Antibodies and chimeric antigen receptors binding to nrcam and methods of use for treating cancers

A CAR targeting the NRCAM splice variant in pediatric high-grade gliomas enhances CAR T cell therapy efficacy by addressing selectivity and tumor adaptation issues, providing a novel approach for effective cancer treatment.

WO2026064380A1PCT designated stage Publication Date: 2026-03-26THE CHILDRENS HOSPITAL OF PHILADELPHIA
View PDF 6 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-17
Publication Date
2026-03-26

AI Technical Summary

Technical Problem

Current cancer treatments, including CAR T cell therapy, face challenges such as tumor heterogeneity, adaptation to immunotherapy, and lack of selectivity in targeting, particularly in pediatric high-grade gliomas and glioblastoma, limiting their effectiveness.

Method used

Development of a chimeric antigen receptor (CAR) that selectively binds to NRCAM, a protein with a unique splice variant (Δex9Δex23) highly expressed in pediatric high-grade gliomas, combined with a monoclonal antibody to enhance CAR T cell therapy efficacy.

Benefits of technology

The CAR T cell therapy targeting NRCAM achieves selective and effective killing of cancer cells, including pediatric high-grade gliomas, by leveraging the unique splice variant's high expression in tumor cells, overcoming limitations of existing therapies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025046749_26032026_PF_FP_ABST
    Figure US2025046749_26032026_PF_FP_ABST
Patent Text Reader

Abstract

The disclosure describes antibodies chimeric antigen receptors (CARs), CAR T cell therapeutics, and their use in treating solid cancers. In particular, the disclosure describes antibodies and CAR T constructs that bind to NRCAM in variety of solid tumors.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] DESCRIPTION ANTIBODIES AND CHIMERIC ANTIGEN RECEPTORS BINDING TO NRCAM AND METHODS OF USE FOR TREATING CANCERS PRIORITY CLAIM This applicant claims benefit of priority to U.S. Provisional Application Serial No. 63 / 696,291, filed September 18, 2024, the entire contents of which are hereby incorporated by reference. REFERENCE TO A SEQUENCE LISTING This application contains a Sequence Listing XML, which has been submitted electronically and is hereby incorporated by reference in its entirety. Said Sequence Listing XML, created on September 15, 2025, is named CHOPP0083WO.xml and is 30,050 bytes in size. FIELD The present disclosure relates generally to binding agents and methods of use therefor for diagnosing and / or treating cancer. In particular, the disclosure relates to binding agents capable of specifically binding to NCAM and their application to chimeric antigen receptor (CAR) construction and use in treating cancer. BACKGROUND Cancer is the second leading cause of death in the world, accounting for one in six deaths. Current treatment options, including surgery, chemotherapy, radiotherapy, and target therapy, can lead to complete remission. However, most of the patients still did not respond or experienced tumor progression after therapy, calling for new therapeutic strategies in cancer treatment. Adoptive chimeric antigen receptor (CAR) T cell therapy has shown durable complete remissions in leukemia and lymphoma, thus revolutionizing clinical guidelines in hematologic malignancies. However, the clinical outcomes of CAR T therapy in certain solid tumors have not been consistently beneficial and can be hampered by a variety of different challenges including loss of the antigen targeted by the CAR due to tumor heterogeneity, tumor adaptation to immunotherapy, or lack of selectivity in targeting.

[0002] 14896-8944-3433, v. 1 Improved CAR T cell therapies that overcome even one of these challenges are therefore greatly in need. Pediatric high-grade gliomas (pHGG) are some of the most recalcitrant, chemoresistant, and often surgically unresectable childhood cancers. For example, children affected by diffuse midline gliomas (DMG) nearly universally succumb to the disease within 8-10 months of diagnosis (Aggarwal et al., 2022). Its adult counterpart, glioblastoma multiforme (GBM), is equally lethal (Fine et al., 2024). Currently, there are no effective standard of care therapies for these patients, despite decades of molecularly agnostic clinical trials, underscoring the importance of developing novel immunotherapies. Several targets for CAR T cells in GBM have been developed, most notably EGFRvIII (O’Rourke et al., 2017; Choi et al., 2024), HER2 (Ahmed et al., 2017), IL13Rα2 (Brown et al., 2016), and Eph2A (Chow et al., 2013), but so far the corresponding immunotherapeutics enjoyed limited success in the clinic, owing in part to the frequent emergence of antigen escape variants (Peterson et al., 2019; Migliorini et al., 2018; Larson et al., 2021; Maggs et al., 2021). Although GBMs and pHGGs are thought to arise in the same lineage, the latter express somewhat different repertoires of surface antigens. Validated pHGG targets include GD2 and B7-H3 (Patterson et al., 2022; Mount et al., 2018). GD2 in particular is highly expressed by H3K27M-mutated DMG cells (Mount et al., 2018), and the first 4 DMG patients were recently treated with anti-GD2 CAR, with some clinical and radiographic improvement (Majzner et al., 2022). Similarly, both anaplastic astrocytomas and DMG express B7-H3 (a.k.a. CD276), and an anti-B7-H3 CAR has shown activity in preclinical models of pediatric tumors (Majzner et al., 2019). However, targeting GD2 is associated with well-documented (although not universally observed) on-target, off-tumor toxicities (Straathof et al., 2020; Ladenstein et al., 2018), and side effects of another anti-B7-H3 CAR have been only assessed in the mouse (Du et al., 2019) and in a relatively small cohort of human patients with DIPG (Vitanza et al., 2023; Vitanza et al., 2025). Even if GD2- and / or B7-H3-directed immunotherapies become standards of care, the clinical use of CAR T cells in patients with hematologic malignancies suggests that there is no such thing as the “perfect” target, and there cannot be too many alternatives (Labanieh et al., 2023; Wagner et al., 2020), the more cancer-specific the better (Tousley et al., 2023).

[0003] 24896-8944-3433, v. 1 SUMMARY In embodiments, an isolated nucleic acid molecule encoding a chimeric antigen receptor (CAR) is provided, wherein the CAR comprises an antigen binding domain, a flexible hinge domain, a transmembrane domain, a costimulatory signaling region, and an intracellular signaling domain, and wherein the antigen binding domain binds selectively to NRCAM. In embodiments, the the antigen binding domain comprises an antibody or an antigen-binding fragment thereof. In embodiments, the antigen-binding fragment is a Fab, a single-chain variable fragment (scFv), or a single-domain antibody. In embodiments, the encoded antigen binding domain comprises a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 1 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 9. In embodiments, the encoded antigen binding domain comprises a heavy chain variable domain including a CDR1 comprising the amino acid sequence of SEQ ID NO: 3, a CDR2 comprising the amino acid sequence of SEQ ID NO: 5, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7, and a light chain variable domain including a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of FAS, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13. In embodiments, the encoded antigen binding domain comprises a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 1 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 9. In embodiments, the C-terminus of the light chain variable domain is fused to the N- terminus of a heavy chain variable domain by a flexible linker. In embodiments, the linker is a peptide linker. In embodiments, the peptide linker is at least 15 amino acids in length. In embodiments, the peptide linker is a glycine-serine linker. In some embodiments, the flexible hinge domain is from CD8α, CD28, or an immunoglobulin (Ig). In some embodiments, the transmembrane domain comprises CD28 transmembrane domain. In some embodiments, the costimulatory signaling region comprises a domain from CD28, 41BB (CD137), OX40, or ICOS. In some embodiments, the intracellular signaling domain comprises a CD3-zeta domain or a high affinity FcεRI. In embodiments, a chimeric antigen receptor (CAR) polypeptide is provided, wherein: (a) the CAR comprises an antigen binding domain, a flexible hinge domain, a transmembrane domain, a costimulatory signaling region, and an intracellular signaling domain; and (b) the antigen binding domain binds selectively to cancer cell-associated

[0004] 34896-8944-3433, v. 1 NRCAM. In embodiments, the antigen-binding fragment is a Fab, a single-chain variable fragment (scFv), or a single-domain antibody. In embodiments, the antigen binding domain comprises a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 1, or having 85%, 90%, 95% or 99% sequence identity to SEQ ID NO: 1, and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 9, or having 85%, 90%, 95% or 99% sequence identity to SEQ ID NO: 9. In embodiments, the antigen binding domain comprises a heavy chain variable domain including a CDR1 comprising the amino acid sequence of SEQ ID NO: 3, a CDR2 comprising the amino acid sequence of SEQ ID NO: 5, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7, and a light chain variable domain including a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of FAS, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13. In embodiment, the antigen binding domain comprises a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 1, or having 85%, 90%, 95% or 99% sequence identity to SEQ ID NO: 1, and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 9, or having 85%, 90%, 95% or 99% sequence identity to SEQ ID NO: 9; and optionally the C-terminus of the light chain variable domain is fused to the N-terminus of a heavy chain variable domain by a flexible linker. In embodiments, a genetically modified T cell is provided, comprising a nucleic acid sequence encoding a chimeric antigen receptor (CAR), or a genetically modified T cell comprising any of the isolated nucleic acid molecules above, or expressing any of the chimeric antigen receptors described above is provided. In embodiments, a method of making a genetically modified T cell is provided, comprising transducing the immune effector cell with any of the chimeric antigen receptors described above. In embodiments, a method of providing anti-tumor immunity in a mammalian subject is provided, such as a human, comprising administering to the mammal an effective amount of a population of the genetically modified T cells described above. In embodiments, a method of treating a mammalian subject is provided, such as a human, having cancer comprising administering to the mammal an effective amount of a population of the genetically modified T cells described above.

[0005] 44896-8944-3433, v. 1 In embodiments, the cancer comprises a solid tumor cell, such as a lung cancer cell, brain cancer cell, head & neck cancer cell, breast cancer cell, skin cancer cell, liver cancer cell (such as hepatocellular carcinoma), pancreatic cancer cell, stomach cancer cell, colon cancer cell, rectal cancer cell, uterine cancer cell, cervical cancer cell, ovarian cancer cell, testicular cancer cell, skin cancer cell, or esophageal cancer cell, or is a leukemia cell or a myeloma cell, such as an acute myeloid leukemia cell, a chronic myelogenous leukemia cell or a multiple myeloma cell, or is selected from the group consisting of sarcoma cell, a rhabdoid cancer cell, a neuroblastoma cell, retinoblastoma cell, or a medulloblastoma cell, uterine carcinosarcoma (UCS), brain lower grade glioma (LGG), thymoma (THYM), testicular germ cell tumors (TGCT), glioblastoma multiforme (GBM) and skin cutaneous melanoma (SKCM), liver hepatocellular carcinoma (LIHC), uveal melanoma (UVM), kidney chromophobe (KICH), thyroid cancer (THCA), kidney renal clear cell carcinoma (KIRC), kidney renal papillary cell carcinoma (KIRP), stomach adenocarcinoma (STAD), cholangiocarcinoma (CHOL), adenoid cystic carcinoma (ACC), prostate adenocarcinoma (PRAD), pheochromocytoma and paraganglioma (PCPG), DLBC, lung adenocarcinoma (LUAD), head-neck squamous cell carcinoma (HNSC), pancreatic adenocarcinoma (PAAD), breast cancer (BRCA), mesothelioma (MESO), colon and rectal adenocarcinoma (COAD). rectum adenocarcinoma (READ), esophageal carcinoma (ESCA), ovarian cancer (OV), lung squamous cell carcinoma (LUSC), bladder urothelial carcinoma (BLCA), sarcoma (SARC), uterine corpus endometrial carcinoma (UCEC), or pediatric high-grade glioma (pHGG). In embodiments, an antibody or fragment thereof that binds selectively to NRCAM is provided, wherein said antibody comprises a variable heavy chain comprising CDR1, CDR2 and CDR3 regions of SEQ ID NOS: 3, 5, and 7, and a variable light chain comprising CDR1, CDR2 and CDR3 regions comprising SEQ ID NO: 11, the sequence FAS, and SEQ ID NO: 13, respectively. In embodiments, the antibody or fragment thereof comprises a variable heavy chain having 70%, 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 1, and a variable light chain having 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 9, respectively.

[0006] 54896-8944-3433, v. 1 In embodiments, the antibody is a single chain antibody, a single domain antibody, a bispecific antibody or a chimeric antibody. In embodiments, the antibody fragment is a Fab fragment. In embodiments, the antibody is a recombinant antibody having specificity for the NRCAM and a distinct cancer cell surface antigen. In embodiments, the antibody is murine antibody, an IgG, a humanized antibody, or a humanized IgG antibody. In embodiments, the antibody or fragment thereof further comprises a label, such as a peptide tag, an enzyme, a magnetic particle, a chromophore, a fluorescent molecule, a chemilluminescent molecule, or a dye, or further comprises an antitumor drug linked thereto, such as a toxin, a radioisotope, a cytokine or an enzyme. In embodiments, the heavy and light chains have 85%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 1 and SEQ ID NO.9, respectively. In embodiments, the heavy and light chains are encoded by nucleic acids having 85%, 90%, 95%. 99% or 100% sequence identity to SEQ ID NO: 2 and SEQ ID NO: 10, respectively. In embodiments, the antibody or fragment thereof is conjugated to a nanoparticle or liposome. In embodiments, a method of treating cancer is provided, comprising contacting a NRCAM-positive cancer cell in a subject, such as a mammalian or human subject, with any of the antibody or fragments described above. In embodiments, the cancer comprises a solid tumor cell, such as a lung cancer cell, brain cancer cell, head & neck cancer cell, breast cancer cell, skin cancer cell, liver cancer cell (such as hepatocellular carcinoma), pancreatic cancer cell, stomach cancer cell, colon cancer cell, rectal cancer cell, uterine cancer cell, cervical cancer cell, ovarian cancer cell, testicular cancer cell, skin cancer cell, or esophageal cancer cell, or is a leukemia cell or a myeloma cell, such as an acute myeloid leukemia cell, a chronic myelogenous leukemia cell or a multiple myeloma cell, or is selected from the group consisting of sarcoma cell, a rhabdoid cancer cell, a neuroblastoma cell, retinoblastoma cell, or a medulloblastoma cell, uterine carcinosarcoma (UCS), brain lower grade glioma (LGG), thymoma (THYM), testicular germ cell tumors (TGCT), glioblastoma multiforme (GBM) and skin cutaneous melanoma (SKCM), liver hepatocellular carcinoma (LIHC), uveal melanoma (UVM),

[0007] 64896-8944-3433, v. 1 kidney chromophobe (KICH), thyroid cancer (THCA), kidney renal clear cell carcinoma (KIRC), kidney renal papillary cell carcinoma (KIRP), stomach adenocarcinoma (STAD), cholangiocarcinoma (CHOL), adenoid cystic carcinoma (ACC), prostate adenocarcinoma (PRAD), pheochromocytoma and paraganglioma (PCPG), DLBC, lung adenocarcinoma (LUAD), head-neck squamous cell carcinoma (HNSC), pancreatic adenocarcinoma (PAAD), breast cancer (BRCA), mesothelioma (MESO), colon and rectal adenocarcinoma (COAD). rectum adenocarcinoma (READ), esophageal carcinoma (ESCA), ovarian cancer (OV), lung squamous cell carcinoma (LUSC), bladder urothelial carcinoma (BLCA), sarcoma (SARC), uterine corpus endometrial carcinoma (UCEC), or pediatric high-grade glioma (pHGG). In embodiments, the method comprises contacting said NRCAM-positive cancer cell with a second anti-cancer agent or treatment. In embodiments, the said second anti-cancer agent or treatment is chemotherapy, radiotherapy, immunotherapy, hormonal therapy, or toxin therapy. In embodiments, the said second anti-cancer agent or treatment is given at the same time as said first agent or is given before and / or after said first agent. In embodiments, the said NRCAM-positive cancer cell is a metastatic cancer cell, a multiply drug-resistant cancer cell or a recurrent cancer cell. In embodiments, a method of diagnosing a NRCAM-positive cancer in a subject is provided, comprising contacting the subject or a cell-containing sample therefrom with any of the antibodies or fragments thereof described above. In embodiments, the method of diagnosing comprises administering to said subject an anti-cancer agent or treatment. In embodiments, said cell-containing sample is a solid tissue sample, such as a biopsy, or wherein said cell-containing sample is a fluid sample, such as urine, semen, sputum, saliva, nipple aspirate, or blood. In embodiments, a pharmaceutical formulation is provided, comprising the any of the genetically modified cells described above, or any of the the antibodies or fragments thereof described above. In embodiments, the pharmaceutical formulation comprises a pharmaceutically acceptable carrier, buffer or diluent. The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” The word “about” means plus or minus 5% of the stated number.

[0008] 74896-8944-3433, v. 1 It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein. Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.

[0009] 84896-8944-3433, v. 1 BRIEF DESCRIPTION OF THE DRAWINGS The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. FIGS. 1A-G depict aberrantly spliced surface protein-encoding transcripts in pHGG. (FIG. 1A) The pipeline used to identify pHGG-specific ectoLSVs. (FIG. 1B) Difference in exon inclusion level (ΔPSI) between pHGG and normal brain samples (y axis). Splicing events were binned based on exon lengths (x axis). Small box indicates the only bin with >50% difference in absolute PSI values. (FIG.1C) Bar graphs showing the expression of select splice factors in normal brain vs. pHGG tissues. (FIG. 1D) Scatter plot showing ΔPSI values, event prevalence, and transcript levels (TPM) of microexons differentially spliced in pHGG. (FIG.1E) Top aberrantly spliced ectoLSVs in HGG. (FIG.1F) Graphical output using Majiqlopedia showing the average PSI for skipping of Exon 5 and Exon 19 in NRCAM across tumor types from TCGA and CBTTC HGG samples. (FIG. 1G) Visualization of the ENST00000351718.8 transcript and its expression level in normal brain (top) vs Kids First Brainstem glioma (bottom) using Xena portal. FIGS. 2A-F depict HGG-specific expression of NRCAM Δex5Δex19 isoform. (FIG.2A) Box plot showing average percent-spliced-in (PSI) value for Exon 5 and Exon 19 in NRCAM across normal brain cell types. (FIG.2B—Left) Expression of mRNA encoding the established B7-H3 antigen in indicated GTEx tissues (neural- and non-neural) and pHGG samples. Read counts corresponding to a constitutive exon-exon junction were used to estimate transcript levels and plotted as junction per million counts on y axis. (FIG.2B— Right) Expression of the Δex5 (the exon 4 – exon 6 junction) isoform of NRCAM mRNA in the same samples. (FIG. 2C) Validation of NRCAM exon 5 and 19 skipping in PDX7316- 1769 by Direct cDNA long-read (ONT) RNA-seq. Reads extending from the 3’ to the 5’ end of the NRCAM transcript were visualized in IGV and plotted as sashimi plots. (FIG. 2D, FIG. 2E) Validation of NRCAM exon 5 and 19 skipping and inclusion in KNS42 cells and SMS-SAN cells by targeted long-read (ONT) RNA-seq, respectively. (FIG.2F) Stacked plot showing estimated abundances of NRCAM Δex5 and Δex19 transcripts as measured in cpm (Y-axis) across pHGG cell lines (KNS42) and PDXs, GBM cell lines (TM31 and U251), and

[0010] 94896-8944-3433, v. 1 a neuroblastoma cell line (SMS-SAN). ΔexΔ5ex19* represents transcripts with additional alternative splicing events besides the skipping of NRCAM exons 5 and 19. FIGS.3A-B depict single-nuclei analysis of PDX 7316-3058. (FIG.3A) Short-read RNA-seq analysis (10x genomic platform) of >3,700 nuclei sequenced using 10x Genomics platform. Uniform Manifold Approximation and Projection (UMAP) plots were generated using Cell Ranger analysis and colored by cell-type annotation (i). Additional UMAP plots of the same cells were colored by expression of individual genes using Loupe Browser (i- iv). (FIG.3B) Long-read RNA-seq analysis of full-length transcripts. ScisorWiz plots show reads spanning exons of interest in NRCAM and CHL1 genes (dotted rectangles) and grouped by clusters. Each horizontal line indicates one transcript; thick blocks denote exons, and thin lines denote introns (not drawn to scale to aid visualization). Bottom panels show annotated GENCODE transcripts. FIGS. 4A-I depicts aberrantly spliced NRCAM proteoforms in pHGG. (FIG. 4A) Immunoblotting showing NRCAM levels in KNS42 pHGG cells (Ctrl) transfected with NRCAM-targeting gRNAs (KO). GAPDH served as loading control. (FIG. 4B) Immuno- blotting showing levels of full length and ∆ex5∆ex19 NRCAM isoforms in cell-surface, flow-through fractions, and total cell lysates of KNS42 wild-type (Ctrl) and NRCAM KO cells. EGFR, Tubulin and Actin were used as controls. (FIG.4C) Immuno-blotting showing NRCAM levels in KNS42 NRCAM KO cells reconstituted with the full length (FL) or the ∆ex5∆ex19 NRCAM isoforms. (FIG. 4D) 72 h proliferation rates of NRCAM KO cells expressing the full length or the ∆ex5∆ex19 NRCAM isoforms. (FIG. 4E) Migration (top) and invasion (bottom) potential of NRCAM KO cells re-expressing full length and ∆ex5∆ex19 isoforms of NRCAM. The Transwell assays were performed with or without Matrigel, respectively. (FIG. 4F) Quantitation of migrated and invaded cells from FIG.4G. Each bar represents mean ± SEM. Significance (asterisks) was determined using unpaired Student’s t-test. (FIG. 4G) Optical imaging of the same cells additionally engineered to expressed firefly luciferase after orthotopic injection in the cortex of NSG mice (Day 28, n=8). (FIG. 4H) Raw photon counts corresponding to tumors in panel FIG. 4G. (FIG. 4I) Kaplan-Meier survival curve of mice depicted in FIG. 4G with p value determined by Log- rank (Mantel-Cox) test. FIGS. 5A-G depict detection of NRCAM proteoforms by mAb 3F8. (FIG. 5A) AlphaFold models of the ectodomains of NRCAM canonical (left) and Δex5Δex19 (right)

[0011] 104896-8944-3433, v. 1 isoform, with the signal peptide (amino acids 1-24) removed. Ectodomain and signal peptide were identified according to UniProt annotations. (FIG.5B) Schematic showing the pipeline followed for antibody production. (FIG.5C) Flow cytometry histograms showing 2D10 and (FIG. 5D) 3F8 mAb binding profiles when used on live CHO-K1 cells expressing “empty vector” (target-null), full-length (FL) NRCAM (unintended target), and Δex5Δex19 NRCAM (intended target). Control staining's with secondary (20) antibody only are shown for comparison. (FIG.5E) Same staining performed on live HGG KNS42 cells endogenously expressing Δex5Δex19 NRCAM (intended target) or with the entire gene knocked out using CRISPR-Cas9 (target-null). In both panels, the thick arrow points to the signal generated by the Δex5Δex19 NRCAM. (FIG. 5F) Flow cytometry histograms showing 3F8 binding profiles with various patient derived cells compared to secondary only stained samples. (FIG. 5G) The strategy to test the therapeutic utility of the 3F8 antibody against glioma cells expressing the splice isoform of NRCAM. The composition of FcγRI-based UIR is shown on the left. Non-neoplastic cells expressing the full-length isoform of NRCAM are depicted at the top right as being presumably resistant to 3F8 UIR treatment. FIGS. 6A-B depict mAb 3F8-mediated killing of glioma cells. (FIG. 6A) Killing of PDX3058 and KNS42 cells expressing indicated NRCAM isoforms. (FIG. 6B) Survival of adult glioblastoma U251 and TM31 cells and their NRCAM KO derivatives. In both panels, shown on the X-axis are Ab concentrations (in mg / ml), and on the Y-axis - the extent of tumor cell killing, as evidenced by reduced luciferase expression. “E:T” values refer to the ratio of effector (T) to target (glioma) cells. FIGS.7A-B depict experimental validation of computational analyses of pHGG datasets. (FIG.7A) Bar graphs showing the expression of splice factors in a pooled normal brain sample vs. pHGG patient-derived cultures (7316-3058. 7316-195, 7316-1763, 7316- 1769*, 7316-1695*, 7316-913). * designates PDXs obtained from the same patient. Each bar represents mean ± SEM. (FIG. 7B) Semi-quantitative RT-PCR showing the inclusion / skipping of indicated micro-exons in NRCAM, L1CAM, CHL1, and NFASC in normal and patient-derived pHGG cells. FIGS.8A-B depict expression patterns of L1-IgCAM family members. (FIG.8A) Visualization of the ENST00000351718.8 transcript and its expression level in normal brain (top) vs. glioblastoma multiforme (bottom) using Xena portal. (FIG. 8B) Expression of the Δex19 variant of NRCAM mRNA, the Δex3 variant of L1CAM mRNA, the Δex24 variant

[0012] 114896-8944-3433, v. 1 of NFASC mRNA and the +ex8 variant of CHL1 mRNA in indicated GTEx tissues (neural- and non-neural) and pHGG samples. Read counts corresponding to exon-exon junction were used to estimate transcript levels and are plotted as junctions per million on the y axis. Horizontal lines correspond to median values. FIGS. 9A-B depict bulk and single-cell RNA-seq analysis of 8 pHGG samples from the GSE231859 dataset. (FIG. 9A) Reads corresponding to skipping / inclusion of NRCAM exon 5 and exon 19, visualized in IGV and shown as sashimi plots. (FIG. 9B) Violin plots showing expression of B7H3 (left) and NRCAM (right) mRNAs across all cells in each sample. FIGS. 10A-C depict single-cell analysis of NRCAM and B7H3 expression in neoplastic cells from the GSE231859 dataset. (FIG. 10A) UMAP projections of pooled sample cells annotated as being of glial origin (astrocytes, oligo-dendrocytes, and OPCs). (FIG. 10B) UMAP plots of the same cells showing expression levels of B7H3 mRNA. (FIG. 10C) UMAP plots of the same cells showing expression levels of NRCAM mRNA. FIGS.11A-B depict generation and validation of NRCAM KO cells. (FIG.11A) Short guide RNA aligned to NRCAM exon 4 and used to generate Cas9 RNP particles. (FIG. 11B) Percentage of mutations in parental KNS42 cells vs. cells treated with the sgRNA / Cas9 RNP, as determined by amplicon re-sequencing. FIG. 12 depicts survival of pHGG and GMB cells treated with untransduced donor T cells. (Top rows) Survival of PDX3058 and KNS42 cells expressing indicated NRCAM isoforms. (Bottom rows) Survival of adult glioblastoma U251 and TM31 cells and their NRCAM KO derivatives. In both panels, shown on the x axis are Ab concentrations (in mg / ml), and on the y axis - the extent of tumor cell killing, as evidenced by reduced luciferase expression. “untr” denoted untransduced T cells, “3F8” – the 3F8 mAb, “IgG2b” – the isotype control. “E:T” values refer to the ratio of effector (T) to target (glioma) cells. FIGS. 13A-E. Design, expression and cytotoxicity of Δex5Δex19 NRCAM- specific CAR T cells. (FIG.13A) Schema of GD2 CAR and 3LHI and 3LHC NRCAM scFv CAR with variable GSS linker and hinge domain. (FIG. 13B) Flow cytometry histograms showing expression of GD2 CAR and 3LHI and 3LHC NRCAM CAR in Jurkat cells, detected with anti- mouse Fab and anti-Protein L antibodies. (FIG. 13C) Flow cytometry histogram showing GD2 and 3LHC NRCAM CAR expression in CAR-transduced vs

[0013] 124896-8944-3433, v. 1 untranduced primary human T cells. (FIG. 13D) Cytotoxicity of primary human T cells transduced with GD2 or 3LHC CAR compared to untransduced T cells in indicated high- grade glioma and glioblastoma cells. (FIG. 13E) Flow cytometry histograms showing 3F8 binding profiles with respect to indicated cell lines, compared to secondary only stained samples.

[0014] 134896-8944-3433, v. 1 DETAILED DESCRIPTION The curative potential of chimeric antigen receptor (CAR) T cell-based cancer immunotherapies has been established in several cancer types, but solid tumor applications have been limited by a paucity of known tumor-specific membrane proteins. Though membrane proteins represent up to a quarter of the proteome, only a fraction of these are specifically expressed on tumors cells and not on normal tissues, and a smaller proportion are essential to tumor homeostasis. Pediatric high-grade gliomas (pHGG) respond poorly to standard therapies, and the development of novel immunotherapeutics (such as chimeric antigen receptor (CAR)-armed T cells) is hindered by the paucity of tumor-specific surface antigens. To overcome this problem, the inventor used various algorithms to compare and contrast splicing patterns in 142 pHGGs vs. adult and fetal brain samples, yielding a list of pHGG-specific splice junctions. After prioritizing events corresponding to extracellular domains, the inventor found that ~40% of them mapped to 3-51 nt-long microexons. One salient example is neural cell adhesion molecule (NRCAM) mRNA, which exhibits skipping of the 18-nt microexon 9 and 30-nt microexon 23 (GTEx nomenclature) in ~70% of pHGG samples. Consequently, the corresponding junctions show much higher expression levels in pHGGs compared to normal tissues of both neural and non-neural origins. Bulk and single-nuclei (SnISOr) long- read RNA-seq of pHGG organoids using the Oxford Nanopore platform revealed coordinated skipping of both microexons and a uniform expression pattern of the Δex9Δex23 NRCAM isoform across different cell clusters. The inventor validated the surface expression of the corresponding proteoform using live cell biotinylation assay and demonstrated that it increases migration and invasion of KNS42 pHGG cells. The inventor also developed a mouse monoclonal antibody with significantly higher avidity for the Δex9Δex23 vs. the full- length NRCAM isoform. Of note, combining this antibody with chimeric antigen receptor- armed T cells directed against the Fc fragment of murine antibodies resulted in efficient, NRCAM-dependent killing of KNS42 cells in vitro. Therefore, the pHGG-specific NRCAM (and possibly other microexon-derived proteoforms) are highly selective and feasible targets for CAR T cell-based immunotherapies. These and other aspects of the disclosure are discussed in detail below.

[0015] 144896-8944-3433, v. 1 I. Terminology Unless otherwise defined, scientific and technical terms used herein shall have the meaning that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclatures utilized in connection with, and techniques of, antibodies and related molecules, cell and tissue culture, molecular biology, and protein and oligo- or polynucleotide chemistry and hybridization described herein are those well- known and commonly used in the art. Standard techniques are used for recombinant DNA, oligonucleotide synthesis, and cell culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See, e.g., B. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984); J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989); T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991); D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1- 4, IRL Press (1995 and 1996); and F.M. Ausubel et al., (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present); Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1988); and J.E. Coligan et al., (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present). The description and definitions of variable regions and parts thereof, immunoglobulins, antibodies and fragments thereof herein may be further clarified by the discussion in Kabat Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, Md. (1987 and 1991); Bork et al., J Mol. Biol. 242, 309-320 (1994); Chothia and Lesk J. Mol Biol. 196:901-917 (1987), Chothia et al., Nature 342, 877-883 (1989), and / or or Al-Lazikani et al., J Mol Biol 273, 927-948 (1997). As used herein, “antigen-binding site” shall be taken to mean a structure formed by a protein that is capable of binding or specifically binding to an antigen, such as an antibody.

[0016] 154896-8944-3433, v. 1 The antigen-binding site need not be a series of contiguous amino acids, or even amino acids in a single polypeptide chain. For example, in a Fv comprising two different polypeptide chains from an antibody, the antigen-binding site is made up of a series of amino acids of a VL and a VH that interact with the antigen and that are generally, however not always in one or more of the CDRs in each variable region. In some embodiments, the antigen-binding site is an antigen-binding site of an antibody. In such embodiments, the antigen-binding site may comprise one or more complementarity-determining regions or “CDRs”. In some embodiments, the antigen-binding site of an antibody comprises at least part of a VHor a VLor a Fv. As used herein the phrase “chimeric antigen receptor (CAR)” refers to a recombinant or synthetic molecule which combines antibody-based specificity for a desired antigen with a T cell receptor-activating intracellular domain to generate a chimeric protein that exhibits cellular immune activity to the specific antigen. As used herein the phrase “T Cell Receptor” or “TCR” refers to soluble and non- soluble forms of recombinant T-cell receptor. As used herein, a “T-cell receptor (TCR) fusion protein” or “TFP” includes a recombinant polypeptide derived from the various polypeptides comprising the TCR that is generally capable of i) binding to a surface antigen on target cells and ii) interacting with other polypeptide components of the intact TCR complex, typically when co-located in or on the surface of a T-cell. As used herein a “T Cell Receptor-like antibody (TCRL” or “peptide-centric CAR (PC-CAR)” refers to an antibody which binds an MHC displaying an HLA-restricted peptide antigen. Binding of the TCRL to its target typically has an MHC-restricted specificity: the TCRL does not bind the MHC in the absence of the complexed peptide, and the TCRL does not bind the peptide in an absence of the MHC. TCRLs are characterized by affinity sufficient to permit specific binding to a tumor antigen even when the TCRL is provided in a soluble, rather than membrane-bound, form. TCRLs are being developed as a new therapeutic class for targeting tumor cells and mediating their specific killing. In addition, TCRLs are valuable research reagents enabling the study of human class I peptide-MHC ligand presentation and TCR-peptide-MHC interactions. In an embodiment, the binding agent of the present disclosure is a TCRL.

[0017] 164896-8944-3433, v. 1 As used herein the phrase “MHC (or HLA)-restricted peptide” refers to a peptide which is potentially presented on an MHC molecule. Such peptides may be identified by laboratory procedures such as Mass-Spectrometry, reverse-immunology or by in-silico analysis. An MHC (or HLA)-presented peptide refers to a peptide which is confirmed in vitro or in vivo as being presented by an MHC molecule. The term “cancer” as used herein is defined as a disease characterized by the rapid and uncontrolled growth of aberrant cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. The terms “normoxia” and “hypoxia” are generally known to those of skill in the art. In general, oxygen levels in tumors range from about 0.3 to 4.2% but are mostly below 2%, whereas oxygen levels in normal tissues range from about 3.4 to 6.8%, mostly above 4%. See McKeown S., Br. J. Radiol 87(1035), 2014. For the purposes of this application, normoxia is defined as 3 / 0% or higher oxygen would be lower than 3.0%o xygen. A “compound” refers to any molecule including small molecules, polypeptides, and other macromolecules. In some embodiments, a compound is a small molecular weight compound with a molecular weight of less than about 2000 Daltons. The term “naturally occurring” (or “native”) as used herein as applied to an object refers to the fact that an object can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory or otherwise is naturally occurring. The term “operably linked” as used herein refers to positions of components so described that are in a relationship permitting them to function in their intended manner. For example, a control sequence “operably linked” to a coding sequence is connected in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences. The term “protein” shall be taken to include a single polypeptide chain, i.e., a series of contiguous amino acids linked by peptide bonds or a series of polypeptide chains covalently or non-covalently linked to one another (i.e., a polypeptide complex). For example, the series of polypeptide chains can be covalently linked using a suitable chemical linker or a disulphide bond, for example. Examples of non-covalent bonds include hydrogen bonds, ionic bonds, Van der Waals forces, and hydrophobic interactions.

[0018] 174896-8944-3433, v. 1 The term “polypeptide” or “polypeptide chain” will be understood from the foregoing paragraph to mean a series of contiguous amino acids linked by peptide bonds. The term “polynucleotide” as referred to herein means a polymeric form of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide, or RNA-DNA hetero-duplexes. The term includes single and double stranded forms of DNA. The term “sequence identity” means that two polynucleotide or amino acid sequences are identical (i.e., on a nucleotide-by-nucleotide or residue-by-residue basis) over the comparison window. The term “percentage of sequence identity” is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. The terms “substantial identity” as used herein denotes a characteristic of a polynucleotide or amino acid sequence, wherein the polynucleotide or amino acid comprises a sequence that has at least 85 percent sequence identity, preferably at least 90 to 95 percent sequence identity, more preferably at least 99 percent sequence identity, as compared to a reference sequence over a comparison window of at least 18 nucleotide (6 amino acid) positions, frequently over a window of at least 24-48 nucleotide (8-16 amino acid) positions, wherein the percentage of sequence identity is calculated by comparing the reference sequence to the sequence which may include deletions or additions which total 20 percent or less of the reference sequence over the comparison window. The reference sequence may be a subset of a larger sequence. As used herein, the twenty conventional amino acids and their abbreviations follow conventional usage. See Immunology - A Synthesis (2ndEdition, E.S. Golub and D.R. Gren, Eds., Sinauer Associates, Sunderland, Mass. (1991)). The term “epitope” includes any protein determinant capable of specific binding to an immunoglobulin or T-cell receptor. Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and may, but not always, have specific three-dimensional structural characteristics, as well as specific charge characteristics.

[0019] 184896-8944-3433, v. 1 The term “agent” is used herein to denote a chemical compound, a mixture of chemical compounds, a biological macromolecule, or an extract made from biological materials. The term “neuronal cell adhesion molecule” (NRCAM) refers to a protein that in humans is encoded by the NRCAM gene. Cell adhesion molecules (CAMs) are members of the immunoglobulin superfamily. This gene encodes a neuronal cell adhesion molecule with multiple immunoglobulin-like C2-type domains and fibronectin type-III domains. This ankyrin-binding protein is involved in neuron-neuron adhesion and promotes directional signaling during axonal cone growth. This gene is also expressed in non-neural tissues and may play a general role in cell-cell communication via signaling from its intracellular domain to the actin cytoskeleton during directional cell migration. Allelic variants of this gene have been associated with autism and addiction vulnerability. Alternative splicing results in multiple transcript variants encoding different isoforms. Exemplary sequences include NM_001037132 and NM_001037133 (mRNA) and NP_001180513 and NP_001180512 (protein). “NRCAM Δex5Δex19” and “NRCAM Δex9Δ23” may be used interchangeably to refer to an NRCAM isoform that results from the skipping of microexon 5 (which also may be referred to as microexon 9) and microexon 19 (which also may be referred to as microexon 23) during alternative splicing. All publications and patents mentioned herein are hereby incorporated by reference in their entirety as if each individual publication or patent was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control. However, mention of any reference, article, publication, patent, patent publication, and patent application cited herein is not, and should not be taken as an acknowledgment, or any form of suggestion, that they constitute valid prior art or form part of the common general knowledge in any country in the world. In the present description, any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated. The term “about”, when immediately preceding a number or numeral, means that the number or numeral ranges plus or minus 10%. It should be understood that the terms “a” and “an” as used herein refer to “one or more” of the enumerated components unless otherwise indicated. The use of the alternative (e.g., “or”)

[0020] 194896-8944-3433, v. 1 should be understood to mean either one, both, or any combination thereof of the alternatives. The term “and / or” should be understood to mean either one, or both of the alternatives. As used herein, the terms “include” and “comprise” are used synonymously. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. II. Antibodies An "isolated antibody" is one that has been separated and / or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In particular embodiments, the antibody is purified: (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most particularly more than 99% by weight; (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator; or (3) to homogeneity by SDS-PAGE under reducing or non-reducing conditions using Coomassie blue or silver stain. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step. The basic four-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. An IgM antibody consists of 5 basic heterotetramer units along with an additional polypeptide called J chain, and therefore contain 10 antigen binding sites, while secreted IgA antibodies can polymerize to form polyvalent assemblages comprising 2-5 of the basic 4-chain units along with J chain. In the case of IgGs, the 4-chain unit is generally about 150,000 daltons. Each L chain is linked to an H chain by one covalent disulfide bond, while the two H chains are linked to each other by one or more disulfide bonds depending on the H chain isotype. Each H and L chain also has regularly spaced intrachain disulfide bridges. Each H chain has at the N- terminus, a variable region (VH) followed by three constant domains (CH) for each of the alpha and gamma chains and four CHdomains for mu and isotypes. Each L chain has at the N-terminus, a variable region (VL) followed by a constant domain (CL) at its other end. The VLis aligned with the VHand the CLis aligned with the first constant domain of the heavy chain (CH1). Particular amino acid residues are believed to form an interface between the

[0021] 204896-8944-3433, v. 1 light chain and heavy chain variable regions. The pairing of a VHand VLtogether forms a single antigen-binding site. For the structure and properties of the different classes of antibodies, see, e.g., Basic and Clinical Immunology, 8th edition, Daniel P. Stites, Abba I. Terr and Tristram G. Parslow (eds.), Appleton & Lange, Norwalk, Conn., 1994, page 71, and Chapter 6. The L chain from any vertebrate species can be assigned to one of two clearly distinct types, called kappa and lambda based on the amino acid sequences of their constant domains (CL). Depending on the amino acid sequence of the constant domain of their heavy chains (CH), immunoglobulins can be assigned to different classes or isotypes. There are five classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, having heavy chains designated alpha, delta, epsilon, gamma and mu, respectively. They gamma and alpha classes are further divided into subclasses on the basis of relatively minor differences in CHsequence and function, humans express the following subclasses: IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The term "variable" refers to the fact that certain segments of the V domains differ extensively in sequence among antibodies. The V domain mediates antigen binding and defines specificity of a particular antibody for its particular antigen. However, the variability is not evenly distributed across the 110-amino acid span of the variable regions. Instead, the V regions consist of relatively invariant stretches called framework regions (FRs) of 15-30 amino acids separated by shorter regions of extreme variability called "hypervariable regions" that are each 9-12 amino acids long. The variable regions of native heavy and light chains each comprise four FRs, largely adopting a beta-sheet configuration, connected by three hypervariable regions, which form loops connecting, and in some cases forming part of, the beta-sheet structure. The hypervariable regions in each chain are held together in close proximity by the FRs and, with the hypervariable regions from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)). The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody dependent cellular cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), antibody-dependent neutrophil phagocytosis (ADNP), and antibody- dependent complement deposition (ADCD).

[0022] 214896-8944-3433, v. 1 The term "hypervariable region" when used herein refers to the amino acid residues of an antibody that are responsible for antigen binding. The hypervariable region generally comprises amino acid residues from a "complementarity determining region" or "CDR" (e.g., around about residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) in the VL, and around about 31-35 (H1), 50-65 (H2) and 95-102 (H3) in the VHwhen numbered in accordance with the Kabat numbering system; Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)); and / or those residues from a "hypervariable loop" (e.g., residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) in the VL, and 26-32 (H1), 52-56 (H2) and 95-101 (H3) in the VH when numbered in accordance with the Chothia numbering system; Chothia and Lesk, J. Mol. Biol. 196:901- 917 (1987)); and / or those residues from a "hypervariable loop" / CDR (e.g., residues 27-38 (L1), 56-65 (L2) and 105-120 (L3) in the VL, and 27-38 (H1), 56-65 (H2) and 105-120 (H3) in the VH when numbered in accordance with the IMGT numbering system; Lefranc, M. P. et al. Nucl. Acids Res. 27:209-212 (1999), Ruiz, M. et al. Nucl. Acids Res. 28:219-221 (2000). Optionally the antibody has symmetrical insertions at one or more of the following points 28, 36 (L1), 63, 74-75 (L2) and 123 (L3) in the VL, and 28, 36 (H1), 63, 74-75 (H2) and 123 (H3) in the VsubH when numbered in accordance with AHo; Honneger, A. and Plunkthun, A. J. Mol. Biol.309:657-670 (2001)). By "germline nucleic acid residue" is meant the nucleic acid residue that naturally occurs in a germline gene encoding a constant or variable region. "Germline gene" is the DNA found in a germ cell (i.e., a cell destined to become an egg or in the sperm). A "germline mutation" refers to a heritable change in a particular DNA that has occurred in a germ cell or the zygote at the single-cell stage, and when transmitted to offspring, such a mutation is incorporated in every cell of the body. A germline mutation is in contrast to a somatic mutation which is acquired in a single body cell. In some cases, nucleotides in a germline DNA sequence encoding for a variable region are mutated (i.e., a somatic mutation) and replaced with a different nucleotide. The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to polyclonal antibody

[0023] 224896-8944-3433, v. 1 preparations that include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they may be synthesized uncontaminated by other antibodies. The modifier "monoclonal" is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies useful in the present disclosure may be prepared by the hybridoma methodology first described by Kohler et al., Nature, 256:495 (1975), or may be made using recombinant DNA methods in bacterial, eukaryotic animal or plant cells (see, e.g., U.S. Patent 4,816,567) after single cell sorting of an antigen specific B cell, an antigen specific plasmablast responding to an infection or immunization, or capture of linked heavy and light chains from single cells in a bulk sorted antigen specific collection. The "monoclonal antibodies" may also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature, 352:624-628 (1991) and Marks et al., J. Mol. Biol., 222:581-597 (1991), for example. A. General Methods It will be understood that monoclonal antibodies binding to NRCAM will have several applications. These include the production of diagnostic kits for use in detecting NRCAM-related cancers, as well as for treating the same. In these contexts, one may link such antibodies to diagnostic or therapeutic agents, use them as capture agents or competitors in competitive assays, or use them individually without additional agents being attached thereto. The antibodies may be mutated or modified, as discussed further below. Methods for preparing and characterizing antibodies are well known in the art (see, e.g., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988; U.S. Patent 4,196,265). The methods for generating monoclonal antibodies (MAbs) generally begin along the same lines as those for preparing polyclonal antibodies. The first step for both these methods is immunization of an appropriate host or identification of subjects who are immune due to prior natural infection or vaccination with a licensed or experimental vaccine. As is well known in the art, a given composition for immunization may vary in its immunogenicity. It is often necessary therefore to boost the host immune system, as may be achieved by coupling a peptide or polypeptide immunogen to a carrier. Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also

[0024] 234896-8944-3433, v. 1 be used as carriers. Means for conjugating a polypeptide to a carrier protein are well known in the art and include glutaraldehyde, m-maleimidobencoyl-N-hydroxysuccinimide ester, carbodiimyde and bis-biazotized benzidine. As also is well known in the art, the immunogenicity of a particular immunogen composition can be enhanced by the use of non- specific stimulators of the immune response, known as adjuvants. Exemplary and preferred adjuvants in animals include complete Freund’s adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete Freund’s adjuvants and aluminum hydroxide adjuvant and in humans include alum, CpG, MFP59 and combinations of immunostimulatory molecules (“Adjuvant Systems”, such as AS01 or AS03). Additional experimental forms of inoculation to induce NRCAM-specific B cells is possible, including nanoparticle vaccines, or gene-encoded antigens delivered as DNA or RNA genes in a physical delivery system (such as lipid nanoparticle or on a gold biolistic bead), and delivered with needle, gene gun, transcutaneous electroporation device. The antigen gene also can be carried as encoded by a replication competent or defective viral vector such as adenovirus, adeno-associated virus, poxvirus, herpesvirus, or alphavirus replicon, or alternatively a virus like particle. The amount of immunogen composition used in the production of polyclonal antibodies varies upon the nature of the immunogen as well as the animal used for immunization. A variety of routes can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intravenous and intraperitoneal). The production of polyclonal antibodies may be monitored by sampling blood of the immunized animal at various points following immunization. A second, booster injection, also may be given. The process of boosting and titering is repeated until a suitable titer is achieved. When a desired level of immunogenicity is obtained, the immunized animal can be bled and the serum isolated and stored, and / or the animal can be used to generate MAbs. Following immunization, somatic cells with the potential for producing antibodies, specifically B lymphocytes (B cells), are selected for use in the MAb generating protocol. These cells may be obtained from biopsied spleens, lymph nodes, tonsils or adenoids, bone marrow aspirates or biopsies, tissue biopsies from mucosal organs like lung or GI tract, or from circulating blood. The antibody-producing B lymphocytes from the immunized animal or immune human are then fused with cells of an immortal myeloma cell, generally one of the same species as the animal that was immunized or human or human / mouse chimeric

[0025] 244896-8944-3433, v. 1 cells. Myeloma cell lines suited for use in hybridoma-producing fusion procedures preferably are non-antibody-producing, have high fusion efficiency, and enzyme deficiencies that render then incapable of growing in certain selective media which support the growth of only the desired fused cells (hybridomas). Any one of a number of myeloma cells may be used, as are known to those of skill in the art (Goding, pp. 65-66, 1986; Campbell, pp. 75-83, 1984). HMMA2.5 cells or MFP-2 cells are particularly useful examples of such cells. Methods for generating hybrids of antibody-producing spleen or lymph node cells and myeloma cells usually comprise mixing somatic cells with myeloma cells in a 2:1 proportion, though the proportion may vary from about 20:1 to about 1:1, respectively, in the presence of an agent or agents (chemical or electrical) that promote the fusion of cell membranes. In some cases, transformation of human B cells with Epstein Barr virus (EBV) as an initial step increases the size of the B cells, enhancing fusion with the relatively large- sized myeloma cells. Transformation efficiency by EBV is enhanced by using CpG and a Chk2 inhibitor drug in the transforming medium. Alternatively, human B cells can be activated by co-culture with transfected cell lines expressing CD40 Ligand (CD154) in medium containing additional soluble factors, such as IL-21 and human B cell Activating Factor (BAFF), a Type II member of the TNF superfamily. Fusion methods using Sendai virus have been described by Kohler and Milstein (1975; 1976), and those using polyethylene glycol (PEG), such as 37% (v / v) PEG, by Gefter et al. (1977). The use of electrically induced fusion methods also is appropriate (Goding, pp.71-74, 1986) and there are processes for better efficiency (Yu et al., 2008). Fusion procedures usually produce viable hybrids at low frequencies, about 1 x 10-6to 1 x 10-8, but with optimized procedures one can achieve fusion efficiencies close to 1 in 200 (Yu et al., 2008). However, relatively low efficiency of fusion does not pose a problem, as the viable, fused hybrids are differentiated from the parental, infused cells (particularly the infused myeloma cells that would normally continue to divide indefinitely) by culturing in a selective medium. The selective medium is generally one that contains an agent that blocks the de novo synthesis of nucleotides in the tissue culture medium. Exemplary and preferred agents are aminopterin, methotrexate, and azaserine. Aminopterin and methotrexate block de novo synthesis of both purines and pyrimidines, whereas azaserine blocks only purine synthesis. Where aminopterin or methotrexate is used, the medium is supplemented with hypoxanthine and thymidine as a

[0026] 254896-8944-3433, v. 1 source of nucleotides (HAT medium). Where azaserine is used, the medium is supplemented with hypoxanthine. Ouabain is added if the B cell source is an EBV-transformed human B cell line, in order to eliminate EBV-transformed lines that have not fused to the myeloma. The preferred selection medium is HAT or HAT with ouabain. Only cells capable of operating nucleotide salvage pathways are able to survive in HAT medium. The myeloma cells are defective in key enzymes of the salvage pathway, e.g., hypoxanthine phosphoribosyl transferase (HPRT), and they cannot survive. The B cells can operate this pathway, but they have a limited life span in culture and generally die within about two weeks. Therefore, the only cells that can survive in the selective media are those hybrids formed from myeloma and B cells. When the source of B cells used for fusion is a line of EBV-transformed B cells, as here, ouabain may also be used for drug selection of hybrids as EBV-transformed B cells are susceptible to drug killing, whereas the myeloma partner used is chosen to be ouabain resistant. Culturing provides a population of hybridomas from which specific hybridomas are selected. Typically, selection of hybridomas is performed by culturing the cells by single- clone dilution in microtiter plates, followed by testing the individual clonal supernatants (after about two to three weeks) for the desired reactivity. The assay should be sensitive, simple and rapid, such as radioimmunoassays, enzyme immunoassays, cytotoxicity assays, plaque assays dot immunobinding assays, and the like. The selected hybridomas are then serially diluted or single-cell sorted by flow cytometric sorting and cloned into individual antibody-producing cell lines, which clones can then be propagated indefinitely to provide mAbs. The cell lines may be exploited for MAb production in two basic ways. A sample of the hybridoma can be injected (often into the peritoneal cavity) into an animal (e.g., a mouse). Optionally, the animals are primed with a hydrocarbon, especially oils such as pristane (tetramethylpentadecane) prior to injection. When human hybridomas are used in this way, it is optimal to inject immunocompromised mice, such as SCID mice, to prevent tumor rejection. The injected animal develops tumors secreting the specific monoclonal antibody produced by the fused cell hybrid. The body fluids of the animal, such as serum or ascites fluid, can then be tapped to provide MAbs in high concentration. The individual cell lines could also be cultured in vitro, where the MAbs are naturally secreted into the culture medium from which they can be readily obtained in high concentrations. Alternatively, human hybridoma cells lines can be used in vitro to produce immunoglobulins in cell

[0027] 264896-8944-3433, v. 1 supernatant. The cell lines can be adapted for growth in serum-free medium to optimize the ability to recover human monoclonal immunoglobulins of high purity. MAbs produced by either means may be further purified, if desired, using filtration, centrifugation and various chromatographic methods such as FPLC or affinity chromatography. Fragments of the monoclonal antibodies of the disclosure can be obtained from the purified monoclonal antibodies by methods which include digestion with enzymes, such as pepsin or papain, and / or by cleavage of disulfide bonds by chemical reduction. Alternatively, monoclonal antibody fragments encompassed by the present disclosure can be synthesized using an automated peptide synthesizer. It also is contemplated that a molecular cloning approach may be used to generate monoclonal antibodies. Single B cells identified as responding to infection or vaccination because of plasmablast or activated B cell markers, or memory B cells labelled with the antigen of interest, can be sorted physically using paramagnetic bead selection or flow cytometric sorting, then RNA can be isolated from the single cells and antibody genes amplified by RT-PCR. Various single-cell RNA-seq methods are available to obtain antibody variable genes from single cells. Alternatively, antigen-specific bulk sorted populations of cells can be segregated into microvesicles and the matched heavy and light chain variable genes recovered from single cells using physical linkage of heavy and light chain amplicons, or common barcoding of heavy and light chain genes from a vesicle. Matched heavy and light chain genes from single cells also can be obtained from populations of antigen specific B cells by treating cells with cell-penetrating nanoparticles bearing RT- PCR primers and barcodes for marking transcripts with one barcode per cell. The antibody variable genes also can be isolated by RNA extraction of a hybridoma line and the antibody genes obtained by RT-PCR and cloned into an immunoglobulin expression vector. Alternatively, combinatorial immunoglobulin phagemid libraries are prepared from RNA isolated from the cell lines and phagemids expressing appropriate antibodies are selected by panning using viral antigens. The advantages of this approach over conventional hybridoma techniques are that approximately 104times as many antibodies can be produced and screened in a single round, and that new specificities are generated by H and L chain combination which further increases the chance of finding appropriate antibodies. Other U.S. patents, each incorporated herein by reference, that teach the production of antibodies useful in the present disclosure include U.S. Patent 5,565,332, which describes

[0028] 274896-8944-3433, v. 1 the production of chimeric antibodies using a combinatorial approach; U.S. Patent 4,816,567 which describes recombinant immunoglobulin preparations; and U.S. Patent 4,867,973 which describes antibody-therapeutic agent conjugates. B. Antibodies of the Present Disclosure Antibodies according to the present disclosure may be defined, in the first instance, by their binding specificity. Those of skill in the art, by assessing the binding specificity / affinity of a given antibody using techniques well known to those of skill in the art, can determine whether such antibodies fall within the scope of the instant claims. For example, the epitope to which a given antibody bind may consist of a single contiguous sequence of 3 or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) amino acids located within the antigen molecule (e.g., a linear epitope in a domain). Alternatively, the epitope may consist of a plurality of non-contiguous amino acids (or amino acid sequences) located within the antigen molecule (e.g., a conformational epitope). Various techniques known to persons of ordinary skill in the art can be used to determine whether an antibody “interacts with one or more amino acids” within a polypeptide or protein. Exemplary techniques include, for example, routine cross-blocking assays, such as those described in Antibodies, Harlow and Lane (Cold Spring Harbor Press, Cold Spring Harbor, N.Y.). Cross-blocking can be measured in various binding assays such as ELISA, biolayer interferometry, or surface plasmon resonance. Other methods include alanine scanning mutational analysis, peptide blot analysis (Reineke, Methods Mol. Biol. 248: 443-63, 2004), peptide cleavage analysis, high-resolution electron microscopy techniques using single particle reconstruction, cryoEM, or tomography, crystallographic studies and NMR analysis. In addition, methods such as epitope excision, epitope extraction and chemical modification of antigens can be employed (Tomer Prot. Sci.9: 487-496, 2000). Another method that can be used to identify the amino acids within a polypeptide with which an antibody interacts is hydrogen / deuterium exchange detected by mass spectrometry. In general terms, the hydrogen / deuterium exchange method involves deuterium-labeling the protein of interest, followed by binding the antibody to the deuterium-labeled protein. Next, the protein / antibody complex is transferred to water and exchangeable protons within amino acids that are protected by the antibody complex undergo deuterium-to-hydrogen back- exchange at a slower rate than exchangeable protons within amino acids that are not part of the interface. As a result, amino acids that form part of the protein / antibody interface may

[0029] 284896-8944-3433, v. 1 retain deuterium and therefore exhibit relatively higher mass compared to amino acids not included in the interface. After dissociation of the antibody, the target protein is subjected to protease cleavage and mass spectrometry analysis, thereby revealing the deuterium-labeled residues which correspond to the specific amino acids with which the antibody interacts. See, e.g., Ehring, Analytical Biochemistry 267: 252-259 (1999); Engen and Smith, Anal. Chem.73: 256A-265A (2001). The term “epitope” refers to a site on an antigen to which B and / or T cells respond. B-cell epitopes can be formed both from contiguous amino acids or noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained on exposure to denaturing solvents, whereas epitopes formed by tertiary folding are typically lost on treatment with denaturing solvents. An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation. Modification-Assisted Profiling (MAP), also known as Antigen Structure-based Antibody Profiling (ASAP) is a method that categorizes large numbers of monoclonal antibodies (mAbs) directed against the same antigen according to the similarities of the binding profile of each antibody to chemically or enzymatically modified antigen surfaces (see U.S. Patent Publication 2004 / 0101920, herein specifically incorporated by reference in its entirety). Each category may reflect a unique epitope either distinctly different from or partially overlapping with epitope represented by another category. This technology allows rapid filtering of genetically identical antibodies, such that characterization can be focused on genetically distinct antibodies. When applied to hybridoma screening, MAP may facilitate identification of rare hybridoma clones that produce mAbs having the desired characteristics. MAP may be used to sort the antibodies of the disclosure into groups of antibodies binding different epitopes. The present disclosure includes antibodies that may bind to the same epitope, or a portion of the epitope. Likewise, the present disclosure also includes antibodies that compete for binding to a target or a fragment thereof with any of the specific exemplary antibodies described herein. One can easily determine whether an antibody binds to the same epitope as, or competes for binding with, a reference antibody by using routine methods known in the art. For example, to determine if a test antibody binds to the same epitope as a reference, the reference antibody is allowed to bind to target under saturating conditions. Next, the

[0030] 294896-8944-3433, v. 1 ability of a test antibody to bind to the target molecule is assessed. If the test antibody is able to bind to the target molecule following saturation binding with the reference antibody, it can be concluded that the test antibody binds to a different epitope than the reference antibody. On the other hand, if the test antibody is not able to bind to the target molecule following saturation binding with the reference antibody, then the test antibody may bind to the same epitope as the epitope bound by the reference antibody. To determine if an antibody competes for binding with a reference anti-NRCAM antibody, the above-described binding methodology is performed in two orientations: In a first orientation, the reference antibody is allowed to bind to the antigen under saturating conditions followed by assessment of binding of the test antibody to the antigen. In a second orientation, the test antibody is allowed to bind to the antigen molecule under saturating conditions followed by assessment of binding of the reference antibody to the antigen. If, in both orientations, only the first (saturating) antibody is capable of binding to NRCAM, then it is concluded that the test antibody and the reference antibody compete for binding to the antigen. As will be appreciated by a person of ordinary skill in the art, an antibody that competes for binding with a reference antibody may not necessarily bind to the identical epitope as the reference antibody but may sterically block binding of the reference antibody by binding an overlapping or adjacent epitope. Two antibodies bind to the same or overlapping epitope if each competitively inhibits (blocks) binding of the other to the antigen. That is, a 1-, 5-, 10-, 20- or 100-fold excess of one antibody inhibits binding of the other by at least 50% but preferably 75%, 90% or even 99% as measured in a competitive binding assay (see, e.g., Junghans et al., Cancer Res.1990 50:1495-1502). Alternatively, two antibodies have the same epitope if essentially all amino acid mutations in the antigen that reduce or eliminate binding of one antibody reduce or eliminate binding of the other. Two antibodies have overlapping epitopes if some amino acid mutations that reduce or eliminate binding of one antibody reduce or eliminate binding of the other. Additional routine experimentation (e.g., peptide mutation and binding analyses) can then be carried out to confirm whether the observed lack of binding of the test antibody is in fact due to binding to the same epitope as the reference antibody or if steric blocking (or another phenomenon) is responsible for the lack of observed binding. Experiments of this sort can be performed using ELISA, RIA, surface plasmon resonance, flow cytometry or any

[0031] 304896-8944-3433, v. 1 other quantitative or qualitative antibody-binding assay available in the art. Structural studies with EM or crystallography also can demonstrate whether or not two antibodies that compete for binding recognize the same epitope. In another aspect, there are provided monoclonal antibodies having clone-paired CDRs from the heavy and light chains as illustrated in Tables 3 and 4, respectively. Such antibodies may be produced by the clones discussed below in the Examples section using methods described herein. In another aspect, the antibodies may be defined by their variable sequence, which include additional “framework” regions. Furthermore, the antibodies sequences may vary from these sequences, optionally using methods discussed in greater detail below. For example, nucleic acid sequences may vary from those set out above in that (a) the variable regions may be segregated away from the constant domains of the light and heavy chains, (b) the nucleic acids may vary from those set out above while not affecting the residues encoded thereby, (c) the nucleic acids may vary from those set out above by a given percentage, e.g., 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, (d) the nucleic acids may vary from those set out above by virtue of the ability to hybridize under high stringency conditions, as exemplified by low salt and / or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50°C to about 70°C, (e) the amino acids may vary from those set out above by a given percentage, e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, or (f) the amino acids may vary from those set out above by permitting conservative substitutions (discussed below). Each of the foregoing applies to the nucleic acid sequences and the amino acid sequences. When comparing polynucleotide and polypeptide sequences, two sequences are said to be "identical" if the sequence of nucleotides or amino acids in the two sequences is the same when aligned for maximum correspondence, as described below. Comparisons between two sequences are typically performed by comparing the sequences over a comparison window to identify and compare local regions of sequence similarity. A "comparison window" as used herein, refers to a segment of at least about 20 contiguous positions, usually 30 to about 75, 40 to about 50, in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.

[0032] 314896-8944-3433, v. 1 Optimal alignment of sequences for comparison may be conducted using the Megalign program in the Lasergene suite of bioinformatics software (DNASTAR, Inc., Madison, Wis.), using default parameters. This program embodies several alignment schemes described in the following references: Dayhoff, M. O. (1978) A model of evolutionary change in proteins--Matrices for detecting distant relationships. In Dayhoff, M. O. (ed.) Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington D.C. Vol. 5, Suppl. 3, pp. 345-358; Hein J. (1990) Unified Approach to Alignment and Phylogeny pp.626-645 Methods in Enzymology vol. 183, Academic Press, Inc., San Diego, Calif.; Higgins, D. G. and Sharp, P. M. (1989) CABIOS 5:151-153; Myers, E. W. and Muller W. (1988) CABIOS 4:11-17; Robinson, E. D. (1971) Comb. Theor 11:105; Santou, N. Nes, M. (1987) Mol. Biol. Evol. 4:406-425; Sneath, P. H. A. and Sokal, R. R. (1973) Numerical Taxonomy--the Principles and Practice of Numerical Taxonomy, Freeman Press, San Francisco, Calif.; Wilbur, W. J. and Lipman, D. J. (1983) Proc. Natl. Acad., Sci. USA 80:726-730. Alternatively, optimal alignment of sequences for comparison may be conducted by the local identity algorithm of Smith and Waterman (1981) Add. APL. Math 2:482, by the identity alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol.48:443, by the search for similarity methods of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85: 2444, by computerized implementations of these algorithms (GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.), or by inspection. One particular example of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nucl. Acids Res. 25:3389-3402 and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. BLAST and BLAST 2.0 can be used, for example, with the parameters described herein, to determine percent sequence identity for the polynucleotides and polypeptides of the disclosure. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. The rearranged nature of an antibody sequence and the variable length of each gene requires multiple rounds of BLAST searches for a single antibody sequence. Also, manual assembly of different genes is difficult and error prone. The sequence analysis tool IgBLAST (world- wide-web at ncbi.nlm.nih.gov / igblast / ) identifies matches to the germline V, D and J genes,

[0033] 324896-8944-3433, v. 1 details at rearrangement junctions, the delineation of Ig V domain framework regions and complementarity determining regions. IgBLAST can analyze nucleotide or protein sequences and can process sequences in batches and allows searches against the germline gene databases and other sequence databases simultaneously to minimize the chance of missing possibly the best matching germline V gene. In one illustrative example, cumulative scores can be calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignments, (B) of 50, expectation (E) of 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, a scoring matrix can be used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. In one approach, the "percentage of sequence identity" is determined by comparing two optimally aligned sequences over a window of comparison of at least 20 positions, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less, usually 5 to 15 percent, or 10 to 12 percent, as compared to the reference sequences (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid bases or amino acid residues occur in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the reference

[0034] 334896-8944-3433, v. 1 sequence (i.e., the window size) and multiplying the results by 100 to yield the percentage of sequence identity. Yet another way of defining an antibody is as a “derivative” of any of the below- described antibodies and their antigen-binding fragments. The term “derivative” refers to an antibody or antigen-binding fragment thereof that immunospecifically binds to an antigen, but which comprises, one, two, three, four, five or more amino acid substitutions, additions, deletions or modifications relative to a “parental” (or wild-type) molecule. Such amino acid substitutions or additions may introduce naturally occurring (i.e., DNA-encoded) or non- naturally occurring amino acid residues. The term “derivative” encompasses, for example, as variants having altered CH1, hinge, CH2, CH3 or CH4 regions, so as to form, for example, antibodies, etc., having variant Fc regions that exhibit enhanced or impaired effector or binding characteristics. The term “derivative” additionally encompasses non-amino acid modifications, for example, amino acids that may be glycosylated (e.g., have altered mannose, 2-N-acetylglucosamine, galactose, fucose, glucose, sialic acid, 5-N- acetylneuraminic acid, 5-glycolneuraminic acid, etc. content), acetylated, pegylated, phosphorylated, amidated, derivatized by known protecting / blocking groups, proteolytic cleavage, linked to a cellular ligand or other protein, etc. In some embodiments, the altered carbohydrate modifications modulate one or more of the following: solubilization of the antibody, facilitation of subcellular transport and secretion of the antibody, promotion of antibody assembly, conformational integrity, and antibody-mediated effector function. In a specific embodiment, the altered carbohydrate modifications enhance antibody mediated effector function relative to the antibody lacking the carbohydrate modification. Carbohydrate modifications that lead to altered antibody mediated effector function are well known in the art (for example, see Shields, R. L. et al. (2002) “Lack Of Fucose On Human IgG N-Linked Oligosaccharide Improves Binding To Human Fcgamma RIII And Antibody- Dependent Cellular Toxicity,” J. Biol. Chem.277(30): 26733-26740; Davies J. et al. (2001) “Expression Of GnTIII In A Recombinant Anti-CD20 CHO Production Cell Line: Expression Of Antibodies With Altered Glycoforms Leads To An Increase In ADCC Through Higher Affinity For FC Gamma RIII,” Biotechnology & Bioengineering 74(4): 288-294). Methods of altering carbohydrate contents are known to those skilled in the art, see, e.g., Wallick, S. C. et al. (1988), J. Exp. Med. 168(3): 1099-1109; Tao, M. H. et al. (1989), J. Immunol.143(8): 2595-2601; Routledge, E. G. et al. (1995), Transplantation 60(8):847-53;

[0035] 344896-8944-3433, v. 1 Elliott, S. et al. (2003), Nature Biotechnol. 21:414-21; Shields, R. L. et al. (2002), J. Biol. Chem.277(30): 26733-26740). A derivative antibody or antibody fragment can be generated with an engineered sequence or glycosylation state to confer preferred levels of activity in antibody dependent cellular cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), antibody- dependent neutrophil phagocytosis (ADNP), or antibody-dependent complement deposition (ADCD) functions as measured by bead-based or cell-based assays or in vivo studies in animal models. A derivative antibody or antibody fragment may be modified by chemical modifications using techniques known to those of skill in the art, including, but not limited to, specific chemical cleavage, acetylation, formulation, metabolic synthesis of tunicamycin, etc. In one embodiment, an antibody derivative will possess a similar or identical function as the parental antibody. In another embodiment, an antibody derivative will exhibit an altered activity relative to the parental antibody. For example, a derivative antibody (or fragment thereof) can bind to its epitope more tightly or be more resistant to proteolysis than the parental antibody. C. Engineering of Antibody Sequences In various embodiments, one may choose to engineer sequences of the identified antibodies for a variety of reasons, such as improved expression, improved cross-reactivity or diminished off-target binding. Modified antibodies may be made by any technique known to those of skill in the art, including expression through standard molecular biological techniques, or the chemical synthesis of polypeptides. Methods for recombinant expression are addressed elsewhere in this document. The following is a general discussion of relevant goals techniques for antibody engineering. Hybridomas may be cultured, then cells lysed, and total RNA extracted. Random hexamers may be used with RT to generate cDNA copies of RNA, and then PCR performed using a multiplex mixture of PCR primers expected to amplify all human variable gene sequences. PCR products can be cloned into pGEM-T Easy vector, then sequenced by automated DNA sequencing using standard vector primers. Assay of binding and neutralization may be performed using antibodies collected from hybridoma supernatants and purified by FPLC, using Protein G columns.

[0036] 354896-8944-3433, v. 1 Recombinant full-length IgG antibodies can be generated by subcloning heavy and light chain Fv DNAs from the cloning vector into an IgG plasmid vector, transfected into 293 (e.g., Freestyle) cells or CHO cells, and antibodies can be collected and purified from the 293 or CHO cell supernatant. Other appropriate host cells systems include bacteria, such as E. coli, insect cells (S2, Sf9, Sf29, High Five), plant cells (e.g., tobacco, with or without engineering for human-like glycans), algae, or in a variety of non-human transgenic contexts, such as mice, rats, goats or cows. Expression of nucleic acids encoding antibodies, both for the purpose of subsequent antibody purification, and for immunization of a host, is also contemplated. Antibody coding sequences can be RNA, such as native RNA or modified RNA. Modified RNA contemplates certain chemical modifications that confer increased stability and low immunogenicity to mRNAs, thereby facilitating expression of therapeutically important proteins. For instance, N1-methyl-pseudouridine (N1mΨ) outperforms several other nucleoside modifications and their combinations in terms of translation capacity. In addition to turning off the immune / eIF2α phosphorylation-dependent inhibition of translation, incorporated N1mΨ nucleotides dramatically alter the dynamics of the translation process by increasing ribosome pausing and density on the mRNA. Increased ribosome loading of modified mRNAs renders them more permissive for initiation by favoring either ribosome recycling on the same mRNA or de novo ribosome recruitment. Such modifications could be used to enhance antibody expression in vivo following inoculation with RNA. The RNA, whether native or modified, may be delivered as naked RNA or in a delivery vehicle, such as a lipid nanoparticle. Alternatively, DNA encoding the antibody may be employed for the same purposes. The DNA is included in an expression cassette comprising a promoter active in the host cell for which it is designed. The expression cassette is advantageously included in a replicable vector, such as a conventional plasmid or minivector. Vectors include viral vectors, such as poxviruses, adenoviruses, herpesviruses, adeno-associated viruses, and lentiviruses are contemplated. Replicons encoding antibody genes such as alphavirus replicons based on VEE virus or Sindbis virus are also contemplated. Delivery of such vectors can be performed by needle through intramuscular, subcutaneous, or intradermal routes, or by transcutaneous electroporation when in vivo expression is desired.

[0037] 364896-8944-3433, v. 1 The rapid availability of antibody produced in the same host cell and cell culture process as the final cGMP manufacturing process has the potential to reduce the duration of process development programs. Lonza has developed a generic method using pooled transfectants grown in CDACF medium, for the rapid production of small quantities (up to 50 g) of antibodies in CHO cells. Although slightly slower than a true transient system, the advantages include a higher product concentration and use of the same host and process as the production cell line. Example of growth and productivity of GS-CHO pools, expressing a model antibody, in a disposable bioreactor: in a disposable bag bioreactor culture (5 L working volume) operated in fed-batch mode, a harvest antibody concentration of 2 g / L was achieved within 9 weeks of transfection. Antibody molecules will comprise fragments (such as F(ab′), F(ab′)2) that are produced, for example, by the proteolytic cleavage of the mAbs, or single-chain immunoglobulins producible, for example, via recombinant means. F(ab′) antibody derivatives are monovalent, while F(ab′)2 antibody derivatives are bivalent. In one embodiment, such fragments can be combined with one another, or with other antibody fragments or receptor ligands to form “chimeric” binding molecules. Significantly, such chimeric molecules may contain substituents capable of binding to different epitopes of the same molecule. In related embodiments, the antibody is a derivative of the disclosed antibodies, e.g., an antibody comprising the CDR sequences identical to those in the disclosed antibodies (e.g., a chimeric, or CDR-grafted antibody). Alternatively, one may wish to make modifications, such as introducing conservative changes into an antibody molecule. In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte and Doolittle, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like. It also is understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Patent 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the

[0038] 374896-8944-3433, v. 1 protein. As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: basic amino acids: arginine (+3.0), lysine (+3.0), and histidine (-0.5); acidic amino acids: aspartate (+3.0 ± 1), glutamate (+3.0 ± 1), asparagine (+0.2), and glutamine (+0.2); hydrophilic, nonionic amino acids: serine (+0.3), asparagine (+0.2), glutamine (+0.2), and threonine (-0.4), sulfur containing amino acids: cysteine (-1.0) and methionine (-1.3); hydrophobic, nonaromatic amino acids: valine (-1.5), leucine (-1.8), isoleucine (-1.8), proline (-0.5 ± 1), alanine (-0.5), and glycine (0); hydrophobic, aromatic amino acids: tryptophan (-3.4), phenylalanine (-2.5), and tyrosine (-2.3). It is understood that an amino acid can be substituted for another having a similar hydrophilicity and produce a biologically or immunologically modified protein. In such changes, the substitution of amino acids whose hydrophilicity values are within ± 2 is preferred, those that are within ± 1 are particularly preferred, and those within ± 0.5 are even more particularly preferred. As outlined above, amino acid substitutions generally are based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take into consideration the various foregoing characteristics are well known to those of skill in the art and include arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. The present disclosure also contemplates isotype modification. By modifying the Fc region to have a different isotype, different functionalities can be achieved. For example, changing to IgG1 can increase antibody dependent cell cytotoxicity, switching to class A can improve tissue distribution, and switching to class M can improve valency. Alternatively or additionally, it may be useful to combine amino acid modifications with one or more further amino acid modifications that alter C1q binding and / or the complement dependent cytotoxicity (CDC) function of the Fc region of an IL-23p19 binding molecule. The binding polypeptide of particular interest may be one that binds to C1q and displays complement dependent cytotoxicity. Polypeptides with pre-existing C1q binding activity, optionally further having the ability to mediate CDC may be modified such that one or both of these activities are enhanced. Amino acid modifications that alter C1q and / or modify its complement dependent cytotoxicity function are described, for example, in WO / 0042072, which is hereby incorporated by reference.

[0039] 384896-8944-3433, v. 1 One can design an Fc region of an antibody with altered effector function, e.g., by modifying C1q binding and / or FcγR binding and thereby changing CDC activity and / or ADCC activity. “Effector functions” are responsible for activating or diminishing a biological activity (e.g., in a subject). Examples of effector functions include, but are not limited to: C1q binding; complement dependent cytotoxicity (CDC); Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors (e.g., B cell receptor; BCR), etc. Such effector functions may require the Fc region to be combined with a binding domain (e.g., an antibody variable domain) and can be assessed using various assays (e.g., Fc binding assays, ADCC assays, CDC assays, etc.). For example, one can generate a variant Fc region of an antibody with improved C1q binding and improved FcγRIII binding (e.g., having both improved ADCC activity and improved CDC activity). Alternatively, if it is desired that effector function be reduced or ablated, a variant Fc region can be engineered with reduced CDC activity and / or reduced ADCC activity. In other embodiments, only one of these activities may be increased, and, optionally, also the other activity reduced (e.g., to generate an Fc region variant with improved ADCC activity, but reduced CDC activity and vice versa). FcRn binding. Fc mutations can also be introduced and engineered to alter their interaction with the neonatal Fc receptor (FcRn) and improve their pharmacokinetic properties. A collection of human Fc variants with improved binding to the FcRn have been described (Shields et al., (2001). High resolution mapping of the binding site on human IgG1 for FcγRI, FcγRII, FcγRIII, and FcRn and design of IgG1 variants with improved binding to the FcγR, (J. Biol. Chem.276:6591-6604). A number of methods are known that can result in increased half-life (Kuo and Aveson, (2011)), including amino acid modifications may be generated through techniques including alanine scanning mutagenesis, random mutagenesis and screening to assess the binding to the neonatal Fc receptor (FcRn) and / or the in vivo behavior. Computational strategies followed by mutagenesis may also be used to select one of amino acid mutations to mutate. The present disclosure therefore provides a variant of an antigen binding protein with optimized binding to FcRn. In a particular embodiment, the said variant of an antigen binding protein comprises at least one amino acid modification in the Fc region of said antigen binding protein, wherein said modification is selected from the group consisting of 226, 227,

[0040] 394896-8944-3433, v. 1 228, 230, 231, 233, 234, 239, 241, 243, 246, 250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285, 288, 289, 290, 291, 292, 294, 297, 298, 299, 301, 302, 303, 305, 307, 308, 309, 311, 315, 317, 320, 322, 325, 327, 330, 332, 334, 335, 338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356, 359, 360, 361, 362, 369, 370, 371, 375, 378, 380, 382, 384, 385, 386, 387, 389, 390, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401403, 404, 408, 411, 412, 414, 415, 416, 418, 419, 420, 421, 422, 424, 426, 428, 433, 434, 438, 439, 440, 443, 444, 445, 446 and 447 of the Fc region as compared to said parent polypeptide, wherein the numbering of the amino acids in the Fc region is that of the EU index in Kabat. In a further aspect of the disclosure the modifications are M252Y / S254T / T256E. Additionally, various publications describe methods for obtaining physiologically active molecules whose half-lives are modified, see for example Kontermann (2009) either by introducing an FcRn-binding polypeptide into the molecules or by fusing the molecules with antibodies whose FcRn-binding affinities are preserved but affinities for other Fc receptors have been greatly reduced or fusing with FcRn binding domains of antibodies. Derivatized antibodies may be used to alter the half-lives (e.g., serum half-lives) of parental antibodies in a mammal, particularly a human. Such alterations may result in a half- life of greater than 15 days, preferably greater than 20 days, greater than 25 days, greater than 30 days, greater than 35 days, greater than 40 days, greater than 45 days, greater than 2 months, greater than 3 months, greater than 4 months, or greater than 5 months. The increased half-lives of the antibodies of the present disclosure or fragments thereof in a mammal, preferably a human, results in a higher serum titer of said antibodies or antibody fragments in the mammal, and thus reduces the frequency of the administration of said antibodies or antibody fragments and / or reduces the concentration of said antibodies or antibody fragments to be administered. Antibodies or fragments thereof having increased in vivo half-lives can be generated by techniques known to those of skill in the art. For example, antibodies or fragments thereof with increased in vivo half-lives can be generated by modifying (e.g., substituting, deleting or adding) amino acid residues identified as involved in the interaction between the Fc domain and the FcRn receptor. Altered Glycosylation. A particular embodiment of the present disclosure is an isolated monoclonal antibody, or antigen binding fragment thereof, containing a substantially homogeneous glycan without sialic acid, galactose, or fucose. The monoclonal antibody comprises a heavy chain variable region and a light chain variable region, both of

[0041] 404896-8944-3433, v. 1 which may be attached to heavy chain or light chain constant regions respectively. The aforementioned substantially homogeneous glycan may be covalently attached to the heavy chain constant region. Another embodiment of the present disclosure comprises a mAb with a novel Fc glycosylation pattern. The isolated monoclonal antibody, or antigen binding fragment thereof, is present in a substantially homogenous composition represented by the GNGN or G1 / G2 glycoform. Fc glycosylation plays a significant role in anti-viral and anti-cancer properties of therapeutic mAbs. The disclosure is in line with a recent study that shows increased anti-lentivirus cell-mediated viral inhibition of a fucose free anti-HIV mAb in vitro. This embodiment of the present disclosure with homogenous glycans lacking a core fucose, showed increased protection against specific viruses by a factor greater than two- fold. Elimination of core fucose dramatically improves the ADCC activity of mAbs mediated by natural killer (NK) cells but appears to have the opposite effect on the ADCC activity of polymorphonuclear cells (PMNs). The isolated monoclonal antibody, or antigen binding fragment thereof, comprising a substantially homogenous composition represented by the GNGN or G1 / G2 glycoform exhibits increased binding affinity for Fc gamma RI and Fc gamma RIII compared to the same antibody without the substantially homogeneous GNGN glycoform and with G0, G1F, G2F, GNF, GNGNF or GNGNFX containing glycoforms. In one embodiment of the present disclosure, the antibody dissociates from Fc gamma RI with a Kd of 1 x 10-8M or less and from Fc gamma RIII with a Kd of 1 x 10-7M or less. Glycosylation of an Fc region is typically either N-linked or O-linked. N-linked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue. O-linked glycosylation refers to the attachment of one of the sugars N-acetylgalactosamine, galactose, or xylose to a hydroxyamino acid, most commonly serine or threonine, although 5-hydroxyproline or 5-hydroxylysine may also be used. The recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagine side chain peptide sequences are asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline. Thus, the presence of either of these peptide sequences in a polypeptide creates a potential glycosylation site. The glycosylation pattern may be altered, for example, by deleting one or more glycosylation site(s) found in the polypeptide, and / or adding one or more glycosylation

[0042] 414896-8944-3433, v. 1 site(s) that are not present in the polypeptide. Addition of glycosylation sites to the Fc region of an antibody is conveniently accomplished by altering the amino acid sequence such that it contains one or more of the above-described tripeptide sequences (for N-linked glycosylation sites). An exemplary glycosylation variant has an amino acid substitution of residue Asn 297 of the heavy chain. The alteration may also be made by the addition of, or substitution by, one or more serine or threonine residues to the sequence of the original polypeptide (for O-linked glycosylation sites). Additionally, a change of Asn 297 to Ala can remove one of the glycosylation sites. In certain embodiments, the antibody is expressed in cells that express beta (1,4)-N- acetylglucosaminyltransferase III (GnT III), such that GnT III adds GlcNAc to the IL-23p19 antibody. Methods for producing antibodies in such a fashion are provided in WO / 9954342, WO / 03011878, patent publication 20030003097A1, and Umana et al., Nature Biotechnology, 17:176-180, February 1999. Cell lines can be altered to enhance or reduce or eliminate certain post-translational modifications, such as glycosylation, using genome editing technology such as Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR). For example, CRISPR technology can be used to eliminate genes encoding glycosylating enzymes in 293 or CHO cells used to express recombinant monoclonal antibodies. Elimination of monoclonal antibody protein sequence liabilities. It is possible to engineer the antibody variable gene sequences obtained from human B cells to enhance their manufacturability and safety. Potential protein sequence liabilities can be identified by searching for sequence motifs associated with sites containing: 1) Unpaired Cys residues, 2) N-linked glycosylation, 3) Asn deamidation, 4) Asp isomerization, 5) SYE truncation, 6) Met oxidation, 7) Trp oxidation, 8) N-terminal glutamate, 9) Integrin binding, 10) CD11c / CD18 binding, or

[0043] 424896-8944-3433, v. 1 11) Fragmentation Such motifs can be eliminated by altering the synthetic gene for the cDNA encoding recombinant antibodies. Protein engineering efforts in the field of development of therapeutic antibodies clearly reveal that certain sequences or residues are associated with solubility differences (Fernandez-Escamilla et al., Nature Biotech., 22 (10), 1302-1306, 2004; Chennamsetty et al., PNAS, 106 (29), 11937-11942, 2009; Voynov et al., Biocon. Chem., 21 (2), 385-392, 2010) Evidence from solubility-altering mutations in the literature indicate that some hydrophilic residues such as aspartic acid, glutamic acid, and serine contribute significantly more favorably to protein solubility than other hydrophilic residues, such as asparagine, glutamine, threonine, lysine, and arginine. Stability. Antibodies can be engineered for enhanced biophysical properties. One can use elevated temperature to unfold antibodies to determine relative stability, using average apparent melting temperatures. Differential Scanning Calorimetry (DSC) measures the heat capacity, Cp, of a molecule (the heat required to warm it, per degree) as a function of temperature. One can use DSC to study the thermal stability of antibodies. DSC data for mAbs is particularly interesting because it sometimes resolves the unfolding of individual domains within the mAb structure, producing up to three peaks in the thermogram (from unfolding of the Fab, CH2, and CH3 domains). Typically unfolding of the Fab domain produces the strongest peak. The DSC profiles and relative stability of the Fc portion show characteristic differences for the human IgG1, IgG2, IgG3, and IgG4subclasses (Garber and Demarest, Biochem. Biophys. Res. Commun.355, 751-757, 2007). One also can determine average apparent melting temperature using circular dichroism (CD), performed with a CD spectrometer. Far-UV CD spectra will be measured for antibodies in the range of 200 to 260 nm at increments of 0.5 nm. The final spectra can be determined as averages of 20 accumulations. Residue ellipticity values can be calculated after background subtraction. Thermal unfolding of antibodies (0.1 mg / mL) can be monitored at 235 nm from 25-95 °C and a heating rate of 1 °C / min. One can use dynamic light scattering (DLS) to assess the propensity for aggregation. DLS is used to characterize the size of various particles including proteins. If the system is not dispersed in size, the mean effective diameter of the particles can be determined. This measurement depends on the size of the particle core, the size of surface structures, and particle concentration. Since DLS essentially measures fluctuations

[0044] 434896-8944-3433, v. 1 in scattered light intensity due to particles, the diffusion coefficient of the particles can be determined. DLS software in commercial DLA instruments displays the particle population at different diameters. Stability studies can be done conveniently using DLS. DLS measurements of a sample can show whether the particles aggregate over time or with temperature variation by determining whether the hydrodynamic radius of the particle increases. If particles aggregate, one can see a larger population of particles with a larger radius. Stability depending on temperature can be analyzed by controlling the temperature in situ. Capillary electrophoresis (CE) techniques include proven methodologies for determining features of antibody stability. One can use an iCE approach to resolve antibody protein charge variants due to deamidation, C-terminal lysines, sialylation, oxidation, glycosylation, and any other change to the protein that can result in a change in pI of the protein. Each of the expressed antibody proteins can be evaluated by high throughput, free solution isoelectric focusing (IEF) in a capillary column (cIEF), using a Protein Simple Maurice instrument. Whole-column UV absorption detection can be performed every 30 seconds for real time monitoring of molecules focusing at the isoelectric points (pIs). This approach combines the high resolution of traditional gel IEF with the advantages of quantitation and automation found in column-based separations while eliminating the need for a mobilization step. The technique yields reproducible, quantitative analysis of identity, purity, and heterogeneity profiles for the expressed antibodies. The results identify charge heterogeneity and molecular sizing on the antibodies, with both absorbance and native fluorescence detection modes and with sensitivity of detection down to 0.7 µg / mL. Solubility. One can determine the intrinsic solubility score of antibody sequences. The intrinsic solubility scores can be calculated using CamSol Intrinsic (Sormanni et al., J Mol Biol 427, 478-490, 2015). The amino acid sequences for residues 95-102 (Kabat numbering) in HCDR3 of each antibody fragment such as a scFv can be evaluated via the online program to calculate the solubility scores. One also can determine solubility using laboratory techniques. Various techniques exist, including addition of lyophilized protein to a solution until the solution becomes saturated and the solubility limit is reached, or concentration by ultrafiltration in a microconcentrator with a suitable molecular weight cut- off. The most straightforward method is induction of amorphous precipitation, which measures protein solubility using a method involving protein precipitation using ammonium sulfate (Trevino et al., J Mol Biol, 366: 449-460, 2007). Ammonium sulfate precipitation

[0045] 444896-8944-3433, v. 1 gives quick and accurate information on relative solubility values. Ammonium sulfate precipitation produces precipitated solutions with well-defined aqueous and solid phases and requires relatively small amounts of protein. Solubility measurements performed using induction of amorphous precipitation by ammonium sulfate also can be done easily at different pH values. Protein solubility is highly pH dependent, and pH is considered the most important extrinsic factor that affects solubility. Autoreactivity. Generally, it is thought that autoreactive clones should be eliminated during ontogeny by negative selection, however it has become clear that many human and naturally occurring antibodies with autoreactive properties persist in adult mature repertoires, and the autoreactivity may enhance the antiviral function of many antibodies to pathogens. It has been noted that HCDR3 loops in antibodies during early B cell development are often rich in positive charge and exhibit autoreactive patterns (Wardemann et al., Science 301, 1374-1377, 2003). One can test a given antibody for autoreactivity by assessing the level of binding to human origin cells in microscopy (using adherent HeLa or HEp-2 epithelial cells) and flow cytometric cell surface staining (using suspension Jurkat T cells and 293S human embryonic kidney cells). Autoreactivity also can be surveyed using assessment of binding to tissues in tissue arrays. Preferred residues (“Human Likeness”). B cell repertoire deep sequencing of human B cells from blood donors is being performed on a wide scale in many recent studies. Sequence information about a significant portion of the human antibody repertoire facilitates statistical assessment of antibody sequence features common in healthy humans. With knowledge about the antibody sequence features in a human recombined antibody variable gene reference database, the position specific degree of “Human Likeness” (HL) of an antibody sequence can be estimated. HL has been shown to be useful for the development of antibodies in clinical use, like therapeutic antibodies or antibodies as vaccines. The goal is to increase the human likeness of antibodies to reduce potential adverse effects and anti- antibody immune responses that will lead to significantly decreased efficacy of the antibody drug or can induce serious health implications. One can assess antibody characteristics of the combined antibody repertoire of three healthy human blood donors of about 400 million sequences in total and created a novel “relative Human Likeness” (rHL) score that focuses on the hypervariable region of the antibody. The rHL score allows one to easily distinguish

[0046] 454896-8944-3433, v. 1 between human (positive score) and non-human sequences (negative score). Antibodies can be engineered to eliminate residues that are not common in human repertoires. D. Single Chain Antibodies A single chain variable fragment (scFv) is a fusion of the variable regions of the heavy and light chains of immunoglobulins, linked together with a short (usually serine, glycine) linker. This chimeric molecule retains the specificity of the original immunoglobulin, despite removal of the constant regions and the introduction of a linker peptide. This modification usually leaves the specificity unaltered. These molecules were created historically to facilitate phage display where it is highly convenient to express the antigen binding domain as a single peptide. Alternatively, scFv can be created directly from subcloned heavy and light chains derived from a hybridoma or B cell. Single chain variable fragments lack the constant Fc region found in complete antibody molecules, and thus, the common binding sites (e.g., protein A / G) used to purify antibodies. These fragments can often be purified / immobilized using Protein L since Protein L interacts with the variable region of kappa light chains. Flexible linkers generally are comprised of helix- and turn-promoting amino acid residues such as alanine, serine, and glycine. However, other residues can function as well. Tang et al. (1996) used phage display as a means of rapidly selecting tailored linkers for single-chain antibodies (scFvs) from protein linker libraries. A random linker library was constructed in which the genes for the heavy and light chain variable domains were linked by a segment encoding an 18-amino acid polypeptide of variable composition. The scFv repertoire (approx. 5 × 106different members) was displayed on filamentous phage and subjected to affinity selection with hapten. The population of selected variants exhibited significant increases in binding activity but retained considerable sequence diversity. Screening 1,054 individual variants subsequently yielded a catalytically active scFv that was produced efficiently in soluble form. Sequence analysis revealed a conserved proline in the linker two residues after the VHC terminus and an abundance of arginines and prolines at other positions as the only common features of the selected tethers. The recombinant antibodies of the present disclosure may also involve sequences or moieties that permit dimerization or multimerization of the receptors. Such sequences include those derived from IgA, which permit formation of multimers in conjunction with the J-chain. Another multimerization domain is the Gal4 dimerization domain. In other

[0047] 464896-8944-3433, v. 1 embodiments, the chains may be modified with agents such as biotin / avidin, which permit the combination of two antibodies. In a separate embodiment, a single-chain antibody can be created by joining receptor light and heavy chains using a non-peptide linker or chemical unit. Generally, the light and heavy chains will be produced in distinct cells, purified, and subsequently linked together in an appropriate fashion (i.e., the N-terminus of the heavy chain being attached to the C- terminus of the light chain via an appropriate chemical bridge). Cross-linking reagents are used to form molecular bridges that tie functional groups of two different molecules, e.g., a stabilizing and coagulating agent. However, it is contemplated that dimers or multimers of the same analog or heteromeric complexes comprised of different analogs can be created. To link two different compounds in a stepwise manner, hetero-bifunctional cross-linkers can be used that eliminate unwanted homopolymer formation. An exemplary hetero-bifunctional cross-linker contains two reactive groups: one reacting with primary amine group (e.g., N-hydroxy succinimide) and the other reacting with a thiol group (e.g., pyridyl disulfide, maleimides, halogens, etc.). Through the primary amine reactive group, the cross-linker may react with the lysine residue(s) of one protein (e.g., the selected antibody or fragment) and through the thiol reactive group, the cross-linker, already tied up to the first protein, reacts with the cysteine residue (free sulfhydryl group) of the other protein (e.g., the selective agent). It is preferred that a cross-linker having reasonable stability in blood will be employed. Numerous types of disulfide bond-containing linkers are known that can be successfully employed to conjugate targeting and therapeutic / preventative agents. Linkers that contain a disulfide bond that is sterically hindered may prove to give greater stability in vivo, preventing release of the targeting peptide prior to reaching the site of action. These linkers are thus one group of linking agents. Another cross-linking reagent is SMPT, which is a bifunctional cross-linker containing a disulfide bond that is “sterically hindered” by an adjacent benzene ring and methyl groups. It is believed that steric hindrance of the disulfide bond serves a function of protecting the bond from attack by thiolate anions such as glutathione which can be present in tissues and blood, and thereby help in preventing decoupling of the conjugate prior to the delivery of the attached agent to the target site.

[0048] 474896-8944-3433, v. 1 The SMPT cross-linking reagent, as with many other known cross-linking reagents, lends the ability to cross-link functional groups such as the SH of cysteine or primary amines (e.g., the epsilon amino group of lysine). Another possible type of cross-linker includes the hetero-bifunctional photoreactive phenylazides containing a cleavable disulfide bond such as sulfosuccinimidyl-2-(p-azido salicylamido) ethyl-1,3′-dithiopropionate. The N-hydroxy- succinimidyl group reacts with primary amino groups and the phenylazide (upon photolysis) reacts non-selectively with any amino acid residue. In addition to hindered cross-linkers, non-hindered linkers also can be employed in accordance herewith. Other useful cross-linkers, not considered to contain or generate a protected disulfide, include SATA, SPDP and 2-iminothiolane (Wawrzynczak & Thorpe, 1987). The use of such cross-linkers is well understood in the art. Another embodiment involves the use of flexible linkers. U.S. Patent 4,680,338 describes bifunctional linkers useful for producing conjugates of ligands with amine-containing polymers and / or proteins, especially for forming antibody conjugates with chelators, drugs, enzymes, detectable labels and the like. U.S. Patents 5,141,648 and 5,563,250 disclose cleavable conjugates containing a labile bond that is cleavable under a variety of mild conditions. This linker is particularly useful in that the agent of interest may be bonded directly to the linker, with cleavage resulting in release of the active agent. Particular uses include adding a free amino or free sulfhydryl group to a protein, such as an antibody, or a drug. U.S. Patent 5,856,456 provides peptide linkers for use in connecting polypeptide constituents to make fusion proteins, e.g., single chain antibodies. The linker is up to about 50 amino acids in length, contains at least one occurrence of a charged amino acid (preferably arginine or lysine) followed by a proline, and is characterized by greater stability and reduced aggregation. U.S. Patent 5,880,270 discloses aminooxy-containing linkers useful in a variety of immunodiagnostic and separative techniques. E. Multispecific Antibodies In certain embodiments, antibodies of the present disclosure are bispecific or multispecific. Bispecific antibodies are antibodies that have binding specificities for at least two different epitopes. Exemplary bispecific antibodies may bind two different epitopes of a single antigen. Other such antibodies may combine a first antigen binding site with a binding site for a second antigen. Alternatively, an anti-pathogen arm may be combined with

[0049] 484896-8944-3433, v. 1 an arm that binds to a triggering molecule on a leukocyte, such as a T-cell receptor molecule (e.g., CD3), or Fc receptors for IgG (FcγR), such as FcγRI (CD64), FcγRII (CD32) and Fc gamma RIII (CD16), so as to focus and localize cellular defense mechanisms to the infected cell. Bispecific antibodies may also be used to localize cytotoxic agents to infected cells. These antibodies possess a pathogen-binding arm and an arm that binds the cytotoxic agent (e.g., saporin, anti-interferon-α, vinca alkaloid, ricin A chain, methotrexate or radioactive isotope hapten). Bispecific antibodies can be prepared as full-length antibodies or antibody fragments (e.g., F(ab′)2bispecific antibodies). WO 96 / 16673 describes a bispecific anti- ErbB2 / anti-Fc gamma RIII antibody and U.S. Patent 5,837,234 discloses a bispecific anti- ErbB2 / anti-Fc gamma RI antibody. A bispecific anti-ErbB2 / Fc alpha antibody is shown in WO98 / 02463. U.S. Patent 5,821,337 teaches a bispecific anti-ErbB2 / anti-CD3 antibody. Methods for making bispecific antibodies are known in the art. Traditional production of full-length bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain-light chain pairs, where the two chains have different specificities (Millstein et al., Nature, 305:537-539 (1983)). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule, which is usually done by affinity chromatography steps, is rather cumbersome, and the product yields are low. Similar procedures are disclosed in WO 93 / 08829, and in Traunecker et al., EMBO J., 10:3655-3659 (1991). According to a different approach, antibody variable regions with the desired binding specificities (antibody-antigen combining sites) are fused to immunoglobulin constant domain sequences. Preferably, the fusion is with an Ig heavy chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions. It is preferred to have the first heavy-chain constant region (CH1) containing the site necessary for light chain bonding, present in at least one of the fusions. DNA encoding the immunoglobulin heavy chain fusions and, if desired, DNA encoding the immunoglobulin light chain, are inserted into separate expression vectors, and are co-transfected into a suitable host cell. This provides for greater flexibility in adjusting the mutual proportions of the three polypeptide fragments in embodiments when unequal ratios of the three polypeptide chains used in the construction provide the optimum yield of the desired bispecific antibody. It is, however, possible to insert

[0050] 494896-8944-3433, v. 1 the coding sequences for two or all three polypeptide chains into a single expression vector when the expression of at least two polypeptide chains in equal ratios results in high yields or when the ratios have no significant effect on the yield of the desired chain combination. In a particular embodiment of this approach, the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. It was found that this asymmetric structure facilitates the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations, as the presence of an immunoglobulin light chain in only one half of the bispecific molecule provides for a facile way of separation. This approach is disclosed in WO 94 / 04690. For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, 121:210 (1986). According to another approach described in U.S. Patent 5,731,168, the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers that are recovered from recombinant cell culture. The preferred interface comprises at least a part of the CH3 domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e.g., tyrosine or tryptophan). Compensatory "cavities" of identical or similar size to the large side chain(s) are created on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (e.g., alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end- products such as homodimers. Bispecific antibodies include cross-linked or "heteroconjugate" antibodies. For example, one of the antibodies in the heteroconjugate can be coupled to avidin, the other to biotin. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (U.S. Patent 4,676,980), and for treatment of HIV infection (WO 91 / 00360, WO 92 / 200373, and EP 03089). Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable cross-linking agents are well known in the art, and are disclosed in U.S. Patent 4,676,980, along with a number of cross-linking techniques. Techniques for generating bispecific antibodies from antibody fragments have also been described in the literature. For example, bispecific antibodies can be prepared using chemical linkage. Brennan et al., Science, 229: 81 (1985) describe a procedure wherein intact

[0051] 504896-8944-3433, v. 1 antibodies are proteolytically cleaved to generate F(ab')2fragments. These fragments are reduced in the presence of the dithiol complexing agent, sodium arsenite, to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The Fab' fragments generated are then converted to thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB derivatives is then reconverted to the Fab'-thiol by reduction with mercaptoethylamine and is mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody. The bispecific antibodies produced can be used as agents for the selective immobilization of enzymes. Techniques exist that facilitate the direct recovery of Fab'-SH fragments from E. coli, which can be chemically coupled to form bispecific antibodies. Shalaby et al., J. Exp. Med., 175: 217-225 (1992) describe the production of a humanized bispecific antibody F(ab')2 molecule. Each Fab' fragment was separately secreted from E. coli and subjected to directed chemical coupling in vitro to form the bispecific antibody. The bispecific antibody thus formed was able to bind to cells overexpressing the ErbB2 receptor and normal human T cells, as well as trigger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets. Various techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described (Merchant et al., Nat. Biotechnol.16, 677–681 (1998). doi:10.1038 / nbt0798-677pmid:9661204). For example, bispecific antibodies have been produced using leucine zippers (Kostelny et al., J. Immunol., 148(5):1547-1553, 1992). The leucine zipper peptides from the Fos and Jun proteins were linked to the Fab' portions of two different antibodies by gene fusion. The antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers. This method can also be utilized for the production of antibody homodimers. The "diabody" technology described by Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993) has provided an alternative mechanism for making bispecific antibody fragments. The fragments comprise a VHconnected to a VLby a linker that is too short to allow pairing between the two domains on the same chain. Accordingly, the VHand VLdomains of one fragment are forced to pair with the complementary VLand VH domains of another fragment, thereby forming two antigen-binding sites. Another

[0052] 514896-8944-3433, v. 1 strategy for making bispecific antibody fragments by the use of single-chain Fv (sFv) dimers has also been reported. See Gruber et al., J. Immunol., 152:5368 (1994). In a particular embodiment, a bispecific or multispecific antibody may be formed as a DOCK-AND-LOCK™ (DNL™) complex (see, e.g., U.S. Patents 7,521,056; 7,527,787; 7,534,866; 7,550,143 and 7,666,400, the Examples section of each of which is incorporated herein by reference.) Generally, the technique takes advantage of the specific and high- affinity binding interactions that occur between a dimerization and docking domain (DDD) sequence of the regulatory (R) subunits of cAMP-dependent protein kinase (PKA) and an anchor domain (AD) sequence derived from any of a variety of AKAP proteins (Baillie et al., FEBS Letters.2005; 579: 3264; Wong and Scott, Nat. Rev. Mol. Cell Biol.2004; 5: 959). The DDD and AD peptides may be attached to any protein, peptide, or other molecule. Because the DDD sequences spontaneously dimerize and bind to the AD sequence, the technique allows the formation of complexes between any selected molecules that may be attached to DDD or AD sequences. Antibodies with more than two valencies are contemplated. For example, trispecific antibodies can be prepared (Tutt et al., J. Immunol. 147: 60, 1991; Xu et al., Science, 358(6359):85-90, 2017). A multivalent antibody may be internalized (and / or catabolized) faster than a bivalent antibody by a cell expressing an antigen to which the antibodies bind. The antibodies of the present disclosure can be multivalent antibodies with three or more antigen binding sites (e.g., tetravalent antibodies), which can be readily produced by recombinant expression of nucleic acid encoding the polypeptide chains of the antibody. The multivalent antibody can comprise a dimerization domain and three or more antigen binding sites. The preferred dimerization domain comprises (or consists of) an Fc region or a hinge region. In this scenario, the antibody will comprise an Fc region and three or more antigen binding sites amino-terminal to the Fc region. The preferred multivalent antibody herein comprises (or consists of) three to about eight, but preferably four, antigen binding sites. The multivalent antibody comprises at least one polypeptide chain (and preferably two polypeptide chains), wherein the polypeptide chain(s) comprise two or more variable regions. For instance, the polypeptide chain(s) may comprise VD1-(X1)n-VD2-(X2)n-Fc, wherein VD1 is a first variable region, VD2 is a second variable region, Fc is one polypeptide chain of an Fc region, X1 and X2 represent an amino acid or polypeptide, and n is 0 or 1. For instance, the polypeptide chain(s) may comprise: VH-CH1-flexible linker-VH-CH1-Fc

[0053] 524896-8944-3433, v. 1 region chain; or VH-CH1-VH-CH1-Fc region chain. The multivalent antibody herein preferably further comprises at least two (and preferably four) light chain variable region polypeptides. The multivalent antibody herein may, for instance, comprise from about two to about eight light chain variable region polypeptides. The light chain variable region polypeptides contemplated here comprise a light chain variable region and, optionally, further comprise a CLdomain. Charge modifications are particularly useful in the context of a multi-specific antibody, where amino acid substitutions in Fab molecules result in reducing the mispairing of light chains with non-matching heavy chains (Bence-Jones-type side products), which can occur in the production of Fab-based bi- / multi-specific antigen binding molecules with a VH / VL exchange in one (or more, in case of molecules comprising more than two antigen- binding Fab molecules) of their binding arms (see also PCT publication no. WO 2015 / 150447, particularly the examples therein, incorporated herein by reference in its entirety). Accordingly, in particular embodiments, an antibody comprised in the therapeutic agent comprises: (a) a first Fab molecule which specifically binds to a first antigen (b) a second Fab molecule which specifically binds to a second antigen, and wherein the variable domains VL and VH of the Fab light chain and the Fab heavy chain are replaced by each other, wherein the first antigen is an activating T cell antigen and the second antigen is a target cell antigen, or the first antigen is a target cell antigen and the second antigen is an activating T cell antigen; and wherein i) in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted by a positively charged amino acid (numbering according to Kabat), and wherein in the constant domain CH1 of the first Fab molecule under a) the amino acid at position 147 or the amino acid at position 213 is substituted by a negatively charged amino acid (numbering according to Kabat EU index); or ii) in the constant domain CL of the second Fab molecule under b) the amino acid at position 124 is substituted by a positively charged amino acid (numbering according to Kabat), and wherein in the constant domain CH1 of the second Fab molecule under

[0054] 534896-8944-3433, v. 1 b) the amino acid at position 147 or the amino acid at position 213 is substituted by a negatively charged amino acid (numbering according to Kabat EU index). The antibody may not comprise both modifications mentioned under i) and ii). The constant domains CL and CH1 of the second Fab molecule are not replaced by each other (i.e., remain unexchanged). In another embodiment of the antibody, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted independently by lysine (K), arginine (R) or histidine (H) (numbering according to Kabat) (in one preferred embodiment independently by lysine (K) or arginine (R)), and in the constant domain CH1 of the first Fab molecule under a) the amino acid at position 147 or the amino acid at position 213 is substituted independently by glutamic acid (E), or aspartic acid (D) (numbering according to Kabat EU index). In a further embodiment, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted independently by lysine (K), arginine (R) or histidine (H) (numbering according to Kabat), and in the constant domain CH1 of the first Fab molecule under a) the amino acid at position 147 is substituted independently by glutamic acid (E), or aspartic acid (D) (numbering according to Kabat EU index). In a particular embodiment, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted independently by lysine (K), arginine (R) or histidine (H) (numbering according to Kabat) (in one preferred embodiment independently by lysine (K) or arginine (R)) and the amino acid at position 123 is substituted independently by lysine (K), arginine (R) or histidine (H) (numbering according to Kabat) (in one preferred embodiment independently by lysine (K) or arginine (R)), and in the constant domain CH1 of the first Fab molecule under a) the amino acid at position 147 is substituted independently by glutamic acid (E), or aspartic acid (D) (numbering according to Kabat EU index) and the amino acid at position 213 is substituted independently by glutamic acid (E), or aspartic acid (D) (numbering according to Kabat EU index). In a more particular embodiment, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted by lysine (K) (numbering according to Kabat) and the amino acid at position 123 is substituted by lysine (K) or arginine (R) (numbering according to Kabat), and in the constant domain CH1 of the first Fab molecule under a) the amino acid at position 147 is substituted by glutamic acid (E) (numbering

[0055] 544896-8944-3433, v. 1 according to Kabat EU index) and the amino acid at position 213 is substituted by glutamic acid (E) (numbering according to Kabat EU index). In an even more particular embodiment, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted by lysine (K) (numbering according to Kabat) and the amino acid at position 123 is substituted by arginine (R) (numbering according to Kabat), and in the constant domain CH1 of the first Fab molecule under a) the amino acid at position 147 is substituted by glutamic acid (E) (numbering according to Kabat EU index) and the amino acid at position 213 is substituted by glutamic acid (E) (numbering according to Kabat EU index). F. ADCs Antibody Drug Conjugates or ADCs are a new class of highly potent biopharmaceutical drugs designed as a targeted therapy for the treatment of people with infectious disease. ADCs are complex molecules composed of an antibody (a whole mAb or an antibody fragment such as a single-chain variable fragment, or scFv) linked, via a stable chemical linker with labile bonds, to a biological active cytotoxic / anti-viral payload or drug. Antibody Drug Conjugates are examples of bioconjugates and immunoconjugates. By combining the unique targeting capabilities of monoclonal antibodies with the cancer-killing ability of cytotoxic drugs, antibody-drug conjugates allow sensitive discrimination between healthy and diseased tissue. This means that, in contrast to traditional systemic approaches, antibody-drug conjugates target and attack the infected cell so that healthy cells are less severely affected. In the development ADC-based anti-tumor therapies, an anticancer drug (e.g., a cell toxin or cytotoxin) is coupled to an antibody that specifically targets a certain cell marker (e.g., a protein that, ideally, is only to be found in or on infected cells). Antibodies track these proteins down in the body and attach themselves to the surface of cancer cells. The biochemical reaction between the antibody and the target protein (antigen) triggers a signal in the tumor cell, which then absorbs or internalizes the antibody together with the cytotoxin. After the ADC is internalized, the cytotoxic drug is released and kills the cell or impairs viral replication. Due to this targeting, ideally the drug has lower side effects and gives a wider therapeutic window than other agents. A stable link between the antibody and cytotoxic / anti-viral agent is a crucial aspect of an ADC. Linkers are based on chemical motifs including disulfides, hydrazones or

[0056] 554896-8944-3433, v. 1 peptides (cleavable), or thioethers (noncleavable) and control the distribution and delivery of the cytotoxic agent to the target cell. Cleavable and noncleavable types of linkers have been proven to be safe in preclinical and clinical trials. Brentuximab vedotin includes an enzyme-sensitive cleavable linker that delivers the potent and highly toxic antimicrotubule agent Monomethyl auristatin E or MMAE, a synthetic antineoplastic agent, to human specific CD30-positive malignant cells. Because of its high toxicity MMAE, which inhibits cell division by blocking the polymerization of tubulin, cannot be used as a single-agent chemotherapeutic drug. However, the combination of MMAE linked to an anti-CD30 monoclonal antibody (cAC10, a cell membrane protein of the tumor necrosis factor or TNF receptor) proved to be stable in extracellular fluid, cleavable by cathepsin and safe for therapy. Trastuzumab emtansine, the other approved ADC, is a combination of the microtubule-formation inhibitor mertansine (DM-1), a derivative of the Maytansine, and antibody trastuzumab (Herceptin® / Genentech / Roche) attached by a stable, non-cleavable linker. The availability of better and more stable linkers has changed the function of the chemical bond. The type of linker, cleavable or noncleavable, lends specific properties to the cytotoxic (anti-cancer) drug. For example, a non-cleavable linker keeps the drug within the cell. As a result, the entire antibody, linker, and cytotoxic agent enter the targeted cancer cell where the antibody is degraded to the level of an amino acid. The resulting complex – amino acid, linker and cytotoxic agent – now becomes the active drug. In contrast, cleavable linkers are catalyzed by enzymes in the host cell where it releases the cytotoxic agent. Another type of cleavable linker, currently in development, adds an extra molecule between the cytotoxic / anti-viral drug and the cleavage site. This linker technology allows researchers to create ADCs with more flexibility without worrying about changing cleavage kinetics. Researchers are also developing a new method of peptide cleavage based on Edman degradation, a method of sequencing amino acids in a peptide. Future direction in the development of ADCs also includes the development of site-specific conjugation (TDCs) to further improve stability and therapeutic index and α emitting immunoconjugates and antibody-conjugated nanoparticles. G. BiTES Bi-specific T-cell engagers (BiTEs) are a class of artificial bispecific monoclonal antibodies that are investigated for the use as anti-cancer drugs. They direct a host's immune

[0057] 564896-8944-3433, v. 1 system, more specifically the T cells' cytotoxic activity, against infected cells. BiTE is a registered trademark of Micromet AG. BiTEs are fusion proteins consisting of two single-chain variable fragments (scFvs) of different antibodies, or amino acid sequences from four different genes, on a single peptide chain of about 55 kilodaltons. One of the scFvs binds to T cells via the CD3 receptor, and the other to an infected cell via a specific molecule. Like other bispecific antibodies, and unlike ordinary monoclonal antibodies, BiTEs form a link between T cells and target cells. This causes T cells to exert cytotoxic / anti-viral activity on infected cells by producing proteins like perforin and granzymes, independently of the presence of MHC I or co-stimulatory molecules. These proteins enter infected cells and initiate the cell's apoptosis. This action mimics physiological processes observed during T cell attacks against infected cells. H. Intrabodies In a particular embodiment, the antibody is a recombinant antibody that is suitable for action inside of a cell – such antibodies are known as “intrabodies.” These antibodies may interfere with target function by a variety of mechanisms, such as by altering intracellular protein trafficking, interfering with enzymatic function, and blocking protein- protein or protein-DNA interactions. In many ways, their structures mimic or parallel those of single chain and single domain antibodies, discussed above. Indeed, single- transcript / single-chain is an important feature that permits intracellular expression in a target cell, and also makes protein transit across cell membranes more feasible. However, additional features are required. The two major issues impacting the implementation of intrabody therapeutic are delivery, including cell / tissue targeting, and stability. With respect to delivery, a variety of approaches have been employed, such as tissue-directed delivery, use of cell-type specific promoters, viral-based delivery and use of cell-permeability / membrane translocating peptides. With respect to the stability, the approach is generally to either screen by brute force, including methods that involve phage display and may include sequence maturation or development of consensus sequences, or more directed modifications such as insertion stabilizing sequences (e.g., Fc regions, chaperone protein sequences, leucine zippers) and disulfide replacement / modification.

[0058] 574896-8944-3433, v. 1 An additional feature that intrabodies may require is a signal for intracellular targeting. Vectors that can target intrabodies (or other proteins) to subcellular regions such as the cytoplasm, nucleus, mitochondria and ER have been designed and are commercially available (Invitrogen Corp.; Persic et al., 1997). I. Purification In certain embodiments, the antibodies of the present disclosure may be purified. The term “purified,” as used herein, is intended to refer to a composition, isolatable from other components, wherein the protein is purified to any degree relative to its naturally obtainable state. A purified protein therefore also refers to a protein, free from the environment in which it may naturally occur. Where the term “substantially purified” is used, this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or more of the proteins in the composition. Protein purification techniques are well known to those of skill in the art. These techniques involve, at one level, the crude fractionation of the cellular milieu to polypeptide and non-polypeptide fractions. Having separated the polypeptide from other proteins, the polypeptide of interest may be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity). Analytical methods particularly suited to the preparation of a pure peptide are ion-exchange chromatography, exclusion chromatography; polyacrylamide gel electrophoresis; isoelectric focusing. Other methods for protein purification include precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; gel filtration, reverse phase, hydroxylapatite and affinity chromatography; and combinations of such and other techniques. In purifying an antibody of the present disclosure, it may be desirable to express the polypeptide in a prokaryotic or eukaryotic expression system and extract the protein using denaturing conditions. The polypeptide may be purified from other cellular components using an affinity column, which binds to a tagged portion of the polypeptide. As is generally known in the art, it is believed that the order of conducting the various purification steps may be changed, or that certain steps may be omitted, and still result in a suitable method for the preparation of a substantially purified protein or peptide.

[0059] 584896-8944-3433, v. 1 Commonly, complete antibodies are fractionated utilizing agents (i.e., protein A) that bind the Fc portion of the antibody. Alternatively, antigens may be used to simultaneously purify and select appropriate antibodies. Such methods often selection agent bound to a support, such as a column, filter, or bead. The antibodies are bound to a support, contaminants removed (e.g., washed away), and the antibodies released by applying conditions (salt, heat, etc.). Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific activity of an active fraction, or assessing the amount of polypeptides within a fraction by SDS / PAGE analysis. Another method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity. The actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique chosen to follow the purification and whether or not the expressed protein or peptide exhibits a detectable activity. It is known that the migration of a polypeptide can vary, sometimes significantly, with different conditions of SDS / PAGE (Capaldi et al., 1977). It will therefore be appreciated that under differing electrophoresis conditions, the apparent molecular weights of purified or partially purified expression products may vary. J. Diagnostic Applications In still further embodiments, the present disclosure concerns immunodetection methods for binding, purifying, removing, quantifying and otherwise generally detecting NRCAM and its associated antigens. While such methods can be applied in a traditional sense, another use will be in quality control and monitoring of vaccine and other virus stocks, where antibodies according to the present disclosure can be used to assess the amount or integrity (i.e., long term stability) of antigens in viruses. Alternatively, the methods may be used to screen various antibodies for appropriate / desired reactivity profiles. Other immunodetection methods include specific assays for determining the presence of cancer cells in a subject. A wide variety of assay formats are contemplated, but specifically those that would be used to detect cancer cells in a fluid or tissue sample obtained from a subject, such as saliva, blood, plasma, sputum, semen, or urine. Contacting the chosen biological sample with the antibody under effective conditions and for a period sufficient to

[0060] 594896-8944-3433, v. 1 allow the formation of immune complexes (primary immune complexes) is generally a matter of simply adding the antibody composition to the sample and incubating the mixture for a period of time long enough for the antibodies to form immune complexes with, i.e., to bind to antigens present. After this time, the sample-antibody composition, such as a tissue section, ELISA plate, dot blot or Western blot, will generally be washed to remove any non- specifically bound antibody species, allowing only those antibodies specifically bound within the primary immune complexes to be detected. In general, the detection of immunocomplex formation is well known in the art and may be achieved through the application of numerous approaches. These methods are generally based upon the detection of a label or marker, such as any of those radioactive, fluorescent, biological and enzymatic tags. Patents concerning the use of such labels include U.S. Patents 3,817,837, 3,850,752, 3,939,350, 3,996,345, 4,277,437, 4,275,149 and 4,366,241. Of course, one may find additional advantages using a secondary binding ligand such as a second antibody and / or a biotin / avidin ligand binding arrangement, as is known in the art. The antibody employed in the detection may itself be linked to a detectable label, wherein one would then simply detect this label, thereby allowing the amount of the primary immune complexes in the composition to be determined. Alternatively, the first antibody that becomes bound within the primary immune complexes may be detected by means of a second binding ligand that has binding affinity for the antibody. In these cases, the second binding ligand may be linked to a detectable label. The second binding ligand is itself often an antibody, which may thus be termed a “secondary” antibody. The primary immune complexes are contacted with the labeled, secondary binding ligand, or antibody, under effective conditions and for a period of time sufficient to allow the formation of secondary immune complexes. The secondary immune complexes are then generally washed to remove any non-specifically bound labeled secondary antibodies or ligands, and the remaining label in the secondary immune complexes is then detected. Further methods include the detection of primary immune complexes by a two-step approach. A second binding ligand, such as an antibody that has binding affinity for the antibody, is used to form secondary immune complexes, as described above. After washing, the secondary immune complexes are contacted with a third binding ligand or antibody that has binding affinity for the second antibody, again under effective conditions and for a period

[0061] 604896-8944-3433, v. 1 sufficient to allow the formation of immune complexes (tertiary immune complexes). The third ligand or antibody is linked to a detectable label, allowing detection of the tertiary immune complexes thus formed. This system may provide signal amplification if this is desired. One method of immunodetection uses two different antibodies. A first biotinylated antibody is used to detect the target antigen, and a second antibody is then used to detect the biotin attached to the complexed biotin. In that method, the sample to be tested is first incubated in a solution containing the first step antibody. If the target antigen is present, some of the antibody binds to the antigen to form a biotinylated antibody / antigen complex. The antibody / antigen complex is then amplified by incubation in successive solutions of streptavidin (or avidin), biotinylated DNA, and / or complementary biotinylated DNA, with each step adding additional biotin sites to the antibody / antigen complex. The amplification steps are repeated until a suitable level of amplification is achieved, at which point the sample is incubated in a solution containing the second step antibody against biotin. This second step antibody is labeled, for example, with an enzyme that can be used to detect the presence of the antibody / antigen complex by histoenzymology using a chromogen substrate. With suitable amplification, a conjugate can be produced which is macroscopically visible. Another known method of immunodetection takes advantage of the immuno-PCR (Polymerase Chain Reaction) methodology. The PCR method is like the Cantor method up to the incubation with biotinylated DNA, however, instead of using multiple rounds of streptavidin and biotinylated DNA incubation, the DNA / biotin / streptavidin / antibody complex is washed out with a low pH or high salt buffer that releases the antibody. The resulting wash solution is then used to carry out a PCR reaction with suitable primers with appropriate controls. At least in theory, the enormous amplification capability and specificity of PCR can be utilized to detect a single antigen molecule. 1. ELISAs Immunoassays, in their most simple and direct sense, are binding assays. Certain preferred immunoassays are the various types of enzyme-linked immunosorbent assays (ELISAs) and radioimmunoassays (RIA) known in the art. Immunohistochemical detection using tissue sections is also particularly useful. However, it will be readily appreciated that

[0062] 614896-8944-3433, v. 1 detection is not limited to such techniques, and western blotting, dot blotting, FACS analyses, and the like may also be used. Irrespective of the format employed, ELISAs have certain features in common, such as coating, incubating and binding, washing to remove non-specifically bound species, and detecting the bound immune complexes. These are described below. In coating a plate with either antigen or antibody, one will generally incubate the wells of the plate with a solution of the antigen or antibody, either overnight or for a specified period of hours. The wells of the plate will then be washed to remove incompletely adsorbed material. Any remaining available surfaces of the wells are then “coated” with a nonspecific protein that is antigenically neutral with regard to the test antisera. These include bovine serum albumin (BSA), casein or solutions of milk powder. The coating allows for blocking of nonspecific adsorption sites on the immobilizing surface and thus reduces the background caused by nonspecific binding of antisera onto the surface. In ELISAs, it is probably more customary to use a secondary or tertiary detection means rather than a direct procedure. Thus, after binding of a protein or antibody to the well, coating with a non-reactive material to reduce background, and washing to remove unbound material, the immobilizing surface is contacted with the biological sample to be tested under conditions effective to allow immune complex (antigen / antibody) formation. Detection of the immune complex then requires a labeled secondary binding ligand or antibody, and a secondary binding ligand or antibody in conjunction with a labeled tertiary antibody or a third binding ligand. “Under conditions effective to allow immune complex (antigen / antibody) formation” means that the conditions preferably include diluting the antigens and / or antibodies with solutions such as BSA, bovine gamma globulin (BGG) or phosphate buffered saline (PBS) / Tween. These added agents also tend to assist in the reduction of nonspecific background. The “suitable” conditions also mean that the incubation is at a temperature or for a period of time sufficient to allow effective binding. Incubation steps are typically from about 1 to 2 to 4 hours or so, at temperatures preferably on the order of 25°C to 27°C or may be overnight at about 4°C or so. Following all incubation steps in an ELISA, the contacted surface is washed so as to remove non-complexed material. A preferred washing procedure includes washing with a

[0063] 624896-8944-3433, v. 1 solution such as PBS / Tween, or borate buffer. Following the formation of specific immune complexes between the test sample and the originally bound material, and subsequent washing, the occurrence of even minute amounts of immune complexes may be determined. To provide a detecting means, the second or third antibody will have an associated label to allow detection. Preferably, this will be an enzyme that will generate color development upon incubating with an appropriate chromogenic substrate. Thus, for example, one will desire to contact or incubate the first and second immune complex with a urease, glucose oxidase, alkaline phosphatase, or hydrogen peroxidase-conjugated antibody for a period of time and under conditions that favor the development of further immune complex formation (e.g., incubation for 2 hours at room temperature in a PBS-containing solution such as PBS-Tween). After incubation with the labeled antibody, and subsequent to washing to remove unbound material, the amount of label is quantified, e.g., by incubation with a chromogenic substrate such as urea, or bromocresol purple, or 2,2'-azino-di-(3-ethyl-benzthiazoline-6- sulfonic acid (ABTS), or H2O2, in the case of peroxidase as the enzyme label. Quantification is then achieved by measuring the degree of color generated, e.g., using a visible spectra spectrophotometer. 2. Western Blot The Western blot (alternatively, protein immunoblot) is an analytical technique used to detect specific proteins in each sample of tissue homogenate or extract. It uses gel electrophoresis to separate native or denatured proteins by the length of the polypeptide (denaturing conditions) or by the 3-D structure of the protein (native / non-denaturing conditions). The proteins are then transferred to a membrane (typically nitrocellulose or PVDF), where they are probed (detected) using antibodies specific to the target protein. Samples may be taken from whole tissue or from cell culture. In most cases, solid tissues are first broken down mechanically using a blender (for larger sample volumes), using a homogenizer (smaller volumes), or by sonication. Cells may also be broken open by one of the above mechanical methods. However, it should be noted that bacteria, virus, or environmental samples can be the source of protein and thus Western blotting is not restricted to cellular studies only. Assorted detergents, salts, and buffers may be employed to encourage lysis of cells and to solubilize proteins. Protease and phosphatase inhibitors are

[0064] 634896-8944-3433, v. 1 often added to prevent the digestion of the sample by its own enzymes. Tissue preparation is often done at cold temperatures to avoid protein denaturing. The proteins of the sample are separated using gel electrophoresis. Separation of proteins may be by isoelectric point (pI), molecular weight, electric charge, or a combination of these factors. The nature of the separation depends on the treatment of the sample and the nature of the gel. This is a very useful way to determine a protein. It is also possible to use a two-dimensional (2-D) gel which spreads the proteins from a single sample out in two dimensions. Proteins are separated according to isoelectric point (pH at which they have neutral net charge) in the first dimension, and according to their molecular weight in the second dimension. In order to make the proteins accessible to antibody detection, they are moved from within the gel onto a membrane made of nitrocellulose or polyvinylidene difluoride (PVDF). The membrane is placed on top of the gel, and a stack of filter papers placed on top of that. The entire stack is placed in a buffer solution which moves up the paper by capillary action, bringing the proteins with it. Another method for transferring the proteins is called electroblotting and uses an electric current to pull proteins from the gel into the PVDF or nitrocellulose membrane. The proteins move from within the gel onto the membrane while maintaining the organization they had within the gel. As a result of this blotting process, the proteins are exposed on a thin surface layer for detection (see below). Both varieties of membrane are chosen for their non-specific protein binding properties (i.e., binds all proteins equally well). Protein binding is based upon hydrophobic interactions, as well as charged interactions between the membrane and protein. Nitrocellulose membranes are cheaper than PVDF but are far more fragile and do not stand up well to repeated probings. The uniformity and overall effectiveness of transfer of protein from the gel to the membrane can be checked by staining the membrane with Coomassie Brilliant Blue or Ponceau S dyes. Once transferred, proteins are detected using labeled primary antibodies, or unlabeled primary antibodies followed by indirect detection using labeled protein A or secondary labeled antibodies binding to the Fc region of the primary antibodies. 3. Lateral Flow Assays Lateral flow assays, also known as lateral flow immunochromatographic assays, are simple devices intended to detect the presence (or absence) of a target analyte in sample (matrix) without the need for specialized and costly equipment, though many laboratory-

[0065] 644896-8944-3433, v. 1 based applications exist that are supported by reading equipment. Typically, these tests are used as low resources medical diagnostics, either for home testing, point of care testing, or laboratory use. A widely spread and well-known application is the home pregnancy test. The technology is based on a series of capillary beds, such as pieces of porous paper or sintered polymer. Each of these elements has the capacity to transport fluid (e.g., urine) spontaneously. The first element (the sample pad) acts as a sponge and holds an excess of sample fluid. Once soaked, the fluid migrates to the second element (conjugate pad) in which the manufacturer has stored the so-called conjugate, a dried format of bio-active particles (see below) in a salt-sugar matrix that contains everything to guarantee an optimized chemical reaction between the target molecule (e.g., an antigen) and its chemical partner (e.g., antibody) that has been immobilized on the particle's surface. While the sample fluid dissolves the salt-sugar matrix, it also dissolves the particles and in one combined transport action the sample and conjugate mix while flowing through the porous structure. In this way, the analyte binds to the particles while migrating further through the third capillary bed. This material has one or more areas (often called stripes) where a third molecule has been immobilized by the manufacturer. By the time the sample-conjugate mix reaches these strips, analyte has been bound on the particle and the third 'capture' molecule binds the complex. After a while, when more and more fluid has passed the stripes, particles accumulate and the stripe-area changes color. Typically, there are at least two stripes: one (the control) that captures any particle and thereby shows that reaction conditions and technology worked fine, the second contains a specific capture molecule and only captures those particles onto which an analyte molecule has been immobilized. After passing these reaction zones, the fluid enters the final porous material – the wick – that simply acts as a waste container. Lateral Flow Tests can operate as either competitive or sandwich assays. Lateral flow assays are disclosed in U.S. Patent 6,485,982. 4. Immunohistochemistry The antibodies of the present disclosure may also be used in conjunction with both fresh-frozen and / or formalin-fixed, paraffin-embedded tissue blocks prepared for study by immunohistochemistry (IHC). The method of preparing tissue blocks from these particulate specimens has been successfully used in previous IHC studies of various prognostic factors

[0066] 654896-8944-3433, v. 1 and is well known to those of skill in the art (Brown et al., 1990; Abbondanzo et al., 1990; Allred et al., 1990). Briefly, frozen-sections may be prepared by rehydrating 50 ng of frozen “pulverized” tissue at room temperature in phosphate buffered saline (PBS) in small plastic capsules; pelleting the particles by centrifugation; resuspending them in a viscous embedding medium (OCT); inverting the capsule and / or pelleting again by centrifugation; snap-freezing in -70°C isopentane; cutting the plastic capsule and / or removing the frozen cylinder of tissue; securing the tissue cylinder on a cryostat microtome chuck; and / or cutting 25-50 serial sections from the capsule. Alternatively, whole frozen tissue samples may be used for serial section cuttings. Permanent-sections may be prepared by a similar method involving rehydration of the 50 mg sample in a plastic microfuge tube; pelleting; resuspending in 10% formalin for 4 hours fixation; washing / pelleting; resuspending in warm 2.5% agar; pelleting; cooling in ice water to harden the agar; removing the tissue / agar block from the tube; infiltrating and / or embedding the block in paraffin; and / or cutting up to 50 serial permanent sections. Again, whole tissue samples may be substituted. 5. Immunodetection Kits In still further embodiments, the present disclosure concerns immunodetection kits for use with the immunodetection methods described above. As the antibodies may be used to detect NRCAM antigens, the antibodies may be included in the kit. The immunodetection kits will thus comprise, in suitable container means, a first antibody that binds to NRCAM, and optionally an immunodetection reagent. In certain embodiments, the antibody may be pre-bound to a solid support, such as a column matrix and / or well of a microtiter plate. The immunodetection reagents of the kit may take any one of a variety of forms, including those detectable labels that are associated with or linked to the given antibody. Detectable labels that are associated with or attached to a secondary binding ligand are also contemplated. Exemplary secondary ligands are those secondary antibodies that have binding affinity for the first antibody. Further suitable immunodetection reagents for use in the present kits include the two- component reagent that comprises a secondary antibody that has binding affinity for the first antibody, along with a third antibody that has binding affinity for the second antibody, the third antibody being linked to a detectable label. As noted above, several exemplary labels

[0067] 664896-8944-3433, v. 1 are known in the art and all such labels may be employed in connection with the present disclosure. The kits may further comprise a suitably aliquoted composition of the antigen, whether labeled or unlabeled, as may be used to prepare a standard curve for a detection assay. The kits may contain antibody-label conjugates either in fully conjugated form, in the form of intermediates, or as separate moieties to be conjugated by the user of the kit. The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which the antibody may be placed, or preferably, suitably aliquoted. The kits of the present disclosure will also typically include a means for containing the antibody, antigen, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained. III. Chimeric Antigen Receptors (CARs) As used herein, the term “at least a portion of a TCR extracellular domain” refers to α and β chains of the TCR comprising variable and constant regions or domains. The term "domain" or "region" can be used interchangeably herein. The variable domain consists of a concatenation of variable region and joining region. The term "TCR alpha variable domain" therefore refers to the concatenation of TRAV and TRAJ regions, and the term TCR alpha constant domain refers to the extracellular TRAC region, or to a C-terminal truncated TRAC sequence. Likewise, the term "TCR beta variable domain" refers to the concatenation of TRBV and TRBD / TRBJ regions, and the term TCR beta constant domain refers to the extracellular TRBV region or to a C-terminal truncated TRBC sequence. The unique sequences defined by the IMGT nomenclature are widely known and accessible to those working in the TCR field. For example, they can be found in the IMGT public database. The "T cell Receptor Factsbook", (2001) LeFranc and LeFranc, Academic Press, ISBN 0-12- 441352-8 also discloses sequences defined by the IMGT nomenclature, but because of its publication date and consequent time-lag, the information therein sometimes needs to be confirmed by reference to the IMGT database. As used herein, the term “wherein the TCR incorporates into a TCR when expressed in a T-cell” refers to the process of a TFP of the invention being expressed and fused to a T-cell receptor of a T-cell.

[0068] 674896-8944-3433, v. 1 Artificial T cell receptors (also known as chimeric T cell receptors, chimeric immunoreceptors, chimeric antigen receptors (CARs)) are engineered receptors that graft an arbitrary specificity onto an immune effector cell. Typically, these receptors are used to graft the specificity of a monoclonal antibody onto a T cell, with transfer of their coding sequence facilitated by retroviral vectors. In this way, many target-specific T cells can be generated for adoptive cell transfer. Phase I clinical studies of this approach show efficacy. The most common form of these molecules are fusions of single-chain variable fragments (scFv) derived from monoclonal antibodies, fused to CD3-zeta transmembrane and endodomain. Such molecules result in the transmission of a zeta signal in response to recognition by the scFv of its target. An example of such a construct is 14g2a-Zeta, which is a fusion of a scFv derived from hybridoma 14g2a (which recognizes disialoganglioside GD2). When T cells express this molecule (usually achieved by oncoretroviral vector transduction), they recognize and kill target cells that express GD2 (e.g., neuroblastoma cells). To target malignant B cells, investigators have redirected the specificity of T cells using a chimeric immunoreceptor specific for the B-lineage molecule, CD19. The variable portions of an immunoglobulin heavy and light chain are fused by a flexible linker to form a scFv. This scFv is preceded by a signal peptide to direct the nascent protein to the endoplasmic reticulum and subsequent surface expression (this is cleaved). A flexible spacer allows the scFv to orient in different directions to enable antigen binding. The transmembrane domain is a typical hydrophobic alpha helix usually derived from the original molecule of the signaling endodomain which protrudes into the cell and transmits the desired signal. Type I proteins are in fact two protein domains linked by a transmembrane alpha helix in between. The cell membrane lipid bilayer, through which the transmembrane domain passes, acts to isolate the inside portion (endodomain) from the external portion (ectodomain). It is not so surprising that attaching an ectodomain from one protein to an endodomain of another protein results in a molecule that combines the recognition of the former to the signal of the latter. Ectodomain. A signal peptide directs the nascent protein into the endoplasmic reticulum. This is essential if the receptor is to be glycosylated and anchored in the cell membrane. Any eukaryotic signal peptide sequence usually works fine. Generally, the signal

[0069] 684896-8944-3433, v. 1 peptide natively attached to the amino-terminal most component is used (e.g., in a scFv with orientation light chain - linker - heavy chain, the native signal of the light-chain is used The antigen recognition domain is usually an scFv. There are, however, many alternatives. An antigen recognition domain from native T-cell receptor (TCR) alpha and beta single chains have been described, as have simple ectodomains (e.g., CD4 ectodomain to recognize HIV infected cells) and more exotic recognition components such as a linked cytokine (which leads to recognition of cells bearing the cytokine receptor). In fact, almost anything that binds a given target with high affinity can be used as an antigen recognition region. A spacer region links the antigen binding domain to the transmembrane domain. It should be flexible enough to allow the antigen binding domain to orient in different directions to facilitate antigen recognition. The simplest form is the hinge region from IgG1. Alternatives include the CH2CH3 region of immunoglobulin and portions of CD3. For most scFv based constructs, the IgG1 hinge suffices. However, the best spacer often has to be determined empirically. Transmembrane domain. The transmembrane domain is a hydrophobic alpha helix that spans the membrane. Generally, the transmembrane domain from the most membrane proximal component of the endodomain is used. Interestingly, using the CD3-zeta transmembrane domain may result in incorporation of the artificial TCR into the native TCR, a factor that is dependent on the presence of the native CD3-zeta transmembrane charged aspartic acid residue. Different transmembrane domains result in different receptor stability. The CD28 transmembrane domain results in a brightly expressed, stable receptor. Endodomain. This is the “business-end” of the receptor. After antigen recognition, receptors cluster and a signal is transmitted to the cell. The most commonly used endodomain component is CD3-zeta which contains 3 ITAMs. This transmits an activation signal to the T cell after antigen is bound. CD3-zeta may not provide a fully competent activation signal and additional co-stimulatory signaling is needed. For example, chimeric CD28 and OX40 can be used with CD3-Zeta to transmit a proliferative / survival signal, or all three can be used together. “First-generation” CARs typically had the intracellular domain from the CD3 ξ- chain, which is the primary transmitter of signals from endogenous TCRs. generation” CARs add intracellular signaling domains from various costimulatory protein

[0070] 694896-8944-3433, v. 1 receptors (e.g., CD28, 41BB, ICOS) to the cytoplasmic tail of the CAR to provide additional signals to the T cell. Preclinical studies have indicated that the second generation of CAR designs improves the antitumor activity of T cells. More recent, “third-generation” CARs combine multiple signaling domains, such as CD3z-CD28-41BB or CD3z-CD28-OX40, to further augment potency. Adoptive transfer of T cells expressing chimeric antigen receptors is a promising anti-cancer therapeutic as CAR-modified T cells can be engineered to target virtually any tumor associated antigen. There is great potential for this approach to improve patient- specific cancer therapy in a profound way. Following the collection of a patient's T cells, the cells are genetically engineered to express CARs specifically directed towards antigens on the patient's tumor cells, then infused back into the patient. Although adoptive transfer of CAR-modified T-cells is a unique and promising cancer therapeutic, there are significant safety concerns. Clinical trials of this therapy have revealed potential toxic effects of these CARs when healthy tissues express the same target antigens as the tumor cells, leading to outcomes similar to graft-versus-host disease (GVHD). A potential solution to this problem is engineering a suicide gene into the modified T cells. In this way, administration of a prodrug designed to activate the suicide gene during GVHD triggers apoptosis in the suicide gene-activated CAR T cells. This method has been used safely and effectively in hematopoietic stem cell transplantation (HSCT). Adoption of suicide gene therapy to the clinical application of CAR-modified T cell adoptive cell transfer has potential to alleviate GVHD while improving overall anti-tumor efficacy. In some embodiments of the NRCAM-targeting CAR disclosed herein, the VH sequence is operably linked downstream to the VL sequence. In some embodiments, the VH sequence is operably linked upstream to the VL sequence. As used herein, the term "upstream" in reference to an amino acid sequence refers to a location that is distal from a point of reference in an N-terminus to C-terminus direction of the amino acid sequence. Similarly, the term "downstream" refers to a location that is distal from a point of reference in a C-terminus to N-terminus direction of an amino acid sequence. Generally, the transmembrane domain suitable for the NRCAM-targeting CARs disclosed herein can be any one of the transmembrane domains known in the art. Non- limiting examples of suitable transmembrane domains include transmembrane domains derived from a CD28 transmembrane domain, a CD8a transmembrane domain, CTLA4

[0071] 704896-8944-3433, v. 1 transmembrane domain, or a PD-I transmembrane domain. Accordingly, in some embodiments, the NRCAM-targeting CAR of the disclosure includes a transmembrane domain derived from a CD28 transmembrane domain, a CD8a transmembrane domain, CTLA4 transmembrane domain, or a PD-I transmembrane domain. In some embodiments, the NRCAM-targeting CAR includes a transmembrane domain derived from a CD28 transmembrane domain. In some embodiments, the intracellular signaling domain of the NRCAM-targeting CAR disclosed herein includes a co-stimulatory domain. Generally, the co-stimulatory domain suitable for the NRCAM-targeting CARs disclosed herein can be any one of the co-stimulatory domains known in the art. Examples of suitable co-stimulatory domains include, but are not limited to, co-stimulatory polypeptide sequences derived from 4-IBB (CD137), CD27, CD28, OX40 (CD 134), and co-stimulatory inducible T-cell costimulatory (ICOS) polypeptide sequences. Accordingly, in some embodiments, the co-stimulatory domain of the NRCAM-targeting CAR disclosed herein is selected from the group consisting of a co-stimulatory 4-IBB (CD137) polypeptide sequence, a co-stimulatory CD27 polypeptide sequence, a co-stimulatory CD28 polypeptide sequence, a co-stimulatory OX40 (CD134) polypeptide sequence, and a co-stimulatory inducible T-cell costimulatory (ICOS) polypeptide sequence. In some embodiments, the NRCAM-targeting CAR includes a co- stimulatory domain derived from a co-stimulatory 4-lBB (CD137) polypeptide sequence. In some embodiments, the NRCAM-targeting CAR includes a co-stimulatory domain derived from a co-stimulatory CD28 polypeptide sequence. In some embodiments, the NRCAM-targeting CAR further includes an extracellular hinge domain (e.g., hinge region) or “linker”. The term "hinge domain" generally refers to a flexible polypeptide connector region or “linker” disposed between the targeting moiety and the transmembrane domain. These sequences are generally derived from IgG subclasses (such as IgG 1 and IgG4), IgD and CD8 domains, of which IgG 1 has been most extensively used. In some embodiments, the hinge / linker domain provides structural flexibility to flanking polypeptide regions. The hinge / linker domain may consist of natural or synthetic polypeptides. It will be appreciated by those skilled in the art that hinge / linker domains may improve the function of the CAR by promoting optimal positioning of the antigen-binding moiety in relationship to the portion of the antigen recognized by the same. It will be appreciated that, in some embodiments, the hinge / linker domain may not be required for

[0072] 714896-8944-3433, v. 1 optimal CAR activity. In some embodiments, a beneficial hinge / linker domain comprising a short sequence of amino acids promotes CAR activity by facilitating antigen-binding by, e.g., relieving any steric constraints that may otherwise alter antibody binding kinetics. The sequence encoding the hinge / linker domain may be positioned between the antigen recognition moiety and the transmembrane domain. In some embodiments, the hinge / linker domain is operably linked downstream of the antigen-binding moiety and upstream of the transmembrane domain. The hinge / linker sequence can be any moiety or sequence derived or obtained from any suitable molecule. For example, in some embodiments, the hinge / linker sequence can be derived from the human CD8a molecule or a CD28 molecule and any other receptors that provide a similar function in providing flexibility to flanking regions. The hinge / linker domain can have a length of from about 4 amino acid (aa) to about 50 aa, e.g., from about 4 aa to about 10 aa, from about 10 aa to about 15 aa, from about aa to about 20 aa, from about 20 aa to about 25 aa, from about 25 aa to about 30 aa, from about 30 aa to about 40 aa, or from about 40 aa to about 50 aa. Suitable hinge / linker domains can be readily selected and can be of any of a number of suitable lengths, uch as from 1 amino acid (e.g., Gly) to 20 aa, from 2 aa to 15 aa, from 3 aa to 12 aa, including 4 aa to 10 aa, 5 aa to 9 aa, 6 aa to 8 aa, or 7 aa to 8 aa, and can be 1, 2, 3, 4, 5, 6, or 7 aa. The terms “long linker” and “short linker” are used throughout the application and are meant to refer to the following: “long linker” amino acid sequence: GGGGSGGGGSGGGGS (SEQ ID NO: 4) “short linker” amino acid sequence: GGGGS (SEQ ID NO: 41) Non-limiting examples of suitable hinge / linker domains include a CD8 hinge domain, a CD28 hinge domain, a CTLA4 hinge domain, or an IgG4 hinge domain. In some embodiments, the hinge / linker domain can include regions derived from a human CD8a (a.k.a. CD8a) molecule or a CD28 molecule and any other receptors that provide a similar function in providing flexibility to flanking regions. In some embodiments, the NRCAM- targeting CAR disclosed herein includes a hinge domain derived from a CD8a hinge domain. In some embodiments, the NRCAM-targeting CAR disclosed herein includes a hinge domain derived from a CD28 hinge domain. In some embodiments, the CAR disclosed herein further includes an extracellular spacer domain including one or more intervening amino acid residues that are positioned

[0073] 724896-8944-3433, v. 1 between the anti-NRCAM scFV region and the extracellular hinge / linker domain. In some embodiments, the extracellular hinge / linker domain is operably linked downstream to the anti-NRCAM scFV region and upstream to the hinge / linker domain. In principle, there are no particular limitations to the length and / or amino acid composition of the extracellular spacer. In some embodiments, any arbitrary single-chain peptide comprising about one to about 300 amino acid residues (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. amino acid residues) can be used as an extracellular spacer. In some embodiments, the extracellular spacer includes about 5 to 50, about 10 to 60, about 20 to 70, about 30 to 80, about 40 to 90, about 50 to 100, about 60 to 120, about 70 to 150, about 100 to 200, about 150 to 250, about 200 to 300, about 30 to 60, about 20 to 80, about 30 to 90 amino acid residues. In some embodiments, the extracellular spacer includes about 1 to 10, about 50 to 100, about 100 to 150, about 150 to 200, about 200 to 300, about 20 to 80, about 40 to 120, about 200 to 250 amino acid residues. In some embodiments, the extracellular hinge / linker includes about 40 to 70, about 50 to 80, about 60 to 80, about 70 to 90, or about 80 to 100 amino acid residues. In some embodiments, the extracellular hinge / linker includes about 1 to 10, about 5 to 15, about 10 to 20, about 15 to 25 amino acid residues. In some embodiments, the extracellular hinge / linker includes about 220, 225, 230, 235, or 240 amino acid residues. In some embodiments, the extracellular hinge / linker includes 229 amino acid residues. In some embodiments, the length and amino acid composition of the extracellular hinge / linker can be optimized to vary the orientation and / or proximity of the anti-NRCAM scFV region and the extracellular hinge / linker domain to one another to achieve a desired activity of the NRCAM-targeting CAR. In some embodiments, the orientation and / or proximity of the anti-NRCAM scFV region and the extracellular hinge / linker domain to one another can be varied and / or optimized as a "tuning" tool or effect that would enhance or reduce the efficacy of the NRCAM CAR. In some embodiments, the orientation and / or proximity of the anti-NRCAM scFV region and the extracellular hinge / linker domain to one another can be varied and / or optimized to create a partially functional or partially functional versions of the NRCAM CAR. In some embodiments, the extracellular hinge / linker domain includes an amino acid sequence corresponding to an IgG4 hinge domain and an IgG4 CH2- CH3 domain. In some embodiments, the intracellular signaling domain of the NRCAM-targeting CAR disclosed herein includes a CD3ζ intracellular signaling domain. In some embodiments

[0074] 734896-8944-3433, v. 1 of the disclosure, the NRCAM-targeting CAR includes a) an anti-NRCAM scFv region; b) a CD28 hinge domain; c) a CD28 transmembrane domain; and d) an intracellular signaling domain including a co-stimulatory domain derived from a 4-lBBz co-stimulatory domain or a CD28 co-stimulatory domain. In one aspect, some embodiments of the disclosure relate to a recombinant nucleic acid molecule including a nucleic acid sequence that encodes a NRCAM-targeting CAR as disclosed herein, or an antibody as disclosed herein. The terms "nucleic acid molecule" and "polynucleotide" are used interchangeably herein, and refer to both RNA and DNA molecules, including nucleic acid molecules comprising cDNA, genomic DNA, synthetic DNA, and DNA or RNA molecules containing nucleic acid analogs. A nucleic acid molecule can be double-stranded or single-stranded (e.g., a sense strand or an antisense strand). A nucleic acid molecule may contain unconventional or modified nucleotides. The terms "polynucleotide sequence" and "nucleic acid sequence" as used herein interchangeably refer to the sequence of a polynucleotide molecule. Nucleic acid molecules of the present disclosure can be nucleic acid molecules of any length, including nucleic acid molecules that are generally between about 5 Kb and about 50 Kb, for example between about 5 Kb and about 40 Kb, between about 5 Kb and about 30 Kb, between about 5 Kb and about 20 Kb, or between about 10 Kb and about 50 Kb, for example between about 15 Kb to 30 Kb, between about 20 Kb and about 50 Kb, between about 20 Kb and about 40 Kb, about 5 Kb and about 25 Kb, or about 30 Kb and about 50 Kb. In some embodiments, the recombinant nucleic acid molecule is operably linked to a heterologous nucleic acid sequence, such as, for example, a structural gene that encodes a protein of interest or a regulatory sequence (e.g., promoter sequence). In some embodiments, the recombinant nucleic acid molecule is further defined as an expression cassette or a vector. In some embodiments, the vector is a lentiviral vector, an adeno virus vector, an adeno- associated virus vector, or a retroviral vector. Some embodiments disclosed herein relate to vectors or expression cassettes including a recombinant nucleic acid molecule as disclosed herein. As used herein, the term "expression cassette" refers to a construct of genetic material that contains coding sequences and enough regulatory information to direct proper transcription and / or translation of the

[0075] 744896-8944-3433, v. 1 coding sequences in a recipient cell, in vivo and / or ex vivo. The expression cassette may be inserted into a vector for targeting to a desired host cell and / or into a subject. As such, the term expression cassette may be used interchangeably with the term "expression construct." Chimeric antigen receptors (CARs) according to the present disclosure may be defined, in the first instance, by their binding specificity, which in this case is for NRCAM. CARs may also be defined by the sequences disclosed herein, or may vary from the sequences provided above, optionally using methods discussed in greater detail below. For example, amino sequences may vary from those set out above in that (a) the variable regions may be segregated away from the constant domains of the light chains, (b) the amino acids may vary from those set out above while not drastically affecting the chemical properties of the residues thereby (so-called conservative substitutions), (c) the amino acids may vary from those set out above by a given percentage, e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity. Alternatively, the nucleic acids encoding the antibodies may (a) be segregated away from the constant domains of the light chains, (b) vary from those set out above while not changing the residues coded thereby, (c) may vary from those set out above by a given percentage, e.g., 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity, or (d) vary from those set out above by virtue of the ability to hybridize under high stringency conditions, as exemplified by low salt and / or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50°C to about 70°C. In making conservative changes in amino acid sequence, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte and Doolittle, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like. It also is understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Patent 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have been

[0076] 754896-8944-3433, v. 1 assigned to amino acid residues: basic amino acids: arginine (+3.0), lysine (+3.0), and histidine (-0.5); acidic amino acids: aspartate (+3.0 ± 1), glutamate (+3.0 ± 1), asparagine (+0.2), and glutamine (+0.2); hydrophilic, nonionic amino acids: serine (+0.3), asparagine (+0.2), glutamine (+0.2), and threonine (-0.4), sulfur containing amino acids: cysteine (-1.0) and methionine (-1.3); hydrophobic, nonaromatic amino acids: valine (-1.5), leucine (-1.8), isoleucine (-1.8), proline (-0.5 ± 1), alanine (-0.5), and glycine (0); hydrophobic, aromatic amino acids: tryptophan (-3.4), phenylalanine (-2.5), and tyrosine (-2.3). It is understood that an amino acid can be substituted for another having a similar hydrophilicity and produce a biologically or immunologically modified protein. In such changes, the substitution of amino acids whose hydrophilicity values are within ± 2 is preferred, those that are within ± 1 are particularly preferred, and those within ± 0.5 are even more particularly preferred. As outlined above, amino acid substitutions generally are based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take into consideration the various foregoing characteristics are well known to those of skill in the art and include arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Chimeric antigen receptors (CARs) are fusion proteins comprising antigen recognition moieties and T cell-activation domains. Exemplary CARs are provided by US Patent No.8,399,645 and US Patent No.7,638,325. Other exemplary recombinant receptors, including CARs, recombinant T-cell receptors (TCRs), TCR fusion proteins (TFPs), as well as methods for engineering and introducing the receptors into cells, include those described in Int’l Pat. Appl. Nos. WO2017 / 096329, WO2000 / 14257, WO2013 / 126726, WO2012 / 129514, WO2014031687, WO2013 / 166321, and WO2013 / 071154, WO2013 / 123061, and WO / 2014055668; U.S. Pat. App. Nos. US2002131960, US2013287748, and US20130149337; U.S. Pat. Nos. 6,451,995, 7,446,190, 7,638,325, 8,252,592, 8,339,645, 8,398,282, 7,446,179, 6,410,319, 7,070,995, 7,265,209, 7,354,762, 7,446,191, 8,324,353, and 8,479,118; European Pat. App. No. EP2537416; and Sadelain et al. Cancer Discov. April 3(4): 388-398 (2013); Davila et al. PLoS ONE 8(4): e61338 (2013); Turtle et al. Curr. Opin. Immunol. October 24(5): 633-39 (2012); and Wu et al. Cancer,

[0077] 764896-8944-3433, v. 1 March 18(2): 160-75 (2012). In an embodiment, the binding agent is a TFP as described in U.S. Pat. No.15 / 419,398. IV. Expression Constructs According to the disclosure there are provided an engineered vectors that facilitate expression of CAR constructs. Such expression vectors contain elements coding for the non- antigen binding portions of CARs along with cis-acting regulatory elements. The expression vector of some embodiments of the disclosure includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., as a shuttle vector). In addition, typical cloning vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal. The nucleic acid construct of some embodiments of the disclosure includes a signal sequence for secretion or presentation of the binding agent from a host cell in which it is placed. Preferably the signal sequence for this purpose is a mammalian signal sequence. Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. The other upstream promoter elements determine the rate at which transcription is initiated. Preferably, the promoter utilized by the expression vector is active in the specific cell population transformed. Examples of cell type-specific and / or tissue- specific promoters include promoters such as albumin that is liver specific (Pinkert et al., Genes Dev. 1:268-277 (1987)), lymphoid specific promoters (Calame et al., Adv. Immunol. 43:235-275 (1988)); in particular promoters of T-cell receptors (Winoto et al., EMBO J. 8:729-733 (1989)) and immunoglobulins; (Banerji et al., Cell 33:729-740 (1983)), neuron-specific promoters such as the neurofilament promoter (Byrne et al., Proc. Natl. Acad. Sci. USA 86:5473-5477 (1989)), pancreas-specific promoters (Edlunch et al., Science 230:912-916 (1985)) or mammary gland-specific promoters such as the milk whey promoter (U.S. Pat. No. 4,873,316 and European Application Publication No. EP0264166). In the construction of the expression vector, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art; however, some variation in this distance can be accommodated without loss of promoter function.

[0078] 774896-8944-3433, v. 1 Enhancer elements can stimulate transcription up to 1,000-fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer / promoter combinations that are suitable for some embodiments of the disclosure include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long-term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983. Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of TCRL mRNA translation. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream. Termination and polyadenylation signals that are suitable for some embodiments of the disclosure include those derived from SV40. In addition to the elements already described the expression vector of some embodiments of the disclosure may contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell. The vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid. Also provided are cells which comprise the polynucleotides / expression vectors as described herein. Such cells are typically selected for high expression of recombinant

[0079] 784896-8944-3433, v. 1 proteins (e.g., bacterial, plant or eukaryotic cells e.g., CHO, HEK-293 cells), but may also be host cells having a specific immune effector activity (e.g., T cells or NK cells, such as Jurkat cells) when for instance the CDRs of the TCRL are implanted in a T Cell Receptor or CAR transduced in said cells which are used in adoptive cell therapy. Next, the CAR library is introduced into mammalian host cells that are then cultured under conditions supporting expression of encoded CARs. The host cells expressing the CAR are then contacted with target antigen positive host cells exhibiting CAR activation are then identified using a variety of different approaches. Once these cells are identified, the binding region can be sequenced and further developed. V. Treatment of Cancers In accordance with the present disclosure, there are provided methods of treating cancers, particularly solid cancers. The methods involve the administration of CAR T cells to a subject such that the cells are brought in proximity with a cancer cell / cancer cell environment and their therapeutic effect is delivered. The administration may be performed multiple times (2, 3, 4, 5, 6, 7, 8, 9, 10 or more) to a subject as needed. The subject may be an infant, a pediatric patient, a juvenile, a young adult, and adult or a senior. The subject may be a human, male or female, or may be a non-human mammal. In certain aspects the cancer tumor is a renal cell cancer, melanoma, prostate cancer, chronic lymphocytic leukemia, bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, pancreas, prostate, skin, stomach, testis, tongue, or uterus. In addition, the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and

[0080] 794896-8944-3433, v. 1 follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; paget's disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w / squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant; androblastoma, malignant; sertoli cell carcinoma; leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extra-mammary paraganglioma, malignant; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malig melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; kaposi's sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis

[0081] 804896-8944-3433, v. 1 fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia. The term “treatment,” as used herein in the context of treating a condition, pertains generally to treatment and therapy, whether of a human or an animal (e.g., in veterinary applications), in which some desired therapeutic effect is achieved, for example, the inhibition of the progress of the condition, and includes a reduction in the rate of progress, a halt in the rate of progress, regression of the condition, amelioration of the condition, and cure of the condition. Treatment as a prophylactic measure (i.e., prophylaxis, prevention) is also included. The term “therapeutically-effective amount,” as used herein, pertains to that amount of binding agent, or a material such as an antibody-drug conjugate, composition or dosage form comprising an active binding agent, which is effective for producing some desired therapeutic effect when administered in accordance with a desired treatment regimen. In some embodiments, the treatment reduces or inhibits tumor growth for at least 6, 12, 24, 36, or 48 months. In some embodiments, the treatment enhances an immune response against the tumor. The subject / patient may be an animal or any species of mammal, including, without limitation, a horse, a dog, a cat, a pig, or a primate. In a preferred embodiment, the subject / patient is a human. A. Pharmaceutical Formulations and Routes of Administration Pharmaceutical compositions provided herein comprise an effective amount of one or more therapeutic compositions and, optionally, an additional agent dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases "pharmaceutical or pharmacologically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The preparation of a pharmaceutical composition that contains a therapeutic nucleic acid construct or a therapeutic engineered cell and one or more excipients will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990,

[0082] 814896-8944-3433, v. 1 incorporated herein by reference. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards. As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in therapeutic or pharmaceutical compositions is contemplated. In certain embodiments, the pharmaceutical composition may comprise different types of carriers depending on whether it is to be administered in solid, liquid or aerosol form, and whether it needs to be sterile for such routes of administration as injection. In certain embodiments, pharmaceutical compositions provided herein can be administered intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, intramuscularly, intraperitoneally, subcutaneously, subconjunctival, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularally, orally, topically, locally, inhalation (e.g. aerosol inhalation), injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference). In certain embodiments, the actual dosage amount of a composition administered to a patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. The practitioner

[0083] 824896-8944-3433, v. 1 responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject. In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% of an active compound. In other embodiments, the active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. In other non-limiting examples, a dose may also comprise from about 1 microgram / kg / body weight, about 5 microgram / kg / body weight, about 10 microgram / kg / body weight, about 15 microgram / kg / body weight, about 20 microgram / kg / body weight, about 25 microgram / kg / body weight, about 30 microgram / kg / body weight, about 35 microgram / kg / body weight, about 0.04 milligram / kg / body weight, about 0.05 milligram / kg / body weight, about 0.06 milligram / kg / body weight, about 0.07 milligram / kg / body weight, about 0.08 milligram / kg / body weight, about 0.09 milligram / kg / body weight, about 0.1 milligram / kg / body weight, about 0.2 milligram / kg / body weight, to about 0.5 mg / kg / body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 0.01 mg / kg / body weight to about 0.1 mg / kg / body weight, about 0.04 microgram / kg / body weight to about 0.08 milligram / kg / body weight, etc., can be administered, based on the numbers described above. In any case, the composition may comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof. In embodiments where the composition is in a liquid form, a carrier can be a solvent or dispersion medium comprising but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), lipids (e.g., triglycerides, vegetable oils, liposomes) and combinations thereof. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin; by the maintenance of the required particle size by dispersion in carriers such as, for example liquid polyol or lipids; by the use of surfactants such as, for example hydroxypropylcellulose; or combinations thereof such methods. In

[0084] 834896-8944-3433, v. 1 many cases, it will be preferable to include isotonic agents, such as, for example, sugars, sodium chloride or combinations thereof. In other embodiments, one may use eye drops, nasal solutions or sprays, aerosols or inhalants in the present embodiments. Such compositions are generally designed to be compatible with the target tissue type. In a non-limiting example, nasal solutions are usually aqueous solutions designed to be administered to the nasal passages in drops or sprays. Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained. Thus, in preferred embodiments the aqueous nasal solutions usually are isotonic or slightly buffered to maintain a pH of about 5.5 to about 6.5. In addition, antimicrobial preservatives, similar to those used in ophthalmic preparations, drugs, or appropriate drug stabilizers, if required, may be included in the formulation. For example, various commercial nasal preparations are known and include drugs such as antibiotics or antihistamines. Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and / or the other ingredients. In the case of sterile powders for the preparation of sterile injectable solutions, suspensions or emulsion, the preferred methods of preparation are vacuum-drying or freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered liquid medium thereof. The liquid medium should be suitably buffered if necessary and the liquid diluent first rendered isotonic prior to injection with sufficient saline or glucose. The preparation of highly concentrated compositions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small area. The composition must be stable under the conditions of manufacture and storage, and preserved against the contaminating action of microorganisms, such as bacteria and fungi. It will be appreciated that endotoxin contamination should be kept minimally at a safe level, for example, less than 0.5 ng / mg protein.

[0085] 844896-8944-3433, v. 1 In particular embodiments, prolonged absorption of an injectable composition can be brought about by the use in the compositions of agents delaying absorption, such as, for example, aluminum monostearate, gelatin or combinations thereof. B. Combination Therapies In order to increase the effectiveness of a nucleic acid, polypeptide or nanoparticle complex of the present embodiments, it may be desirable to combine these compositions with other agents effective in the treatment of the disease of interest. As a non-limiting example, the treatment of cancer may be implemented with a CAR / CAR T cell of the present disclosure along with other anti-cancer agents. An “anti-cancer” agent is capable of negatively affecting cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the growth rate of cancer cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing the blood supply to a tumor or cancer cells, promoting an immune response against cancer cells or a tumor, preventing or inhibiting the progression of cancer, or increasing the lifespan of a subject with cancer. More generally, these other compositions would be provided in a combined amount effective to kill or inhibit proliferation of the cell. This process may involve contacting the cells with the CAR / CAR T cell and the other agent(s) or factor(s) at the same time. This may be achieved by contacting the cell with a single composition or pharmacological formulation that includes both agents, or by contacting the cell with two distinct compositions or formulations, at the same time, wherein one composition includes the CAR / CAR T cell and the other includes the second agent(s). Treatment with the CAR / CAR T cell may precede or follow the other agent treatment by intervals ranging from minutes to weeks. In embodiments where the other agent and the anti-cancer peptide or nanoparticle complex are applied separately to the cell, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the agent and the anti-cancer peptide or nanoparticle complex would still be able to exert an advantageously combined effect on the cell. In such instances, it is contemplated that one may contact the cell with both modalities within about 12-24 hours of each other and, more preferably, within about 6-12 hours of each other. In some situations, it may be desirable to extend the time period for treatment significantly where several days (e.g., 2, 3, 4, 5, 6 or 7 days) to several weeks (e.g., 1, 2, 3, 4, 5, 6, 7 or 8 weeks) lapse between the respective administrations.

[0086] 854896-8944-3433, v. 1 Various combinations may be employed, where the CAR / CAR T cell therapy is “A” and the other agent is “B”: A / B / A B / A / B B / B / A A / A / B A / B / B B / A / A A / B / B / B B / A / B / B B / B / B / A B / B / A / B A / A / B / B A / B / A / B A / B / B / A B / B / A / A B / A / B / A B / A / A / B A / A / A / B B / A / A / A A / B / A / A A / A / B / A In certain embodiments, administration of the CAR / CAR T cell therapy and / or other agent(s) to a patient will follow general protocols for the administration of chemotherapeutics, taking into account the toxicity, if any, of the vector. It is expected that the treatment cycles would be repeated as necessary. It also is contemplated that various standard therapies, as well as surgical intervention, may be applied in combination with the described hyperproliferative cell therapy. Chemotherapy. Cancer therapies also include a variety of combination therapies. In some aspects, a TUSC2 therapeutic and / or an immune checkpoint inhibitor of the embodiments is administered (or formulated) in conjunction with a chemotherapeutic agent. For example, in some aspects, the chemotherapeutic agent is a protein kinase inhibitor such as a EGFR, VEGFR, AKT, Erb1, Erb2, ErbB, Syk, Bcr-Abl, JAK, Src, GSK-3, PI3K, Ras, Raf, MAPK, MAPKK, mTOR, c-Kit, eph receptor or BRAF inhibitors. Nonlimiting examples of protein kinase inhibitors include Afatinib, Axitinib, Bevacizumab, Bosutinib, Cetuximab, Crizotinib, Dasatinib, Erlotinib, Fostamatinib, Gefitinib, Imatinib, Lapatinib, Lenvatinib, Mubritinib, Nilotinib, Panitumumab, Pazopanib, Pegaptanib, Ranibizumab, Ruxolitinib, Saracatinib, Sorafenib, Sunitinib, Trastuzumab, Vandetanib, AP23451, Vemurafenib, MK-2206, GSK690693, A-443654, VQD-002, Miltefosine, Perifosine, CAL101, PX-866, LY294002, rapamycin, temsirolimus, everolimus, ridaforolimus, Alvocidib, Genistein, Selumetinib, AZD-6244, Vatalanib, P1446A-05, AG-024322, ZD1839, P276-00, GW572016 or a mixture thereof. Yet further combination chemotherapies include, for example, alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin,

[0087] 864896-8944-3433, v. 1 carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammalI and calicheamicin omegaI1; dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores, aclacinomysins, actinomycin, authrarnycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2- pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalarnycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti- adrenals such as mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK polysaccharide complex; razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2”-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan;

[0088] 874896-8944-3433, v. 1 vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (“Ara-C”); cyclophosphamide; taxoids, e.g., paclitaxel and docetaxel gemcitabine; 6-thioguanine; mercaptopurine; platinum coordination complexes such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-11); topoisomerase inhibitor RFS 2000; difluorometlhylornithine (DMFO); retinoids such as retinoic acid; capecitabine; carboplatin, procarbazine, plicomycin, gemcitabien, navelbine, farnesyl-protein tansferase inhibitors, transplatinum, and pharmaceutically acceptable salts, acids or derivatives of any of the above. In certain embodiments, the compositions provided herein may be used in combination with gefitinib. In other embodiments, the present embodiments may be practiced in combination with Gleevac (e.g., from about 400 to about 800 mg / day of Gleevac may be administered to a patient). In certain embodiments, one or more chemotherapeutic may be used in combination with the compositions provided herein. Radiotherapy. Other factors that cause DNA damage and have been used extensively include what are commonly known as γ-rays, X-rays, and / or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves and UV-irradiation. It is most likely that all of these factors effect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells. The terms “contacted” and “exposed,” when applied to a cell, are used herein to describe the process by which a therapeutic composition and a chemotherapeutic or radiotherapeutic agent are delivered to a target cell or are placed in direct juxtaposition with the target cell. To achieve cell killing or stasis, both agents are delivered to a cell in a combined amount effective to kill the cell or prevent it from dividing. Immunotherapy. Immunotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The

[0089] 884896-8944-3433, v. 1 antibody alone may serve as an effector of therapy or it may recruit other cells to actually effect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK cells. Immunotherapy, thus, could be used as part of a combined therapy, in conjunction with a TUSC2 therapy of the present embodiments. The general approach for combined therapy is discussed below. Generally, the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present embodiments. Common tumor markers include carcinoembryonic antigen, prostate specific antigen, urinary tumor associated antigen, fetal antigen, tyrosinase (p97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, estrogen receptor, laminin receptor, erb B and p155. Gene Therapy. In yet another embodiment, the secondary treatment is a gene therapy in which a therapeutic polynucleotide is administered before, after, or at the same time as the therapeutic composition. Viral vectors for the expression of a gene product are well known in the art, and include such eukaryotic expression systems as adenoviruses, adeno-associated viruses, retroviruses, herpesviruses, lentiviruses, poxviruses including vaccinia viruses, and papiloma viruses, including SV40. Alternatively, the administration of expression constructs can be accomplished with lipid-based vectors such as liposomes or DOTAP:cholesterol vesicles. All of these methods are well known in the art (see, e.g., Sambrook et al., 1989; Ausubel et al., 1998; Ausubel, 1996). Delivery of a vector encoding one of the following gene products will have a combined anti-hyperproliferative effect on target tissues. A variety of proteins are encompassed within the present embodiments, some of which are described below. As noted above, the tumor suppressor oncogenes function to inhibit excessive cellular proliferation. The inactivation of these genes destroys their inhibitory activity, resulting in unregulated proliferation. Genes that may be employed as secondary treatment in accordance with the present embodiments include p53, p16, Rb, APC, DCC, NF-1, NF-2, WT-1, MEN-I, MEN-II, zac1,

[0090] 894896-8944-3433, v. 1 p73, VHL, MMAC1 / PTEN, DBCCR-1, FCC, rsk-3, p27, p27 / p16 fusions, p21 / p27 fusions, anti-thrombotic genes (e.g., COX-1, TFPI), PGS, Dp, E2F, ras, myc, neu, raf, erb, fms, trk, ret, gsp, hst, abl, E1A, p300, genes involved in angiogenesis (e.g., VEGF, FGF, thrombospondin, BAI-1, GDAIF, or their receptors), and MCC. Apoptosis, or programmed cell death, is an essential process for normal embryonic development, maintaining homeostasis in adult tissues, and suppressing carcinogenesis (Kerr et al., 1972). The Bcl-2 family of proteins and ICE-like proteases have been demonstrated to be important regulators and effectors of apoptosis in other systems. The Bcl-2 protein, discovered in association with follicular lymphoma, plays a prominent role in controlling apoptosis and enhancing cell survival in response to diverse apoptotic stimuli (Bakhshi et al., 1985; Cleary and Sklar, Proc. Nat’l. Acad. Sci. USA, 82(21):7439-43, 1985; Cleary et al., 1986; Tsujimoto et al., 1985; Tsujimoto and Croce, 1986). The evolutionarily conserved Bcl-2 protein now is recognized to be a member of a family of related proteins, which can be categorized as death agonists or death antagonists. Subsequent to its discovery, it was shown that Bcl-2 acts to suppress cell death triggered by a variety of stimuli. Also, it now is apparent that there is a family of Bcl-2 cell death regulatory proteins which share in common structural and sequence homologies. These different family members have been shown to either possess similar functions to Bcl-2 (e.g., BclXL, BclW, BclS, Mcl-1, A1, Bfl-1) or counteract Bcl-2 function and promote cell death (e.g., Bax, Bak, Bik, Bim, Bid, Bad, Harakiri). Surgery. Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative and palliative surgery. Curative surgery is a cancer treatment that may be used in conjunction with other therapies, such as the treatments provided herein, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy and / or alternative therapies. Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and / or destroyed. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and miscopically controlled surgery (Mohs’ surgery). It is further contemplated that the present embodiments may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue.

[0091] 904896-8944-3433, v. 1 Upon excision of part of all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well. Anti-Inflammatory Agents. In certain aspects TUSC2 therapies and / or an immune checkpoint inhibitor are administered in conjuction with an anti-inflammatory agent. An anti-inflammatory agent is defined herein to refer to an agent that is known or suspected to be of benefit in the treatment or prevention of inflammation in a subject. Corticosteroids are a major class of anti-inflammatory agent. The corticosteroids may be short, medium, or long acting, and may be delivered in a variety of methods. A non-limiting list of corticosteroids contemplated in the present embodiments include the oral corticosteroids such as: cortisone, hydrocortisone, prednisone, and dexamethasone. Another major class of anti-inflammatory agents are non-steroidal anti-inflammatory agents. Non-steroidal anti-inflammatory agents include a class of drugs used in the treatment of inflammation and pain. The exact mode of action of this class of drugs is unknown. Examples of members of this class of agents include, but are not limited to, ibuprofen, ketoprofen, flurbiprofen, nabumetone, piroxicam, naproxen, diclofenac, indomethacin, sulindac, tolmetin, etodolac, flufenamic acid, diflunisal, oxaprozin, rofecoxib, and celecoxib. One of ordinary skill in the art would be familiar with these agents. Included in this category are salicylates and derivates of salicylates, such as acetyl salicylic acid, sodium salicylate, choline salicylate, choline magnesium salicylate and diflunisal. Other anti-inflammatory agents include anti-rheumatic agents, such as gold salts (e.g., gold sodium thiomalate, aurothioglucose, and auranofin), anti-rheumatic agents (e.g., chloroquine, hydroxychloroquine, and penicillamine), antihistamines (e.g., diphenhydramine, chlorpheniramine, clemastine, hydroxyzine, and triprolidine), and immunosuppressive agents (e.g., methotrexate, mechlorethamine, cyclophosphamide, chlorambucil, cyclosporine, and azathioprine). Other immunosuppressive agents contemplated by the present embodiments is tacrolimus and everolimus. Tacrolimus suppresses interleukin-2 production associated with T-cell activation, inhibits differentiation and proliferation of cytotoxic T cells. Today, it is recognized worldwide as the cornerstone

[0092] 914896-8944-3433, v. 1 of immunosuppressant therapy. One of ordinary skill in the art would be familiar with these agents, and other members of this class of agents, as well as the mechanism of actions of these agents and indications for use of these agents. Other agents. It is contemplated that other agents may be used in combination with the compositions provided herein to improve the therapeutic efficacy of treatment. These additional agents include immunomodulatory agents, agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adehesion, or agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers. Immunomodulatory agents include tumor necrosis factor; interferon alpha, beta, and gamma; IL-2 and other cytokines; F42K and other cytokine analogs; or MIP- 1, MIP-1beta, MCP-1, RANTES, and other chemokines. It is further contemplated that the upregulation of cell surface receptors or their ligands such as Fas / Fas ligand, DR4 or DR5 / TRAIL would potentiate the apoptotic inducing abilities of the compositions provided herein by establishment of an autocrine or paracrine effect on hyperproliferative cells. Increases intercellular signaling by elevating the number of GAP junctions would increase the anti-hyperproliferative effects on the neighboring hyperproliferative cell population. In other embodiments, cytostatic or differentiation agents can be used in combination with the compositions provided herein to improve the anti-hyperproliferative efficacy of the treatments. Inhibitors of cell adhesion are contemplated to improve the efficacy of the present invention. Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody c225, could be used in combination with the compositions provided herein to improve the treatment efficacy. In certain embodiments, hormonal therapy may also be used in conjunction with the present embodiments or in combination with any other cancer therapy previously described. The use of hormones may be employed in the treatment of certain cancers such as breast, prostate, ovarian, or cervical cancer to lower the level or block the effects of certain hormones such as testosterone or estrogen. This treatment is often used in combination with at least one other cancer therapy as a treatment option or to reduce the risk of metastases.

[0093] 924896-8944-3433, v. 1 VI. Examples The following examples are included to demonstrate particular embodiments. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventor to function well in the practice of embodiments, and thus can be considered to constitute particular modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the disclosure. Example 1 – Identification of microexon-derived surface proteoforms in pHGG Initial analysis of 325 pHGG tumors from the Open Pediatric Brain Tumor Atlas (Shapiro et al., 2023) revealed that not only is aberrant splicing prevalent in pHGG, but these tumors had some of the most heterogeneous splicing programs (Naqvi et al., 2025). Thus, the rMATS-turbo splicing algorithm (Wang et al., 2024) was used to compare 184 pHGG patient samples to each of the 7 healthy controls comprised of an adult brain homogenate, an adult brain stem, an adult cerebellum, an adult occipital cortex, two fetal brains, and one pediatric normal cortex. pHGG-specific splice junction candidates were filtered for single- exon (SE) events, whose junctions were mapped to predicted protein structures using UniProt annotations and filtered for SE events corresponding to extracellular protein domains (FIG. 1A), to enable future development of therapeutic antibodies and chimeric antigen receptors. These events were filtered for 40% prevalence and further binned according to exon lengths. The only events with mean differences in percent-spliced-in (∆PSI) absolute values greater than 0.50 were skipping of very short exons: ≤30- and 31-50-nucleotide long (FIG. 1B, box). These are known as microexons 28, and their dysregulation has been previously implicated in several CNS diseases (Gonatopoulos et al., 2020), including autism spectrum disorder (Irimia et al., 2014). Inclusion of microexons requires dedicated RNA binding proteins such as RBFOX (Jbara et al., 2023; Li et al., 2018) and SRRM4 (Irimia et al., 2014; Head et al., 2021; Conn et al., 2020; Quesnel-Vallieres et al., 2015), whose activity is counteracted by PTBP1, a promoter of microexon skipping (Mochizuki et al., 2021; Li et al., 2015; Raj et al., 2014). Of note, expression levels of RBFOX1 and SRRM4 mRNA were lower, and that of PTBP1 were higher in pHGG compared to normal brain tissues (FIG.1C),

[0094] 934896-8944-3433, v. 1 which could explain the observed bias toward microexon skipping. To validate these findings in patient-derived samples, qRT-PCR assays were performed on pooled normal brain RNAs vs. 6 pHGG PDXs. Statistically significant differences were observed in RBFOX1, SRRM4, and PTBP1 levels, which mirrored those seen in the original datasets (FIG.7A). Thus, the entire rMATS-turbo output was re-analyzed focusing on microexons corresponding to cell surface proteins and with |∆PSI|≥0.5. mRNAs encoding the 4 members of the L1-immunoglobulin superfamily of cell adhesion molecules (IgCAM), L1CAM itself, NFASC, CHL1, and NRCAM, were among the most profoundly and consistently mis- spliced transcripts (FIG. 1D and FIG. 1E). In fact, neuronal cell adhesion molecule (NRCAM) mRNA had two microexon-related events: skipping of the 18-nt microexon 5 and the 30-nt microexon 19 [MANE nomenclature (Morales et al., 2022); exons 9 and 23 in GTEx v8 (Aguet et al., 2020)] (FIG. 1E). Skipping of microexon 7 in L1CAM and microexon 24 - in NFASC was also observed. One exception to the trend toward exon skipping was increased inclusion of exon 8 in CHL1, but that exon was slightly longer, 48 nucleotides, which is borderline for the purpose of microexon definition (Gonatopoulos- Pournatzis et al., 2020). To validate these findings in patient-derived samples, semi- quantitative, low-cycle-number RT-PCR assays were performed on the samples from FIG. 7A. Using forward and reverse primers corresponding to exons flanking microexons in question, both skipping and inclusion events were detected in the same reactions. Without exemption, the splicing patterns of the 6 PDXs matched those predicted by rMATS-Turbo (FIG.7B). Focusing on NRCAM as the most profoundly affected transcript, the inventors asked whether its microexons are skipped in other human tumors. MAJIQlopedia was queried, which is a recently developed compendium of splicing variations across 86 human tissues and 41 cancer datasets (Quesnel-Vallieres et al., 2024). Skipping of NRCAM exons 5 and 19 was prevalent in all tumor types with detectable NRCAM splice junctions. They included pHGG, adult low-grade gliomas and GBMs, pheochromocytomas and paragangliomas, and also cancers of non-neural origins, such lung adenocarcinomas (FIG.1F). The sole exception was pediatric neuroblastoma, where NRCAM exons 5 and 19 were uniformly included. Of note, these splicing quantifications were based on MAJIQ (Vaquero-Garcia et al., 2023), an

[0095] 944896-8944-3433, v. 1 algorithm orthogonal to rMATS-turbo, increasing our confidence in NRCAM-centric events. Further evidence for preferential NRCAM exon 5 and 19 skipping in pHGG was found in the output of Toil, yet another orthogonal approach to transcript reconstitution from short- read RNA-seq data (Vivian et al., 2017). Using Xena portal (Goldman et al., 2020), transcript ENST00000351718.8 lacking exons 5 and 19 was overexpressed in brainstem gliomas compared to normal brain tissues (FIG. 1G). ENST00000351718.8 was also upregulated in GBMs, consistent with the MAJIQlopedia output (FIG.8A). Example 2 – HGG-specific expression of NRCAM ∆ex5∆ex19 isoform To determine whether microexon skipping reflects, at least to some extent, HGG lineage, the RNA-seq dataset corresponding to 20 human primary astrocyte samples, 1 neuron sample, and 4 oligodendrocytes were included in the analysis (Zhang et al., 2016). Skipping of HGG-specific microexons occurred primarily in astrocytes and oligodendrocytes, but not neurons, consistent with the pHGG eponymous cell of origin (FIG. 2A). PSI values, while reflective of the underlying molecular mechanism, do not yield information about expression levels of a given isoform, which are much more relevant from the immunotherapy standpoint. Thus, the splicing analysis was contemplated with the parsing of splice junction counts, one of the key outputs of the STAR aligner (Dobin et al., 2013), as described by us recently (Torres-Diz et al., 2024). Specifically, expression of the non-canonical exon 4-exon 6 junctions were quantified in pHGG samples and across the GTEx dataset comprised of both neuronal and non-neuronal normal tissues. B7-H3 / CD276 canonical exon 15-exon 16 junction was used for comparison. NRCAM Δex5Δex19 and B7- H3 transcripts were expressed at comparable levels in pHGG and brain sub-regions, while NRCAM Δex5Δex19 had the advantage of being expressed at lower levels in non-neuronal normal organs, such as the adrenal gland and the adipose tissue (FIG. 2B). Similar results were obtained using as a readout NRCAM exon 18-exon 20 junction (FIG.8B, top left.) The other three members of the L1CAM family showed the same pattern of elective exon usage,

[0096] 954896-8944-3433, v. 1 except that their expression levels in pHGG were markedly lower (FIG. 8B, top right and bottom). To determine whether skipping of NRCAM microexons 5 and 19 occurs concurrently and in the context of functional, cap-to-poly(A) transcripts, direct cDNA long-read sequencing was performed using Oxford Nanopore platform PromethION P2 for two DMG PDX samples, 7316-1763 and 7316-1769. To ensure accurate detection of small exons, STAR-aligned reads were re-aligned using MisER (Liu et al., 2023). Skipping of both NRCAM exon 5 and exon 19 in PDX 7316-1769 (FIG. 2C), however due to low read depth there were transcripts for NRCAM in PDX 7316-1763 detected. To circumvent the read depth issues, targeted long-read re-sequencing was performed on several PDX samples, KNS42 pHGG cell line, TM31 and U251 GBM cell lines, and SMS-SAN neuroblastoma cell line. Direct examination of sequencing reads in the Integrative Genomics Viewer [IGV; (Robinson et al., 2017)] revealed that all oligo(dT)-primed NRCAM transcripts extending to the 5’ end lacked exons 5 and 19 in KNS42 cells, but included them at ~50% frequency in SMS-SAN NBL (FIG.2D, FIG.2E). Using the ESPRESSO computational tool (Gao et al., 2023), the expression of various NRCAM transcripts in all sequenced samples were quantified. All pHGG and GBM cell lines and PDXs predominantly express the NRCAM variant lacking both exon 5 and exon 19 (FIG. 2F), while in SMS-SAN cells inclusion of exon 19 was common (FIG.2F) and skipping of both exon 5 and exon 19 was rather rare. Example 3 – Assessment of tumor heterogeneity by single-cell long-read-seq Bulk long-read RNA sequencing is commonly used to identify full-length transcripts, but initially it did not have single-cell resolution capabilities (Sharon et al., 2013; Au et al., 2013). Subsequent single-cell long-read approaches were developed for fewer than 100 cells (Byrne et al., 2017; Karlsson et al., 2017), making the assessment of tumor heterogeneity difficult. To overcome this limitation, the inventors recently developed techniques for long-read sequencing of thousands of single cells from both fresh [ScISOr- Seq; (Gupta et al., 2018)] and frozen [SnISOr-Seq; (Harwick et al., 2022)] tissues. The most recent iteration of this approach [(SnISOr-Seq / ScISOr-ATAC; (Hardwick et al., 2022; Hu et al., 2024)] allows for the accurate cataloging of full-length transcripts devoid of intronic sequences. This approach was applied to DMG PDX 7316-3058. According to the short-read dataset (the 10x Genomics part of the workflow), this sample can be broken down into 3

[0097] 964896-8944-3433, v. 1 clusters based on K-means (FIG.3A, panel i). While all of them expressed glial cell markers, proliferating cells are largely confined to Cluster 2, as evidenced by expression of the MKI67 gene (FIG. 3A, panel ii). Nevertheless, virtually all neoplastic cells, regardless of cluster attribution, expressed both B7-H3 (FIG.3A, panel iii) and NRCAM mRNAs (FIG.3A, panel iv), especially robustly the latter. Then, using the long-read dataset (the long-read-seq part of the workflow), the inventors asked how microexons of interest are represented in the 3 major clusters (A, B, and C in FIG. 3B). This was achieved by retaining barcoded reads only and aligning them over GRCh39 genome by minimap2 with gencode v44 gtf as described earlier (Stein et al., 2022). When the inventors examined ScisorWiz (Hardwick et al., 2022) plots. All recovered reads for NRCAM exons 4 and 6 skipped microexon 5 (left most dotted rectangle) and all recovered reads for CHL1 exons 7 and 9 included microexon 8 (middle dotted rectangle), with no evidence of intra- or inter-cluster heterogeneity. This was in sharp contrast with the CHL1 “non-micro” cassette exon 26, whose inclusion and skipping varied considerably both within and among the 3 clusters (right most dotted rectangle). Collectively, these results suggest that in pHGG L1-CAM microexons are processed in a uniform, rather than a stochastic manner, making the corresponding proteoforms much more compelling immunotherapy targets. To validate these findings in additional pHGG samples, data was parsed from the recent study wherein bulk and single-cell RNA-Seq was performed on 19 pHGG primary samples [(DeSisto et al., 2024); NCBI GEO dataset GSE231859]. Non-cancerous samples were excluded, as were samples annotated as epithelioid glioblastoma or with fewer that than 200 neoplastic cells. The bulk sequencing reads corresponding to the remaining 8 samples were visualized in IGV, with emphasis on NRCAM exons 5 and 19. As anticipated, predominant patterns of exon 19 and especially exon 5 skipping, with 5 out of 8 samples not containing any exon 5 reads (FIG. 9A). Then single-cell sequencing reads were integrated and analyzed using the Seurat and Azimuth packages (Hao et al., 2024; Butler et al., 2018; Hao et al., 2021; Bakken et al., 2021), and cell types were mapped using the Human Motor Cortex Reference Explorer. When all cell types were included in the analysis, NRCAM and B7-H3 showed similar patterns of intertumoral heterogeneity (FIG. 9B). However, after zeroing on the glial compartments (astrocytes, oligodendrocytes, and oligodendrocyte

[0098] 974896-8944-3433, v. 1 progenitor cells; FIG. 10A), much more robust and more uniform distribution of NRCAM mRNAs than B7-H3 mRNAs was observed, with fewer dropout events (FIG.10B,and FIG. 10C), attesting to NRCAM’s potential as an immunotherapy target. Example 4 – The role of ∆ex5∆ex19 NRCAM in pHGG pathogenesis To determine the contribution of NRCAM Δex5Δex19 to gliomagenesis, a guide RNA was designed to map to NRCAM exon 4 (FIG.11A) and used it in combination with the CRISPR / Cas9 system to generate NRCAM-null (KO) KNS42 cells. The KO event was validated at the genomic DNA levels by amplicon re-sequencing (FIG. 11B) and at the protein level - by immunoblotting with a commercially available anti-NRCAM antibody (FIG. 4A). To determine whether the Δex5Δex19 NRCAM isoform is expressed on the plasma membrane, a whole-cell biotinylation assay was adapted. Briefly, live KNS42 cells were incubated with biotin to label Lys residues of surface proteins, which upon lysis were isolated using neutravidin beads and analyzed by immunoblotting. In these subcellular localization experiments, EGFR served as a reference cell surface marker and tubulin and actin as cytosolic markers. The Δex5Δex19 NRCAM isoform was reliably observed in both total cell lysate and the cell surface but not cytosolic (“flow-through”) fractions and largely absent from all NRCAM KO cells fraction (FIG. 4B). This result is in line with multiple reports showing that microexon-encoded amino acids are often located on outer surfaces and regulate protein-protein interactions, as catalogued in the recent review (Table 1 in Mackensen et al., 2025). To determine the role of the skipped isoform of NRCAM in pHGG, NRCAM KO cells were reconstituted with the full-length (exon 5- / exon 19-including) and the Δex5Δex19 NRCAM isoform and confirmed their expression by immunoblotting (FIG. 4C). Compared to vector control cells, neither of them showed any effect on cell proliferation in 2-D cultures (FIG. 4D). However, the Δex5Δex19 - but not the full-length NRCAM isoform - enhanced migration and invasion by KNS42 cells, as evidenced by the Transwell assays performed with and without Matrigel (FIG.4E, and FIG.4F), as described previously in Sehgal et al., 2021. Finally, these cells were modified to express firefly luciferase and implanted orthotopically into the cortexes of NSG mice, as described previously (Brosius et al., 2024).

[0099] 984896-8944-3433, v. 1 More consistent tumor take and substantially more robust tumor growth were observed when the Δex5Δex19 NRCAM isoform was expressed, whereas both NRCAM-null and NRCAM- full length KNS42 cells took and grew rather poorly (FIG. 4G, and FIG. 4H). In fact, mice bearing these tumors were still alive on Day 120, while their Δex5Δex19 counterparts were all dead by day 30 (FIG. 4I). The apparent essentiality of Δex5Δex19 for tumor growth and its uniform expression on the cell surface made it an attractive target for pHGG immunotherapy. Example 5 – pHGG-selective anti-NRCAM, chimeric antigen receptors, antibodies and their therapeutic utility Given the minimal difference in the amino acid sequences between the full-length and the Δex5Δex19 NRCAM proteoforms, AlphaFold 3 (Abramson et al., 2024) was used to predict 3D structural models for the corresponding UniProt-annotated ectodomains. It predicted a “horseshoe” conformation with a hinge between Ig-like 2 and Ig-like 3 domains in both isoforms, similar to crystal structures of another L1 family-member, L1CAM [(Su et al., 1998); discussed in (Hortsch et al., 2014)]. AlphaFold 3 also predicts that the proline- rich microexon 19-encoded amino acid sequence creates a sharp bend between Ig-like 6 domain and the first fibronectin type-III domain (FIG.5A, left). This band is absent from the NRCAMΔex5Δex19 proteoform model, creating a more open conformation that could be available for selective targeting (FIG.5A, right). To generate NRCAM Δex5Δex19-selective monoclonal antibodies, this isoform was expressed in murine NIH3T3 cells and immunized syngeneic C57BL / J mice with whole cells using the Fred Hutchinson Cancer Center Antibody Technology Core Facility (FIG.5B), as described by others previously (Pattwell et al., 2020). Supernatants from the resultant hybridomas were used to stain CHO cells expressing either the full-length or the Δex5Δex19 NRCAM proteoform. As expected, the majority of mAbs (exemplified by 2D10 in FIG.5C) stained both the full-length and the NRCAM isoforms equally well (thin arrows). However, mAb 3F8 showed selectivity for NRCAM Δex5Δex19, as judged by ~10-fold difference in mean fluorescent intensities (FIG. 5D, thin and thick arrows). Importantly, this binder recognized the endogenously expressed Δex5Δex19 NRCAM in pHGG samples, such as the KNS42 cell line (FIG. 5E, Parental KNS42 with thick arrow), even though non-specific, background staining was also observed in NRCAM KO cells (bottom peak).4 pHGG PDXs

[0100] 994896-8944-3433, v. 1 were also stained with 3F8. Consistent with single-cell RNA-seq data (FIGS. 9A-B and FIGS.10A-C), robust and uniform expression of NRCAM Δex5Δex19 was observed (FIG. 5F). To determine how efficient and selective 3F8-based immunotherapeutics might be, a universal immune receptor (UIR) technology was applied to redirect T cell specificity towards antibody-stained cells, as described by previously (Urbanska et al., 2012; Smole et al., 2022; Minutolo et al., 2019). Specifically, KNS42 cells were “painted” with the 3F8 antibody and admixed them in vitro with human donor-derived T cells engineered to express a CD64 (FcγRI)-based UIR (FIG. 5G). This antibody-UIR combination could kill the majority of pHGG cells, but only when the cancer cells expressed the Δex5Δex19 NRCAM proteoform, ectopically or endogenously using KNS42 or PDX 7316-3058 (FIG. 6A, top row). No killing was observed against cells expressing full-length NRCAM, when the FcγRI UIR was armed by an irrelevant isotype-control IgG2b antibody (FIG. 6A, bottom row), or with un-transduced donor T cells (FIG.12A).3F8-UIR combination was also tested against adult GBM cell lines U251 and TM31 (which exclusively express the Δex5Δex19 NRCAM isoform) and their NRCAM KO derivatives. The same efficacy and selectivity of cell killing was observed as seen with pHGG models (FIG.6B and FIG.12B). mAb 3F8, therefore, may be a promising immunotherapeutic for pediatric and adult tumors of glial origin. Given the promising results obtained with purified 3F8 combined with UIR, we generated Δex5Δex19 NRCAM-directed CAR T cells. Utilizing the scFv sequence from the 3F8 antibody and the overall design of the existing GD2 CAR (Figure 13A,left), second- generation NRCAM CARs with a 4-1BB costimulatory domain and different combinations of GSS linkers and hinge regions were generated (FIG. 13A, middle and right). To standardize the expression of CARs, Jurkat cells were transduced with the indicated CAR constructs incorporated into a lentiviral backbone. Cell surface expression was analyzed using Fab fragment- and Protein L-directed antibodies. The construct with 4(G4S) linker and IgG1 hinge region showed superior cell-surface expression, comparable to that of GD2 CAR, and was chosen for further experiments (FIG. 13B). We then used the same lentiviruses to transduce donor-derived T cells (FIG. 13C). Following transduction, killings assays were performed on pHGG cell line KNS42, pHGG PDX 7316-3058, and adult glioblastoma cell line U251; GD2 CAR was used as a positive control. Co-culturing effector and target cells in increasing ratios resulted in dose-dependent killing of glioma cells by both CARs (FIG.

[0101] 1004896-8944-3433, v. 1 13D). In parallel, expression of the target surface protein (Δex5Δex19 NRCAM) was verified by flow cytometry with the 3F8 antibody (FIG.13E) Example 6 – Discussion Failures of adoptive cancer immunotherapies come in two flavors: effector cell- centric (e.g., T cell exhaustion) and target cell-centric (e.g., epitope loss or down- modulation) (Uslu et al., 2024). The latter problem underscores the need for robust pipelines yielding alternative antigens for salvage immunotherapies. Traditionally, such pipelines focused either on discovery of lineage-specific markers (B cell-specific CD19, CD22, etc.) (Ang et al., 2024) or on identification of proteins overexpressed in tumors compared to their respective tissues of origin. While such “tumor-versus-normal” comparisons continue to yield viable therapeutic targets, for example DLK1 and GPC2 in high-risk neuroblastoma (Bosse et al., 2017; Hamilton et al., 2024), GPC2 in CNS tumors (Foster et al., 2022), B7- H3 (CD276) and GD2 in diffuse intrinsic pontine glioma (DIPG) and DMG (Majzner, et al., 2022; Vitanza et al., 2023), GD2 in medulloblastoma (Ciccone et al., 2024), this approach might be entering the phase of diminishing returns, as existing microarray and RNA-seq datasets have been mined extensively already. Additionally, “tumor-versus-normal” comparisons often ignore expression of the target antigen in non-adjacent normal tissues, creating the potential for severe on-target, off-tumor toxicities (OTOT) (Flugel et al., 2023). For CAR T cells, OTOT could be circumvented with locoregional delivery, but this approach may not be effective for antibody-drug conjugates and other soluble therapeutics. All these limitations led the cancer immunotherapy field to look for alternative sources of tumor-specific epitopes, such as alternatively splicing (Anczukow et al., 2024; Nejo et al., 2024). In a hallmark paper investigating splicing patterns across The Cancer Genome Atlas, it was estimated that in the average tumor there exist close to 1,000 unique “neojunctions" not typically found in normal samples profiled by the GTEx consortium (Kahles et al., 2018). However, only a tiny fraction of them (~0.1%) generate peptides capable of being presented by major histocompatibility complex class I molecules. In principle, this bottleneck could be bypassed by focusing on transmembrane proteins with large extracellular domains, which could be recognized by engineered T-cells independently of MHC class I presentation (Pan et al., 2023). However, it is not clear what

[0102] 1014896-8944-3433, v. 1 fraction of alternatively spliced transcripts yields functional proteoforms able to reach the plasma membrane. In hematologic malignancies, for example, there are several examples where exon skipping results in either protein degradation [P2RX5 (Ang et al., 2024)] or its retention in the endoplasmic reticulum [CD19 (Bagashev et al., 2018; Sotillo et al., 2015), CD33 (Lamba et al., 2017)]. Finally, even when alternative splicing-derived proteoforms are expressed on the cell surface, anti-peptide monoclonal antibodies directed against “neojunctions” might efficiently and specifically recognize the denatured protein [e.g., CD22 Δex5-6 (Zheng et al., 2022)], but not necessarily its membrane-bound conformation. Thus, in most cases alternative splicing might be just as likely to drive resistance than to enable new therapies (Zheng et al., 2019). However, not all alternative splicing events are created equal; and some of them, for example inclusion / skipping of microexons, have evolved to preserve protein structures while generating unique 3D conformations (Gonatopoulos-Pournatzis et al., 2020; Mackensen et al., 2025). In pediatric HGG, the pattern of microexon inclusion is markedly different from that observed in normal brain samples. In fact, microexon skipping was the only single-exon type of event with profound differences in ∆PSI values (>50%). By focusing further on SE events with high prevalence, the inventors were able to identify members of the L1 family of cell adhesion molecules (Hortsch et al., 2014), including NRCAM, as being particularly strongly affected by alternative splicing. This is not completely surprising since NRCAM was recently shown to be the molecule with the greatest number of proteoforms in the developing mouse and human retinas (Ray et al., 2020). There is also some evidence that NRCAM and related CAMs might be implicated in tumor progression [reviewed in (Cavallaro et al., 2004)]. However, the importance of individual proteoforms in either normal or development and cancerous growth has not been elucidated. By focusing on concurrent skipping of NRCAM microexons 5 and 19, the inventors were able to demonstrate that the corresponding proteoform is not only stable and present on the pHGG cell surface, but it promotes cell migration and invasion and is essential for progressive tumor growth in orthotopic mouse models. Remarkably, despite minimal amino acid changes, it is also antigenically distinct, as the inventors were successful in generating a monoclonal antibody (3F8) with high selectively toward NRCAM Δex5Δex19. This selectivity manifested itself not only in flow cytometry experiments, but also in functional

[0103] 1024896-8944-3433, v. 1 cell killing assays, where pHGG cells reconstituted with NRCAM Δex5Δex19 – but not the full-length isoform – were effectively killed by human T cells engineered to express an FcR- based universal immune receptor and redirected by an NRCAM Δex5Δex19-specific mAb. These findings provide the rationale for future development and preclinical testing of other 3F8-based immunotherapeutics, including CARs. If 3F8-based immunotherapeutics prove to be as potent as current ones (e.g., B7-H3 CARs), targeting NRCAM Δex5Δex19 could be advantageous from the OTOT standpoint. Indeed, it was observed that this mRNA isoform is expressed at lower levels in several normal tissues, including the adrenal gland. Even in normal brain samples, which have sizable fractions of cells of glial origin , significant levels of NRCAM Δex5Δex19 expression was not detected, as judged by JPM counts (FIG.2B). In fact, the recently developed Cancer- Specific Exon Miner identified NRCAM as one of the six alternatively spliced proteoforms highly and specifically expressed in multiple solid and brain pediatric tumors at high prevalence (Shaw et al., 2024). The potential of NRCAM Δex5Δex19 as a therapeutic target is not limited to pediatric tumors and could include adult low-grade gliomas and GBMs, pheochromocytomas and paragangliomas, and also cancers of non-neural origins, such lung adenocarcinomas. Example 7 – Method Details Animal experiments. All animal experiments had received prior approval from the Children Hospital of Philadelphia Institutional Animal Care and Use Committee (IACUC) and were conducted as described in Protocol IAC 24-001295 “Validation of drivers in tumor formation and preclinical testing” (approval date 2 / 29 / 2024). The orthotopic pHGG models have been established as follows. Eight to 10-week-old Nu / J mice (8 animals per treatment group) were anesthetized with 2.5% isoflurane, placed into the stereotactic frame, then injected with 1x106 glioma cells. Stereotactic coordinates used to target the cortex for tumor were as follows: -0.4 mm posterior to bregma, 3mm lateral to bregma, and 1 mm depth from pia. All animals were subjected to regular optical imaging beginning at 3 weeks post- injection. Human samples. All high-grade glioma pediatric brain tumor raw data were harvested from the database of Genotypes and Phenotypes (dbGAP) (accession number

[0104] 1034896-8944-3433, v. 1 phs002517.v2.p2), which includes tumors from the Children’s Brain Tumor Network (cbtn.org) and the Pediatric Neuro-Oncology Consortium (pnoc.us). Cell culture. The pediatric high-grade glioma cell line KNS42 was cultured in DMEM-F12 (GIBCO Cat#11320033), the neuroblastoma cell line SMS-SAN was cultured in RPMI (Corning Cat#10-040-CM), murine NIH3T3 cells were cultured in IMDM (ThermoFischer Scientific Cat#12440053), Chinese Hamster Ovary (CHO) cells were cultured in Ham's F 12K (Kaighn's) Medium (ThermoFischer Scientific Cat# 21127022) supplemented with 10% FBS (GIBCO Cat#26140079), 2 mmol / L L-glutamine (GIBCO Cat#25030081), and penicillin / streptomycin (GIBCO Cat #15140122) at 370C and 5% CO2. After thawing, cells were authenticated by short tandem repeat analysis, tested for Mycoplasma using the EZ-PCR Mycoplasma Detection Kit (Biological Industries Cat#20- 700-20), and used for up to 12 passages. Patient derived cells were cultured in DMEM-F12 supplemented with B27 supplement (ThermoFischer Cat#12587-010), N2 supplement (ThermoFischer Cat#175020-48), EGF recombinant protein (ThermoFischer Cat#PHG0311L), FGF recombinant protein (Peprotech Cat#100-18B), Heparin (Sigma Cat#H3149), 2 mmol / L L-glutamine, and penicillin / streptomycin at 370C and 5% CO2. supplemented with 10% FBS, 2 mmol / L L-glutamine and penicillin / streptomycin at 370C and 5% CO2. RNA extraction and reverse transcription. Total RNAs were isolated using Maxwell RSC simplyRNA Cells kit with the Maxwell RSC48 Instrument (Promega Cat#AS1390) and reverse-transcribed using SuperScript IV (Invitrogen Cat#18090010). Primer sequences used for cDNA amplification are listed in the Key resource table. Oxford Nanopore Technologies (ONT) long-read direct cDNA sequencing. Total RNAs were isolated using Maxwell RSC simplyRNA Cell Kits (Promega Cat#AS1390). Approximately 500 ng of total RNA was used for direct cDNA (SQK-LSK114; Oxford Nanopore Technologies [ONT]) library preparation. Subsequently, each library was loaded into a PromethION Flow Cell R10.4.1 version (FLO-PRO114M; ONT) and sequenced using a PromethION 2 Solo (ONT) for 48 hours. Raw Fast5 files were converted to FASTQ with guppy (version 3.4.5), followed by alignment to the GENCODE version of hg38 (version

[0105] 1044896-8944-3433, v. 1 30) using minimap2 (version 2.18); the resulting bam file was visualized using the Integrative Genomics Viewer (version 2.11.0). ONT targeted resequencing. For NRCAM, primers were designed to bind to exons present in all the isoforms to ensure full coverage of all alternative splicing events. 5ng of cDNA were amplified with the long LongAmp Taq 2X Master Mix (New England Biolabs) for 25 cycles. The resulting amplicons were subjected to amplicon-seq (SQKNBD112.24, ONT) library preparation. Subsequently, each library was loaded into a Spot-ON flow cell R9 Version (FLO-MIN112, ONT) and sequenced in a MinION Mk1C device (ONT) until it had at least 1000 reads per sample. Results were aligned using Minimap2 version 2.24-r1122 and visualized in IGV version 2.12.3. MisER, a splicing re-alignment tool, was run on ONT output files and reads were realigned using NRCAM RefSeq transcripts downloaded from UCSC genome browser. The flanking region parameter for Miser was 110. For isoform quantitation, ESPRESSO was run with default settings on MisER-realigned bam files.\ Single-nuclei isoform RNA sequencing. Nuclei from pHGG patient-derived organoids were isolated and processed using the Chromium Next Gem Single Cell Multiome ATAC + Gene Expression kit from 10X Genomics (kit PN-1000285, chip PN-1000230, dual index kit PN-1000215). For short-read sequencing, the Chromium Single Cell Multiome Gene Expression Library was performed by following the manufacturer’s instructions, starting from 8,000 single-nuclei. It was then loaded on an Illumina NovaSeq 6000 with PE 2 × 100 paired-end kit, using the following sequencing read lengths: 28 cycles Read1, 10 cycles i7 index, 10 cycles i7 index, and 90 cycles Read2. For long-read sequencing, cDNA obtained from the 10X Genomics Single Cell Multiome ATAC + Gene Expression kit was used for amplification and exome enrichment. The amplified / enriched cDNA was then sequenced on the Oxford Nanopore Technology platform starting from ~200 fmol cDNA and using the Ligation Sequencing Kit (SQK-LSK114), according to the manufacturer’s protocol (Nanopore Protocol, Amplicons by Ligation, version ACDE_9163_v114_revO_29Jun2022). The ONT library was loaded onto a PromethION sequencer by using PromethION Flow Cell (FLO-PRO114M) and sequenced for 72 h. Base- calling was performed with Guppy by setting the base quality score >7. Genome editing. Single-guide RNA targeting NRCAM exon 4 and CAS9 protein were obtained from Integrated DNA Technologies. Cas9 ribonucleoprotein complexes were

[0106] 1054896-8944-3433, v. 1 assembled following manufacturer’s recommendations. These ribonucleoprotein complexes were transfected into KNS42 and 7316-3058 cells using Lipofectamine CRISPR MAX Kit (Invitrogen Cat#CMAX00001) following manufacturer’s instructions. The effect of gRNA was determined by immunoblotting for NRCAM. Plasmid constructs and viral infections. For NRCAM constructs, the coding sequence of the full-length isoform (NM_001193582.2 / ENST00000413765.6) and Δex5Δex19 NRCAM (NM_005010.5 / ENST00000351718.8) was synthesized and cloned into the lentiviral backbone (pTwistLentiSFFV puro) by Twist Biosciences. For viral particle production, 293T cells (ATCC) grown to 90% confluence in a 10-cm Petri dish were transfected with 10 μg of the NRCAM constructs, 2.5 μg of the pMD2.G (RRID:Addgene_12259) and 7.5 μg of the psPAX2, (RRID:Addgene_12260) using Lipofectamine 3000 (Invitrogen, #L3000001). Supernatants were collected 48 hours after transfection, passed through 0.45-μm PVDF filters, and incubated for 48 hours with cells in media containing 10 µg / mL polybrene (MedChemExpress, Cat#HY112735). After 48 hours, culture media were replaced, and cells were incubated with 1.5 μg / mL puromycin for selection. For FcIR-28z, transfection was performed with a plasmid mix containing the transfer plasmid encoding the Fc binding immune receptor (FcIR) fused to the intracellular TCR and co-stimulatory signaling domains (FcIR-28z), along with packaging plasmids pRSV.REV (RRID:Addgene_12253), pMD2.G, and pVSV-G (RRID:Addgene_138479) in a 15:18:18:7 mass ratio. Lentiviral supernatants were collected at 24- and 48-hours post- transfection, filtered through a 0.45 µm filter, and concentrated via ultracentrifugation at 25,000 rpm for 2.5 hours. The final viral preparation was stored at -80°C. Viral titers were determined by transducing HEK 293T cells, and results were expressed as Infection Units per milliliter (IU / mL). Immunoblotting. Total cell lysates were prepared from cells using RIPA buffer with protease and phosphatase inhibitors (Pierce Halt Inhibitor Cocktail, Thermo Fisher Scientific Cat#78446). After protein transference to PVDF (Immobilin-p, Millipore Cat#IPVH00010), an anti-NRCAM antibody (Abcam Cat#191418, RRID: AB_3697105) and anti-EGFR antibody (Cell Signaling Technology Cat# 4267, RRID:AB_2246311) was used. Subsequently, recommended dilutions of horseradish peroxidase–conjugated secondary antibody (Cell signaling, #7074S, RRID:AB_2099233) was applied. Enhanced

[0107] 1064896-8944-3433, v. 1 chemiluminescence (Millipore, #WBKLS0500) was used to detect bands that were then captured by Chemiluminescence imager (GE Healthcare). Each sample was normalized to HRP conjugated β-actin (Cell Signaling Technology Cat #12262S, RRID:AB_2566811) or GAPDH (Cell Signaling Technology Cat# 3683, RRID:AB_1642205) or Tubulin (Cell Signaling Technology Cat# 2144, RRID:AB_2210548). Isolation of Biotin-labeled Cell Surface Proteins. Cell surface biotinylation was performed using Pierce™ Cell Surface Biotinylation and Isolation Kit (Thermo Fischer scientific Cat#A44390). Briefly, cells were grown to confluency in 10-well dishes, washed with PBS, and labeled with a non-cell-permeable sulfo-NHS biotin analog for 10 minutes at room temperature. After washing, ice cold TBS was added to the cells which were collected with a cell scraper, and clarified by centrifugation (500 × g, 5 min, 4 °C). To isolate biotin- labeled cell surface proteins, lysate (was added to Neutravidin agarose column and incubated for 30 minutes at room temperature. Eluted protein fractions were then analyzed by immunoblotting. Cell proliferation, migration, and invasion assays. To assess proliferation, cells were seeded in white 96 well flat bottom plates at a density of 8000 cells per well. Cell viability was measured using the CellTitre-Glo (CTG) luminescent cell viability assay (Promega Cat#G7570). Luminescence was measured using Biotek Synergy 2 plate reader at 24, 48 and 72hrs. Corning BioCoat Cell Culture Inserts and Matrigel inserts (Corning, USA) were used for migration and invasion assays, respectively, as described in (58). Briefly, the inserts were rehydrated with plain DME-F12 for 2 h before use.5–7×104 cells (treated with 10ug / ml of Mitomycin C) were trypsinized and resuspended in serum-free medium and then seeded onto 24-well Transwell chambers with 8-μm pore membrane in 500 μL serum-free medium. The lower chamber contained medium supplemented with 10% FBS. After incubation for 22 h, the non-migrated / invaded cells on the upper side of membrane were removed with a cotton swab and the migrated / invaded cells stained with crystal violet and microphotographed. AlphaFold analysis of NRCAM isoform structures. AlphaFold 3 models were generated for the UniProt-annotated ectodomains of the full-length and Δex5Δex19 NRCAM isoforms, specifically C9JYY6 and Q14CA1. The signal peptide at the N-terminus of the sequence (amino acids 1-24, identified in UniProt) was removed before generating the

[0108] 1074896-8944-3433, v. 1 models because these amino acids are cleaved in the ER during protein processing. Additionally, these isoforms lack the fifth fibronectin type-III domain, owning the exonic structures of the respective mRNAs (ENST00000413765.6 and ENST00000351718.8). Generation of monoclonal antibody against NRCAM Δex5Δex19. All monoclonal antibodies were generated at the Fred Hutchinson Antibody Technology Core. Briefly, male and female 20-week-old mice were immunized with syngeneic NIH3T3 cells overexpressing Δex5Δex19 NRCAM. Following a 12+ week boosting protocol, splenocytes were isolated from high-titer-yielding mice and electrofused with FOX-NY myeloma cells. Hybridomas secreting isoform specific antibody were identified and isolated. Antibodies from the picked clones were validated for proteoform binding by flow cytometry using cell- based flow cytometry. Clone 3F8 was subcloned followed by validation for proteoform binding by cell-based flow cytometry using cells expressing empty vector, full length and Δex5Δex19 NRCAM. Affinity purified IgG2b kappa chains from the hybridoma was further characterized by Western blot analysis and flow cytometry staining. Generation of Primary T Cells with FcIR-28z. The activation, transduction, and expansion of primary T cells were carried out using standard techniques. All primary T cell studies were conducted under approval from the University of Pennsylvania Institutional Review Board (IRB). Identified donors provided informed consent, signing forms approved by the IRB. Briefly, primary human CD4+ and CD8+ T cells, obtained from healthy donors and purchased from the Human Immunology Core (University of Pennsylvania), were combined in a 1:1 ratio in complete medium (CM) supplemented with 100 IU / mL IL-2 (Prometheus Therapeutics and Diagnostics). On Day 0, the T cells were stimulated with anti- CD3 / CD28 Dynabeads (Invitrogen) at a 1:1 bead-to-cell ratio. After 24 hours (Day 1), T cells were transduced with FcIR-28z lentivirus at a multiplicity of infection (MOI) of 5. The culture volume was doubled daily by the addition of fresh CM until Day 6, at which point the Dynabeads were removed via magnetic separation. Cells were maintained at a concentration of 0.75 × 10⁶ cells / mL in IL-2 supplemented CM until Day 10, when IL-2 was withdrawn from the medium to complete the expansion process. The efficiency of T cell

[0109] 1084896-8944-3433, v. 1 transduction was assessed on Day 10 by flow cytometry, analyzing for the surface expression of FcIR. Cytotoxicity Assays. NS42 and patient-derived target cell lines were transduced with a pLC-luciferase-zsGreen-blasticidin plasmid and subsequently sorted for GFP-positive populations using fluorescence-activated cell sorting (FACS). Target cells were resuspended in serum-free complete medium (CM) at a concentration of 205 viable cells / mL, and 100 µL was plated per well in a white, opaque-walled, flat-bottom 96-well plate. Cells were cultured overnight at 37°C in 5% CO₂ to reach a confluency of approximately 70-80%. FcIR-28z effector cells were “painted” with the antibody 3F8 and its IgG2b isotype control at concentrations of 0, 0.001, 0.01, 0.1, and 1 µg / mL. The painting was performed at 37°C in 5% CO₂ for 45 minutes in PBS. Following incubation, effector cells were washed three times in PBS and resuspended in serum-free CM. To calculate the effector-to-target (E:T) ratio, three random target cell samples from each cell line were trypsinized and counted for live cells. Based on the counts, effector cells were added to the target cells at 3:1, 10:1, and 30:1 E:T ratios. The appropriate number of effector cells was resuspended in 100 µL of serum-free CM and added to the corresponding target cell groups. All conditions were tested in triplicate for each target cell line. Plates were centrifuged at 200g for 3 minutes and then incubated in a humidified incubator at 37°C with 5% CO₂ for 24 hours. Following incubation, 100 µL of medium was carefully removed from each well for further analysis. For luminescence-based viability assessment, D-luciferin was resuspended in PBS at 900 µg / mL, and 20 µL was added to each well to achieve a final concentration of 150 µg / mL. The plates were placed on an orbital shaker (GeneMate) at 500 rpm for 3 minutes in the dark, then incubated for an additional 3 minutes at 37°C and 5% CO₂. Luminescence readings were obtained using a microplate reader (BioTek Synergy H4), and cytotoxicity was calculated using the following formula: (1 - luminescence (effector + target cells) / luminescence(target cells)) x 100. Quantification and Statistical Analysis. RNA seq analyses. rMATS Turbo (v4.1.0) with GENCODE v39 GFF annotations was used to detect alternative splicing events. Paired comparisons were performed between each tumor sample and seven distinct control sets,

[0110] 1094896-8944-3433, v. 1 including brain homogenate (Clontech, #636643), brain stem (Agilent, #540053, adult), fetal brain (Clontech, #636526), cerebellum (Asterand, #63559-1156128F), and occipital cortex (Asterand, #38061-113046A4). Additionally, publicly available datasets were incorporated, including fetal brain (SRR4787052) and pediatric normal cortex (SRR7268790, SRR7268791, SRR7268792). Aberrant splicing events were filtered to retain those with ≥10 junction read counts. The filtered results served as the basis for all downstream analyses. For target discovery, we extracted all skipped exon (SE) splice events with a ΔPSI ≥ |0.30| or a ΔPSI ≥ 0.10 when the control PSI was <.10. Additionally, they had to meet significance thresholds (FDR and p-value of < 0.05) in all seven comparisons per tumor sample. We then generated BED files representing exons of interest and intersected them with UniProt protein domain topologies using Bedtools (v2.30.0), which allowed identification of exons corresponding to extracellular domains. Box plots were used to visualize splicing events altered in at least 40% of tumor samples, stratified by exon length into the following categories: 0–30 nt, 31–50 nt, 51–100 nt, and >100 nt. The plots were color-coded to denote splicing preference (i.e., inclusion or skipping). Scatter plots were generated using the ggscatter function to highlight microexons (<50 nucleotides). All downstream analyses were conducted using R v4.4.0, with plots generated using ggplot2 v3.5.1. For the analysis of isoform expression levels, FASTQ files corresponding to GTEx samples and brain cell subpopulations were downloaded, respectively, from dbGaP (accession number phs000424.v10.p2.c1) and GEO (Project GSE73721) using sratoolkit. Reads were aligned using STAR (46) 2-pass mapping to hg38 genome and GENCODE v39 version . Junction per million (JPM) was calculated by collating “uniquely mapped reads” column from the “SJ.out.tab” files from the STAR aligner output. Uniquely mapped reads were divided by the total number of reads per sample to normalize these splicing junctions for each sample. Orthotopic transplantations. In vivo data in Figure 4H represents a single study. However, considerable effort was expanded to minimize bias, with each replicate treated as a separate experiment. Specifically, each batch of pHGG cells (Empty vector, Full-length NRCAM, NRCAM Δex5Δex19) were harvested from 8 cell culture plates (3x8). We then

[0111] 1104896-8944-3433, v. 1 injected 8 mice per group. Both surgeries and orthotopic injections (24 in total) were performed not serially, but independently throughout the day.

[0112] 1114896-8944-3433, v. 1 Table 1 – Heavy Chain Sequences Amino acid sequence DNA sequence C G T G T T G C A G A Table 2 – Light Chain Sequences Amino acid sequence DNA sequence T A A A T G A T G A

[0113] 1124896-8944-3433, v. 1 Table 3 – Key Resources Table REAGENT OR RESOURCE SOURCE IDENTIFIER Antibodies - N- 91,

[0114] 1134896-8944-3433, v. 1 GTEx samples dbGAP phs000424.v10.p2 9 - m- - m- - 1-

[0115] 1144896-8944-3433, v. 1 NFASC exon 24 skipping / inclusion primers This paper N / A F- TTAACGGGACCAAAGTAGGAAAG (SEQ ID NO: 29) R- TCCATATGGACTGCTCATCAGGG (SEQ ID NO: 30) L1CAM exon 3 skipping / inclusion primers This paper N / A 4.1 ot AR

[0116] 1154896-8944-3433, v. 1 * * * * * * * * * * * * * * * * * All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this disclosure have been described in terms of particular embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the disclosure. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the disclosure as defined by the appended claims.

[0117] 1164896-8944-3433, v. 1 REFERENCES The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. Aggarwal, P., Luo, W., Pehlivan, K.C., Hoang, H., Rajappa, P., Cripe, T.P., Cassady, K.A., Lee, D.A., and Cairo, M.S. (2022). Pediatric versus adult high grade glioma: Immunotherapeutic and genomic considerations. Front Immunol 13, 1038096. doi.org / 10.3389 / fimmu.2022.1038096. Fine, H.A. (2024). Glioblastoma: Not Just Another Cancer. Cancer Discov 14, 648-652. doi.org / 10.1158 / 2159-8290.CD-23-1498. O'Rourke, D.M., Nasrallah, M.P., Desai, A., Melenhorst, J.J., Mansfield, K., Morrissette, J.J.D., Martinez-Lage, M., Brem, S., Maloney, E., Shen, A., et al. (2017). A single dose of peripherally infused EGFRvIII-directed CAR T cells mediates antigen loss and induces adaptive resistance in patients with recurrent glioblastoma. Sci Transl Med 9. doi.org / 10.1126 / scitranslmed.aaa0984. Choi, B.D., Gerstner, E.R., Frigault, M.J., Leick, M.B., Mount, C.W., Balaj, L., Nikiforow, S., Carter, B.S., Curry, W.T., Gallagher, K., and Maus, M.V. (2024). Intraventricular CARv3-TEAM-E T Cells in Recurrent Glioblastoma. N Engl J Med 390, 1290-1298. doi.org / 10.1056 / NEJMoa2314390. Ahmed, N., Brawley, V., Hegde, M., Bielamowicz, K., Kalra, M., Landi, D., Robertson, C., Gray, T.L., Diouf, O., Wakefield, A., et al. (2017). HER2-Specific Chimeric Antigen Receptor-Modified Virus-Specific T Cells for Progressive Glioblastoma: A Phase 1 Dose-Escalation Trial. JAMA Oncol 3, 1094-1101. doi.org / 10.1001 / jamaoncol.2017.0184. Brown, C.E., Alizadeh, D., Starr, R., Weng, L., Wagner, J.R., Naranjo, A., Ostberg, J.R., Blanchard, M.S., Kilpatrick, J., Simpson, J., et al. (2016). Regression of Glioblastoma after Chimeric Antigen Receptor T-Cell Therapy. N Engl J Med 375, 2561-2569. doi.org / 10.1056 / NEJMoa1610497. Chow, K.K., Naik, S., Kakarla, S., Brawley, V.S., Shaffer, D.R., Yi, Z., Rainusso, N., Wu, M.F., Liu, H., Kew, Y., et al. (2013). T cells redirected to EphA2 for the

[0118] 1174896-8944-3433, v. 1 immunotherapy of glioblastoma. Mol Ther 21, 629-637. doi.org / 10.1038 / mt.2012.210. Petersen, C.T., and Krenciute, G. (2019). Next Generation CAR T Cells for the Immunotherapy of High-Grade Glioma. Front Oncol 9, 69. doi.org / 10.3389 / fonc.2019.00069. Migliorini, D., Dietrich, P.Y., Stupp, R., Linette, G.P., Posey, A.D., Jr., and June, C.H. (2018). CAR T-Cell Therapies in Glioblastoma: A First Look. Clin Cancer Res 24, 535-540. doi.org / 10.1158 / 1078-0432.CCR-17-2871. Larson, R.C., and Maus, M.V. (2021). Recent advances and discoveries in the mechanisms and functions of CAR T cells. Nat Rev Cancer 21, 145-161. doi.org / 10.1038 / s41568- 020-00323-z. Maggs, L., Cattaneo, G., Dal, A.E., Moghaddam, A.S., and Ferrone, S. (2021). CAR T Cell- Based Immunotherapy for the Treatment of Glioblastoma. Front Neurosci 15, 662064. doi.org / 10.3389 / fnins.2021.662064. Patterson, J.D., Henson, J.C., Breese, R.O., Bielamowicz, K.J., and Rodriguez, A. (2020). CAR T Cell Therapy for Pediatric Brain Tumors. Front Oncol 10, 1582. doi.org / 10.3389 / fonc.2020.01582. Lin, Y.J., Mashouf, L.A., and Lim, M. (2022). CAR T Cell Therapy in Primary Brain Tumors: Current Investigations and the Future. Front Immunol 13, 817296. doi.org / 10.3389 / fimmu.2022.817296. Mount, C.W., Majzner, R.G., Sundaresh, S., Arnold, E.P., Kadapakkam, M., Haile, S., Labanieh, L., Hulleman, E., Woo, P.J., Rietberg, S.P., et al. (2018). Potent antitumor efficacy of anti-GD2 CAR T cells in H3-K27M(+) diffuse midline gliomas. Nat Med 24, 572-579. doi.org / 10.1038 / s41591-018-0006-x. Majzner, R.G., Ramakrishna, S., Yeom, K.W., Patel, S., Chinnasamy, H., Schultz, L.M., Richards, R.M., Jiang, L., Barsan, V., Mancusi, R., et al. (2022). GD2-CAR T cell therapy for H3K27M-mutated diffuse midline gliomas. Nature 603, 934-941. doi.org / 10.1038 / s41586-022-04489-4. Majzner, R.G., Theruvath, J.L., Nellan, A., Heitzeneder, S., Cui, Y., Mount, C.W., Rietberg, S.P., Linde, M.H., Xu, P., Rota, C., et al. (2019). CAR T Cells Targeting B7-H3, a Pan-Cancer Antigen, Demonstrate Potent Preclinical Activity Against Pediatric Solid

[0119] 1184896-8944-3433, v. 1 Tumors and Brain Tumors. Clin Cancer Res 25, 2560-2574. doi.org / 10.1158 / 1078- 0432.CCR-18-0432. Straathof, K., Flutter, B., Wallace, R., Jain, N., Loka, T., Depani, S., Wright, G., Thomas, S., Cheung, G.W., Gileadi, T., et al. (2020). Antitumor activity without on-target off- tumor toxicity of GD2-chimeric antigen receptor T cells in patients with neuroblastoma. Sci Transl Med 12. doi.org / 10.1126 / scitranslmed.abd6169. Ladenstein, R., Potschger, U., Valteau-Couanet, D., Luksch, R., Castel, V., Yaniv, I., Laureys, G., Brock, P., Michon, J.M., Owens, C., et al. (2018). Interleukin 2 with anti-GD2 antibody ch14.18 / CHO (dinutuximab beta) in patients with high-risk neuroblastoma (HR-NBL1 / SIOPEN): a multicentre, randomised, phase 3 trial. Lancet Oncol 19, 1617-1629. doi.org / 10.1016 / S1470-2045(18)30578-3. Du, H., Hirabayashi, K., Ahn, S., Kren, N.P., Montgomery, S.A., Wang, X., Tiruthani, K., Mirlekar, B., Michaud, D., Greene, K., et al. (2019). Antitumor Responses in the Absence of Toxicity in Solid Tumors by Targeting B7-H3 via Chimeric Antigen Receptor T Cells. Cancer Cell 35, 221-237 e228. doi.org / 10.1016 / j.ccell.2019.01.002. Vitanza, N.A., Wilson, A.L., Huang, W., Seidel, K., Brown, C., Gustafson, J.A., Yokoyama, J.K., Johnson, A.J., Baxter, B.A., Koning, R.W., et al. (2023). Intraventricular B7- H3 CAR T Cells for Diffuse Intrinsic Pontine Glioma: Preliminary First-in-Human Bioactivity and Safety. Cancer Discov 13, 114-131. doi.org / 10.1158 / 2159-8290.CD- 22-0750. Vitanza, N.A., Ronsley, R., Choe, M., Seidel, K., Huang, W., Rawlings-Rhea, S.D., Beam, M., Steinmetzer, L., Wilson, A.L., Brown, C., et al. (2025). Intracerebroventricular B7-H3-targeting CAR T cells for diffuse intrinsic pontine glioma: a phase 1 trial. Nature Medicine. doi.org / 10.1038 / s41591-024-03451-3. Labanieh, L., and Mackall, C.L. (2023). CAR immune cells: design principles, resistance and the next generation. Nature 614, 635-648. doi.org / 10.1038 / s41586-023-05707- 3. Wagner, J., Wickman, E., DeRenzo, C., and Gottschalk, S. (2020). CAR T Cell Therapy for Solid Tumors: Bright Future or Dark Reality? Mol Ther 28, 2320-2339. doi.org / 10.1016 / j.ymthe.2020.09.015.

[0120] 1194896-8944-3433, v. 1 Tousley, A.M., Rotiroti, M.C., Labanieh, L., Rysavy, L.W., Kim, W.J., Lareau, C., Sotillo, E., Weber, E.W., Rietberg, S.P., Dalton, G.N., et al. (2023). Co-opting signalling molecules enables logic-gated control of CAR T cells. Nature 615, 507-516. doi.org / 10.1038 / s41586-023-05778-2. Naqvi, A.S., Corbett, R.J., Seghal, P., Conkrite, K.L., Rathi, K.S., Ennis, B.M., Hayer, K.E., Zhang, B., Brown, M.A., Miller, D.P., et al. (2025). Characterization of aberrant splicing in pediatric central nervous system tumors reveals CLK1 as a candidate oncogenic dependency. bioRxiv. doi.org / 10.1101 / 2024.08.03.606419. Shapiro, J.A., Gaonkar, K.S., Spielman, S.J., Savonen, C.L., Bethell, C.J., Jin, R., Rathi, K.S., Zhu, Y., Egolf, L.E., Farrow, B.K., et al. (2023). OpenPBTA: The Open Pediatric Brain Tumor Atlas. Cell Genom 3, 100340. doi.org / 10.1016 / j.xgen.2023.100340. Wang, Y., Xie, Z., Kutschera, E., Adams, J.I., Kadash-Edmondson, K.E., and Xing, Y. (2024). rMATS-turbo: an efficient and flexible computational tool for alternative splicing analysis of large-scale RNA-seq data. Nat Protoc 19, 1083-1104. doi.org / 10.1038 / s41596-023-00944-2. Volfovsky, N., Haas, B.J., and Salzberg, S.L. (2003). Computational discovery of internal micro-exons. Genome Res 13, 1216-1221. doi.org / 10.1101 / gr.677503. Gonatopoulos-Pournatzis, T., and Blencowe, B.J. (2020). Microexons: at the nexus of nervous system development, behaviour and autism spectrum disorder. Curr Opin Genet Dev 65, 22-33. doi.org / 10.1016 / j.gde.2020.03.007. Irimia, M., Weatheritt, R.J., Ellis, J.D., Parikshak, N.N., Gonatopoulos-Pournatzis, T., Babor, M., Quesnel-Vallieres, M., Tapial, J., Raj, B., O'Hanlon, D., et al. (2014). A highly conserved program of neuronal microexons is misregulated in autistic brains. Cell 159, 1511-1523. doi.org / 10.1016 / j.cell.2014.11.035. Jbara, A., Lin, K.T., Stossel, C., Siegfried, Z., Shqerat, H., Amar-Schwartz, A., Elyada, E., Mogilevsky, M., Raitses-Gurevich, M., Johnson, J.L., et al. (2023). RBFOX2 modulates a metastatic signature of alternative splicing in pancreatic cancer. Nature 617, 147-153. doi.org / 10.1038 / s41586-023-05820-3. Li, J., Choi, P.S., Chaffer, C.L., Labella, K., Hwang, J.H., Giacomelli, A.O., Kim, J.W., Ilic, N., Doench, J.G., Ly, S.H., et al. (2018). An alternative splicing switch in FLNB

[0121] 1204896-8944-3433, v. 1 promotes the mesenchymal cell state in human breast cancer. Elife 7. doi.org / 10.7554 / eLife.37184. Head, S.A., Hernandez-Alias, X., Yang, J.S., Ciampi, L., Beltran-Sastre, V., Torres-Mendez, A., Irimia, M., Schaefer, M.H., and Serrano, L. (2021). Silencing of SRRM4 suppresses microexon inclusion and promotes tumor growth across cancers. PLoS Biol 19, e3001138. doi.org / 10.1371 / journal.pbio.3001138. Conn, V.M., Gabryelska, M., Marri, S., Stringer, B.W., Ormsby, R.J., Penn, T., Poonnoose, S., Kichenadasse, G., and Conn, S.J. (2020). SRRM4 Expands the Repertoire of Circular RNAs by Regulating Microexon Inclusion. Cells 9. doi.org / 10.3390 / cells9112488. Quesnel-Vallieres, M., Irimia, M., Cordes, S.P., and Blencowe, B.J. (2015). Essential roles for the splicing regulator nSR100 / SRRM4 during nervous system development. Genes Dev 29, 746-759. doi.org / 10.1101 / gad.256115.114. Mochizuki, Y., Funayama, R., Shirota, M., Kikukawa, Y., Ohira, M., Karasawa, H., Kobayashi, M., Ohnuma, S., Unno, M., and Nakayama, K. (2021). Alternative microexon splicing by RBFOX2 and PTBP1 is associated with metastasis in colorectal cancer. Int J Cancer 149, 1787-1800. doi.org / 10.1002 / ijc.33758. Li, Y.I., Sanchez-Pulido, L., Haerty, W., and Ponting, C.P. (2015). RBFOX and PTBP1 proteins regulate the alternative splicing of micro-exons in human brain transcripts. Genome Res 25, 1-13. doi.org / 10.1101 / gr.181990.114. Raj, B., Irimia, M., Braunschweig, U., Sterne-Weiler, T., O'Hanlon, D., Lin, Z.Y., Chen, G.I., Easton, L.E., Ule, J., Gingras, A.C., et al. (2014). A global regulatory mechanism for activating an exon network required for neurogenesis. Mol Cell 56, 90-103. doi.org / 10.1016 / j.molcel.2014.08.011. Morales, J., Pujar, S., Loveland, J.E., Astashyn, A., Bennett, R., Berry, A., Cox, E., Davidson, C., Ermolaeva, O., Farrell, C.M., et al. (2022). A joint NCBI and EMBL- EBI transcript set for clinical genomics and research. Nature 604, 310-315. doi.org / 10.1038 / s41586-022-04558-8. Aguet, F., Anand, S., Ardlie, K.G., Gabriel, S., Getz, G.A., Graubert, A., Hadley, K., Handsaker, R.E., Huang, K.H., Kashin, S., et al. (2020). The GTEx Consortium atlas of genetic regulatory effects across human tissues. Science 369, 1318-1330. doi.org / 10.1126 / science.aaz1776.

[0122] 1214896-8944-3433, v. 1 Quesnel-Vallieres, M., Jewell, S., Lynch, K.W., Thomas-Tikhonenko, A., and Barash, Y. (2024). MAJIQlopedia: an encyclopedia of RNA splicing variations in human tissues and cancer. Nucleic Acids Res 52, D213-D221. doi.org / 10.1093 / nar / gkad1043. Vaquero-Garcia, J., Aicher, J.K., Jewell, S., Gazzara, M.R., Radens, C.M., Jha, A., Norton, S.S., Lahens, N.F., Grant, G.R., and Barash, Y. (2023). RNA splicing analysis using heterogeneous and large RNA-seq datasets. Nat Commun 14, 1230. doi.org / 10.1038 / s41467-023-36585-y. Vivian, J., Rao, A.A., Nothaft, F.A., Ketchum, C., Armstrong, J., Novak, A., Pfeil, J., Narkizian, J., Deran, A.D., Musselman-Brown, A., et al. (2017). Toil enables reproducible, open source, big biomedical data analyses. Nat Biotechnol 35, 314- 316. doi.org / 10.1038 / nbt.3772. Goldman, M.J., Craft, B., Hastie, M., Repecka, K., McDade, F., Kamath, A., Banerjee, A., Luo, Y., Rogers, D., Brooks, A.N., et al. (2020). Visualizing and interpreting cancer genomics data via the Xena platform. Nat Biotechnol 38, 675-678. doi.org / 10.1038 / s41587-020-0546-8. Zhang, Y., Sloan, S.A., Clarke, L.E., Caneda, C., Plaza, C.A., Blumenthal, P.D., Vogel, H., Steinberg, G.K., Edwards, M.S., Li, G., et al. (2016). Purification and Characterization of Progenitor and Mature Human Astrocytes Reveals Transcriptional and Functional Differences with Mouse. Neuron 89, 37-53. doi.org / 10.1016 / j.neuron.2015.11.013. Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., and Gingeras, T.R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21. doi.org / 10.1093 / bioinformatics / bts635. Torres-Diz, M., Reglero, C., Falkenstein, C.D., Castro, A., Hayer, K.E., Radens, C.M., Quesnel-Vallieres, M., Ang, Z., Sehgal, P., Li, M.M., et al. (2024). An Alternatively Spliced Gain-of-Function NT5C2 Isoform Contributes to Chemoresistance in Acute Lymphoblastic Leukemia. Cancer Res 84, 3327-3336. doi.org / 10.1158 / 0008- 5472.CAN-23-3804. Liu, Z., Zhu, C., Steinmetz, L.M., and Wei, W. (2023). Identification and quantification of small exon-containing isoforms in long-read RNA sequencing data. Nucleic Acids Res 51, e104. doi.org / 10.1093 / nar / gkad810.

[0123] 1224896-8944-3433, v. 1 Robinson, J.T., Thorvaldsdottir, H., Wenger, A.M., Zehir, A., and Mesirov, J.P. (2017). Variant Review with the Integrative Genomics Viewer. Cancer Res 77, e31-e34. doi.org / 10.1158 / 0008-5472.CAN-17-0337. Gao, Y., Wang, F., Wang, R., Kutschera, E., Xu, Y., Xie, S., Wang, Y., Kadash-Edmondson, K.E., Lin, L., and Xing, Y. (2023). ESPRESSO: Robust discovery and quantification of transcript isoforms from error-prone long-read RNA-seq data. Sci Adv 9, eabq5072. doi.org / 10.1126 / sciadv.abq5072. Sharon, D., Tilgner, H., Grubert, F., and Snyder, M. (2013). A single-molecule long-read survey of the human transcriptome. Nat Biotechnol 31, 1009-1014. doi.org / 10.1038 / nbt.2705. Au, K.F., Sebastiano, V., Afshar, P.T., Durruthy, J.D., Lee, L., Williams, B.A., van Bakel, H., Schadt, E.E., Reijo-Pera, R.A., Underwood, J.G., and Wong, W.H. (2013). Characterization of the human ESC transcriptome by hybrid sequencing. Proc Natl Acad Sci U S A 110, E4821-4830. doi.org / 10.1073 / pnas.1320101110. Byrne, A., Beaudin, A.E., Olsen, H.E., Jain, M., Cole, C., Palmer, T., DuBois, R.M., Forsberg, E.C., Akeson, M., and Vollmers, C. (2017). Nanopore long-read RNAseq reveals widespread transcriptional variation among the surface receptors of individual B cells. Nat Commun 8, 16027. doi.org / 10.1038 / ncomms16027. Karlsson, K., and Linnarsson, S. (2017). Single-cell mRNA isoform diversity in the mouse brain. BMC Genomics 18, 126. doi.org / 10.1186 / s12864-017-3528-6. Gupta, I., Collier, P.G., Haase, B., Mahfouz, A., Joglekar, A., Floyd, T., Koopmans, F., Barres, B., Smit, A.B., Sloan, S.A., et al. (2018). Single-cell isoform RNA sequencing characterizes isoforms in thousands of cerebellar cells. Nat Biotechnol 36, 1197–1202. doi.org / 10.1038 / nbt.4259. Hardwick, S.A., Hu, W., Joglekar, A., Fan, L., Collier, P.G., Foord, C., Balacco, J., Lanjewar, S., Sampson, M.M., Koopmans, F., et al. (2022). Single-nuclei isoform RNA sequencing unlocks barcoded exon connectivity in frozen brain tissue. Nat Biotechnol 40, 1082-1092. doi.org / 10.1038 / s41587-022-01231-3. Hu, W., Foord, C., Hsu, J., Fan, L., Corley, M.J., Bhatia, T.N., Xu, S., Belchikov, N., He, Y., Pang, A.P., et al. (2024). ScISOr-ATAC reveals convergent and divergent splicing and chromatin specifici...

Claims

WHAT IS CLAIMED:

1. An isolated nucleic acid molecule encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain, a flexible hinge domain, a transmembrane domain, a costimulatory signaling region, and an intracellular signaling domain, and wherein the antigen binding domain binds selectively to NRCAM.

2. The isolated nucleic acid molecule of claim 1, wherein the antigen binding domain comprises an antibody or an antigen-binding fragment thereof.

3. The isolated nucleic acid molecule of claim 2, wherein the antigen-binding fragment is a Fab, a single-chain variable fragment (scFv), or a single-domain antibody.

4. The isolated nucleic acid molecule of any one of claims 1-3, wherein the encoded antigen binding domain comprises a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 1 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO:

9.

5. The isolated nucleic acid molecule of any one of claims 1-3, wherein the encoded antigen binding domain comprises a heavy chain variable domain including a CDR1 comprising the amino acid sequence of SEQ ID NO: 3, a CDR2 comprising the amino acid sequence of SEQ ID NO: 5, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7, and a light chain variable domain including a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of FAS, and a CDR3 comprising the amino acid sequence of SEQ ID NO:

13.

6. The isolated nucleic acid molecule of any one of claims 1-3 or 5, wherein the encoded antigen binding domain comprises a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 1, or having 85%, 90%, 95% or 99% sequence identity to SEQ ID NO: 1, and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 9, or having 85%, 90%, 95% or 99% sequence identity to SEQ ID NO: 9; and optionally the C-terminus of the light chain variable domain is fused to the N-terminus of a heavy chain variable domain by a flexible linker.1304896-8944-3433, v.

17. The isolated nucleic acid molecule of claim 6, wherein the linker is a peptide linker.

8. The isolated nucleic acid molecule of claim 7, wherein the peptide linker is at least 15 amino acids in length.

9. The isolated nucleic acid molecule of claim 8, wherein the peptide linker is a glycine- serine linker.

10. The isolated nucleic acid molecule of any one of claims 1-9 wherein: (a) the flexible hinge domain is from CD8α, CD28, or an immunoglobulin (Ig), (b) the transmembrane domain comprises CD28 transmembrane domain, (c) the costimulatory signaling region comprises a domain from CD28, 41BB (CD137), OX40, or ICOS, and (d) the intracellular signaling domain comprises a CD3-zeta domain or a high affinity FcεRI.

11. A chimeric antigen receptor (CAR) polypeptide, wherein: (a) the CAR comprises an antigen binding domain, a flexible hinge domain, a transmembrane domain, a costimulatory signaling region, and an intracellular signaling domain; and (b) the antigen binding domain binds selectively to cancer cell-associated NRCAM.

12. The chimeric antigen receptor polypeptide of claim 11, wherein the antigen-binding fragment is a Fab, a single-chain variable fragment (scFv), or a single-domain antibody.

13. The chimeric antigen receptor (CAR) polypeptide of claim 11 or claim 12, wherein the antigen binding domain comprises a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 1, or having 85%, 90%, 95% or 99% sequence identity to SEQ ID NO: 1, and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 9, or having 85%, 90%, 95% or 99% sequence identity to SEQ ID NO: 9.1314896-8944-3433, v.

114. The chimeric antigen receptor (CAR) polypeptide of any one of claims 11-13, wherein the antigen binding domain comprises a heavy chain variable domain including a CDR1 comprising the amino acid sequence of SEQ ID NO: 3, a CDR2 comprising the amino acid sequence of SEQ ID NO: 5, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7, and a light chain variable domain including a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of FAS, and a CDR3 comprising the amino acid sequence of SEQ ID NO:

13.

15. The chimeric antigen receptor polypeptide of any one of claims 11-14, wherein the antigen binding domain comprises a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 1 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 9; and the C-terminus of the light chain variable domain is fused to the N-terminus of a heavy chain variable domain by a flexible linker.

16. A genetically modified T cell comprising a nucleic acid sequence encoding a chimeric antigen receptor (CAR), or a genetically modified T cell comprising the isolated nucleic acid molecule of any one of claims 1-10, or expressing the chimeric antigen receptor of any one of claims 11-15. 17 A method of making a genetically modified T cell comprising transducing the immune effector cell with the chimeric antigen receptor of any one of claims 11-15.

18. A method of providing anti-tumor immunity in a mammalian subject, such as a human, comprising administering to the mammal an effective amount of a population of genetically modified T cells of claim 16.

19. A method of treating a mammalian subject, such as a human, having cancer comprising administering to the mammal an effective amount of a population of genetically modified T cells of claim 16.

20. The method of claim 19, wherein the cancer is wherein said solid tumor cell, such as a lung cancer cell, brain cancer cell, head & neck cancer cell, breast cancer cell, skin cancer cell, liver cancer cell (such as hepatocellular carcinoma), pancreatic cancer cell, stomach cancer cell, colon cancer cell, rectal cancer cell, uterine cancer cell, cervical cancer cell, ovarian cancer cell, testicular cancer cell, skin cancer cell, or esophageal cancer cell, or is a1324896-8944-3433, v. 1leukemia cell or a myeloma cell, such as an acute myeloid leukemia cell, a chronic myelogenous leukemia cell or a multiple myeloma cell, or is selected from the group consisting of sarcoma cell, a rhabdoid cancer cell, a neuroblastoma cell, retinoblastoma cell, or a medulloblastoma cell, uterine carcinosarcoma (UCS), brain lower grade glioma (LGG), thymoma (THYM), testicular germ cell tumors (TGCT), glioblastoma multiforme (GBM) and skin cutaneous melanoma (SKCM), liver hepatocellular carcinoma (LIHC), uveal melanoma (UVM), kidney chromophobe (KICH), thyroid cancer (THCA), kidney renal clear cell carcinoma (KIRC), kidney renal papillary cell carcinoma (KIRP), stomach adenocarcinoma (STAD), cholangiocarcinoma (CHOL), adenoid cystic carcinoma (ACC), prostate adenocarcinoma (PRAD), pheochromocytoma and paraganglioma (PCPG), DLBC, lung adenocarcinoma (LUAD), head-neck squamous cell carcinoma (HNSC), pancreatic adenocarcinoma (PAAD), breast cancer (BRCA), mesothelioma (MESO), colon and rectal adenocarcinoma (COAD). rectum adenocarcinoma (READ), esophageal carcinoma (ESCA), ovarian cancer (OV), lung squamous cell carcinoma (LUSC), bladder urothelial carcinoma (BLCA), sarcoma (SARC), uterine corpus endometrial carcinoma (UCEC), or pediatric high-grade glioma (pHGG).

21. An antibody or fragment thereof that binds selectively to NRCAM, wherein said antibody comprises a variable heavy chain comprising CDR1, CDR2 and CDR3 regions of SEQ ID NOS: 3, 5, and 7, and a variable light chain comprising CDR1, CDR2 and CDR3 regions comprising SEQ ID NO: 11, the sequence FAS, and SEQ ID NO: 13, respectively.

22. The antibody or fragment thereof of claim 21, comprising a variable heavy chain having the sequence of SEQ ID NO: 1, and a variable light chain having the sequence of SEQ ID NO: 9, respectively.

23. The antibody or fragment thereof of claim 21 or claim 22, wherein said antibody is a single chain antibody, a single domain antibody, a bispecific antibody or a chimeric antibody.

24. The antibody or fragment thereof of any one of claims 21-23, wherein said antibody fragment is a Fab fragment.1334896-8944-3433, v.

125. The antibody or fragment thereof of any one of claims 21-24, wherein said antibody is a recombinant antibody having specificity for the NRCAM and a distinct cancer cell surface antigen.

26. The antibody or fragment thereof of any one of claims 21-25, wherein said antibody is murine antibody, an IgG, a humanized antibody, or a humanized IgG antibody.

27. The antibody or fragment thereof of any one of claims 21-26, wherein said antibody or fragment thereof further comprises a label, such as a peptide tag, an enzyme, a magnetic particle, a chromophore, a fluorescent molecule, a chemilluminescent molecule, or a dye, or further comprises an antitumor drug linked thereto, such as a toxin, a radioisotope, a cytokine or an enzyme.

28. The antibody or fragment thereof of any one of claims 21 or 23-27, wherein said heavy light chain has 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 1, and said variable light chain has 80%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 9, respectively.

29. The antibody or fragment thereof of any one of claims 21-28, wherein said heavy and light chains are encoded by nucleic acids having 85%, 90%, 95%. 99% or 100% sequence identity to SEQ ID NO: 2 and SEQ ID NO: 10, respectively.

30. The antibody or fragment thereof of any one of claims 21-29, wherein said antibody or fragment thereof is conjugated to a nanoparticle or a liposome.

31. A method of treating a NRCAM-positive cancer cell in a subject, such as a mammalian or human subject, comprising administering to said subject the antibody or fragment thereof of any one of claims 21-30.

32. The method of claim 31 wherein the cancer is wherein said solid tumor cell, such as a lung cancer cell, brain cancer cell, head & neck cancer cell, breast cancer cell, skin cancer cell, liver cancer cell (such as hepatocellular carcinoma), pancreatic cancer cell, stomach cancer cell, colon cancer cell, rectal cancer cell, uterine cancer cell, cervical cancer cell, ovarian cancer cell, testicular cancer cell, skin cancer cell, or esophageal cancer cell, or is a leukemia cell or a myeloma cell, such as an acute myeloid leukemia cell, a chronic1344896-8944-3433, v. 1myelogenous leukemia cell or a multiple myeloma cell, or is selected from the group consisting of sarcoma cell, a rhabdoid cancer cell, a neuroblastoma cell, retinoblastoma cell, or a medulloblastoma cell, uterine carcinosarcoma (UCS), brain lower grade glioma (LGG), thymoma (THYM), testicular germ cell tumors (TGCT), glioblastoma multiforme (GBM) and skin cutaneous melanoma (SKCM), liver hepatocellular carcinoma (LIHC), uveal melanoma (UVM), kidney chromophobe (KICH), thyroid cancer (THCA), kidney renal clear cell carcinoma (KIRC), kidney renal papillary cell carcinoma (KIRP), stomach adenocarcinoma (STAD), cholangiocarcinoma (CHOL), adenoid cystic carcinoma (ACC), prostate adenocarcinoma (PRAD), pheochromocytoma and paraganglioma (PCPG), DLBC, lung adenocarcinoma (LUAD), head-neck squamous cell carcinoma (HNSC), pancreatic adenocarcinoma (PAAD), breast cancer (BRCA), mesothelioma (MESO), colon and rectal adenocarcinoma (COAD). rectum adenocarcinoma (READ), esophageal carcinoma (ESCA), ovarian cancer (OV), lung squamous cell carcinoma (LUSC), bladder urothelial carcinoma (BLCA), sarcoma (SARC), uterine corpus endometrial carcinoma (UCEC), or pediatric high-grade glioma (pHGG).

33. The method of claim 31 or claim 32, further comprising contacting said NRCAM- positive cancer cell with a second anti-cancer agent or treatment.

34. The method of claim 33, wherein said second anti-cancer agent or treatment is chemotherapy, radiotherapy, immunotherapy, hormonal therapy, or toxin therapy.

35. The method of claim 33, wherein said second anti-cancer agent or treatment is given at the same time as said first agent or is given before and / or after said first agent.

36. The method of any one of claim 31-35, wherein said NRCAM-positive cancer cell is a metastatic cancer cell, a multiply drug-resistant cancer cell or a recurrent cancer cell.

37. A method of diagnosing a NRCAM-positive cancer in a subject comprising contacting the subject or a cell-containing sample therefrom with the antibody or fragment thereof of any one of claims 21-30.

38. The method of claim 37, further comprising administering to said subject an anti- cancer agent or treatment.1354896-8944-3433, v.

139. The method of claim 37 or claim 38, wherein said cell-containing sample is a solid tissue sample, such as a biopsy, or wherein said cell-containing sample is a fluid sample, such as urine, semen, sputum, saliva, nipple aspirate, or blood.

40. A pharmaceutical formulation comprising the genetically modified cell of claim 16, or the antibody or fragment thereof of any one of claims 21-30 and a pharmaceutically acceptable carrier, buffer or diluent.1364896-8944-3433, v. 1

Citation Information

Patent Citations

  • Anti-MS4A4A antibodies and methods of use thereof

    US11472874B2

  • Regulatable chimeric antigen receptor

    US20160311907A1

  • Anti-CD79b Antibodies, Drug Conjugates, and Applications Thereof

    US20210388082A1

  • Use of brain-specific antigens to home, block and deliver cell-based treatments to the brain

    US20230055337A1

  • Anti-CLDN6 antibody and use thereof

    US20240150455A1