RNA-BASED INHIBITORS OF tRNA MODIFYING ENZYMES

WO2026055327A3PCT designated stage Publication Date: 2026-05-07YALE UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
YALE UNIVERSITY
Filing Date
2025-09-04
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Existing anticancer chemotherapies, such as 5-fluorouracil, cause significant off-target effects due to misincorporation into DNA, leading to unwanted cellular pathways inhibition.

Method used

Development of modified tRNA molecules, specifically designed to covalently bind to tRNA-modifying enzymes like DUS1, DUS2, and DUS3, delivered via lipid nanoparticles, which inhibit these enzymes and can be combined with ferroptosis-inducing therapies to target cancer cells.

Benefits of technology

The modified tRNA molecules effectively reduce the activity of tRNA-modifying enzymes, leading to reduced tumor growth and increased sensitivity to ferroptosis, thereby selectively targeting and killing cancer cells with minimal off-target effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025044858_07052026_PF_FP_ABST
    Figure US2025044858_07052026_PF_FP_ABST
Patent Text Reader

Abstract

The disclosure provides RNA molecules comprising at least one nucleotide capable of forming a covalent bond with a tRNA modifying enzyme, wherein formation of the covalent bond inhibits the tRNA modifying enzyme, and compositions comprising the RNA molecules. The disclosure further provides methods for killing cells, in particular cancer cells, and for treating or preventing cancer in a subject.
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Docket No.047162-7527WO1 RNA-BASED INHIBITORS OF tRNA MODIFYING ENZYMES CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No.63 / 691,051, filed September 05, 2024, which is incorporated herein by reference in its entirety. STATEMENT OF RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under CA254339 and CA246118-02 awarded by National Institutes of Health. The government has certain rights in the invention. SEQUENCE LISTING

[0003] The XML text file named "047162-7527WO1_Seq Listing.xml" created on September 03, 2025, comprising 97,632 bytes, is hereby incorporated by reference in its entirety. BACKGROUND

[0004] Many known anticancer chemotherapies have significant side effects that result from off target inhibition of cellular pathways such as, for example, DNA replication. For example, 5- fluorouracil (5-FU) is a known anticancer drug that can be misincorporated into DNA of drug- treated cells, and it is believed that accumulation of 5-FU in the genome is correlated with 5-FU cytotoxicity in mammalian cells. As such, these compounds have significant off target effects.

[0005] A need exists in the art for compositions and methods effective against cancer and / or have reduced off-target effects. The present invention addresses this need. SUMMARY

[0006] In some aspects, the present disclosure is directed to a modified tRNA molecule capable of binding covalently to a tRNA-modifying enzyme, wherein the modified tRNA molecule is associated with a delivery vehicle. In some embodiments, the modified tRNA molecule is selected from any one of SEQ ID Nos.1-82. In some embodiments, the modified tRNA molecule 1 12243502v1Attorney Docket No.047162-7527WO1 corresponds to SEQ ID 11. In some embodiments, the modified tRNA molecule corresponds to SEQ ID 12. In some embodiments, the modified tRNA molecule corresponds to SEQ ID 13. In some embodiments, the modified tRNA molecule corresponds to SEQ ID 14.

[0007] In some embodiments, the tRNA-modifying enzyme is a DUS1 protein; a DUS2 protein; a DUS3 protein; a PUS1 protein; a PUS7 protein; a PUS10 protein; a TRUB1 protein; a TRMT2A / 2B protein; or a combination thereof.

[0008] In some embodiments, the delivery vehicle is a lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises: MC3; SM102; CKKE12; ALC-0135; LP-01, or combinations thereof.

[0009] In some aspects, the present disclosure is directed to a method of treating a disease, disorder, or condition in a subject, the method comprising administering to the subject a modified tRNA molecule associated with a delivery vehicle. In some embodiments, the delivery vehicle is a lipid nanoparticle.

[0010] In some embodiments, the modified tRNA molecule is administered in combination with a ferroptosis-inducing therapy.

[0011] In some embodiments, the disease, disorder, or condition is a cancer. In some embodiments, the cancer is one or more of a colon cancer, a liver cancer, a brain cancer, or a lung cancer. In some embodiments, the cancer comprises a tumor.

[0012] In some aspects, the present disclosure is directed to a method of reducing levels or activity of DUS2 in a subject, comprising administering to the subject a modified tRNA molecule.

[0013] In some aspects, the present disclosure is directed to a method of reducing levels or activity of DUS3 in a subject, comprising administering to the subject a modified tRNA molecule. In some embodiments, growth of the tumor is reduced or suspended after administration of the modified tRNA molecule.

[0014] In some embodiments, the tRNA-modifying enzyme is a DUS1 protein; a DUS2 protein; a DUS3 protein; a PUS1 protein; a PUS7 protein; a PUS10 protein; a TRUB1 protein; a TRMT2A / 2B protein; or a combination thereof.

[0015] In some embodiments, the modified tRNA molecule corresponds to SEQ ID 11. In some embodiments, the modified tRNA molecule corresponds to SEQ ID 12. In some embodiments, 2 12243502v1Attorney Docket No.047162-7527WO1 the modified tRNA molecule corresponds to SEQ ID 13. In some embodiments, the modified tRNA molecule corresponds to SEQ ID 14.

[0016] In some aspects, the present disclosure is directed to a preparation of lipid nanoparticles encapsulating modified tRNA molecules characterized by a particle diameter of at most 300 nm and a polydispersity index of at most 0.2, wherein, when administered to a subject, a reduction or a suspension of a tumor in the subject is observed. In some embodiments, the lipid nanoparticles encapsulating modified tRNA comprise MC3; SM102; CKKE12; ALC-0135; LP-01, or a combination thereof. In some embodiments, the lipid nanoparticles encapsulating modified tRNAs are stable in storage for at least 1 week. In some embodiments, the lipid nanoparticles encapsulating modified tRNAs are stable in storage for at least 5 weeks.

[0017] In some aspects, the present disclosure is directed to a method of treating a disease, disorder, or condition, comprising administering to a subject a modified tRNA molecule encapsulated by and / or conjugated to a delivery vehicle; and administering a ferroptosis therapy in combination, such that the subject is exposed to both the modified tRNA molecule and the ferroptosis therapy.

[0018] In some aspects, the present disclosure is directed to a method of treating a disease, disorder, or condition, comprising administering a ferroptosis therapy to a subject who has received or is receiving a modified tRNA therapy.

[0019] In some aspects, the present disclosure is directed to a method of treating a disease, disorder, or condition, comprising administering a modified tRNA therapy to a subject who has received or is receiving a ferroptosis therapy. In some embodiments, the ferroptosis marker is or comprises glutathione; iron; glutathione peroxidase 4; lipid peroxide; reactive oxygen species; or combinations thereof.

[0020] In some aspects, the present disclosure is directed to a method of treatment, comprising administering a modified tRNA therapy to a subject having a tumor characterized by reduced DUS2 levels or activity, or both.

[0021] In some aspects, the present disclosure is directed to a method of treatment, comprising administering a modified tRNA therapy to a subject having a tumor characterized by reduced DUS3 levels or activity, or both. 3 12243502v1Attorney Docket No.047162-7527WO1

[0022] In some aspects, the present disclosure is directed to a method of treatment, comprising administering a modified tRNA therapy to a subject having a tumor, wherein administration of a modified tRNA therapy results in a decrease in tRNA expression.

[0023] In some aspects, the present disclosure is directed to a method of treatment, comprising administering a modified tRNA therapy to a subject having a tumor, wherein administration of a modified tRNA therapy results in a change in tRNA modification.

[0024] In some embodiments, the method further comprises administering a chemotherapeutic agent.

[0025] In some aspects, the present invention is directed to the following non-limiting embodiments: RNA molecule

[0026] In some embodiments, the present invention is directed to an RNA molecule.

[0027] In some embodiments, the RNA molecule comprises at least one nucleotide capable of forming a covalent bond with a tRNA modifying enzyme.

[0028] In some embodiments, the formation of the covalent bond inhibits the tRNA modifying enzyme.

[0029] In some embodiments, the RNA molecule is a tRNA molecule.

[0030] In some aspects, the present invention is directed to an RNA molecule including at least one nucleotide capable of forming a covalent bond with a tRNA modifying enzyme, wherein formation of the covalent bond inhibits the tRNA modifying enzyme.

[0031] In some embodiments, the at least one nucleotide comprises a non-natural base.

[0032] In some embodiments, the at least one nucleotide is 5-halouridine (5-haloU), 5- halocytidine (5-haloC), 5-aza-cytidine (5-azaC), 8-haloadenosine (8-haloA), 8-azanebularine, 8- aza-adenosine (8-azaA), or 8-haloguanosine (8-haloG).

[0033] In some embodiments, the tRNA modifying enzyme is a dihydrouridine synthase (DUS) or a pseudouridine synthase (PUS).

[0034] In some embodiments, the tRNA modifying enzyme is dihydrouridine synthase 1 (DUS1), dihydrouridine synthase 2 (DUS2), dihydrouridine synthase 3 (DUS3), dihydrouridine synthase 4 (DUS4), dihydrouridine synthase 1-like (DUS1L), dihydrouridine synthase 3 like (DUS3L), dihydrouridine synthase 4 like (DUS4L), pseudouridine synthase 1 (PUS1), 4 12243502v1Attorney Docket No.047162-7527WO1 pseudouridine synthase like 1(PUSL1), pseudouridine synthase 3 (PUS3), TruB pseudouridine synthase family member 1 (TRUB1), TruB pseudouridine synthase family member 2 (TRUB2), dyskerin pseudouridine synthase 1 (DKC1), pseudouridine synthase 7 (PUS7), pseudouridine synthase 7 like (PUS7L), RNA pseudouridylate synthase domain containing 1 (RPUSD1), RNA pseudouridylate synthase domain containing 2 (RPUSD2), RNA pseudouridylate synthase domain containing 4 (RPUSD4), pseudouridine synthase 10 (PUS10), tRNA methyltransferase 2 homolog A (TRMT2A), tRNA methyltransferase 2 homolog B (TRMT2B), NOP2 / Sun RNA methyltransferase 2 (NSUN2), NOP2 / Sun RNA methyltransferase 3 (NSUN3), NOP2 / Sun RNA methyltransferase 6 (NSUN6), DNA methyltransferase 2 (DNMT2), Methyltransferase-Like Protein 1 (METTL1), WD repeat domain 4 (WDR4), adenosine deaminase TRNA specific 1 (ADAT1), adenosine deaminase TRNA specific 2 (ADAT2), adenosine deaminase TRNA specific 2 (ADAT3), ISCU, or combinations thereof.

[0035] In some embodiments, the non-natural base is 5-haloU, and the tRNA modifying enzyme is DUS2, DUS1L, DUS3L, DUS4L, ISCU, PUS1, PUS3, PUS7, PUS10, PUSL1, PUS7L, RPUSD1, RPUSD2, RPUSD4, TRMT2A, TRMT2B, TRUB1, TRUB2, or combinations thereof.

[0036] In some embodiments, the nucleotide comprising the non-natural base is 5-azaC, and the tRNA modifying enzyme is DNMT2, NSUN2, NSUN3, NSUN6, or combinations thereof.

[0037] In some embodiments, the nucleotide comprising the non-natural base is 8-halo-G, and the tRNA modifying enzyme is METTL1, WDR4, or combinations thereof.

[0038] In some embodiments, the nucleotide comprising the non-natural base is 8-azaA, and the tRNA modifying enzyme is ADAT1, ADAT2, ADAT3, or combinations thereof.

[0039] In some embodiments, the at least one nucleotide is at a position corresponding to a natural position of a natural nucleotide of a natural tRNA that is modified by the tRNA modifying enzyme.

[0040] In some embodiments, the RNA molecule is a tRNA molecule, and the non-natural modified base is a 5-halouracil in the D-loop, the t-psi-c loop, the anticodon loop, the RNA stems, and other portions of the tRNA molecule.

[0041] In some embodiments, the RNA molecule comprises the sequence of any one of SEQ ID NOs:1-82; or comprises at least about 80% sequence identity to the sequence of any one of SEQ ID NOs:1-82.

[0042] In some embodiments, the RNA molecule is an isolated tRNA molecule. 5 12243502v1Attorney Docket No.047162-7527WO1

[0043] In some embodiments, the RNA molecule comprises two or more non-natural bases.

[0044] In some embodiments, the two or more non-natural bases inhibit two or more different tRNA modifying enzymes. Composition

[0045] In some embodiments, the present invention is directed to a composition.

[0046] In some embodiments, the composition comprises the RNA molecule herein.

[0047] In some embodiments, the composition is a pharmaceutical composition.

[0048] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0049] In some embodiments, the composition is a pharmaceutical composition.

[0050] In some embodiments, a pharmaceutical composition comprises a tRNA molecule combined with a delivery system (e.g., that facilitates and / or achieves delivery of the RNA into cells); in some embodiments a composition (e.g., a pharmaceutical composition) comprises a tRNA encapsulated in LNPs.

[0051] In some embodiments, a provided composition (e.g., a provided pharmaceutical composition) comprises and / or delivers an RNA as described herein. Method for killing a cell

[0052] In some embodiments, the present invention is directed to a method for killing a cell.

[0053] In some embodiments, the method comprises contacting the RNA molecule herein with the tRNA modifying enzyme in the cell.

[0054] In some embodiments, the formation of the covalent bond inhibits the tRNA modifying enzyme, thereby killing the cell.

[0055] In some embodiments, the method comprises delivering a tRNA molecule to a cell. In some such embodiments, the tRNA molecule includes a moiety capable of forming a covalent bond with one or more tRNA modifying enzymes.

[0056] In some embodiments, the cell is a brain cancer cell, a digestive tract cancer cell, a kidney cancer cell, a liver cancer cell, or a lung cancer cell.

[0057] In some embodiments, the cell is a brain cancer cell, a bladder cancer cell, a breast cancer cell, a cervix cancer cell, a bile duct cancer cell, a colon cancer cell, an esophageal cancer cell, a 6 12243502v1Attorney Docket No.047162-7527WO1 head / neck cancer cell, a kidney clear cell cancer cell, a kidney papillary cancer cell, a liver cancer cell, a lung non small cell cancer cell, a lung small cell cancer cell, a prostate cancer cell, a rectum cancer cell, a sarcoma cancer cell, a stomach cancer cell, a uterine cancer cell, a liquid tumor (e.g., acute myeloid leukemia / AML and the like) cell, and the like.

[0058] In some embodiments, the cell is a cancer cell in a culture. Method for sensitizing a cell to ferroptosis

[0059] In some embodiments, the present invention is directed to a method of sensitizing cells to ferroptosis.

[0060] In some embodiments, a method of sensitizing a cell to ferroptosis comprises contacting an RNA molecule herein with a tRNA modifying enzyme in the cell.

[0061] In some embodiments, formation of the covalent bond inhibits a tRNA modifying enzyme, thereby killing a cell.

[0062] In some embodiments, a method of killing a cell includes induction of ferroptosis (e.g., in some embodiments sensitizing to ferroptosis prior to or substantially concurrently with exposing to ferroptosis). In some embodiments, the method includes: contacting the RNA molecule with the tRNA modifying enzyme in the cell. In some embodiments, the formation of the covalent bond inhibits the tRNA modifying enzyme, thereby killing the cell.

[0063] In some embodiments, a method of sensitizing cells to ferroptosis is validated with a ferroptosis marker.

[0064] In some embodiments, a ferroptosis marker is 4-HNE.

[0065] In some embodiments, a ferroptosis marker is glutathione, iron, glutathione peroxidase, lipid peroxide, reactive oxygen species or combinations thereof. Method for treating cancer

[0066] In some embodiments, the present invention is directed to a method for treating a cancer in a subject in need thereof.

[0067] In some embodiments, the method comprises: administering to the subject an effective amount of the pharmaceutical composition herein.

[0068] In some aspects, the present invention is directed to a method for treating a cancer in a subject in need thereof. In some embodiments, the method includes: administering to the subject 7 12243502v1Attorney Docket No.047162-7527WO1 an effective amount of the pharmaceutical composition. In some embodiments, the RNA molecule contacts the tRNA modifying enzyme in a cancer cell of the cancer, and formation of the covalent bond inhibits the tRNA modifying enzyme, thereby killing the cancer cell.

[0069] In some embodiments, a pharmaceutical composition comprises a tRNA molecule encapsulated into LNPs.

[0070] In some embodiments, a pharmaceutical composition comprising a tRNA molecule encapsulated into LNPs can be delivered to a tumor.

[0071] In some embodiments, a pharmaceutical composition comprising a tRNA molecule encapsulated into LNPs can be delivered to a cancer cell in a tumor.

[0072] In some embodiments, the RNA molecule contacts the tRNA modifying enzyme in a cancer cell of the cancer.

[0073] In some embodiments, formation of the covalent bond inhibits the tRNA modifying enzyme, thereby slowing the proliferation of a cancer cell.

[0074] In some embodiments, the formation of the covalent bond inhibits the tRNA modifying enzyme, thereby killing the cancer cell.

[0075] In some embodiments, killing of a cancer cell comprises sensitizing the cancer cell to ferroptosis.

[0076] In some embodiments, a provide method for killing of a cancer cell comprises inducing ferroptosis in the cancer cell (e.g., in a cancer cell that has been sensitized to ferroptosis as described herein).

[0077] In some embodiments, the cancer is a lung cancer, a brain cancer, a digestive tract cancer, a kidney cancer, a liver cancer, or combinations thereof.

[0078] In some embodiments, the cancer is a bladder cancer, a brain cancer, a breast cancer, a cervix cancer, a bile duct cancer, a colon cancer, an esophageal cancer, a head / neck cancer, a kidney clear cancer, a kidney papillary cancer, a liver cancer, a lung non small cell cancer, a lung small cell cancer, a prostate cancer, a rectum cancer, a sarcoma cancer, a stomach cancer, a uterine cancer, a liquid tumor (e.g., acute myeloid leukemia / AML and the like), and the like.

[0079] In some embodiments, the method further comprises administering a chemotherapy to the subject. BRIEF DESCRIPTION OF THE DRAWINGS 8 12243502v1Attorney Docket No.047162-7527WO1

[0080] Figs.1A-1B depict non-limiting examples of tRNA modifying enzymes that are upregulated in cancers. Fig.1A: dihydrouridine synthases (DUS) upregulated in cancers. Fig. 1B: pseudouridine synthases (PUS) upregulated in cancers.

[0081] Fig.2 depicts 5-halouracil forming covalent bound with a DUS, in accordance with some embodiments.

[0082] Fig.3 depicts a non-limiting example of a tRNA molecule of the invention covalently bound to a tRNA modifying enzyme, in accordance with some embodiments.

[0083] Fig.4 depicts a western blot confirming that a non-limiting example of the RNA molecule described herein was able to form covalent bond with a non-limiting tRNA modifying enzyme, DUS2, in accordance with some embodiments.

[0084] Fig.5 is a graph showing the RNA molecule of Fig.4 was able to kill cells of the lung adenocarcinoma cell line PC9, in accordance with some embodiments.

[0085] Figs.6A-6I depict that DUS2 is overexpressed in lung cancer and loss of DUS2 sensitizes cells to ferroptosis, in accordance with some embodiments. Fig.6A: Schematic of key regulators and chemical effectors of ferroptosis. Fig.6B: High DUS2 mRNA expression correlates with resistance to chemical ferroptosis inducers in a panel of 860 cancer cell lines. Fig.6C: DUS enzymes convert uridine to dihydrouridine. Fig.6D: DUS2 RNA levels are significantly higher in lung adenocarcinoma (LUAD) tumor samples compared to normal tissue (two tailed Mann- Whitney U test, CysGCA p<.0001). Fig.6E: High DUS2 expression predicts worse outcomes for NSCLC patients. Fig.6F: DUS2 protein expression is absent in clonal A549 DUS2 KO cells. Fig.6G: Increased cell death (Annexin V+ / PI+ cells) in DUS2 KOs compared to WT A549 following treatment with 2µM RSL-3. Fig.6H: Elevated lipid ROS (C11-BODIPY staining) in DUS2 KOs compared to WT A549 following treatment with 2µM RSL3. Fig.6I: Quantification of Fig.6H (two tailed t-test, * p<.0001).

[0086] Figs.7A-7F depict that DUS2 is required to sustain levels of a specific tRNA, tRNACysGCA, in accordance with some embodiments. Fig.7A: DUS2 targets position U20 in tRNA. Fig.7B: Quantification of tRNA charging levels in DUS2 WT and KO cells. tRNA charging is unaffected by loss of DUS2, whereas Gln starvation reduces tRNAGln charging levels >50%. Fig.7C: Changes in tRNA levels in DUS2 KO cells, black dots (FDR< 0.05), grey (FDR >0.05), red (tRNACysGCA with FDR< .05). Fig.7D: Example isodecoder tRNACysGCA10-1 shows ~50% lower expression in DUS2 KOs. Fig.7E: Analysis of tRNA 9 12243502v1Attorney Docket No.047162-7527WO1 levels in TCGA LUAD data. tRNACysGCA but not tRNAGlnCTG levels are significantly higher in tumors compared to normal tissue (two tailed Mann-Whitney U test, CysGCA p<.0001).

[0087] Figs.8A-8I depict that loss of DUS2 impairs translation of cysteine rich proteins, including metallothioneins, which leads to ferroptosis sensitivity, in accordance with some embodiments. Fig.8A: Cysteine translation reporter. Fig.8B: DUS2 KO impairs translation of TGT and TGC cysteine codons (two tailed t-test, *p<.03). Fig.8C: Rescue of TGT translation by transfection of tRNACysGCA into DUS2 KO cells (two tailed t-test, * p<.0001). Fig.8D: Proteins with high (>5%) Cys content are reduced in DUS2 KO cells. Cumulative distribution of changes in protein abundance (log2 fold change, Kolmogorov-Smirnov test, p<.05). Fig.8E: Metallothionein translation reporter. Fig.8F: Metallothioneins (MT1A and MT1G) are translated less well in DUS2 KOs. Fig.8G: Increased cell death (Annexin V+ / PI+ cells) in DUS2 KOs compared to WT A549 following addition of 62.5µM ZnCl2. Fig.8H: DUS2 KO cells have lower levels of reduced GSH (two tailed t-test, * p<.004). Fig.8I: Model of anti-ferroptotic function of DUS2.

[0088] Figs.9A-9G depict that combined loss of DUS2 and ferroptosis induction extends lifespan in a mouse xenograft NSCLC model, in accordance with some embodiments. Fig.9A: A549 tumors grow faster than DUS2 KO tumors. Fig.9B: Example tumor from A549 and DUS2 KO-2. Fig.9C: DUS2 KO tumors have higher expression of a marker of ferroptosis, PTGS2, than A549 cells by qRT-PCR (ANOVA, * p<.002). Fig.9D: Dosing scheme for xenograft experiments. Fig.9E: Oral JKE-1674 treatment induces PTGS2 mRNA in mouse lungs (ANOVA, * p<.03). Fig.9F: JKE-1674 treatment increases PTGS2 mRNA expression in DUS2 KO tumors (ANOVA, * p<.02). Fig.9G: Mice implanted with DUS2 KO xenograft tumors survive longer than mice implanted with A549 tumors when treated with JKE-1674 (Mantel-Cox test * p<.03).

[0089] Figs.10A-10E depict that fraction of dead (Annexin V+ / PI+) DUS2 KO cells is reduced with pre-treated with DUS2 expression plasmid, Ferrostatin-1, Trolox but not ZVAD-FMK when treated with 2µM RSL-3. Fig.10D: DUS2 KOs have higher levels of lipid ROS measured by C11-BODIPY staining when treated with 200nM ML162. Fig.10E: DUS2 KOs have higher levels of cellular ROS measured by H2DCFDA staining when treated with 2µM RSL-3. 10 12243502v1Attorney Docket No.047162-7527WO1

[0090] Fig.11 depicts that, in aggregate, the total pool of tRNACysGCA is reduced ~40% in DUS2 KO clones.

[0091] Fig.12A depicts that the total protein synthesis is unimpaired in DUS2 KO cells as measured by 35S-Met incorporation (two tailed t-test, * p=.67). Fig.12B: mRNAs encoding cysteine rich proteins are reduced in DUS2 KO cells consistent with RQC. Cumulative distribution of changes in mRNA abundance (log2 fold change, K-S test, p<.0001).). Fig.12C: Depletion of RQC factor GIGYF2 (siGIGYF2) rescues MT1A mRNA levels in DUS2 KO cells compared to non-targeting control (siNT) (two tailed t-test, * p<.04).

[0092] Figs.13A-13B depict that mouse weights generally increased over time with vehicle and JKE-1674. Fig.13B: Mice receiving JKE-1674 had shorter median survival than mice receiving vehicle.

[0093] Figs.14A-14B demonstrate that a non-limiting example of the RNA-based DUS inhibitors herein, CLB-001, was able to kill cancer cells with nanomolar level IC50, in accordance with some embodiments. The hepatocellular carcinoma cell line, HepG2 (Fig.14A), and the non-small cell lung cancer cell line, A549 (Fig.14B), were subjected to various concentrations of CLB-001. The viabilities of the cells are plotted against the CLB-001 concentrations.

[0094] Fig.15 demonstrates that the non-limiting example of the RNA-based DUS inhibitors herein, CLB-001, does not kill non-cancerous cells, in accordance with some embodiments. The non-transformed hepatocyte cell line, AML12, was subjected to various concentrations of CLB- 001. The viabilities of the cells are plotted against the CLB-001 concentrations.

[0095] Fig.16 demonstrates that the non-limiting example of the RNA-based DUS inhibitors herein, CLB-001, is vastly more potent than 5-FU, in accordance with some embodiments. HepG2 was subjected to various concentrations of CLB-001. The viabilities of the cells are plotted against the CLB-001 concentrations. Even though the active moiety of CLB-001 is 5-FU, incorporating 5-FU into tRNACys molecule dramatically increased the potency of the drug, such that CLB-001 is more than 7000X more potent than 5FU in killing HepG2 cancer cells.

[0096] Figs.17A-17C demonstrate that tRNA modifying enzymes are upregulated in hepatocellular carcinoma, in accordance with some embodiments. The mRNA levels of various tRNA modifying enzymes from hepatocellular carcinoma (HCC) tumor tissues were compared 11 12243502v1Attorney Docket No.047162-7527WO1 with those from normal liver tissues. The tRNA modifying enzymes were found to be consistently overexpressed in the HCC tumors.

[0097] Figs.18A-18G demonstrate that high expression of tRNA modifying enzymes predicts worse outcomes in hepatocellular carcinoma (HCC), in accordance with some embodiments. In each panel of the figures, HCC patients are grouped according to the expression levels of the tRNA modifying enzymes in the tumor tissues, and the patient survival percentages with time are plotted according to the grouping.

[0098] Fig.19 demonstrates that a non-limiting example of the RNA-based DUS and PUS inhibitors herein, CLB-001, was able to kill cancer cells with nanomolar level IC50, in accordance with some embodiments. The hepatocellular carcinoma cell lines, SNU-387, HepG2, and PLC / PRF / 5 and the non-small cell lung cancer cell line, A549 were subjected to various concentrations of CLB-001. The viabilities of the cells are plotted against the CLB-001 concentrations.

[0099] Fig.20 demonstrates that the loss of DUS2 increases ferroptosis in lung tumors and sensitizes lung cancer cells to ferroptosis via ferroptosis-activating compounds, in accordance with some embodiments. Fig.20A: Ferroptosis is more prevalent in DUS2 knockout tumors derived from A549 cells compared to WT tumors. Fig.20B: Quantification of cells positive for 4-HNE staining via immunohistochemistry. Fig.20C: DUS2 KO cells are more sensitive to erastin-induced ferroptosis.

[0100] Fig.21 demonstrates that RSL3 sensitizes A549 DUS3-KO to ferroptosis and metallothionein over-expression overcomes this sensitivity, in accordance with some embodiments.

[0101] Fig.22 demonstrates that 5-FU containing CysGCA can be stored at 4C for at least 5 weeks without degradation and encapsulated by LNPs, in accordance with some embodiments. Fig.22A: RNA gels of 5-FU containing CysGCA at weeks 0 and 5 after manufacturing. Fig.22B: Encapsulation efficiency of 5-FU containing CysGCA.

[0102] Fig.23 demonstrates that LNP-encapsulated CLB-001 exhibit a dose-dependent killing effect on liver, lung, colorectal, and brain cancer cells, in accordance with some embodiments. Fig.23A: Dose-dependent killing of SNU475 hepatocellular carcinoma cells by the CLB-001 encapsulated in MC3, SM102, or CKKE12 LNPs with and without ApoE. Fig.23B: Dose- dependent killing of A549 lung adenocarcinoma cells by the CLB-001 encapsulated in MC3, 12 12243502v1Attorney Docket No.047162-7527WO1 SM102, or CKKE12 LNPs with and without ApoE. Fig.23C: Dose-dependent killing of A549 lung adenocarcinoma cells by the CLB-001 encapsulated in LP-01 or ALC-0315 LNPs with ApoE. Fig.23D: Dose-dependent killing of hepatocellular carcinoma and hepatoblastoma cells by CLB-001 encapsulated in MC3 LNPs. Fig.23E: Dose-dependent killing of lung adenocarcinoma and lung large cell carcinoma cells by CLB-001 encapsulated in MC3 LNPs. Fig.23F: Dose-dependent killing of colorectal adenocarcinoma cells by CLB-001 encapsulated in MC3 LNPs. Fig.23G: Dose-dependent killing of glioblastoma cells by CLB-001 encapsulated in MC3 LNPs.

[0103] Fig.24 demonstrates efficacy in a hepatocellular carcinoma mouse model with the CLB- 001 encapsulated in LNPs treatment, in accordance with some embodiments. Fig.24A: Chemiluminescence measurement of mice implanted with hepatocellular carcinoma cells with or without the SM102-encapsulated CLB-001 or sorafenib. Fig.24B: Fold change of tumor volume measured with calipers in mice implanted with hepatocellular carcinoma cells with or without the SM102-encapsulated CLB-001 or sorafenib.

[0104] Fig.25 demonstrates efficacy in a lung adenocarcinoma mouse model with the CLB-001 encapsulated in LNPs treatment, in accordance with some embodiments.

[0105] Fig.26 demonstrates that there is little to no in vivo toxicity after administration of LNP- encapsulated CLB-001 to mice, in accordance with some embodiments. Fig.26A: Schematic of a study timeline for body weight, liver enzyme level measurements, and blood chemistry profiling in mice. Fig.26B: Total mouse body weight before and after the treatment with the MC3- encapsulated CLB-001 at three different doses or control tRNA. Fig.26C: ALT enzyme levels after 7 days of treatment with the MC3-encapsulated CLB-001 control tRNA. Fig.26D: AST enzyme levels after 7 days of treatment with the MC3-encapsulated CLB-001 control tRNA. Fig. 26E: Blood chemistry profile 7 days of treatment with the MC3-encapsulated CLB-001 or control tRNA.

[0106] Fig.27 demonstrates that DUS3L is overexpressed in kidney clear cell carcinoma tumors, in accordance with some embodiments. Fig.27A: Expression of DUS3L RNA in normal and KIRC kidney tissue. Fig.27B: KIRC patients with high tumor expression of DUS3L have worse overall survival than those with low DUS3L expression.

[0107] Fig.28 demonstrates that knockdown of DUS3L in a KIRC cell line reduces tRNA charging, in accordance with some embodiments. Fig.28A: qRT-PCR quantification of DUS3 13 12243502v1Attorney Docket No.047162-7527WO1 levels in shRNA-mediated knockdown cells or control. Fig.28B: tRNA sequencing of 786-O cells with baseline or reduced DUS3. DETAILED DESCRIPTION

[0108] Without being limited by theory, the invention is based in part on the discovery that substrate mimetic transfer RNAs (tRNAs) that incorporate non-natural nucleotides at specific positions can be used to covalently trap tRNA modifying enzymes (e.g., tRNA modifying enzymes that drive cancer progression and / or metastasis), thereby inhibiting them. Definitions

[0109] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar or equivalent to those described herein may be used in the practice of an / or for the testing of the present invention, the preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used according to how it is defined, where a definition is provided.

[0110] It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0111] It is also to be understood that the methods described in this disclosure are not limited to particular methods and experimental conditions disclosed herein as such methods and conditions may vary.

[0112] Furthermore, the experiments described herein, unless otherwise indicated, use conventional molecular and cellular biological and immunological techniques within the skill of the art. Such techniques are well known to the skilled worker, and are explained fully in the literature. See, e.g., Ausubel, et al., ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, N.Y. (1987-2008), including all supplements, Molecular Cloning: A Laboratory Manual (Fourth Edition) by MR Green and J. Sambrook, and Harlow et al., Antibodies: A Laboratory Manual, Chapter 14, Cold Spring Harbor Laboratory, Cold Spring Harbor (2013, 2nd edition). 14 12243502v1Attorney Docket No.047162-7527WO1

[0113] Unless otherwise defined, scientific and technical terms used herein have the meanings that are commonly understood by those of ordinary skill in the art. In the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. The use of “or” means “and / or” unless stated otherwise. The use of the term “including,” as well as other forms, such as “includes” and “included,” is not limiting.

[0114] Generally, nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein is well-known and commonly used in the art. The methods and techniques provided herein are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as described herein. The nomenclatures used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well- known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.

[0115] So that the disclosure may be more readily understood, select terms are defined below.

[0116] As used herein, the articles “a” and “an” are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0117] As used herein when referring to a measurable value such as an amount, a temporal duration, and the like, the term “about” is meant to encompass variations of ±20% or within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the specified value, as such variations are appropriate to perform the disclosed methods. Unless otherwise clear from context, all numerical values provided herein are modified by the term about.

[0118] In general, the term “agent”, as used herein, is used to refer to an entity (e.g., for example, a lipid, metal, nucleic acid, polypeptide, polysaccharide, small molecule, etc, or complex, combination, mixture or system [e.g., cell, tissue, organism] thereof), or phenomenon 15 12243502v1Attorney Docket No.047162-7527WO1 (e.g., heat, electric current or field, magnetic force or field, etc). In appropriate circumstances, as will be clear from context to those skilled in the art, the term may be utilized to refer to an entity that is or comprises a cell or organism, or a fraction, extract, or component thereof. Alternatively or additionally, as context will make clear, the term may be used to refer to a natural product in that it is found in and / or is obtained from nature. In some instances, again as will be clear from context, the term may be used to refer to one or more entities that is man-made in that it is designed, engineered, and / or produced through action of the hand of man and / or is not found in nature. In some embodiments, an agent may be utilized in isolated or pure form; in some embodiments, an agent may be utilized in crude form. In some embodiments, potential agents may be provided as collections or libraries, for example that may be screened to identify or characterize active agents within them. In some cases, the term “agent” may refer to a compound or entity that is or comprises a polymer; in some cases, the term may refer to a compound or entity that comprises one or more polymeric moieties. In some embodiments, the term “agent” may refer to a compound or entity that is not a polymer and / or is substantially free of any polymer and / or of one or more particular polymeric moieties. In some embodiments, the term may refer to a compound or entity that lacks or is substantially free of any polymeric moiety.

[0119] Two events or entities are “associated” with one another, as that term is used herein, if the presence, level, degree, type and / or form of one is correlated with that of the other. For example, a particular entity (e.g., polypeptide, genetic signature, metabolite, microbe, etc) is considered to be associated with a particular disease, disorder, or condition, if its presence, level and / or form correlates with incidence of, susceptibility to, severity of, stage of, etc the disease, disorder, or condition (e.g., across a relevant population). In some embodiments, two or more entities are physically “associated” with one another if they interact, directly or indirectly, so that they are and / or remain in physical proximity with one another. In some embodiments, two or more entities that are physically associated with one another are covalently linked to one another; in some embodiments, two or more entities that are physically associated with one another are not covalently linked to one another but are non-covalently associated, for example by means of hydrogen bonds, van der Waals interaction, hydrophobic interactions, magnetism, and combinations thereof. In some embodiments, two or more entities are physically associated with 16 12243502v1Attorney Docket No.047162-7527WO1 one another when one (or more) is partially or fully encompassed (e.g., encapsulated) by another(s).

[0120] It will be understood that the term “binding”, as used herein, typically refers to a non- covalent association between or among two or more entities. “Direct” binding involves physical contact between entities or moieties; indirect binding involves physical interaction by way of physical contact with one or more intermediate entities. Binding between two or more entities can typically be assessed in any of a variety of contexts – including where interacting entities or moieties are studied in isolation or in the context of more complex systems (e.g., while covalently or otherwise associated with a carrier entity and / or in a biological system or cell). Binding between two entities may be considered “specific” if, under the conditions assessed, the relevant entities are more likely to associate with one another than with other available binding partners.

[0121] The terms "cancer", “malignancy”, "neoplasm", "tumor", and "carcinoma", are used herein to refer to cells that exhibit relatively abnormal, uncontrolled, and / or autonomous growth, so that they exhibit an aberrant growth phenotype characterized by a significant loss of control of cell proliferation. In some embodiments, a tumor may be or comprise cells that are precancerous (e.g., benign), malignant, pre-metastatic, metastatic, and / or non-metastatic. The present disclosure specifically identifies certain cancers to which its teachings may be particularly relevant. In some embodiments, a relevant cancer may be characterized by a solid tumor. In some embodiments, a relevant cancer may be characterized by a hematologic tumor. In general, examples of different types of cancers known in the art include, for example, hematopoietic cancers including leukemias, lymphomas (Hodgkin’s and non-Hodgkin’s), myelomas and myeloproliferative disorders; sarcomas, melanomas, adenomas, carcinomas of solid tissue, squamous cell carcinomas of the mouth, throat, larynx, and lung, liver cancer, genitourinary cancers such as prostate, cervical, bladder, uterine, and endometrial cancer and renal cell carcinomas, brain cancer, bone cancer, lung cancer, pancreatic cancer, skin cancer, cutaneous or intraocular melanoma, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, head and neck cancers, breast cancer, gastro-intestinal cancers and nervous system cancers, benign lesions such as papillomas, and the like. 17 12243502v1Attorney Docket No.047162-7527WO1

[0122] The term “chemotherapeutic” with reference, e.g., to an agent, is used herein to indicate that the agent is utilized, recommended for use in, or capable of treating one or more diseases, disorders or conditions associated with undesirable cell proliferation.

[0123] The term “chemotherapy” has its art-understood meaning referring to one or more chemotherapeutic agents for example specifically including agents utilized and / or recommended for use in treating one or more diseases, disorders or conditions associated with undesirable cell proliferation. In some embodiments, one or more chemotherapeutic agents comprises one or more pro-apoptotic, pro-ferroptotic, cytostatic and / or cytotoxic agents. In many embodiments, chemotherapeutic agents are useful in the treatment of cancer. In some embodiments, a chemotherapeutic agent may be or comprise one or more alkylating agents, one or more anthracyclines, one or more cytoskeletal disruptors (e.g. microtubule targeting agents such as taxanes, maytansine and analogs thereof, of), one or more epothilones, one or more histone deacetylase inhibitors HDACs), one or more topoisomerase inhibitors (e.g., inhibitors of topoisomerase I and / or topoisomerase II), one or more kinase inhihitors, one or more nucleotide analogs or nucleotide precursor analogs, one or more peptide antibiotics, one or more platinum- based agents, one or more retinoids, one or more vinca alkaloids, and / or one or more analogs of one or more of the following (i.e., that share a relevant anti-proliferative activity). In some particular embodiments, a chemotherapeutic agent may be or comprise one or more of Actinomycin, All-trans retinoic acid, an Auiristatin, Azacitidine, Azathioprine, Bleomycin, Bortezomib, Carboplatin, Capecitabine, Cisplatin, Chlorambucil, Cyclophosphamide, Curcumin, Cytarabine, Daunorubicin, Docetaxel, Doxifluridine, Doxorubicin, Epirubicin, Epothilone, Etoposide, Fluorouracil, Gemcitabine, Hydroxyurea, Idarubicin, Imatinib, Irinotecan, Maytansine and / or analogs thereof (e.g. DM1) Mechlorethamine, Mercaptopurine, Methotrexate, Mitoxantrone, a Maytansinoid, Oxaliplatin, Paclitaxel, Pemetrexed, Teniposide, Tioguanine, Topotecan, Valrubicin, Vinblastine, Vincristine, Vindesine, Vinorelbine, and combinations thereof. In some embodiments, a chemotherapeutic agent may be utilized in the context of an antibody-drug conjugate. In some embodiments, a chemotherapeutic agent is one found in an antibody-drug conjugate selected from the group consisting of: hLL1-doxorubicin, hRS7-SN-38, hMN-14-SN-38, hLL2-SN-38, hA20-SN-38, hPAM4-SN-38, hLL1-SN-38, hRS7-Pro-2-P-Dox, hMN-14-Pro-2-P-Dox, hLL2-Pro-2-P-Dox, hA20-Pro-2-P-Dox, hPAM4-Pro-2-P-Dox, hLL1- Pro-2-P-Dox, P4 / D10-doxorubicin, gemtuzumab ozogamicin, brentuximab vedotin, trastuzumab 18 12243502v1Attorney Docket No.047162-7527WO1 emtansine, inotuzumab ozogamicin, glembatumomab vedotin, SAR3419, SAR566658, BIIB015, BT062, SGN-75, SGN-CD19A, AMG-172, AMG-595, BAY-94-9343, ASG-5ME, ASG-22ME, ASG-16M8F, MDX-1203, MLN-0264, anti-PSMA ADC, RG-7450, RG-7458, RG-7593, RG- 7596, RG-7598, RG-7599, RG-7600, RG-7636, ABT-414, IMGN-853, IMGN-529, vorsetuzumab mafodotin, and lorvotuzumab mertansine. In some embodiments, a chemotherapeutic agent may be one described as utilized in an antibody-drug conjugate as described or discussed in one or more of Govindan et al, ScientificWorldJOURNAL 10:2070, 2010, –2089-89).

[0124] As used herein, the terms “combination therapy” or “in combination” refer to those situations in which a subject is simultaneously exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents). In some embodiments, the two or more regimens may be administered simultaneously; in some embodiments, such regimens may be administered sequentially (e.g., all “doses” of a first regimen are administered prior to administration of any doses of a second regimen); in some embodiments, such agents are administered in overlapping dosing regimens. In some embodiments, “administration” of combination therapy may involve administration of one or more agent(s) or modality(ies) to a subject receiving the other agent(s) or modality(ies) in the combination. In some embodiments, “administration” of combination therapy, or of two or more regimens “in combination,” means that a subject is exposed to two or more treatment regimens within a period of time, e.g., within a treatment cycle, or a dosing regimen, of one of the two or more therapeutic regimens. For example, a subject may be administered two or more treatment regimens “in combination” if a second therapeutic agent is administered at any point during the treatment regimen of a first therapeutic agent. For clarity, combination therapy does not require that individual agents be administered together in a single composition (or even necessarily at the same time), although in some embodiments, two or more agents, or active moieties thereof, may be administered together in a combination composition.

[0125] In this disclosure, "comprises," "comprising," "containing" and "having" and the like can have the meaning ascribed to them in U.S. Patent law and can mean "includes," "including," and the like; "consisting essentially of" or "consists essentially" likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments. 19 12243502v1Attorney Docket No.047162-7527WO1 Use of the transitional phrase “consisting essentially of” means that the scope of a claim is to be interpreted to encompass the specified materials or steps recited in the claim, and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. Thus, the term “consisting essentially of” when used in a claim of this invention is not intended to be interpreted to be equivalent to “comprising.” In some embodiments, the term “consisting essentially of” refers to a composition, whose only active ingredient is the indicated active ingredient(s) (e.g., the indicated RNA molecule(s)), however, other components may be included which are for stabilizing, preserving, etc. the formulation, but are not involved directly in the therapeutic effect of the indicated active ingredient.

[0126] The term “encapsulated” is used herein to refer to substances that are completely surrounded by another material.

[0127] As used herein, the term “expression” of a nucleic acid sequence refers to the generation of any gene product from the nucleic acid sequence. In some embodiments, a gene product can be a transcript. In some embodiments, a gene product can be a polypeptide. In some embodiments, expression of a nucleic acid sequence involves one or more of the following: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, etc); (3) translation of an RNA into a polypeptide or protein; and / or (4) post-translational modification of a polypeptide or protein.

[0128] The term “isolated” as used herein in relation to any molecule, as in, for example, “isolated RNA molecule,” refers to molecules, which are isolated from other cellular components and is meant to encompass both purified and recombinant molecules. The term “isolated RNA molecule(s)” thus refers to, for example, a RNA molecule(s) that is / are substantially free of cellular material, viral material, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized.

[0129] “Identity” as used herein refers to the subunit sequence identity between two polymeric molecules, for example between two nucleic acid molecules, such as, between two RNA molecules. When two polynucleotide sequences have the same nucleotides at the same positions, e.g., if a position in each of two nucleic acid molecules is occupied by a uracil, then they are identical at that position. The identity or extent to which two sequences have the same, for example nucleotide, at the same positions in an alignment is often expressed as a percentage. Since two polynucleotides may each comprise a sequence (i.e., a portion of the complete 20 12243502v1Attorney Docket No.047162-7527WO1 polynucleotide sequence) that is similar between the two polynucleotides, and may further comprise a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a “comparison window” to identify and compare local regions of sequence similarity. Homology or identity can be determined by sequence alignment, e.g., using a program such as BLAST, ALIGN, or CLUSTAL known in the art.

[0130] As used herein, the term “inhibit(s)” or “inhibiting” an tRNA modifying enzyme refers to any statistically significant decrease in biological activity of the tRNA modifying enzyme, including full blocking of the activity.

[0131] The term “in vitro” as used herein refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multi- cellular organism.

[0132] As used herein, the term “in vivo” refers to events that occur within a multi-cellular organism, such as a human and a non-human animal. In the context of cell-based systems, the term may be used to refer to events that occur within a living cell (as opposed to, for example, in vitro systems).

[0133] As used herein, terms “nanoparticle”, “lipid nanoparticle”, and “LNP” refers to a discrete entity of small size, e.g., typically having a longest dimension that is shorter than about 1000 nanometers (nm) and often is shorter than 500 nm, or even 100 nm or less. In many embodiments, a nanoparticle may be characterized by a longest dimension between about 1 nm and about 100 nm, or between about 50 nm to 200nm, or between about 1 µm and about 500 nm, or between about 1 nm and 1000 nm. In many embodiments, a population of nanoparticles is characterized by an average size (e.g., longest dimension) that is below about 1000 nm, about 750 nm, about 500 nm, about 200 nm, about 100 nm, about 50 nm, about 40 nm, about 30 nm, about 20 nm, or about 10 nm and often above about 1 nm. In many embodiments, a nanoparticle may be substantially spherical (e.g., so that its longest dimension may be its diameter). In some embodiments, a nanoparticle has a diameter of less than 100 nm as defined by the National Institutes of Health. In some embodiments, nanoparticles are micelles in that they comprise an enclosed compartment, separated from the bulk solution by a micellar membrane, typically comprised of amphiphilic entities which surround and enclose a space or compartment (e.g., to 21 12243502v1Attorney Docket No.047162-7527WO1 define a lumen). In some embodiments, a micellar membrane is comprised of at least one polymer, such as for example a biocompatible and / or biodegradable polymer.

[0134] The terms “non-natural” and “non-naturally occurring” refer to that which is not present in nature. For example, a “non-natural” or “non-naturally occurring nucleic acid or nucleotide refers to a nucleic acid or nucleotide that is not present in nature. For example, non-naturally occurring nucleic acids can include one or more non-natural base, sugar, and / or inter-subunit linkage, e.g., a sugar, base, and / or linkage that has been modified or substituted with respect to that found in a naturally occurring nucleic acid molecule. In some embodiments, non-naturally occurring nucleic acids include more than one type of modification, e.g., but not limited to, sugar and base modifications, sugar and linkage modifications, base and linkage modifications, or base, sugar, and linkage modifications.

[0135] As used herein, in its broadest sense, the term “nucleic acid” refers to any compound and / or substance that is or can be incorporated into an oligonucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage. As will be clear from context, in some embodiments, "nucleic acid" refers to an individual nucleic acid residue (e.g., a nucleotide and / or nucleoside); in some embodiments, "nucleic acid" refers to an oligonucleotide chain comprising individual nucleic acid residues. In some embodiments, a "nucleic acid" is or comprises RNA; in some embodiments, a "nucleic acid" is or comprises DNA. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, a nucleic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone. For example, in some embodiments, a nucleic acid is, comprises, or consists of one or more "peptide nucleic acids", which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention. Alternatively or additionally, in some embodiments, a nucleic acid has one or more phosphorothioate and / or 5'-N-phosphoramidite linkages rather than phosphodiester bonds. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxycytidine). In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2- 22 12243502v1Attorney Docket No.047162-7527WO1 thiothymidine, inosine, pyrrolo-pyrimidine, 3 -methyl adenosine, 5-bromouridine, 5- chlorouridine, 5-fluorouridine, 5-halouridine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5- propynyl-uridine, C5 -propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7- deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)-methylguanine, 2- thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a nucleic acid comprises one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or protein. In some embodiments, a nucleic acid includes one or more introns. In some embodiments, nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long. In some embodiments, a nucleic acid is partly or wholly single stranded; in some embodiments, a nucleic acid is partly or wholly double stranded. In some embodiments a nucleic acid has a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide. In some embodiments, a nucleic acid has enzymatic activity.

[0136] The term “stable nanoparticle composition,” when applied to compositions herein, means that the compositions maintain one or more aspects of their physical structure (e.g., size range and / or distribution of particles) over a period of time. In some embodiments, a stable nanoparticle composition is one for which the average particle size, the maximum particle size, the range of particle sizes, and / or the distribution of particle sizes (i.e., the percentage of particles above a designated size and / or outside a designated range of sizes) is maintained for a period of time under specified conditions. In some embodiments, a stable provided composition is one for which a biologically relevant activity is maintained for a period of time. In some embodiments, the period of time is at least about one hour; in some embodiments the period of time is about 5 hours, about 10 hours, about one (1) day, about one (1) week, about two (2) weeks, about one (1) 23 12243502v1Attorney Docket No.047162-7527WO1 month, about two (2) months, about three (3) months, about four (4) months, about five (5) months, about six (6) months, about eight (8) months, about ten (10) months, about twelve (12) months, about twenty-four (24) months, about thirty-six (36) months, or longer. In some embodiments, the period of time is within the range of about one (1) day to about twenty-four (24) months, about two (2) weeks to about twelve (12) months, about two (2) months to about five (5) months, etc. For example, if a population of nanoparticles is subjected to prolonged storage, temperature changes, and / or pH changes, and a majority of the nanoparticles in the composition maintain a diameter within a stated range, the nanoparticle composition is stable. In some embodiments, a stable composition is stable at ambient conditions. In some embodiments, a stable composition is stable under biologic conditions (i.e.37º C in phosphate buffered saline).

[0137] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range. In some embodiments, a range may be presented in a format such that the given range includes a lower bound and an upper bound. For example, description of a range such as from 1 to 6 may be construed as having a lower bound of 1 and an upper bound of 6. In some such examples, description of a range is inclusive of subranges as well as individual numbers within the range not exceeding the lower or upper bounds of said range.

[0138] A “subject” or “patient,” as used therein, may be a human, a non-human mammal, or an aspect of a human or non-human animal, including but not limited to a cell, a tumor, and an organ. Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline, and murine mammals.

[0139] As used herein, the terms “treat,” treating,” “ameliorating,” “treatment,” and the like refer to reducing or improving a disease or condition and / or one or more symptoms associated therewith. It will be appreciated that, although not precluded, treating a disease or condition 24 12243502v1Attorney Docket No.047162-7527WO1 and / or one or more symptoms associated therewith does not require that the disease, condition, or symptoms associated therewith be completely ameliorated or eliminated. It means that the clinical signs and / or the symptoms associated with a disease or condition are lessened as a result of the actions performed. The signs or symptoms to be monitored will be well known to the skilled clinician.

[0140] As used herein, the term “tumor” refers to an abnormal growth of cells or tissue. In some embodiments, a tumor may comprise cells that are precancerous (e.g., benign), malignant, pre-metastatic, metastatic, and / or non-metastatic. In some embodiments, a tumor is associated with, or is a manifestation of, a cancer. In some embodiments, a tumor may be a disperse tumor or a liquid tumor. In some embodiments, a tumor may be a solid tumor.

[0141] By “wildtype” is meant a non-mutated version of a gene, allele, genotype, nucleic acid, polypeptide, or phenotype, or a fragment of any of these. It may occur in nature or produced recombinantly.

[0142] The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

[0143] Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein. Molecules and Compositions

[0144] In some aspects, the present invention provides an RNA molecule comprising at least one nucleotide capable of forming a covalent bond to a tRNA modifying enzyme, wherein formation of the covalent bond inhibits the tRNA modifying enzyme.

[0145] RNA molecules can be prepared using methods known in the art including, but not limited to, in vitro transcriptions and chemical synthesis. Nelissen, E. et al., Nucleic Acids Research, 40(13):e102 (2012), Milligan, J. F. et al., Nucleic Acids Research, 15:8783-8798 (1987), Marshall, W. S. et al., Curr. Opin. Chem. Biol., 8:222-229 (2004), Ponchon, L. et al., Nat. Protoc., 4:947-959 (2009), Ponchon, L. et al., Nat. Methods, 4:571-576 (2007), Ponchon, L. et al., Methods, 54:267-273 (2011), and U.S. Patent Application No, 2009 / 0298920, each of which is herein incorporated by reference in its entirety, describe methods for production of RNA. In some embodiments, RNA molecules, or preparations thereof, are prepared by in vitro 25 12243502v1Attorney Docket No.047162-7527WO1 transcription. In some embodiments, RNA molecules, or preparations thereof, are prepared by chemical synthesis. In some embodiments, RNA molecules, or preparations thereof, are prepared by a combination of in vitro transcription and chemical synthesis.

[0146] In one embodiment, the RNA molecule comprises any ribonucleic chain.

[0147] In another embodiment, the RNA molecule comprises about 1,000 ribonucleotides in length, illustratively, about 5 to about 1,000, about 10 to about 900, about 20 to about 500, about 30 to about 300, about 40 to about 200, and about 70 to about 100 ribonucleotides.

[0148] In other embodiments, the RNA molecule comprises about 76 to about 96 ribonucleotides.

[0149] In other embodiments, the RNA molecule comprises about 60 to about 86 ribonucleotides.

[0150] In some embodiments, formation of a bond between the at least nucleotide and the tRNA modifying enzyme can be achieved through any of a variety of direct or indirect covalent associations or attachments.

[0151] In one embodiment, the at least one nucleotide is capable of forming a covalent bond to a tRNA modifying enzyme through direct or indirect formation of a covalent bond between a base of the at least one nucleotide and an amino acid residue of the tRNA modifying enzyme.

[0152] In other embodiments, the covalent attachment of the at least one nucleotide to the tRNA modifying enzyme is irreversible.

[0153] In another embodiment, the covalent attachment of the at least one nucleotide to the tRNA modifying enzyme inhibits the tRNA modifying enzyme. In one embodiment, inhibition comprises a decrease of at least about 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% in tRNA modifying enzyme activity. In another embodiment, inhibition comprises a decrease of 100% in tRNA modifying enzyme activity.

[0154] In some embodiments, formation of the bond covalently traps the tRNA modifying enzyme, irreversibly inhibiting.

[0155] In some embodiments, the at least one nucleotide is a non-natural nucleotide. In one embodiment, the at least one nucleotide comprises a non-natural base.

[0156] In one embodiment, the RNA molecule comprises no more than 1, 2, 3, 4, ,5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 non-natural nucleotides, independently each nucleotide comprising a non-natural base. 26 12243502v1Attorney Docket No.047162-7527WO1

[0157] One of ordinary skill in the art will recognize that a large number of “synthetic” non- natural nucleosides comprising various heterocyclic bases and / or various sugar moieties (and sugar analogs) are available in the art, and that as long as other criteria of the present invention are satisfied, the RNA molecule can include one or several heterocyclic bases other than the principal five base components of naturally-occurring nucleic acids.

[0158] In some embodiments, the heterocyclic base includes, but is not limited to, uracil-5-yl cytosine-5-yl, adenine-7-yl, adenine-8-yl, guanine-7-yl, guanine-8-yl, 4-aminopyrrolo[2,3- d]pyrimidin-5-yl, 2-amino-4-oxopyrolo[2,3-d]pyrimidin-5-yl, 2-amino-4-oxopyrrolo[2,3- d]pyrimidin-3-yl groups, where the purines are attached to the sugar moiety of the ISS via the 9- position, the pyrimidines via the 1-position, the pyrrolopyrimidines via the 7-position and the pyrazolopyrimidines via the 1-position.

[0159] In other embodiments, the at least one nucleotide comprises at least one modified base. Examples of base modifications include, but are not limited to, uracils modified at C-5 and / or C- 6, preferably with a halogen, including, but are not limited to, fluorouracil such as 5-fluorouracil (5-FU), bromouracil such as 5-bromouracil, chlorouracil such as 5-chlorouracil, and iodouracil such as 5-iodouracil and hydroxyuracil. Other examples of base modifications include 8- azaadenosine (8-aza-Ad), 7-deazaadenosine, N6-methyl-7-deazaadenosine, N6methyl-8- azaadenosine, 7-deaza-8-azaadenosine, N6-methyl-7-deaza-8-azaadenosine, N625 amino-7- deazaadenosine, N6-amino-8-azaadenosine, N6-amino-7-deaza-8-azaadenosine, N6- hydroxyadenosine, N6-hydroxy-7-deazaadenosine, N6-hydroxy-8-azaadenosine, N6-hydroxy-7- deaza-8-azaadenosine, 6-thioguanosine, 7-deazaguanosine, 8-azaguanosine, 6thio-7- deazaguanosine, 6-thio-8-azaguanosine, 7-deaza-8-azaguanosine, and 6-thio-7deaza-8- azaguanosine. azacytosine, 5-bromocytosine, 5-chlorocytosine, chlorinated cytosine, cyclocytosine, cytosine arabinoside, 5-fluorocytosine, fluoropyrimidine, 5,6-dihydrocytosine, 5- iodocytosine, 5-nitrocytosine, 5-hydroxy-cytosine, 6-thio-guanine, and 4-thiouracil.

[0160] In one embodiment, the at least one nucleotide comprising a non-natural base is 5-halo (halo=F / Cl / Br / I) uridine, 5-halo (halo=F / Cl / Br / I) cytidine, 5-aza-cytidine, 8-halo (halo=F / Cl / Br / I) adenosine, 8-azanebularine, 8-aza-adenosine, or 8-halo (halo=F / Cl / Br / I) guanosine.

[0161] In some embodiments, the amino acid residue of the tRNA modifying enzyme is a conserved catalytic amino acid residue. 27 12243502v1Attorney Docket No.047162-7527WO1

[0162] In other embodiments, the amino acid residue of the tRNA modifying enzyme is a reactive amino acid residue.

[0163] In one embodiment, the amino acid residue of the tRNA modifying enzyme is a reactive nucleophilic amino acid residue.

[0164] In some embodiments, the reactive nucleophilic amino acid residue is a reactive cysteine residue, wherein formation of the covalent bond occurs via nucleophilic attack of the at least one nucleotide by the reactive cysteine residue.

[0165] In another embodiment, the at least one nucleotide of the RNA molecule is a 5- halopyrmidine, wherein the at least one nucleotide is capable of forming a covalent bond with a conserved catalytic cysteine residue of the tRNA modifying enzyme, wherein the covalent bond crosslinks the RNA molecule to the tRNA modifying enzyme.

[0166] Without being limited by theory, in some embodiments, the crosslink begins with reduction (e.g., enzymatic reduction) of 5-halouridine to 5-halodihydrouridine followed by nucleophilic attack of a conserved catalytic cysteine of the tRNA modifying enzyme on the C5 position with halide serving as leaving group. Dai, W. et al., Nat Chem Biol., 17(11):1178–1187 (2021), which describe activity-based RNA modifying enzyme probing, is herein incorporated by reference in its entirety.

[0167] In one embodiment, the RNA molecule is a tRNA molecule.

[0168] The general characteristics of a naturally occurring tRNA are well-known to one of ordinary skill in the art. Sprinzl, M. et al., Nucleic Acids Research, 26(1):148-153 (1998), which is herein incorporated by reference in its entirety, describe compilation of tRNA sequences and sequences of tRNA genes.

[0169] In some embodiments, the tRNA molecule of the present invention is a single ribonucleotide chain which is capable of folding to adopt a characteristic, so-called cloverleaf secondary structure.

[0170] In some embodiments, the secondary structure comprises (i) an acceptor stem composed of a first 7 ribonucleotides of the 5’ end of the ribonucleotide chain and 7 ribonucleotides that precede the last 4 ribonucleotides of the 3’ end of the ribonucleotide chain, thus forming a double-stranded structure comprising about 6 or 7 pairs of ribonucleotides, it being possible for the ribonucleotides comprising the first ribonucleotide of the 5’ end of the ribonucleotide chain and the ribonucleotide that precedes the last 4 ribonucleotides of the 3’ end of the ribonucleotide 28 12243502v1Attorney Docket No.047162-7527WO1 chain not to be paired; (ii) a D arm comprising 4 pairs of ribonucleotides and a D loop comprising about 8 to 10 ribonucleotides, formed by the folding of a part of the ribonucleotide chain that follows the first 7 ribonucleotides of the 5’ end of the ribonucleotide chain; (iii) a stem of the anticodon comprising 5 pairs of ribonucleotides, and a loop of the anticodon comprising about 7 ribonucleotides (stem-loop of the anticodon), formed by the folding of a part of the ribonucleotide chain that follows the D arm and the D loop; (iv) a variable loop comprising about 4 to about 21 ribonucleotides and formed by a part of the ribonucleotide chain that follows the stem of the anticodon and the loop of the anticodon; (v) a T arm comprising about 5 pairs of ribonucleotides, and a T loop comprising about 8 ribonucleotides, formed by the folding of a part of the ribonucleotide chain that follows the variable loop and precedes the ribonucleotides of the 3’ end of the ribonucleotide chain which comprising the acceptor stem.

[0171] In some embodiments, the tRNA modifying enzyme is a dihydrouridine synthase (DUS) or a pseudouridine synthase (PUS). Both DUS and PUS are known to contain highly conserved cysteine or aspartic acid residues in their respective active sites.

[0172] In some embodiments, the tRNA modifying enzyme is dihydrouridine synthase 1 (DUS1), dihydrouridine synthase 2 (DUS2), dihydrouridine synthase 3 (DUS3), dihydrouridine synthase 4 (DUS4), dihydrouridine synthase 1-like (DUS1L), dihydrouridine synthase 3 like (DUS3L), dihydrouridine synthase 4 like (DUS4L), pseudouridine synthase 1 (PUS1), pseudouridine synthase like 1(PUSL1), pseudouridine synthase 3 (PUS3), TruB pseudouridine synthase family member 1 (TRUB1), TruB pseudouridine synthase family member 2 (TRUB2), dyskerin pseudouridine synthase 1 (DKC1), pseudouridine synthase 7 (PUS7), pseudouridine synthase 7 like (PUS7L), RNA pseudouridylate synthase domain containing 1 (RPUSD1), RNA pseudouridylate synthase domain containing 2 (RPUSD2), RNA pseudouridylate synthase domain containing 4 (RPUSD4), pseudouridine synthase 10 (PUS10), tRNA methyltransferase 2 homolog A (TRMT2A), tRNA methyltransferase 2 homolog B (TRMT2B), NOP2 / Sun RNA methyltransferase 2 (NSUN2), NOP2 / Sun RNA methyltransferase 3 (NSUN3), NOP2 / Sun RNA methyltransferase 6 (NSUN6), DNA methyltransferase 2 (DNMT2), Methyltransferase-Like Protein 1 (METTL1), WD repeat domain 4 (WDR4), adenosine deaminase TRNA specific 1 (ADAT1), adenosine deaminase TRNA specific 2 (ADAT2), adenosine deaminase TRNA specific 2 (ADAT3), or ISCU. 29 12243502v1Attorney Docket No.047162-7527WO1

[0173] In some embodiments, the non-natural base in the RNA molecule is selected based on the target tRNA modifying enzyme that the RNA molecule is to inhibit. A non-limiting list of nucleotides comprising non-natural bases together with tRNA modifying enzymes is shown below in Table 1. Table 1: Examples of enzymes and nucleotides comprising non-natural bases tRNA modifying enzyme Nucleotide TRMT2A 5-haloU TRMT2B 5-haloU NSUN2 5-azaC OR 5-haloC DNMT2 5-azaC OR 5-haloC NSUN3 5-azaC OR 5-haloC NSUN6 5-azaC OR 5-haloC METTL1 8-halo-G WDR4 8-halo-G ADAT1 8-aza-A ADAT2 8-aza-A ADAT3 8-aza-A PUS1 5-haloU PUSL1 5-haloU PUS3 5-haloU TRUB1 5-haloU TRUB2 5-haloU PUS7 5-haloU PUS7L 5-haloU RPUSD1 5-haloU RPUSD2 5-haloU RPUSD4 5-haloU PUS10 5-haloU DUS1L 5-haloU DUS2 5-haloU 30 12243502v1Attorney Docket No.047162-7527WO1 DUS3L 5-haloU DUS4L 5-haloU ISCU 5-haloU

[0174] In some embodiments, the non-natural base is 5-haloU, and the tRNA modifying enzyme is DUS2, DUS1L, DUS3L, DUS4L, ISCU, PUS1, PUS3, PUS7, PUS10, PUSL1, PUS7L, RPUSD1, RPUSD2, RPUSD4, TRMT2A, TRMT2B, TRUB1, TRUB2, or combinations thereof.

[0175] Base modifications of natural tRNA molecules by tRNA modifying enzymes in humans and other species have been extensively mapped, and there is a large amount of available information regarding natural tRNA molecules modified by these enzymes, as well as the specific naturally occurring nucleotides of the naturally occurring tRNA molecule that are modified by these enzymes. As such, in some embodiments, the tRNA molecule of the present invention comprises the sequence of a naturally occurring tRNA molecule, wherein the at least one nucleotide is a non-natural nucleotide located at a nucleotide position of the tRNA molecule that corresponds to the naturally occurring position, or is at a position that is no more than five, four, three, two, or one nucleotide position away from the naturally occurring position, in the naturally occurring tRNA molecule.

[0176] The location of the non-natural base is not limited, as tRNA modifying enzymes, such as those described herein, are known to modify bases located in virtually all the locations of tRNA molecules. In some embodiments, the location of the non-natural base is determined based on the enzyme to be inhibited, the sequence of the parent natural tRNA, as well as the non-natural base. For example, DUS enzymes can modify uridines in the D-loop (as well as uridines outside the D- loop such as the tRNA stems) of tRNAs and can be inhibited by 5-halo uridine. As such, in some embodiments, inhibitors specific for DUS enzymes can be designed by modifying natural tRNA by incorporating a 5-halo uridine in the D-loop. For another example, PUS can modify uridines in the D-loop, the t-psi-c loop, or the anticodon loop (as well as uridines outside the D-loop such as the tRNA stems). In other embodiments, inhibitors specific for PUS enzymes can be designed by modifying natural tRNA by incorporating a 5-halo uridine in the D-loop, the t-psi-c loop, and / or the anticodon loop. 31 12243502v1Attorney Docket No.047162-7527WO1

[0177] In some embodiments, the tRNA molecule comprises an anticodon-arm and an acceptor arm, wherein the anticodon-arm comprises a trinucleotide anticodon, wherein the anticodon recognizes a stop codon. In other embodiments, the anticodon recognizes a codon for alanine, arginine, aspartic acid, asparagine, cysteine, glycine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, or valine. In one embodiment, the anticodon recognizes a codon for cysteine. In another embodiment, the acceptor arm comprises a 3'-terminal sequence of 5’-cytidine-cytidine- adenosine (CCA)-3’ that overhangs the end.

[0178] In some embodiments, the RNA molecule comprises the sequence: GGGGGXAXAGCXCAGXGGXAGAGCAXXXGACXGCAGAXCAAGAGGXCCCCGGXX CAAAXCCGGGXGCCCCC (SEQ ID NO: 1), wherein one or more of the Xs comprise any nucleotide comprising a non-natural base such as, for example, 5-halouracil, 5-halocytidine,-5- aza-cytidine, or combinations thereof. In other embodiments, the RNA molecule comprises the sequence of SEQ ID NO:1, with the proviso that X is a U, C, or G, and one or more U, C, or G of SEQ ID NO:1 comprises a non-natural base.

[0179] In some embodiments, the RNA molecule comprises the sequence: GGGGGXAXAGCXCAGXGGXAGAGCGCGXGCXXAGCAXGCACGAGGXCCXGGGXX CGAXCCCCAGXACCXCCA (SEQ ID NO: 2), wherein one or more of the Xs comprise any nucleotide comprising a non-natural base such as, for example, 5-halouracil, 5-halocytidine, -5- aza-cytidine, or combinations thereof. In other embodiments, the RNA molecule comprises the sequence of SEQ ID NO:2, with the proviso that X is a U, C, or G, and one or more U, C, or G of SEQ ID NO:2 comprises a non-natural base.

[0180] In some embodiments, the RNA molecule comprises the sequence: GUUUXXGUAGUGUAGUGGUUAUXAXGUUXGXXUAAXAXGXGAAAGGUXXXXGGU UXGAAAXXGGGXGGAAAXA (SEQ ID NO: 3), wherein one or more of the Xs comprise any nucleotide comprising a non-natural base such as, for example, 5-halouracil, 5-halocytidine, -5- aza-cytidine, or combinations thereof. In other embodiments, the RNA molecule comprises the sequence of SEQ ID NO:3, with the proviso that X is a U, C, or G, and one or more U, C, or G of SEQ ID NO:3 comprises a non-natural base.

[0181] In some embodiments, the RNA molecule comprises the sequence: GGXUXGUUGGUXUAGGGGUAUGAUUXUXGXUUAGGGUGXGAGAGGUXXXGGGUU 32 12243502v1Attorney Docket No.047162-7527WO1 XAAAUXXXGGAXGAGXXX (SEQ ID NO: 4), wherein one or more of the Xs comprise any nucleotide comprising a non-natural base such as, for example, 5-halouracil, 5-halocytidine, -5- aza-cytidine, or combinations thereof. In other embodiments, the RNA molecule comprises the sequence of SEQ ID NO:4, with the proviso that X is a U, C, or G, and one or more U, C, or G of SEQ ID NO:4 comprises a non-natural base.

[0182] In some embodiments, the RNA molecule comprises the sequence: GGGGGUAUAGXUXAGUGGUAGAGXGXGUGXUUAGXAUGXAXGAGGUXXUGGGUU XGAUXXXXAGUAXXUXXA (SEQ ID NO: 5), wherein one or more of the Xs comprise any nucleotide comprising a non-natural base such as, for example, 5-halouracil, 5-halocytidine, -5- aza-cytidine, or combinations thereof. In other embodiments, the RNA molecule comprises the sequence of SEQ ID NO:5, with the proviso that X is a U, C, or G, and one or more U, C, or G of SEQ ID NO:5 comprises a non-natural base.

[0183] In some embodiments, the RNA molecule comprises the sequence: GXXXCCGXAGXGXAGXGGXXAXCACGXXCGCCXAACACGCGAAAGGXCCCCGGXX CGAAACCGGGCGGAAACA (SEQ ID NO: 6), wherein one or more of the Xs comprise any nucleotide comprising a non-natural base such as, for example, 5-halouracil, 5-halocytidine, -5- aza-cytidine, or combinations thereof. In other embodiments, the RNA molecule comprises the sequence of SEQ ID NO:6, with the proviso that X is a U, C, or G, and one or more U, C, or G of SEQ ID NO:6 comprises a non-natural base.

[0184] In some embodiments, the RNA molecule comprises the sequence: GGCXCGXXGGXCXAGGGGXAXGAXXCXCGCXXAGGGXGCGAGAGGXCCCGGGXX CAAAXCCCGGACGAGCCC (SEQ ID NO: 7), wherein one or more of the Xs comprise any nucleotide comprising a non-natural base such as, for example, 5-halouracil, 5-halocytidine, -5- aza-cytidine, or combinations thereof. In other embodiments, the RNA molecule comprises the sequence of SEQ ID NO:7, with the proviso that X is a U, C, or G, and one or more U, C, or G of SEQ ID NO:7 comprises a non-natural base.

[0185] In some embodiments, the RNA molecule comprises the sequence: AGCAGAGXGGCGCAGCGGAAGCGXGCXGGGCCCAXAACCCAGAGGXCGAXGGAXC GAAACCAXCCXCXGCXA (SEQ ID NO: 8), wherein one or more of the Xs comprise any nucleotide comprising a non-natural base such as, for example, 5-halouracil, 5-halocytidine, -5- aza-cytidine, or combinations thereof. In other embodiments, the RNA molecule comprises the 33 12243502v1Attorney Docket No.047162-7527WO1 sequence of SEQ ID NO:8, with the proviso that X is a U, C, or G, and one or more U, C, or G of SEQ ID NO:8 comprises a non-natural base.

[0186] In some embodiments, the RNA molecule comprises the sequence: AGXAGAGUGGXGXAGXGGAAGXGUGXUGGGXXXAUAAXXXAGAGGUXGAUGGAU XGAAAXXAUXXUXUGXUA (SEQ ID NO: 9), wherein one or more of the Xs comprise any nucleotide comprising a non-natural base such as, for example, 5-halouracil, 5-halocytidine, -5- aza-cytidine, or combinations thereof. In other embodiments, the RNA molecule comprises the sequence of SEQ ID NO:9, with the proviso that X is a U, C, or G, and one or more U, C, or G of SEQ ID NO:9 comprises a non-natural base.

[0187] In some embodiments, the RNA molecule comprises the sequence: GGGGGUAUAGXUXAGUGGUAGAGXAUUUGAXUGXAGAUXAAGAGGUXXXXGGUU XAAAUXXGGGUGXXXXXU (SEQ ID NO: 10), wherein one or more of the Xs comprise any nucleotide comprising a non-natural base such as, for example, 5-halouracil, 5-halocytidine, -5- aza-cytidine, or combinations thereof. In other embodiments, the RNA molecule comprises the sequence of SEQ ID NO:10, with the proviso that X is a U, C, or G, and one or more U, C, or G of SEQ ID NO:10 comprises a non-natural base.

[0188] In some embodiments, a provided RNA molecule comprises one or more residues with the sequence: GGGGGXAXAGCXCAGXGGXAGAGCAXXXGACXGCAGAXCAAGAGGXCCCCGGXX CAAAXCCGGGXGCCCCC (SEQ ID NO: 1), wherein two or more of the Xs comprise a nucleotide comprising a non-natural base. In some embodiments, five or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 10 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 15 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 20 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, all Xs comprise a nucleotide comprising a non-natural base.

[0189] In some embodiments, a provided RNA molecule comprises one or more residues with the sequence: GGGGGXAXAGCXCAGXGGXAGAGCGCGXGCXXAGCAXGCACGAGGXCCXGGGXX CGAXCCCCAGXACCXCCA (SEQ ID NO: 2), wherein two or more of the Xs comprise a nucleotide comprising a non-natural base. In some embodiments, five or more Xs comprise a 34 12243502v1Attorney Docket No.047162-7527WO1 nucleotide comprising a non-natural base. In some embodiments, 10 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 15 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 20 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, all Xs comprise a nucleotide comprising a non-natural base.

[0190] In some embodiments, a provided RNA molecule comprises one or more residues with the sequence: GUUUXXGUAGUGUAGUGGUUAUXAXGUUXGXXUAAXAXGXGAAAGGUXXXXGGU UXGAAAXXGGGXGGAAAXA (SEQ ID NO: 3), wherein two or more of the Xs comprise a nucleotide comprising a non-natural base. In some embodiments, five or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 10 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 15 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 20 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, all Xs comprise a nucleotide comprising a non-natural base.

[0191] In some embodiments, a provided RNA molecule comprises one or more residues with the sequence: GGXUXGUUGGUXUAGGGGUAUGAUUXUXGXUUAGGGUGXGAGAGGUXXXGGGUU XAAAUXXXGGAXGAGXXX (SEQ ID NO: 4), wherein two or more of the Xs comprise a nucleotide comprising a non-natural base. In some embodiments, five or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 10 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 15 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 20 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, all Xs comprise a nucleotide comprising a non-natural base.

[0192] In some embodiments, a provided RNA molecule comprises one or more residues with the sequence: GGGGGUAUAGXUXAGUGGUAGAGXGXGUGXUUAGXAUGXAXGAGGUXXUGGGUU XGAUXXXXAGUAXXUXXA (SEQ ID NO: 5), wherein two or more of the Xs comprise a nucleotide comprising a non-natural base. In some embodiments, five or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 10 or more Xs comprise a 35 12243502v1Attorney Docket No.047162-7527WO1 nucleotide comprising a non-natural base. In some embodiments, 15 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 20 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, all Xs comprise a nucleotide comprising a non-natural base.

[0193] In some embodiments, a provided RNA molecule comprises one or more residues with the sequence: GXXXCCGXAGXGXAGXGGXXAXCACGXXCGCCXAACACGCGAAAGGXCCCCGGXX CGAAACCGGGCGGAAACA (SEQ ID NO: 6), wherein two or more of the Xs comprise a nucleotide comprising a non-natural base. In some embodiments, five or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 10 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 15 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 20 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, all Xs comprise a nucleotide comprising a non-natural base.

[0194] In some embodiments, a provided RNA molecule comprises one or more residues with the sequence: GGCXCGXXGGXCXAGGGGXAXGAXXCXCGCXXAGGGXGCGAGAGGXCCCGGGXX CAAAXCCCGGACGAGCCC (SEQ ID NO: 7), wherein two or more of the Xs comprise a nucleotide comprising a non-natural base. In some embodiments, five or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 10 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 15 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 20 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, all Xs comprise a nucleotide comprising a non-natural base.

[0195] In some embodiments, a provided RNA molecule comprises one or more residues with the sequence: AGCAGAGXGGCGCAGCGGAAGCGXGCXGGGCCCAXAACCCAGAGGXCGAXGGAXC GAAACCAXCCXCXGCXA (SEQ ID NO: 8), wherein two or more of the Xs comprise a nucleotide comprising a non-natural base. In some embodiments, five or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 10 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 15 or more Xs comprise a 36 12243502v1Attorney Docket No.047162-7527WO1 nucleotide comprising a non-natural base. In some embodiments, 20 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, all Xs comprise a nucleotide comprising a non-natural base.

[0196] In some embodiments, a provided RNA molecule comprises one or more residues with the sequence: AGXAGAGUGGXGXAGXGGAAGXGUGXUGGGXXXAUAAXXXAGAGGUXGAUGGAU XGAAAXXAUXXUXUGXUA (SEQ ID NO: 9), wherein two or more of the Xs comprise a nucleotide comprising a non-natural base. In some embodiments, five or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 10 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 15 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 20 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, all Xs comprise a nucleotide comprising a non-natural base.

[0197] In some embodiments, a provided RNA molecule comprises one or more residues with the sequence: GGGGGUAUAGXUXAGUGGUAGAGXAUUUGAXUGXAGAUXAAGAGGUXXXXGGUU XAAAUXXGGGUGXXXXXU (SEQ ID NO: 10), wherein two or more of the Xs comprise a nucleotide comprising a non-natural base. In some embodiments, five or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 10 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 15 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, 20 or more Xs comprise a nucleotide comprising a non-natural base. In some embodiments, all Xs comprise a nucleotide comprising a non-natural base.

[0198] In some embodiments, at least one non-natural base is 5-halouracil. In some embodiments, at least 1% of the non-natural bases in the tRNA molecule are 5-halouracil. In some embodiments, at least one non-natural base is 5-halouracil. In some embodiments, at least 5% of the non-natural bases in the tRNA molecule are 5-halouracil. In some embodiments, at least one non-natural base is 5-halouracil. In some embodiments, at least 10% of the non-natural bases in the tRNA molecule are 5-halouracil. In some embodiments, at least 25% of the non- natural bases in the tRNA molecule are 5-halouracil. In some embodiments, at least 50% of the non-natural bases in the tRNA molecule are 5-halouracil. In some embodiments, at least 75% of 37 12243502v1Attorney Docket No.047162-7527WO1 the non-natural bases in the tRNA molecule are 5-halouracil. In some embodiments, all non- natural bases in the tRNA molecule are 5-halouracil.

[0199] In some embodiments, at least one non-natural base is 5- halocytidine. In some embodiments, at least 1% of the non-natural bases in the tRNA molecule are 5- halocytidine. In some embodiments, at least one non-natural base is 5- halocytidine. In some embodiments, at least 5% of the non-natural bases in the tRNA molecule are 5- halocytidine. In some embodiments, at least one non-natural base is 5- halocytidine. In some embodiments, at least 10% of the non-natural bases in the tRNA molecule are 5- halocytidine. In some embodiments, at least 25% of the non-natural bases in the tRNA molecule are 5- halocytidine. In some embodiments, at least 50% of the non-natural bases in the tRNA molecule are 5- halocytidine. In some embodiments, at least 75% of the non-natural bases in the tRNA molecule are 5- halocytidine. In some embodiments, all non-natural bases in the tRNA molecule are 5- halocytidine.

[0200] In some embodiments, at least one non-natural base is 5- aza-cytidine. In some embodiments, at least 1% of the non-natural bases in the tRNA molecule are 5- aza-cytidine. In some embodiments, at least one non-natural base is 5- aza-cytidine. In some embodiments, at least 5% of the non-natural bases in the tRNA molecule are 5- aza-cytidine. In some embodiments, at least one non-natural base is 5- aza-cytidine. In some embodiments, at least 10% of the non-natural bases in the tRNA molecule are 5- aza-cytidine. In some embodiments, at least 25% of the non-natural bases in the tRNA molecule are 5- aza-cytidine. In some embodiments, at least 50% of the non-natural bases in the tRNA molecule are 5- aza-cytidine. In some embodiments, at least 75% of the non-natural bases in the tRNA molecule are 5- aza- cytidine. In some embodiments, all non-natural bases in the tRNA molecule are 5- aza-cytidine.

[0201] In some embodiments, at least one non-natural base is 5-halouracil and at least one non- natural base is 5-halocytidine. In some embodiments, at least 1% of the non-natural bases in the tRNA molecule are 5-halouracil and at most 99% of the non-natural bases in the tRNA molecule are 5-halocytidine. In some embodiments, at least one non-natural base is 5-halouracil and at least one non-natural base is 5-halocytidine. In some embodiments, at least 5% of the non-natural bases in the tRNA molecule are 5-halouracil and at most 99% of the non-natural bases in the tRNA molecule are 5-halocytidine. In some embodiments, at least one non-natural base is 5- halouracil and at least one non-natural base is 5-halocytidine. In some embodiments, at least 10% 38 12243502v1Attorney Docket No.047162-7527WO1 of the non-natural bases in the tRNA molecule are 5-halouracil and at most 90% of the non- natural bases in the tRNA molecule are 5-halocytidine. In some embodiments, at least one non- natural base is 5-halouracil and at least one non-natural base is 5-halocytidine. In some embodiments, at least 25% of the non-natural bases in the tRNA molecule are 5-halouracil and at most 75% of the non-natural bases in the tRNA molecule are 5-halocytidine. In some embodiments, at least one non-natural base is 5-halouracil and at least one non-natural base is 5- halocytidine and at most 50% of the non-natural bases in the tRNA molecule are 5-halocytidine. In some embodiments, at least 50% of the non-natural bases in the tRNA molecule are 5- halouracil. In some embodiments, at least one non-natural base is 5-halouracil and at least one non-natural base is 5-halocytidine. In some embodiments, at least 75% of the non-natural bases in the tRNA molecule are 5-halouracil and at most 25% of the non-natural bases in the tRNA molecule are 5-halocytidine. In some embodiments, at least one non-natural base is 5-halouracil and at least one non-natural base is 5-halocytidine. In some embodiments, at least one non- natural base is 5-halouracil and at least one non-natural base is 5-halocytidine. In some embodiments, at least 90% of the non-natural bases in the tRNA molecule are 5-halouracil and at most 10% of the non-natural bases in the tRNA molecule are 5-halocytidine. In some embodiments, at least 95% of the non-natural bases in the tRNA molecule are 5-halouracil and at most 5% of the non-natural bases in the tRNA molecule are 5-halocytidine. In some embodiments, at least one non-natural base is 5-halouracil and at least one non-natural base is 5- halocytidine. In some embodiments, at least 99% of the non-natural bases in the tRNA molecule are 5-halouracil and at most 1% of the non-natural bases in the tRNA molecule are 5- halocytidine.

[0202] In some embodiments, each instance of X in SEQ ID NOs:1-10 is a nucleotide with a non-natural base. In some such embodiments, a non-natural base is selected from the group consisting of halouracil (e.g., fluorouracil such as 5-fluorouracil (5-FU); bromouracil such as 5- bromouracil; chlorouracil such as 5-chlorouracil; and iodouracil such as 5-iodouracil and hydroxyuracil), 8-azaadenosine (8-aza-Ad), 7-deazaadenosine, N6-methyl-7-deazaadenosine, N6methyl-8-azaadenosine, 7-deaza-8-azaadenosine, N6-methyl-7-deaza-8-azaadenosine, N625 amino-7-deazaadenosine, N6-amino-8-azaadenosine, N6-amino-7-deaza-8-azaadenosine, N6- hydroxyadenosine, N6-hydroxy-7-deazaadenosine, N6-hydroxy-8-azaadenosine, N6-hydroxy-7- deaza-8-azaadenosine, 6-thioguanosine, 7-deazaguanosine, 8-azaguanosine, 6thio-7- 39 12243502v1Attorney Docket No.047162-7527WO1 deazaguanosine, 6-thio-8-azaguanosine, 7-deaza-8-azaguanosine, and 6-thio-7deaza-8- azaguanosine. azacytosine, 5-bromocytosine, 5-chlorocytosine, chlorinated cytosine, cyclocytosine, cytosine arabinoside, 5-fluorocytosine, fluoropyrimidine, 5,6-dihydrocytosine, 5- iodocytosine, 5-nitrocytosine, 5-hydroxy-cytosine, 6-thio-guanine, and 4-thiouracil, and combinations thereof. In some such embodiments, such non-natural base is 5-halouracil; in some such embodiments, such non-natural base is 5-fluorouracil.

[0203] In some embodiments, an RNA molecule comprises one or more residues with the sequence: GGGGG[5FU]A[5FU]AGC[5FU]CAG[5FU]GG[5FU]AGAGCA[5FU][5FU][5FU]GAC[5FU] GCAGA[5FU]CAAGAGG[5FU]CCCCGG[5FU][5FU]CAAA[5FU]CCGGG[5FU]GCCCCC (SEQ ID NO: 11).

[0204] In some embodiments, an RNA molecule comprises one or more residues with the sequence: GGGGG[5FC]A[5FC]AGC[5FC]CAG[5FC]GG[5FC]AGAGCA[5FC][5FC][5FC]GAC[5FC]G CAGA[5FC]CAAGAGG[5FC]CCCCGG[5FC][5FC]CAAA[5FC]CCGGG[5FC]GCCCCC (SEQ ID NO: 12).

[0205] In some embodiments, an RNA molecule comprises one or more residues with the sequence: GGGGG[5FU]A[5FU]AGC[5FU]CAG[5FU]GG[5FU]AGAGCGCG[5FU]GC[5FU][5FU]AGC A[5FU]GCACGAGG[5FU]CC[5FU]GGG[5FU][5FU]CGA[5FU]CCCCAG[5FU]ACC[5FU]C CA (SEQ ID NO: 13).

[0206] In some embodiments, an RNA molecule comprises one or more residues with the sequence: GGGGG[5FC]A[5FC]AGC[5FC]CAG[5FC]GG[5FC]AGAGCGCG[5FC]GC[5FC][5FC]AGC A[5FC]GCACGAGG[5FC]CC[5FC]GGG[5FC][5FC]CGA[5FC]CCCCAG[5FC]ACC[5FC]CC A (SEQ ID NO: 14).

[0207] In some embodiments, an RNA molecule comprises one or more residues with the sequence: GUUU[5FU][5FU]GUAGUGUAGUGGUUAU[5FU]A[5FU]GUU[5FU]G[5FU][5FU]UAA[5F U]A[5FU]G[5FU]GAAAGGU[5FU][5FU][5FU][5FU]GGUU[5FU]GAAA[5FU][5FU]GGG[5F U]GGAAA[5FU]A (SEQ ID NO: 15). 40 12243502v1Attorney Docket No.047162-7527WO1

[0208] In some embodiments, an RNA molecule comprises one or more residues with the sequence: GUUU[5FC][5FC]GUAGUGUAGUGGUUAU[5FC]A[5FC]GUU[5FC]G[5FC][5FC]UAA[5F C]A[5FC]G[5FC]GAAAGGU[5FC][5FC][5FC][5FC]GGUU[5FC]GAAA[5FC][5FC]GGG[5F C]GGAAA[5FC]A (SEQ ID NO: 16).

[0209] In some embodiments, an RNA molecule comprises one or more residues with the sequence: GG[5FU]U[5FU]GUUGGU[5FU]UAGGGGUAUGAUU[5FU]U[5FU]G[5FU]UUAGGGUG[5 FU]GAGAGGU[5FU][5FU][5FU]GGGUU[5FU]AAAU[5FU][5FU][5FU]GGA[5FU]GAG[5F U][5FU][5FU] (SEQ ID NO: 17).

[0210] In some embodiments, an RNA molecule comprises one or more residues with the sequence: GG[5FC]U[5FC]GUUGGU[5FC]UAGGGGUAUGAUU[5FC]U[5FC]G[5FC]UUAGGGUG[5F C]GAGAGGU[5FC][5FC][5FC]GGGUU[5FC]AAAU[5FC][5FC][5FC]GGA[5FC]GAG[5FC][ 5FC][5FC] (SEQ ID NO: 18).

[0211] In some embodiments, an RNA molecule comprises one or more residues with the sequence: GGGGGUAUAG[5FU]U[5FU]AGUGGUAGAG[5FU]G[5FU]GUG[5FU]UUAG[5FU]AUG[5 FU]A[5FU]GAGGU[5FU][5FU]UGGGUU[5FU]GAU[5FU][5FU][5FU][5FU]AGUA[5FU][5F U]U[5FU][5FU]A (SEQ ID NO: 19).

[0212] In some embodiments, a RNA molecule comprises one or more residues with the sequence: GGGGGUAUAG[5FC]U[5FC]AGUGGUAGAG[5FC]G[5FC]GUG[5FC]UUAG[5FC]AUG[5F C]A[5FC]GAGGU[5FC][5FC]UGGGUU[5FC]GAU[5FC][5FC][5FC][5FC]AGUA[5FC][5FC] U[5FC][5FC]A (SEQ ID NO: 20).

[0213] In some embodiments, an RNA molecule comprises one or more residues with the sequence: G[5FU][5FU][5FU]CCG[5FU]AG[5FU]G[5FU]AG[5FU]GG[5FU][5FU]A[5FU]CACG[5FU][ 5FU]CGCC[5FU]AACACGCGAAAGG[5FU]CCCCGG[5FU][5FU]CGAAACCGGGCGGAA ACA (SEQ ID NO: 21). 41 12243502v1Attorney Docket No.047162-7527WO1

[0214] In some embodiments, an RNA molecule comprises one or more residues with the sequence: G[5FC][5FC][5FC]CCG[5FC]AG[5FC]G[5FC]AG[5FC]GG[5FC][5FC]A[5FC]CACG[5FC][5 FC]CGCC[5FC]AACACGCGAAAGG[5FC]CCCCGG[5FC][5FC]CGAAACCGGGCGGAAA CA (SEQ ID NO: 22).

[0215] In some embodiments, an RNA molecule comprises one or more residues with the sequence: GGC[5FU]CG[5FU][5FU]GG[5FU]C[5FU]AGGGG[5FU]A[5FU]GA[5FU][5FU]C[5FU]CGC[ 5FU][5FU]AGGG[5FU]GCGAGAGG[5FU]CCCGGG[5FU][5FU]CAAA[5FU]CCCGGACGA GCCC (SEQ ID NO: 23).

[0216] In some embodiments, an RNA molecule comprises one or more residues with the sequence: GGC[5FC]CG[5FC][5FC]GG[5FC]C[5FC]AGGGG[5FC]A[5FC]GA[5FC][5FC]C[5FC]CGC[5 FC][5FC]AGGG[5FC]GCGAGAGG[5FC]CCCGGG[5FC][5FC]CAAA[5FC]CCCGGACGAG CCC (SEQ ID NO: 24).

[0217] In some embodiments, an RNA molecule comprises one or more residues with the sequence: AGCAGAG[5FU]GGCGCAGCGGAAGCG[5FU]GC[5FU]GGGCCCA[5FU]AACCCAGAGG [5FU]CGA[5FU]GGA[5FU]CGAAACCA[5FU]CC[5FU]C[5FU]GC[5FU]A (SEQ ID NO: 25).

[0218] In some embodiments, an RNA molecule comprises one or more residues with the sequence: AGCAGAG[5FC]GGCGCAGCGGAAGCG[5FC]GC[5FC]GGGCCCA[5FC]AACCCAGAGG[ 5FC]CGA[5FC]GGA[5FC]CGAAACCA[5FC]CC[5FC]C[5FC]GC[5FC]A (SEQ ID NO: 26).

[0219] In some embodiments, an RNA molecule comprises one or more residues with the sequence: AG[5FU]AGAGUGG[5FU]G[5FU]AG[5FU]GGAAG[5FU]GUG[5FU]UGGG[5FU][5FU][5FU ]AUAA[5FU][5FU][5FU]AGAGGU[5FU]GAUGGAU[5FU]GAAA[5FU][5FU]AU[5FU][5FU] U[5FU]UG[5FU]UA (SEQ ID NO: 27).

[0220] In some embodiments, an RNA molecule comprises one or more residues with the sequence: AG[5FC]AGAGUGG[5FC]G[5FC]AG[5FC]GGAAG[5FC]GUG[5FC]UGGG[5FC][5FC][5FC] 42 12243502v1Attorney Docket No.047162-7527WO1 AUAA[5FC][5FC][5FC]AGAGGU[5FC]GAUGGAU[5FC]GAAA[5FC][5FC]AU[5FC][5FC]U [5FC]UG[5FC]UA (SEQ ID NO: 28).

[0221] In some embodiments, an RNA molecule comprises one or more residues with the sequence: GGGGGUAUAG[5FU]U[5FU]AGUGGUAGAG[5FU]AUUUGA[5FU]UG[5FU]AGAU[5FU] AAGAGGU[5FU][5FU][5FU][5FU]GGUU[5FU]AAAU[5FU][5FU]GGGUG[5FU][5FU][5FU] [5FU][5FU]U (SEQ ID NO: 29).

[0222] In some embodiments, an RNA molecule comprises one or more residues with the sequence: GGGGGUAUAG[5FC]U[5FC]AGUGGUAGAG[5FC]AUUUGA[5FC]UG[5FC]AGAU[5FC]A AGAGGU[5FC][5FC][5FC][5FC]GGUU[5FC]AAAU[5FC][5FC]GGGUG[5FC][5FC][5FC][5 FC][5FC]U (SEQ ID NO: 30).

[0223] In some embodiments, the RNA molecule comprises a sequence of a natural tRNA molecule including, but not limited to, any one of the tRNA molecules listed in Table 2, with the proviso that the RNA molecule comprises at least one nucleotide capable of forming a covalent bond with a tRNA modifying enzyme at any one of the nucleotide positions. In some embodiments, at least one U, A, G or C residue in the natural tRNA molecule is substituted with a 5-haloU, 8-haloG, 5-halo-C, 5-aza-C, or 8-azaA. In some embodiments, the RNA molecule comprises about 80% identity or more with the parent tRNA, such as about 85% identity or more, about 90% identity or more, about 92% identity or more, about 95% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or identical. Table 2: Non-limiting examples of parent tRNA molecules for designing the RNA based inhibitor >tRNA-Val- UUUCCGUAGUGUAGUGGUUAUCACGUUCGCCUAACACGCGAAAG AAC-1-1 GUCCCCGGUUCGAAACCGGGCGGAAACACCA (SEQ ID NO:31) >tRNA-Val- UUUCCGUGGUGUAGUGGUUAUCACAUUCGCCUUACACGCGAAAG TAC-4-1 GUCCUCGGGUCGAAACCGAGCGGAAACACCA (SEQ ID NO:32) >tRNA-Val- UUUCCGUAGUGUAGUGGUUAUCACGUUCGCCUCACACGCGAAAG CAC-1-1 GUCCCCGGUUCGAAACCGGGCGGAAACACCA (SEQ ID NO:33) 43 12243502v1Attorney Docket No.047162-7527WO1 >tRNA-Val- GGGGUGUAGCUCAGUGGUAGAGCGUAUGCUUAACAUUCAUGAG AAC-6-1 GCUCUGGGUUCGAUCCCCAGCACUUCCACCA (SEQ ID NO:34) >tRNA-Val- UUUCCGUAGUGUAGUGGUUAUCACGUUCGCCUAACACGCGAAAG AAC-4-1 GUCCGCGGUUCGAAACCGGGCGGAAACACCA (SEQ ID NO:35) >tRNA-Tyr- UCUUCAAUAGCUCAGCUGGUAGAGCGGAGGACUGUAGAUUCUUA GTA-9-1 GGUGCUGGUUUGAUUCCGACUUGGAGAGCCA (SEQ ID NO:36) >tRNA-Tyr- CCUUCAAUAGUUCAGCUGGUAGAGCAGAGGACUAUAGGUCCUUA ATA-1-1 GGUUGCUGGUUCGAUUCCAGCUUGAAGGACCA (SEQ ID NO:37) >tRNA-Trp- ACCUCGUGGCGCAACGGCAGCGCGUCUGACUCCAGAUCAGAAGG CCA-5-1 UUGCGUGUUCAAAUCACGUCGGGGUCACCA (SEQ ID NO:38) >tRNA-Thr- GCUCCAUAGCUCAGGGGUUAGAGCACUGGUCUUGUAAACCAGGG TGT-6-1 UCGCGAGUUCAAAUCUCGCUGGGGCCUCCA (SEQ ID NO:39) >tRNA-Thr- GCCCUGUAGCUCAGCGGUUGGAGCGCUGGUCUCGUAAACCUAGG CGT-5-1 GGUCGUGAGUUCAAAUCUCACCAGGGCCUCCA (SEQ ID NO:40) >tRNA-Thr- GCCCUGUGGCUUAGCUGGUCAAAGCGCCUGUCUAGUAAACAGGA AGT-6-1 GAUCCUGGGUUCGAAUCCCAGCGGGGCCUCCA (SEQ ID NO:41) UAGUCGUGGCCGAGUGGUUAAGGCGAUGGACUUGAAAUCCAUUG >tRNA-Ser- GGGUUUCCCCGCGCAGGUUCGAAUCCUGUCGGCUACGCCA (SEQ TGA-4-1 ID NO:42) GAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAU >tRNA-Ser- UGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCGCCA GCT-6-1 (SEQ ID NO:43) UCACGGUGGCCGAGUGGUUAAGGCGUUGGACUCGAAAUCCAAUG >tRNA-Ser- GGGUUUCCCCGCACAGGUUCGAAUCCUGUUCGUGACGCCA (SEQ CGA-4-1 ID NO:44) UAGUCGUGGCCGAGUGGUUAAGGUGAUGGACUAGAAACCCAUUG >tRNA-Ser- GGGUCUCCCCGCGCAGGUUCGAAUCCUGCCGACUACGCCA (SEQ AGA-4-1 ID NO:45) 44 12243502v1Attorney Docket No.047162-7527WO1 CCCGGAUGAUCCUCAGUGGUCUGGGGUGCAGGCUUCAAACCUGU >tRNA-SeC- AGCUGUCUAGCGACAGAGUGGUUCAAUUCCACCUUUCGGGCGCC TCA-1-1 A (SEQ ID NO:46) >tRNA-Pro- GCUCGUUGGUCUAGGGGUAUGAUUCUCGCUUUGGGUGCGAGAGG TGG-3-1 UCCCGGGUUCAAAUCCCGGACGAGCCCCCA (SEQ ID NO:47) >tRNA-Pro- GCUCGUUGGUCUAGGGGUAUGAUUCUCGCUUCGGGUGUGAGAGG CGG-2-1 UCCCGGGUUCAAAUCCCGGACGAGCCCCCA (SEQ ID NO:48) >tRNA-Pro- GCUCGUUGGUCUAGGGGUAUGAUUCUCGCUUAGGGUGCGAGAGG AGG-2-1 UCCCGGGUUCAAAUCCCGGACGAGCCCCCA (SEQ ID NO:49) >tRNA-Phe- CUGAAAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUUAA GAA-6-1 AGUUCCCUGGUUCAACCCUGGGUUUCAGCCCCA (SEQ ID NO:50) >tRNA-Met- CCCUCUUAGUGCAGCUGGCAGCGCGUCAGUUUCAUAAUCUGAAA CAT-7-1 GUCCUGAGUUCAAGCCUCAGAGAGGGCACCA (SEQ ID NO:51) >tRNA-Lys- CCUGGAUAGCUCAGUUGGUAGAACAUCAGACUUUUAAUCUGACG TTT-7-1 GUGCAGGGUUCAAGUCCCUGUUCAGGCGCCA (SEQ ID NO:52) >tRNA-Lys- CCUGGAUAGCUCAGUUGGUAGAGCAUCAGACUUUUAAUCUGAGG TTT-1-1 GUCCAGGGUUCAAGUCCCUGUUCAGGCACCA (SEQ ID NO:53) >tRNA-Lys- CCCGGCUAGCUCAGUCGGUAGAGCAUGGGACUCUUAAUCCCAGG CTT-1-1 GUCGUGGGUUCGAGCCCCACGUUGGGCGCCA (SEQ ID NO:54) GUAGCGUGGCCGAGUGGUCUAAGGCGCUGGAUUUAGGCUCCAGU >tRNA-Leu- CAUUUCGAUGGCGUGGGUUCGAAUCCCACCGCUGCCACCA (SEQ TAG-3-1 ID NO:55) ACCGGGAUGGCUGAGUGGUUAAGGCGUUGGACUUAAGAUCCAAU >tRNA-Leu- GGACAGGUGUCCGCGUGGGUUCGAGCCCCACUCCCGGUACCA TAA-4-1 (SEQ ID NO:56) UCAGGAUGGCCGAGCGGUCUAAGGCGCUGCGUUCAGGUCGCAGU >tRNA-Leu- CUCCCCUGGAGGCGUGGGUUCGAAUCCCACUUCUGACACCA (SEQ CAG-2-1 ID NO:57) 45 12243502v1Attorney Docket No.047162-7527WO1 UCAGGAUGGCCGAGCAGUCUUAAGGCGCUGCGUUCAAAUCGCAC >tRNA-Leu- CCUCCGCUGGAGGCGUGGGUUCGAAUCCCACUUUUGACACCA CAA-6-1 (SEQ ID NO:58) GUAGCGUGGCCGAGUGGUCUAAGACGCUGGAUUAAGGCUCCAGU >tRNA-Leu- CUCUUCGGGGGCGUGGGUUUGAAUCCCACCGCUGCCACCA (SEQ AAG-4-1 ID NO:59) >tRNA-iMet- AGCAGAGUGGCGCAGCGGAAGCGUGCUGGGCCCAUAACCCAGAG CAT-2-1 GUCGAUGGAUCUAAACCAUCCUCUGCUACCA (SEQ ID NO:60) >tRNA-Ile- CUCCAGUGGCGCAAUCGGUUAGCGCGCGGUACUUAUAAUGCCGA TAT-3-1 GGUUGUGAGUUCAAGCCUCACCUGGAGCACCA (SEQ ID NO:61) >tRNA-Ile- GCCGGUUAGCUCAGUUGGUAAGAGCGUGGUGCUGAUAACACCAA GAT-1-1 GGUCGCGGGCUCGACUCCCGCACCGGCCACCA (SEQ ID NO:62) >tRNA-Ile- GCCGGUUAGCUCAGUUGGUUAGAGCGUGGCGCUAAUAACGCCAA AAT-1-1 GGUCGCGGGUUCGAUCCCCGUACGGGCCACCA (SEQ ID NO:63) >tRNA-His- CCAUGAUCGUAUAGUGGUUAGUACUCUGCGCUGUGGCCGCAGCA GTG-2-1 ACCUCGGUUCGAAUCCGAGUCACGGCACCA (SEQ ID NO:64) >tRNA-Gly- CGUUGGUGGUAUAGUGGUGAGCAUAGUUGCCUUCCAAGCAGUUG TCC-4-1 ACCCGGGCUCGAUUCCCGCCCAACGCACCA (SEQ ID NO:65) >tRNA-Gly- CAUUGGUGGUUCAGUGGUAGAAUUCUCGCCUGCCAUGCGGGCGG GCC-5-1 CCGGGCUUCGAUUCCUGGCCAAUGCACCA (SEQ ID NO:66) >tRNA-Gly- CAUUGGUGGUUCAAUGGUAGAAUUCUCGCCUCCCACGCAGGAGA CCC-3-1 CCCAGGUUCGAUUCCUGGCCAAUGCACCA (SEQ ID NO:67) >tRNA-Glu- UCCCUGGUGGUCUAGUGGCUAGGAUUCGGCGCUUUCACCGCCGC TTC-4-1 GGCCCGGGUUCGAUUCCCGGUCAGGGAACCA (SEQ ID NO:68) >tRNA-Glu- UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGCUCUCACCGCCGC CTC-2-1 GGCCCGGGUUCGAUUCCCGGUCAGGAAACCA (SEQ ID NO:69) >tRNA-Gln- GUCCCAUGGUGUAAUGGUUAGCACUCUGGGCUUUGAAUCCAGCA TTG-4-1 AUCCGAGUUCGAAUCUUGGUGGGACCUCCA (SEQ ID NO:70) >tRNA-Gln- GUUCCAUGGUGUAAUGGUAAGCACUCUGGACUCUGAAUCCAGCC CTG-7-1 AUCUGAGUUCGAGUCUCUGUGGAACCUCCA (SEQ ID NO:71) 46 12243502v1Attorney Docket No.047162-7527WO1 >tRNA-Cys- GGGGUAUAGCUCAGUGGUAGAGCAUUUGACUGCAGAUCAAGAG GCA-2-1 GUCCCCGGUUCAAAUCCGGGUGCCCCCUCCA (SEQ ID NO:72) >tRNA-Asp- UCCUCGUUAGUAUAGUGGUGAGUGUCCCCGUCUGUCACGCGGGA GTC-3-1 GACCGGGGUUCGAUUCCCCGACGGGGAGCCA (SEQ ID NO:73) >tRNA-Asn- UCUCUGUGGCGCAAUCGGUUAGCGCGUUCGGCUGUUAACUGAAA GTT-9-1 GGUUAGUGGUUCGAGCCCACCCGGGGACGCCA (SEQ ID NO:74) >tRNA-Arg- GCUCUGUGGCGCAAUGGAUAGCGCAUUGGACUUCUAAUUCAAAG TCT-5-1 GUUGCGGGUUCGAGUCCCUCCAGAGUCGCCA (SEQ ID NO:75) >tRNA-Arg- GCCGUGUGGCCUAAUGGAUAAGGCGUCUGACUUCGGAUCAAAAG TCG-6-1 AUUGCAGGUUUGAGUUCUGCCACGGUCGCCA (SEQ ID NO:76) >tRNA-Arg- CCCCAGUGGCCUGAUGGAUAAGGUACUGGCCUCCUAAGCCAGGG CCT-5-1 AUUGUGGGUUCGAGUUCCACCUGGGGUACCA (SEQ ID NO:77) >tRNA-Arg- ACCCAGUGGCCUAAUGGAUAAGGCAUCAGCCUCCGGAGCUGGGG CCG-2-1 AUUGUGGGUUCGAGUCCCAUCUGGGUCGCCA (SEQ ID NO:78) >tRNA-Arg- GGCCAGUGGCGCAAUGGAUAACGCGUCUGACUACGGAUCAGAAG ACG-2-1 AUUCUAGGUUCGACUCCUGGCUGGCUCGCCA (SEQ ID NO:5079 >tRNA-Ala- GGGUGUAGCUCAGUGGUAGAGCGCAUGCUUUGCAUGUAUGAGGC TGC-7-1 CUCGGUUCGAUCCCCGACACCUCCACCA (SEQ ID NO:80) >tRNA-Ala- GGGGUGUAGCUCAGUGGUAGAGCGCGUGCUUCGCAUGUACGAGG CGC-4-1 CCCCGGGUUCGACCCCCGGCUCCUCCACCA (SEQ ID NO:81) >tRNA-Ala- GGGAAUUAGCUCAGGCGGUAGAGCGCUCGCUUAGCAUGCGAGAG AGC-9-1 GUAGCGGGAUCGACGCCCGCAUUCUCCACCA (SEQ ID NO:82)

[0224] In some embodiments, an RNA molecule of the present invention comprises a percent degree of sequence identity to the sequence of any one of SEQ ID NOs: 1-82, e.g., at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence of any one of SEQ ID NOs:1-82. In some embodiments, the specified degree of sequence identity retains one or more characteristics, e.g., substrate for a tRNA modifying enzyme and / or structure (e.g., cloverleaf secondary structure), as the RNA molecule of SEQ ID NOs:1-82. 47 12243502v1Attorney Docket No.047162-7527WO1

[0225] In some embodiments, the RNA molecule is an isolated or purified tRNA molecule.

[0226] In some embodiments, the RNA molecule is purified. The contaminants can be cellular proteins remaining after expression of the RNA molecule of interest in cell systems, or chemicals remaining after chemical synthesis. Suitable methods to purify the RNA molecule from a mixture of contaminants are known in the art. In certain embodiments, the purity of the RNA molecule(s) of the invention is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% purity.

[0227] In one embodiment, the RNA molecule (such as the tRNA molecule) comprises two or more non-natural bases, wherein the two or more non-natural bases inhibit two or more different tRNA modifying enzymes.

[0228] In other aspects, the present invention provides a composition comprising the RNA molecules described herein.

[0229] Among other things, the present disclosure provides preparations of RNA molecules whose nucleotide sequences are set forth in SEQ ID NOs:1-82. In some embodiments, all RNA molecules in such a preparation have the same nucleotide sequence; in some embodiments, different RNA molecules within such a preparation have different nucleotide sequences (i.e., have different residues from one another at one or more “X” positions). For example, those skilled in the art will appreciate that an RNA preparation prepared by in vitro transcription allows rapid and high quality production of a variety of RNA transcripts. In some embodiments, about 10% of “X” positions across a population of RNA molecules in a preparation comprise a non-natural base. In some embodiments, about 25% of “X” positions across a population of RNA molecules in a preparation comprise a non-natural base. In some embodiments, about 50% of “X” positions across a population of RNA molecules in a preparation comprise a non-natural base. In some embodiments, about 75% of “X” positions across a population of RNA molecules in a preparation comprise a non-natural base. In some embodiments, about 80% of “X” positions across a population of RNA molecules in a preparation comprise a non-natural base. In some embodiments, about 90% of “X” positions across a population of RNA molecules in a preparation comprise a non-natural base. In some embodiments, all “X” positions across a population of RNA molecules in a preparation comprise a non-natural base.

[0230] In some embodiments, about 10% of “X” positions across a population of RNA molecules in a preparation comprise 5-halouracil. In some embodiments, about 25% of “X” 48 12243502v1Attorney Docket No.047162-7527WO1 positions across a population of RNA molecules in a preparation comprise 5-halouracil. In some embodiments, about 50% of “X” positions across a population of RNA molecules in a preparation comprise 5-halouracil. In some embodiments, about 75% of “X” positions across a population of RNA molecules in a preparation comprise 5-halouracil. In some embodiments, about 80% of “X” positions across a population of RNA molecules in a preparation comprise 5- halouracil. In some embodiments, about 90% of “X” positions across a population of RNA molecules in a preparation comprise 5-halouracil. In some embodiments, all “X” positions across a population of RNA molecules in a preparation comprise 5-halouracil.

[0231] In some embodiments, about 10% of “X” positions across a population of RNA molecules in a preparation comprise 5-fluorouracil. In some embodiments, about 25% of “X” positions across a population of RNA molecules in a preparation comprise 5-fluorouracil. In some embodiments, about 50% of “X” positions across a population of RNA molecules in a preparation comprise 5-fluorouracil. In some embodiments, about 75% of “X” positions across a population of RNA molecules in a preparation comprise 5-fluorouracil. In some embodiments, about 80% of “X” positions across a population of RNA molecules in a preparation comprise 5- fluorouracil. In some embodiments, about 90% of “X” positions across a population of RNA molecules in a preparation comprise 5-fluorouracil. In some embodiments, all “X” positions across a population of RNA molecules in a preparation comprise 5-fluorouracil.

[0232] In some embodiments, about 10% of “X” positions across a population of RNA molecules in a preparation comprise 5-halocytidine. In some embodiments, about 25% of “X” positions across a population of RNA molecules in a preparation comprise 5-halocytidine. In some embodiments, about 50% of “X” positions across a population of RNA molecules in a preparation comprise 5-halocytidine. In some embodiments, about 75% of “X” positions across a population of RNA molecules in a preparation comprise 5-halocytidine. In some embodiments, about 80% of “X” positions across a population of RNA molecules in a preparation comprise 5-halocytidine. In some embodiments, about 90% of “X” positions across a population of RNA molecules in a preparation comprise 5-halocytidine. In some embodiments, all “X” positions across a population of RNA molecules in a preparation comprise 5-halocytidine.

[0233] In some embodiments, about 10% of “X” positions across a population of RNA molecules in a preparation comprise 5-fluorocytidine. In some embodiments, about 25% of “X” 49 12243502v1Attorney Docket No.047162-7527WO1 positions across a population of RNA molecules in a preparation comprise 5-fluorocytidine. In some embodiments, about 50% of “X” positions across a population of RNA molecules in a preparation comprise 5-fluorocytidine. In some embodiments, about 75% of “X” positions across a population of RNA molecules in a preparation comprise 5-fluorocytidine. In some embodiments, about 80% of “X” positions across a population of RNA molecules in a preparation comprise 5-fluorocytidine. In some embodiments, about 90% of “X” positions across a population of RNA molecules in a preparation comprise 5-fluorocytidine. In some embodiments, all “X” positions across a population of RNA molecules in a preparation comprise 5-fluorocytidine.

[0234] In some embodiments, the composition is a pharmaceutical composition further comprising a pharmaceutically acceptable carrier. Suitable carriers and / or formulations of pharmaceutical compositions are described elsewhere herein. Methods

[0235] In one aspect, the present invention provides a method for inhibiting a tRNA modifying enzyme. The method comprises contacting the RNA molecule described herein with the tRNA modifying enzyme in the cell. The formation of the covalent bond inhibits the tRNA modifying enzyme.

[0236] In some embodiments, the method is an in vitro or ex vivo method.

[0237] In one embodiment, the at least one nucleotide comprises a non-natural base.

[0238] In another embodiment, the non-natural base comprises 5-halouracil or 8-azaadenosine.

[0239] In some embodiments, the non-natural modified base is a 5-halouracil in the D-loop, the t-psi-c loop, and / or the anticodon loop of the tRNA molecule.

[0240] In other embodiments, the tRNA modifying enzyme is a dihydrouridine synthase (DUS) or a pseudouridine synthase (PUS).

[0241] In other aspects, the present invention provides a method for killing a cell. The method comprises contacting the RNA molecule described herein with the tRNA modifying enzyme in the cell. The formation of the covalent bond inhibits the tRNA modifying enzyme, thereby killing the cell.

[0242] In some embodiments, the method is an in vitro or ex vivo method. 50 12243502v1Attorney Docket No.047162-7527WO1

[0243] In one embodiment, the cell is a brain cancer cell, a digestive tract cancer cell, a kidney cancer cell, a liver cancer cell, or a lung cancer cell.

[0244] In another embodiment, the cell is a cancer cell in a culture.

[0245] In one embodiment, the at least one nucleotide comprises a non natural base.

[0246] In another embodiment, the non-natural base comprises 5-halouracil or 8-azaadenosine.

[0247] In some embodiments, the non-natural modified base is a 5-halouracil in the D-loop, the t-psi-c loop, and / or the anticodon loop of the tRNA molecule.

[0248] In another aspect, the present invention provides a method for treating or preventing cancer in a subject in need thereof. The method comprises administering to the subject an effective amount of a pharmaceutical composition comprising the RNA molecule described herein. The RNA molecule contacts the tRNA modifying enzyme in a cancer cell of the cancer, wherein formation of the covalent bond inhibits the tRNA modifying enzyme, thereby killing the cancer cell.

[0249] In some embodiments, the cancer is a lung cancer, a brain cancer, a digestive tract cancer, a kidney cancer, or a liver cancer.

[0250] In other embodiments, the method further comprises administering a chemotherapy to the subject before, after, or concurrently with the administration of the pharmaceutical composition comprising the RNA molecule described herein.

[0251] In some embodiments, the subject is a mammal. In one embodiment, the subject is a human.

[0252] In other embodiments, the method comprises administering the pharmaceutical composition in combination with a therapeutic that induces ferroptosis in the cancer cell. Compounds that induce ferroptosis are described in, for example, Wang et al., Genes & Diseases, 9(2): 334-346 (March 2022), which is herein incorporated by reference in its entirety. Non-limiting examples of ferroptosis-inducing compounds include, but are not limited to, GPX4 inhibitors such as, for example, RSL3, ML162, ML210, JKE-1674, and XC- system inhibitor, such as erastin, and the like.

[0253] In some embodiments, the RNA molecule herein is further modified, conjugated or combined with a delivery vehicle for delivery into a cell or administration to a subject in need thereof. Non-limiting modifications include, but are not limited to, backbone modifications, such as introducing phosphorothioate (PS) or phosphodiester (PO) linkages to the backbone of 51 12243502v1Attorney Docket No.047162-7527WO1 the RNA molecule; modifying nucleobase to improve delivery (in addition to the non-natural bases for inhibiting tRNA modifying enzymes), such as by introducing pyrimidine methylation; modifying termini of the RNA molecule to improve delivery, such as by introducing 5ʹ-(E)- vinylphosphonate or abasic ribonucleotides to reduce exonuclease digestion; modifying ribose sugar groups such as by introducing 2ʹ-O-methyl (2ʹ-OMe), 2ʹ-O-methoxyethyl (2ʹ-MOE) and 2ʹ- Fluoro (2ʹ-F) to improve the resistance of the RNA molecule to nuclease digestion; conjugating the RNA molecule with lipids, peptides, aptamers, antibodies, or sugars to improve the cellular intake; or packing the RNA molecules with nanoparticles. In some embodiments, the modification, conjugation or delivery vehicle is the same as or similar to those already used for delivering oligonucleotide drugs, which is described in, for example, Roberts et al. (Nature Reviews Drug Discovery volume 19, pages673–694 (2020)) and Huang et al. (Biomaterials Research volume 26, Article number: 49 (2022).

[0254] In some embodiments, the delivery vehicle is a lipid nanoparticle (LNP). LNPs are effective nano-delivery vehicles that enable targeted delivery of therapeutics such as cytotoxic chemotherapy agents, antibiotics, and nucleic acids (Jung et al., 2022, Theranostics). Additionally, LNPs exhibit enhanced storage and in vivo stability, and have superior controlled release properties of a payload. Non-limiting examples of LNP types comprise liposomes, nanoemulsions, solid lipid nanoparticles, nanostructured lipid carriers, lipid polymer hybrid nanoparticles and others (Mehta et al., 2023, ACS materials Au). Different types of LNPs can enable delivery of different types of payloads: for example, mRNA can be delivered with nanostructured lipid carriers, and chemotherapies can be delivered with liposomes and solid lipid nanoparticles. Targeting specific organs and avoiding liver toxicity remains a challenge with some LNPs. Careful design and screening of lipids used in nanoparticle formulation, as well as evaluation of suitable LNP size, encapsulation efficiency, surface charge, and intended injection site can improve target selectivity and toxicity of LNPs (Mehta et al., 2023, ACS materials Au). Introduction of bleb structures into LNPs (“blebbed” LNPs) can enhance the efficiency of payload delivery into cells (Cheng et al., 2023, Adv Mat.). In some embodiments, nanostructured lipid carriers comprise LNP formulations comprising SM102, MC3, CKKE12, ALC-0315 or LP- 01, or a combination thereof. In some embodiments, the LNP comprises SM102. In some embodiments, the LNP comprises MC3. In some embodiments, the LNP comprises MC3 and is “blebbed”. In some embodiments, the LNP comprises CKKE12. In some embodiments, the LNP 52 12243502v1Attorney Docket No.047162-7527WO1 comprises ALC-0315. In some embodiments, the LNP comprises LP-01. In some embodiments, the LNP comprises one or more of SM102, MC3, CKKE12, ALC-0315 or LP-01, or a combination thereof. In some embodiments, the LNP comprises one or more of SM102, MC3, CKKE12, ALC-0315 or LP-01 and is “blebbed”. Administration and Dosage

[0255] The regimen for administration may affect what constitutes an effective amount. The therapeutic formulations contemplated within the disclosure may be administered to the subject either prior to or after the onset of a disease and / or disorder contemplated herein. Further, several divided dosages, as well as staggered dosages may be administered daily or sequentially, or the dose may be continuously infused, or may be a bolus injection. Further, the dosages of the therapeutic formulations contemplated within the disclosure may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation.

[0256] Administration of the compositions contemplated within the disclosure to a patient, preferably a mammal, more preferably a human, may be carried out using known procedures, at dosages and for periods of time effective to treat a disease and / or disorder contemplated herein in the patient. An effective amount of the therapeutic compound necessary to achieve a therapeutic effect may vary according to factors such as the state of the disease or disorder in the patient; the age, sex, and weight of the patient; and the ability of the therapeutic compound contemplated within the disclosure to treat a disease and / or disorder contemplated herein in the patient. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. A non-limiting example of an effective dose range for a therapeutic compound contemplated within the disclosure is from about 1 and 5,000 mg / kg of body weight / per day. One of ordinary skill in the art would be able to study the relevant factors and make the determination regarding the effective amount of the therapeutic compound without undue experimentation.

[0257] Actual dosage levels of the active ingredients in the pharmaceutical compositions contemplated within the disclosure may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. 53 12243502v1Attorney Docket No.047162-7527WO1

[0258] In particular, the selected dosage level depends upon a variety of factors including the activity of the particular compound employed, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds or materials used in combination with the compound, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well, known in the medical arts.

[0259] A medical doctor, e.g., physician or veterinarian, having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds contemplated within the disclosure employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

[0260] In particular embodiments, it is especially advantageous to formulate the compound in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the patients to be treated; each unit containing a predetermined quantity of therapeutic compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle. The dosage unit forms contemplated within the disclosure are dictated by and directly dependent on (a) the unique characteristics of the therapeutic compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding / formulating such a therapeutic compound for the treatment of a disease and / or disorder contemplated herein.

[0261] In certain embodiments, the compositions described herein are formulated using one or more pharmaceutically acceptable excipients or carriers. In certain embodiments, the pharmaceutical compositions described herein comprise a therapeutically effective amount of a compound described herein and a pharmaceutically acceptable carrier.

[0262] The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it is 54 12243502v1Attorney Docket No.047162-7527WO1 preferable to include isotonic agents, for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition. Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.

[0263] In certain embodiments, the compositions described herein are administered to the patient in dosages that range from one to five times per day or more. In another embodiment, the compositions described herein are administered to the patient in range of dosages that include, but are not limited to, once every day, every two, days, every three days to once a week, and once every two weeks. It is readily apparent to one skilled in the art that the frequency of administration of the various combination compositions described herein varies from individual to individual depending on many factors including, but not limited to, age, disease or disorder to be treated, gender, overall health, and other factors. Thus, the disclosure should not be construed to be limited to any particular dosage regime and the precise dosage and composition to be administered to any patient is determined by the attending physical taking all other factors about the patient into account.

[0264] The dose of RNA molecules of the invention for administration may be in the range of from about 1 μg to about 10,000 mg, about 20 μg to about 9,500 mg, about 40 μg to about 9,000 mg, about 75 μg to about 8,500 mg, about 150 μg to about 7,500 mg, about 200 μg to about 7,000 mg, about 3050 μg to about 6,000 mg, about 500 μg to about 5,000 mg, about 750 μg to about 4,000 mg, about 1 mg to about 3,000 mg, about 10 mg to about 2,500 mg, about 20 mg to about 2,000 mg, about 25 mg to about 1,500 mg, about 30 mg to about 1,000 mg, about 40 mg to about 900 mg, about 50 mg to about 800 mg, about 60 mg to about 750 mg, about 70 mg to about 600 mg, about 80 mg to about 500 mg, and any and all whole or partial increments therebetween.

[0265] In some embodiments, the administered dose of the RNA molecules is about 1 mg to about 2,500 mg. In some embodiments, the dose used in compositions described herein is less than about 10,000 mg, or less than about 8,000 mg, or less than about 6,000 mg, or less than about 5,000 mg, or less than about 3,000 mg, or less than about 2,000 mg, or less than about 1,000 mg, or less than about 500 mg, or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, a dose of a second compound as described herein is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, 55 12243502v1Attorney Docket No.047162-7527WO1 or less than about 400 mg, or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg, or less than about 10 mg, or less than about 5 mg, or less than about 2 mg, or less than about 1 mg, or less than about 0.5 mg, and any and all whole or partial increments thereof.

[0266] In some aspects, embodiments of the present disclosure are encapsulated by an LNP at a concentration of at least about 1mM, about 2mM, about 3mM, about 4mM, about 5mM, about 6 mM, about 7mM, about 8mM, about 8mM, about 10 mM, about 15 mM, about 20mM, about 25mM, about 30mM, about 35 mM, about 40mM, about 45mM, about 50mM or more. In some aspects, embodiments of the present disclosure are encapsulated by an LNP at a concentration of at most about 100mM, about 90mM, about 80mM, about 70mM, about 60mM, about 50mM, about 40mM, about 30 mM, about 20mM, about 15mM, about 10mM, about 9mM, about 8mM, about 7mM, about 6mM, about 5mM, about 4mM, about 3mM, about 2mM or less.

[0267] In some aspects, embodiments of the present disclosure are encapsulated by an LNP at a concentration of about 1mM to about 100mM, about 1mM to about 90mM, about 1mM to about 80mM, about 1mM to about 70mM, about 1mM to about 60mM, about 1 mM to about 50mM, about 1mM to about 40mM, about 1mM to about 30mM, about 1mM to about 20mM, about 1mM to about 15mM, about 1mM to about 10mM, about 2mM to about 9mM, about 1mM to about 8mM, about 1mM to about 6mM, about 1mM to about 5mM, about 1mM to about 4mM, about 1mM to about 3mM, or about 1mM to about 2mM. In some aspects, embodiments of the present disclosure are encapsulated by a LNP at a concentration of about 2mM to about 100mM, about 2mM to about 90mM, about 2mM to about 80mM, about 2mM to about 70mM, about 2mM to about 60mM, about 2 mM to about 50mM, about 2mM to about 40mM, about 2mM to about 30mM, about 2mM to about 20mM, about 2mM to about 15mM, about 2mM to about 10mM, about 2mM to about 9mM, about 2mM to about 8mM, about 2mM to about 6mM, about 2mM to about 5mM, about 2mM to about 4mM, or about 2mM to about 3mM. In some aspects, embodiments of the present disclosure are encapsulated by a LNP at a concentration of about 3mM to about 100mM, about 3mM to about 90mM, about 3mM to about 80mM, about 3mM to about 70mM, about 3mM to about 60mM, about 3 mM to about 50mM, about 3mM to about 40mM, about 3mM to about 30mM, about 3mM to about 20mM, about 3mM to about 15mM, about 3mM to about 10mM, about 3mM to about 9mM, about 3mM to about 8mM, about 3mM 56 12243502v1Attorney Docket No.047162-7527WO1 to about 6mM, about 3mM to about 5mM, or about 3mM to about 4mM. In some aspects, embodiments of the present disclosure are encapsulated by a LNP at a concentration of about 4mM to about 100mM, about 4mM to about 90mM, about 4mM to about 80mM, about 3mM to about 70mM, about 4mM to about 60mM, about 4mM to about 50mM, about 4mM to about 40mM, about 3mM to about 30mM, about 4mM to about 20mM, about 4mM to about 15mM, about 4mM to about 10mM, about 4mM to about 9mM, about 4mM to about 8mM, about 4mM to about 6mM, or about 4mM to about 5mM. In some aspects, embodiments of the present disclosure are encapsulated by a LNP at a concentration of about 5mM to about 100mM, about 5mM to about 90mM, about 5mM to about 80mM, about 5mM to about 90mM, about 5mM to about 60mM, about 5mM to about 50mM, about 5mM to about 40mM, about 5mM to about 90mM, about 5mM to about 20mM, about 5mM to about 15mM, about 5mM to about 10mM, about 5mM to about 9mM, about 5mM to about 8mM, or about 5mM to about 6mM. In some aspects, embodiments of the present disclosure are encapsulated by a LNP at a concentration of about 6mM to about 100mM, about 6mM to about 80mM, about 6mM to about 60mM, about 6mM to about 50mM, about 6mM to about 40mM, about 6mM to about 20mM, about 6mM to about 15mM, about 6mM to about 10mM, about 6mM to about 9mM, or about 6mM to about 8mM. In some aspects, embodiments of the present disclosure are encapsulated by a LNP at a concentration of about 7mM to about 100mM, about 7mM to about 90mM, about 7mM to about 80mM, about 7mM to about 70mM, about 7mM to about 60mM, about 7mM to about 50mM, about 7mM to about 40mM, about 7mM to about 30mM, about 7mM to about 20mM, about 7mM to about 15mM, about 7mM to about 10mM, about 7mM to about 9mM, or about 7mM to about 8mM. In some aspects, embodiments of the present disclosure are encapsulated by a LNP at a concentration of about 8mM to about 100mM, about 8mM to about 90mM, about 8mM to about 80mM, about 8mM to about 70mM, about 8mM to about 60mM, about 8mM to about 50mM, about 8mM to about 40mM, about 8mM to about 30mM, about 8mM to about 20mM, about 8mM to about 15mM, or about 8mM to about 10mM. In some aspects, embodiments of the present disclosure are encapsulated by a LNP at a concentration of about 10mM to about 100mM, about 10mM to about 90mM, about 10mM to about 80mM, about 10mM to about 70mM, about 10mM to about 60mM, about 10mM to about 50mM, about 10mM to about 40mM, about 10mM to about 30mM, about 10mM to about 20mM, or about 10mM to about 15mM. 57 12243502v1Attorney Docket No.047162-7527WO1

[0268] In some aspects, embodiments of the present disclosure are encapsulated by a LNP at a concentration of about 1mM, about 2mM, about 3mM, about 4mM, about 5mM, about 6mM, about 7mM, about 8mM, about 9mM, about 10mM, about 11mM, about 12mM, about 13mM, about 14mM, about 15mM, about 16mM, about 17mM, about 18mM, about 19mM, about 20mM, about 25mM, about 30mM, about 35mM, about 40mM, about 50mM, about 60mM, about 70mM, about 80mM, about 90mM, or about 100mM.

[0269] In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of at least about 0.05 mg / kg, about 0.1 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, about 2.5 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 12.5 mg / kg, about 15 mg / kg, about 20 mg / kg, about 30 mg / kg, about 40 mg / kg, or more. In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of at most about 50 mg / kg, about 40 mg / kg, about 30 mg / kg, about 20 mg / kg, about 15 mg / kg, about 12.5 mg / kg, about 10 mg / kg, about 7.5 mg / kg, about 5 mg / kg, about 2.5 mg / kg, about 2 mg / kg, about 1 mg / kg, about 0.5 mg / kg, about 0.1 mg / kg or less.

[0270] In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 0.05 mg / kg to about 50 mg / kg, about 0.05 mg / kg to about 40 mg / kg, about 0.05 mg / kg to about 30 mg / kg, about 0.05 mg / kg to about 20 mg / kg, about 0.05 mg / kg to about 15 mg / kg, about 0.05 mg / kg to about 12.5 mg / kg, about 0.05 mg / kg to about 10 mg / kg, about 0.05 mg / kg to about 7.5 mg / kg, about 0.05 mg / kg to about 5 mg / kg, about 0.05 mg / kg to about 2.5 mg / kg, about 0.05 mg / kg to about 2 mg / kg, about 0.05 mg / kg to about 1 mg / kg, about 0.05 to about 0.5 mg / kg, or about 0.05 mg / kg to about 0.1 mg / kg. In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 0.1 mg / kg to about 50 mg / kg, about 0.1 mg / kg to about 40 mg / kg, about 0.1 mg / kg to about 30 mg / kg, about 0.1 mg / kg to about 20 mg / kg, about 0.1 mg / kg to about 15 mg / kg, about 0.1 mg / kg to about 12.5 mg / kg, about 0.1 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 7.5 mg / kg, about 0.1 mg / kg to about 5 mg / kg, about 0.1 mg / kg to about 2.5 mg / kg, about 0.1 mg / kg to about 2 mg / kg, about 0.1 mg / kg to about 1 mg / kg, or about 0.1 to about 0.5 mg / kg. In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 0.5 mg / kg to about 50 mg / kg, about 0.5 mg / kg to about 40 mg / kg, about 0.5 mg / kg to about 30 58 12243502v1Attorney Docket No.047162-7527WO1 mg / kg, about 0.5 mg / kg to about 20 mg / kg, about 0.5 mg / kg to about 15 mg / kg, about 0.5 mg / kg to about 12.5 mg / kg, about 0.5 mg / kg to about 10 mg / kg, about 0.5 mg / kg to about 7.5 mg / kg, about 0.5 mg / kg to about 5 mg / kg, about 0.5 mg / kg to about 2.5 mg / kg, about 0.5 mg / kg to about 2 mg / kg, or about 0.5 mg / kg to about 1 mg / kg. In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 1 mg / kg to about 50 mg / kg, about 1 mg / kg to about 40 mg / kg, about 1 mg / kg to about 30 mg / kg, about 1 mg / kg to about 20 mg / kg, about 1 mg / kg to about 15 mg / kg, about 1 mg / kg to about 12.5 mg / kg, about 1 mg / kg to about 10 mg / kg, about 1 mg / kg to about 7.5 mg / kg, about 1 mg / kg to about 5 mg / kg, about 1 mg / kg to about 2.5 mg / kg, or about 1 mg / kg to about 2 mg / kg. In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 2 mg / kg to about 50 mg / kg, about 2 mg / kg to about 40 mg / kg, about 2 mg / kg to about 30 mg / kg, about 2 mg / kg to about 20 mg / kg, about 2 mg / kg to about 15 mg / kg, about 2 mg / kg to about 12.5 mg / kg, about 2 mg / kg to about 10 mg / kg, about 2 mg / kg to about 7.5 mg / kg, about 2 mg / kg to about 5 mg / kg, or about 2 mg / kg to about 2.5 mg / kg.

[0271] In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 2.5 mg / kg to about 50 mg / kg, about 2.5 mg / kg to about 40 mg / kg, about 2.5 mg / kg to about 30 mg / kg, about 2.5 mg / kg to about 20 mg / kg, about 2.5 mg / kg to about 15 mg / kg, about 2.5 mg / kg to about 12.5 mg / kg, about 2.5 mg / kg to about 10 mg / kg, about 2.5 mg / kg to about 7.5 mg / kg, or about 2.5 mg / kg to about 5 mg / kg. In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 5 mg / kg to about 50 mg / kg, about 5 mg / kg to about 40 mg / kg, about 5 mg / kg to about 30 mg / kg, about 5 mg / kg to about 20 mg / kg, about 5 mg / kg to about 15 mg / kg, about 5 mg / kg to about 12.5 mg / kg, about 5 mg / kg to about 10 mg / kg, or about 5 mg / kg to about 7.5 mg / kg. In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 7.5 mg / kg to about 50 mg / kg, about 7.5 mg / kg to about 40 mg / kg, about 7.5 mg / kg to about 30 mg / kg, about 7.5 mg / kg to about 20 mg / kg, about 7.5 mg / kg to about 15 mg / kg, about 7.5 mg / kg to about 12.5 mg / kg, or about 7.5 mg / kg to about 10 mg / kg. In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 10 mg / kg to about 50 mg / kg, about 10 mg / kg to about 40 mg / kg, about 10 mg / kg to about 30 mg / kg, about 10 mg / kg to about 20 mg / kg, about 10 mg / kg to about 15 mg / kg, or about 59 12243502v1Attorney Docket No.047162-7527WO1 10 mg / kg to about 12.5 mg / kg. In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 12.5 mg / kg to about 50 mg / kg, about 12.5 mg / kg to about 40 mg / kg, about 12.5 mg / kg to about 30 mg / kg, about 12.5 mg / kg to about 20 mg / kg, or about 12.5 mg / kg to about 15 mg / kg. In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 15 mg / kg to about 50 mg / kg, about 15 mg / kg to about 40 mg / kg, about 15 mg / kg to about 30 mg / kg, or about 15 mg / kg to about 20 mg / kg. In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 20 mg / kg to about 50 mg / kg, about 20 mg / kg to about 40 mg / kg, or about 20 mg / kg to about 30 mg / kg. In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 30 mg / kg to about 50 mg / kg, or about 30 mg / kg to about 40 mg / kg. In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 40 mg / kg to about 50 mg / kg.

[0272] In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a subject at a concentration of about 0.05 mg / kg, about 0.1 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg, about 10 mg / kg, about 11 mg / kg, about 12 mg / kg, about 13 mg / kg, about 14 mg / kg, about 15 mg / kg, about 16 mg / kg, about 17 mg / kg, about 18 mg / kg, about 19 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, or about 50 mg / kg.

[0273] In some embodiments, a modified tRNA and LNP conjugate of the present disclosure is administered to a human at a concentration commensurate with (e.g., proportional with or corresponding to) an effective concentration in a mouse. In some embodiments, an effective concentration of a modified tRNA and LNP conjugate in a mouse is about 0.05 mg / kg, about 0.1 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg, about 10 mg / kg, about 11 mg / kg, about 12 mg / kg, about 13 mg / kg, about 14 mg / kg, about 15 mg / kg, about 16 mg / kg, about 17 mg / kg, about 18 mg / kg, about 19 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, or about 50 mg / kg. 60 12243502v1Attorney Docket No.047162-7527WO1

[0274] In certain embodiments, the present disclosure is directed to a packaged pharmaceutical composition comprising a container holding a therapeutically effective amount of a RNA molecule of the invention, alone or in combination with a second pharmaceutical agent; and instructions for treating or preventing, or reducing one or more symptoms of cancer in a subject.

[0275] Formulations may be employed in admixtures with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for intracranially, oral, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable mode of administration, known to the art. The pharmaceutical preparations may be sterilized and if desired mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure buffers, coloring, flavoring and / or aromatic substances and the like. They may also be combined where desired with other active agents, e.g., other analgesic agents.

[0276] Routes of administration of any of the compositions described herein include oral, nasal, rectal, intravaginal, parenteral, buccal, sublingual or topical. The compounds for use in the disclosure may be formulated for administration by any suitable route, such as for oral or parenteral, for example, transdermal, transmucosal (e.g., sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g., trans- and perivaginally), (intra)nasal and (trans)rectal), intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.

[0277] Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, troches, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry powder or aerosolized formulations for inhalation, compositions and formulations for intravesical administration and the like. It should be understood that the formulations and compositions that would be useful in the present disclosure are not limited to the particular formulations and compositions that are described herein. Oral Administration 61 12243502v1Attorney Docket No.047162-7527WO1

[0278] For oral application, particularly suitable are tablets, dragees, liquids, drops, suppositories, or capsules, caplets and gelcaps. The compositions intended for oral use may be prepared according to any method known in the art and such compositions may contain one or more agents selected from the group consisting of inert, non-toxic pharmaceutically excipients that are suitable for the manufacture of tablets. Such excipients include, for example an inert diluent such as lactose; granulating and disintegrating agents such as cornstarch; binding agents such as starch; and lubricating agents such as magnesium stearate. The tablets may be uncoated or they may be coated by known techniques for elegance or to delay the release of the active ingredients. Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert diluent.

[0279] For oral administration, the compounds described herein may be in the form of tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., polyvinylpyrrolidone, hydroxypropylcellulose or hydroxypropylmethylcellulose); fillers (e.g., cornstarch, lactose, microcrystalline cellulose or calcium phosphate); lubricants (e.g., magnesium stearate, talc, or silica); disintegrates (e.g., sodium starch glycollate); or wetting agents (e.g., sodium lauryl sulphate). If desired, the tablets may be coated using suitable methods and coating materials such as OPADRY™ film coating systems available from Colorcon, West Point, Pa. (e.g., OPADRY™ OY Type, OYC Type, Organic Enteric OY-P Type, Aqueous Enteric OY-A Type, OY-PM Type and OPADRY™ White, 32K18400). Liquid preparation for oral administration may be in the form of solutions, syrups or suspensions. The liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, methyl cellulose or hydrogenated edible fats); emulsifying agent (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters or ethyl alcohol); and preservatives (e.g., methyl or propyl p-hydroxy benzoates or sorbic acid).

[0280] The present disclosure also includes a multi-layer tablet comprising a layer providing for the delayed release of one or more compounds described herein, and a further layer providing for the immediate release of another medication. Using a wax / pH-sensitive polymer mix, a gastric insoluble composition may be obtained in which the active ingredient is entrapped, ensuring its delayed release. 62 12243502v1Attorney Docket No.047162-7527WO1 Parenteral Administration

[0281] For parenteral administration, the RNA molecules described herein may be formulated for injection or infusion, for example, intravenous, intramuscular or subcutaneous injection or infusion, or for administration in a bolus dose and / or continuous infusion. Suspensions, solutions or emulsions in an oily or aqueous vehicle, optionally containing other formulatory agents such as suspending, stabilizing and / or dispersing agents may be used. Additional Administration Forms

[0282] Additional dosage forms of the present invention include dosage forms as described in U.S. Patents Nos.6,340,475; 6,488,962; 6,451,808; 5,972,389; 5,582,837; and 5,007,790. Additional dosage forms of this disclosure also include dosage forms as described in U.S. Patent Applications Nos.20030147952; 20030104062; 20030104053; 20030044466; 20030039688; and 20020051820. Additional dosage forms of this disclosure also include dosage forms as described in PCT Applications Nos. WO 03 / 35041; WO 03 / 35040; WO 03 / 35029; WO 03 / 35177; WO 03 / 35039; WO 02 / 96404; WO 02 / 32416; WO 01 / 97783; WO 01 / 56544; WO 01 / 32217; WO 98 / 55107; WO 98 / 11879; WO 97 / 47285; WO 93 / 18755; and WO 90 / 11757. Controlled Release Formulations and Drug Delivery Systems

[0283] In certain embodiments, the formulations of the present invention may be, but are not limited to, short-term, rapid-offset, as well as controlled, for example, sustained release, delayed release and pulsatile release formulations.

[0284] The term sustained release is used in its conventional sense to refer to a drug formulation that provides for gradual release of a drug over an extended period of time, and that may, although not necessarily, result in substantially constant blood levels of a drug over an extended time period. The period of time may be as long as a month or more and should be a release which is longer that the same amount of agent administered in bolus form.

[0285] For sustained release, the compounds may be formulated with a suitable polymer or hydrophobic material which provides sustained release properties to the compounds. As such, the compounds for use the method described herein may be administered in the form of microparticles, for example, by injection or in the form of wafers or discs by implantation. 63 12243502v1Attorney Docket No.047162-7527WO1

[0286] In certain embodiments of the disclosure, the RNA molecules described herein are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation.

[0287] The term delayed release is used herein in its conventional sense to refer to a drug formulation that provides for an initial release of the drug after some delay following drug administration and that mat, although not necessarily, includes a delay of from about 10 minutes up to about 12 hours.

[0288] The term pulsatile release is used herein in its conventional sense to refer to a drug formulation that provides release of the drug in such a way as to produce pulsed plasma profiles of the drug after drug administration.

[0289] The term immediate release is used in its conventional sense to refer to a drug formulation that provides for release of the drug immediately after drug administration.

[0290] As used herein, short-term refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes and any or all whole or partial increments thereof after drug administration after drug administration.

[0291] As used herein, rapid-offset refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes, and any and all whole or partial increments thereof after drug administration. Dosing

[0292] The therapeutically effective amount or dose of a RNA molecule of the present invention depends on the age, sex and weight of the patient, the current medical condition of the patient and the progression of the cancer in the patient being treated. The skilled artisan is able to determine appropriate dosages depending on these and other factors.

[0293] A suitable dose of a RNA molecule described herein may be in the range of from about 0.01 mg to about 5,000 mg per day, such as from about 0.1 mg to about 1,000 mg, for example, from about 1 mg to about 500 mg, such as about 5 mg to about 250 mg per day. The dose may be administered in a single dosage or in multiple dosages, for example from 1 to 4 or more times per day. When multiple dosages are used, the amount of each dosage may be the same or 64 12243502v1Attorney Docket No.047162-7527WO1 different. For example, a dose of 1 mg per day may be administered as two 0.5 mg doses, with about a 12-hour interval between doses.

[0294] It is understood that the amount of RNA molecule dosed per day may be administered, in non-limiting examples, every day, every other day, every 2 days, every 3 days, every 4 days, or every 5 days. For example, with every other day administration, a 5 mg per day dose may be initiated on Monday with a first subsequent 5 mg per day dose administered on Wednesday, a second subsequent 5 mg per day dose administered on Friday, and so on.

[0295] In the case wherein the patient's status does improve, upon the doctor's discretion the administration of the modulator of the disclosure is optionally given continuously; alternatively, the dose of drug being administered is temporarily reduced or temporarily suspended for a certain length of time (i.e., a "drug holiday"). The length of the drug holiday optionally varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction during a drug holiday includes from 10%-100%, including, by way of example only, 10%, 15%,20%,25%,30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0296] Once improvement of the patient's conditions has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, is reduced, as a function of the patient's condition, to a level at which the improved disease is retained. In certain embodiments, patients require intermittent treatment on a long-term basis upon any recurrence of symptoms and / or infection.

[0297] The RNA molecules for use in the methods described herein may be formulated in unit dosage form. The term "unit dosage form" refers to physically discrete units suitable as unitary dosage for patients undergoing treatment, with each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, optionally in association with a suitable pharmaceutical carrier. The unit dosage form may be for a single daily dose or one of multiple daily doses (e.g., about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form may be the same or different for each dose.

[0298] Toxicity and therapeutic efficacy of such therapeutic regimens are optionally determined in cell cultures or experimental animals, including, but not limited to, the determination of the 65 12243502v1Attorney Docket No.047162-7527WO1 LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LD50and ED50. Capsid assembly modulators exhibiting high therapeutic indices are preferred. The data obtained from cell culture assays and animal studies are optionally used in formulating a range of dosage for use in human. The dosage of such capsid assembly modulators lies preferably within a range of circulating concentrations that include the ED50with minimal toxicity. The dosage optionally varies within this range depending upon the dosage form employed and the route of administration utilized. Examples

[0299] The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless so specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

[0300] Without further description, one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the molecules and compositions of the present invention and practice the claimed methods. The following working examples, therefore, specifically point out embodiments of the present invention, and are not to be construed as limiting in any way. Example 1: Design and test of an RNA-based inhibitor for tRNA modifying enzymes

[0301] To test the hypothesis that non-specific chemotherapy compounds can be incorporated into tRNA molecules, and form covalent bonds with and inhibit tRNA modifying enzymes that modifies the tRNA molecules, the present study designed a non-limiting RNA molecule inhibitor based on a natural tRNA molecule.

[0302] Referring to Fig.2, the non-limiting RNA molecule inhibitor was designed to utilize the non-natural modified base 5-halouracil, which is able to react with a cysteine residue in the active site of dihydrouridine synthases (DUS). Notably, the cysteine residue in the active site is conserved in all DUS (Rider et al., J Biol Chem.2009 Apr 17;284(16):10324-33). 66 12243502v1Attorney Docket No.047162-7527WO1

[0303] Referring to Fig.3, the non-limiting RNA molecule inhibitor herein is modified from a natural tRNA decodes the cysteine codon (tRNACys). In the tRNACys, position 20 (the 19thnucleoside), a uridine, is naturally modified by tRNA modifying enzymes such as DUS2 into a dihydrouridine. In the RNA molecule inhibitor, the above-mentioned uridine was replaced with the non-natural modified nucleoside 5-fluorouridine (5-FU). The result RNA-based inhibitor is referred to as 5-FU tRNA or tRNACys-5FU. This non-limiting example of RNA molecule inhibitor has the sequence set forth in SEQ ID NO:1.

[0304] Referring to Fig.4, the present study confirmed that the RNA molecule inhibitor including the non-natural 5-FU nucleoside was able to form stable covalent bond with DUS2.

[0305] Referring to Figs.5, 14A, the present study further confirmed that tRNACys-5FU was able to significantly reduce the viability of a lung cancer cell line, PC9. Example 2-1: Dihydrouridine synthase 2 sustains levels of tRNACys and prevents ferroptosis in lung cancer

[0306] Dihydrouridine is a universally conserved tRNA modification installed by enzymes that are important for human health for reasons that are yet unclear. High expression of dihydrouridine synthase 2 (DUS2) predicts poor patient outcomes in lung adenocarcinoma1. Here, the present study shows in human cells and mouse xenografts that DUS2 suppresses ferroptosis, a metal-dependent non-apoptotic form of cell death to which many lung cancers are unusually sensitive, which is emerging as a therapeutic target in lung cancer. Consistent with a positive role for DUS2 in lung adenocarcinoma growth and metastasis, high expression of DUS2 correlates with increased resistance to ferroptosis inducers. Loss of DUS2 causes increased sensitivity with concomitant accumulation of toxic lipid peroxides, a hallmark of ferroptotic cell death. Mechanistically, DUS2 is required to maintain tRNA CysGCA levels and support translation of cysteine-rich proteins including metallothioneins that serve as key regulators of both metal and redox homeostasis. Metallothionein deficiency in DUS2 knockout cells leads to increased susceptibility to zinc intoxication and lower levels of reduced glutathione, which partially explains their sensitivity to ferroptosis. The results here reveal a tRNA-specific vulnerability and demonstrate the therapeutic potential of targeting DUS2.

[0307] Many cancers display resistance to canonical apoptotic cell death pathways. Non-small cell lung cancers (NSCLC) use a number mechanisms to avoid apoptosis including loss of 67 12243502v1Attorney Docket No.047162-7527WO1 expression of the pro-apoptotic gene Bcl-2-like protein (BIM) and amplification of an anti- apoptotic gene, induced myeloid leukemia cell differentiation protein (MCL1).One of the cell death mechanism, ferroptosis, is a form of non-apoptotic cell death that is emerging as a therapeutic target in lung cancer. Example 2-2: DUS2 is overexpressed in lung cancer and loss of DUS2 sensitizes cells to ferroptosis

[0308] Hallmarks of ferroptotic cell death include dependence on redox active iron and accumulation of toxic lipid peroxides. Several compounds have been described to induce ferroptosis, including class I ferroptosis inducers that inhibit import of cystine (erastin) and class II ferroptosis inducers which inhibit activity of the phospholipid hydroperoxidase GPX4 ((1S,3R)-RSL3, M162, and ML210) (Fig.6A). Several studies have demonstrated that NSCLC cell lines are sensitive to chemical ferroptosis inducers, both in vitro and in vivo, and development of ferroptosis modulating drugs is an active area of research. Intriguingly, resistance to treatment with several class II ferroptosis inducers (RSL3, ML162 and ML210) correlates with expression of the tRNA modifying enzyme dihydrouridine synthase 2 (DUS2) in a panel of 860 cancer cell lines (Fig.6B).

[0309] Dihydrouridine synthases (DUS) install a modified form of uridine in RNA (Fig.6C). Dihydrouridine (D) is the most common modified nucleotide in tRNA, and is found in tRNA from organisms from all branches of the tree of life. In tRNAs, D is thought to stabilize to the correct folding of the D-loop. Eukaryotes including humans express four D synthases, and each DUS has unique target nucleotides in multiple individual tRNAs. Disturbance of D levels and / or DUS expression are implicated in lung, brain and kidney cancer. DUS2 is known to modify tRNAs at position in the tRNA D-loop in yeast. DUS2 is frequently overexpressed in non-small cell lung cancer (NSCLC) tumors (Fig.6D), and NSCLC patients whose tumors express high levels of DUS2 have shorter survival time when compared to patients whose tumors do not express high levels of DUS2 (Fig.6E).

[0310] Here, the present study investigated the role that DUS2 plays in NSCLC disease progression. Using CRISPR / Cas9, DUS2 was knock out in a NSCLC cell line (A549) that expresses high levels of DUS2 and show that loss of DUS2 leads to hypersensitivity to ferroptosis inducing compounds. Consistent with the in vitro sensitivity of the DUS2 KOs to 68 12243502v1Attorney Docket No.047162-7527WO1 ferroptosis, the present study shows that DUS2 KO cells form smaller tumors in a mouse xenograft model and are more sensitive to systemic administration of a ferroptosis inducer. The present study probed the role of DUS2 in gene expression and find that loss of DUS2 causes a ~40% decrease in the level of a single tRNA, CysGCA. This loss of tRNACysGCA reduces levels of cysteine rich proteins proteome wide, including decreasing synthesis of a family of small, highly conserved cysteine rich proteins called metallothioneins (MTs). MTs are known to inhibit ferroptosis, and play two critical roles in cells: first, MTs directly inhibit the formation of lipid peroxides and defend the cell against oxidative stress. Second, MTs are major regulators of intracellular zinc levels. The results here establish the loss of MT expression as the likely basis for increased ferroptosis in the absence of DUS2 and suggest therapeutic potential for targeting DUS2 in lung cancer.

[0311] To investigate the link between high DUS2 expression and poor patient prognosis in NSCLC, the present study used CRISPR / Cas9 to generate knockout (KO) cell lines in a common NSCLC model cell line (A549) that expresses high levels of DUS2. Using two different lentiviral delivered guide RNAs targeting exons 3 and 4 of the DUS2 coding sequence, multiple independent clonal KO cell lines were recovered. As expected, the clonal DUS2 KO CRISPR lines did not have detectable DUS2 protein expression (Fig.6F).

[0312] The correlation between DUS2 mRNA levels and resistance to known ferroptosis inducing compounds across a panel of 860 cell lines prompted the present study to test the sensitivity of DUS2 KO cells to ferroptosis. The DUS2 KO cells showed an approximately 2- fold increase in the fraction of dead cells after ferroptosis induction with the GPX4 inhibitor RSL3 (Fig.6G). This sensitivity was reversed upon re-expression of DUS2 (Fig.10A), or by treatment with known ferroptosis inhibitors, trolox and ferrostatin (Figs.10A-10C), but not by treatment with Z-FAD-FMK, an apoptosis inhibitor (Figs.10A-10C). A key feature of ferroptotic cell death is a buildup of toxic lipid peroxides. The present study measured the levels of lipid peroxidation after GPX4 inhibitor treatment using an oxidation-sensitive fluorescent lipid peroxidation probe, C11-BODIPY26. When compared to WT A549 cells, the DUS2 KO cells had 6-8 fold higher levels of lipid peroxides when treated with RSL3 (Figs.6H-6I), or a second GPX4 inhibitor, ML162 (Fig.10D). Consistent with the higher levels of lipid peroxidation in the DUS2 KO cells, using a probe for cellular reactive oxygen species (ROS), 69 12243502v1Attorney Docket No.047162-7527WO1 2',7'-dichlorodihydrofluorescein diacetate (H2DCFDA), the present study observed higher cellular ROS levels in the DUS2 KOs when treated with RSL3 (Fig.10E). Example 2-3: DUS2 is required to sustain levels of a specific tRNA, tRNACysGCA

[0313] As DUS2 is known to modify tRNAs at position 20 in the tRNA D-loop in yeast (Fig. 7A), and D is known to stabilize tRNA folding, the present study next investigated if DUS2 is required to sustain tRNA expression or function in NSCLC cells. The present study performed tRNA sequencing using a combination of the ARM-seq and DM-TIGRT-seq protocols. The DUS2 KO cells showed no significant change in charging fraction of any tRNA. As a positive control a ~70% reduction of tRNAGln charging was detected after starving cells of glutamine (Fig.7B). Notably, both DUS2 KO cell lines showed a reproducible decrease in expression of nearly every tRNACysGCA isodecoder expressed in A549 cells (Figs.7C-7D). When tRNACysGCA levels are summed across all isodecoders, the DUS2 KO cells have a ~40% decrease in the total pool of tRNACysGCA (Fig.11).

[0314] The present study next re-analyzed small RNA seq data from TCGA lung adenocarcinoma (LUAD) samples for tRNA expression. For tRNACysGCA, the present study found statistically significant increased levels in patient tumor samples as compared to non- tumor samples (Fig.7E). Levels of another U20 containing tRNA (tRNAGlnCTG) were not significantly different in tumor samples (Fig.7F). Together, these results show that DUS2 is required to sustain levels of a specific tRNA, tRNACysGCA, in NSCLC cells and suggest a role for tRNACysGCA levels in lung cancer disease. Example 2-4: Loss of DUS2 impairs translation of cysteine rich proteins, including known anti- ferroptotic oncoproteins

[0315] To determine if the ~40% decrease in tRNACysGCA expression in the DUS2 KO cells has a functional impact on translation, the present study measured cysteine codon translation using luciferase reporters. An array of 15 cysteine codons was prepended to a P2A sequence followed by firefly luciferase as a proxy for production of the cysteine repeat peptide, with an IRES driven renilla luciferase as a normalization control (Fig.8A). Because cysteine is encoded by two independent codons (UGU and UGC) that are decoded by the same pool of GCA anticodon tRNA, the present study generated versions of the cysteine repeat reporter with either 70 12243502v1Attorney Docket No.047162-7527WO1 UGU or UGC codons. When transfected into the DUS2 KO cells, these reporters showed a ~40% decrease in the ratio of firefly luciferase produced to renilla luciferase produced (Fig.8B). This loss of efficient cysteine translation was partially rescued by transfection of in vitro transcribed tRNACysGCA into the DUS2 KO cells (Fig.8C). The observed cysteine translation defects did not affect bulk protein synthesis as determined by 35S methionine incorporation (Fig. 12A).

[0316] The present study then used SILAC proteomics to measure changes in the levels of endogenous proteins in DUS2 KO cells. When analyzed by amino acid content, proteins with greater than 5% Cys content showed a significant decrease in abundance (Fig.8D) consistent with deficient translation of cysteine codons in cells lacking DUS2. Due to the inherently limited coverage of shotgun proteomics and the fact that many cysteine rich proteins are secreted, the SILAC experiment detected only relatively abundant proteins with moderate cysteine content. The present study did not observe any peptides corresponding to many cysteine rich proteins, including any of the metallothioneins. Metallothioneins (MTs) are a class of very cysteine rich proteins (~35% cysteine content) that have been linked to ferroptosis and cancer progression. The present study therefore measured metallothionein translation in DUS2 KO cells using a dual luciferase reporter similar to the cysteine codon repeat reporter by replacing the arrays of cysteine codons with the coding sequences of MT 1A or MT 1G (Fig.8E). Production of metallothionein proteins was impaired in the DUS 2 KO cells (Figs.8G-8H), demonstrating that loss of DUS2 activity leads to defects in production of an endogenously expressed cysteine rich oncoprotein known to inhibit ferroptosis and lipid peroxidation.

[0317] In parallel the present study measured steady state mRNA levels in the DUS2 KO cells by RNA seq. Among the hundreds of mRNAs that were differentially expressed in the DUS2 KO cells (Fig.12B), it was noticed that mRNAs encoding cysteine rich proteins were decreased in the DUS2 KO cells (Fig.12B). Slow translation elongation has been shown to trigger mRNA degradation downstream of surveillance by the ribosome quality control (RQC) pathway. It was hypothesized that reduced tRNACysGCA levels, which impair cysteine translation in DUS2 KO cells, cause ribosomes to stall more frequently on cysteine codons, leading to RQC mediated degradation of cysteine rich mRNAs. Supporting this hypothesis, metallothionein mRNAs were decreased in abundance in the DUS2 KO cells and partially restored by knocking down the RQC factor GIGYF2 (Fig.12C). 71 12243502v1Attorney Docket No.047162-7527WO1

[0318] Metallothioneins utilize their high thiol content to play two interrelated roles in cells: first, through direct coordination of Zn2+and Cu2+ions, they are key regulators of cellular zinc and copper levels. Although ferroptosis was initially characterized as an iron-dependent form of cell death, more recent studies show that defects in zinc homeostasis which elevate cytosolic zinc concentrations sensitize cells to ferroptosis. Given the established role of metallothioneins in regulating intracellular zinc levels, the role of zinc in the ferroptosis sensitivity of cells lacking DUS2 was explored. DUS2 KO cells are more sensitive to Zn2+intoxication and Zn2+-induced cell death (Fig.8G). The second function of the MTs is to defend the cell from oxidative stress and directly inhibit the accumulation of lipid peroxides, which is a hallmark of ferroptosis. It was hypothesized that because of the decreased MT levels in the DUS2 KOs there would be an increased demand for GPX4 mediated reduction of lipid peroxides, and lower cellular levels of reduced glutathione (GSH). Supporting this hypothesis, the present study found significantly lower GSH levels in the DUS2 KO cells (Fig.8H). Together, these observations suggest that a major cause of ferroptosis sensitivity in the DUS2 KO cells is loss of MT synthesis, which in turn triggers defects in metal and redox homeostasis (Fig.8I). Example 2-5: Combined loss of DUS2 and ferroptosis induction extends lifespan in a mouse xenograft NSCLC model

[0319] To characterize the impact of DUS2 on tumor growth and progression in vivo, the present study subcutaneously injected either A549 or DUS2 KO cells to develop xenograft tumors in nude mice. After injection, we monitored tumor size and mouse survival. The tumors derived from DUS2 KO cells took 33% longer to establish and were notably smaller than tumors from A549 cells (Fig.9A-9B). Examining the DUS2 WT and KO tumors revealed modestly increased expression of the ferroptosis biomarker PTSG2 in the DUS2 KO tumors, suggesting endogenous induction of ferroptosis in the tumors (Fig.9C) Ferroptosis inducers are a promising therapeutic approach for the treatment of some cancers. The in vitro experiments indicate that ferroptosis induction might be a more effective strategy to treat NSCLC in combination with inhibition of DUS2. To determine if the ferroptosis sensitivity of the DUS2 KO cells could be exploited for therapeutic benefit, ferroptosis was induced in mice with established tumors by administration of a GPX4 inhibitor (Fig.9D). Most GPX4 inhibitors (RSL3, ML162, ML210) suffer from poor pharmacological properties and have limited utility in vivo. However, a new 72 12243502v1Attorney Docket No.047162-7527WO1 class of GPX4 inhibitors with improved physiochemical and pharmacokinetic properties was recently developed. The present study first tested if oral administration of one of these compounds (JKE-1674) could induce ferroptosis in mouse lungs by measuring mRNA levels of a marker of ferroptosis, PTSG241 after oral JKE-1674 administration. JKE-1674 induced PTSG2 mRNA in lung tissue approximately 8.5-fold (Fig.9E), similar to the level of induction by other GPX4 inhibitors. Treatment with JKE-1674 induced PTSG2 expression 3-fold in DUS2 KO tumors (Fig.9F). Among the mice receiving JKE, mice with DUS2 KO tumors had significantly increased lifespan (Fig.9G). Together, these data indicate that either inhibition of DUS2 or combinatorial inhibition of DUS2 and induction of ferroptosis could be a promising therapeutic strategy for treatment of NSCLC patients. Example 2-6

[0320] The data here indicate that high expression of a ubiquitous tRNA modifying enzyme is a specific cancer vulnerability in NSCLC cells. DUS2 is frequently over expressed in NSCLC, and patients whose tumors express high levels of DUS2 have worse outcomes. Using NSCLC cells depleted for DUS2, it was demonstrated that DUS2 is required to support the levels of a specific family of tRNAs, tRNA CysGCA. This result highlights the outsized roles that specific tRNA substrates can play in the biological functions of tRNA modifying enzymes. Loss of CysGCA expression in DUS2 KO cells leads to defects in translation of cysteine codons, which reduces steady state levels of many cysteine rich proteins, including metallothioneins that play key roles in regulating cellular zinc levels and responding to oxidative stress. Loss of metallothionein expression in DUS2 KO cells sensitizes the cells to ferroptosis both in vitro and in vivo.

[0321] The data here supports that, to fend off ferroptosis, lung cancer cells require both cysteine incorporation into GSH and into cysteine rich metallothionein proteins. Inhibiting either DUS2 or the MT family could increase ferroptosis sensitivity in patients and hold therapeutic value. Example 2-7: Methods

[0322] Cell culture 73 12243502v1Attorney Docket No.047162-7527WO1

[0323] A549 cells were maintained in a 50:50 mixture of DMEM:F12 medium (Gibco), supplemented with 1x penicillin / streptomycin (Gibco) and 10% FBS (Sigma). Cells were grown at 37°C with 5% CO2and maintained at subconfluency.

[0324] CRISPR knockout generation

[0325] DUS2 CRISPR knockout A549 cells were generated using a single-guide LentiCRISPRv2 strategy to cause deletions in the third and fourth exons of DUS2. Oligos for each guide RNA were phosphorylated and annealed and then cloned into pLentiGuide-Puro (Addgene) digested with BsmBI. Cas9 / guideRNA lentiviruses were generated by transfection of pLentiGuide-Puro, psPAX2 (Addgene), and pdr8.2 (Addgene) into 293T cells. Viral supernatant was harvested, filtered and flash frozen 48 and 96 hours post transfection. For infection, 1mL of 48hr viral supernatant was placed in a 6-well dish with A549 cells at 50% confluency. At 90% confluency, the A549 cells were split in to a 10cm dish and selected for stable integrations using 1ug / mL puromycin (Sigma). After a stable puro resistant population was generated, single clones were isolated using serial dilution and colony picking. Single cell clones were expanded, screened for lack of expression of DUS2 protein, and frozen.

[0326] Western Blotting

[0327] Whole cell lysates were made by pelleting A549 cells and re-suspending fresh or frozen (-80°C) pellets in RIPA buffer (50mM Tris pH 8, 150 mM NaCl, sodium deoxycholate 0.5%, sodium dodecyl sulfate 0.1%, NP-401%), lysed on ice for 10 min with vortexing. Lysates were clarified by centrifugation at 4°C and maximum speed (22,500 x g) for 15 min. Approximately 20ug of whole cell lysate, as determined by BCA assay, was run on a 7% Tris-Acetate Gel and transferred to nitrocellulose membranes using wet transfer. Membranes were blocked in 5% milk for 1 hour and incubated with primary antibodies overnight at 4C in 5% milk low-salt TBST (50 mM Tris pH 7.5150 mM NaCl 0.1% Tween-20). Antibodies used for Western blot were as follows: anti-DUS2 at 1:10,000, anti-GAPDH at 1:10,000 (Sigma-Aldrich G9545). Secondary antibody incubation was for 1 hour at room temperature using HRP conjugated goat anti-rabbit IgG at 1:3000 (Promega W4011). Washes were with high-salt TBST (50 mM Tris pH 7.5400 mM NaCl 0.1% Tween-20). 74 12243502v1Attorney Docket No.047162-7527WO1

[0328] AlkB and AlkB D135S purification

[0329] pET30a-AlkB and pET30a-AlkB(D135S) (Addgene) were transformed into BL21(DE3) (NEB).1L cultures were grown to OD .55, at 37°C with shaking. IPTG (Gold Bio) and FeSO4(Sigma) were added to 1mM and 10uM final concentration. Cultures were induced for 4h at 37°C with shaking, cells were harvested with centrifugation and flash frozen. Each 1L pellet was resuspended in 20mL fresh AlkB lysis buffer (50 mM HEPES pH8.0, 10mM Fe(II) sulfate, 300mM NaCl and 5mM imidazole). Cells were lysed by sonication and addition of lysozyme (Sigma). Lysates were clarified with a 12,000 x g spin for 30min at 4°C. Lysates were filtered through a 0.2uM filter and loaded onto a HisTrap 5mL nickel column (Cytiva). Unbound protein and RNA were removed with extensive washing with lysis buffer, and crude alkB protein was eluted from the Ni column using AlkB Lysis buffer with 250mM imidazole. AlkB protein containing fractions were pooled and desalted using a Zeba spin desalting column (Thermo). Desalted protein was purified away from bound RNA using a MonoS column (Cytiva) with a 100mM-1M NaCl gradient. AlkB protein containing fractions were pooled and concentrated using Amicon Ultra-1510KMWCO filters (Milipore). Concentrated AlkB protein was fractionated over a HiLoad 16 / 60 Superdex S200 column (Cytiva). S200 fractions containing AlkB were again concentrated using Amicon Ultra-1510KMWCO filters (Milipore), diluted to 50% glycerol, and flash frozen.

[0330] Total RNA Isolation

[0331] A549 cells were harvested by pelleting and resuspending fresh or frozen (-80°C) pellets in 1mL of QIAzol (Qiagen). Total RNA was harvested according to the manufacturer’s protocol.

[0332] tRNA sequencing

[0333] Total RNA from A549 cells was resuspended in 100mM NaOAc / HOAc pH 4.8.3µL 1M NaIO4(50mM FC) was added and the mixture was incubated at 22°C. After 30 minutes, 6.65µL 1M glucose was added. Total RNA was then recovered by EtOH precipitation. Briefly, 10µL 3M NaOAc, 1mL EtOH were added, incubated at -20°C for 15min, and then spun at 4°C and maximum speed (22,500 x g) for 30 min. The RNA pellet was washed with 70% EtOH and spund again for 5min. The pellet was resuspended in 50µL of Na Borate pH 9.5 and incubated at 45°C for 90 minutes. Large RNAs were depleted from the total RNA with Qiagen miRNeasy 75 12243502v1Attorney Docket No.047162-7527WO1 spin colums using manufactures recommendations. Small RNAs were demethylated with AlkB and AlkB D135S in AlkB buffer (50 mM HEPES KOH, pH 8, 75 µM ferrous ammonium sulfate pH 5, 1 mM α-ketoglutarate, 2 mM sodium ascorbate, 50 µg / ml BSA) with with 4× molar ratio of wtAlkB and 4× molar ratio of D135S at 37°C for 100 minutes. RNA was recovered with denaturing SILANE bead cleanup. RNA was then 3’ end healed using T4 PNK (NEB) and CIP (NEB), and recovered again with denaturing SILANE bead cleanup. A 3’ adapter was ligated onto the small RNA using T4Rnl2.5µL of RNA was incubated with 1.5µL DMSO and 0.5µL 80uM preadenylated 3’ adapter. This mixture was incubated at 65°C for 2min, and placed on ice for 1min. ligations were incubated overnight at 16°C with 3.5µL water, 2µL 10X NEB ligase 50 buffer, 5µL 50% PEG 8000, 1µL SUPERASIN (Thermo), and 2µL RNA ligase (NEB). RNA was recovered again with denaturing SILANE bead cleanup. RNA was reverse transcribed using superscript III.8µL of RNA was annealed to RT primer at 65°C for 5 min, and 10 min cooling to RT on benchtop. RT was performed following manufacturer’s instructions. RNA was removed from cDNA by adding 1µL 1M NaOH to the RT reaction, incubating 5m 95°C and adding 1µL 1M HCl. cDNA was recovered with denaturing SILANE bead cleanup. A 5’ linker was ligated to the cDNA using T4 RNA ligase. cDNA was mixed with .8µL 80uM 5’ adapter, and 1µL DMSO. This mixture was incubated at 75°C for 2min and placed on ice for 1min. to this was added 4.6µL water, 2µL 10X NEB RNA ligase buffer, 0.2µL 0.1M ATP, 5µL 50% PEG 8000, and 2µL RNA ligase. This mixture was incubated at RT overnight with shaking. Linker ligated cDNA was recovered with denaturing SILANE bead cleanup. Final library PCR was performed with Phusion DNA polymerase according to manufacturer’s recommendation.

[0334] tRNA rescue experiment

[0335] T7 template DNA was constructed using PCR to fuse the T7 promoter sequence to the tRNA CysGCA sequence with CCA tail added. tRNA CysGCA RNA was prepared by run off transcription with T7 RNAP at 37°C for 8 hours followed by template removal with DNAseI (Ambion) at 37°C for 30 minutes. Full length tRNA CysGCA was purified on an 8% denaturing urea-PAGE gel, eluted overnight, precipitated with ethanol, and resuspended water. For rescue experiments, 2µg tRNACysGCA and 2µg translational reporter plasmid were co-transfected into cells using TransIT-X2 (Mirus). Forty-eight (48) hours after transfection, cells were harvested in 500 µL 1X passive lysis buffer (Promega) and flash frozen. Lysates were freeze thawed 2x and 76 12243502v1Attorney Docket No.047162-7527WO1 75µL of lysate was used to measure firefly and renilla luciferase activity with the dual-luciferase reporter assay system (Promega) according to manufacturer’s instructions.

[0336] DUS2 rescue experiment

[0337] Full length DUS2 was cloned into pcDNA3.1 (CMV promoter, C-terminal FLAG tag) and 2µg of DUS2 plasmid was transfected into cells using TransIT-X2 (Mirus). Forty-eight (48) hours after transfection, cells were split into 6 well plates and allowed to recover for 24 hours. At 40-50% confluency, cells were treated with indicated concentrations of ferroptosis inducing compounds for 12 hours. Cells then stained with Annexin / PI as below.

[0338] tRNAseq data analysis

[0339] Demultiplexed reads were adapter trimmed using BBTools bbduk.sh. Adapter trimmed reads were then PCR-duplicate collapsed based on unique molecular identifier (UMI) using dedupe.sh. The UMI was then force trimmed with a second round of trimming. Adapter trimmed and duplicate collapsed reads were then aligned to a single copy of each isodecoder pseudo- genome using bbmap.sh. tRNA expression was quantified by counting the number of uniquely mapping reads that mapped to a tRNA, and differential expression analysis was performed using limma-voom. tRNAs with less than 100 uniquely mapping reads were not considered during expression analysis. tRNA charging ratio was determined using custom python scripts ratioing the number of reads terminating with CC-3’ or CCA-3’.

[0340] 35S Met total protein synthesis

[0341] Equal amounts of DUS2 KO and wt cells were seeded into 6 well plates. Cells were allowed to grow to ~80% confluency, and media was switched to DMEM -Met for 20m.10µL 100uCi / mL 35S Met was added to each well, and incubated at 37°C for 30m. To harvest, cells were washed in 1X PBS 2x, and harvested in 200µL RIPA with 1x PMSF and 1x cOmplete. Lysates were freeze thawed 2x, and spun at 4°C at 22,500 x g for 15min to pellet cellular debris. Equal amounts of whole cell lysate, as determined by BCA assay were loaded on a 4-20% SDS- PAGE gel, dried for 2hrs and exposed overnight on a storage phosphor screen.

[0342] Dual luciferase assay 77 12243502v1Attorney Docket No.047162-7527WO1

[0343] pCMV:codonarray:P2A:Fluc:IRES:Rluc or pCMV:metallothionein:P2A:Fluc:IRES:Rluc constructs were constructed by gibson assembly into pTwist CMV Hygro, and successful assembly was confirmed by sanger sequencing.2µg of each plasmid was transfected into cells using TransIT-X2 (Mirus). Forty-eight (48) hours after transfection, cells were harvested in 1X passive lysis buffer (Promega), and flash frozen. Lysates were freeze thawed 2x, and then 75µL of lysate was used to measure firefly and renilla luciferase activity with the dual-luciferase reporter assay system (Promega) according to manufacturer’s instructions.

[0344] SILAC proteomics

[0345] The SILAC experiment was configured as a two channel experiment: Cells were grown in either 1:1 DMEM:F12 with dialyzed FBS (Gibco) supplemented with either un-labeled Arg and Lys (Invitrogen) or 13C6 ,15N4 Arg and 13C6 ,15N2 Lys (Invitrogen). Cells were maintained in isotopically labeled medium for 10 doublings, and then were harvested in RIPA supplemented with 1mM PMSF and 1X HALT phosphatase / protease cocktail (Pierce). Lysates were clarified at 4°C and 22,500 x g for 10 minutes. Total protein was quantified using a BCA assay, and 120µg total protein was submitted to the Yale MS & Proteomics Resource where they were processed and analyzed. Total protein samples were filtered through a 3-kDa Amicon Ultra filter, and the retentate was SpeedVac dried and used for downstream proteomics preparation. Dried protein pellets were reduced with DTT, alkylated with iodoacetamide, enzymatically digested with trypsin, and desalted using C18 RP microspin column. High-resolution liquid chromatography mass spectrometry MS / MS data were collected on an Orbitrap Fusion mass spectrometer coupled to a NanoACQUITY UPLC. All MS / MS samples were analyzed using Mascot (Matrix Science, Mascot version 2.7.0) For peptide identification, Mascot was set up to search SwissProt assuming the digestion enzyme trypsin. Mascot was searched with a fragment ion mass tolerance of 0.020 Da and a parent ion tolerance of 10.0 PPM. Scaffold (version 4.11.1, Proteome Software)) was used to validate MS / MS based peptide and protein identifications. Peptide identifications were accepted if they could be established at greater than 95.0% probability by the Scaffold Local FDR algorithm. Protein identifications were accepted if they could be established at greater than 99.0% probability and contained at least 2 identified peptides. Protein probabilities were assigned by the Protein Prophet algorithm. 78 12243502v1Attorney Docket No.047162-7527WO1

[0346] RNAseq

[0347] Total RNA was isolated for three replicates of A549 and both DUS2 KO cell lines as described above. Stranded poly(A)+ selected mRNA-seq libraries were prepared by Genewiz and sequenced on a HiSeq X 10 with paired end 150-bp reads.

[0348] qRT-PCR

[0349] Total RNA was isolated as described above. For siRNA knockdown experiments, cells were seeded into 6-well plates, and transfected with siGIGFY2 or siNT siRNAs using TransIT- X2 (Mirus) for 48 hours. Total RNA was DNAse treated using TURBO DNAse (Thermo) according to manufacture instructions. One-step qRT-PCR was performed with gene specific forward and reverse primers using Luna Universal One-Step RT-qPCR (NEB) reagents on a CFX96 Real-Time PCR instrument (Bio-Rad). Fold change was calculated using the Pfaffl method, with GAPDH as the housekeeping gene. For qPCR experiments from tissues and tumors, cells were disassociated, pelleted and resuspended in TRIzol (Invitrogen). RNA was then extracted following manufacturer’s instructions.

[0350] Cell death measurements by Annexin V / Propidium Iodide Staining

[0351] Cells were counted and seeded into 6-well plates (Corning). At 40-50% confluency, cells were treated with ferroptosis inducing or inhibiting compounds (RSL3, Cayman Chemical, ML162 Cayman Chemical, Trolox, Sigma, ZVAD-FMK, Promega, ZnCl2, Sigma)for 12 hours. Cells were harvested by trypsinization and centrifugation, washed once with 1X Hanks Buffered Salt Solution (HBSS), and resuspended in 1X annexin-binding buffer (Thermo) and stained with Annexin V / Propidium Iodide according to manufacturer’s instructions. Cells were filtered through 70 micron filters and analyzed on a BD LSR II FACS analyzer using FITC and Propidium Iodide filter sets.

[0352] Quantification of lipid oxidation using C11-BODIPY staining

[0353] Cells were counted and seeded into 6-well plates (Corning). At 40-50% confluency, cells were treated with indicated concentration of ferroptosis inducing compound for 12 hours followed by treatment with 1uM C11-BODIPY for 30 minutes. Cells were then harvested by 79 12243502v1Attorney Docket No.047162-7527WO1 trypsinization and centrifugation, washed once with 1X HBSS, and resuspended in 1X Dulbecco's phosphate-buffered saline (DPBS). Cells were filtered through 70 micron filters and analyzed on a BD LSR II FACS analyzer using FITC (reduced C11-BODIPY) or PE (oxidized C11-BODIPY) filter sets.

[0354] Cellular Glutathione Concentration Measurements

[0355] Cells were seeded into black 96 well cell culture treated plates (Corning). At 80% confluency, media was removed and cells were washed once with 1X DPBS. Glutathione levels were measured using GSH-Glo reagents (Promega) according to manufacturer instructions.

[0356] Subcutaneous Mouse Xenografts

[0357] All animal protocols were reviewed by the Yale University IACUC and approved under protocol 2020-20303. A549 and A549 DUS2 KO cells were washed with and resuspended in 1X PBS and combined 1:1 with Matrigel (Corning) to a concentration of 5,000,000 cells per mL. Mice were randomized before injection.500,000 A549 cells (100 μL) were subcutaneously injected into both flanks of six female nude mice.500,000 A549 DUS2 KO cells (100 μL) were subcutaneously injected into both flanks of six female nude mice. Mice were anesthetized with isoflurane twice weekly, during which time mice were weighed and tumor volumes were measured. Tumors were measured in two dimensions with calipers and tumor volumes were calculated with the formula ^^^^^^^^^^^^ = 0.5 × ^^1× ^^22, where ^^1> ^^2.

[0358] Each mouse began dosing once either tumor was at least 5 mm long in at least one dimension. Mice within each group were randomized before dosing. Mice were given 10 mg / mL JKE-1674 (MedChemExpress) (10% 100 mg / mL JKE-1674 dissolved in DMSO, 90% 20%-β- cyclodextran in 1X PBS) to a concentration of 50 mg JKE-1674 per kg body weight, or vehicle solution (10% DMSO, 90% 20%-β-cyclodextran in 1X PBS) by oral gavage. Three of the six mice injected with only A549 or A549 DUS2 KO cells were dosed with JKE-1674, and the remaining mice were dosed with vehicle solution. Mice were dosed twice weekly. Survival endpoints were defined by death (either naturally or as required by veterinary technicians based on the health of each mouse), a 15% decrease in body weight, or a tumor reaching 2 cm in length in any dimension. 80 12243502v1Attorney Docket No.047162-7527WO1 Example 3:

[0359] In the study described in Example 3, the effects of a non-limiting example of the RNA based DUS / PUS inhibitors herein on various types of cells were studied.

[0360] In Example 3, HepG2 cells were maintained in DMEM plus 10% FBS. A549 cells were maintained in 50:50 DMEM:F12 plus 10% FBS. CLB-001 tRNA was transfected using Lipofectamine RNAiMAX. Cell viability was measured using Cell TiterGlo 2.0. Example 3-1: RNA-based inhibitor for tRNA modifying enzymes kills cancer cells but not non- transformed cells

[0361] Referring to Figs.14A and 14B, the non-limiting example of the RNA-based inhibitors for DUS enzymes described in Example 1 (the tRNACys having the sequence set forth in SEQ ID NO:1, in which the all the uridine residues are replaced with the non-natural modified nucleoside 5-flurouridine (5-FU), referred to as CLB-001 in Example 3 section), was found to be able to kill two different types of cancer cells with strong IC50.

[0362] Referring to Fig.14A, the cultured hepatocellular carcinoma cell line, HepG2, was treated with various concentrations of CLB-001. At higher concentrations, CLB-001 was found to be able to almost complete kill the hepatocellular carcinoma cells. The IC50 was calculated to be around 5 nM.

[0363] Referring to Fig.14B, the cultured non-small cell lung cancer cell line, A549, was treated with various concentrations of CLB-001. At higher concentrations, CLB-001 was found to be able to almost complete kill the non-small cell lung cancer cells. The IC50 was calculated to be around 10 nM.

[0364] Referring to Fig.19, the cultured hepatocellular carcinoma cell lines, PLC / PRF / 5 and SNU-387, were treated with various concentrations of CLB-001. At higher concentrations, CLB- 001 was found to be able to almost complete kill the Hepatocellular Carcinoma cells. The IC50 was calculated to be between 3 nM and 30 nM.

[0365] Notably, CLB-001 did not show significant toxicity toward non-cancer cells. Referring to Fig.15, when the non-transformed hepatocyte cell line, AML12, was subjected to various concentrations of CLB-001, no statistically significant cell death caused by the DUS inhibitor was observed. This is true even at the relatively high 1000 nM CLB-001 concentration. 81 12243502v1Attorney Docket No.047162-7527WO1 Example 3-2: CLB-001 was vastly more potent than 5-fluorouracil in killing cancer cells

[0366] The present study discovered that CLB-001 is vastly more potent than 5FU in killing HepG2 cancer cells.

[0367] Referring to Fig.16, HepG2 cells were separated into two groups. The first group was subjected to various concentrations of 5-fluorouracil (5FU), and the second group was subjected to various concentrations of CLB-001, in which 5FU was incorporated into the tRNACys molecule. The experiment demonstrates that CLB-001 is more than 7000 times more potent than 5FU in killing the HepG2 cancer cells. Example 3-3: High tRNA modifying enzyme levels are associated with hepatocellular carcinoma and worse outcomes in hepatocellular carcinoma

[0368] Referring to Figs.17A-17C, various modifying enzymes (PUS1, PUSL1, PUS7, RPUSD1, RPUSD2, TRMT2A, TRMT2B, DUS1L, DUS2, DUS3L, and DUS4L) are upregulated in hepatocellular carcinoma tumors, as assayed by the mRNA levels of these enzymes.

[0369] Referring to Figs.18A-18G the upregulations of various modifying enzymes generally predict worse outcomes in hepatocellular carcinoma. Example 4: Loss of DUS2 sensitizes A549 lung carcinoma cells to ferroptosis

[0370] The present example further augments the findings that the loss of DUS2 sensitizes cancer cells to ferroptosis. This sensitization to ferroptosis can be improved by treatment with ferroptosis-inducing compounds. The present example shows that further sensitization to ferroptosis is ameliorated when MTs are re-expressed in cancer cells. Example 4-1: 4-HNE is increased in DUS2 knockout tumors vs WT

[0371] Hallmarks of ferroptotic cell death include dependence on redox active iron and accumulation of toxic lipid peroxides. Products of lipid peroxidation, such as 4-HNE, can be used to visualize and quantify ferroptosis in cells and tumors. As shown in Figs.20A and B, 4- HNE is increased in DUS2 KO A549-derived tumors compared to the WT ones. 82 12243502v1Attorney Docket No.047162-7527WO1 Example 4-2: DUS2 knockout cells are sensitized to ferroptosis induced by erastin as well as RSL3 treatment

[0372] Fig.20C shows that the DUS2 KO-mediated sensitization to ferroptosis is further enhanced with a class I ferroptosis inducer, erastin. Treatment of the DUS2 KO cells with a class II ferroptosis inducer, RSL-3, also sensitizes the cells to ferroptosis, but this effect is reduced in cells with re-expressed MTs, as seen in Fig.21. MTs are known in the art to induce resistance to chemotherapeutic agents such as sorafenib by inhibiting apoptosis. Without being bound by any particular theory, the present example may suggest that the loss of DUS2 leads to sensitization of tumors to ferroptosis by, in part, inhibiting MT expression and / or activity. Example 4-3: Methods

[0373] Cell culture

[0374] A549 cells were maintained in a 50:50 mixture of DMEM:F12 medium (Gibco), supplemented with 1x penicillin / streptomycin (Gibco) and 10% FBS (Sigma). Cells were grown at 37°C with 5% CO2 and maintained at subconfluency.

[0375] CRISPR knockout generation

[0376] DUS2 CRISPR knockout A549 cells were generated using a single-guide LentiCRISPRv2 strategy to cause deletions in the third and fourth exons of DUS2. Oligos for each guide RNA were phosphorylated and annealed and then cloned into pLentiGuide-Puro (Addgene) digested with BsmBI. Cas9 / guideRNA lentiviruses were generated by transfection of pLentiGuide-Puro, psPAX2 (Addgene), and pdr8.2 (Addgene) into 293T cells. Viral supernatant was harvested, filtered and flash frozen 48 and 96 hours post transfection. For infection, 1mL of 48hr viral supernatant was placed in a 6-well dish with A549 cells at 50% confluency. At 90% confluency, the A549 cells were split in to a 10cm dish and selected for stable integrations using 1ug / mL puromycin (Sigma). After a stable puro resistant population was generated, single clones were isolated using serial dilution and colony picking. Single cell clones were expanded, screened for lack of expression of DUS2 protein, and frozen.

[0377] A549 murine xenografts 83 12243502v1Attorney Docket No.047162-7527WO1

[0378] All animal protocols were reviewed by the Yale University IACUC and approved under protocol 2020-20303. A549 and A549 DUS2 KO cells were washed with and resuspended in 1X PBS and combined 1:1 with Matrigel (Corning) to a concentration of 5,000,000 cells per mL. Mice were randomized before injection. Next, 5×105A549 cells (100 μL) were subcutaneously injected into both flanks of six female nude mice. Tumors were measured in two dimensions with calipers and tumor volumes were calculated with the formula ^^^^^^^^^^^^ = 0.5 × ^^1 × ^^22, where ^^1 > ^^2. Tumors were allowed to grow until 100 mm3in size, and then mice were euthanized, tumors were removed, fixed, and embedded in paraffin.

[0379] Immunohistochemistry staining of A549 tumors for 4-HNE

[0380] Tumor tissue blocks were then sectioned, and antigen retrieval was performed in citrate buffer at 120°C for 10 minutes in a decloaking chamber. Endogenous peroxidase was blocked by 3% hydrogen peroxide and sections were incubated overnight at 4°C in primary antibody. Sections were then treated with the Dako EnVision®+ Rabbit-HRP System and visualized with the Dako DAB+ (3,3-diaminobenzadine) for 10 min. Negative (IgG and omission of primary antibody) and positive controls were concurrently performed. Sections were lightly counterstained with hematoxylin, dehydrated with a series of ethanol washes, cleared in xylene and coverslipped before examination by light microscopy.

[0381] Cell death measurements by Annexin V / Propidium Iodide Staining

[0382] Cells were counted and seeded into 6-well plates (Corning). At 40-50% confluency, cells were treated with ferroptosis inducing or inhibiting compounds (RSL3, Cayman Chemical, ML162 Cayman Chemical, Trolox, Sigma, ZVAD-FMK, Promega, ZnCl2, Sigma) for 12 hours. Cells were harvested by trypsinization and centrifugation, washed once with 1X Hanks Buffered Salt Solution (HBSS), and resuspended in 1X annexin-binding buffer (Thermo) and stained with Annexin V / Propidium Iodide according to manufacturer’s instructions. Cells were filtered through 70 µm filters and analyzed on a BD LSR II FACS analyzer using FITC and Propidium Iodide filter sets.

[0383] Quantification of lipid oxidation using C11-BODIPY staining 84 12243502v1Attorney Docket No.047162-7527WO1

[0384] Cells were counted and seeded into 6-well plates (Corning). At 40-50% confluency, cells were treated with indicated concentration of ferroptosis inducing compound (RSL3, Cayman Chemical; erastin, Cayman Chemical) for 12 hours followed by treatment with 1uM C11-BODIPY for 30 minutes. Cells were then harvested by trypsinization and centrifugation, washed once with 1X HBSS, and resuspended in 1X Dulbecco's phosphate-buffered saline (DPBS). Cells were filtered through 70 micron filters and analyzed on a BD LSR II FACS analyzer using FITC (reduced C11-BODIPY) or PE (oxidized C11-BODIPY) filter sets.

[0385] Metallothionein (MT) re-expression

[0386] Cells were co-transfected with 2.5 µg of pcDNA3.1 plasmids expressing MT1X, MT1A, and MT2A 24 hours prior to experimentation. Example 5: Lipid nanoparticle studies for delivery of CB-001 to cells

[0387] The present example shows that modified tRNA as described herein can be encapsulated by LNPs and stored without degradation for at least 5 weeks. Furthermore, the present example demonstrates that LNP / tRNA complexes can be effectively delivered to cells, specifically tumor cells, wherein the tumor cells are hepatocellular carcinoma cells. Example 5-1: 5-FU containing CysGCA can be packaged into LNPs

[0388] LNPs are currently considered the most effective drug delivery tool in RNA cancer therapies (Zong et al., Adv Mater.2023 Dec;35(51):e2303261). LNPs can easily penetrate leaky malignant vasculature, preferentially accumulating in the tumor (Tenchov et al., ACS Nano 2021, 15, 11, 16982–17015). Similar to mRNA molecules, embodiments of the present disclosure can be encapsulated into commercial and in-house LNPs, such as SM102, MC3, CKKE12, ALC- 0315, LP-01 and “blebbed” MC3. Fig.22A shows that a MC3 / tRNA complex is stable for more than 5 weeks at 4⁰C. Example 5-2: CLB-001 is effectively delivered to cancer cells and induces cancer cell death.

[0389] Systemically administered LNPs are complexed with ApoE in the bloodstream, and the complex is subsequently largely taken up by hepatocytes or cancer cells. Enhancement of the delivered drug effect by ApoE addition can serve as a positive control for confirming LNP- 85 12243502v1Attorney Docket No.047162-7527WO1 mediated delivery of the drug to cells. ApoE can enhance LNP binding to LDLR and their subsequent internalization into cells, such as hepatocytes or cancer cells, which express LDLR. For example, in Fig.23A, CLB-001 encapsulated into MC3, SM102, and ALC-0315 induces SNU475 HCC cell killing, which is further enhanced with the addition of ApoE. Figs.23B and 23C show that CLB-001 encapsulated into MC3, SM102, ALC-0315, CKKE12, and LP-01 induces A549 lung adenocardinoma cell killing, which is further enhanced with the addition of ApoE. These results demonstrate that the CLB-001 is delivered effectively with a variety of LNPs to cancer cells.

[0390] In Fig.23D, MC3-encapsulated CLB-001 shows dose-dependent SNU-387, SNU449, SNU-423, SNU-475, PLC / PRF / 5, Hepa1-6, HEP3B, HepG2 and Huh7 liver cancer cell killing. Similar dose-dependent cell killing is shown in Fig.23E by the MC3-encapsulated CLB-001 is observed in lung cancer cells H460, NCI-H2009, NCI-H1355, HCC827, LL2, A549 and PC9. Colorectal adenocarcinoma cells DLD-1, as seen in Fig.23F, and glioblastoma cells as seen in Fig.23G are also susceptible to MC3-encapsulated CLB-001-mediated killing. Example 5-3: CLB-001 encapsulated in various LNPs prevents tumor growth in a mouse model of HCC

[0391] To characterize the effects of treatment with SM102-encapsulated CLB-001 at concentrations of 0.3 mg / kg and 1 mg / kg on HCC tumor growth, luciferase-expressing Hep3B xenografts were established by subcutaneously injecting tumor cells into nude mice. Two other mouse cohorts were treated with PBS only or fed an oral gavage of 40 mg / kg sorafenib. After the injection, mouse tumor size was monitored by luminescence imaging and caliper measurements, and the study endpoint was 21 days. Figs.25A and 25B show that a 67% and a 93% reduction in tumor volume was achieved at the study endpoint with the 0.3 mg / kg and 1.0 mg / kg of the SM102-encapsulated CLB-001, respectively, and this effect was similar to that of sorafenib. These data indicate that LNP-encapsulated CLB-001 treatment could be a promising therapeutic strategy for treatment of HCC patients. Example 5-4: CLB-001 encapsulated in various LNPs prevents tumor growth in a mouse model of NSCLC 86 12243502v1Attorney Docket No.047162-7527WO1

[0392] To characterize the effects of treatment with 1 mg / kg CLB-001 encapsulated in mMC3, MC3 and SM102 LNPs on NSCLC tumor growth, expressing A549 xenografts were established by subcutaneously injecting tumor cells into nude mice. The control cohorts received PBS treatment or 100mg / kg of unencapsulated 5-FU. After the injection, mouse tumor size was monitored by caliper measurements, and the study endpoint was 21 days. Surprisingly, Fig.26 demonstrates that tumor volumes were reduced by 60% by the end of the study with the treatment with CLB-001 encapsulated into any of the three tested LNPs compared to pre- treatment volumes, unlike with the 5-FU treatment. These findings demonstrate that LNP- encapsulated CLB-001 treatment results in cytotoxic effects on tumor cells in vivo and could be a promising therapeutic strategy for treatment of NSCLC patients. Example 5-5: In vivo liver and systemic toxicity studies with MC3-encapsulated CLB-001

[0393] To characterize the safety of LNP-encapsulated CLB-001 treatment, mouse weight, liver enzyme levels, and blood chemistry profiling were performed in female C57Bl / 6 mice for 7 days of treatment. Fig.24A shows that mouse weight remained stable for the duration of the study. As shown in Fig.24B, liver enzymes AST and ALT remained within the reference ranges for this strain of mice. No differences between the blood chemistry profiles of untreated and treated mice with any dose of the MC3-encapsulated CB-001 were observed, as seen inFig.24D. Together, these data demonstrate that LNP-encapsulated CLB-001 treatment is safe and could be a promising therapeutic agent for a variety of diseases. Example 5-6: Methods

[0394] LNP formulation

[0395] LNP tRNA complexes were formulated by first dissolving lipids (ionizable lipid, DSPC, cholesterol, PEG-DMG or PEG-C-DMG) into ethanol to a final concentration of 10 mm and at a ratio of 50 / 10 / 38.5 / 1.5 mol%, respectively. The lipid mixture was then rapidly mixed with an aqueous solution of tRNA (amine-to-phosphate ratio (N / P) of 4) and either 300 mM Na-citrate or 30 mM Na-citrate) at pH 4 using a microfluidic or impinged jet mixer at a 1:3 ethanol / water ratio and final flow rate of 12 mL / min. The resulting mixture was dialyzed overnight against >500- fold volume of pH 7.4 PBS then sterile-filtered with a 0.2 µm Supor membrane syringe filter (Pall Corporation, Mississauga, ON, Canada) and concentrated in 10K Amicon 87 12243502v1Attorney Docket No.047162-7527WO1 ultracentrifugation units (EMD Millipore Corporation, Billerica, MA, USA). Particle size was measured as the number mean average, determined via dynamic light scattering using the Anton- Paar Litesizer 500. Encapsulation efficiency and tRNA-LNP concentration was determined via Quant-iT RiboGreen RNA Assay Kit (Thermo-Fisher).

[0396] Kill Curves

[0397] All cells were seeded into black, clear-bottom 96-well plates at 2500 cells per well. Cells were treated with the indicated dose of LNP-tRNAs.96 hours post-dosing, cell viability was measured using CellTiter-Glo 2.0 (Promega) following the manufacturer’s protocol. IC50 values were determined by fitting the dose-response data to a variable slope least squares fit curve.

[0398] RNA Gels

[0399] tRNA LNPs were prepared as above either fresh or were placed at 4C for 5 weeks. tRNA LNPs were then lysed using 1% Triton X in TE. RNA was then denatured in 50% formamide at 65C for 5 minutes, and then run on an 8% urea-TBE polyacrylamide gel electrophoresis (PAGE) gel. RNA was visualized using SYBR Gold (Invitrogen)

[0400] In vivo toxicity

[0401] A total of 72 female C57BL / 6J mice were randomly assigned to 6 groups with 12 / group. Animals in Group 1 were treated with control article, CLB-001-U, at 5 mg / kg. Animals in Groups 2 to 6 were treated with test article, CLB-001, at 0.3125, 0.625, 1.25, 2.5, and 5 mg / kg, respectively. The control article is a RNA targeting the same domain as the test article, without a key RNA base modification. Both the test and control articles were formulated in the same lipid nanoparticle formulation and dosed by intravenous injection at 8 mL / kg to animals. The first 4 animals in Group 1 were terminated on Day -2 for baseline measurements (clinical chemistry and cytokine), and the other animals were euthanized on Day 8 for necropsy.

[0402] Parameters evaluated in this study included clinical observations, body weights, clinical pathology (hematology and clinical chemistry) and cytokine analysis (pre-dose (Day -2), 4 and 48 hours post dosing and at termination (Day 8)). Analyzed cytokines included interleukin-1α (IL-1α), interleukin-2 (IL-2), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α) and 88 12243502v1Attorney Docket No.047162-7527WO1 interferon-γ (IFN-γ) with a flow cytometry method. Necropsy was performed for animals at termination.

[0403] Hep3B murine xenografts

[0404] Hep 3B (ATCC # HB-8064) hepatocellular carcinoma cells were obtained from ATCC. These cells were grown in DMEM medium supplemented with 10% fetal bovine serum, and 1% penicillin and streptomycin. Hep 3B cells were transformed with RediFect Red-FLuc-Puromycin (Perkin Elmer CLS960002) and selected using puromycin (Life Technologies) at 2.0 µg / mL. The resulting cell (Hep 3B luc) expressed both puromycin resistance genes and a red-shifted Luciola Italica luciferase gene under the control of a UbC promoter. Cells were routinely trypsinized and passaged 1:4. On the day of implantation, cells were washed in PBS, trypsinized and resuspended in complete media. Cells were resuspended to a density of 1 x 108cells / ml in PBS / Matrigel 50:50, and injected directly into the left flank in a volume of 0.1 mL using a 25G needle, equivalent to 1 x 107cells / mouse.

[0405] Disease was induced in forty-eight (48) female nude mice by implantation with 1x10^7 Hep 3B-luc cells into the left flank. When tumors reached a mean volume of approximately 100 mm3, 32 mice were randomized into four (4) groups of eight (8) to give equal mean tumor volumes and treated. All animals were weighed and assessed visually daily. Tumors were measured three times per week on Mondays, Wednesdays, and Fridays.

[0406] Mice receiving CLB-001 SM102 at 1.0 mg / kg or 0.3 mg / kg or PBS were dosed twice per week via intratumoral injection. Animals receiving sorafenib at 40 mg / kg were dosed daily by oral gavage.

[0407] Tumors were measured on Mondays, Wednesdays and Fridays by measuring each tumor in 2 dimensions, Tumor volumes were calculated using the standard formula: (L x W 2 ) / 2. The mean tumor weight and standard error of the mean were calculated for each group at each time point. IVIS measurements will be made weekly. Mice were injected with luciferin, anesthetized after ~20 minutes and imaged.

[0408] A549 murine Xenograft

[0409] A549 (ATCC # CCL-185) lung adenocarcinoma cells were obtained from ATCC. These cells were grown in a 50:50 mixture of DMEM:F12 medium (Gibco), supplemented with 1x 89 12243502v1Attorney Docket No.047162-7527WO1 penicillin / streptomycin (Gibco) and 10% FBS (Sigma). Cells were grown at 37°C with 5% CO2 and maintained at subconfluency. Cells were routinely trypsinized and passaged 1:10. On the day of implantation, A549 cells were washed with and resuspended in 1X PBS and combined 1:1 with Matrigel (Corning) to a concentration of 5,000,000 cells per mL. Mice were randomized before injection.500,000 A549 cells (100 μL) were subcutaneously injected into both flanks.

[0410] Disease was induced in forty-two (42) female nude mice by implantation with 500,000 A549 cells into both flanks. When tumors reached a mean volume of approximately 100mm3, 32 mice were randomized into eight (8) groups of four (4) to give equal mean tumor volumes and treated. All animals were weighed twice per week. Tumors were measured twice per week on Mondays and Thursdays.

[0411] Mice receiving test articles (LNP-tRNAs) at 1.0 mg / kg, 5-fluorouracil at 100 mg / kg, or PBS were dosed twice per week via intratumoral injection.

[0412] Tumors were measured in two dimensions (^^_1,^^_2) with calipers and tumor volumes were calculated with the formula ^^^^^^^^^^^^=0.5 × ^^_1×〖^^_2〗2, where ^^_1>^^_2. Example 6: DUS3 knockout studies

[0413] The present example demonstrates that DUS3 is elevated in patients with kidney clear cell carcinomas and exacerbates their overall survival. Further, the loss of DUS3 leads to reduced mRNA translation into proteins. The present example demonstrates that these results can be accomplished with measuring DUS3 expression levels and a DUS3 knockdown. Example 6-1: DUS3 is overexpressed in Kidney clear cell carcinoma tumors

[0414] Fig.27A shows that the interrogation of DUS3L expression data in the TCGA database demonstrates that DUS3L is overexpressed in KIRC tumors compared to normal kidney tissue. Further, as seen in Fig.27B, high expression of DUS3L is associated with worse survival of KIRC patients. Example 6-2: Knockdown of DUS3L in KIRC cell line reduces tRNA charging

[0415] To interrogate whether this association could be linked to protein translation, DUS3 was knocked down by up to 80% in 786-O KIRC cells (Fig.27C). Interestingly and surprisingly, Figs.28D and 28E demonstrate that tRNA charging was significantly reduced in DUS3 KD cells 90 12243502v1Attorney Docket No.047162-7527WO1 compared to the control. The present example demonstrates that DUS3 can be a useful therapeutic target in treating KIRC. Example 6-3: Methods

[0416] Generation of DUS3 knockdown cell lines

[0417] DUS3 knockdown 786-O cells were generated using four independent shRNAs (TRC numbers or sequences). Oligos for each shRNA were annealed then cloned into pLKO.1-puro (Addgene) digested with AgeI and EcoRI. DUS3 shRNA lentiviruses were generated by transfection of pLKO.1-puro, psPAX2 (Addgene), and pCMV-VSV-G (Addgene) into 293T cells. Viral supernatant was harvested, filtered, and flash frozen 48 and 96 hours post transfection. For transduction, 1mL of 48hr viral supernatant was placed in a 6-well dish with 786-O cells at 50% confluency. At 90% confluency, 786-O cells were transferred to a 10 cm dish and selected for stable transformants using 1 ug / mL puromycin (Sigma). After a stable puro- resistant population was generated, knockdown efficiency was assessed by qRT-PCR.

[0418] qRT-PCR

[0419] Cells were harvested by pelleting and resuspending fresh or frozen (-80°C) pellets in 1mL of QIAzol (Qiagen). Total RNA was harvested according to the manufacturer’s protocol. Total RNA was DNAse treated using TURBO DNAse (Thermo) according to manufacture instructions. One-step qRT-PCR was performed with gene specific forward and reverse primers using Luna Universal One-Step RT-qPCR (NEB) reagents on a CFX96 Real-Time PCR instrument (Bio-Rad). Fold change was calculated using the Pfaffl method, with GAPDH as the housekeeping gene.

[0420] tRNA sequencing

[0421] Total RNA from A549 cells was resuspended in 100mM NaOAc / HOAc pH 4.8. Then 3µL of 1M NaIO4 (50mM FC) was added and the mixture was incubated at 22°C. After 30 minutes, 6.65µL of 1M glucose was added. Total RNA was then recovered by EtOH precipitation. Briefly, 10µL of 3M NaOAc, 1mL of EtOH were added, incubated at -20°C for 15min, and then spun at 4°C and maximum speed (22,500 x g) for 30 min. The RNA pellet was washed with 70% EtOH and spun again for 5min. The pellet was resuspended in 50µL of sodium 91 12243502v1Attorney Docket No.047162-7527WO1 borate pH 9.5 and incubated at 45°C for 90 minutes. Large RNAs were depleted from the total RNA with Qiagen miRNeasy spin columns using manufacturer’s recommendations. Small RNAs were demethylated with AlkB and AlkB D135S in AlkB buffer (50 mM HEPES KOH, pH 8, 75 µM ferrous ammonium sulfate pH 5, 1 mM α-ketoglutarate, 2 mM sodium ascorbate, 50 µg / ml BSA) with with 4× molar ratio of wtAlkB and 4× molar ratio of D135S at 37°C for 100 minutes. RNA was recovered with denaturing SILANE bead cleanup. RNA was then 3′ end healed using T4 PNK (NEB) and CIP (NEB), and recovered again with denaturing SILANE bead cleanup. A 3′ adapter was ligated onto the small RNA using T4Rnl2. Then 5µL of RNA was incubated with 1.5µL DMSO and 0.5µL 80uM preadenylated 3′ adapter. This mixture was incubated at 65°C for 2min, and placed on ice for 1min. Ligations were incubated overnight at 16°C with 3.5µL water, 2µL 10X NEB ligase buffer, 5µL 50% PEG 8000, 1µL SUPERASIN (Thermo), and 2µL RNA ligase (NEB). RNA was recovered again with denaturing SILANE bead cleanup. RNA was reverse transcribed using superscript III. Next, 8µL of RNA was annealed to a reverse transcription primer at 65°C for 5 min, and 10 min cooling to room temperature on a benchtop. Reverse transcription was performed following manufacturer’s instructions. RNA was removed from cDNA by adding 1µL 1M NaOH to the reverse transcriptase reaction, incubating for 5 min at 95°C and adding 1µL 1M HCl. cDNA was recovered with denaturing SILANE bead cleanup. A 5′ linker was ligated to the cDNA using T4 RNA ligase. cDNA was mixed with .8µL 80uM 5′ adapter, and 1µL DMSO. This mixture was incubated at 75°C for 2min and placed on ice for 1min. To this mixture was added 4.6µL of water, 2µL of 10X NEB RNA ligase buffer, 0.2µL of 0.1M ATP, 5µL of 50% PEG 8000, and 2µL of RNA ligase. This mixture was incubated at room temperature overnight with shaking. Linker ligated cDNA was recovered with a denaturing SILANE bead cleanup. Final tRNA library PCR was performed with Phusion DNA polymerase according to manufacturer’s recommendation.

[0422] tRNAseq data analysis

[0423] Demultiplexed reads were adapter trimmed using BBTools (bbduk.sh). Adapter trimmed reads were then PCR-duplicate collapsed based on unique molecular identifier (UMI) using (dedupe.sh). The UMI was then force trimmed with a second round of trimming. Adapter trimmed and duplicate collapsed reads were then aligned to a single copy of each isodecoder pseudo-genome using bbmap.sh. tRNA expression was quantified by counting the number of 92 12243502v1Attorney Docket No.047162-7527WO1 uniquely mapping reads that mapped to a tRNA, and differential expression analysis was performed using limma-voom. tRNAs with less than 100 uniquely mapping reads were not considered during expression analysis. tRNA charging ratio was determined using custom python scripts ratioing the number of reads terminating with CC-3′ or CCA-3′. Enumerated Embodiments

[0424] In some aspects, the present invention is directed to the following non-limiting embodiments: Embodiment 1: A modified tRNA molecule capable of binding covalently to a tRNA- modifying enzyme, wherein the modified tRNA molecule is associated with a delivery vehicle. Embodiment 2: The modified tRNA molecule of embodiment 1, wherein the modified tRNA molecule is selected from any one of SEQ ID Nos.1-82. Embodiment 3: The modified tRNA molecule of embodiment 1, wherein the modified tRNA molecule corresponds to SEQ ID 11. Embodiment 4: The modified tRNA molecule of embodiment 1, wherein the modified tRNA molecule corresponds to SEQ ID 12. Embodiment 5: The modified tRNA molecule of embodiment 1, wherein the modified tRNA molecule corresponds to SEQ ID 13. Embodiment 6: The modified tRNA molecule of embodiment 1, wherein the modified tRNA molecule corresponds to SEQ ID 14. Embodiment 7: A modified tRNA molecule of any of the preceding embodiments, wherein the tRNA-modifying enzyme is a. a DUS1 protein; b. a DUS2 protein; c. a DUS3 protein; d. a PUS1 protein; e. a PUS7 protein; f. a PUS10 protein; g. a TRUB1 protein; h. a TRMT2A / 2B protein; or a combination thereof. 93 12243502v1Attorney Docket No.047162-7527WO1 Embodiment 8: The modified tRNA molecule of any of the preceding embodiments, wherein the delivery vehicle is a lipid nanoparticle. Embodiment 9: The modified tRNA molecule of embodiment 8, wherein the lipid nanoparticle comprises: i. MC3; j. SM102; k. CKKE12; l. ALC-0135; m. LP-01, or combinations thereof. Embodiment 10: A method of treating a disease, disorder, or condition in a subject, the method comprising: administering to the subject a modified tRNA molecule associated with a delivery vehicle. Embodiment 11: The method of embodiment 10, wherein the delivery vehicle is a lipid nanoparticle. Embodiment 12: The method of embodiment 10 or 11, wherein the modified tRNA molecule is administered in combination with a ferroptosis-inducing therapy. Embodiment 13: The method of any one of embodiments 10-12, wherein the disease, disorder, or condition is a cancer. Embodiment 14: The method of embodiment 13, wherein the cancer is one or more of a colon cancer, a liver cancer, a brain cancer, or a lung cancer. Embodiment 15: The method of embodiment 13 or 14, wherein the cancer comprises a tumor. Embodiment 16: A method of reducing levels or activity of a tRNA modifying enzyme in a subject, comprising: administering to the subject a modified tRNA molecule. Embodiment 17: The method of embodiment 16, wherein the tRNA modifying enzyme is selected from one of the following: a. DUS1; b. DUS2; 94 12243502v1Attorney Docket No.047162-7527WO1 c. DUS3; d. PUS1; e. PUS7; f. PUS10; g. TRUB1; h. TRMT2A / 2B; or a combination thereof. Embodiment 18: The method of embodiment 15, wherein growth of the tumor is reduced or suspended after administration of the modified tRNA molecule. Embodiment 19: The method of any one of embodiments 10-18, wherein the modified tRNA molecule corresponds to SEQ ID 11. Embodiment 20: The method of any one of embodiments 10-18, wherein the modified tRNA molecule corresponds to SEQ ID NO: 12. Embodiment 21: The method of any one of embodiments 10-18, wherein the modified tRNA molecule corresponds to SEQ ID NO: 13. Embodiment 22: The method of any one of embodiments 10-18, wherein the modified tRNA molecule corresponds to SEQ ID NO: 14. Embodiment 23: A preparation of lipid nanoparticles encapsulating modified tRNA molecules characterized by a particle diameter of at most 300 nm and a polydispersity index of at most 0.2, wherein, when administered to a subject, a reduction or a suspension of a tumor in the subject is observed. Embodiment 24: A preparation of embodiment 23, wherein the lipid nanoparticles encapsulating modified tRNA comprise: i. MC3; j. SM102; k. CKKE12; l. ALC-0135; m. LP-01, or a combination thereof. 95 12243502v1Attorney Docket No.047162-7527WO1 Embodiment 25: A preparation of embodiment 23 or 24, wherein the lipid nanoparticles encapsulating modified tRNAs are stable in storage for at least 1 week. Embodiment 26: A preparation of any one of embodiments 23-25, wherein the lipid nanoparticles encapsulating modified tRNAs are stable in storage for at least 5 weeks. Embodiment 27: A method of treating a disease, disorder, or condition, comprising: administering to a subject a modified tRNA molecule encapsulated by and / or conjugated to a delivery vehicle; and administering a ferroptosis therapy in combination, such that the subject is exposed to both the modified tRNA molecule and the ferroptosis therapy. Embodiment 28: A method of treating a disease, disorder, or condition, comprising: administering a ferroptosis therapy to a subject who has received or is receiving a modified tRNA therapy. Embodiment 29: A method of treating a disease, disorder, or condition, comprising: administering a modified tRNA therapy to a subject who has received or is receiving a ferroptosis therapy. Embodiment 30: A method of treatment, comprising: administering a modified tRNA therapy to a subject having a tumor characterized by reduced DUS2 levels or activity, or both. Embodiment 31: A method of treatment, comprising: administering a modified tRNA therapy to a subject having a tumor characterized by reduced DUS3L levels or activity, or both. Embodiment 32: A method of treatment, comprising: administering a modified tRNA therapy to a subject having a tumor, wherein administration of a modified tRNA therapy results in a decrease in tRNA expression. Embodiment 33: A method of treatment, comprising: administering a modified tRNA therapy to a subject having a tumor, wherein administration of a modified tRNA therapy results in a change in tRNA modification. Embodiment 34: The method of treatment of embodiments 28-32, wherein the ferroptosis marker is or comprises: a. glutathione; b. iron; 96 12243502v1Attorney Docket No.047162-7527WO1 c. glutathione peroxidase 4; d. lipid peroxide; e. reactive oxygen species; or combinations thereof. Embodiment 35: The method of any one of embodiments 10-34, further comprising administering a chemotherapeutic agent. Other Embodiments

[0425] The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or sub-combination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

[0426] The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations. 97 12243502v1

Claims

Attorney Docket No.047162-7527WO1 CLAIMS What is claimed is:

1. A modified tRNA molecule capable of binding covalently to a tRNA-modifying enzyme, wherein the modified tRNA molecule is associated with a delivery vehicle.

2. The modified tRNA molecule of claim 1, wherein the modified tRNA molecule is selected from any one of SEQ ID NOs: 1-82.

3. The modified tRNA molecule of claim 1, wherein the modified tRNA molecule corresponds to SEQ ID NO:

11.

4. The modified tRNA molecule of claim 1, wherein the modified tRNA molecule corresponds to SEQ ID NO:

12.

5. The modified tRNA molecule of claim 1, wherein the modified tRNA molecule corresponds to SEQ ID NO:

13.

6. The modified tRNA molecule of claim 1, wherein the modified tRNA molecule corresponds to SEQ ID NO:

14.

7. A modified tRNA molecule of any of the preceding claims, wherein the tRNA-modifying enzyme is a. a DUS1 protein; b. a DUS2 protein; c. a DUS3 protein; d. a PUS1 protein; e. a PUS7 protein; f. a PUS10 protein; g. a TRUB1 protein; h. a TRMT2A / 2B protein; 98 12243502v1Attorney Docket No.047162-7527WO1 or a combination thereof.

8. The modified tRNA molecule of any of the preceding claims, wherein the delivery vehicle is a lipid nanoparticle.

9. The modified tRNA molecule of claim 8, wherein the lipid nanoparticle comprises: i. MC3; j. SM102; k. CKKE12; l. ALC-0135; m. LP-01, or combinations thereof.

10. A method of treating a disease, disorder, or condition in a subject, the method comprising: administering to the subject a modified tRNA molecule associated with a delivery vehicle.

11. The method of claim 10, wherein the delivery vehicle is a lipid nanoparticle.

12. The method of claim 10 or 11, wherein the modified tRNA molecule is administered in combination with a ferroptosis-inducing therapy.

13. The method of any one of claims 10-12, wherein the disease, disorder, or condition is a cancer.

14. The method of claim 13, wherein the cancer is one or more of a colon cancer, a liver cancer, a brain cancer, or a lung cancer.

15. The method of claim 13 or 14, wherein the cancer comprises a tumor. 99 12243502v1Attorney Docket No.047162-7527WO1 16. A method of reducing levels or activity of a tRNA modifying enzyme in a subject, comprising: administering to the subject a modified tRNA molecule.

17. The method of claim 16, wherein the tRNA modifying enzyme is selected from the group consisting of: n. DUS1; o. DUS2; p. DUS3; q. PUS1; r. PUS7; s. PUS10; t. TRUB1; u. TRMT2A / 2B; or a combination thereof.

18. The method of claim 15, wherein growth of the tumor is reduced or suspended after administration of the modified tRNA molecule.

19. The method of any one of claims 10-18, wherein the modified tRNA molecule corresponds to SEQ ID NO:

11.

20. The method of any one of claims 10-18, wherein the modified tRNA molecule corresponds to SEQ ID NO:

12.

21. The method of any one of claims 10-18, wherein the modified tRNA molecule corresponds to SEQ ID NO:

13.

22. The method of any one of claims 10-18, wherein the modified tRNA molecule corresponds to SEQ ID NO:

14. 100 12243502v1Attorney Docket No.047162-7527WO1 23. A preparation of lipid nanoparticles encapsulating modified tRNA molecules characterized by a particle diameter of at most 300 nm and a polydispersity index of at most 0.2, wherein, when administered to a subject, a reduction or a suspension of a tumor in the subject is observed.

24. The preparation of claim 23, wherein the lipid nanoparticles encapsulating modified tRNA comprise: a. MC3; b. SM102; c. CKKE12; d. ALC-0135; e. LP-01, or a combination thereof.

25. The preparation of claim 23 or 24, wherein the lipid nanoparticles encapsulating modified tRNA molecules are stable in storage for at least 1 week.

26. The preparation of any one of claims 23-25, wherein the lipid nanoparticles encapsulating modified tRNA molecules are stable in storage for at least 5 weeks.

27. A method of treating a disease, disorder, or condition, comprising: administering to a subject a modified tRNA molecule encapsulated by and / or conjugated to a delivery vehicle; and administering a ferroptosis therapy, such that the subject is exposed to both the modified tRNA molecule and the ferroptosis therapy.

28. A method of treating a disease, disorder, or condition, comprising: administering a ferroptosis therapy to a subject who has received or is receiving a modified tRNA therapy.

29. A method of treating a disease, disorder, or condition, comprising: 101 12243502v1Attorney Docket No.047162-7527WO1 administering a modified tRNA therapy to a subject who has received or is receiving a ferroptosis therapy.

30. A method of treating a subject, comprising: administering a modified tRNA therapy to a subject having a tumor characterized by reduced DUS2 levels or activity, or both.

31. A method of treating a subject, comprising: administering a modified tRNA therapy to a subject having a tumor characterized by reduced DUS3 levels or activity, or both.

32. A method of treating a subject, comprising: administering a modified tRNA therapy to a subject having a tumor, wherein administration of a modified tRNA therapy results in a decrease in tRNA expression.

33. A method of treating a subject, comprising: administering a modified tRNA therapy to a subject having a tumor, wherein administration of a modified tRNA therapy results in a change in tRNA modification.

34. The method of any of claims 28-32, wherein a ferroptosis marker is or comprises: a. glutathione; b. iron; c. glutathione peroxidase 4; d. lipid peroxide; e. reactive oxygen species; or combinations thereof.

35. The method of any one of claims 10-34, further comprising administering a chemotherapeutic agent. 102 12243502v1