprising SEQ ID NO: 130. Attorney Docket No.: 086013-0585293
[0019] In some embodiments, provided herein is an adeno-associated virus (AAV) vector comprising a capsid protein and a nucleic acid molecule of the invention. In some embodiments, the nucleic acid molecule comprises a promoter sequence, a pri-miRNA scaffold, and a guide sequence within the scaffold that targets an MSH3 transcript. In some embodiments, the nucleic acid molecule encodes, in order, a first scaffold sequence, the guide sequence, a loop scaffold sequence, a passenger sequence to the guide sequence, and a second scaffold sequence.
[0020] In some embodiments, the guide sequence in the AAV vector comprises a sequence having 90% or more sequence identity to any one of SEQ ID NOs: 1-29. In some embodiments, the guide sequence comprises a sequence having 95% or more sequence identity to any one of SEQ ID NOs: 1-29. In some embodiments, the guide sequence comprises a sequence having 100% sequence identity to any one of SEQ ID NOs: 1-29.
[0021] In some embodiments, the passenger sequence in the AAV vector comprises a sequence having 90% or more sequence identity to any one of SEQ ID NOs: 30-58. In some embodiments, the passenger sequence comprises a sequence having 95% or more sequence identity to any one of SEQ ID NOs: 30-58. In some embodiments, the passenger sequence comprises a sequence having 100% sequence identity to any one of SEQ ID NOs: 30-58.
[0022] In some embodiments, the loop scaffold sequence, first scaffold sequence, and / or second scaffold sequence in the AAV vector are selected from Table 2. In some embodiments, the AAV vector comprises a scaffold backbone. In some embodiments, the scaffold backbone is selected from miR-30 or miR-451.
[0023] In some embodiments, the AAV vector comprises specific sequence combinations, such as a first scaffold sequence comprising SEQ ID NO: 94, a guide sequence comprising SEQ ID NO: 6, a loop scaffold sequence comprising SEQ ID NO: 64, a passenger sequence comprising SEQ ID NO: 35, and a second scaffold sequence comprising SEQ ID NO: 125. In another embodiment, the AAV vector comprises a first scaffold sequence comprising SEQ ID NO: 99, a guide sequence comprising SEQ ID NO: 11, a loop scaffold sequence comprising SEQ ID NO: 69, a passenger sequence comprising SEQ ID NO: 40, and a second scaffold sequence comprising SEQ ID NO: 130.
[0024] In some embodiments, the AAV vector comprises one or more inverted terminal repeats (ITRs) flanking the nucleic acid molecule. In some embodiments, the one or more ITRs are Attorney Docket No.: 086013-0585293 selected from AAV1 , AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, RhlO, and Rh74 serotypes, or a combination thereof.
[0025] In some embodiments, the capsid protein is a modified or variant AAV VP 1, VP2, and / or VP3 capsid having 90% or more sequence identity to AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, RhlO, Rh74, or AAV-2i8 VP1, VP2, and / or VP3 sequences. In some embodiments, the capsid protein is a modified or variant AAV VP1, VP2, and / or VP3 capsid having 95% or more sequence identity to AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, RhlO, Rh74, or AAV-2i8 VP1, VP2, and / or VP3 sequences. In some embodiments, the capsid protein is an AAV VP1, VP2, and / or VP3 capsid having 100% sequence identity to AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, RhlO, Rh74, or AAV-2i8 VP1, VP2, and / or VP3 sequences.
[0026] In some embodiments, the capsid protein comprises an amino acid sequence having 90% or more sequence identity to any one of SEQ ID NOs: 158-163. In some embodiments, the capsid protein comprises an amino acid sequence having 95% or more sequence identity to any one of SEQ ID NOs: 158-163. In some embodiments, the capsid protein comprises an amino acid sequence having 100% sequence identity to any one of SEQ ID NOs: 158-163.
[0027] In some embodiments, provided herein is a composition comprising any of the nucleic acid molecules described herein. In some embodiments, provided herein is a composition comprising a plurality of AAV vectors as described herein.
[0028] In some embodiments, provided herein is a method for inhibiting MutS Homolog 3 (MSH3) expression in a cell, the method comprising administering to the cell any nucleic acid molecule or AAV vector described herein.
[0029] In some embodiments, provided herein is a method of treating Huntington’s Disease in a subject, the method comprising administering to the subject any composition described herein. In some embodiments, the subject is a human. In some embodiments, the composition is administered to said human intravenously, intraarterially, intracavity, intramucosally, or via catheter. In some embodiments, the composition is administered to the brain or central nervous system (CNS) of the subject. In some embodiments, the composition is administered to the parenchyma (intraparenchymal). In some embodiments, the composition is administered to the Globus Pallidus, Caudate Nucleus, Putamen, Thalamus, or Substantia Nigra. In some Attorney Docket No.: 086013-0585293 embodiments, the composition is administered to the ventricle (intracerebroventricular, ICV). In some embodiments, the composition is administered to the lateral ventricle of the subject. In some embodiments, the composition is administered to the Anterior Hom of the Lateral Ventricle, the Body of the Lateral Ventricle, or the Posterior Horn of the Lateral Ventricle (caudal lateral ventricle). In some embodiments, the composition is administered to the cisterna magna (Intraci sterna magna, ICM) or to the dura matter (Intrathecal, IT).
[0030] In some embodiments, the AAV vector in the composition administered to said human is in a range from about IxlO8to about IxlO14vector genomes per kilogram (vg / kg) of the weight of said human.
[0031] In some embodiments, a method further comprises administering an immunosuppressive agent to the subject. In some embodiments, the immunosuppressive agent comprises Rituximab, Sirolimus or Tacrolimus. In some embodiments, the immunosuppressive agent comprises a corticosteroid. In some embodiments, the corticosteroid comprises prednisone, prednisolone or dexamethasone.
[0032] Brief Description of the Drawings
[0033] FIG. 1 shows a graph of results from an in vitro dual-luciferase knockdown assay of guides sequences of the invention.
[0034] FIG. 2 shows a graph of results from an in vitro dual-luciferase knockdown assay of passenger sequences of the invention.
[0035] FIG. 3A shows a graph of results from the in vitro knockdown of endogenous human MSH3 mRNA in human HEK293 cells.
[0036] FIG. 3B shows a graph of results from the in vitro knockdown of endogenous human MSH3 protein in HEK293 cells.
[0037] FIG. 4A shows a graph of results from the in vitro knockdown of endogenous mouse Msh3 mRNA in mouse N2a cells.
[0038] FIG. 4B shows a graph of results from the in vitro knockdown of endogenous mouse Msh3 protein in mouse N2a cells.
[0039] FIG. 5A shows a graph of results from the in vitro knockdown of endogenous human MSH3 mRNA in human HEK293 cells with lead miMSH3 candidates embedded in the miR-30 backbone. Attorney Docket No.: 086013-0585293
[0040] FIG. 5B shows a graph of results from the in vitro knockdown of endogenous human MSH3 mRNAin human HEK293 cells with lead miMSH3 candidates embedded in the miR-451 backbone.
[0041] FIG. 6 shows a schematic of the AAV genomes with the WT AAV2 ITR sequences at the 5’ and 3’ ends, the ubiquitous CAG promoter, miMSH3-06 or miMSH3-ll embedded in the miR-30 or miR-451 scaffold backbones, SV40 polyadenylation (pA) signal, and a stuffer sequence to ensure packaging of full-length genomes.
[0042] FIG. 7 shows a graph of results from the in vivo knockdown of endogenous mouse Msh3 mRNA in wildtype C57B16 / J mouse striatum after AAV-mediated delivery of miMSH3.
[0043] FIG. 8A shows a graph of results from the in vivo biodistribution of AAV-DB- 3.miR30.miMSH3-l l in HdhQl l l mice after intrastriatal injection.
[0044] FIG. 8B shows a graph of results from the in vivo miMSH3-l 1 expression of AAV-DB- 3.miR30.miMSH3-ll in HdhQl ll mice after intrastriatal injection.
[0045] FIG. 8C shows a graph of results from the in vivo knockdown of endogenous mouse Msh3 mRNA in HdhQl ll mouse striatum after AAV-mediated delivery of miMSH3-ll.
[0046] FIG. 8D shows a graph of results from in vivo knockdown of endogenous mouse Msh3 protein in HdhQl l l mouse striatum after AAV-mediated delivery of miMSH3-ll.
[0047] FIG. 8E shows a graph of results from in vivo slowing of somatic CAG repeat expansion in HdhQlll mouse striatum after AAV-mediated delivery of miMSH3-ll.
[0048] FIG. 9A shows a graph of results from the in vivo biodistribution of AAV-DB- 3.miR30.miMSH3-06 and AAV-DB-3.miR30.miMSH3-ll in HdhQlll mice after intrastriatal injection.
[0049] FIG. 9B shows a graph of results from the in vivo knockdown of endogenous mouse Msh3 mRNA in HdhQ 111 mouse striatum after intrastriatal injection of AAV-DB- 3.miR30.miMSH3-06 and AAV-DB-3.miR30.miMSH3-l 1.
[0050] FIG. 9C shows a graph of results from in vivo knockdown of endogenous mouse Msh3 protein in HdhQlll mouse striatum after intrastriatal injection of AAV-DB-3.miR3O.miMSH3- 06 and AAV-DB-3.miR3O.miMSH3-l l.
[0051] FIG. 9D shows a graph of results from in vivo slowing of somatic CAG repeat expansion in HdhQlll mouse striatum after intrastriatal injection of AAV-DB-3.miR30.miMSH3-06 and AAV-DB-3.miR3O.miMSH3-ll. Attorney Docket No.: 086013-0585293
[0052] FIG. 10A shows electropherogram traces representing intensity of CAG repeat lengths in HdhQl ll mouse striatum after intrastriatal injection of AAV-DB-3.miR30.miMSH3-06 at multiple doses.
[0053] FIG. 10B shows a graph of results from in vivo slowing of somatic CAG repeat expansion in HdhQlll mouse striatum after instrastriatal injection of AAV-DB- 3.miR30.miMSH3-06 at multiple doses.
[0054] FIG. 11A shows a graph of results from the in vivo biodistribution of AAV-DB- 3.miR30.miMSH3-06 in rhesus macaques after bilateral intraparenchymal globus pallidus injections at multiple doses.
[0055] FIG. 11B shows a graph of results from the in vivo miMSH3-06 expression levels of AAV- DB-3.miR30.miMSH3-06 in rhesus macaques after bilateral intraparenchymal globus pallidus injections at multiple doses.
[0056] FIG. 11C shows a graph of results from the in vivo knockdown of endogenous rhesus MSH3 mRNAin rhesus macaques after bilateral intraparenchymal globus pallidus injections at multiple doses.
[0057] FIG. HD shows a graph of results from thezn vivo knockdown of endogenous rhesus MSH3 protein in rhesus macaques after bilateral intraparenchymal globus pallidus injections at multiple doses.
[0058] Detailed Description
[0059] The invention provides nucleic acid molecules and methods that use artificial miRNA sequences that knock down mRNA for the human DNA mismatch repair protein MutS Homolog 3 (MSH3), thereby resulting in the treatment of Huntington’s Disease.
[0060] Definitions
[0061] In this disclosure, “comprises,” “comprising,” “containing,” and “having” and the like can have the meaning ascribed to them in U.S. Patent law and can mean “includes,” “including,” and the like. “Consisting essentially of’ or “consists essentially” likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited are not changed by the presence of more than that which is recited, but excludes prior art embodiments. Attorney Docket No.: 086013-0585293
[0062] Amino Acids and Related Sequences
[0063] An amino acid residue in a protein "corresponds" to a given residue when it occupies the same essential structural position within the protein as the given residue.
[0064] The term “isolated”, when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. It can be, for example, in a homogeneous state and may be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant species present in a preparation is substantially purified.
[0065] The term “amino acid” refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as amino acids that are later modified, e.g., hydroxyproline, y-carboxyglutamate, and O- phosphoserine. Amino acid analogs are compounds that have the same basic chemical structure as a naturally occurring amino acid (i.e., an a carbon bound to a hydrogen, a carboxyl group, an amino group, and an R group), such as homoserine, norleucine, methionine sulfoxide, and methionine methyl sulfonium. Amino acid mimetics are compounds with a different general structure than an amino acid but that function in a manner similar to a naturally occurring amino acid, in a peptide or polypeptide context. The terms “non-naturally occurring amino acid” and “unnatural amino acid” refer to amino acid analogs, synthetic amino acids, and amino acid mimetics not found in nature.
[0066] Amino acids may be referred to herein by their commonly known three-letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
[0067] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues, wherein the polymer may in embodiments be conjugated to a moiety that does not consist of amino acids. The terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring and non-naturally Attorney Docket No.: 086013-0585293 occurring amino acid polymers. A “fusion protein” refers to a chimeric protein encoding two or more separate protein sequences that are recombinantly expressed as a single moiety.
[0068] Nucleic Acids and Related Sequences
[0069] The term “nucleic acid” refers to nucleotides (e.g., deoxyribonucleotides or ribonucleotides) and polymers thereof in either single-, double-, or multiple-stranded form, or complements thereof; or nucleosides (e.g., deoxyribonucleosides or ribonucleosides). In embodiments, “nucleic acid” does not include nucleosides. The terms “polynucleotide,” “oligonucleotide,” “oligo,” or the like refer, in the usual and customary sense, to a linear sequence of nucleotides.
[0070] The term “nucleoside” refers to a glycosylamine including a nucleobase and a five- carbon sugar (ribose or deoxyribose). Non-limiting examples include cytidine, uridine, adenosine, guanosine, thymidine, and inosine.
[0071] The term “nucleotide” refers, in the usual and customary sense, to a single unit of a polynucleotide, i.e., a monomer. Nucleotides can be ribonucleotides, deoxyribonucleotides, or modified versions thereof.
[0072] Examples of polynucleotides contemplated herein include single- and double- stranded DNA, single- and double-stranded RNA, and hybrid molecules having mixtures of single- and double-stranded DNA and RNA. Examples of nucleic acids contemplated herein include mRNA, siRNA, miRNA, guide RNA, genomic DNA, plasmid DNA, minicircle DNA, and fragments thereof.
[0073] The term “duplex”, in the context of polynucleotides, refers to double-strandedness.
[0074] Nucleic acids can be linear or branched. For example, nucleic acids can be a linear chain of nucleotides, or can be branched such that they comprise one or more arms or branches of nucleotides, including repetitively branched higher order structures such as dendrimers.
[0075] Nucleic acids, including those with a phosphothioate backbone, can include one or more reactive moieties. As used herein, a reactive moiety includes any functional group capable of reacting with another molecule, for example, through covalent interactions (e.g., amines, thiols, aldehydes) or through strong non-covalent interactions.
[0076] The term “nonspecific sequence” refers to a nucleic acid sequence that contains residues not designed to be complementary to, or only partially complementary to, any other nucleic acid sequence. Attorney Docket No.: 086013-0585293
[0077] The term “antisense nucleic acid” refers to a nucleic acid (e.g., DNA or RNA molecule) that is complementary to at least a portion of a specific target nucleic acid and is capable of reducing transcription, reducing translation, altering transcript splicing, or interfering with the endogenous activity of the target nucleic acid. Antisense nucleic acids may be single- or doublestranded, and non-limiting examples include siRNAs, shRNAs, miRNAs, saRNAs, and snoRNAs.
[0078] The term “complement” refers to a nucleotide or sequence of nucleotides capable of base-pairing with a complementary nucleotide or sequence of nucleotides. Complementarity may be partial or complete.
[0079] The term “promoter sequence” refers to a nucleic acid sequence that directs the initiation of transcription of an operably linked nucleic acid. A promoter sequence functions by providing a binding site for RNA polymerase and, in many cases, additional transcription factors or regulatory proteins. Promoter sequences may be constitutive, inducible, tissue-specific, or viral in origin, and can be naturally occurring, synthetic, or engineered. A promoter sequence may include minimal core elements sufficient for transcription initiation (e.g., a TATA box or initiator element) as well as additional upstream or downstream regulatory elements that modulate the level, timing, or cell-type specificity of transcription.
[0080] Sequences and Variants
[0081] The term “percentage of sequence identity” is determined by comparing two optimally aligned sequences over a comparison window. The number of identical positions is divided by the total number of positions in the window and multiplied by 100 to yield percent identity. As used herein, percentage of sequence identity may refer to miRNA sequences, capsid sequences, ITR sequences, stuffer sequences, or other nucleic acid or amino acid sequences.
[0082] The terms “identical” or percent “identity”, in the context of two or more sequences, refer to sequences that are the same or that share a specified percentage of residues (about 60% or more, e.g., 65-99% or higher) when optimally aligned. Such sequences are said to be “substantially identical.”
[0083] An amino acid or nucleotide base “position” is denoted by a sequential number relative to the N-terminus (for proteins) or 5' end (for nucleic acids) of a reference sequence. Attorney Docket No.: 086013-0585293
[0084] The terms “numbered with reference to” or “corresponding to”, when used in the context of sequence numbering, refer to the numbering of residues of a specified reference sequence when the given sequence is compared to that reference.
[0085] The term “conservatively modified variant” refers to a nucleic acid, peptide, polypeptide, or protein sequence in which one or more residues are substituted with chemically similar residues such that the biological activity is maintained. Examples of conservative substitutions include: Alanine (A), Glycine (G); Aspartic acid (D), Glutamic acid (E); Asparagine (N), Glutamine (Q); Arginine (R), Lysine (K); Isoleucine (I), Leucine (L), Methionine (M), Valine (V); Phenylalanine (F), Tyrosine (Y), Tryptophan (W); Serine (S), Threonine (T); Cysteine (C), Methionine (M).
[0086] Genes and Gene Products
[0087] The term “gene” means a segment of DNA involved in producing a protein. It includes coding regions, leaders, trailers, and introns, as well as regulatory elements necessary for transcription and translation.
[0088] A “protein gene product” is a protein expressed from a particular gene.
[0089] For specific proteins described herein, the named protein includes any of the protein’s naturally occurring forms, variants, or homologs that maintain the activity of the protein. Variants or homologs may share at least 90-100% sequence identity across the whole protein or portions thereof, and may include alleles, polymorphisms, or functional fragments.
[0090] Viruses and Viral Components
[0091] Included herein are “virus” and “virus particles” which can comprise nucleic acid molecules as disclosed herein. Nonlimiting examples include, for example, adenoviruses, adeno- associated viruses (AAV), retroviruses such as lentiviruses, and herpes viruses, vaccinia viruses, alpha viruses, measles virus, Newcastle disease viruses and rhabdoviruses.
[0092] The terms “virus” or “virus particle” refer to a virion comprising a viral genome (DNA or RNA, single- or double-stranded), viral capsid, and associated proteins, and, in the case of enveloped viruses, a lipid envelope.
[0093] The term “adenovirus” refers to a non-enveloped, double-stranded DNA virus of the Adenoviridae family. Adenoviruses are capable of infecting a broad range of dividing and nondividing mammalian cells. The term “adenoviral vector” refers to an engineered adenovirus in Attorney Docket No.: 086013-0585293 which pathogenic genes (e g., El , E3 regions) are deleted and replaced with heterologous nucleic acid sequences of interest. Adenoviral vectors may be replication-deficient or helper-dependent and are capable of efficient transgene delivery in vivo.
[0094] The term “AAV” or “adeno-associated virus” refers to a small, non-enveloped virus of the Parvoviridae family, genus Dependoparvovirus. AAVs contain a single-stranded DNA genome, of about 4.7 kb, flanked by inverted terminal repeats (ITRs), and encode rep and cap genes. Wild-type AAV requires helper virus functions to replicate.
[0095] The term “recombinant AAV” or “rAAV” refers to an engineered AAV in which the rep and / or cap genes are replaced in whole or in part with heterologous nucleic acid sequences of interest, while retaining essential cis-acting elements (e.g., ITRs). Recombinant AAVs are gene transfer vectors capable of packaging into capsids, transducing target cells, and delivering nucleic acid cargo, but lacking autonomous replication capacity.
[0096] The term “capsid” refers to the protein shell of a virus that encases the genome. In AAV, the capsid is composed of VP1, VP2, and VP3 proteins that assemble into an icosahedral structure and mediate attachment, entry, and genome delivery. Capsids may be naturally occurring, engineered, recombinant, chimeric, or modified to alter tropism, stability, or immunogenicity.
[0097] The term “capsid protein” refers to viral structural proteins (e.g., VP1, VP2, VP3 in AAV) that assemble into capsids. Capsid proteins may be naturally occurring or engineered, and may contain substitutions, deletions, insertions, truncations, or fusions.
[0098] The term “inverted terminal repeats” or “ITRs” refers to palindromic DNA sequences at both ends of the AAV genome that fold into hairpin loop structures and function as essential cis- acting elements for replication and packaging of the viral genome, and in some contexts may mediate integration. The term encompasses wild-type, truncated, modified, or synthetic ITRs.
[0099] The term “serotype” refers to a classification of viruses based on antigenic differences in their capsid proteins that determine immune recognition and tissue tropism. In AAV, different serotypes (e.g., AAV1, AAV2, AAV5, AAV8, AAV9) exhibit distinct properties. The term includes naturally occurring, engineered, chimeric, or pseudotyped AAV serotypes. The term “retrovirus” refers to a family of enveloped RNA viruses (Retroviridae) characterized by reverse transcription of their RNA genome into DNA and integration into the host genome. Retroviruses include oncoviruses, spumaviruses, and lentiviruses. The term “retroviral vector” refers to an Attorney Docket No.: 086013-0585293 engineered vector derived from retrovirus genomes, typically murine leukemia virus (MLV) or related strains, in which pathogenic genes are removed and replaced with heterologous nucleic acid cargo. Retroviral vectors retain long terminal repeats (LTRs) and packaging sequences to permit encapsidation and transduction of target cells.
[0100] The term “lentivirus” refers to a genus of retroviruses (family Retroviridae) that are characterized by long incubation periods and the ability to transduce both dividing and nondividing cells. Lentiviruses include human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anemia virus (EIAV), and engineered derivatives thereof. The term “lentiviral vector” refers to an engineered viral vector derived from a lentivirus genome, typically in which accessory and pathogenic genes are removed and replaced with a heterologous nucleic acid sequence of interest. Lentiviral vectors retain essential cis-acting elements (e.g., long terminal repeats, packaging signal) and are capable of transducing mammalian cells in vitro and in vivo. Lentiviral vectors may be pseudotyped with heterologous envelope proteins (e.g., vesicular stomatitis virus G protein, VSV-G) to broaden host range and improve stability.
[0101] The term “herpesvirus” refers to members of the Herpesviridae family, which are large, double-stranded DNA viruses characterized by latent and lytic phases. Examples include herpes simplex virus (HSV), Epstein-Barr virus (EBV), and cytomegalovirus (CMV). The term “herpesvirus vector” refers to an engineered viral vector derived from herpesvirus genomes in which nonessential or pathogenic genes are deleted and replaced with heterologous nucleic acid cargo. Herpesvirus vectors retain essential cis-acting elements necessary for packaging and replication.
[0102] The term “vaccinia virus” refers to a large, enveloped, double-stranded DNA poxvirus that replicates in the cytoplasm of infected cells. The term “vaccinia virus vector” refers to an engineered viral vector derived from vaccinia or other poxvirus backbones in which heterologous nucleic acid sequences are inserted, often into nonessential loci (e.g., thymidine kinase gene), while retaining essential cis-acting elements for packaging and replication. Vaccinia virus vectors are capable of delivering large nucleic acid payloads.
[0103] The term “alphavirus” refers to a genus of positive-sense, single-stranded RNA viruses in the Togaviridae family, including Sindbis virus, Semliki Forest virus (SFV), and Venezuelan equine encephalitis virus (VEEV). Alphavirus vectors are engineered by replacing structural Attorney Docket No.: 086013-0585293 protein genes with heterologous nucleic acid sequences of interest, typically resulting in selfreplicating RNA vectors or replicon particles. Alphavirus vectors are capable of high-level, transient gene expression in mammalian cells.
[0104] The term “measles virus” refers to a negative-sense, single-stranded RNA virus of the Paramyxoviridae family. The term “measles virus vector” refers to an engineered measles virus genome in which heterologous nucleic acid sequences are inserted, typically replacing viral genes, while retaining essential elements for replication and packaging. Measles virus vectors may be engineered for oncolytic applications, vaccination, or gene therapy, and can efficiently infect human cells expressing CD46, SLAM, or Nectin-4 receptors.
[0105] The term “Newcastle disease virus” (NDV) refers to a negative-sense, single-stranded RNA virus of the Paramyxoviridae family that naturally infects avian species. The term “NDV vector” refers to an engineered Newcastle disease virus genome carrying heterologous nucleic acid sequences of interest, typically in place of or in addition to viral genes. NDV vectors are capable of infecting mammalian cells, and may be engineered for oncolytic virotherapy or gene delivery applications.
[0106] The term “rhabdovirus” refers to a family of enveloped, negative-sense, single-stranded RNA viruses (Rhabdoviridae), including vesicular stomatitis virus (VSV). The term “rhabdovirus vector” refers to an engineered rhabdovirus genome in which heterologous nucleic acid sequences of interest are inserted, often replacing viral genes, while retaining essential cis-acting elements necessary for packaging and replication. Rhabdovirus vectors, such as VSV-based vectors, are capable of infecting a wide range of mammalian cells and are used in oncolytic therapy, vaccination, and experimental gene therapy applications.
[0107] MicroRNA-Related Terms
[0108] The term “scaffold backbone”, when used in the context of a microRNA (miRNA), refers to the conserved structural framework of a precursor miRNA that folds into a stem-loop configuration recognized and processed by the microRNA biogenesis machinery (e.g., Drosha, Dicer, RISC). Scaffold backbones include naturally occurring and engineered frameworks (e.g., pri-miRNA or shRNA).
[0109] The term “guide sequence” refers to the strand of a microRNA (miRNA) or artificial miRNA duplex that is incorporated into the RNA-induced silencing complex (RISC) and directs the complex to a complementary target nucleic acid sequence, thereby mediating silencing of the Attorney Docket No.: 086013-0585293 target. The guide sequence is typically derived from one arm of a stem-loop structure within a pri-miRNA or pre-miRNA scaffold.
[0110] The term “passenger sequence” refers to the strand of a microRNA (miRNA) or artificial miRNA duplex that is complementary to the guide sequence and is typically discarded during formation of the active RISC complex. The passenger sequence forms part of the duplex with the guide strand within the scaffold prior to RISC loading and contributes to proper structural folding and processing of the miRNA.
[0111] The terms “scaffold sequence” and “loop scaffold sequence” refer to portions of a pri- miRNA or engineered microRNA scaffold that flank and structurally support the guide and passenger sequences. A scaffold sequence provides stem regions that stabilize the hairpin structure of the precursor miRNA. A loop scaffold sequence refers specifically to the singlestranded loop that connects the two arms of the hairpin and is cleaved during miRNA maturation. Scaffold sequences and loop scaffold sequences may be naturally occurring or engineered, and may be selected or modified to optimize stability, processing, or activity of the guide sequence.
[0112] The term “stuffer sequence” refers to a non-coding or non-functional nucleic acid sequence inserted into a vector, such as an AAV vector genome, for the purpose of adjusting or standardizing the overall length of the vector genome without altering the function of other vector elements. A stuffer sequence does not encode a functional product and does not interfere with expression or processing of other functional sequences contained within the vector.
[0113] The term “retaining activity”, when used in reference to a guide miRNA sequence comprising one or more nucleotide substitutions, such as 1-3 (one, two, or three) or 1-5 (one, two, three, four, or five) substitutions, refers to the ability of the modified sequence to maintain substantially the same biological activity as the corresponding unmodified guide sequence. Retained activity includes, for example, specific hybridization to the intended target nucleic acid, recruitment of the RNA-induced silencing complex (RISC), and downregulation of the target nucleic acid. A guide miRNA is considered to retain activity when it achieves at least about 50%, preferably at least about 70-99% of the activity of the reference guide miRNA under comparable conditions, as measured by assays such as reporter gene silencing, target RNA cleavage, or reduction of target protein expression. Attorney Docket No.: 086013-0585293
[0114] Compositions and Therapeutics
[0115] The term “composition” refers to a mixture comprising at least one active agent (e.g., nucleic acid, polynucleotide, polypeptide, protein, virus, viral vector, small molecule, or cell) in combination with one or more additional components such as carriers, diluents, excipients, stabilizers, buffers, salts, solvents, or delivery vehicles. Compositions may be formulated for research, diagnostic, prophylactic, or therapeutic use, and may be in solution, suspension, emulsion, powder, lyophilized, or other form. In embodiments, a composition is a pharmaceutical composition.
[0116] The term “immunosuppressive agent” refers to any compound, protein, nucleic acid, small molecule, or other therapeutic agent that decreases, inhibits, suppresses, or modulates an immune response in a subject. Examples include corticosteroids, calcineurin inhibitors, mTOR inhibitors, antimetabolites, monoclonal antibodies, cytokine inhibitors, and combinations thereof.
[0117] Nucleic acid molecules of the invention may be delivered to cells by any suitable method. In some embodiments, nucleic acid molecules of the invention are delivered by lipid nanoparticles (LNPs). In some embodiments, nucleic acid molecules of the invention are delivered by viral vectors. Suitable viral vectors include adeno-associated virus (AAV) vectors. In certain embodiments, the viral vector is a modified AAV, such as AAV-DB-3, a peptide- modified AAV1 variant (Leib et al., 2025).
[0118] Diseases and Treatments
[0119] The terms “disease” or “condition” refer to a state of being or health status of a patient or subject capable of being treated with the compositions or methods provided herein.
[0120] The term “repeat expansion disease” refers to a genetic disorder caused by the abnormal expansion of a repeated nucleotide sequence within a gene. Repeat expansion diseases are characterized by dynamic mutations in which the number of repeats exceeds a normal polymorphic range, resulting in pathogenic effects on gene expression, RNA processing, protein translation, or protein function. Repeat expansion diseases include, but are not limited to, disorders caused by trinucleotide, tetranucleotide, pentanucleotide, hexanucleotide, or dodecanucleotide repeat expansions. Non-limiting examples of repeat expansion diseases include Huntington disease, spinal and bulbar muscular atrophy (SBMA), dentatorubral-pallidoluysian atrophy (DRPLA), spinocerebellar ataxia types 1, 2, 3, 6, 7, 8, 10, 12, 17, 31 and 36, fragile X syndrome (FXS), fragile X-associated tremor / ataxia syndrome (FXTAS), FRAXE mental Attorney Docket No.: 086013-0585293 retardation, FRA16A-associated fragile site, myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), Huntington disease-like 2 (HDL2), Fuchs endothelial corneal dystrophy (FECD), Friedreich ataxia, oculopharyngeal muscular dystrophy (OPMD), C9ORF72- mediated frontotemporal dementia / amyotrophic lateral sclerosis (FTD / ALS), Unverricht- Lundborg myoclonic epilepsy (EPM1), and X-linked dystonia-parkinsonism (XDP).
[0121] “Huntington’s Disease” or “HD” refers to a progressive, inherited neurodegenerative disorder caused by an expanded CAG trinucleotide repeat in the HTT gene encoding the huntingtin protein. HD is characterized by abnormal protein aggregation, neuronal dysfunction, and selective neurodegeneration, particularly in the striatum and cortex, leading to motor impairment (e.g., chorea), psychiatric symptoms, and cognitive decline. HD is autosomal dominant and typically manifests in mid-adulthood, though juvenile-onset forms also occur.
[0122] The term “subject” refers to any animal to which the compositions, vectors, nucleic acids, or methods of the present disclosure can be administered. In embodiments, the subject is a mammal. Mammals include, but are not limited to, humans, non-human primates, canines, felines, rodents, bovines, ovines, porcines, and equines. In certain embodiments, the subject is a human. The terms “subject” and “patient” are used interchangeably.
[0123] The terms “treating” or “treatment” refer to the medical management of a disease, disorder, or condition (such as Huntington’s Disease) in a subject, with the intent to achieve a desired beneficial effect. Treating includes, but is not limited to, preventing the onset of disease or symptoms (prophylaxis), inhibiting the progression or worsening of the disease or one or more symptoms, reducing the severity of the disease or one or more symptoms, or ameliorating the disease or one or more symptoms. Treatment may be partial or complete, and may include improvement in one or more measurable parameters, such as reduction of MutS Homolog 3 (MSH3) expression, reduction of CAG repeat instability, improvement of motor function, or delay in disease onset or progression.
[0124] The term “therapeutically effective amount” refers to an amount of a composition, nucleic acid, vector, or agent sufficient to produce a desired therapeutic effect in a subject, including but not limited to inhibition of MSH3 expression or treatment of Huntington’s Disease.
[0125] The terms “administering” or “administered” refer to the act of providing a composition, nucleic acid, vector, cell, or agent of the present disclosure to a subject by any suitable route. Attorney Docket No.: 086013-0585293
[0126] Administration may be systemic, regional, or local, and may be performed once or repeatedly, on an acute or chronic schedule.
[0127] Routes of administration include, without limitation, parenteral (e.g., intravenous, intraarterial (e.g., carotid), intramuscular, intradermal, subcutaneous, intraperitoneal, intracardiac, intraosseous, intracavemous, intracranial, intrathecal, intravitreal, intracerebral, or intracerebroventricular), oral, intranasal, pulmonary, intratracheal, intramucosal, topical, transdermal, rectal, vaginal, intraocular, intraarticular, intratumoral, or direct or indirect administration to an organ or tissuesuch as the brain or central nervous system (CNS). Examples include brain ventricle, parenchyma (intraprenchymal), Globus Pallidus, Caudate Nucleus, Putamen, Thalamus or Substantia Nigra, ventricle (intracerebroventricular, ICV), lateral ventricle, Anterior Horn of the Lateral Ventricle, Body of the Lateral Ventricle, Posterior Horn of the Lateral Ventricle, caudal lateral ventricle, cisterna magna (Intraci sterna magna, ICM), and / or dura matter (Intrathecal, IT).
[0128] “Intravenous” or “intravenously” refers to administration into a vein.
[0129] Adminstration (e.g., intravenous) includes an intact blood brain barrier and a composition, nucleic acid, vector, or agent capable of crossing the blood brain barrier. Adminstration (e.g., intravenous) includes an open blood brain barrier, such as with focused ultrasound to open the blood brain barrier.
[0130] “Intraarterial” or “intraarterially” refers to administration into an artery. One example of an artery is the carotid artery.
[0131] “Intracavity” refers to administration into a body cavity, such as the peritoneal, pleural, pericardial, or cranial cavity.
[0132] “Intramucosal” or “intramucosally” refers to administration into or across a mucosal surface, such as oral, nasal, gastrointestinal, rectal, or urogenital mucosa.
[0133] “Via catheter” refers to administration through a tubular medical device inserted into a body lumen, vessel, cavity, or organ to deliver the composition.
[0134] MicroRNA
[0135] MicroRNAs (miRNAs) are small, single-stranded, non-coding RNA molecules. miRNAs base-pair to complementary sequences in mRNA molecules, thereby silencing post- transcriptional regulation of gene expression. Typically, miRNA molecules silence mRNA Attorney Docket No.: 086013-0585293 translation by cleavage of mRNA strand into two pieces or destabilization of the mRNAby shortening its poly(A) tail. miRNAs resemble small interfering RNAs (siRNAs), however miRNAs derive from regions of RN A transcripts that fold back on themselves to form short hairpins.
[0136] A miRNA in its final form is a non-coding RNA molecule ~22 nucleotides in length. However, it is initially transcribed as part of one arm of an RNA stem-loop that in turn forms part of a several hundred nucleotide-long miRNA precursor termed a primary miRNA transcript (pri- miRNA). Pri-miRNAs have hairpin structures that are processed by the Drosha enzyme (as part of the microprocessor complex). The microprocessor complex functions by recognizing and cleaving near the junction between hairpin structure and ssRNA. After Drosha processing, the pri-miRNAs are only 60-100 nucleotides long, and are called precursor miRNAs (pre-miRNAs).
[0137] At this point, the pre-miRNA is exported to the cytoplasm, where it typically encounters the RNAase enzyme Dicer. Dicer interacts with 5’ and 3’ ends of the hairpin and cuts away the loop joining the 3’ and 5’ arms, resulting in a miRNA:miRNA duplex about 22 nucleotides in length.
[0138] After processing, the duplexed miRNA strands are loaded onto an Argonaute (AGO) protein to form a precursor to an RNA-induced silencing complex (RISC). The complex causes the duplex to unwind and the passenger RNA strand is discarded, leaving behind a mature RISC carrying the mature, single stranded miRNA. The miRNA remains part of the RISC as it silences the expression of its target genes. Overall hairpin length and loop size influence the efficiency of Dicer processing. Although either strand of the duplex may potentially act as a functional miRNA, only one strand is generally incorporated into the RISC where the miRNA and its mRNA target interact.
[0139] A variety of other pathways have been discovered, including Drosha-independent pathways (such as the mirtron pathway, snoRNA-derived pathway, and shRNA-derived pathway) and Dicer-independent pathways (such as one that relies on AGO for cleavage, and another which is dependent on tRNaseZ) miRs using guide strands of the invention may utilize any pre-miR scaffold. For example, the miR scaffold may be a miR-30 microRNA precursor or a scaffold derived from miR-30. miRNA-based therapies, including miRNA inhibition and miRNA replacement, may be used to treat many diseases such as hepatitis C viral infection, muscular dystrophies, Attorney Docket No.: 086013-0585293 neurodegenerative diseases, peripheral neuropathies, chronic heart failure and post-myocardial infarction remodeling and cancers. In addition, miRNA directed regulation of gene expression may improve traditional gene therapy approaches in which the vector payload is a protein coding gene.
[0140] Pri-miR Scaffolds and Exemplary Structural Features
[0141] It is understood that pri-miR scaffolds together with their guide and passenger sequence may form a hairpin loop structure. The hairpin loop structure may be greater than 250 nucleotides in length (for example between 250-270 nucleotides in length). The pri-miR may have the structure, in order, of a first (“upstream”) scaffold sequence, the guide strand sequence, a hairpin loop, a sequence complementary to the guide strand sequence (called a “passenger” strand sequence), and a second (“downstream”) scaffold sequence. The guide strand and passenger strand form a double stranded RNA (dsRNA), with the first and second scaffold sequence being single stranded RNA (sRNA) on either end of the double stranded molecule (referred to as “arms”).
[0142] The passenger strand may be fully complementary to the guide sequence or may have one or more mismatched nucleotides to the guide strand. For example, mismatches or additional nucleotides may result in “bulges” in the pre-miRNA, while maintaining overall hybridization between the guide strand and passenger strand.
[0143] For example, the nucleic acid molecule (e g., pri-miR) may comprise in order: a first scaffold sequence; the guide strand sequence; a loop scaffold sequence; a passenger strand sequence; and a second scaffold sequence.
[0144] It is understood that any pre-miR scaffold, including hairpin loop, first scaffold, and second scaffold sequences may be used together with guide and passenger sequences of the invention. For example, common miR scaffolds may be derived from miR-30 or miR-451.
[0145] Huntington ’s disease and MSH3
[0146] Huntington’s disease (HD) is a neurodegenerative repeat expansion disorder caused by an expansion of the CAG trinucleotide repeat present in exon 1 of the huntingtin (HTT) gene. The expanded repeats result in instability in somatic tissues, resulting in an increase in length over the lifetime of an HD carrier. Although the length of the expanded CAG repeat is the strongest Attorney Docket No.: 086013-0585293 predictor of age at onset and progression, potential genetic modifiers have also been identified, including modifiers within DNA repair genes.
[0147] MutS Homolog 3 (MSH3) is a DNA repair gene, which functions in mismatch repair to maintain genomic stability through detection and repair of the short stretches of mismatched DNA that occur routinely during transcription and replication. MSH3 also plays a role in instability at the HTT CAG repeat tract, a process that may result in or worsen HD-associated neuronal dysfunction.
[0148] Proficient mismatch repair (MMR) in mammalian cells is dependent on the MutS protein homologs MSH2, MSH3, and MSH6. These proteins form heterodimer complexes of either MSH2 and MSH6 (MutSa) or MSH2 and MSH3 (MutSP). The MutSa complex preferentially drives repair of single base mismatches and 1- to4-bp loop-outs. The MutS complex recognizes longer extrusions.
[0149] MutSP may associate with extra-helical DNA structures occurring with higher frequency in highly repetitive sequences such as the HTT CAG. The subsequent aberrant repair attempts by the MMR factors recruited by MutSP may lead to the inclusion of additional repeats in the strand opposing the looped-out DNA upon its resolution Without being limited to a mechanism of action, lowering MSH3 and therefore MutSP slows this process.
[0150] Adeno-associated Virus (AAV) Vectors
[0151] Adeno-associated virus (AAV) is a small nonpathogenic virus of the parvoviridae family. To date, numerous serologically distinct AAV s have been identified, and more than a dozen have been isolated from humans or primates. AAV is distinct from other members of this family by its dependence upon a helper virus for replication.
[0152] AAV genomes can exist in an extrachromosomal state without integrating into host cellular genomes; possess a broad host range; transduce both dividing and non-dividing cells in vitro and in vivo and maintain high levels of transgene expression in the transduced cells. AAV viral particles are heat stable; resistant to solvents, detergents, changes in pH, and temperature; and can be column purified and / or concentrated on CsCl gradients or by other means. The AAV genome comprises a single-stranded deoxyribonucleic acid (ssDNA), either positive- or negative-sensed. The approximately 4.7 kb genome of AAV consists of one segment of single stranded DNA of either plus or minus polarity. The ends of the genome are short inverted Attorney Docket No.: 086013-0585293 terminal repeats (ITRs) that can fold into hairpin structures and serve as the origin of viral DNA replication.
[0153] An AAV vector “genome” (vg) refers to a recombinant nucleic acid sequence that is ultimately packaged or encapsulated to form an AAV particle. An AAV particle often comprises an AAV genome packaged with AAV capsid proteins. In cases where recombinant plasmids are used to construct or manufacture recombinant vectors, the AAV vector genome does not include the portion of the “plasmid” that does not correspond to the vector genome sequence of the recombinant plasmid. This non vector genome portion of the recombinant plasmid is referred to as the “plasmid backbone,” which is important for cloning and amplification of the plasmid, a process that is needed for plasmid propagation and production, but is not itself packaged or encapsulated into viral particles. Thus, an AAV vector “genome” refers to nucleic acid that is packaged or encapsulated by AAV capsid proteins.
[0154] The AAV virion (particle) is a non-enveloped, icosahedral particle approximately 25 nm in diameter that comprises an AAV capsid. The AAV particle comprises an icosahedral symmetry comprised of three related capsid proteins, VP1, VP2 and VP3, which interact together to form the capsid. The genome of most native AAVs often contain two open reading frames (ORFs), sometimes referred to as a left ORF and a right ORF. The right ORF often encodes the capsid proteins VP1, VP2, and VP3. These proteins are often found in a ratio of 1 : 1 : 10 respectively, but may be in varied ratios, and are all derived from the right-hand ORF. The VP1, VP2 and VP3 capsid proteins differ from each other by the use of alternative splicing and an unusual start codon. Deletion analysis has shown that removal or alteration of VP1 which is translated from an alternatively spliced message results in a reduced yield of infectious particles. Mutations within the VP3 coding region result in the failure to produce any single-stranded progeny DNA or infectious particles. In certain embodiments, the genome of an AAV particle encodes one, two or all three VP1, VP2 and VP3 polypeptides.
[0155] The left ORF often encodes the non-structural Rep proteins, Rep 40, Rep 52, Rep 68 and Rep 78, which are involved in regulation of replication and transcription in addition to the production of single-stranded progeny genomes. Two of the Rep proteins have been associated with the preferential integration of AAV genomes into a region of the q arm of human chromosome 19. Rep68 / 78 have been shown to possess NTP binding activity as well as DNA and RNA helicase activities. Some Rep proteins possess a nuclear localization signal as well as Attorney Docket No.: 086013-0585293 several potential phosphorylation sites. In certain embodiments the genome of an AAV (e.g., an rAAV) encodes some or all of the Rep proteins. In certain embodiments the genome of an AAV (e.g., an rAAV) does not encode the Rep proteins. In certain embodiments one or more of the Rep proteins can be delivered in trans and are therefore not included in an AAV particle comprising a nucleic acid encoding a polypeptide.
[0156] The ends of the AAV genome comprise short inverted terminal repeats (ITR) which have the potential to fold into T-shaped hairpin structures that serve as the origin of viral DNA replication. Accordingly, the genome of an AAV comprises one or more (e.g., a pair of) ITR sequences that flank a single stranded viral DNA genome. The ITR sequences often have a length of about 145 bases each. Within the ITR region, two elements have been described which are believed to be central to the function of the ITR, a GAGC repeat motif and the terminal resolution site (trs). The repeat motif has been shown to bind Rep when the ITR is in either a linear or hairpin conformation. This binding is thought to position Rep68 / 78 for cleavage at the trs which occurs in a site- and strand-specific manner. In addition to their role in replication, these two elements appear to be central to viral integration. Contained within the chromosome 19 integration locus is a Rep binding site with an adjacent trs. These elements have been shown to be functional and necessary for locus specific integration.
[0157] The term “recombinant,” as a modifier of vector, such as recombinant viral, e.g., lenti- or parvo-virus (e.g., AAV) vectors, as well as a modifier of sequences such as recombinant nucleic acid sequences and polypeptides, means that the compositions have been manipulated (i.e., engineered) in a fashion that generally does not occur in nature. A particular example of a recombinant vector, such as an AAV, retroviral, or lentiviral vector would be where a nucleic acid sequence that is not normally present in the wild-type viral genome is inserted within the viral genome. An example of a recombinant nucleic acid sequence would be where a nucleic acid (e.g., gene) encodes an inhibitory RNA cloned into a vector, with or without 5’, 3’ and / or intron regions that the gene is normally associated within the viral genome. Although the term “recombinant” is not always used herein in reference to vectors, such as viral vectors, as well as sequences such as polynucleotides, “recombinant” forms including nucleic acid sequences, polynucleotides, transgenes, etc. are expressly included in spite of any such omission.
[0158] A recombinant viral “vector” is derived from the wild type genome of a virus by using molecular methods to remove part of the wild type genome from the virus, and replacing with a Attorney Docket No.: 086013-0585293 non-native nucleic acid, such as a nucleic acid sequence. Typically, for example, for AAV, one or both inverted terminal repeat (ITR) sequences of the AAV genome are retained in the recombinant AAV vector. A “recombinant” viral vector (e.g., rAAV) is distinguished from a viral (e.g., AAV) genome, since part of the viral genome has been replaced with a non-native sequence with respect to the viral genomic nucleic acid such a nucleic acid encoding a transactivator or nucleic acid encoding an inhibitory RNA or nucleic acid encoding a therapeutic protein. Incorporation of such non-native nucleic acid sequences therefore defines the viral vector as a “recombinant” vector, which in the case of AAV can be referred to as a “rAAV vector.”
[0159] In certain embodiments, an AAV (e.g., a rAAV) comprises two ITRs. In certain embodiments, an AAV (e.g., a rAAV) comprises a pair of ITRs. In certain embodiments, an AAV (e.g., a rAAV) comprises a pair of ITRs that flank (i.e., are at each 5’ and 3’ end) of a nucleic acid sequence that at least encodes a polypeptide having function or activity.
[0160] An AAV vector (e.g., rAAV vector) can be packaged and is referred to herein as an “AAV particle” for subsequent infection (transduction) of a cell, ex vivo, in vitro or in vivo. Where a recombinant AAV vector is encapsulated or packaged into an AAV particle, the particle can also be referred to as a “rAAV particle.” In certain embodiments, an AAV particle is a rAAV particle. A rAAV particle often comprises a rAAV vector, or a portion thereof. A rAAV particle can be one or more rAAV particles (e.g., a plurality of AAV particles). rAAV particles typically comprise proteins that encapsulate or package the rAAV vector genome (e.g., capsid proteins). It is noted that reference to a rAAV vector can also be used to reference a rAAV particle.
[0161] Any suitable AAV particle (e.g., rAAV particle) can be used for a method or use herein. A rAAV particle, and / or genome comprised therein, can be derived from any suitable serotype or strain of AAV A rAAV particle, and / or genome comprised therein, can be derived from two or more serotypes or strains of AAV. Accordingly, a rAAV can comprise proteins and / or nucleic acids, or portions thereof, of any serotype or strain of AAV, wherein the AAV particle is suitable for infection and / or transduction of a mammalian cell. Non-limiting examples of AAV serotypes include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-rh74, AAV-rhlO and AAV-2M8.
[0162] In certain embodiments a plurality of rAAV particles comprises particles of, or derived from, the same strain or serotype (or subgroup or variant). In certain embodiments a plurality Attorney Docket No.: 086013-0585293 of rAAV particles comprise a mixture of two or more different rAAV particles (e.g., of different serotypes and / or strains).
[0163] As used herein, the term “serotype” is a distinction used to refer to an AAV having a capsid that is serologically distinct from other AAV serotypes. Serologic distinctiveness is determined on the basis of the lack of cross-reactivity between antibodies to one AAV as compared to another AAV. Such cross-reactivity differences are usually due to differences in capsid protein sequences / antigenic determinants (e.g., due to VP1, VP2, and / or VP3 sequence differences of AAV serotypes). Despite the possibility that AAV variants including capsid variants may not be serologically distinct from a reference AAV or other AAV serotype, they differ by at least one nucleotide or amino acid residue compared to the reference or other AAV serotype.
[0164] In certain embodiments, a rAAV vector based upon a first serotype genome corresponds to the serotype of one or more of the capsid proteins that package the vector. For example, the serotype of one or more AAV nucleic acids (e.g., ITRs) that comprises the AAV vector genome corresponds to the serotype of a capsid that comprises the rAAV particle.
[0165] In certain embodiments, a rAAV vector genome can be based upon an AAV (e.g., AAV2) serotype genome distinct from the serotype of one or more of the AAV capsid proteins that package the vector. For example, a rAAV vector genome can comprise AAV2 derived nucleic acids (e.g., ITRs), whereas at least one or more of the three capsid proteins are derived from a different serotype, e.g., an AAVl, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, RhlO, Rh74 or AAV-2i8 serotype or variant thereof.
[0166] In certain embodiments, a rAAV particle or a vector genome thereof related to a reference serotype has a polynucleotide, polypeptide or subsequence thereof that comprises or consists of a sequence at least 60% or more (e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, etc.) identical to a polynucleotide, polypeptide or subsequence of an AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, RhlO, Rh74 or AAV-2i8 particle. In particular embodiments, a rAAV particle or a vector genome thereof related to a reference serotype has a capsid or ITR sequence that comprises or consists of a sequence at least 60% or more (e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, Attorney Docket No.: 086013-0585293
[0167] 99.4%, 99.5%, etc.) identical to a capsid or ITR sequence of an AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, RhlO, Rh74 or AAV-2i8 serotype.
[0168] In certain embodiments, a method herein comprises use, administration or delivery of an rAAVl, rAAV2, rAAV3, rAAV4, rAAV5, rAAV6, rAAV7, rAAV8, rAAV9, r AAV 10, rAAVll, rAAV12, rRhlO, rRh74 or rAAV-2i8 particle.
[0169] In certain embodiments, a method herein comprises use, administration or delivery of a rAAV2 particle. In certain embodiments a rAAV2 particle comprises an AAV2 capsid. In certain embodiments a rAAV2 particle comprises one or more capsid proteins (e.g., VP1, VP2 and / or VP3) that are at least 60%, 65%, 70%, 75% or more identical, e.g., 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, etc., up to 100% identical to a corresponding capsid protein of a native or wild-type AAV2 particle. In certain embodiments a rAAV2 particle comprises VP1, VP2 and VP3 capsid proteins that are at least 75% or more identical, e.g., 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, etc., up to 100% identical to a corresponding capsid protein of a native or wildtype AAV2 particle. In certain embodiments, a rAAV2 particle is a variant of a native or wildtype AAV2 particle. In some aspects, one or more capsid proteins of an AAV2 variant have 1, 2, 3, 4, 5, 5-10, 10-15, 15-20 or more amino acid substitutions compared to capsid protein(s) of a native or wild-type AAV2 particle.
[0170] In certain embodiments a rAAV9 particle comprises an AAV9 capsid. In certain embodiments a rAAV9 particle comprises one or more capsid proteins (e.g., VP1, VP2 and / or VP3) that are at least 60%, 65%, 70%, 75% or more identical, e.g., 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, etc., up to 100% identical to a corresponding capsid protein of a native or wild-type AAV9 particle. In certain embodiments a rAAV9 particle comprises VP1, VP2 and VP3 capsid proteins that are at least 75% or more identical, e.g., 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, etc., up to 100% identical to a corresponding capsid protein of a native or wildtype AAV9 particle. Attorney Docket No.: 086013-0585293
[0171] In certain embodiments, a rAAV9 particle is a variant of a native or wild-type AAV9 particle. In some aspects, one or more capsid proteins of an AAV9 variant have 1, 2, 3, 4, 5, 5- 10, 10-15, 15-20 or more amino acid substitutions compared to capsid protein(s) of a native or wild-type AAV9 particle.
[0172] In certain embodiments, the rAAV particle comprises a Deep Brain-targeting (DB- targeting) AAV capsid. In certain embodiments, the peptide sequence of the DB-targeting AAV capsid is selected from Table 3. In certain embodiments, the DNA sequence encoding the DB- targeting AAV capsid is selected from Table 3.
[0173] Table 3: Nucleotide and Peptide Sequences of DB-targeting AAV Capsids
[0174] In certain embodiments, a rAAV particle comprises one or two ITRs (e.g., a pair of ITRs) that are at least 75% or more identical, e.g., 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, etc., up to 100% identical to corresponding ITRs of a native or wild-type AAV1, AAV2, Attorney Docket No.: 086013-0585293
[0175] AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-rh74, AAV-rhlO or AAV-2i8, as long as they retain one or more desired ITR functions (e.g., ability to form a hairpin, which allows DNA replication; integration of the AAV DNA into a host cell genome; and / or packaging, if desired).
[0176] In certain embodiments, a rAAV2 particle comprises one or two ITRs (e.g., a pair of ITRs) that are at least 75% or more identical, e.g., 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, etc., up to 100% identical to corresponding ITRs of a native or wild-type AAV2 particle, as long as they retain one or more desired ITR functions (e.g., ability to form a hairpin, which allows DNA replication; integration of the AAV DNA into a host cell genome; and / or packaging, if desired).
[0177] In certain embodiments, a rAAV9 particle comprises one or two ITRs (e.g., a pair of ITRs) that are at least 75% or more identical, e.g., 80%, 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, etc., up to 100% identical to corresponding ITRs of a native or wild-type AAV2 particle, as long as they retain one or more desired ITR functions (e.g., ability to form a hairpin, which allows DNA replication; integration of the AAV DNA into a host cell genome; and / or packaging, if desired).
[0178] A rAAV particle can comprise an ITR having any suitable number of “GAGC” repeats. In certain embodiments an ITR of an AAV2 particle comprises 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more “GAGC” repeats. In certain embodiments a rAAV2 particle comprises an ITR comprising three “GAGC” repeats. In certain embodiments a rAAV2 particle comprises an ITR which has less than four “GAGC” repeats. In certain embodiments a rAAV2 particle comprises an ITR which has more than four “GAGC” repeats. In certain embodiments an ITR of a rAAV2 particle comprises a Rep binding site wherein the fourth nucleotide in the first two “GAGC” repeats is a C rather than a T.
[0179] Exemplary suitable length of DNA can be incorporated in rAAV vectors for packaging / encapsidation into a rAAV particle can about 5 kilobases (kb) or less. In particular, embodiments, length of DNA is less than about 5 kb, less than about 4.5 kb, less than about 4 kb, less than about 3.5 kb, less than about 3 kb, or less than about 2.5 kb. rAAV vectors that include a nucleic acid sequence that directs the expression of an RNAi or polypeptide can be generated using suitable recombinant techniques known in the art (e.g., see Sambrook et al., 1989). Recombinant AAV vectors are typically packaged into transduction- Attorney Docket No.: 086013-0585293 competent AAV particles and propagated using an AAV viral packaging system. A transduction- competent AAV particle is capable of binding to and entering a mammalian cell and subsequently delivering a nucleic acid cargo (e.g., a heterologous gene) to the nucleus of the cell. Thus, an intact rAAV particle that is transduction-competent is configured to transduce a mammalian cell. A rAAV particle configured to transduce a mammalian cell is often not replication competent, and requires additional protein machinery to self-replicate. Thus, a rAAV particle that is configured to transduce a mammalian cell is engineered to bind and enter a mammalian cell and deliver a nucleic acid to the cell, wherein the nucleic acid for delivery is often positioned between a pair of AAV ITRs in the rAAV genome.
[0180] In certain embodiments, the AAV genome sequence comprises any of SEQ ID NOs: 164- 167, which are provided below. In these sequences, the miMSH3 guide strand sequence is shown in bold font.
[0181] SEQ ID NO: 164 - ITR-CAG-miR-30.miMSH3-06-SV40pA-Stuffer-ITR
[0182] CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCC CGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAG AGGGAGTGGCCAACTCCATCACTAGGGGTTCCTACGCGTGTCTGTCTGCACATTTCGT AGAGCGAGTGTTCCGATACTCTAATCTCCCTAGGACTAGTTATTAATAGTAATCAATTA CGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAAT GGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTAT GTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTAC GGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATT GACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGG ACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTG AGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTA TTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGC GCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGT GCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGG CGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCG CTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTG ACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTG TAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTG Attorney Docket No.: 086013-0585293
[0183] AGGGGCTCCGGGAGGGCCCTTTGTGCGGGGGGAGCGGCTCGGGGGGTGCGTGCGTG
[0184] TGTGTGTGCGTGGGGAGCGCCGCGTGCGGCTCCGCGCTGCCCGGCGGCTGTGAGCG
[0185] CTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCAGTGTGCGCGAGGGGAGCGCGG
[0186] CCGGGGGCGGTGCCCCGCGGTGCGGGGGGGGCTGCGAGGGGAACAAAGGCTGCGT
[0187] GCGGGGTGTGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGTCGGTCGGGCTGC
[0188] AACCCCCCCTGCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGCGG
[0189] GGCTCCGTACGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAG
[0190] GTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGG
[0191] GGCGCGGCGGCCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCAT
[0192] TGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCCCAAATCTGTG
[0193] CGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGGGGCGAAG
[0194] CGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCG
[0195] CCGCCGTCCCCTTCTCCCTCTCCAGCCTCGGGGCTGTCCGCGGGGGGACGGCTGCCT
[0196] TCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTA
[0197] GAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTG
[0198] CTGGTTATTGTGCTGTCTCATCATTTTGGCAAAGAATTAAACACGCGTTTAGTGAACC
[0199] GTCAGATGGTACCGTTTAAACTCGAGTGAGCGATGCAGGATGACAGAATTCGAGCTG
[0200] TAAAGCCACAGATGGGTTCGAATTCTGTCATCCTGCACCGCCTACTAGAGCGGCCG
[0201] CCACAGCGGGGAGATCCAGACATGATAAGATACATACGCGTGCCGGCCGCTTCGAGC
[0202] AGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAA
[0203] AAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTG
[0204] CAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAG
[0205] GTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTAAAGATCTCTGTT
[0206] GTTTGGCACAGCTTCCTCCCTCTTGGGTGGGCAAGCTTTTGGAAGAGAAGGCTCCTT
[0207] TGGGTGAGAGTGGGGCACCAAAGTCTTCCCTGTCCCTTCCCCTAGCTTGAGAAGCCC
[0208] TTCTCTATTGTGGACTTTGTGCAATTAGCTTAATTACTAGCTTGAAGTTGACCTTCTGG
[0209] AAATACTTTCTGGTTTAGCCTCACAAGTGAGCAAGGAGGGTTGAGAGTTGTGCTGTG
[0210] AGGATTGTGGGGCCCCAGCTGGCAGCAGGCTCTGGGTCAGGGGGGCAGGGACCAAA
[0211] GGCTTACCTGACAGTGAGGAGGGGTCTAGTAGGGGATCAGTTCCCCTGTTGTTCTTTA
[0212] GAACCTTCTGGATATTCTTCTTCCCTGATTGGGGGTTGTGAACAATAGAATCAACTTCT
[0213] ACTTGTAGATTGATTTAGGGAGAACTTATACCTCAGTTGTTAAGTCACCCTGTCCAGAT Attorney Docket No.: 086013-0585293
[0214] TGTGGGTTGCTTTCCTATTTGTTCAGAACTTTCCCAATTACCTCAGAAGCACTTGAAAT
[0215] TTAAAGGATTTTAACCCCAACTTAGGGATTATTTCACTTAGCTCTTGCACTTTTCTTGA
[0216] TAATTGAATCCTCAGGTATTCCTCTGTTTGGGTTACTAATAGTTACTTCTTTTGGGGGG
[0217] GTTTTCCCCTGAAAATCTTTTATCCCCAATTTGTGGCTTACCCTCTGAAGGTTGTTTGA
[0218] TAATTTTGGAAGATTTGAAAGTCTTCTTATTTTACAAGGTTTGGGGTCTCTTTAAGCTG
[0219] CTTGGTTCTCTTGTCAGCTCCCAAAGCAGAAGAAAGCTAGCTGAAAATTGCAATAGA
[0220] GAAGATACTTCTTTTCCACCTGTTTTCAACTCTTATCTTCTTGAATTTCAGGGCACCTT
[0221] TCCTTGCTCCTAGTGCTTGCTATCTGTTTATTATTTTCCTTCCTGAATACCCTGAACTCC
[0222] AGCTTGTTCTGCTGTAATTCTGGCCTCCCTGGCTTCTTGGACTCCTGTTTCCTTTGCTC
[0223] TGTCTTCCCCCAAGTCAGCTCCTGCTGAACAGCTTCTCAGCTGAAGTGAACCTGGAG
[0224] TGCCTGGATCTTGCTGGATCTTTGAGTATTGCCTCTGGGGTCCTTGGTTCCTTCTGCTG
[0225] AGTTGCTCAGAATCTCCACTCCCCCAACCTTGTGTGGCCCTTCCTGCACTCCTCTGAT
[0226] TCCCCTTGTCTTCCCTGGTTTCTTGCTTTGGTTTAAAGTCTCCACAGAACTTTTGCAGC
[0227] TCTTCTGAAGACCTGGAAGCTTTTTCTTCTTAATTCTCTTCTCTTGACCTCTTTTCCCTT
[0228] CTTTGAGAGCTAGAACTTCCCTTGGTGAACTTCTCTTTCCAGAATTACTTGCCTTCTTT
[0229] TCCCTCCCACTTACCTGTTGTCCAGGAGAGGTCAGATTGCTGTGCTTATTGGAGGAGA
[0230] ACCCTTTCTTCCCTGGGCTCTTCTTCTCACTTGACTTCACCACTTCACCTAATTCCTTG
[0231] GACCCTCAGTGGTGTCACTGCTGGATTTTTCTTTCCTTTGGCTGGCCTTAGGGCACAC
[0232] CCAGGTTGACTAGAATAGTCTTGGTATTTAGATCCACTCACTTTTTCAGTTTCTGTGTC
[0233] TGTCTCTTGCCTGCTTCTGACTTAACCCAGAGAAAGCTTCTCTTTCACAAGGGTTCTT
[0234] AGATTTTTGTTCACTGAGCACCTTCTTTTCTGAGGCAGTGTTTTACCAATAGGGGTTTT
[0235] CCTAGTCAGTCTAACCTTACCTTTCTTGTTGGGCTTGTCTTTGGTCCTGACCCTTTCTC
[0236] TGAGTCTGTAACCCAGAATTGCTGTATAACCCAATTACTTGAAATCCTTTAGAATCTTA
[0237] ACACTTCTTACACCTGATTTCCCCTTTTATTGTATCCAAATTGAACCAACCCTTTGTGA
[0238] ATTTGACAGTGATTTCTCCCAGGGATCCTAGTGTATAAGGAATAGGACTTAGTATTTTC
[0239] TATTGGGGGATATACCACTTACCAGATACTGATTTTGTTGGAGATCTGTGTGTTGGTTT
[0240] TTTGTGTAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGC
[0241] TCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCC
[0242] TCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG
[0243] SEQ ID: 165 - ITR-CAG-miR-30.miMSH3-l l-SV40pA-Stuffer-ITR Attorney Docket No.: 086013-0585293
[0244] CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCC
[0245] CGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAG
[0246] AGGGAGTGGCCAACTCCATCACTAGGGGTTCCTACGCGTGTCTGTCTGCACATTTCGT
[0247] AGAGCGAGTGTTCCGATACTCTAATCTCCCTAGGACTAGTTATTAATAGTAATCAATTA
[0248] CGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAAT
[0249] GGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTAT
[0250] GTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTAC
[0251] GGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATT
[0252] GACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGG
[0253] ACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTG
[0254] AGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTA
[0255] TTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGC
[0256] GCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGT
[0257] GCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGG
[0258] CGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCG
[0259] CTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTG
[0260] ACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTG
[0261] TAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTG
[0262] AGGGGCTCCGGGAGGGCCCTTTGTGCGGGGGGAGCGGCTCGGGGGGTGCGTGCGTG
[0263] TGTGTGTGCGTGGGGAGCGCCGCGTGCGGCTCCGCGCTGCCCGGCGGCTGTGAGCG
[0264] CTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCAGTGTGCGCGAGGGGAGCGCGG
[0265] CCGGGGGCGGTGCCCCGCGGTGCGGGGGGGGCTGCGAGGGGAACAAAGGCTGCGT
[0266] GCGGGGTGTGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGTCGGTCGGGCTGC
[0267] AACCCCCCCTGCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGCGG
[0268] GGCTCCGTACGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAG
[0269] GTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGG
[0270] GGCGCGGCGGCCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCAT
[0271] TGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCCCAAATCTGTG
[0272] CGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGGGGCGAAG
[0273] CGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCG
[0274] CCGCCGTCCCCTTCTCCCTCTCCAGCCTCGGGGCTGTCCGCGGGGGGACGGCTGCCT Attorney Docket No.: 086013-0585293
[0275] TCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTA
[0276] GAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTG
[0277] CTGGTTATTGTGCTGTCTCATCATTTTGGCAAAGAATTAAACACGCGTTTAGTGAACC
[0278] GTCAGATGGTACCGTTTAAACTCGAGTGAGCGTGGGAAATAAATGCCCGGCTTGCTG
[0279] TAAAGCCACAGATGGGTAAGCCGGGCATTTATTTCCCTCGCCTACTAGAGCGGCCG
[0280] CCACAGCGGGGAGATCCAGACATGATAAGATACATACGCGTGCCGGCCGCTTCGAGC
[0281] AGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAA
[0282] AAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTG
[0283] CAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAG
[0284] GTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTAAAGATCTCTGTT
[0285] GTTTGGCACAGCTTCCTCCCTCTTGGGTGGGCAAGCTTTTGGAAGAGAAGGCTCCTT
[0286] TGGGTGAGAGTGGGGCACCAAAGTCTTCCCTGTCCCTTCCCCTAGCTTGAGAAGCCC
[0287] TTCTCTATTGTGGACTTTGTGCAATTAGCTTAATTACTAGCTTGAAGTTGACCTTCTGG
[0288] AAATACTTTCTGGTTTAGCCTCACAAGTGAGCAAGGAGGGTTGAGAGTTGTGCTGTG
[0289] AGGATTGTGGGGCCCCAGCTGGCAGCAGGCTCTGGGTCAGGGGGGCAGGGACCAAA
[0290] GGCTTACCTGACAGTGAGGAGGGGTCTAGTAGGGGATCAGTTCCCCTGTTGTTCTTTA
[0291] GAACCTTCTGGATATTCTTCTTCCCTGATTGGGGGTTGTGAACAATAGAATCAACTTCT
[0292] ACTTGTAGATTGATTTAGGGAGAACTTATACCTCAGTTGTTAAGTCACCCTGTCCAGAT
[0293] TGTGGGTTGCTTTCCTATTTGTTCAGAACTTTCCCAATTACCTCAGAAGCACTTGAAAT
[0294] TTAAAGGATTTTAACCCCAACTTAGGGATTATTTCACTTAGCTCTTGCACTTTTCTTGA
[0295] TAATTGAATCCTCAGGTATTCCTCTGTTTGGGTTACTAATAGTTACTTCTTTTGGGGGG
[0296] GTTTTCCCCTGAAAATCTTTTATCCCCAATTTGTGGCTTACCCTCTGAAGGTTGTTTGA
[0297] TAATTTTGGAAGATTTGAAAGTCTTCTTATTTTACAAGGTTTGGGGTCTCTTTAAGCTG
[0298] CTTGGTTCTCTTGTCAGCTCCCAAAGCAGAAGAAAGCTAGCTGAAAATTGCAATAGA
[0299] GAAGATACTTCTTTTCCACCTGTTTTCAACTCTTATCTTCTTGAATTTCAGGGCACCTT
[0300] TCCTTGCTCCTAGTGCTTGCTATCTGTTTATTATTTTCCTTCCTGAATACCCTGAACTCC
[0301] AGCTTGTTCTGCTGTAATTCTGGCCTCCCTGGCTTCTTGGACTCCTGTTTCCTTTGCTC
[0302] TGTCTTCCCCCAAGTCAGCTCCTGCTGAACAGCTTCTCAGCTGAAGTGAACCTGGAG
[0303] TGCCTGGATCTTGCTGGATCTTTGAGTATTGCCTCTGGGGTCCTTGGTTCCTTCTGCTG
[0304] AGTTGCTCAGAATCTCCACTCCCCCAACCTTGTGTGGCCCTTCCTGCACTCCTCTGAT
[0305] TCCCCTTGTCTTCCCTGGTTTCTTGCTTTGGTTTAAAGTCTCCACAGAACTTTTGCAGC Attorney Docket No.: 086013-0585293
[0306] TCTTCTGAAGACCTGGAAGCTTTTTCTTCTTAATTCTCTTCTCTTGACCTCTTTTCCCTT
[0307] CTTTGAGAGCTAGAACTTCCCTTGGTGAACTTCTCTTTCCAGAATTACTTGCCTTCTTT
[0308] TCCCTCCCACTTACCTGTTGTCCAGGAGAGGTCAGATTGCTGTGCTTATTGGAGGAGA
[0309] ACCCTTTCTTCCCTGGGCTCTTCTTCTCACTTGACTTCACCACTTCACCTAATTCCTTG
[0310] GACCCTCAGTGGTGTCACTGCTGGATTTTTCTTTCCTTTGGCTGGCCTTAGGGCACAC
[0311] CCAGGTTGACTAGAATAGTCTTGGTATTTAGATCCACTCACTTTTTCAGTTTCTGTGTC
[0312] TGTCTCTTGCCTGCTTCTGACTTAACCCAGAGAAAGCTTCTCTTTCACAAGGGTTCTT
[0313] AGATTTTTGTTCACTGAGCACCTTCTTTTCTGAGGCAGTGTTTTACCAATAGGGGTTTT
[0314] CCTAGTCAGTCTAACCTTACCTTTCTTGTTGGGCTTGTCTTTGGTCCTGACCCTTTCTC
[0315] TGAGTCTGTAACCCAGAATTGCTGTATAACCCAATTACTTGAAATCCTTTAGAATCTTA
[0316] ACACTTCTTACACCTGATTTCCCCTTTTATTGTATCCAAATTGAACCAACCCTTTGTGA
[0317] ATTTGACAGTGATTTCTCCCAGGGATCCTAGTGTATAAGGAATAGGACTTAGTATTTTC
[0318] TATTGGGGGATATACCACTTACCAGATACTGATTTTGTTGGAGATCTGTGTGTTGGTTT
[0319] TTTGTGTAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGC
[0320] TCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCC
[0321] TCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG
[0322] SEQ ID: 166 - ITR-CAG-miR-451.miMSH3-06-SV40pA-Stuffer-ITR
[0323] CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCC
[0324] CGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAG
[0325] AGGGAGTGGCCAACTCCATCACTAGGGGTTCCTACGCGTGTCTGTCTGCACATTTCGT
[0326] AGAGCGAGTGTTCCGATACTCTAATCTCCCTAGGACTAGTTATTAATAGTAATCAATTA
[0327] CGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAAT
[0328] GGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTAT
[0329] GTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTAC
[0330] GGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATT
[0331] GACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGG
[0332] ACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTG
[0333] AGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTA
[0334] TTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGC
[0335] GCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGT Attorney Docket No.: 086013-0585293
[0336] GCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGG
[0337] CGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCG
[0338] CTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTG
[0339] ACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTG
[0340] TAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTG
[0341] AGGGGCTCCGGGAGGGCCCTTTGTGCGGGGGGAGCGGCTCGGGGGGTGCGTGCGTG
[0342] TGTGTGTGCGTGGGGAGCGCCGCGTGCGGCTCCGCGCTGCCCGGCGGCTGTGAGCG
[0343] CTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCAGTGTGCGCGAGGGGAGCGCGG
[0344] CCGGGGGCGGTGCCCCGCGGTGCGGGGGGGGCTGCGAGGGGAACAAAGGCTGCGT
[0345] GCGGGGTGTGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGTCGGTCGGGCTGC
[0346] AACCCCCCCTGCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGCGG
[0347] GGCTCCGTACGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAG
[0348] GTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGG
[0349] GGCGCGGCGGCCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCAT
[0350] TGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCCCAAATCTGTG
[0351] CGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGGGGCGAAG
[0352] CGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCG
[0353] CCGCCGTCCCCTTCTCCCTCTCCAGCCTCGGGGCTGTCCGCGGGGGGACGGCTGCCT
[0354] TCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTA
[0355] GAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTG
[0356] CTGGTTATTGTGCTGTCTCATCATTTTGGCAAAGAATTAAACCAGCTCTGGAGCCTGA
[0357] CAAGGAGGACAGGAGAGATGCTGCAAGCCCAAGAAGCTCTCTGCTCAGCCTGTCAC
[0358] AACCTACTGACTGCCAGGGCACTTGGGAATGGCAAGGCTCGAATTCTGTCATCCTG
[0359] CACAGGATGACAGAATTCGACTCTTGCTATACCCAGAAAACGTGCCAGGAAGAGAA
[0360] CTCAGGACCCTGAAGCAGACTACTGGAAGGGAGACTCCAGCTCAAACAAGGCAGGG
[0361] GTGGGGGCGTGGGATTGGGGGTAGGGGAGGGAATAGATACATTTTCTCTTTCCTGTTG
[0362] TAAAGAAATAAAGATAAGCCAGGCACAGTGGCTCACGCCTGTAATCCCACCACTTTC
[0363] AGAGGCCAAGGCAGGAGGATTTCTTGAGCGCCGGCCGCTTCGAGCAGACATGATAA
[0364] GATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTAT
[0365] TTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAG
[0366] TTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGT Attorney Docket No.: 086013-0585293
[0367] TTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTAAAGATCTCTGTTGTTTGGCACAG
[0368] CTTCCTCCCTCTTGGGTGGGCAAGCTTTTGGAAGAGAAGGCTCCTTTGGGTGAGAGT
[0369] GGGGCACCAAAGTCTTCCCTGTCCCTTCCCCTAGCTTGAGAAGCCCTTCTCTATTGTG
[0370] GACTTTGTGCAATTAGCTTAATTACTAGCTTGAAGTTGACCTTCTGGAAATACTTTCTG
[0371] GTTTAGCCTCACAAGTGAGCAAGGAGGGTTGAGAGTTGTGCTGTGAGGATTGTGGGG
[0372] CCCCAGCTGGCAGCAGGCTCTGGGTCAGGGGGGCAGGGACCAAAGGCTTACCTGAC
[0373] AGTGAGGAGGGGTCTAGTAGGGGATCAGTTCCCCTGTTGTTCTTTAGAACCTTCTGGA
[0374] TATTCTTCTTCCCTGATTGGGGGTTGTGAACAATAGAATCAACTTCTACTTGTAGATTG
[0375] ATTTAGGGAGAACTTATACCTCAGTTGTTAAGTCACCCTGTCCAGATTGTGGGTTGCT
[0376] TTCCTATTTGTTCAGAACTTTCCCAATTACCTCAGAAGCACTTGAAATTTAAAGGATTT
[0377] TAACCCCAACTTAGGGATTATTTCACTTAGCTCTTGCACTTTTCTTGATAATTGAATCCT
[0378] CAGGTATTCCTCTGTTTGGGTTACTAATAGTTACTTCTTTTGGGGGGGTTTTCCCCTGA
[0379] AAATCTTTTATCCCCAATTTGTGGCTTACCCTCTGAAGGTTGTTTGATAATTTTGGAAG
[0380] ATTTGAAAGTCTTCTTATTTTACAAGGTTTGGGGTCTCTTTAAGCTGCTTGGTTCTCTT
[0381] GTCAGCTCCCAAAGCAGAAGAAAGCTAGCTGAAAATTGCAATAGAGAAGATACTTCT
[0382] TTTCCACCTGTTTTCAACTCTTATCTTCTTGAATTTCAGGGCACCTTTCCTTGCTCCTA
[0383] GTGCTTGCTATCTGTTTATTATTTTCCTTCCTGAATACCCTGAACTCCAGCTTGTTCTGC
[0384] TGTAATTCTGGCCTCCCTGGCTTCTTGGACTCCTGTTTCCTTTGCTCTGTCTTCCCCCA
[0385] AGTCAGCTCCTGCTGAACAGCTTCTCAGCTGAAGTGAACCTGGAGTGCCTGGATCTT
[0386] GCTGGATCTTTGAGTATTGCCTCTGGGGTCCTTGGTTCCTTCTGCTGAGTTGCTCAGA
[0387] ATCTCCACTCCCCCAACCTTGTGTGGCCCTTCCTGCACTCCTCTGATTCCCCTTGTCTT
[0388] CCCTGGTTTCTTGCTTTGGTTTAAAGTCTCCACAGAACTTTTGCAGCTCTTCTGAAGA
[0389] CCTGGAAGCTTTTTCTTCTTAATTCTCTTCTCTTGACCTCTTTTCCCTTCTTTGAGAGCT
[0390] AGAACTTCCCTTGGTGAACTTCTCTTTCCAGAATTACTTGCCTTCTTTTCCCTCCCACT
[0391] TACCTGTTGTCCAGGAGAGGTCAGATTGCTGTGCTTATTGGAGGAGAACCCTTTCTTC
[0392] CCTGGGCTCTTCTTCTCACTTGACTTCACCACTTCACCTAATTCCTTGGACCCTCAGTG
[0393] GTGTCACTGCTGGATTTTTCTTTCCTTTGGCTGGCCTTAGGGCACACCCAGGTTGACT
[0394] AGAATAGTCTTGGTATTTAGATCCACTCACTTTTTCAGTTTCTGTGTCTGTCTCTTGCC
[0395] TGCTTCTGACTTAACCCAGAGAAAGCTTCTCTTTCACAAGGGTTCTTAGATTTTTGTT
[0396] CACTGAGCACCTTCTTTTCTGAGGCAGTGTTTTACCAATAGGGGTTTTCCTAGTCAGT
[0397] CTAACCTTACCTTTCTTGTTGGGCTTGTCTTTGGTCCTGACCCTTTCTCTGAGTCTGTA Attorney Docket No.: 086013-0585293
[0398] ACCCAGAATTGCTGTATAACCCAATTACTTGAAATCCTTTAGAATCTTAACACTTCTTA
[0399] CACCTGATTTCCCCTTTTATTGTATCCAAATTGAACCAACCCTTTGTGAATTTGACAGT
[0400] GATTTCTCCCAGGGATCCTAGTGTATAAGGAATAGGACTTAGTATTTTCTATTGGGGGA
[0401] TATACCACTTACCAGATACTGATTTTGTTGGAGATCTGTGTGTTGGTTTTTTGTGTAGG
[0402] AACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGG
[0403] CCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGC
[0404] GAGCGAGCGCGCAGCTGCCTGCAGG
[0405] SEQ ID: 167 - ITR-CAG-miR-451.miMSH3-l l-SV40pA-Stuffer-ITR
[0406] CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCC
[0407] CGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAG
[0408] AGGGAGTGGCCAACTCCATCACTAGGGGTTCCTACGCGTGTCTGTCTGCACATTTCGT
[0409] AGAGCGAGTGTTCCGATACTCTAATCTCCCTAGGACTAGTTATTAATAGTAATCAATTA
[0410] CGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAAT
[0411] GGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTAT
[0412] GTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTAC
[0413] GGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATT
[0414] GACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGG
[0415] ACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTG
[0416] AGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTA
[0417] TTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGC
[0418] GCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGT
[0419] GCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGG
[0420] CGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCG
[0421] CTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTG
[0422] ACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTG
[0423] TAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTG
[0424] AGGGGCTCCGGGAGGGCCCTTTGTGCGGGGGGAGCGGCTCGGGGGGTGCGTGCGTG
[0425] TGTGTGTGCGTGGGGAGCGCCGCGTGCGGCTCCGCGCTGCCCGGCGGCTGTGAGCG
[0426] CTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCAGTGTGCGCGAGGGGAGCGCGG
[0427] CCGGGGGCGGTGCCCCGCGGTGCGGGGGGGGCTGCGAGGGGAACAAAGGCTGCGT Attorney Docket No.: 086013-0585293
[0428] GCGGGGTGTGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGTCGGTCGGGCTGC
[0429] AACCCCCCCTGCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGCGG
[0430] GGCTCCGTACGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAG
[0431] GTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGG
[0432] GGCGCGGCGGCCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCAT
[0433] TGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCCCAAATCTGTG
[0434] CGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGGGGCGAAG
[0435] CGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCG
[0436] CCGCCGTCCCCTTCTCCCTCTCCAGCCTCGGGGCTGTCCGCGGGGGGACGGCTGCCT
[0437] TCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTA
[0438] GAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTG
[0439] CTGGTTATTGTGCTGTCTCATCATTTTGGCAAAGAATTAAACCAGCTCTGGAGCCTGA
[0440] CAAGGAGGACAGGAGAGATGCTGCAAGCCCAAGAAGCTCTCTGCTCAGCCTGTCAC
[0441] AACCTACTGACTGCCAGGGCACTTGGGAATGGCAAGGCAAGCCGGGCATTTATTTC
[0442] CCTAAATAAATGCCCGGCTTCTCTTGCTATACCCAGAAAACGTGCCAGGAAGAGAAC
[0443] TCAGGACCCTGAAGCAGACTACTGGAAGGGAGACTCCAGCTCAAACAAGGCAGGGG
[0444] TGGGGGCGTGGGATTGGGGGTAGGGGAGGGAATAGATACATTTTCTCTTTCCTGTTGT
[0445] AAAGAAATAAAGATAAGCCAGGCACAGTGGCTCACGCCTGTAATCCCACCACTTTCA
[0446] GAGGCCAAGGCAGGAGGATTTCTTGAGCGCCGGCCGCTTCGAGCAGACATGATAAG
[0447] ATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATT
[0448] TGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGT
[0449] TAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTT
[0450] TTTTAAAGCAAGTAAAACCTCTACAAATGTGGTAAAGATCTCTGTTGTTTGGCACAGC
[0451] TTCCTCCCTCTTGGGTGGGCAAGCTTTTGGAAGAGAAGGCTCCTTTGGGTGAGAGTG
[0452] GGGCACCAAAGTCTTCCCTGTCCCTTCCCCTAGCTTGAGAAGCCCTTCTCTATTGTGG
[0453] ACTTTGTGCAATTAGCTTAATTACTAGCTTGAAGTTGACCTTCTGGAAATACTTTCTGG
[0454] TTTAGCCTCACAAGTGAGCAAGGAGGGTTGAGAGTTGTGCTGTGAGGATTGTGGGGC
[0455] CCCAGCTGGCAGCAGGCTCTGGGTCAGGGGGGCAGGGACCAAAGGCTTACCTGACA
[0456] GTGAGGAGGGGTCTAGTAGGGGATCAGTTCCCCTGTTGTTCTTTAGAACCTTCTGGAT
[0457] ATTCTTCTTCCCTGATTGGGGGTTGTGAACAATAGAATCAACTTCTACTTGTAGATTGA
[0458] TTTAGGGAGAACTTATACCTCAGTTGTTAAGTCACCCTGTCCAGATTGTGGGTTGCTT Attorney Docket No.: 086013-0585293
[0459] TCCTATTTGTTCAGAACTTTCCCAATTACCTCAGAAGCACTTGAAATTTAAAGGATTTT AACCCCAACTTAGGGATTATTTCACTTAGCTCTTGCACTTTTCTTGATAATTGAATCCT
[0460] CAGGTATTCCTCTGTTTGGGTTACTAATAGTTACTTCTTTTGGGGGGGTTTTCCCCTGA
[0461] AAATCTTTTATCCCCAATTTGTGGCTTACCCTCTGAAGGTTGTTTGATAATTTTGGAAG
[0462] ATTTGAAAGTCTTCTTATTTTACAAGGTTTGGGGTCTCTTTAAGCTGCTTGGTTCTCTT
[0463] GTCAGCTCCCAAAGCAGAAGAAAGCTAGCTGAAAATTGCAATAGAGAAGATACTTCT TTTCCACCTGTTTTCAACTCTTATCTTCTTGAATTTCAGGGCACCTTTCCTTGCTCCTA
[0464] GTGCTTGCTATCTGTTTATTATTTTCCTTCCTGAATACCCTGAACTCCAGCTTGTTCTGC
[0465] TGTAATTCTGGCCTCCCTGGCTTCTTGGACTCCTGTTTCCTTTGCTCTGTCTTCCCCCA AGTCAGCTCCTGCTGAACAGCTTCTCAGCTGAAGTGAACCTGGAGTGCCTGGATCTT
[0466] GCTGGATCTTTGAGTATTGCCTCTGGGGTCCTTGGTTCCTTCTGCTGAGTTGCTCAGA
[0467] ATCTCCACTCCCCCAACCTTGTGTGGCCCTTCCTGCACTCCTCTGATTCCCCTTGTCTT
[0468] CCCTGGTTTCTTGCTTTGGTTTAAAGTCTCCACAGAACTTTTGCAGCTCTTCTGAAGA
[0469] CCTGGAAGCTTTTTCTTCTTAATTCTCTTCTCTTGACCTCTTTTCCCTTCTTTGAGAGCT AGAACTTCCCTTGGTGAACTTCTCTTTCCAGAATTACTTGCCTTCTTTTCCCTCCCACT
[0470] TACCTGTTGTCCAGGAGAGGTCAGATTGCTGTGCTTATTGGAGGAGAACCCTTTCTTC
[0471] CCTGGGCTCTTCTTCTCACTTGACTTCACCACTTCACCTAATTCCTTGGACCCTCAGTG
[0472] GTGTCACTGCTGGATTTTTCTTTCCTTTGGCTGGCCTTAGGGCACACCCAGGTTGACT
[0473] AGAATAGTCTTGGTATTTAGATCCACTCACTTTTTCAGTTTCTGTGTCTGTCTCTTGCC TGCTTCTGACTTAACCCAGAGAAAGCTTCTCTTTCACAAGGGTTCTTAGATTTTTGTT CACTGAGCACCTTCTTTTCTGAGGCAGTGTTTTACCAATAGGGGTTTTCCTAGTCAGT CTAACCTTACCTTTCTTGTTGGGCTTGTCTTTGGTCCTGACCCTTTCTCTGAGTCTGTA ACCCAGAATTGCTGTATAACCCAATTACTTGAAATCCTTTAGAATCTTAACACTTCTTA CACCTGATTTCCCCTTTTATTGTATCCAAATTGAACCAACCCTTTGTGAATTTGACAGT GATTTCTCCCAGGGATCCTAGTGTATAAGGAATAGGACTTAGTATTTTCTATTGGGGGA TATACCACTTACCAGATACTGATTTTGTTGGAGATCTGTGTGTTGGTTTTTTGTGTAGG AACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGG CCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGC
[0474] GAGCGAGCGCGCAGCTGCCTGCAGG
[0475] Suitable host cells for producing transduction-competent AAV particles include but are not limited to microorganisms, yeast cells, insect cells, and mammalian cells that can be, or have Attorney Docket No.: 086013-0585293 been, used as recipients of a heterologous rAAV vectors. Cells from the stable human cell line, HEK293 (readily available through, e.g., the American Type Culture Collection under Accession Number ATCC CRL1573) can be used. In certain embodiments a modified human embryonic kidney cell line (e.g., HEK293), which is transformed with adenovirus type-5 DNA fragments, and expresses the adenoviral Ela and Elb genes is used to generate recombinant AAV particles. The modified HEK293 cell line is readily transfected, and provides a particularly convenient platform in which to produce rAAV particles. Methods of generating high titer AAV particles capable of transducing mammalian cells are known in the art. For example, AAV particle can be made as set forth in Wright, 2008 and Wright, 2009.
[0476] In certain embodiments, AAV helper functions are introduced into the host cell by transfecting the host cell with an AAV helper construct either prior to, or concurrently with, the transfection of an AAV expression vector. AAV helper constructs are thus sometimes used to provide at least transient expression of AAV rep and / or cap genes to complement missing AAV functions necessary for productive AAV transduction. AAV helper constructs often lack AAV ITRs and can neither replicate nor package themselves. These constructs can be in the form of a plasmid, phage, transposon, cosmid, virus, or virion. A number of AAV helper constructs have been described, such as the commonly used plasmids pAAV / Ad and pIM29+45 which encode both Rep and Cap expression products. A number of other vectors are known which encode Rep and / or Cap expression products.
[0477] An “expression vector” is a specialized vector that contains a gene or nucleic acid sequence with the necessary regulatory regions needed for expression in a host cell. An expression vector may contain at least an origin of replication for propagation in a cell and optionally additional elements, such as a heterologous nucleic acid sequence, expression control element (e.g., a promoter, enhancer), intron, ITR(s), and polyadenylation signal.
[0478] Exemplary AAV vectors that may be used with miRNAs of the invention are described in U.S. Pat. Pub. No. 2023-0346981, U.S. Pat. Pub. No. 2024-0100194, and U.S. Pat. Pub. No. 2024-0197920. incorporated by reference herein.
[0479] Pharmaceutical Composition
[0480] Some embodiments of the invention may include any acceptable form of providing the AAV vector to a subject. For example, the AAV vector may be provided to the subject in the form of a composition or formulation comprising the AAV vector. The expression vector of this Attorney Docket No.: 086013-0585293 invention can be formulated and administered to treat a variety of disease states by any means that produces contact of the active ingredient with the agent’s site of action in the body of the subject. The compositions, polynucleotides, polypeptides, particles, cells, vector systems and combinations thereof described herein can be contained in a formulation, such as a pharmaceutical formulation. In some embodiments, the formulations can be used to generate polypeptides and other particles that include one or more muscle-specific targeting moieties described herein. In some embodiments, the formulations can be delivered to a subject in need thereof. In some embodiments, component(s) of the engineered AAV capsid system, engineered cells, engineered AAV capsid particles, and / or combinations thereof described herein can be included in a formulation that can be delivered to a subject or a cell. In some embodiments, the formulation is a pharmaceutical formulation. One or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein can be provided to a subject in need thereof or a cell alone or as an active ingredient, such as in a pharmaceutical formulation. As such, also described herein are pharmaceutical formulations containing an amount of one or more of the polypeptides, polynucleotides, vectors, cells, or combinations thereof described herein. In some embodiments, the pharmaceutical formulation can contain an effective amount of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein. The pharmaceutical formulations described herein can be administered to a subject in need thereof or a cell.
[0481] In some embodiments, the amount of the one or more of the polypeptides, polynucleotides, vectors, cells, virus particles, nanoparticles, other delivery particles, and combinations thereof described herein contained in the pharmaceutical formulation can range from about 1 pg / kg to about 10 mg / kg based upon the body weight of the subject in need thereof or average body weight of the specific patient population to which the pharmaceutical formulation can be administered. The amount of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein in the pharmaceutical formulation can range from about 1 pg to about 10 g, from about 10 nL to about 10 ml. In embodiments where the pharmaceutical formulation contains one or more cells, the amount can range from about 1 cell to 1 x 101, 1 x 102, 1 x 103, 1 x 104, 1 x 105, 1 x 106, 1 x 107, 1 x 108, 1 x 109, 1 x 1010or more cells. In embodiments where the pharmaceutical formulation contains one Attorney Docket No. : 086013-0585293 or more cells, the amount can range from about 1 cell to 1 x 101, 1 x 102, 1 x 103, 1 x 104, 1 x 105, 1 x 106, 1 x 107, 1 x 108, 1 x 109, 1 x IO10or more cells per nL, pL, mb, or L.
[0482] In embodiments, were engineered AAV capsid particles are included in the formulation, the formulation can contain 1 t o 1 x 102, 1 x 103, 1 x 104, 1 x 105, 1 x 106, 1 x 107, 1 x 108, 1 x 109, 1 x IO10, 1 x 1011, 1 x 1012, 1 x 1013, 1 x IO14, 1 x 1015, 1 x 1016, 1 x 1017, 1 x 1018, 1 x 1019, or 1 x IO20transducing units (TU) / mL of the engineered AAV capsid particles. In some embodiments, the formulation can be 0. 1 to 100 mb in volume and can contain 1 to 1 x 102, 1 x 103, 1 x 104, 1 x 105, 1 x 106, 1 x 107, 1 x 108, 1 x 109, 1 x IO10, 1 x 1011, 1 x 1012, 1 x 1013, 1 x 1014, 1 x 1013, 1 x 1016, 1 x 1017, 1 x 1018, 1 x 1019, or 1 x IO20transducing units (TU) / mL of the engineered AAV capsid particles.
[0483] Pharmaceutically Acceptable Carriers and Auxiliary Ingredients and Agents
[0484] In embodiments, the pharmaceutical formulation containing an amount of one or more of the polypeptides, polynucleotides, vectors, cells, virus particles, nanoparticles, other delivery particles, and combinations thereof described herein can further include a pharmaceutically acceptable carrier. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, gum arabic, vegetable oils, benzyl alcohols, polyethylene glycols, gelatin, carbohydrates such as lactose, amylose or starch, magnesium stearate, talc, silicic acid, viscous paraffin, perfume oil, fatty acid esters, hydroxy methylcellulose, and polyvinyl pyrrolidone, which do not deleteriously react with the active composition.
[0485] The pharmaceutical formulations can be sterilized, and if desired, mixed with auxiliary agents, such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, flavoring and / or aromatic substances, and the like which do not deleteriously react with the active composition.
[0486] In some embodiments, the pharmaceutical formulations described herein may be in a dosage form. The dosage forms can be adapted for administration by any appropriate route. Appropriate routes include, but are not limited to, oral (including buccal or sublingual), rectal, epidural, intracranial, intraocular, inhaled, intranasal, topical (including buccal, sublingual, or transdermal), vaginal, intraurethral, parenteral, intracranial, subcutaneous, intramuscular, intravenous, intraperitoneal, intradermal, intraosseous, intracardiac, intraarticular, intracavernous, intrathecal, intravitreal, intracerebral, gingival, subgingival, Attorney Docket No.: 086013-0585293 intracerebroventricular, and intradermal. Such formulations may be prepared by any method known in the art.
[0487] Dosage forms adapted for oral administration can be discrete dosage units such as capsules, pellets or tablets, powders or granules, solutions, or suspensions in aqueous or nonaqueous liquids; edible foams or whips, or in oil-in-water liquid emulsions or water-in-oil liquid emulsions. In some embodiments, the pharmaceutical formulations adapted for oral administration also include one or more agents which flavor, preserve, color, or help disperse the pharmaceutical formulation. Dosage forms prepared for oral administration can also be in the form of a liquid solution that can be delivered as foam, spray, or liquid solution. In some embodiments, the oral dosage form can contain about 1 ng to 1000 g of a pharmaceutical formulation containing a therapeutically effective amount or an appropriate fraction thereof of the targeted effector fusion protein and / or complex thereof or composition containing the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein. The oral dosage form can be administered to a subject in need thereof.
[0488] Where appropriate, the dosage forms described herein can be microencapsulated.
[0489] The dosage form can also be prepared to prolong or sustain the release of any ingredient. In some embodiments, the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein can be the ingredient whose release is delayed. In other embodiments, the release of an optionally included auxiliary ingredient is delayed. Suitable methods for delaying the release of an ingredient include, but are not limited to, coating or embedding the ingredients in material in polymers, wax, gels, and the like. Delayed release dosage formulations can be prepared as described in standard references such as “Pharmaceutical dosage form tablets,” eds. Liberman et. al. (New York, Marcel Dekker, Inc., 1989), “Remington - The science and practice of pharmacy”, 20th ed., Lippincott Williams & Wilkins, Baltimore, MD, 2000, and “Pharmaceutical dosage forms and drug delivery systems”, 6th Edition, Ansel et al., (Media, PA: Williams and Wilkins, 1995). These references provide information on excipients, materials, equipment, and processes for preparing tablets and capsules and delayed release dosage forms of tablets and pellets, capsules, and granules. The delayed release can be anywhere from about an hour to about 3 months or more.
[0490] Examples of suitable coating materials include, but are not limited to, cellulose polymers such as cellulose acetate phthalate, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, Attorney Docket No.: 086013-0585293 hydroxypropyl methylcellulose phthalate, and hydroxypropyl methyl cellulose acetate succinate; polyvinyl acetate phthalate, acrylic acid polymers and copolymers, and methacrylic resins that are commercially available under the trade name EUDRAGIT® (Roth Pharma, Westerstadt, Germany), zein, shellac, and polysaccharides.
[0491] Coatings may be formed with a different ratio of water-soluble polymer, water insoluble polymers, and / or pH dependent polymers, with or without water insoluble / water soluble non- polymeric excipient, to produce the desired release profde. The coating is either performed on the dosage form (matrix or simple) which includes, but is not limited to, tablets (compressed with or without coated beads), capsules (with or without coated beads), beads, particle and compositions, formulated as, but not limited to, suspension form or as a sprinkle dosage form.
[0492] Dosage forms adapted for topical administration can be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols, or oils. In some embodiments for treatments of the eye or other external tissues, for example the mouth or the skin, the pharmaceutical formulations are applied as a topical ointment or cream. When formulated in an ointment, the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein can be formulated with a paraffinic or water-miscible ointment base. In some embodiments, the active ingredient can be formulated in a cream with an oil-in-water cream base or a water-in-oil base. Dosage forms adapted for topical administration in the mouth include lozenges, pastilles, and mouth washes.
[0493] Dosage forms adapted for nasal or inhalation administration include aerosols, solutions, suspension drops, gels, or dry powders. In some embodiments, the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein is contained in a dosage form adapted for inhalation is in a particle-size-reduced form that is obtained or obtainable by micronization. In some embodiments, the particle size of the size reduced (e.g., micronized) compound or salt or solvate thereof, is defined by a D50 value of about 0.5 to about 10 microns as measured by an appropriate method known in the art. Dosage forms adapted for administration by inhalation also include particle dusts or mists. Suitable dosage forms wherein the carrier or excipient is a liquid for administration as a nasal spray or drops include aqueous or oil solutions / suspensions of an active ingredient (e.g., the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein Attorney Docket No.: 086013-0585293 and / or auxiliary active agent), which may be generated by various types of metered dose pressurized aerosols, nebulizers, or insufflators.
[0494] In some embodiments, the dosage forms can be aerosol formulations suitable for administration by inhalation. In some of these embodiments, the aerosol formulation can contain a solution or fine suspension of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein and a pharmaceutically acceptable aqueous or non-aqueous solvent. Aerosol formulations can be presented in single or multi-dose quantities in sterile form in a sealed container. For some of these embodiments, the sealed container is a single dose or multi-dose nasal, or an aerosol dispenser fitted with a metering valve (e.g., metered dose inhaler), which is intended for disposal once the contents of the container have been exhausted.
[0495] Where the aerosol dosage form is contained in an aerosol dispenser, the dispenser contains a suitable propellant under pressure, such as compressed air, carbon dioxide, or an organic propellant, including but not limited to a hydrofluorocarbon. The aerosol formulation dosage forms in other embodiments are contained in a pump-atomizer. The pressurized aerosol formulation can also contain a solution or a suspension of one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein. In further embodiments, the aerosol formulation can also contain co-solvents and / or modifiers incorporated to improve, for example, the stability and / or taste and / or fine particle mass characteristics (amount and / or profile) of the formulation. Administration of the aerosol formulation can be once daily or several times daily, for example 2, 3, 4, or 8 times daily, in which 1, 2, or 3 doses are delivered each time.
[0496] For some dosage forms suitable and / or adapted for inhaled administration, the pharmaceutical formulation is a dry powder inhalable formulation. In addition to the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein, an auxiliary active ingredient, and / or pharmaceutically acceptable salt thereof, such a dosage form can contain a powder base such as lactose, glucose, trehalose, mannitol, and / or starch. In some of these embodiments, the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein is in a particle-size reduced form. In further embodiments, a performance modifier, such as L-leucine or another amino acid, cellobiose octaacetate, and / or metals salts of stearic acid, such as magnesium or calcium stearate. Attorney Docket No.: 086013-0585293
[0497] In some embodiments, the aerosol dosage forms can be arranged so that each metered dose of aerosol contains a predetermined amount of an active ingredient, such as the one or more of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein.
[0498] Dosage forms adapted for vaginal administration can be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulations. Dosage forms adapted for rectal administration include suppositories or enemas.
[0499] Dosage forms adapted for parenteral administration and / or adapted for any type of injection (e.g. intravenous, intraperitoneal, subcutaneous, intramuscular, intradermal, intraosseous, epidural, intracardiac, intraarticular, intracavernous, gingival, subgingival, intrathecal, intravitreal, intracerebral, and intracerebroventricular) can include aqueous and / or non-aqueous sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, solutes that render the composition isotonic with the blood of the subject, and aqueous and nonaqueous sterile suspensions, which can include suspending agents and thickening agents. The dosage forms adapted for parenteral administration can be presented in a single- unit dose or multi-unit dose containers, including but not limited to sealed ampoules or vials. The doses can be lyophilized and resuspended in a sterile carrier to reconstitute the dose prior to administration. Extemporaneous injection solutions and suspensions can be prepared in some embodiments, from sterile powders, granules, and tablets.
[0500] Dosage forms adapted for ocular administration can include aqueous and / or nonaqueous sterile solutions that can optionally be adapted for injection, and which can optionally contain anti-oxidants, buffers, bacteriostats, solutes that render the composition isotonic with the eye or fluid contained therein or around the eye of the subject, and aqueous and nonaqueous sterile suspensions, which can include suspending agents and thickening agents.
[0501] For some embodiments, the dosage form contains a predetermined amount of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein per unit dose. In some embodiments, the predetermined amount of the Such unit doses may therefore be administered once or more than once a day. Such pharmaceutical formulations may be prepared by any of the methods well known in the art.
[0502] Experimental examples Attorney Docket No.: 086013-0585293
[0503] In vitro miRNA MSH3 knockdown candidate screen miRNAs targeting human MSH3 (miMSH3) were identified using siSPOTR, a bioinformatics tool for design of highly specific and potent miRNA sequences, resulting in the identification of 608 miRNA sequences. Top candidate miRNA sequences predicted to have low off target potential were identified as candidates with potential off target scores (POTS) under 200. Homology between non-human primate (NHP - African green) and mouse MSH3 transcripts was analyzed to assess cross species miRNA compatibility. 29 artificial miRNA sequences were identified as lead candidates for further validation (Table 4).
[0504] POTS analysis of the 29 candidates is shown in Table 4 below:
[0505] Table 4: MSH3 RNAi off-target probability Attorney Docket No.: 086013-0585293
[0506] *POTS - probability of off-target score
[0507] Candidate miMSH3 guide and passenger sequences were engineered into a miR-30 scaffold. Candidates were designed and cloned together with a luciferase reporter plasmid.
[0508] FIG. 1 shows a graph of results from an in vitro dual-luciferase knockdown assay of guides sequences of the invention.
[0509] A dual -luciferase screen of 29 miRNAs in HEK293 cells for knockdown by the guide strand was conducted. Renilla luciferase signal was normalized to the Firefly luciferase signal and plotted relative to miSAFE (non-targeting control). A positive control miRNA referred to as miHDSl that targets HTT mRNAwas included. N=3 independent experiments, each shown as an individual dot, are plotted as mean and error bars represent standard deviation.
[0510] 6 lead candidates (miMSH3-05, miMSH3-06, miMSH3-07, miMSH3-09, miMSH3-ll, and miMSH3-25) were identified together with 3 additional low potency sequences (miMSH3- 12, miMSH3-15, miMSH3-21) for additional screening (9 total sequences).
[0511] A second dual-luciferase screen was conducted of the 9 sequences in HEK293 cells for knockdown by the passenger strand.
[0512] FIG. 2 shows a graph of results from the in vitro dual-luciferase knockdown assay of passenger sequences of the invention.
[0513] In vitro miRNA endogenous MSH3 knockdown Attorney Docket No.: 086013-0585293
[0514] FIG. 3A shows a graph of results from the in vitro knockdown of endogenous human MSH3 mRNAin human HEK293 cells.
[0515] RT-qPCR was used with primer probe sets targeting human MSH3 and GAPDH after plasmid transfection of miMSH3 sequences in the miR-30 backbone in HEK293 cells and total RNA isolation. MSH3 was normalized to GAPDH and plotted relative to miSAFE (non-targeting control). A positive control miRNA referred to as miHDS 1 that targets HTT mRNA was included. N=3 independent experiments, each shown as an individual dot, are plotted as the mean and error bars represent standard deviation. The results demonstrated miMSH3 knockdown of endogenous human MSH3 mRNA.
[0516] FIG. 3B shows a graph of results from the in vitro knockdown of endogenous human MSH3 protein in HEK293 cells.
[0517] Western blot for human MSH3 and ACTB protein was preformed after plasmid transfection of miMSH3 sequences in the miR-30 backbone and protein isolation with RIPA buffer. BCA was used to quantify total protein concentrations. MSH3 was normalized to ACT-B and plotted relative to miSAFE (non-targeting control). Non-transfection control (NTC) was included as control for no plasmid treatment. N=3 independent experiments, each shown as an individual dot, are plotted as the mean and error bars represent standard deviation. The results demonstrated miMSH3 knockdown of endogenous human MSH3 protein.
[0518] FIG. 4A shows a graph of results from the in vitro knockdown of endogenous mouse Msh3 mRNA in mouse N2a cells.
[0519] RT-qPCR was used with primer probe sets targeting mouse Msh3 and ActB after plasmid transfection of miMSH3 sequences in the miR-30 backbone and total RNA isolation. Msh3 was normalized to ActB and plotted relative to miSAFE (non-targeting control). A positive control miRNA referred to as miHDS 1 that targets HTT mRNA was included. N=3 independent experiments, each shown as an individual dot, are plotted as the mean and error bars represent standard deviation. The results demonstrated miMSH3 knockdown of endogenous mouse Msh3 mRNA.
[0520] FIG. 4B shows a graph of results from the in vitro knockdown of endogenous mouse Msh3 protein in mouse N2a cells.
[0521] Western blot for mouse Msh3 and ActB protein was preformed after plasmid transfection of miMSH3 sequences in the miR-30 backbone and protein isolation with RIPA buffer. BCA was Attorney Docket No.: 086013-0585293 used to quantify total protein concentrations. Msh3 was normalized to ActB and plotted relative to miSAFE (non-targeting control). Non-transfection control (NTC) was included as control for no plasmid treatment. N=3 independent experiments, each shown as an individual dot, are plotted as the mean and error bars represent standard deviation. The results demonstrated miMSH3 knockdown of endogenous mouse Msh3 protein.
[0522] FIG. 5A shows a graph of results from the in vitro knockdown of endogenous human MSH3 mRNAin human HEK293 cells with lead miMSH3 candidates embedded in the miR-30 scaffold backbone after GFP positive transfected cell selection.
[0523] RT-qPCR was used with primer probe sets targeting human MSH3 and GAPDH after plasmid transfection of miMSH3 sequences in the miR-30 backbone in HEK293 cells, sorting for GFP+ cells, and total RNA isolation. MSH3 was normalized to GAPDH and plotted relative to miSAFE (non-targeting control). A positive control miRNA referred to as miHDSl that targets HTT mRNA was included. N=3 independent experiments, each shown as an individual dot, are plotted as the mean and error bars represent standard deviation. The results demonstrated miMSH3 knockdown of endogenous human MSH3 mRNA using miMSH3 embedded in the miR-30 scaffold backbone.
[0524] FIG. 5B shows a graph of results from the in vitro knockdown of endogenous human MSH3 mRNAin human HEK293 cells with lead miMSH3 candidates embedded in the miR-451 scaffold backbone after GFP positive transfected cell selection.
[0525] RT-qPCR was used with primer probe sets targeting human MSH3 and GiAPDH after plasmid transfection of miMSH3 sequences in the miR-451 scaffold backbone in HEK293 cells, sorting for GFP+ cells, and total RNA isolation. MSH3 was normalized to GAPDH and plotted relative to miSAFE (non-targeting control). A positive control miRNA referred to as miH12 that targets HTT mRNA was included. N=3 independent experiments, each shown as an individual dot, are plotted as the mean and error bars represent standard deviation. The results demonstrated miMSH3 knockdown of endogenous human MSH3 mRNA using miMSH3 embedded in the miR-451 scaffold backbone.
[0526] In vivo Msh3 knockdown after AAV-DB-3 delivered miRNA in miR-30 and miR-451 backbones in wildtype mice
[0527] FIG. 6 shows a schematic of the AAV vector genomes with the WT AAV2 ITR sequences at the 5’ and 3’ ends, the ubiquitous CAG promoter, miMSH3-06 or miMSH3-ll embedded in Attorney Docket No.: 086013-0585293 the miR-30 or miR-451 scaffold backbones, SV40 polyadenylation (pA) signal, and a stuffer sequence to ensure packaging of full-length genomes. These AAV constructs were used for in vivo testing in animal models.
[0528] FIG. 7 shows a graph of results from the in vivo knockdown of endogenous mouse Msh3 mRNA in wildtype C57B16 / J mouse striatum after AAV-mediated delivery of miMSH3.
[0529] RT-qPCR was used with primer probe sets targeting mouse Msh3 and ActB after intrastriatal injection of vehicle (vector saline buffer), or 5el0 vector genomes (vg) or 1 el 1 vg of miMSH3-06 or miMSH3-ll sequences in the miR-30 backbone or miR-451 backbone packaged into AAV-DB-3 capsid, an AAV1 peptide modified variant. Msh3 was normalized to ActB and plotted relative to vehicle control animals. N=3 mice per group shown as an individual dots, plotted as the mean and error bars represent standard deviation. A vehicle control animal was an outlier and removed from the analysis. The results demonstrated AAV-mediated miMSH3 knockdown of endogenous mouse Msh3 mRNA in the striatum of wildtype mice using miMSH3 embedded in the miR-30 and miR-451 scaffold backbones.
[0530] In vivo AAV-DB-3 delivered miMSH3-ll in the HdhQlll knock-in mouse model of HD
[0531] FIG. 8A shows a graph of results from the in vivo biodistribution of AAV-DB- 3.miR30.miMSH3-ll in HdhQl ll mice after intrastriatal injection. ddPCR was used with primer probes sets targeting the CAG promoter in the AAV genome and mouse Tfrc genomic DNA after intrastriatal injection of 5el0 vector genomes (vg) of miR3O.miMSH3-l l packaged into AAV-DB-3 capsid, an AAV1 peptide modified variant, in 8-week old heterozygous HdhQll l mice and necropsy performed at 24-weeks old. AAV genome copies were normalized to Tfrc copies to calculate AAV genome copy numbers per diploid genome in striatum, cortex, cerebellum, liver, spleen, kidney, and heart. N=6 treated mice are shown as an individual dots, plotted as the mean and error bars represent standard deviation. N=3 untreated mice were used as controls (triangles). The results demonstrated AAV-DB-3 biodistribution and specificity to the striatum and cortex with minimal biodistribution to the cerebellum, liver, spleen, kidney, and heart after intrastriatal injection in HdhQlll mice.
[0532] FIG. 8B shows a graph of results from the in vivo miMSH3-l 1 expression of AAV-DB- 3.miR30.miMSH3-l l in HdhQl l l mice after intrastriatal injection.
[0533] Stem-loop RT-qPCR was used with a RT stem loop primer targeting mature miMSH-11 sequence and qPCR primers probes after intrastriatal injection 5el0 vector genomes (vg) of Attorney Docket No.: 086013-0585293 miR30.miMSH3-l 1 packaged into AAV-DB-3 capsid, an AAV1 peptide modified variant, in 8- week old HdhQlll mice and necropsy performed at 24-weeks old. miMSH3-ll copies were interpolated from a miMSH3-ll RNA oligo standard curve and are plotted as copies per microgram of RNA. N=6 treated mice are shown as an individual dots, plotted as the mean and error bars represent standard deviation. N=6 untreated mice were used as controls (triangles). The results demonstrated high AAV-DB-3 miMSH3 expression in the striatum and cortex with low expression in the cerebellum and minimal expression in the liver in HdhQlll mice after intrastriatal injection.
[0534] FIG. 8C shows a graph of results from the in vivo knockdown of endogenous mouse Msh3 mRNA in HdhQl ll mouse striatum after AAV-mediated delivery of miMSH3-ll.
[0535] RT-qPCR was used with primer probe sets targeting mouse Msh3 and ActB after intrastriatal injection 5el0 vector genomes (vg) of miR-30.miMSH3-ll packaged into AAV-DB- 3 capsid, an AAV1 peptide modified variant, in 8-week old HdhQlll mice and necropsy performed at 24-weeks old. Msh3 was normalized to ActB and plotted relative to untreated control animals. N=6 treated mice and N=10 untreated control mice as an individual dots, plotted as the mean and error bars represent standard deviation. Differences between untreated and treated groups were compared using one-way ANOVA. Differences between groups were considered to be significant at a P value of < 0.05. The results demonstrated AAV-mediated miMSH3 knockdown of endogenous mouse Msh3 mRNA in the striatum of HdhQlll mice after intrastriatal injection.
[0536] FIG. 8D shows a graph of results from in vivo knockdown of endogenous mouse Msh3 protein in HdhQl l l mouse striatum after AAV-mediated delivery of miMSH3-ll.
[0537] Western blot for mouse Msh3 and ActB protein was performed after intrastriatal injection of 5el0 vector genomes (vg) of miR-30.miMSH3-ll packaged into AAV-DB-3 capsid, an AAV1 peptide modified variant, in 8-week old HdhQll l mice and necropsy at 24-weeks old and protein isolation with RIPA buffer. BCA was used to quantify total protein concentrations. Msh3 was normalized to ActB and plotted relative to untreated controls. N=6 treated mice and N=6 untreated control mice shown as an individual dots, plotted as the mean and error bars represent standard deviation. Differences between untreated and treated groups were compared using oneway ANOVA. Differences between groups were considered to be significant at a P value of < Attorney Docket No.: 086013-0585293
[0538] 0.05. The results demonstrated AAV-mediated miMSH3 knockdown of endogenous mouse Msh3 protein in the striatum ofHdhQll l mice after intrastriatal injection.
[0539] FIG. 8E shows a graph of results from in vivo slowing of somatic CAG repeat expansion in HdhQlll mouse striatum after AAV-mediated delivery of miMSH3-ll.
[0540] Somatic instability index was measured using PCR-based fragment analysis of the HTT knock-in allele after intrastriatal injection of 5el0 vector genomes (vg) of miR-30.miMSH3-l 1 packaged into AAV-DB-3 capsid, an AAV 1 peptide modified variant, in 8-week old HdhQ 111 mice, and necropsy performed at 24-weeks old, followed by genomic DNA isolation. N=6 treated mice and N=10 8-week old baseline untreated control mice collected at time of treatment and N=1024-week old untreated mice shown as an individual dots, plotted as the mean and error bars represent standard deviation. Differences between untreated and treated groups were compared using one-way ANOVA with Dunnett’s test for multiple comparisons for somatic instability index. Differences between groups were considered to be significant at a P value of < 0.05. The results demonstrated AAV-mediated slowing of CAG repeat instability in the striatum ofHdhQll l mice after intrastriatal injection.
[0541] In vivo comparison of AAV-DB-3 delivered miMSH3-06 and miMSH3-ll in the HdhQlll knock-in mouse model of HD
[0542] FIG. 9A shows a graph of results from the in vivo biodistribution of AAV-DB- 3.miR30.miMSH3-06 and AAV-DB-3. miR30.miMSH3-l 1 in HdhQl l l mouse striatum after intrastriatal injection. ddPCR was used with primer probes sets targeting the CAG promoter in the AAV genome and mouse Tfrc genomic DNA after intrastriatal injection of vehicle (vector saline buffer), 1.5el0 vg (low dose) or 5el0 vg (high dose) of miR30.miMSH3-06 or miR3O.miMSH3- 11 packaged into AAV-DB-3 capsid, an AAV 1 peptide modified variant, in 10-week old heterozygous HdhQl ll mice and necropsy at 14-weeks old. AAV genome copies were normalized to Tfrc copies to calculate AAV genome copy numbers per diploid genome in striatum. N=6 treated mice are shown as an individual dots, plotted as the mean and error bars represent standard deviation. The results demonstrated similar AAV-DB-3 biodistribution with miMSH3-06 and miMSH3-l 1 AAV vectors in the HdhQ 111 mouse striatum that increased with dose. Attorney Docket No.: 086013-0585293
[0543] FIG. 9B shows a graph of results from the in vivo knockdown of endogenous mouse Msh3 mRNA in HdhQ 111 mouse striatum after intrastriatal injection of AAV-DB- 3.miR30.miMSH3-06 and AAV-DB-3.miR30.miMSH3-l l.
[0544] RT-qPCR was used with primer probe sets targeting mouse Msh3 and ActB after intrastriatal injection of vehicle, 1.5el0 vg (low dose) or 5el0 vg (high dose) of miR30.miMSH3-06 or miR30.miMSH3-l l packaged into AAV-DB-3 capsid, an AAV1 peptide modified variant, in 10-week old HdhQlll mice and necropsy performed at 14-weeks old, followed by RNA isolation. Msh3 was normalized to ActB and plotted relative to vehicle control animals. N=6 treated mice and N=6 vehicle control mice are shown as an individual dots, plotted as the mean and error bars represent standard deviation. The results demonstrated similar knockdown at the high dose with miMSH3-06 and miMSH3-l 1 AAV vectors in the HdhQl 11 mouse striatum after intrastriatal injection.
[0545] FIG. 9C shows a graph of results from in vivo knockdown of endogenous mouse Msh3 protein in HdhQl l l mouse striatum after intrastriatal injection of AAV-DB-3. miR3O.miMSH3- 06 and AAV-DB-3. miR3O.miMSH3-l l.
[0546] Jess capillary immunoassay for mouse Msh3 and ActB protein was performed after intrastriatal injection of vehicle, 1.5el0 vg (low dose) or 5el0 vg (high dose) of miR30.miMSH3-06 or miR30.miMSH3-ll packaged into AAV-DB-3 capsid, an AAV1 peptide modified variant, in 10-week old HdhQlll mice, and necropsy performed at 14-weeks old followed by protein isolation with RIPA buffer. BCA was used to quantify total protein concentrations. Msh3 was normalized to ActB and plotted relative to vehicle control mice. N=6 treated mice and N=6 vehicle control mice are shown as an individual dots, plotted as the mean and error bars represent standard deviation. Differences between vehicle and treated groups were compared using one-way ANOVA. Differences between groups were considered to be significant at a P value of < 0.05. The results demonstrated knockdown at the high dose with the miMSH3- 06 AAV vector in the HdhQl 11 mouse striatum after intrastriatal injection.
[0547] FIG. 9D shows a graph of results from in vivo slowing of somatic CAG repeat expansion in HdhQl l l mouse striatum after intragastrical injection of AAV-DB-3. miR30.miMSH3-06 and AAV-DB-3. miR3O.miMSH3-l 1.
[0548] Somatic instability index was measured using PCR-based fragment analysis of the HTT knock-in allele after intrastriatal injection of vehicle, 1.5el0 vg (low dose) or 5el0 vg (high Attorney Docket No.: 086013-0585293 dose) of miR30.miMSH3-06 or miR30.miMSH3-l 1 packaged into AAV-DB-3 capsid, an AAV1 peptide modified variant, in 10-week old HdhQll l mice and necropsy at 14 weeks old and genomic DNA isolation. N=6 treated mice and N=6 vehicle control mice are shown as individual dots, plotted as the mean and error bars represent standard deviation. Differences between vehicle and treated groups were compared using one-way ANOVA with Dunnett’s test for multiple comparisons for somatic instability index. Differences between groups were considered to be significant at a P value of < 0.05. The results demonstrated similar slowing of somatic instability at the high dose with the miMSH3-06 and miMSH3-l 1 AAV vectors in the HdhQl 11 mouse striatum after intrastriatal injection.
[0549] In vivo dose response of AAV-DB-3 delivered nuMSH3-06 in the HdhQlll knock-in mouse model of HD
[0550] FIG. 10A shows electropherogram traces representing intensity of CAG repeat lengths in HdhQl ll mouse striatum after intrastriatal injection of AAV-DB-3.miR30.miMSH3-06 at multiple doses.
[0551] PCR-based fragment analysis of the 7 / 77'knock-in allele after intrastriatal injection of vehicle, 5e9 vg, 1.5el0 vg, 5el0 vg, or 1.5ell vg of miR30.miMSH3-06 packaged into AAV- DB-3 capsid, an AAV1 peptide modified variant, in 8-week old HdhQl ll mice and necropsy performed at 24 weeks old followed by genomic DNA isolation. 8-week old untreated baseline (at the time of treatment) mice and 24-week old untreated mice were included as control groups for somatic instability. The results qualitatively demonstrated slowing of somatic instability shown by the reduction of CAG lengths in the treated groups compared to vehicle and untreated 24-week old groups.
[0552] FIG. 10B shows a graph of results from in vivo slowing of somatic CAG repeat expansion in HdhQl 11 mouse striatum after intrastriatal injection of AAV-DB- 3.miR30.miMSH3-06 at multiple doses.
[0553] PCR-based fragment analysis of the 7 / 77'kriock-in allele after intrastriatal injection of vehicle, 5e9 vg, 1.5el0 vg, 5el0 vg, or 1.5ell vg of miR30.miMSH3-06 packaged into AAV- DB-3 capsid, an AAV1 peptide modified variant, in 8-week old HdhQl ll mice and necropsy performed at 24 weeks old followed by genomic DNA isolation. 8-week old untreated baseline (at the time of treatment) mice and 24-week old untreated mice were included as control groups for somatic instability. N=10 treated mice and N=10 vehicle control mice and N=10 untreated Attorney Docket No.: 086013-0585293 mice at 24 weeks old and N=10 untreated 8 week old mice are shown as individual dots, plotted as the mean and error bars represent standard deviation. Differences between vehicle and treated groups and differences between untreated and vehicle groups were compared using one-way ANOVA with Dunnett’s test for multiple comparisons for somatic instability index. Differences between groups were considered to be significant at a P value of < 0.05. The results demonstrated dose-dependent slowing of somatic instability in the striatum of HdhQlll mice after intrastriatal injection of miMSH3-06 AAV vector.
[0554] In vivo AAV-DB-3 delivered miMSH3-06 in rhesus macaques at multiple doses
[0555] Dose range study design in NHPs is shown in Table 5 below:
[0556] Table 5: Summary of Study Design for Nonhuman Primate Dose Range Finding Study
[0557] FIG. 11A shows a graph of results from the in vivo biodistribution of AAV-DB- 3.miR30.miMSH3-06 in rhesus macaques after bilateral intraparenchymal globus pallidus injections at multiple doses. ddPCR was used with primer probes sets targeting the CAG promoter in the AAV genome and rhesus RPP30 genomic DNA after bilateral bilateral intraparenchymal globus pallidus injection of vehicle, 7.5el0 vg, 4. lei 1 vg, or 1.6el2 vg per hemisphere of miR30.miMSH3-06 packaged into AAV-DB-3 capsid, an AAV1 peptide modified variant, in adult rhesus macaques, followed by genomic DNA isolation. AAV genome copies were normalized to RPP30 copies to calculate AAV vector genome copy numbers per diploid genome in striatum. N=2 NHP per group are plotted as the mean. The results demonstrated dosedependent AAV biodistribution in the globus pallidus, caudate, and putamen, after bilateral intraparenchymal globus pallidus injection in rhesus macaques. Attorney Docket No.: 086013-0585293
[0558] FIG. 11B shows a graph of results from the in vivo miMSH3-06 expression levels of AAV-DB-3.miR30.miMSH3-06 in rhesus macaques after bilateral intraparenchymal globus pallidus injections at multiple doses.
[0559] Stem-loop RT-qPCR was used with a RT stem loop primer targeting mature miMSH-06 sequence and qPCR primers probes after bilateral intraparenchymal globus pallidus injection of vehicle, 7.5el0 vg, 4.1 el 1 vg, or 1.6el2 vg per hemisphere of miR30.miMSH3-06 packaged into AAV-DB-3 capsid, an AAV1 peptide modified variant, in adult rhesus macaques, followed by RNA isolation. miMSH3-06 copies were interpolated from a miMSH3-06 RNA oligo standard curve and are plotted as copies per microgram of RNA. N=2 NHP per group are plotted as the mean. The results demonstrated AAV-mediated expression of miMSH3-06 in the globus pallidus, caudate, and putamen, after bilateral intraparenchymal globus pallidus injection in rhesus macaques that mostly increased with dose.
[0560] FIG. 11C shows a graph of results from the in vivo knockdown of endogenous rhesus MSH3 mRNAin rhesus macaques after bilateral intraparenchymal globus pallidus injections at multiple doses.
[0561] RT-qPCR was used with primer probe sets targeting rhesus MSH3 and rhesus TBP after bilateral intraparenchymal globus pallidus injection of vehicle, 7.5el0 vg, 4. lei 1 vg, or 1.6el2 vg per hemisphere of miR30.miMSH3-06 packaged into AAV-DB-3 capsid, an AAV1 peptide modified variant, in adult rhesus macaques, followed by RNA isolation. MSH3 was normalized to TBP and plotted relative to vehicle control animals. N=2 NHP per group are plotted as the mean. The results demonstrated target engagement and knockdown of rhesus MSH3 mRNA in the globus pallidus, caudate, and putamen, after bilateral intraparenchymal globus pallidus injection of AAV-delivered miMSH3-06 in rhesus macaques that was mostly dose-dependent.
[0562] FIG. HD shows a graph of results from the in vivo knockdown of endogenous rhesus MSH3 protein in rhesus macaques after bilateral intraparenchymal globus pallidus injections at multiple doses.
[0563] Jess capillary immunoassay for rhesus MSH3 protein levels was performed after bilateral intraparenchymal globus pallidus injection of vehicle, 7.5el0 vg, 4.1 e 11 vg, or 1.6el2 vg per hemisphere of miR30.miMSH3-06 packaged into AAV-DB-3 capsid, an AAV1 peptide modified variant, in adult rhesus macaques, followed by protein isolation with RIPA buffer. BCA was used to quantify total protein concentrations. MSH3 protein levels are plotted relative to vehicle Attorney Docket No.: 086013-0585293 control group in the globus pallidus, caudate nucleus, and putamen. N=2 NHP per group are plotted as the mean. The results demonstrated target engagement and knockdown of rhesus MSH3 protein in the globus pallidus, caudate, and putamen, after bilateral intraparenchymal globus pallidus injection of AAV-delivered miMSH3-06 in rhesus macaques that was mostly dose-dependent.
Claims
1. Attorney Docket No.: 086013-0585293Claims1. A nucleic acid molecule comprising: a primary microRNA (pri-miRNA) scaffold; and a guide sequence within the scaffold that targets an MutS Homolog 3 (MSH3) transcript.
2. The nucleic acid molecule of claim 1, wherein the guide sequence comprises a sequence having 90% or more sequence identity to any one of SEQ ID NOs: 1-29.
3. The nucleic acid molecule of claim 1, wherein the guide sequence comprises a sequence having 95% or more sequence identity to any one of SEQ ID NOs: 1-29.
4. The nucleic acid molecule of claim 1, wherein the guide sequence comprises a sequence having 100% sequence identity to any one of SEQ ID NOs: 1-29.
5. The nucleic acid molecule of claim 2, comprising in order: a first scaffold sequence; the guide sequence; a loop scaffold sequence; a passenger sequence to the guide sequence; and a second scaffold sequence.
6. The nucleic acid molecule of claim 5, wherein the passenger sequence comprises a sequence having 90% or more sequence identity to any one of SEQ ID NOs: 30-58.
7. The nucleic acid molecule of claim 6, wherein the passenger sequence comprises a sequence having 95% or more sequence identity to any one of SEQ ID NOs: 30-58.
8. The nucleic acid molecule of claim 7, wherein the passenger sequence comprises a sequence having 100% sequence identity to any one of SEQ ID NOs: 30-58.
9. The nucleic acid molecule of claim 6, wherein the loop scaffold sequence, first scaffold, and / or second scaffold sequence are selected from Table 2.
10. The nucleic acid of claim 1, wherein the nucleic acid comprises a scaffold backbone.
11. The nucleic acid of claim 10, wherein the scaffold backbone is selected from miR-30 or miR-451.
12. The nucleic acid of claim 5, wherein the first scaffold sequence comprises SEQ ID NO: 94, the guide sequence comprises SEQ ID NO: 6, the loop scaffold sequence comprisesAttorney Docket No.: 086013-0585293SEQ ID NO: 64, the passenger sequence to the guide sequence comprises SEQ ID NO: 35, and the second scaffold sequence comprises SEQ ID NO: 125.
13. The nucleic acid of claim 1 wherein the first scaffold sequence comprises SEQ ID NO:99, the guide sequence comprises SEQ ID NO: 11, the loop scaffold sequence comprises SEQ ID NO: 69, the passenger sequence to the guide sequence comprises SEQ ID NO: 40, and the second scaffold sequence comprises SEQ ID NO: 130.
14. An adeno-associated virus (AAV) vector comprising: a capsid protein, and a first nucleic acid molecule encoding: a promoter sequence; a primary microRNA (pri-miRNA) scaffold; and a guide sequence within the scaffold that targets an MSH3 transcript.
15. The AAV vector of claim 14, wherein the first nucleic acid molecule encodes in order: a first scaffold sequence; the guide sequence; a loop scaffold sequence; a passenger sequence to the guide sequence; and a second scaffold sequence.
16. The AAV vector of claim 15, wherein the guide sequence comprises a sequence having 90% or more sequence identity to any one of SEQ ID NOs: 1-29.
17. The AAV vector of claim 15, wherein the guide sequence comprises a sequence having 95% or more sequence identity to any one of SEQ ID NOs: 1-29.
18. The AAV vector of claim 15, wherein the guide sequence comprises a sequence having 100% sequence identity to any one of SEQ ID NOs: 1-29.
19. The AAV vector of claim 15, wherein the passenger sequence comprises a sequence having 90% or more sequence identity to any one of SEQ ID NOs: 30-58.
20. The AAV vector of claim 15, wherein the passenger sequence comprises a sequence having 95% or more sequence identity to any one of SEQ ID NOs: 30-58.
21. The AAV vector of claim 15, wherein the passenger sequence comprises a sequence having 100% sequence identity to any one of SEQ ID NOs: 30-58.Attorney Docket No.: 086013-058529322. The AAV vector of claim 15, wherein the loop scaffold sequence, first scaffold, and / or second scaffold sequence are selected from Table 2.
23. The AAV vector of claim, 14, wherein the capsid protein is a modified or variant AAV VP1, VP2 and / or VP3 capsid having 90% or more sequence identity to AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, RhlO, Rh74, or AAV-2i8 VP1, VP2 and / or VP3 sequences.
24. The AAV vector of claim 14, wherein the capsid protein is a modified or variant AAV VP1, VP2 and / or VP3 capsid having 95% or more sequence identity to AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, RhlO, Rh74, or AAV-2i8 VP1, VP2 and / or VP3 sequences.
25. The AAV vector of claim 14, wherein the capsid protein is an AAV VP1, VP2 and / or VP3 capsid having 100% sequence identity to AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, RhlO, Rh74, or AAV-2i8 VP1, VP2 and / or VP3 sequences.
26. The AAV vector of claim 14, wherein the capsid protein comprises an amino acid sequence having 90% or more sequence identity to any one of SEQ ID NOs: 158-163.
27. The AAV vector of claim 14, wherein the capsid protein comprises an amino acid sequence having 95% or more sequence identity to any one of SEQ ID NOs: 158-163.
28. The AAV vector of claim 14, wherein the capsid protein comprises an amino acid sequence having 100% sequence identity to any one of SEQ ID NOs: 158-163.
29. The AAV vector of claim 14, wherein the first nucleic acid molecule comprises a scaffold backbone.
30. The AAV vector of claim 16, wherein the scaffold backbone is selected from miR-30 or miR-451.
31. The AAV vector of claim 15, wherein the first scaffold sequence comprises SEQ ID NO: 94, the guide sequence comprises SEQ ID NO: 6, the loop scaffold sequence comprisesAttorney Docket No.: 086013-0585293SEQ ID NO: 64, the passenger sequence to the guide sequence comprises SEQ ID NO: 35, and the second scaffold sequence comprises SEQ ID NO: 125.
32. The AAV vector of claim 15, wherein the first scaffold sequence comprises SEQ ID NO:99, the guide sequence comprises SEQ ID NO: 11, the loop scaffold sequence comprises SEQ ID NO: 69, the passenger sequence to the guide sequence comprises SEQ ID NO: 40, and the second scaffold sequence comprises SEQ ID NO: 130.
33. The AAV vector of claim 14, wherein the AAV vector comprises one or more inverted terminal repeats (ITRs) flanking the nucleic acid molecule.
34. The AAV vector of claim 33, wherein the one or more ITRs are selected from any of AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, RhlO, or Rh74 serotypes, or a combination thereof.
35. A composition comprising the nucleic acid of any of claims 1-13.
36. A composition comprising a plurality of AAV vectors of any of claims 14-34.
37. A method for inhibiting MutS Homolog 3 (MSH3) expression in a cell, the method comprising administering to the cell the nucleic acid of any one of claims 1-13.
38. The method of claim 37, wherein the nucleic acid molecule is delivered by an AAV vector.
39. A method of treating Huntington’s Disease (HD) in a subject, the method comprising administering to the subject the composition of claim 35 or 36.
40. The method of claim 39, wherein the subject is a human.
41. The method of claim 36 or 40, wherein the composition is administered to said human intravenously, intraarterially, intracavity, intramucosally, or via catheter.
42. The method of claim 40, wherein the AAV vector in the composition administered to said human is in a range from about IxlO8to about IxlO14vector genomes per kilogram (vg / kg) of the weight of said human.Attorney Docket No.: 086013-058529343. The method of claim 39, further comprising administering an immunosuppressive agent to the subj ect.
44. The method of claim 43, wherein the immunosuppressive agent comprises Rituximab, Sirolimus or Tacrolimus.
45. The method of claim 43, wherein the immunosuppressive agent comprises a corticosteroid.
46. The method of claim 45, wherein the corticosteroid comprises prednisone, prednisolone or dexamethasone.
47. The method of claim 39, wherein the composition is administered to brain or central nervous system (CNS) of the subject.
48. The method of claim 39, wherein the composition is administered to the parenchyma (intraprenchymal).
49. The method of claim 39, wherein the composition is administered to the Globus Pallidus, Caudate Nucleus, Putamen, Thalamus or Substantia Nigra.
50. The method of claim 39, wherein the composition is administered to the ventricle (intracerebroventricular, ICV).
51. The method of claim 39, wherein the composition is administered to the lateral ventricle of the subject.
52. The method of claim 39, wherein the composition is administered to the Anterior Horn of the Lateral Ventricle, Body of the Lateral Ventricle or Posterior Horn of the Lateral Ventricle (caudal lateral ventricle).
53. The method of claim 39, wherein the composition is administered to the cisterna magna (Intracistema magna, ICM) or to the dura matter (Intrathecal, IT).
54. The nucleic acid molecule of claim 1 or the AAV vector of claim 14, wherein the guide sequence comprises 1 to 5 nucleotide substitutions while retaining activity.Attorney Docket No.: 086013-058529355. The nucleic acid molecule of claim 1 or the AAV vector of claim 14, wherein the guide sequence comprises 1 to 3 nucleotide substitutions while retaining activity.