Detection of target nucleic acid by competitive hybrid-based signaling assay

The method using a labeled oligonucleotide and competing oligonucleotide forms competitive hybrids with different melting temperatures, allowing for efficient and accurate detection of multiple nucleic acids in real-time without complex calculations.

WO2026071688A1PCT designated stage Publication Date: 2026-04-02SEEGENE INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-24
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Conventional real-time detection methods for nucleic acids can only detect a limited number of targets using a single label, leading to inaccurate results due to the need for signal difference calculations and requiring multiple compositions for simultaneous detection of multiple targets.

Method used

A method utilizing a labeled oligonucleotide (LO) and a competing oligonucleotide (CO) to form two hybrids with different melting temperatures, enabling detection of multiple nucleic acids using a single label by generating a target signal through competitive hybridization, with a melting profile that includes a signal-changing and two signal-constant temperature ranges.

Benefits of technology

Enables accurate and efficient detection of multiple nucleic acids in real-time by reducing analysis time and eliminating the need for signal difference calculations, while using a single label and controlling signal-change temperature ranges.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025014941_02042026_PF_FP_ABST
    Figure KR2025014941_02042026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a method for detecting a target nucleic acid in a sample by means of a competitive hybrid-based signaling assay. The method can be usefully employed to detect a single or a plurality of target nucleic acids by utilizing the competitive formation of a first hybrid compound and a second hybrid compound.
Need to check novelty before this filing date? Find Prior Art

Description

Detection of target nucleic acids by competitive hybridization-based signaling assays

[0001] Cross-reference regarding related applications

[0002] This application claims priority to Korean Patent Application No. 10-2024-0130945 filed on September 26, 2024, the contents of which are incorporated herein by reference in their entirety.

[0003] Technology field

[0004] The present disclosure relates to the detection of a target nucleic acid (TNA) by a Competitive Hybrids-based Signaling Assay (CHYSA).

[0005]

[0006] For the detection of target nucleic acids (TNAs), real-time detection methods capable of detecting target nucleic acids while monitoring target amplification in real time are widely used. Real-time detection methods generally utilize labeled probes or primers that specifically hybridize with the target nucleic acid.

[0007] Examples of methods utilizing hybridization between a labeled probe and a target nucleic acid include the molecular beacon method using a double-labeled probe having a hairpin structure (Tyagi et al., Nature Biotechnology v.14 MARCH 1996), the HyBeacon method (French DJ et al., Mol. Cell Probes, 15(6):363-374(2001)), the hybridization probe method using two probes labeled as a donor and an acceptor, respectively (Bernad et al., 147-148 Clin Chem 2000; 46), and the Lux method using a single-labeled oligonucleotide (U.S. Patent No. 7,537,886). The TaqMan method (U.S. Patents No. 5,210,015 and 5,538,848), which utilizes a double-labeled probe and the cleavage of the probe by the 5'-nuclease activity of DNA polymerase, is widely used in the art.

[0008] Examples of methods using labeled primers include the Sunrise primer method (Nazarenko et al., 2516-2521 Nucleic Acids Research, 1997, v.25 no.12, and U.S. Patent No. 6,117,635), the Scorpion primer method (Whitcombe et al., 804-807, Nature Biotechnology v.17 AUGUST 1999 and U.S. Patent No. 6,326,145), and the TSG primer method (WO 2011-078441).

[0009] Conventional real-time detection technologies can detect only one target nucleic acid using a single label, so the number of target nucleic acids that can be simultaneously detected in a single reaction is limited by the number of available labels (e.g., 5 or fewer).

[0010] To improve this, U.S. Patent Publication No. 2017-0247750 disclosed a method for simultaneously detecting two targets using a single label. According to the method, signals for two target nucleic acids are generated at a low detection temperature, and signals for one target nucleic acid are generated at a high detection temperature; the presence of one target nucleic acid is determined by the signal measured at the high detection temperature, and the presence of another target nucleic acid is determined by the difference between the signal measured at the low detection temperature and the signal measured at the high detection temperature. However, the method requires the calculation of the difference between the signal measured at the low detection temperature and the signal measured at the high detection temperature, which may lead to inaccurate results due to incorrect calculation.

[0011] Additionally, International Application Publication No. WO 2022-265463 discloses a method capable of simultaneously detecting two targets using a single label. This method enables the determination of the presence of a single target nucleic acid from the signal detected at each detection temperature by causing a signal for a single target nucleic acid to be generated at each detection temperature. Since this method does not require the calculation of differences between signals as disclosed in U.S. Patent Publication No. 2017-0247750, it has the advantage of being very simple and capable of obtaining accurate results. However, for the efficient implementation of this method, compositions that generate signals in various ways, such as UnderSC-, InterSC-, and OverSC- type compositions, are required.

[0012]

[0013] Throughout this specification, numerous patents and documents are referenced and their citations are indicated in parentheses. The disclosures of these patents and documents are incorporated by reference in their entirety into this specification to more clearly explain the level of the art to which the invention pertains and the content of the invention.

[0014]

[0015] The inventors have made diligent research efforts to develop a novel method for detecting target nucleic acids in real time with improved convenience and high efficiency. In particular, the inventors have endeavored to develop a method capable of detecting multiple target nucleic acid sequences using a single type of label. As a result, the inventors have established a novel protocol for detecting target nucleic acids by generating two competitive hybrids using a competitive oligonucleotide (CO) and a labeled oligonucleotide (LO). The protocol according to the present disclosure has improved accuracy and convenience and can detect not only a single target nucleic acid but also multiple target nucleic acids.

[0016] Accordingly, the object of the present disclosure is to provide a method for detecting a target nucleic acid in a sample by a Competitive Hybrids-based Signaling Assay (CHYSA).

[0017] Another object of the present disclosure is to provide a composition for detecting a target nucleic acid in a sample by a competitive hybridization-based signaling assay.

[0018] Another object of the present disclosure is to provide a method for detecting n target nucleic acids in a sample by a competitive hybridization-based signaling assay.

[0019] Other objects and advantages of the present disclosure will become more apparent from the following detailed description together with the appended claims.

[0020]

[0021] According to one aspect of the present disclosure, a method for detecting a target nucleic acid (TNA) in a sample by a Competitive Hybrids-based Signaling Assay (CHYSA) is provided, comprising the following steps:

[0022] (a) a step of contacting a sample suspected of containing TNA with a composition for detecting TNA,

[0023] The above composition is

[0024] (i) a labeled oligonucleotide (LO) comprising a nucleotide sequence hybridizable with the nucleic acid generated dependently on the presence of the TNA or the above, and a label attached thereto, and

[0025] (ii) comprising a competing oligonucleotide (CO) having a nucleotide sequence that is hybridizable with the LO and competes with the nucleic acid generated dependently on the presence of the TNA or in hybridization with the LO, and

[0026] The above LO can generate a background signal by forming a first hybridized compound through hybridization with the above CO, and the above LO can also generate a target signal by forming a second hybridized compound through hybridization with the above TNA or a nucleic acid generated dependent on the presence thereof.

[0027] The melting temperature (Tm1) of the first hybrid compound and the melting temperature (Tm2) of the second hybrid compound are different, and the formation of the hybrid compound having a higher melting temperature among the first and second hybrid compounds is competitively advantageous compared to the formation of the hybrid compound having a lower melting temperature.

[0028] (b) a step of performing an amplification reaction for the TNA under amplification conditions,

[0029] As the amplification reaction proceeds, the formation of the second hybrid increases, thereby providing a target signal, and

[0030] (c) A step of detecting the target signal, wherein the detected target signal indicates the presence of the TNA.

[0031] In a specific embodiment, the LO has a reporter moiety and a quencher moiety positioned to generate a signal when the first hybrid and the second hybrid are formed.

[0032] In a specific embodiment, prior to the formation of the first hybrid or the second hybrid, the reporter moiety and the quencher moiety on the LO are in close proximity to each other so that the quencher moiety quenches the signal from the reporter moiety, whereas upon the formation of the first hybrid or the second hybrid, the reporter moiety and the quencher moiety on the LO are spatially separated from each other so that the quencher moiety unquenches the signal from the reporter moiety.

[0033] In a specific embodiment, the LO has a single label positioned to generate a signal upon the formation of the first hybrid and the second hybrid.

[0034] In a specific embodiment, the CO has a nucleotide sequence of different length and / or different bases compared to the TNA or nucleic acid generated dependently on its presence.

[0035] In a specific embodiment, the CO comprises one or more non-complementary bases or universal bases for the LO.

[0036] In a specific embodiment, the universal base is deoxyinosine.

[0037] In a specific embodiment, the CO has a shorter length than the LO.

[0038] In a specific embodiment, the Tm1 is at least 3°C ​​lower than the Tm2.

[0039] In a specific embodiment, the 3'-ends of the CO and LO are blocked so as not to be extended.

[0040] In a specific embodiment, the amplification reaction for the TNA is real-time PCR.

[0041] In a specific embodiment, the composition further comprises a primer oligonucleotide (PO) for amplifying TNA.

[0042] In a specific embodiment, the composition exhibits a melting profile having one Signal-Changing Temperature Range (SChTR) in which the signal changes depending on the presence of TNA and two Signal-Constant Temperature Ranges (SCoTR) in which the signal remains constant despite the presence of TNA.

[0043] In a specific embodiment, the signal-change temperature range is higher than the first signal-constant temperature range among the two signal-constant temperature ranges and lower than the second signal-constant temperature range among the two signal-constant temperature ranges.

[0044] In a specific embodiment, during the amplification reaction, (i) when TNA is absent in the sample, only the first hybrid is formed to generate a background signal, and (ii) when TNA is present in the sample, the second hybrid is formed to generate a target signal.

[0045] In a specific embodiment, detection of the target signal is performed at a temperature favorable for either the first hybrid and the second hybrid to dissociate into two single strands while the other remains a double strand.

[0046] In a specific embodiment, detection of the target signal is not performed at a temperature favorable for both the first hybrid and the second hybrid to dissociate into two single strands or to maintain a double strand.

[0047] In a specific embodiment, detection of the target signal is performed at a temperature between Tm1 and Tm2.

[0048] In a specific embodiment, detection of the target signal is performed by comparing the signal detected during the amplification reaction with the background signal.

[0049] In a specific embodiment, the nucleic acid generated dependently on the presence of the TNA is the first extended strand (First Extended Strand, First ES) generated by the following step:

[0050] (a3) A step of hybridizing a nucleic acid fragment generated from hybridization between TNA and an additional oligonucleotide with a Capturing and Templating Oligonucleotide (CTO);

[0051] The above CTO comprises, in the 3' to 5' direction: (i) a capturing site comprising a nucleotide sequence capable of hybridizing with the nucleic acid fragment, and (ii) a templating site comprising a nucleotide sequence not hybridizing with the nucleic acid fragment, and the CTO does not include a label,

[0052] The above nucleic acid fragment hybridizes with the capturing site of the CTO, and

[0053] (a4) A step of generating a first ES by extending the nucleic acid fragment hybridized with the capturing site of the CTO along the templating site of the CTO using a DNA polymerase having 5' nuclease activity.

[0054] In a specific embodiment, the LO has a nucleotide sequence capable of hybridizing with the portion of the first ES excluding the PTO fragment.

[0055] In a specific embodiment, the nucleic acid generated dependently on the presence of the TNA is a second extended strand (second ES) generated by the following step:

[0056] (a3) A step of hybridizing a nucleic acid fragment generated from hybridization between TNA and an additional oligonucleotide with a Capturing and Templating Oligonucleotide (CTO);

[0057] The above CTO comprises, in the 3' to 5' direction: (i) a capturing site comprising a nucleotide sequence capable of hybridizing with the nucleic acid fragment, and (ii) a templating site comprising a nucleotide sequence not hybridizing with the nucleic acid fragment, and the CTO does not include a label,

[0058] The above nucleic acid fragment hybridizes with the capturing site of the CTO, and

[0059] (a4) A step of generating a first ES by extending the nucleic acid fragment hybridized with the capturing site of the CTO along the templating site of the CTO using a DNA polymerase having 5' nuclease activity.

[0060] (a5) A step of hybridizing a portion of the first ES with the LO;

[0061] The LO comprises (i) a capturing site comprising a nucleotide sequence capable of hybridizing with the first ES and (ii) a templating site comprising a nucleotide sequence not hybridizing with the first ES, and

[0062] The above first ES is hybridized with the capturing portion of the LO;

[0063] (a6) A step of generating a second ES by extending the first ES hybridized with the capturing site of the LO along the templating site of the LO using a DNA polymerase having 5' nuclease activity.

[0064] In a specific embodiment, the LO has a nucleotide sequence capable of hybridizing with the portion of the second ES excluding the PTO fragment.

[0065] In a specific embodiment, the nucleic acid fragment is generated by the following step:

[0066] (a1) A step of hybridizing the above TNA with a primer oligonucleotide (PO) and a probing and tagging oligonucleotide (PTO);

[0067] The above PO comprises a nucleotide sequence capable of hybridizing with the first region of TNA, and

[0068] The above PTO comprises, in the 5' to 3' direction: (i) a 5'-tagging site comprising a nucleotide sequence that does not hybridize with TNA, and (ii) a 3'-targeting site comprising a nucleotide sequence capable of hybridizing with a second region of TNA, and

[0069] The first region of the TNA is located toward the 3'-end of the second region, and

[0070] (a2) A step of contacting the product of step (a) with a DNA polymerase having 5' nuclease activity under conditions for cleavage of PTO;

[0071] The above PO induces the cleavage of PTO by a DNA polymerase having 5' nuclease activity, thereby releasing a PTO fragment containing the 5'-tagging portion of the PTO, and

[0072] The above PTO fragment is a nucleic acid fragment generated from the hybridization between TNA and PTO as an additional oligonucleotide.

[0073] In a specific embodiment, the 3'-ends of the PTO and CTO are blocked so as not to be extended.

[0074] In a specific embodiment, the PO is close enough to the PTO to induce cleavage of the PTO by a DNA polymerase having 5' nuclease activity.

[0075] In a specific embodiment, the PO induces cleavage of the PTO by a DNA polymerase having 5' nuclease activity through its extension.

[0076] According to another aspect, a composition for detecting a target nucleic acid (TNA) in a sample by a Competitive Hybrids-based Signaling Assay (CHYSA) is provided, comprising:

[0077] (i) a labeled oligonucleotide (LO) comprising a nucleotide sequence hybridizable with the nucleic acid generated dependently on the presence of the TNA or the above, and a label attached thereto, and

[0078] (ii) comprising a competing oligonucleotide (CO) having a nucleotide sequence that is hybridizable with the LO and competes with the nucleic acid generated dependently on the presence of the TNA or in hybridization with the LO, and

[0079] The above LO can generate a background signal by forming a first hybridized compound through hybridization with the above CO, and the above LO can also generate a target signal by forming a second hybridized compound through hybridization with the above TNA or a nucleic acid generated dependent on the presence thereof.

[0080] A composition in which the melting temperature (Tm1) of the first hybrid and the melting temperature (Tm2) of the second hybrid are different, and the formation of the hybrid having a higher melting temperature among the first and second hybrids is competitively advantageous than the formation of the hybrid having a lower melting temperature.

[0081] In a specific embodiment, the composition exhibits a melting profile having one Signal-Changing Temperature Range (SChTR) in which the signal changes depending on the presence of TNA and two Signal-Constant Temperature Ranges (SCoTR) in which the signal remains constant despite the presence of TNA.

[0082] In a specific embodiment, the signal-change temperature range is higher than the first signal-constant temperature range among the two signal-constant temperature ranges and lower than the second signal-constant temperature range among the two signal-constant temperature ranges.

[0083] According to another aspect, a method for detecting n target nucleic acids (TNA) in a sample is provided, comprising the following steps:

[0084] (a) incubating n compositions for detecting n TNAs in a reaction vessel together with a sample suspected of containing at least one of n TNAs, and detecting a signal at n detection temperatures during the incubation;

[0085] Here, n is an integer greater than or equal to 2, and

[0086] Here, the incubation includes a plurality of reaction cycles, and the detection of the signal is performed in at least one of the plurality of reaction cycles, and

[0087] Here, each of the n compositions for detecting the n TNAs provides a signal change at a corresponding detection temperature among the n detection temperatures in the presence of the corresponding TNA, and the signal change indicates the presence of the corresponding TNA.

[0088] Here, among n compositions for detecting n TNAs, the composition for detecting the i-th TNA provides a signal change at the i-th detection temperature among n detection temperatures in the presence of the i-th TNA, and provides a constant signal at other detection temperatures.

[0089] Here, i represents an integer from 1 to n, the i-th detected temperature is lower than the i+1-th detected temperature, and

[0090] Here, within a temperature range covering all n detection temperatures, a composition for detecting the i-th TNA has one signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the i-th TNA, and one or two signal-constant temperature ranges (SCoTR) in which the signal is constant despite the presence of the i-th TNA, and

[0091] Here, the composition for detecting the i-th TNA is any one of the following:

[0092] (i) Under-Signal-Change-Type (UnderSC-Type) composition having a melting profile in which the signal-change temperature range is lower than the signal-constant temperature range,

[0093] (ii) an Inter-Signal-Change-Type (InterSC-Type) composition having a melting profile in which the signal-change temperature range is higher than one of two signal-constant temperature ranges and lower than the other of two signal-constant temperature ranges, and

[0094] (iii) Over-Signal-Change-Type (OverSC-Type) composition having a melting profile in which the signal-change temperature range is higher than the signal-constant temperature range,

[0095] Here, at least one of the n compositions for detecting n TNAs is an InterSC-type composition as described above, and

[0096] (b) A step of determining the presence of n TNAs from the signal detected in step (a), wherein the presence of the i-th TNA is determined by the change in the signal detected at the i-th detection temperature.

[0097] In a specific embodiment, the i-th detection temperature is selected within the signal-change temperature range of the composition for detecting the i-th TNA, wherein the i-th detection temperature is not included in the signal-change temperature range of the composition for detecting other targets.

[0098] In a specific embodiment, the signal-change temperature range of the composition for detecting the i-th TNA partially overlaps with the signal-change temperature range of the composition for detecting the TNA having an adjacent detection temperature, but does not overlap with the signal-change temperature range of the composition for detecting the TNA having a non-adjacent detection temperature.

[0099] In a specific embodiment, when n is 2, the composition for detecting the first TNA is an UnderSC-type or InterSC-type composition, and the composition for detecting the second TNA is an InterSC-type or OverSC-type composition.

[0100] In a specific embodiment, when n is 3, the composition for detecting the first TNA is an UnderSC-type or InterSC-type composition, the composition for detecting the nth TNA is an InterSC-type or OverSC-type composition, and each composition for detecting TNA other than the first TNA and the nth TNA is an InterSC-type composition.

[0101] In a specific embodiment, the detection of the signal at each of the n detection temperatures is performed using a single type of detector.

[0102] In a specific embodiment, the incubation includes an amplification reaction to TNA.

[0103]

[0104] The features and advantages of the present disclosure are summarized as follows:

[0105] (a) A first feature of the method according to the present disclosure is to use a composition comprising a labeled oligonucleotide (LO) having a nucleotide sequence capable of hybridizing with a nucleic acid generated dependently on the presence of TNA or the presence thereof and a label attached thereto, and a competing oligonucleotide (CO) having a nucleotide sequence capable of hybridizing with said LO and competing with said TNA or the nucleic acid generated dependently on the presence thereof in hybridization with said LO. According to the method of the present disclosure, the LO forms a hybrid competitively with said CO or TNA.

[0106] In the method according to the present disclosure, during the amplification reaction, if TNA is absent in the sample, only a first hybrid is formed to generate a background signal, and if TNA is present in the sample, a second hybrid is formed to generate a target signal. The background signal and the target signal are indistinguishable, but only the target signal may be detected at a specific temperature during the amplification reaction.

[0107] (b) A second feature of the method according to the present disclosure is that the first hybrid and the second hybrid have different Tm. By this feature, the composition according to the present disclosure exhibits a melting profile having a signal-change temperature range (SChTR) in which the signal changes depending on the presence of TNA in the amplification reaction, and two signal-constant temperature ranges (SCoTR) in which the signal remains constant despite the presence of TNA.

[0108] (c) The composition according to the present disclosure not only enables the detection of a single TNA, but also enables the detection of multiple TNAs using a single type of label. Specifically, multiple compositions having a single type of label can be used to detect multiple TNAs in real time by controlling their respective signal-change temperature ranges (e.g., by controlling them so as not to overlap). In addition, the method according to the present disclosure can significantly reduce the analysis time compared to the prior art which requires melting analysis after target amplification.

[0109]

[0110] FIG. 1 illustrates the structure of two exemplary hybrids, namely a first hybrid (top) and a second hybrid (bottom), that can be formed according to the method of the present disclosure. As seen in FIG. 1, a labeled oligonucleotide (LO) is labeled with a reporter moiety (R) at its 5'-terminus and a quencher moiety (Q) at its 3'-terminus. A competing oligonucleotide (CO) is blocked at its 3'-terminus (indicated by a filled circle). In FIG. 1, the LO is designed to have a nucleotide sequence that is completely complementary to the TNA, and the CO is designed to have a nucleotide sequence that is substantially complementary to the LO, with a few non-complementary nucleotides.

[0111] FIG. 2 illustrates, in steps, a method according to one embodiment of the present disclosure using a probing and tagging oligonucleotide (PTO) and a capturing and templating oligonucleotide (CTO). The method comprises hybridization of the primer and PTO with TNA in step a1; cleavage of the PTO in step a2; hybridization of the PTO fragment with CTO in step a3; and generation of a first extended strand (ES) in step a4. The first ES generated herein corresponds to the 'nucleic acid generated dependently on the presence of TNA' in the method of the present disclosure. Subsequently, LO may hybridize with CO to form a first hybrid, or LO may hybridize with the first ES to form a second hybrid (see step a).

[0112] FIG. 3 illustrates a method according to another embodiment of the present disclosure using PTO and CTO in steps. The method comprises hybridization of the primer and PTO with TNA in step a1; cleavage of PTO in step a2; hybridization of the PTO fragment with CTO in step a3; generation of a first extended strand (ES) in step a4; hybridization of the first ES with LO in step a5; and generation of a second extended strand (ES) by extension of the first ES in step a6. The second ES generated herein corresponds to the 'nucleic acid generated dependently on the presence of TNA' in the method of the present disclosure. Subsequently, LO may hybridize with CO to form a first hybrid, or LO may hybridize with the second ES to form a second hybrid (see step a).

[0113] FIG. 4 illustrates various hybridization modes between LO and the first extension strand (ES) and between LO and CO. LO is labeled with a reporter moiety at the 5'-end and a quencher moiety at the 3'-end. In hybridization between LO and the first ES, LO may hybridize only to the extension sequence (indicated by the dotted line) excluding the PTO fragment (indicated by the solid line) within the first ES (top); LO may hybridize to a portion of the first ES (middle); or LO may hybridize to the entirety of the first ES (bottom). Meanwhile, the LO may hybridize with CO.

[0114] FIG. 5 illustrates various hybridization modes between LO and the first extension strand (ES) and between LO and CO. LO is labeled with a quencher moiety at the 5'-end and a reporter moiety in the middle. In hybridization between LO and the first ES, LO may hybridize only to the extension sequence (indicated by the dotted line) excluding the PTO fragment (indicated by the solid line) within the first ES (top); LO may hybridize to a portion of the first ES (middle); or LO may hybridize to the entirety of the first ES (bottom). Meanwhile, the LO may hybridize with CO.

[0115] FIG. 6 illustrates various hybridization modes between LO and the second extended strand (ES) and between LO and CO. LO is labeled with a reporter moiety at the 5'-end and a quencher moiety at the 3'-end. In hybridization between LO and the second ES, LO may hybridize only to the second extended sequence, excluding the PTO fragment (indicated by a black solid line) and the first extended sequence (indicated by a gray solid line) within the second ES (top); LO may hybridize to a portion of the second ES (middle); or LO may hybridize to the entire second ES (bottom). Meanwhile, the LO may hybridize with CO.

[0116] FIG. 7 illustrates various hybridization modes between LO and the second extended strand (ES) and between LO and CO. LO is labeled with a quencher moiety at the 5'-end and a reporter moiety in the middle. In hybridization between LO and the second ES, LO may hybridize only to the second extended sequence, excluding the PTO fragment (indicated by a black solid line) and the first extended sequence (indicated by a gray solid line) within the second ES (top); LO may hybridize to a portion of the second ES (middle); or LO may hybridize to the entire second ES (bottom). Meanwhile, the LO may hybridize with CO.

[0117] Figure 8 shows the interaction between LO and CO in the absence of TNA (A) and the interaction between LO, CO, and TNA in the presence of TNA (B).

[0118] In a relatively low temperature range, for example, in a temperature range lower than Tm (Tm1) of the first hybrid, a first hybrid is formed between LO and CO in the absence of TNA, which separates the reporter moiety and the quencher moiety to generate a signal (top left); in the presence of TNA, a second hybrid is formed between LO and TNA, which separates the reporter moiety and the quencher moiety to generate a signal (bottom left). Since no target signal indicating the presence of TNA is generated in the above temperature range, the above temperature range is referred to herein as the first signal-constant temperature range.

[0119] In a relatively intermediate temperature range, for example, in the temperature range between Tm1 and Tm(Tm2) of the second hybrid, in the absence of TNA, LO does not form the first hybrid and exists as a single strand, which brings the reporter moiety and the quencher moiety close together and does not generate a signal (middle top); in the presence of TNA, the second hybrid is formed between LO and TNA, which separates the reporter moiety and the quencher moiety and generates a signal (middle bottom). Since a target signal indicating the presence of TNA is generated in the above temperature range, the above temperature range is referred to herein as the signal-change temperature range.

[0120] In a relatively high temperature range, at a temperature higher than Tm2, ​​in the absence of TNA, LO does not form a first hybrid and exists as a single strand, which does not generate a signal by bringing the reporter moiety and quencher moiety close together (top right); in the presence of TNA, LO does not form a first hybrid or a second hybrid and exists as a single strand, which does not generate a signal by bringing the reporter moiety and quencher moiety close together (bottom right). Since no target signal indicating the presence of TNA is generated in the above temperature range, the above temperature range is referred to herein as the second signal-constant temperature range.

[0121] As shown in FIG. 8, the composition according to the present disclosure exhibits a melting profile having one Signal-Changing Temperature Range (SChTR) in which the signal changes depending on the presence of TNA, and two Signal-Constant Temperature Ranges (SCoTR) in which the signal remains constant despite the presence of TNA.

[0122] FIG. 9 shows (a) the structure of a first hybridization between LO (hybridization probe) and CO formed in the absence of TNA and Tm1, (b) the structure of a second hybridization between LO and TNA formed in the presence of TNA and Tm2, ​​and (c) the content ratio (or presence ratio) of the first hybridization and the second hybridization in the initial, intermediate, and final cycles of a nucleic acid amplification reaction, their melt curves, and a merged plot of said melt curves. As seen in the merged plot of said melt curves, the composition according to the present disclosure exhibits a melting profile having a signal-change temperature range in which the signal changes as TNA is amplified, and a first signal-constant temperature range and a second signal-constant temperature range in which the signal remains constant even when TNA is amplified.

[0123] FIG. 10 shows (a) the structure of a first hybridization between LO (hybridization probe) and CO formed in the absence of TNA and Tm1, (b) the structure of a second hybridization between LO and a first extension strand (ES) formed in the presence of TNA and Tm2, ​​and (c) the content ratio (or presence ratio) of the first hybridization and the second hybridization in the initial, intermediate, and final cycles of a nucleic acid amplification reaction, their melt curves, and a merged plot of said melt curves. As seen in the merged plot of said melt curves, the composition according to the present disclosure exhibits a melting profile having a signal-change temperature range in which the signal changes as TNA is amplified, and a first signal-constant temperature range and a second signal-constant temperature range in which the signal remains constant even when TNA is amplified.

[0124] FIG. 11 shows (a) the structure of a first hybrid between LO (molecular beacon probe) and CO formed in the absence of TNA and Tm1, (b) the structure of a second hybrid between LO and TNA formed in the presence of TNA and Tm2, ​​and (c) the content ratio (or presence ratio) of the first hybrid and the second hybrid in the initial, intermediate, and final cycles of a nucleic acid amplification reaction, their melt curves, and a merged plot of said melt curves. As seen in the merged plot of said melt curves, the composition according to the present disclosure exhibits a melting profile having a signal-change temperature range in which the signal changes as TNA is amplified, and a first signal-constant temperature range and a second signal-constant temperature range in which the signal remains constant even when TNA is amplified.

[0125] FIG. 12 shows (a) the structure of a first hybrid between LO (Lux probe) and CO formed in the absence of TNA and Tm1, (b) the structure of a second hybrid between LO and TNA formed in the presence of TNA and Tm2, ​​and (c) the content ratio (or presence ratio) of the first hybrid and the second hybrid in the initial, intermediate, and final cycles of the nucleic acid amplification reaction, their melt curves, and a merged plot of said melt curves. As seen in the merged plot of said melt curves, the composition according to the present disclosure exhibits a melting profile having a signal-change temperature range in which the signal changes as TNA is amplified, and a first signal-constant temperature range and a second signal-constant temperature range in which the signal remains constant even when TNA is amplified.

[0126] FIG. 13 shows (a) the structure of a first hybrid between LO (two hybrid probes) and CO formed in the absence of TNA and Tm1, (b) the structure of a second hybrid between LO and TNA formed in the presence of TNA and Tm2, ​​and (c) the content ratio (or presence ratio) of the first hybrid and the second hybrid in the initial, intermediate, and final cycles of the nucleic acid amplification reaction, their melt curves, and a merged plot of said melt curves. As seen in the merged plot of said melt curves, the composition according to the present disclosure exhibits a melting profile having a signal-change temperature range in which the signal changes as TNA is amplified, and a first signal-constant temperature range and a second signal-constant temperature range in which the signal remains constant even when TNA is amplified.

[0127] FIG. 14 shows amplification curves obtained by real-time PCR using a competitive hybridization-based signaling assay according to one embodiment of the present disclosure. Each amplification curve was detected at 60°C, 84°C, and 95°C. Tube 1 is the result for a tube containing HPV 18 genomic DNA as TNA, and Tube 2 is the result for a tube containing distilled water as a negative control instead of TNA.

[0128] FIG. 15 shows amplification curves obtained by real-time PCR using a competitive hybridization-based signaling assay according to one embodiment of the present disclosure. Each amplification curve was detected at 60°C, 84°C, and 95°C. Tube 1 is the result for a tube containing HPV 18 genomic DNA as TNA, and Tube 2 is the result for a tube containing distilled water as a negative control instead of TNA.

[0129] FIG. 16 shows amplification curves obtained by real-time PCR using a competitive hybridization-based signaling assay according to one embodiment of the present disclosure. Each amplification curve was detected at 60°C, 84°C, and 95°C. Tube 1 is the result for a tube containing HPV 33 genomic DNA as TNA, Tube 2 is the result for a tube containing HPV 18 genomic DNA as TNA, Tube 3 is the result for a tube containing HPV 33 genomic DNA and HPV 18 genomic DNA as TNA, and Tube 4 is the result for a tube containing distilled water as a negative control instead of TNA.

[0130] FIG. 17 shows amplification curves obtained by real-time PCR using a competitive hybridization-based signaling assay according to one embodiment of the present disclosure. Each amplification curve was detected at 60°C, 77°C, and 95°C. Tube 1 is the result for a tube containing HPV 33 genomic DNA as TNA, Tube 2 is the result for a tube containing HPV 18 genomic DNA as TNA, Tube 3 is the result for a tube containing HPV 33 genomic DNA and HPV 18 genomic DNA as TNA, and Tube 4 is the result for a tube containing distilled water as a negative control instead of TNA.

[0131]

[0132] The inventors have made diligent research efforts to develop a novel method for detecting target nucleic acids in real time with improved convenience and high efficiency. In particular, the inventors have endeavored to develop a method capable of detecting multiple target nucleic acid sequences using a single type of label. As a result, the inventors have established a novel protocol for detecting target nucleic acids by generating two competitive hybrids using a competitive oligonucleotide (CO) and a labeled oligonucleotide (LO). The protocol according to the present disclosure has improved accuracy and convenience and can detect not only a single target nucleic acid but also multiple target nucleic acids.

[0133]

[0134] I. Method for Detecting TNA in a Sample by a Competitive Hybridization-Based Signaling Assay

[0135] In one embodiment, the present disclosure provides a method for detecting a target nucleic acid (TNA) in a sample by a Competitive Hybrids-based Signaling Assay (CHYSA):

[0136] (a) a step of contacting a sample suspected of containing TNA with a composition for detecting TNA,

[0137] The above composition is

[0138] (i) a labeled oligonucleotide (LO) comprising a nucleotide sequence hybridizable with the nucleic acid generated dependently on the presence of the TNA or the above, and a label attached thereto, and

[0139] (ii) comprising a competing oligonucleotide (CO) having a nucleotide sequence that is hybridizable with the LO and competes with the nucleic acid generated dependently on the presence of the TNA or in hybridization with the LO, and

[0140] The above LO can generate a background signal by forming a first hybridized compound through hybridization with the above CO, and the above LO can also generate a target signal by forming a second hybridized compound through hybridization with the above TNA or a nucleic acid generated dependent on the presence thereof.

[0141] The melting temperature (Tm1) of the first hybrid compound and the melting temperature (Tm2) of the second hybrid compound are different, and the formation of the hybrid compound having a higher melting temperature among the first and second hybrid compounds is competitively advantageous compared to the formation of the hybrid compound having a lower melting temperature.

[0142] (b) a step of performing an amplification reaction for the TNA under amplification conditions,

[0143] As the amplification reaction proceeds, the formation of the second hybrid increases, thereby providing a target signal, and

[0144] (c) A step of detecting the target signal, wherein the detected target signal indicates the presence of the TNA.

[0145] In describing the components of the present disclosure, terms such as first, second, A, B, (a), (b), (i), (ii), etc., are used. These terms are used merely to distinguish one component from another, and the nature or order of the components is not limited by the terms.

[0146]

[0147] A method according to the present disclosure utilizes competition between the formation of a first hybrid of a labeled oligonucleotide (LO) and a competing oligonucleotide (CO) and the formation of a second hybrid of the LO and a TNA or a nucleic acid generated in the presence thereof, which is referred to as a "Competitive Hybrids-based Signaling Assay (CHYSA)".

[0148] A CHYSA according to the present disclosure is described in detail below.

[0149]

[0150] Step (a): Contact between the target nucleic acid (TNA) and the composition for detecting it.

[0151] First, a sample suspected of containing target nucleic acid (TNA) is brought into contact with a composition for detecting TNA.

[0152] As used herein, the terms “target nucleic acid,” “target nucleic acid sequence,” “target sequence,” or “TNA” refer to a nucleic acid or a sequence thereof to be detected, which is annealed or hybridized with a probe or primer under hybridization, annealing, or amplification conditions. The TNA includes single strands as well as double strands. The TNA includes sequences newly generated in the reaction as well as sequences initially present in the nucleic acid sample.

[0153] TNA includes all DNA (gDNA and cDNA), RNA, and hybrids thereof (chimeric nucleic acids). TNA may be in a double-stranded or single-stranded form. If the TNA used as the starting material is double-stranded, it is desirable to separate it into a single-stranded or partially single-stranded form. Known methods for separating strands include, but are not limited to, heating, alkali, formamide, urea, and glycoxal treatment, enzymatic methods (e.g., helicase action), and binding proteins. For example, strand separation can be achieved by heating in a temperature range of 80°C. A general method for this is found in the literature [Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001)].

[0154] When mRNA is used as a starting material, a reverse transcription step is essential prior to the annealing step, and details thereof are disclosed in the aforementioned literature. For reverse transcription, oligonucleotide dT primers, random primers, or target-specific primers capable of hybridizing to the poly A tail of mRNA may be used.

[0155] TNA includes all naturally occurring prokaryotic nucleic acids, eukaryotic nucleic acids (e.g., protozoa and parasites, fungi, yeast, higher plants, lower animals, and higher animals including mammals and humans), viral nucleic acids (e.g., herpes virus, HIV, influenza virus, Epstein-Barr virus, hepatitis virus, polio virus, etc.), or viroid nucleic acids. Additionally, TNA may be any nucleic acid molecule produced or capable of being produced by recombination, or any nucleic acid molecule produced or capable of being synthesized chemically. Thus, TNA may or may not be found in nature. TNA may contain known or unknown sequences.

[0156] As used herein, the term “sample” means a cell, tissue, or fluid from a biological source, or any other medium that may be advantageously evaluated according to the present invention, and includes viruses, bacteria, tissues, cells, blood, serum, plasma, lymph, milk, urine, feces, ocular fluid, saliva, semen, brain extracts, cerebrospinal fluid, appendix, spleen and tonsil tissue extracts, amniotic fluid, ascites, and non-biological samples (e.g., food and water). Additionally, said samples include naturally occurring nucleic acid molecules isolated from biological sources and synthesized nucleic acid molecules.

[0157] As used herein, the term "composition for detecting TNA" means a set of components used to detect TNA. The composition may include components that amplify TNA, components that generate a signal from the amplified TNA, and components that assist the function of said components.

[0158] The composition used in the method of the present disclosure is

[0159] (i) a labeled oligonucleotide (LO) comprising a nucleotide sequence hybridizable with the nucleic acid generated dependently on the presence of the TNA or the above, and a label attached thereto, and

[0160] (ii) Competing oligonucleotide (CO) having a nucleotide sequence that is hybridizable with the LO and competes with the nucleic acid generated dependently on the presence of the TNA or the LO in hybridization with the LO.

[0161] Below, the aforementioned CO and LO will be explained in detail.

[0162]

[0163] Labeled oligonucleotides (LO)

[0164] As used herein, the term “labeled oligonucleotide (LO)” refers to an oligonucleotide having a nucleotide sequence capable of hybridizing with a nucleic acid generated dependently on the presence of TNA or the presence thereof, and comprising a label attached thereto.

[0165] The above LO is designed to have a nucleotide sequence complementary to the TNA or the nucleic acid generated dependently on its presence in order to hybridize with the TNA or the nucleic acid generated dependently on its presence.

[0166] Sequence complementarity between LO and TNA, or between nucleic acids generated dependently on their presence, does not necessarily require that the two sequences be completely complementary, i.e., 100% complementary, as long as the two sequences hybridize with each other. It is known in the art that when two sequences hybridize, they can hybridize even if some non-complementary bases are present. This degree of complementarity is referred to herein as substantial complementarity. Therefore, sequence complementarity between LO and TNA, or between nucleic acids generated dependently on their presence, includes complete complementarity or substantial complementarity.

[0167] As used herein, the term 'substantially complementary' means that the oligonucleotide is sufficiently complementary so that it can specifically hybridize to the template under specified annealing or hybridization conditions. On the other hand, the term 'non-complementary' means that the oligonucleotide is sufficiently non-complementary so that it does not specifically hybridize to the template under specified annealing or hybridization conditions, and has a meaning that encompasses both 'substantially non-complementary' and 'perfectly noncomplementary,' and preferably means perfectly non-complementary.

[0168] The LO used herein is capable of hybridizing with TNA or nucleic acids generated dependent on its presence, and is also capable of hybridizing with competing oligonucleotides (CO) described below.

[0169] Specifically, LO can form a first hybrid (LO / CO hybrid) by hybridization with CO (see upper part of FIG. 1), and the LO can also form a second hybrid (LO / TNA hybrid) by hybridization with the TNA or a nucleic acid generated dependent on the presence thereof (see lower part of FIG. 1).

[0170] The formation of the aforementioned first and second hybrids depends on the presence of TNA or nucleic acids generated dependent on its presence within the sample.

[0171] When TNA is absent in the sample, LO included in the composition hybridizes only with CO to form only the first hybrid. On the other hand, when TNA is present in the sample, in addition to the first hybrid, LO included in the composition hybridizes with TNA to form the second hybrid.

[0172] The LO according to the present disclosure includes a label that can generate a signal when the first hybrid is formed and when the second hybrid is formed.

[0173] Useful labels that may be included in the above LO may include various labels known in the art. For example, the labels may include, but are not limited to, single labels, interacting double labels, intercollating dyes, and incorporating labels.

[0174] Single labels include, for example, fluorescent labels, luminescent labels, chemiluminescent labels, electrochemical labels, and metallic labels. According to one embodiment, the single label provides different signals (e.g., different signal intensities) depending on whether it is present in a double-strand or a single-strand. According to one embodiment, the single label is a fluorescent label. Preferred types and binding sites of single fluorescent labels used in this disclosure are disclosed in U.S. Patents No. 7,537,886 and No. 7,348,141, the teachings thereof are incorporated herein by reference in their entirety. For example, the single fluorescent labels include JOE, FAM, TAMRA, ROX, and fluorescein-based labels. The single label may be connected to the LO by various methods. For example, the label is connected to the LO through a spacer containing carbon atoms (e.g., a 3-carbon spacer, a 6-carbon spacer, or a 12-carbon spacer).

[0175] As a representative example of an interaction labeling system, the FRET (fluorescence resonance energy transfer) labeling system includes a fluorescent reporter moiety (donor molecule) and a quencher moiety (acceptor molecule). In FRET, the energy donor is fluorescent, while the energy acceptor may be fluorescent or non-fluorescent. In another form of interaction labeling system, the energy donor is non-fluorescent, e.g., a chromophore, and the energy acceptor is fluorescent. In yet another form of interaction labeling system, the energy donor is luminescent, e.g., bioluminescent, chemiluminescent, or electrochemiluminescent, and the acceptor is fluorescent. The interaction labeling system may include a dual label based on "contact-mediated quenching" (Salvatore et al., Nucleic Acids Research, 2002 (30) no.21 e122 and Johansson et al., J. AM. CHEM. SOC 2002 (124) pp 6950-6956). The interaction labeling system may include any labeling system that induces a signal change through an interaction between at least two molecules (e.g., dyes).

[0176] The reporter moiety and quencher moiety useful in this invention may include any molecule known in the art. Examples include: Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), Rhodamine 110 (520), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™ (531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530 / 550 (550), Dil (565), BODIPY TMR (568), BODIPY558 / 568 (568), BODIPY564 / 570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), Texas Red (615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), Rphycocyanin (642), C-Phycocyanin (648), TO-PRO™-3 (660), TOTO3 (660), DiD DilC (5) (665), Cy5™ (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The numbers in parentheses represent the maximum emission wavelengths in nanometers. Preferably, the reporter moiety and quencher moiety may include JOE, FAM, TAMRA, ROX, and fluorescein-based labels.

[0177] Suitable fluorescent molecules and suitable reporter-quencher pairs are disclosed in various literature as follows: Pesce et al., editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, RP, Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996); U.S. Patents No. 3,996,345 and No. 4,351,760.

[0178] In the present invention, a non-fluorescent quencher moiety capable of quenching fluorescence of a wide range of wavelengths or a specific wavelength (e.g., black quencher or dark quencher) may be used.

[0179] In a signaling system comprising a reporter and a quencher moiety, the reporter comprises a donor of FRET and the quencher comprises the remaining partner (receptor) of FRET. For example, a fluorescein dye may be used as a reporter and a rhodamine dye may be used as a quencher.

[0180] In a specific embodiment, the LO has an interaction dual label (see FIG. 9-11 and 13).

[0181] In a specific embodiment, the LO has a reporter moiety and a quencher moiety positioned to generate a signal when the first hybrid and the second hybrid are formed.

[0182] The reporter moiety and quencher moiety on the LO may exist in a position that induces quenching between the interacting double labels by forming a hairpin or random coil structure when the LO exists in a single-stranded state, i.e., before hybridization with CO or TNA or nucleic acid generated dependently on the presence thereof, whereas when the LO exists in a double-stranded state, i.e. after hybridization with CO or TNA or nucleic acid generated dependently on the presence thereof, the LO may exist in a position that reduces quenching between the interacting double labels.

[0183] Specifically, before the formation of the first hybrid or the second hybrid, the reporter moiety and the quencher moiety on the LO are close to each other (e.g., by a random coil shape) so that the quencher moiety quenches the signal from the reporter moiety, whereas when the first hybrid or the second hybrid is formed, the reporter moiety and the quencher moiety on the LO are spatially separated from each other so that the quencher moiety can unquench the signal from the reporter moiety.

[0184] As described above, to achieve quenching or unquenching of the signal from the reporter moiety by the quencher moiety, the reporter moiety and the quencher moiety are positioned at a sufficient distance apart. As an example, the reporter moiety and the quencher moiety may be positioned apart by 10 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 25 nucleotides or more, 30 nucleotides or more, 35 nucleotides or more, 40 nucleotides or more, 45 nucleotides or more, or 50 nucleotides or more. As another example, the reporter moiety may be located at one end of the LO, and the quencher moiety may be located at the other end of the LO. Figure 1 shows the structure of an LO in which the reporter moiety is located at the 5'-terminus of the LO and the quencher moiety is located at the 3'-terminus of the LO.

[0185] In one embodiment, the LO may be composed of two or more oligonucleotides. For example, as shown in FIG. 13, one LO may have a quencher moiety or a reporter moiety at the 3'-terminus, and another LO may have a reporter moiety or a quencher moiety at the 5'-terminus.

[0186] In one embodiment, the 3'-terminus of the LO is blocked so that its extension is prevented. Blocking can be achieved according to conventional methods. For example, blocking can be performed by adding a chemical moiety, such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate, or an alkane-diol residue, to the 3'-hydroxyl group of the last nucleotide. Alternatively, blocking can be performed by removing the 3'-hydroxyl group of the last nucleotide or by using a nucleotide without a 3'-hydroxyl group, such as a dideoxynucleotide.

[0187] In one embodiment, the LO has a single label positioned to generate a signal upon the formation of the first hybrid and the second hybrid (see FIG. 12). An example of an LO having such a single label is a single-labeled Lux ​​(U.S. Patent No. 7,537,886). The single label on the LO may exhibit different signal strengths in the single-strand state and the double-strand state. For example, the single label on the LO may exhibit a low signal strength in the single-strand state, while exhibiting a high signal strength in the double-strand state.

[0188] In this institution, the length of LO can vary. For example, LO is 5-100 nucleotides, 5-80 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-20 nucleotides, 5-10 nucleotides, 10-100 nucleotides, 10-80 nucleotides, 10-60 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 15-30 nucleotides, 15-20 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-40 nucleotides, or It can be 20-30 nucleotide long.

[0189] LO may be a probe known in the industry.

[0190] As used herein, the term "probe" means a single-stranded nucleic acid molecule comprising a site or sites substantially complementary to a TNA sequence or a nucleic acid sequence derived therefrom. According to one embodiment, the 3'-end of the probe is "blocked" to prevent its extension. Blocking can be achieved according to a conventional method.

[0191] The probe comprises deoxyribonucleotides, ribonucleotides, or combinations thereof. Primers or probes used in the present disclosure may comprise naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP, and dTMP), modified nucleotides, or non-natural nucleotides.

[0192] Examples of the above probes include, but are not limited to, TaqMan probes (U.S. Patents No. 5,210,015 and 5,538,848), molecular beacons using double-labeled probes having a hairpin structure (Tyagi et al., Nature Biotechnology v.14 MARCH 1996), HyBeacon (French DJ et al., mol. Cell Probes, 15(6):363-374(2001)), two probes labeled as a donor and an acceptor, respectively (Bernad et al., 147-148 Clin Chem 2000; 46), and single-labeled Lux ​​(U.S. Patent No. 7,537,886).

[0193] In the present invention, LO can generate a background signal by forming a first hybridization by hybridization with CO, and the LO can also generate a target signal by forming a second hybridization by hybridization with the TNA or a nucleic acid generated dependent on the presence thereof.

[0194] The signal generated by the first hybridization between LO and CO is not related to TNA or nucleic acids generated dependent on its presence. Therefore, since the signal generated from the first hybridization cannot indicate the presence of TNA, it corresponds to a signal independent of TNA, i.e., a background signal.

[0195] In contrast, the signal generated by the second hybridization between LO and TNA or nucleic acids generated dependently on its presence is associated with TNA or the nucleic acids generated dependently on its presence. That is, as the amount of TNA or nucleic acids generated dependently on its presence increases, the amount of the second hybridization increases (when LO is sufficiently abundant), and consequently, the intensity of the signal increases. Therefore, since the signal generated from the second hybridization indicates the presence of TNA, it corresponds to a signal associated with TNA, i.e., a target signal.

[0196] According to the method of the present disclosure, the melting temperature (Tm1) of the first hybrid and the melting temperature (Tm2) of the second hybrid are different. For this purpose, the CO described below is designed to have a nucleotide sequence of different length and / or different bases compared to the TNA or the nucleic acid produced dependent on its presence. These sequence features of the CO make Tm1 and Tm2 different. For a specific description of the first hybrid and the second hybrid, refer to the description of the CO.

[0197] In one embodiment, the content of LO in the composition for detecting TNA is equal to or lower than the content of CO. This is to ensure that most of the LO in the composition forms a first hybrid with CO so that no single strand of LO is present. When the content of LO is equal to or lower than the content of CO, as the amount of TNA or nucleic acid generated dependently on its presence increases (as the amplification reaction for TNA proceeds), the amount of the first hybrid decreases while the amount of the second hybrid increases, which generates a target signal. In one embodiment, the content of LO in the composition is equal to the content of CO or at least 0.5 times, 0.1 times, 0.01 times, 0.001 times, or 0.0001 times the content of CO.

[0198] In one embodiment, the content of LO in the composition for detecting TNA is higher than the content of CO. This is to ensure that an excess of LO exists as a single strand in the composition. In this case, as the amount of TNA or nucleic acid generated dependently on its presence increases (as the amplification reaction for TNA proceeds), the amount of the first hybridization does not change significantly, whereas the excess LO hybridizes with the nucleic acid generated dependently on TNA or its presence, causing the amount of the second hybridization to increase, which generates a target signal. In one embodiment, the content of LO in the composition is at least 2, 3, 4, 5, 10, 100, 1000, 10000, or 1000000 times the content of CO.

[0199]

[0200] Competitive oligonucleotides (CO)

[0201] As used herein, the term "competing oligonucleotide (CO)" refers to an oligonucleotide that plays a role in competing with TNA or nucleic acid generated dependent on its presence. Specifically, CO refers to an oligonucleotide having a nucleotide sequence that is hybridizable with LO and competes with said TNA or nucleic acid generated dependent on its presence in hybridization with said LO.

[0202] In one embodiment, the CO may have a sequence that mimics, i.e., similar to, to compete with TNA or nucleic acid generated dependent on its presence in hybridization with LO.

[0203] The above CO is an artificially synthesized component included in the composition for detecting TNA, whereas TNA or nucleic acid generated dependent on its presence is not necessarily artificially synthesized and is not included in the composition according to the present disclosure. Furthermore, since CO is not amplified during the reaction, its amount remains constant, whereas TNA or nucleic acid generated dependent on its presence may be amplified during the reaction through interaction with the primer oligonucleotide (PO) described below, and its amount may increase. TNA or nucleic acid generated dependent on its presence refers to TNA or a copy thereof that is present in the sample from the beginning, or a product derived from or generated in the presence of said TNA or a copy thereof.

[0204] One feature of the method according to the present disclosure is that LO hybridizes with CO in the absence of TNA or a nucleic acid generated dependent on its presence to form a first hybrid (LO / CO hybrid), and in the presence of TNA or a nucleic acid generated dependent on its presence, LO hybridizes with TNA or a nucleic acid generated dependent on its presence to form a second hybrid (LO / TNA hybrid) instead of or in addition to the first hybrid.

[0205] To this end, the CO has a nucleotide sequence similar to the nucleotide sequence of the nucleic acid generated dependently on the presence of the TNA or the CO.

[0206] The similarity between the nucleotide sequences of CO and the nucleic acid generated dependently on TNA or its presence implies a level of similarity that allows CO to hybridize with LO. That is, CO is required to have sequence similarity with the nucleic acid generated dependently on TNA or its presence to the extent that it can hybridize with LO.

[0207] For example, the CO may have sequence identity of 99% or more, 95% or more, 90% or more, 85% or more, 80% or more, 75% or more, or 70% or more compared to the nucleotide sequence of the nucleic acid generated dependently on the presence of the TNA or its presence. It will be understood that if the CO can hybridize with the LO, the CO may have sequence identity of less than 70% compared to the nucleotide sequence of the nucleic acid generated dependently on the presence of the TNA or its presence.

[0208] One feature of the present disclosure is that in hybridization with LO, CO and TNA or nucleic acids generated dependently on their presence compete with each other, and specifically, in hybridization with LO, either CO and TNA or nucleic acids generated dependently on their presence are more competitive than the other.

[0209] As an example, in hybridization with LO, TNA or nucleic acids generated dependent on its presence may be more competitive than CO. This makes the formation of the second hybrid more favorable compared to the first hybrid.

[0210] As another example, in hybridization with LO, CO may be more competitive compared to TNA or nucleic acids generated dependent on its presence. This makes the formation of the second hybrid favorable compared to the second hybrid.

[0211] In such hybridization with LO, the difference in competitiveness between CO and TNA, or nucleic acids generated dependent on their presence, is due to the sequence similarity of CO and TNA, or nucleic acids generated dependent on their presence, as previously mentioned.

[0212] In order to achieve a difference in competitiveness between CO and TNA or nucleic acids produced dependent on its presence in hybridization with LO, CO must not have 100% sequence identity compared to TNA or nucleic acids produced dependent on its presence.

[0213] Since the above CO has a sequence similar to TNA or nucleic acid generated dependently on its presence, LO designed to hybridize to TNA or nucleic acid generated dependently on its presence can also hybridize to the above CO. That is, with respect to hybridization with LO, CO competes with TNA or nucleic acid generated dependently on its presence. In terms of this hybridization competition with TNA or nucleic acid generated dependently on its presence, the above CO has been referred to herein as a competing oligonucleotide.

[0214] According to the method of the present disclosure, when TNA is absent in the sample, CO can hybridize only with LO, so only a first hybrid, i.e., an LO / CO hybrid, can be formed. On the other hand, when TNA is present in the sample, CO can hybridize to TNA or nucleic acid generated dependent on its presence in addition to LO, so a second hybrid, i.e., an LO / TNA hybrid, can be formed in addition to the first hybrid.

[0215] Structures of two hybrid compounds that can be formed according to the method of the present disclosure are illustrated in FIG. 1. The upper part of FIG. 1 shows a first hybrid compound, i.e., an LO / CO hybrid compound, and the lower part of FIG. 1 shows a second hybrid compound, i.e., an LO / TNA hybrid compound.

[0216] Another feature of the method of the present disclosure is that the formation of either the first hybrid or the second hybrid is competitively advantageous over the formation of the other hybrid. Accordingly, the formation of the competitively advantageous hybrid prevents the formation of the competitively disadvantageous hybrid.

[0217] In one embodiment, the formation of a second hybrid is more advantageous than the formation of a first hybrid. In this case, the probability that LO hybridizes to TNA or to nucleic acid generated dependent on its presence is higher than the probability that LO hybridizes to CO. Therefore, as TNA is amplified during the amplification reaction, the amount of the first hybrid is maintained or decreased, while the amount of the second hybrid increases exponentially.

[0218] In another embodiment, the formation of the first hybrid is more advantageous than the formation of the second hybrid. In this case, the probability that LO hybridizes to CO is higher than the probability that LO hybridizes to TNA or to nucleic acids generated dependent on its presence. Therefore, as TNA is amplified during the amplification reaction, the amount of the first hybrid is maintained, while the amount of the second hybrid increases exponentially as excess LO hybridizes to TNA.

[0219] The method of the present disclosure can determine the presence of TNA by confirming an increase in the amount of a second hybridized compound during or after an amplification reaction. For example, an increase in the amount of the second hybridized compound after an amplification reaction compared to the amount of the second hybridized compound before an amplification reaction may indicate the presence of TNA. Since the second hybridized compound contains TNA or nucleic acids generated dependently on its presence, an increase in the amount of the second hybridized compound may imply the presence of TNA in the sample and its amplification.

[0220] As described below, an increase in the amount of the second hybridized compound can be confirmed by detecting a target signal.

[0221] As described above, the formation of either the first hybrid or the second hybrid is competitively more advantageous than the formation of the other hybrid can be achieved through the difference in thermal stability of the two hybrids, such as the difference in Tm values.

[0222] According to the method of the present disclosure, the melting temperature (Tm1) of the first hybrid is different from the melting temperature (Tm2) of the second hybrid. It is known to those skilled in the art that a hybrid having a high Tm is more stable than a hybrid having a low Tm, and therefore, the formation of a hybrid having a high Tm is competitively advantageous over the formation of a hybrid having a low Tm. The method of the present disclosure can make the formation of one hybrid more competitively advantageous than the formation of the other hybrid by causing the first hybrid and the second hybrid to have different Tms.

[0223] In one embodiment, Tm1 of the first hybrid is lower than Tm2 of the second hybrid. As an example, Tm1 is at least 3°C ​​lower than Tm2. As another example, Tm1 is at least 5°C, at least 6°C, at least 7°C, at least 8°C, at least 9°C, at least 10°C, at least 11°C, at least 12°C, at least 13°C, at least 14°C, at least 15°C, or at least 20°C lower than Tm2. As another example, Tm1 is 5 to 20°C, 7 to 15°C, or 10 to 13°C lower than Tm2. In this case, the formation of the second hybrid is competitively more advantageous than the formation of the first hybrid.

[0224] In another embodiment, Tm1 of the first hybrid is higher than Tm2 of the second hybrid. As an example, Tm1 is at least 3°C ​​higher than Tm2. As another example, Tm1 is at least 5°C, at least 6°C, at least 7°C, at least 8°C, at least 9°C, at least 10°C, at least 11°C, at least 12°C, at least 13°C, at least 14°C, at least 15°C, or at least 20°C higher than Tm2. As another example, Tm1 is 5 to 20°C, 7 to 15°C, or 10 to 13°C higher than Tm2. In this case, the formation of the first hybrid is competitively advantageous over the formation of the second hybrid.

[0225] In one embodiment, Tm1 of the first hybrid and Tm2 of the second hybrid can be predetermined within 50 to 90°C, preferably 60 to 80°C.

[0226] As used herein, the term "Tm" refers to the temperature at which half of the first hybridization or second hybridization of a double strand dissociates into a single strand. The Tm value is determined by the length of the nucleotide being hybridized and the G / C content. The Tm value may be estimated by methods known in the art, such as the Wallace rule (RB Wallace, et al., Nucleic Acids Research, 6:3543-3547 (1979)) and the nearest-neighbor method (Santa Lucia J. Jr., et al., Biochemistry, 35:3555-3562 (1996); Sugimoto N., et al., Nucleic Acids Res., 24:4501-4505 (1996)).

[0227] In one embodiment, the difference between Tm1 and Tm2 can be achieved by adjusting the length and / or sequence of CO.

[0228] In one embodiment, the CO has a nucleotide sequence of different length and / or different bases compared to the TNA or nucleic acid generated dependently on its presence.

[0229] In one embodiment, in order to make Tm2 higher than Tm1, that is, to make the formation of the second hybrid competitively more advantageous than the formation of the first hybrid, the double strand length of the second hybrid can be configured to be longer than the double strand length of the first hybrid. To this end, CO can be configured to have a shorter length compared to TNA or the nucleic acid generated dependently on its presence. Here, the length of the nucleic acid generated dependently on TNA or its presence refers to the length of the region hybridized with LO. In other words, CO can be configured to have a shorter length than LO. Thus, making CO have a shorter length than TNA or the nucleic acid generated dependently on its presence or LO makes the length of the first hybrid between LO and CO shorter than the length of the second hybrid between LO and the product generated dependently on TNA or its presence, thereby making the Tm2 of the second hybrid higher than the Tm1 of the first hybrid. Here, compared to TNA or nucleic acids or LOs generated dependently on its presence, the short length of CO refers to a length short enough to cause Tm1 to be lower than Tm2.

[0230] In another embodiment, in order to make Tm2 higher than Tm1, that is, to make the formation of the second hybrid competitively more favorable than the formation of the first hybrid, CO may have different bases compared to TNA or the nucleic acid generated dependent on its presence. As such an approach, CO may include one or more non-complementary bases or universal bases with respect to LO. Thus, having CO include one or more non-complementary bases or universal bases with respect to LO lowers the Tm1 of the first hybrid between LO and CO, so that consequently, the Tm2 of the second hybrid may be higher than the Tm1 of the first hybrid. Such an embodiment is illustrated in FIG. 1. As seen in FIG. 1, the sequence of TNA is completely complementary to the sequence of LO (see bottom), whereas the sequence of CO has several non-complementary base(s) compared to the sequence of LO (see top). Therefore, the Tm2 of the second hybrid is higher than the Tm1 of the first hybrid. Here, the number of non-complementary bases or universal bases in CO refers to the number required to make Tm2 higher than Tm1.

[0231] Examples of universal bases that can be used in the above CO are, but are not limited to, deoxyinosine, inosine, 7-diaza-2'-deoxyinosine, 2-aza-2'-deoxyinosine, 2'-OMe inosine, 2'-F inosine, deoxy 3-nitropyrrole, 3-nitropyrrole, 2'-OMe 3-nitropyrrole, 2'-F 3-nitropyrrole, 1-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole, deoxy 5-nitropyrrole, 5-nitroindole, 2'-OMe 5-nitroindole, 2'-F 5-nitroindole, deoxy 4-nitrobenzimidazole, 4-nitrobenzimidazole, deoxy 4-aminobenzimidazole, 4-aminobenzimidazole, Deoxynebularin, 2'-F nebularin, 2'-F 4-nitrobenzimidazole, PNA-5-introindole, PNA-nebularin, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrole, Morphorino-5-nitroindole, Morphorino-nebularin, Morphorino-inosine, Morphorino-4-nitrobenzimidazole, Morphorino-3-nitropyrrole, Phosphoramidate-5-nitroindole, Phosphoramidate-nebularin, Phosphoramidate-inosine, Phosphoramidate-4-nitrobenzimidazole, Phosphoramidate-3-nitropyrrole, 2'-0-methoxyethylinosine, 2'-0-methoxyethyl nebularin, It includes 2'-0-methoxyethyl 5-nitroindole, 2'-0-methoxyethyl 4-nitro-benzimidazole, and 2'-0-methoxyethyl 3-nitropyrrole. In a specific embodiment, the universal base that can be used for the CO is deoxyinosine.

[0232] In another embodiment, to make Tm1 higher than Tm2, ​​CO may include a base modification that increases Tm.

[0233] Examples of the base modification include, but are not limited to, Peptide Nucleic Acid (PNA), Bridged Nucleic Acids (2',4'-BNA), or LNA, Zip Nucleic Acid Spermine (ZNA), C-5 propynly dC (5-Propynyl-2'-deoxycytidine), C-5 propynly dU (5-Propynyl-2'-deoxyuridine), AP-dC (G-clamper, Aminoethyl-Phenoxazine-deoxycytosine), 2-Amino dA (2-Amino-deoxyadenosine dA), 5-TriCAP (5'-Trimethoxystilbene Cap), 5-PYRC (5'-Pyrene Cap), 3-UAQC (3'-Uaq Cap), 5-Me-dC(5-Methyl-2'-deoxycytidine), MGB(Minor Groove It includes Binder), iso-dG (iso deoxyguanosine), iso-dC (iso deoxycytosine), and 5N-indole (5-Nitroindole).

[0234] The number of base modifications that may be included in the above CO is 1 to 10, for example, 1, 2, 3, or 4. The number of base modifications means the number required to make Tm1 higher than Tm2.

[0235] In this institution, the length of CO can vary. For example, CO is 5-100 nucleotides, 5-80 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-20 nucleotides, 5-10 nucleotides, 10-100 nucleotides, 10-80 nucleotides, 10-60 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 15-30 nucleotides, 15-20 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-40 nucleotides, or It can be 20-30 nucleotide long.

[0236] In one embodiment, the 3'-terminus of the CO is blocked so that its extension is prevented (indicated by a black circle in the upper part of FIG. 1). Blocking can be achieved according to conventional methods. For example, blocking can be performed by adding a chemical moiety, such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate, or an alkane-diol residue, to the 3'-hydroxyl group of the last nucleotide. Alternatively, blocking can be performed by removing the 3'-hydroxyl group of the last nucleotide or by using a nucleotide without a 3'-hydroxyl group, such as a dideoxynucleotide.

[0237]

[0238] A composition for detecting TNA according to the present disclosure may include additional components in addition to the aforementioned CO and LO.

[0239] In one embodiment, the composition further comprises a primer oligonucleotide (PO) that serves to amplify TNA.

[0240] As used herein, the terms “primer oligonucleotide (PO)” or “primer” refer to an oligonucleotide that can act as an initiator for synthesis under conditions in which the synthesis of a primer extension product complementary to the sequence (template) of the TNA is induced, namely, the presence of a polymerase such as a nucleotide and DNA polymerase, and conditions of suitable temperature and pH. The primer must be sufficiently long to prime the synthesis of the extension product in the presence of the polymerase. The appropriate length of the primer is determined by a number of factors, such as temperature, application, and the source of the primer.

[0241] The aforementioned primer oligonucleotide may consist of a forward primer and a reverse primer, and the forward primer and the reverse primer may each be one or more. For example, there may be one forward primer and one reverse primer, one forward primer and two or more reverse primers, two or more forward primers and one reverse primer, or both the forward primer and the reverse primer may be two or more.

[0242] The composition according to the present disclosure may, but is not limited to, include nucleic acid polymerase, buffers, polymerase cofactors, and deoxyribonucleotide-5-triphosphate. Optionally, the composition may include various polynucleotide molecules, reverse transcriptase, uracil DNA glycosylase (UDG), various buffers and reagents, and antibodies or compounds that inhibit nucleic acid polymerase activity. The composition may also include a set of oligonucleotides or reagents necessary to perform a positive control reaction. The optimal amount of reagent used in a particular reaction can be easily determined by a person skilled in the art who knows the advantages of the present disclosure. The components of the composition may be present or stored in one or more containers prior to the reaction.

[0243]

[0244] According to the method of the present disclosure, LO has a nucleotide sequence capable of hybridizing with the nucleic acid generated dependently on TNA or its presence, and CO has a nucleotide sequence capable of competing with the nucleic acid dependently on TNA or its presence, specifically CO has a nucleotide sequence of different length and / or different bases compared to the nucleic acid dependently on TNA or its presence.

[0245]

[0246] We will now describe the nucleic acids generated dependently on the presence of the aforementioned TNA.

[0247]

[0248] nucleic acids generated dependent on the presence of TNA

[0249] As mentioned herein, the term "nucleic acid generated dependently on the presence of TNA" refers to a product of nucleic acid derived from or generated in the presence of TNA during an amplification reaction for TNA.

[0250] The nucleic acid generated dependently on the presence of TNA has a nucleotide sequence of similar but different lengths and / or different bases compared to the sequence of CO. Additionally, the nucleic acid generated dependently on the presence of TNA is complementary to the sequence of LO and can therefore hybridize with LO.

[0251] In one embodiment, the nucleic acid generated dependently on the presence of TNA does not contain TNA or a copy thereof.

[0252] In a specific embodiment, the nucleic acid generated dependently on the presence of TNA, which does not contain TNA or a copy thereof, is an extended strand generated by extending a nucleic acid fragment generated from hybridization between TNA and an additional oligonucleotide.

[0253] In a specific embodiment, the nucleic acid produced dependently on the presence of TNA, which does not contain TNA or a copy thereof, is an extended strand produced by hybridizing TNA with an additional oligonucleotide, cleaving the additional oligonucleotide to obtain a nucleic acid fragment, and extending the nucleic acid fragment on a template oligonucleotide.

[0254] In a specific embodiment, the nucleic acid generated dependently on the presence of the TNA is the first extended strand (First Extended Strand, First ES) generated by the following step:

[0255] (a3) A step of hybridizing a nucleic acid fragment generated from hybridization between TNA and an additional oligonucleotide with a Capturing and Templating Oligonucleotide (CTO);

[0256] The above CTO comprises, in the 3' to 5' direction: (i) a capturing site comprising a nucleotide sequence capable of hybridizing with the nucleic acid fragment, and (ii) a templating site comprising a nucleotide sequence not hybridizing with the nucleic acid fragment, and the CTO does not include a label,

[0257] The above nucleic acid fragment hybridizes with the capturing site of the CTO, and

[0258] (a4) A step of generating a first ES by extending the nucleic acid fragment hybridized with the capturing site of the CTO along the templating site of the CTO using a DNA polymerase having 5' nuclease activity.

[0259] A specific description of the creation of the first ES described above can be found, but not limited to, in references including U.S. Patents No. 8,809,239, No. 9,540,681, No. 11,306,349, No. 9,650,665, No. 11,702,699, No. 11,078,525, No. 11,447,814, No. 9,840,739, No. 9,783,845, No. 9,868,980, No. 9,683,259, No. 11,193,161, and U.S. Application Publication No. 2021-0189456.

[0260] In the case where the nucleic acid generated dependently on the presence of TNA is the first ES as described above, the LO according to the present disclosure may have a nucleotide sequence capable of hybridizing with the portion of the first ES excluding the PTO fragment.

[0261] In a specific embodiment, the nucleic acid generated dependently on the presence of the TNA is a second extended strand (second ES) generated by the following step:

[0262] (a3) A step of hybridizing a nucleic acid fragment generated from hybridization between TNA and an additional oligonucleotide with a Capturing and Templating Oligonucleotide (CTO);

[0263] The above CTO comprises, in the 3' to 5' direction: (i) a capturing site comprising a nucleotide sequence capable of hybridizing with the nucleic acid fragment, and (ii) a templating site comprising a nucleotide sequence not hybridizing with the nucleic acid fragment, and the CTO does not include a label,

[0264] The above nucleic acid fragment hybridizes with the capturing site of the CTO, and

[0265] (a4) A step of generating a first ES by extending the nucleic acid fragment hybridized with the capturing site of the CTO along the templating site of the CTO using a DNA polymerase having 5' nuclease activity.

[0266] (a5) A step of hybridizing a portion of the first ES with the LO;

[0267] The LO comprises (i) a capturing site comprising a nucleotide sequence capable of hybridizing with the first ES and (ii) a templating site comprising a nucleotide sequence not hybridizing with the first ES, and

[0268] The above first ES is hybridized with the capturing portion of the LO;

[0269] (a6) A step of generating a second ES by extending the first ES hybridized with the capturing site of the LO along the templating site of the LO using a DNA polymerase having 5' nuclease activity.

[0270] A specific description of the generation of the aforementioned second ES can be found, without limitation, in references including U.S. Patent No. 11,306,349.

[0271] In the case where the nucleic acid generated dependently on the presence of TNA is the second ES as described above, the LO according to the present disclosure may have a nucleotide sequence capable of hybridizing with the portion of the second ES excluding the PTO fragment.

[0272]

[0273] In one embodiment, the nucleic acid fragment that is the starting material in step (a3) ​​is generated by the following step:

[0274] (a1) A step of hybridizing the above TNA with a primer oligonucleotide (PO) and a probing and tagging oligonucleotide (PTO);

[0275] The above PO comprises a nucleotide sequence capable of hybridizing with the first region of TNA, and

[0276] The above PTO comprises, in the 5' to 3' direction: (i) a 5'-tagging site comprising a nucleotide sequence that does not hybridize with TNA, and (ii) a 3'-targeting site comprising a nucleotide sequence capable of hybridizing with a second region of TNA, and

[0277] The first region of the TNA is located toward the 3'-end of the second region, and

[0278] (a2) A step of contacting the product of step (a) with a DNA polymerase having 5' nuclease activity under conditions for cleavage of PTO;

[0279] The above PO induces the cleavage of PTO by a DNA polymerase having 5' nuclease activity, thereby releasing a PTO fragment containing the 5'-tagging portion of the PTO, and

[0280] The above PTO fragment is a nucleic acid fragment generated from the hybridization between TNA and PTO as an additional oligonucleotide.

[0281] A specific description of the generation of the aforementioned nucleic acid fragment can be found, but not limited to, in references including U.S. Patents No. 8,809,239, No. 9,540,681, No. 11,306,349, No. 9,650,665, No. 11,702,699, No. 11,078,525, No. 11,447,814, No. 9,840,739, No. 9,783,845, No. 9,868,980, No. 9,683,259, No. 11,306,349, and No. 11,193,161, and No. 2021-0189456.

[0282]

[0283] The aforementioned steps (a1) to (a4) are illustrated in FIG. 2. Additionally, the aforementioned steps (a1) to (a6) are illustrated in FIG. 3.

[0284] Steps (a1) to (a6) will be described in detail below with reference to FIGS. 2 and 3.

[0285]

[0286] Step (a1): Hybridization of TNA with primer oligonucleotide (PO) and probing and tagging oligonucleotide (PTO)

[0287] First, the TNA in the sample is hybridized with PO and PTO.

[0288] PO includes a nucleotide sequence capable of hybridizing with the first region of TNA.

[0289] The PTO in the 5' to 3' direction comprises: (i) a 5'-tagging site comprising a nucleotide sequence that does not hybridize with TNA, and (ii) a 3'-targeting site comprising a nucleotide sequence that can hybridize with a second region of TNA.

[0290] The above PTO refers to an oligonucleotide comprising (i) a 5'-tagging site that is not hybridized with TNA and is cleaved and released after hybridization with TNA, and (ii) a 3'-targeting site that acts as a probe that hybridizes to TNA (specifically, a second region of TNA). The 5'-tagging site and the 3'-targeting site of the PTO must be positioned in the order from 5' to 3'.

[0291] In one embodiment, the hybridization in step (a1) is carried out under strict conditions in which the 3'-targeting region of the PTO is hybridized to the second region of the TNA, but the 5'-tagging region of the PTO is not hybridized to the TNA.

[0292] The PTO does not require any specific length. For example, the length of the PTO can be 15-150 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 20-150 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-50 nucleotides, 30-150 nucleotides, 30-100 nucleotides, 30-80 nucleotides, 30-60 nucleotides, 30-50 nucleotides, 35-100 nucleotides, 35-80 nucleotides, 35-60 nucleotides, or 35-50 nucleotides. As long as the 3'-targeting site of the PTO specifically hybridizes to the TNA, it can have any length. For example, the 3'-targeting site of the PTO can have a length of 10-100 nucleotides, 10-80 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-50 nucleotides, 15-40 nucleotides, 15-30 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-50 nucleotides, 20-40 nucleotides, or 20-30 nucleotides. The 5'-tagging region can have any length as long as it is extended after specifically hybridizing to the capturing region of the CTO. For example, the 5'-tagging region of the PTO can have a length of 5-50 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 5-20 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 15-50 nucleotides, 15-40 nucleotides, 15-30 nucleotides, or 15-20 nucleotides.

[0293] In one embodiment, the 3'-terminal of the PTO may have a 3'-OH terminal.

[0294] In one embodiment, the 3'-end of the PTO may be blocked so as to prevent its extension. Blocking may be achieved according to a conventional method.

[0295] Alternatively, the PTO can be designed to have a hairpin structure.

[0296] Non-hybridization between the 5'-tagging site of the PTO and the TNA means that a stable double-strand is not formed between them under specific hybridization conditions. In one embodiment, the 5'-tagging site of the PTO that does not participate in hybridization with the TNA forms a single strand.

[0297] The first region of the TNA is located toward the 3' end of the second region. Therefore, the PO hybridized in the first region is located upstream of the PTO hybridized in the second region.

[0298] As used in this disclosure, PO refers to an upstream primer located upstream of PTO. When TNA is double-stranded, PO and PTO are hybridized to one of the double strands of TNA, and PTO is located downstream of PO. The PO is hybridized to a specific region (i.e., the first region of TNA) located in the 3'-direction relative to the region of TNA to which PTO is hybridized (i.e., the second region of TNA).

[0299] In one embodiment, when the TNA is double-stranded, one of the double strands of the TNA comprises a first region of the TNA and a second region of the TNA. Specifically, the TNA comprises, in the order of 3' to 5', (i) a first region in which the PO can be hybridized and (ii) a second region in which the PTO can be hybridized.

[0300] In one embodiment, the method is carried out in the presence of an additional PO. The additional PO additionally generates TNA that hybridizes to PTO, thereby improving detection sensitivity for TNA. The additional primer may be referred to as a downstream primer.

[0301] In one embodiment, when PO is used as an upstream primer and additional PO as a downstream primer, a template-dependent nucleic acid polymerase is additionally used for the extension of the two POs. The PO and additional PO may be referred to as a forward primer and a reverse primer, respectively.

[0302] In one embodiment, the 5'-tagging sites of PO, additional PO and / or PTO each have a dual-priming oligonucleotide (DPO) structure. Oligonucleotides having a DPO structure exhibit significantly improved target specificity compared to conventional primers and probes (U.S. Patents No. 9,884,890 and 10,870,675; see Chun et al., Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene, Nucleic Acid Research, 35:6e40 (2007)).

[0303] In one embodiment, the 3'-targeting site of the PTO has a variant dual-specificity oligonucleotide (mDSO) structure. The variant dual-specificity oligonucleotide (mDSO) structure exhibits significantly improved target specificity compared to conventional probes (see U.S. Patent No. 12,371,736).

[0304]

[0305] Step (a2): Contact between the product of Step (a1) and a DNA polymerase having 5' nuclease activity

[0306] Next, the product of step (a1) is brought into contact with an enzyme having 5' nuclease activity under conditions for cleaving PTO. The PO induces cleaving of PTO by a DNA polymerase having 5' nuclease activity, thereby releasing a PTO fragment containing the 5'-tagging portion of the PTO.

[0307] In one embodiment, the extension of PO hybridized to the first region of the TNA induces the cleavage of PTO by an enzyme having 5' nuclease activity. Specifically, PO is hybridized to be separated from PTO, and an enzyme having polymerase activity (e.g., a template-dependent polymerase) promotes the extension of PO, and an enzyme having 5' nuclease activity bound to the extension product cleaves PTO.

[0308] In another embodiment, PO is hybridized to PTO in such close proximity that it induces cleavage of PTO by an enzyme having 5' nuclease activity, and the enzyme bound to PO cleaves PTO without an extension reaction.

[0309] Therefore, cleavage of PTO can be achieved in two ways: (i) PO extension-dependent cleavage induction; and (ii) PO extension-independent cleavage induction.

[0310] Depending on the two cutting methods described above, the PO can be positioned relative to the PTO. The PO can be positioned far enough from the PTO to induce PTO cutting in an extension-dependent manner. That is, the first and second regions of the TNA can be positioned far apart from each other. Alternatively, the PO can be positioned close enough to the PTO to induce PTO cutting in an extension-independent manner. That is, the first and second regions of the TNA can be positioned close to each other.

[0311] The term "adjacent" as used herein when referring to positions or locations means that the PO is located very close to the 3'-targeting site of the PTO to form a nick. Additionally, the term means that the PO is located 1-30 nucleotides, 1-20 nucleotides, or 1-15 nucleotides away from the 3'-targeting site of the PTO.

[0312] The term "distant" as used in this specification when referring to a point or location includes any location or place sufficient for an extended reaction to occur.

[0313] In one embodiment, the PO is positioned so as to be sufficiently spaced from the PTO to induce the cutting of the PTO in an extension-dependent manner.

[0314] In one embodiment, prior art for cleavage reactions by PO may be applied to the present disclosure insofar as PO hybridized to a first region of TNA induces cleavage of PTO hybridized to a second region of TNA to release a fragment comprising the 5'-tagging portion of PTO or a portion of the 5'-tagging portion of PTO. For example, U.S. Patents No. 5,210,015, 5,487,972, 5,691,142, 5,994,069, 7,381,532 and U.S. Application Publication No. 2008-0241838 may be applied to the present disclosure.

[0315] As used herein, the term “conditions for cleavage of PTO” means conditions sufficient to cleave PTO hybridized to TNA by an enzyme having 5’ nuclease activity, such as temperature, pH, ionic strength, buffer, length and sequence of oligonucleotides, and the enzyme. For example, when Taq DNA polymerase is used as the enzyme having 5’ nuclease activity, the conditions for cleavage of PTO include Tris-HCl buffer, KCl, MgCl2, and temperature.

[0316] When the PTO hybridizes with TNA, its 3'-targeting site participates in the hybridization, while its 5'-tagging site does not hybridize with TNA and forms a single strand. As such, structures containing both a single strand in which the oligonucleotide is not hybridized with TNA and a double strand in which the oligonucleotide is hybridized with TNA can be cleaved using an enzyme having 5' nuclease activity by various techniques known in the art.

[0317] The cutting site of the PTO depends on the type of primer, the hybridization location of the primer, and the cutting conditions (see U.S. Patents No. 5,210,015, 5,487,972, 5,691,142, 5,994,069 and 7,381,532 or U.S. Application Publication No. 2008-0241838).

[0318] Many conventional techniques can be used for the cutting reaction of a PTO that releases a fragment containing a 5'-tagging site or a portion of a 5'-tagging site.

[0319] Briefly, there may be three cleavage sites in step (ii). The first cleavage site is a junction site between the hybridized site (3'-targeting site) and the non-hybridized site (5'-tagging site) of the PTO. The second cleavage site is a location spaced a few nucleotides in the 3'-direction from the 3'-end of the 5'-tagging site of the PTO. The second cleavage site may be located in the 5'-end part of the 3'-targeting site of the PTO. The third cleavage site is a location spaced a few nucleotides in the 5'-direction from the 3'-end of the 5'-tagging site of the PTO.

[0320] In one embodiment, the location where the cleavage of the PTO is initiated by a template-dependent polymerase having 5' nuclease activity as the PO is extended is the point where the double strand between the PTO and TNA begins, or a location 1-3 nucleotides away from the beginning point.

[0321] In this regard, in the context of cleavage of a PTO by an enzyme having 5' nuclease activity as used herein, the phrase “a PTO fragment comprising a 5'-tagging site of the PTO or a portion of a 5'-tagging site” is used to comprise (i) a 5'-tagging site, (ii) a portion of the 5'-terminus of the 5'-tagging site and the 3'-targeting site (e.g., the first nucleotide at the 5'-terminus of the 3'-targeting site, the first and second nucleotides at the 5'-terminus of the 3'-targeting site, the first and third nucleotides at the 5'-terminus of the 3'-targeting site, the first and fourth nucleotides at the 5'-terminus of the 3'-targeting site, or the first and fifth nucleotides at the 5'-terminus of the 3'-targeting site), and (iii) a portion of the 5'-tagging site. The phrase "fragment containing the 5'-tagging portion of the PTO or part of the 5'-tagging portion" may be referred to as "PTO fragment".

[0322] The term “part” used in the context of a PTO or CTO, such as a part of the 5’-tagging site of a PTO, a part of the 5’-terminal of the 3’-targeting site of a PTO, and a part of the 5’-terminal of the capturing site of a CTO, refers to a nucleotide sequence consisting of 1-40, 1-30, 1-20, 1-15, 1-10, or 1-5 nucleotides, specifically 1, 2, 3, or 4 nucleotides.

[0323] In one embodiment, the PTO has a blocker site comprising a blocker resistant to cleavage by an enzyme having 5' nuclease activity, and the blocker site is used to control the initial cleavage site and / or subsequent cleavage.

[0324] For example, to induce a cut at the junction location between the hybridized region (3'-targeting region) and the non-hybridized region (5'-tagging region) of the PTO, a portion of the 5'-end of the 3'-targeting region of the PTO may be blocked by a blocker.

[0325] In one embodiment, the enzyme having 5' nuclease activity in step (a2) is a polymerase or FEN nuclease having 5' nuclease activity, and in particular is a heat-stable DNA polymerase or FEN nuclease having 5' nuclease activity.

[0326] In the present disclosure, a suitable DNA polymerase having 5' nuclease activity is a heat-stable DNA polymerase obtained from various bacterial species, which includes Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermusspecies Z05, Thermusspecies sps 17, Thermus thermophilus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcus litoralis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga Includes maritima, Thermotoga neapolitana, Thermosiphoafricanus, Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifex pyrophilus, and Aquifex aeolieus. Most preferably, the heat-stable DNA polymerase is Taq polymerase.

[0327] Alternatively, a DNA polymerase having 5' nuclease activity modified to have less polymerase activity may be used. Examples of this include FEN (flap endonuclease) nucleases, specifically 5' flap-specific nucleases.

[0328] Suitable FEN nucleases include FEN nucleases obtained from various bacterial species, including Sulfolocus solfataricus, Pyrobaculum aerophilum, Thermococcus litoralis, Archaeaglobus veneficus, Archaeaglobus profundus, Acidianus brierlyi, Acidianus ambivalens, Desulfurococcus amylolyticus, Desulfurococcus mobilis, Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii, Methanopyrus kandleri, Methanococcus igneus, Pyrococcus horikoshii, Aeropyrum pernix, and Archaeaglobus veneficus.

[0329] In one embodiment, the conditions for cutting the PTO include the extension reaction of PO.

[0330] In one embodiment, a template-dependent polymerase is used to extend the PO, and the template-dependent polymerase is the same enzyme as the enzyme having 5' nuclease activity.

[0331] Alternatively, a template-dependent polymerase is used to extend the above PO, and the template-dependent polymerase is an enzyme different from the enzyme having 5' nuclease activity.

[0332]

[0333] Step (a3): Hybridization of PTO fragments with CTO

[0334] A PTO fragment (a nucleic acid fragment generated from hybridization between a TNA and an additional oligonucleotide according to the present disclosure) is hybridized with a Capturing and Templating Oligonucleotide (CTO).

[0335] In one embodiment, the additional oligonucleotide is a PTO as described above.

[0336] As used herein, the term "PTO fragment" refers to a fragment produced by cutting after hybridization of PTO and TNA.

[0337] The above CTO comprises, in the 3' to 5' direction: (i) a capturing site comprising a nucleotide sequence capable of hybridizing with a PTO fragment, and (ii) a templating site comprising a nucleotide sequence not hybridizing with the PTO. The above CTO does not include a label, for example, the above CTO does not include an interaction double label comprising a reporter moiety and a quencher moiety, or a single label.

[0338] The above PTO fragment is hybridized with the capturing site of the above CTO.

[0339] The above CTO serves as a template for the extension of the PTO fragment. The above PTO fragment, acting as a primer, hybridizes with the CTO and extends to form an extended hybrid.

[0340] The templated region of the CTO may include any sequence as long as it has a sequence that is non-complementary to the 5'-tagging region and the 3'-targeting region of the PTO. Additionally, the templated region of the CTO may include any sequence as long as it can serve as a template for extending the PTO fragment.

[0341] As described above, when a fragment (PTO fragment) having a 5'-tagging site of a PTO is released, the capturing site of the CTO can be designed to include a nucleotide sequence complementary to the 5'-tagging site. When a fragment having a portion of the 5'-terminus of a 5'-tagging site and a 3'-targeting site is released, the capturing site of the CTO can be designed to include a nucleotide sequence complementary to a portion of the 5'-terminus of a 5'-tagging site and a 3'-targeting site. When a fragment having a portion of the 5'-tagging site of a PTO is released, the capturing site of the CTO can be designed to include a nucleotide sequence complementary to a portion of the 5'-tagging site.

[0342] In addition, the capturing site of the CTO can be designed by anticipating the cleavage site of the PTO. For example, if the capturing site of the CTO is designed to include a nucleotide sequence complementary to the 5'-tagging site, a fragment having part of the 5'-tagging site or a fragment having the 5'-tagging site can be hybridized with the capturing site of the CTO and then extended.

[0343] In one embodiment, when a PTO fragment including a 5'-tagging site and a 5'-terminal portion of a 3'-targeting site is released, the 5'-terminal portion of the capturing site of the CTO is designed to include a nucleotide sequence complementary to the 5'-terminal portion of the truncated 3'-targeting site, thereby resolving the problem associated with mismatched nucleotides.

[0344] In one embodiment, the nucleotide sequence of the 5'-terminal portion of the capturing site of the CTO complementary to the 5'-terminal portion of the truncated 3'-targeting site may be selected according to the expected truncation site on the 3'-targeting site of the PTO. The nucleotide sequence of the 5'-terminal portion of the capturing site of the CTO complementary to the 5'-terminal portion of the truncated 3'-targeting site may have a length of 1-10 nucleotides, 1-5 nucleotides, or 1-3 nucleotides.

[0345] The term “capturing site comprising a nucleotide sequence complementary to a 5’-tagging site or a part thereof” as used herein is described herein to include various designs and compositions of the capturing site of the CTO as described above.

[0346] In one embodiment, the CTO may be designed to have a hairpin structure or not have a hairpin structure.

[0347] The length of a CTO can vary. For example, CTO is 5-1000 nucleotides, 5-500 nucleotides, 5-300 nucleotides, 5-100 nucleotides, 5-80 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 7-1000 nucleotides, 7-500 nucleotides, 7-300 nucleotides, 7-100 nucleotides, 7-80 nucleotides, 7-60 nucleotides, 7-40 nucleotides, 15-1000 nucleotides, 15-500 nucleotides, 15-300 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 20-1000 It is a length of nucleotide, 20-500 nucleotides, 20-300 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-40 nucleotides, 30-1000 nucleotides, 30-500 nucleotides, 30-300 nucleotides, 30-100 nucleotides, 30-80 nucleotides, 30-60 nucleotides, or 30-40 nucleotides.

[0348] The capturing site of the CTO can have any length as long as it specifically hybridizes to the PTO fragment. For example, the capturing site of the CTO is 5-100 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 5-20 nucleotides, 10-100 nucleotides, 10-60 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 15-100 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 15-30 nucleotides, or 15-20 nucleotides in length.

[0349] The templated portion of the CTO can have any length as long as it can function as a template in the extension of the PTO fragment. For example, the templated site of the CTO is 1-900 nucleotides, 1-400 nucleotides, 1-300 nucleotides, 1-100 nucleotides, 1-80 nucleotides, 1-60 nucleotides, 1-40 nucleotides, 1-20 nucleotides, 2-900 nucleotides, 2-400 nucleotides, 2-300 nucleotides, 2-100 nucleotides, 2-80 nucleotides, 2-60 nucleotides, 2-40 nucleotides, 2-20 nucleotides, 5-900 nucleotides, 5-400 nucleotides, 5-300 nucleotides, 5-100 nucleotides, 5-80 nucleotides, 5-60 nucleotides, The length is 5-40 nucleotides, 5-30 nucleotides, 10-900 nucleotides, 10-400 nucleotides, 10-300 nucleotides, 15-900 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, or 15-20 nucleotides.

[0350] In one embodiment, the 3'-end of the CTO may have a 3'-OH terminal. Alternatively, the 3'-end of the CTO is blocked so that its extension is prevented. The method of blocking the CTO can be described in detail by referring to the description of the method of blocking the PTO described above.

[0351] The PTO fragment is hybridized with the CTO to provide a shape suitable for the extension of the PTO fragment. The non-truncation PTO is also hybridized with the capturing region of the CTO through its 5'-tagging region, but its 3'-targeting region is not hybridized with the CTO, so its extension is prevented.

[0352]

[0353] Step (a4): Generation of the first extended strand (ES) by extension of the PTO fragment

[0354] The PTO fragment hybridized with the capturing site of the CTO is extended along the templating site of the CTO using a DNA polymerase having 5' nuclease activity to generate a first ES. On the other hand, the uncut PTO hybridized with the capturing site of the CTO is not extended, and thus the first ES is not formed.

[0355] In step (a4), the PTO fragment hybridized to the capturing site of the CTO is extended by a DNA polymerase having 5' nuclease activity along the templating site of the CTO as a template.

[0356] The term "first ES" used in relation to the extension reaction of the PTO fragment in step (a4) encompasses the PTO fragment and its extended sequence. In other words, the first ES refers to the strand excluding CTO among the extended hybrids.

[0357] As used herein, the term "extended hybrid" means a hybrid or dimer between the first ES and the CTO.

[0358] The DNA polymerase with 5' nuclease activity used in step (a4) may be the same or different from the DNA polymerase with 5' nuclease activity used in step (a2).

[0359] All or part of the above first ES may be hybridized with LO.

[0360] Various hybridization methods between the first ES or CO and LO are exemplified in FIGS. 4 and 5.

[0361] As shown in Figure 4, the LO may have a reporter moiety connected to the 5'-end and a quencher moiety connected to the 3'-end.

[0362] As shown in FIG. 4, LO may hybridize only to the extended sequence of the first ES, which consists of a PTO fragment (indicated by a solid line) and an extended sequence (indicated by a dotted line) (top); LO may hybridize to a part of the first ES (middle); or LO may hybridize to the entire first ES (bottom).

[0363] As shown in Figure 5, the LO may have a quencher moiety connected to the 5'-terminus and a reporter moiety connected in the middle of the sequence.

[0364] As shown in FIG. 5, LO may hybridize only to the extended sequence of the first ES, which consists of a PTO fragment (indicated by a solid line) and an extended sequence (indicated by a dotted line) (top); LO may hybridize to a part of the first ES (middle); or LO may hybridize to the entire first ES (bottom). In addition to the first ES, LO may hybridize with CO.

[0365]

[0366] Step (a5): Hybridization of the first extension strand (ES) with the LO

[0367] The first ES generated by step (a4) is hybridized with the LO.

[0368] For hybridization between the first ES and LO, a step of denaturing the extended hybrid between the first ES and CTO may be additionally performed before carrying out step (a5). During the denaturation step, the extended hybrid is dissociated to create an environment in which the first ES can come into contact with LO. Denaturation may be carried out by conventional techniques including, but not limited to, heat, alkali, formamide, urea, and glycoxal treatment, enzymatic methods (e.g., helicase action), and binding proteins. For example, denaturation may be achieved by heating in a temperature range of 80-105°C. A general method for achieving such treatment is disclosed in the literature [Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001)].

[0369] The LO used in step (a5) comprises (i) a capturing site comprising a nucleotide sequence capable of hybridizing with the first ES and (ii) a templating site comprising a nucleotide sequence not hybridizing with the first ES. Thus, the first ES hybridizes with the capturing site of the LO.

[0370] The capturing portion of LO serves to hybridize with the first ES, and the templating portion of LO serves as a mold that further extends the first ES.

[0371] According to one embodiment, the capturing site of the LO includes a nucleotide sequence identical to all or part of the nucleotide sequence of the template site of the CTO.

[0372] According to one embodiment, the capturing site of the LO contains a nucleotide sequence identical to all or part of the nucleotide sequence of the template site of the CTO, and said identical sequence is not present in the template site of the LO and / or the capturing site of the CTO. In other words, the template site of the LO and / or the capturing site of the CTO does not contain a nucleotide sequence identical to all or part of the nucleotide sequence of the template site of the CTO.

[0373] The term "identical" is used herein to mean that two nucleotide sequences are identical to each other and includes the terms "substantially identical" and "completely identical." The term "completely identical" means that two nucleotide sequences are identical without exception of any nucleotides, whereas the term "substantially identical" means that two nucleotide sequences are similar having some different nucleotides (e.g., 1-10, 1-7, 1-5, and 1-3 nucleotides). The term "substantially identical" also means that some different nucleotides are present to an extent that does not interfere with hybridization between the capturing sites of the first ES and LO. The term "identical" also means that at least 5, 6, 7, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides are identical between the two nucleotide sequences.

[0374] These sequence identity or differences between specific regions of CTO and LO allow for distinction between CTO and LO.

[0375] The CTO used in this document serves to extend the PTO fragment by hybridizing it, whereas the LO serves to extend the 1st ES by hybridizing it. Therefore, the CTO is distinguished from the LO.

[0376] In one embodiment, the capturing site of LO is hybridized with the entire first ES. To this end, the capturing site of LO may be designed to include a hybridized nucleotide sequence for the entire first ES.

[0377] In another embodiment, the capturing site of LO is hybridized with a portion of the first ES comprising a PTO fragment and an extended sequence. To this end, the capturing site of LO may be designed to include a hybridized nucleotide sequence for the portion of the first ES.

[0378] In another embodiment, the capturing site of LO is hybridized only to the entire extended sequence excluding the PTO fragment. To this end, the capturing site of LO may be designed to include a nucleotide sequence hybridized to the entire extended sequence.

[0379] In another embodiment, the capturing site of LO is hybridized only to a portion of the extended sequence excluding the PTO fragment. To this end, the capturing site of LO may be designed to include a nucleotide sequence hybridized to said portion of the extended sequence.

[0380] Since the first ES hybridized to LO is further extended in step (a6) described below, the capturing site of LO needs to be hybridized with the 3'-terminal portion of the first ES. According to one embodiment, the capturing site of LO has at its 5'-terminus (i) a nucleotide complementary to at least the first nucleotide of the 3'-terminus of the first ES; (ii) a nucleotide complementary to at least the first and second nucleotides of the 3'-terminus of the first ES; or (iii) a nucleotide complementary to at least the first, second, and third nucleotides of the 3'-terminus of the first ES.

[0381] According to one embodiment, the capturing site of the LO has a nucleotide sequence that is non-hybridized with respect to the PTO fragment. According to a specific embodiment, the capturing site of the LO has a nucleotide sequence that does not hybridize to the entire PTO fragment. In other words, the capturing site of the LO includes a nucleotide sequence that hybridizes with a portion of the PTO fragment and a sequence extended therefrom, or includes a nucleotide sequence that hybridizes with the entire extended sequence excluding the PTO fragment.

[0382] According to one embodiment of the present invention, the capturing site of the LO comprises a hybridized nucleotide sequence for the extended sequence. In other words, the capturing site of the LO comprises a hybridized nucleotide sequence for all or part of the extended sequence.

[0383] In addition, the capturing site of LO has non-hybridized nucleotide sequences for TNA, PTO, and CTO.

[0384] The template site of LO contains a non-hybridized nucleotide sequence for the first ES, and thus the template site of LO is not hybridized to the first ES.

[0385] Additionally, the template site of LO has a non-hybridized nucleotide sequence for TNA, PTO, and CTO, and therefore, the template site of LO is not hybridized to TNA, PTO, and CTO.

[0386] The template site of LO may include any sequence as long as it does not hybridize to the aforementioned site. Additionally, the template site of LO may include any sequence as long as it can function as a template for further extension of the first ES.

[0387] The 3'-terminus of the LO may include additional nucleotides that do not participate in hybridization with the first ES.

[0388] LO can be designed to have a hairpin structure or not have a hairpin structure.

[0389] The length of LO can vary. For example, LO is 5-1000 nucleotides, 5-500 nucleotides, 5-300 nucleotides, 5-100 nucleotides, 5-80 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 7-1000 nucleotides, 7-500 nucleotides, 7-300 nucleotides, 7-100 nucleotides, 7-80 nucleotides, 7-60 nucleotides, 7-40 nucleotides, 15-1000 nucleotides, 15-500 nucleotides, 15-300 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 20-1000 It is a nucleotide, 20-500 nucleotides, 20-300 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-40 nucleotides, 30-1000 nucleotides, 30-500 nucleotides, 30-300 nucleotides, 30-100 nucleotides, 30-80 nucleotides, 30-60 nucleotides, or 30-40 nucleotide length.

[0390] The capturing site of LO can have any length as long as it specifically hybridizes to the first ES. For example, the capturing site of LO is 5-100 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 5-20 nucleotides, 10-100 nucleotides, 10-60 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 15-100 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 15-30 nucleotides, or 15-20 nucleotides in length.

[0391] The templating portion of LO can have any length as long as it functions as a mold for further extension of the first ES. For example, the template site of the LO is 1-900 nucleotides, 1-400 nucleotides, 1-300 nucleotides, 1-100 nucleotides, 1-80 nucleotides, 1-60 nucleotides, 1-40 nucleotides, 1-20 nucleotides, 2-900 nucleotides, 2-400 nucleotides, 2-300 nucleotides, 2-100 nucleotides, 2-80 nucleotides, 2-60 nucleotides, 2-40 nucleotides, 2-20 nucleotides, 5-900 nucleotides, 5-400 nucleotides, 5-300 nucleotides, 5-100 nucleotides, 5-80 nucleotides, 5-60 nucleotides, The length is 5-40 nucleotides, 5-30 nucleotides, 10-900 nucleotides, 10-400 nucleotides, 10-300 nucleotides, 15-900 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, or 15-20 nucleotides.

[0392] The 3'-end of LO may have a 3'-OH end. Alternatively, the 3'-end of LO is blocked to prevent its extension. Blocking of LO can be achieved according to conventional methods.

[0393] The LO used in steps (a5) and (a6) can be hybridized with a non-cutting PTO depending on its design method. Nevertheless, the 3'-targeting portion of the PTO is not hybridized with the LO so that its extension is prevented.

[0394] In the aforementioned process, CTO may compete with LO for hybridization with the first ES, thereby hindering hybridization between the first ES and LO. That is, hybridization between the first ES and LO may be hindered by the formation of a hybrid between the first ES and CTO. Therefore, in order to minimize the hindrance to hybridization between the first ES and LO, step (a5) may be performed under conditions favorable to hybridization between the first ES and LO.

[0395]

[0396] Step (a6): Generation of the second ES by extension of the first ES

[0397] The first ES hybridized with the capturing site of the LO is extended along the templating site of the LO using a DNA polymerase having 5' nuclease activity to produce a second ES.

[0398] If the capturing site of LO contains a nucleotide sequence that hybridizes with the PTO fragment, the uncut PTO may hybridize with the capturing site of LO but is not extended and thus does not form a second ES; if the capturing site of LO does not contain a nucleotide sequence that hybridizes with the PTO fragment, the uncut PTO is not hybridized to LO and thus a second ES is not formed.

[0399] Afterwards, LO may be hybridized with CO to form a first hybrid, or LO may be hybridized with the second ES to form a second hybrid.

[0400] All or part of the above second ES may be hybridized with LO.

[0401] Various hybridization methods between the above-mentioned second ES or CO and LO are exemplified in FIGS. 6 and 7.

[0402] As shown in Fig. 6, the LO may have a reporter moiety connected to the 5'-end and a quencher moiety connected to the 3'-end.

[0403] As shown in FIG. 6, LO may hybridize only to the second extended sequence of the second ES, which consists of a PTO fragment (indicated by a black solid line), a first extended sequence (indicated by a gray solid line), and a second extended sequence (indicated by a dotted line) (top); LO may hybridize to a part of the second ES (middle); or LO may hybridize to the entire second ES (bottom).

[0404] As shown in Figure 7, the LO may have a quencher moiety connected to the 5'-terminus and a reporter moiety connected in the middle of the sequence.

[0405] As shown in FIG. 7, LO may hybridize only to the second extended sequence of the second ES, which consists of a PTO fragment (indicated by a black solid line), a first extended sequence (indicated by a gray solid line), and a second extended sequence (indicated by a dotted line) (top); LO may hybridize to a part of the second ES (middle); or LO may hybridize to the entire second ES (bottom).

[0406]

[0407] Step (b): Amplification reaction to TNA

[0408] Next, an amplification reaction for the above TNA is performed under amplification conditions.

[0409] In one embodiment, step (b) repeats the cycle of denaturation of TNA, annealing of TNA and PO, and extension of PO. These repetitions amplify TNA and / or a signal indicating the presence of TNA.

[0410] In one embodiment, step (b) is carried out in the presence of a downstream primer.

[0411] In one embodiment, the amplification reaction for the TNA is real-time PCR.

[0412] During the amplification reaction of step (b), the formation of a first hybrid and the generation of a background signal therefrom, and the formation of a second hybrid and the generation of a target signal therefrom are carried out.

[0413] During the above amplification reaction, LO hybridizes with CO to form a first hybrid, or LO hybridizes with TNA or nucleic acid generated dependent on its presence to form a second hybrid, and the formation of the first hybrid and the formation of the second hybrid each generate signals that are indistinguishable from one another.

[0414] According to one embodiment, during the amplification reaction, (i) when TNA is absent in the sample, only a first hybrid is formed to generate a background signal, and (ii) when TNA is present in the sample, a second hybrid is formed to generate a target signal.

[0415] According to the present disclosure, the melting temperature (Tm1) of the first hybrid is different from the melting temperature (Tm2) of the second hybrid, and the formation of the hybrid having a higher melting temperature among the first and second hybrids is competitively advantageous than the formation of the hybrid having a lower melting temperature.

[0416] Specifically, when the formation of the second hybrid is competitively advantageous compared to the formation of the first hybrid, the probability of LO hybridizing to TNA or the nucleic acid generated dependent on its presence becomes higher than the probability of LO hybridizing to CO. Therefore, as the amplification reaction proceeds, the formation of the second hybrid increases, thereby providing a target signal.

[0417] In cases where the formation of a second hybrid is competitively advantageous compared to the formation of a first hybrid, the method of the present disclosure can determine the presence of TNA by confirming an increase in the amount of the second hybrid during or after the amplification reaction of TNA. For example, the presence of TNA can be determined if the amount of the second hybrid after the amplification reaction of TNA increases compared to the amount of the second hybrid before the amplification reaction of TNA.

[0418]

[0419] Step (c): Detection of target signal

[0420] In this step, a target signal is detected. The detected target signal indicates the presence of TNA.

[0421] As used herein, the term "target signal" refers to a signal generated by the presence of TNA, that is, a signal indicating the presence of TNA. According to the method of the present disclosure, the first hybrid is formed independently of the presence of TNA, and the second hybrid is formed due to the presence of TNA. Accordingly, as used herein, the term "target signal" refers to a signal generated by the formation of the second hybrid.

[0422] In contrast, the term "background signal" as used herein refers to a signal that occurs independently of the presence of TNA. According to the method of the present disclosure, since the first hybrid is formed independently of the presence of TNA, the signal generated therefrom corresponds to a "background signal."

[0423] In this document, the signal includes a signal from a label (signal generation or extinction), a change in the signal from the label (signal increase or decrease), a melting curve, a melting pattern, and a melting temperature (or Tm value).

[0424] In this invention, the target signal is a signal generated when LO and TNA constituting the second hybridization, or nucleic acids generated dependent on their presence, bind or dissociate.

[0425] The terms "association" or "dissociation" have the same meaning as the terms "hybridization" or "denaturation."

[0426] According to one embodiment of the method of the present disclosure, when the LO exists as a single strand, the reporter moiety and the quencher moiety of the LO are structurally close to each other so that the quencher moiety quenches the signal from the reporter moiety, whereas when the LO hybridizes with TNA or nucleic acid or CO generated dependent on the presence thereof, the reporter moiety and the quencher moiety of the LO are structurally separated so that the quencher moiety unquenches the signal from the reporter moiety (see FIG. 8).

[0427] According to one embodiment of the method of the present disclosure, when the formation of a second hybrid (LO / TNA hybrid) is competitively more favorable than the formation of a first hybrid (LO / CO), the second hybrid is formed in the presence of TNA, and this increases as TNA is amplified. Conversely, as TNA is amplified, the content of the first hybrid is maintained or decreased. This change in the content of the second hybrid leads to a change in the signal, which provides a target signal indicating the presence of TNA.

[0428] In the present disclosure, the terms “content” or “amount” used when referring to a hybrid (e.g., a first hybrid or a second hybrid) refer to the amount of two nucleic acid strands constituting the hybrid. In one embodiment, the two nucleic acid strands constituting the hybrid may exist in a dissociated form or a combined form depending on the temperature. In this case, the content of the second hybrid may be used to mean the sum of the amount of the second hybrid existing in the combined form and the amount of the second hybrid existing in the dissociated form.

[0429] In step (c) above, the measurement of the target signal may be performed in a real-time manner, an endpoint manner, or a predetermined time interval manner. For example, if the method of the present disclosure is performed by real-time PCR, the measurement of the target signal may be performed at a specific temperature at each cycle, at cycles of a fixed interval, or at the final cycle.

[0430] In one embodiment, detection of the target signal is performed at a temperature favorable for either the first hybridization and the second hybridization to dissociate into two single strands while the other maintains a double strand.

[0431] The favorable temperature described above should not be interpreted as referring to a temperature that causes one molecule of the hybrid to become a single strand or a double strand. According to the method of the present disclosure, numerous hybrids are formed during the amplification reaction, and the description above implies behavior of a significantly high proportion of the hybrids. That is, the favorable temperature described above refers to a temperature that causes a significantly high proportion of the hybrids to become a single strand or a double strand, for example, most of the hybrids, for example, more than 50%, more than 60%, more than 70%, more than 80%, or more than 90% of the hybrids.

[0432] In a specific embodiment, detection of the target signal is performed at a temperature favorable for the first hybrid to dissociate into two single strands while the second hybrid maintains a double strand. In other words, detection of the target signal is performed at a temperature favorable for most of the first hybrid to dissociate into two single strands while most of the second hybrid maintains a double strand. Detection of the target signal may be performed when Tm1 of the first hybrid is lower than Tm2 of the second hybrid.

[0433] In a specific embodiment, detection of the target signal is performed at a temperature favorable for the second hybrid to dissociate into two single strands while the first hybrid maintains a double strand. In other words, detection of the target signal is performed at a temperature favorable for most of the second hybrid to dissociate into two single strands while most of the first hybrid maintains a double strand. Detection of the target signal may be performed when Tm1 of the first hybrid is higher than Tm2 of the second hybrid.

[0434] In one embodiment, detection of the target signal is not performed at a temperature favorable for both the first hybrid and the second hybrid to dissociate into two single strands or to maintain a double strand.

[0435] In one embodiment, the measurement of the target signal in step (c) is performed at a temperature between Tm1 and Tm2.

[0436] When Tm1 is lower than Tm2, ​​at temperatures between Tm1 and Tm2, ​​most of the first hybridization dissociates into two single strands, causing no change in signal even though TNA is amplified, whereas most of the second hybridization maintains double strands, causing a change in signal as TNA is amplified.

[0437] When Tm1 is lower than Tm2, ​​the temperature at which the target signal is measured is at least 1°C, 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, 16°C, 17°C, 18°C, or 19°C higher than Tm1 and at least 1°C, 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, 16°C, 17°C, 18°C, or 19°C lower than Tm2.

[0438] For example, if Tm1 is 5 to 20°C lower than Tm2, ​​the temperature at which the signal is measured may be 3 to 19°C higher than Tm1 and lower than Tm2.

[0439] The temperature between Tm1 and Tm2 above falls within the signal-change temperature range as described elsewhere in this invention.

[0440] When Tm1 is lower than Tm2, ​​at temperatures lower than Tm1, LO (mostly) hybridizes with CO in the absence of TNA to generate a background signal, whereas in the presence of TNA, LO (mostly) hybridizes with TNA or nucleic acids generated dependent on its presence instead of hybridizing with CO to generate a signal. Therefore, at temperatures lower than Tm1 and Tm2, ​​no change in the signal in the presence of TNA is observed compared to the signal in the absence of TNA. On the other hand, at temperatures between Tm1 and Tm2, ​​LO (mostly) fails to hybridize with CO in the absence of TNA and exists in a dissociated state, thus not generating a signal, whereas in the presence of TNA, LO (mostly) hybridizes with TNA or nucleic acids generated dependent on its presence to generate a signal. Furthermore, at temperatures exceeding both Tm1 and Tm2, ​​in the absence of TNA, LO (mostly) fails to hybridize with CO and exists in a dissociated state, thus failing to generate a signal; similarly, in the presence of TNA, LO (mostly) fails to hybridize with TNA or nucleic acids generated dependently on its presence and exists in a dissociated state, also failing to generate a signal. Therefore, at temperatures exceeding both Tm1 and Tm2, ​​no change in the signal in the presence of TNA is observed compared to the signal in the absence of TNA.

[0441] Therefore, a change in the signal in the presence of TNA can be observed compared to the signal in the absence of TNA at temperatures between Tm1 and Tm2.

[0442] Thus, the method according to the present disclosure enables the detection of the presence of TNA or nucleic acids generated dependently on its presence by measuring a target signal at temperatures between Tm1 and Tm2.

[0443] The measurement of the target signal in step (c) according to the present method can generate, for example, a plot of signal intensity against time or cycles, i.e., an amplification curve. Typically, in the amplification curve, the X-axis represents time or cycles, and the Y-axis represents the intensity of the fluorescence signal.

[0444] In this step, the detection of the target signal is performed by comparing the signal detected during the amplification reaction with the background signal. Specifically, the detection of the target signal is performed by measuring the change in the signal compared with the background during the amplification reaction.

[0445] The change in the detected signal above corresponds to the target signal according to the present disclosure, and indicates the presence of the second hybrid and the presence of TNA accordingly.

[0446] As mentioned above, when Tm1 is lower than Tm2, ​​at temperatures between Tm1 and Tm2, ​​LO does not hybridize with CO in the absence of TNA and exists in a dissociated state, thereby not generating a signal; whereas, in the presence of TNA, LO hybridizes to TNA or nucleic acids generated dependent on its presence, thereby generating a signal.

[0447] Considering that the signal prior to the amplification reaction corresponds to the signal in the absence of TNA, i.e., the background signal, if the intensity of the signal measured during the amplification reaction at temperatures between Tm1 and Tm2 is insignificant compared to the intensity of the background signal prior to the amplification reaction, the absence of TNA can be determined, whereas if the intensity of the signal measured during the amplification reaction at temperatures between Tm1 and Tm2 is significantly increased or decreased compared to the intensity of the background signal prior to the amplification reaction, the presence of TNA can be determined.

[0448] Changes in the signal compared to the background signal prior to such amplification reactions can be detected by various conventionally known methods.

[0449] In one embodiment, the change in the signal may be determined using a predetermined threshold having a signal intensity greater than the intensity of the background signal before the amplification reaction. For example, if the measured signal is greater than the predetermined threshold, the presence of TNA may be determined. Alternatively, when the measured signal is plotted as an amplification curve, the presence of TNA may be determined if the amplification curve crosses the predetermined threshold. Alternatively, when the measured signal is plotted as an amplification curve, the presence of TNA may be determined if the difference or ratio between two cycles, such as the difference or ratio of signal intensity between one cycle in the background region and one cycle in the plateau region (e.g., the last cycle), is greater than the predetermined threshold.

[0450] In another embodiment, the change in the signal may be determined by the fitting accuracy after fitting the signal data obtained from the amplification response to a nonlinear function. The nonlinear function may be, for example, a polynomial function, an exponential function, a logarithmic function, a trigonometric function, or a sigmoid function, preferably a sigmoid function. The sigmoid function refers to a function capable of representing a sigmoid-shaped curve and includes a logistic function, a Gompertz function, or a Chapman function. The fitting accuracy refers to how closely the nonlinear function approximates the actual measurements (e.g., a data set), i.e., the goodness of fit, and is typically R 2 It is represented as a value. For example, R 2 If the value is greater than 0.90, the presence of TNA can be determined, otherwise the absence of TNA can be determined.

[0451] In another embodiment, the change in the signal may be determined by a Ct (Cycle threshold) value or a Cq (quantification cycle) value. The Ct value may be determined, for example, as the cycle number at which the amplification curve and the threshold intersect by applying a threshold to the amplification curve. Additionally, the Cq value may be determined, for example, as a First Derivative Maximum (FDM) or Second Derivative Maximum (SDM). Subsequently, if the determined Ct value or Cq value is greater than a predetermined cycle number, for example, 15 cycles, 20 cycles, or 30 cycles, the presence of TNA may be determined, and if not, the absence of TNA may be determined.

[0452] As mentioned above, the composition for detecting TNA used in the method according to the present disclosure corresponds to the InterSC-type composition among the three types of compositions disclosed in International Application Publication WO2022-265463.

[0453] Specifically, a composition for detecting TNA used in the method according to the present disclosure exhibits a melting profile having one Signal-Changing Temperature Range (SChTR) in which the signal changes depending on the presence of TNA, and two Signal-Constant Temperature Ranges (SCoTR) in which the signal remains constant despite the presence of TNA. Here, the Signal-Changing Temperature Range is higher than the first Signal-Constant Temperature Range among the two Signal-Constant Temperature Ranges and lower than the second Signal-Constant Temperature Range among the two Signal-Constant Temperature Ranges.

[0454] A composition for detecting TNA used in the method according to the present disclosure is described in detail below.

[0455]

[0456] II. Composition for detecting TNA in a sample by a competitive hybridization-based signaling assay

[0457] In another aspect, the present disclosure provides a composition for detecting a target nucleic acid (TNA) in a sample by a Competitive Hybrids-based Signaling Assay (CHYSA), comprising:

[0458] (i) a labeled oligonucleotide (LO) comprising a nucleotide sequence hybridizable with the nucleic acid generated dependently on the presence of the TNA or the above, and a label attached thereto, and

[0459] (ii) A competing oligonucleotide (CO) having a nucleotide sequence capable of hybridizing with the LO and competing with the nucleic acid generated dependently on the presence of the TNA or its hybridization with the LO,

[0460] The above LO can generate a background signal by forming a first hybridized compound through hybridization with the above CO, and the above LO can also generate a target signal by forming a second hybridized compound through hybridization with the above TNA or a nucleic acid generated dependent on the presence thereof.

[0461] The melting temperature (Tm1) of the first hybrid and the melting temperature (Tm2) of the second hybrid are different, and the formation of the hybrid having a higher melting temperature among the first and second hybrids is competitively advantageous than the formation of the hybrid having a lower melting temperature.

[0462]

[0463] Since Aspect II of the present disclosure, "composition for detecting TNA in a sample by a competitive hybridization-based signaling assay," is configured to enable the implementation of the "method for detecting TNA in a sample by a competitive hybridization-based signaling assay" of Aspect I described above, the common details between them are omitted to avoid excessive complexity in this specification.

[0464] In one embodiment, the LO has a reporter moiety and a quencher moiety positioned to generate a signal when the first hybrid and the second hybrid are formed.

[0465] In one embodiment, prior to the formation of the first hybrid or the second hybrid, the reporter moiety and the quencher moiety on the LO are close to each other so that the quencher moiety quenches the signal from the reporter moiety, whereas upon the formation of the first hybrid or the second hybrid, the reporter moiety and the quencher moiety on the LO are spatially separated from each other so that the quencher moiety unquenches the signal from the reporter moiety.

[0466] In one embodiment, the LO has a single label positioned to generate a signal upon the formation of the first hybrid and the second hybrid.

[0467] In one embodiment, the CO has a nucleotide sequence of different length and / or different bases compared to the TNA or nucleic acid generated dependently on its presence.

[0468] In one embodiment, the CO comprises one or more non-complementary bases or universal bases for the LO.

[0469] In one embodiment, the universal base is deoxyinosine.

[0470] In one embodiment, the CO has a shorter length than the LO.

[0471] In one embodiment, the Tm1 is at least 3°C ​​lower than the Tm2.

[0472] In one embodiment, the three ends of the CO and LO are blocked so that they are not extended.

[0473] In one embodiment, the amplification reaction for the TNA is real-time PCR.

[0474] In one embodiment, the composition further comprises a primer oligonucleotide (PO) for amplifying TNA.

[0475] In one embodiment, the composition exhibits a melting profile having one Signal-Changing Temperature Range (SChTR) in which the signal changes depending on the presence of TNA, and two Signal-Constant Temperature Ranges (SCoTR) in which the signal remains constant despite the presence of TNA.

[0476] In one embodiment, the signal-change temperature range is higher than the first signal-constant temperature range among the two signal-constant temperature ranges and lower than the second signal-constant temperature range among the two signal-constant temperature ranges.

[0477] In one embodiment, the composition of the present disclosure, during an amplification reaction, (i) when TNA is absent in the sample, only a first hybrid is formed to generate a background signal, and (ii) when TNA is present in the sample, a second hybrid is formed to generate a target signal.

[0478] In one embodiment, detection of the target signal is performed at a temperature favorable for either the first hybrid and the second hybrid to dissociate into two single strands while the other maintains a double strand.

[0479] In one embodiment, detection of the target signal is not performed at a temperature favorable for both the first hybrid and the second hybrid to dissociate into two single strands or to maintain a double strand.

[0480] In one embodiment, when Tm2 is higher than Tm1, the composition of the present disclosure dissociates into two single strands of the first hybrid, while the second hybrid generates a target signal at a temperature favorable for maintaining a double strand.

[0481] In one embodiment, when Tm2 is lower than Tm1, the composition of the present disclosure generates a target signal at a temperature favorable for the second hybrid to dissociate into two single strands, while the first hybrid maintains a double strand.

[0482] In one embodiment, the composition of the present disclosure generates a target signal at a temperature between Tm1 and Tm2.

[0483] When Tm2 is higher than Tm1, LO in the composition of the present disclosure is hybridized with CO at a temperature lower than Tm1 in the absence of TNA to form a first hybrid, and the formation of said first hybrid generates a background signal. However, said background signal does not change during or after the reaction, that is, it does not provide a signal change.

[0484] When Tm2 is higher than Tm1, LO in the composition of the present disclosure at a temperature between Tm1 and Tm2 in the absence of TNA does not hybridize with CO to form a first hybrid, which does not generate a signal.

[0485] When Tm2 is higher than Tm1, LO in the composition of the present disclosure at a temperature higher than Tm2 in the absence of TNA does not hybridize with CO and does not form a first hybrid, which does not generate a signal.

[0486] In contrast, when Tm2 is higher than Tm1, LO in the composition of the present disclosure at a temperature lower than Tm1 in the presence of TNA preferentially hybridizes to TNA or nucleic acid generated dependently on its presence rather than CO to form a second hybrid, and the formation of said second hybrid generates a signal. However, the signal generated from the second hybrid in the presence of TNA is similar to the signal generated from the first hybrid in the absence of TNA and does not provide a signal change.

[0487] When Tm2 is higher than Tm1, in the absence of TNA, LO in the composition of the present disclosure at a temperature between Tm1 and Tm2 preferentially hybridizes to TNA or nucleic acid generated dependent on its presence rather than CO to form a second hybrid, and the formation of said second hybrid generates a signal. When the nucleic acid generated dependent on TNA or its presence is amplified to a significant amount through an amplification reaction, for example, when the amount of amplified TNA or nucleic acid generated dependent on its presence is greater than the LO included in the reaction (e.g., after the mid-cycle of the amplification reaction, specifically after the terminal cycle), the amount of the first hybrid decreases while the amount of the second hybrid increases. That is, the second hybrid is predominantly present over the first hybrid.

[0488] When Tm2 is higher than Tm1, LO in the composition of the present disclosure at a temperature higher than Tm2 in the absence of TNA does not hybridize with CO and does not form a first hybrid, which does not generate a signal.

[0489] As described above, at temperatures between Tm1 and Tm2 of the amplification reaction, the first hybrid dissociates and does not generate a signal, whereas the second hybrid maintains a double-stranded state and generates a signal. Therefore, when TNA is present, a stronger signal is generated than the signal provided in the absence of TNA, such as the signal provided by the first hybrid, which may indicate the presence of the second hybrid, i.e., the presence of TNA.

[0490] As such, the composition of the present disclosure does not provide a signal change at a temperature lower than Tm1, provides a signal change at a temperature between Tm1 and Tm2, ​​and does not provide a signal change at a temperature higher than Tm2.

[0491] In other words, the composition of the present disclosure exhibits a melting profile having one signal-change temperature range (SChTR) in which the signal changes depending on the presence of TNA, and two signal-constant temperature ranges (SCoTR) in which the signal remains constant despite the presence of TNA.

[0492] In one embodiment, the composition exhibits a melting profile having a signal-change temperature range that is greater than the first signal-constant temperature range and lower than the second signal-constant temperature range among two signal-constant temperature ranges.

[0493] In one embodiment, the expression “one temperature range is lower than another temperature range” used in relation to the signal-change temperature range and the signal-constant temperature range of the composition means that the maximum temperature within one temperature range is lower than the minimum temperature within another temperature range. Conversely, the expression “one temperature range is higher than another temperature range” means that the minimum temperature within one temperature range is higher than the maximum temperature within another temperature range. For example, the expression “the signal-constant temperature range is higher than the signal-change temperature range” means that the minimum temperature within the signal-constant temperature range is higher than the maximum temperature within the signal-change temperature range.

[0494] The generation of a signal according to temperature of the composition of the present disclosure is exemplified in FIG. 8.

[0495] Figure 8 shows the interaction between LO and CO in the absence of TNA (top) and the interaction between LO, CO, and TNA in the presence of TNA (bottom).

[0496] In the absence of TNA, in the first signal-constant temperature range, for example at a temperature lower than Tm1, a first hybrid is formed between LO and CO, which separates the reporter moiety and the quencher moiety to generate a signal. In the signal-change temperature range, for example at a temperature between Tm1 and Tm2, ​​and in the second signal-constant temperature range, for example at a temperature higher than Tm2, ​​LO does not form the first hybrid and exists as a single strand, which brings the reporter moiety and the quencher moiety close together and does not generate a signal.

[0497] When TNA is present, in the first signal-constant temperature range, for example at a temperature lower than Tm1, and in the signal-change temperature range, for example at a temperature between Tm1 and Tm2, ​​a second hybrid is formed between LO and TNA, which separates the reporter moiety and the quencher moiety to generate a signal. In the second signal-constant temperature range, for example at a temperature higher than Tm2, ​​LO does not form the first hybrid or the second hybrid and exists as a single strand, which brings the reporter moiety and the quencher moiety close together and does not generate a signal.

[0498] As shown in FIG. 8, in the first signal-constant temperature range, a signal is generated both in the absence of TNA and in the presence of TNA, so no signal change is provided; in the signal-change temperature range, a signal is not generated in the absence of TNA but a signal is generated in the presence of TNA, so a signal change (i.e., target signal) is provided; and in the second signal-constant temperature range, a signal is not generated both in the absence of TNA and in the presence of TNA, so no signal change (i.e., target signal) is provided.

[0499] As such, the composition of the present disclosure exhibits a melting profile having a signal-constant temperature range (SCoTR)-signal-change temperature range (SChTR)-signal-constant temperature range (SCoTR) in order from low temperature to high temperature.

[0500] International application publication WO2022-265463 discloses that various known conventional signal generation methods for detecting TNA exhibit a melting profile having a temperature range in which the signal changes depending on the presence of TNA (i.e., a signal-change temperature range) and a temperature range in which the signal does not change even when TNA is present (i.e., a signal-constant temperature range). The aforementioned literature discloses that various conventional signal generation methods can be classified into one of the following based on the number and order of such signal-change temperature ranges and signal-constant temperature ranges: (i) an UnderSC-type signal generation method (UnderSC-type composition) in which the signal-change temperature range has a melting profile lower than the signal-constant temperature range; (ii) an OverSC-type signal generation method (OverSC-type composition) in which the signal-change temperature range has a melting profile higher than the signal-constant temperature range; and (iii) an InterSC-type signal generation method (InterSC-type composition) in which the signal-change temperature range has a melting profile higher than one of the two signal-constant temperature ranges and lower than the other signal-constant temperature range. Furthermore, the literature proposes that by combining the three types of signal generation methods in various ways, multiple TNAs can be detected in a single reaction vessel using a single type of label and a single type of detector.

[0501] The method for detecting TNA proposed in the aforementioned international application publication WO2022-265463 utilizes n different compositions corresponding to each TNA to detect n different TNAs using a single label in a single reaction vessel, wherein each of the n different compositions is subjected to any one of the aforementioned UnderSC-, OverSC-, and InterSC-type signal generation methods, and the n TNAs are detected by measuring the change in signal at n temperatures (i.e., detection temperatures) by adjusting the signal-change temperature ranges thereof (e.g., by adjusting them so as not to overlap). Among the n compositions, the composition for detecting the i-th TNA provides a change in signal at the i-th detection temperature among the n detection temperatures in the presence of the i-th TNA, and provides a constant signal at other detection temperatures. i represents an integer from 1 to n, and the i-th detection temperature is lower than the i+1-th detection temperature. The presence of the i-th TNA can be determined by the change in the signal detected at the i-th detection temperature (i.e., the i-th signal). In one embodiment, when i is n, the i+1 detection temperature (i.e., n+1 detection temperature) does not exist.

[0502] The composition according to the present disclosure may be applied to the method described in International Application Publication WO2022-265463. Specifically, the composition according to the present disclosure may be applied as an InterSC-type composition among the three types of compositions described in International Application Publication WO2022-265463.

[0503] In one embodiment, the composition according to the present disclosure is a composition comprising a hybridization probe and CO as LO. The hybridization probe in the composition may hybridize with CO to form a first hybrid or hybridize with TNA to form a second hybrid. As shown in FIG. 9, the composition exhibits a melting profile having one signal-change temperature range (e.g., a temperature range of 58°C to 83°C) and two signal-constant temperature ranges (e.g., a temperature range of 57°C or lower and a temperature range of 84°C or higher).

[0504] In one embodiment, the composition according to the present disclosure is a composition comprising PTO and CTO, LO, and CO. The PTO and CTO in the composition react with TNA to produce a first ES (or a second ES). The LO in the composition may hybridize with CO to form a first hybrid, or hybridize with the first ES (or the second ES) to form a second hybrid. As shown in FIG. 10, the composition exhibits a melting profile having one signal-change temperature range (e.g., a temperature range of 58°C to 83°C) and two signal-constant temperature ranges (e.g., a temperature range of 57°C or lower and a temperature range of 84°C or higher).

[0505] In one embodiment, the composition of the present disclosure is a composition comprising a molecular beacon and CO as LO. The molecular beacon in the composition may hybridize with CO to form a first hybrid or hybridize with TNA to form a second hybrid. As shown in FIG. 11, the composition exhibits a melting profile having one signal-change temperature range (e.g., a temperature range of 58°C to 83°C) and two signal-constant temperature ranges (e.g., a temperature range of 57°C or lower and a temperature range of 84°C or higher).

[0506] In one embodiment, the composition of the present disclosure is a composition comprising a Lux probe and CO as LO. The Lux probe in the composition may hybridize with CO to form a first hybrid or hybridize with TNA to form a second hybrid. As shown in FIG. 12, the composition exhibits a melting profile having one signal-change temperature range (e.g., a temperature range of 58°C to 83°C) and two signal-constant temperature ranges (e.g., a temperature range of 57°C or lower and a temperature range of 84°C or higher).

[0507] In one embodiment, the composition of the present disclosure is a composition comprising two hybrid probes and CO as LO. One of the two hybrid probes has a reporter moiety and the other has a quencher moiety. The two hybrid probes in the composition may hybridize with CO to form a first hybrid or hybridize with TNA to form a second hybrid. As shown in FIG. 13, the composition exhibits a melting profile having one signal-change temperature range (e.g., a temperature range of 58°C to 83°C) and two signal-constant temperature ranges (e.g., a temperature range of 57°C or lower and a temperature range of 84°C or higher).

[0508] The composition according to the present disclosure may, but is not limited to, include nucleic acid polymerase, buffers, polymerase cofactors, and deoxyribonucleotide-5-triphosphate. Optionally, the composition may include various polynucleotide molecules, reverse transcriptase, uracil DNA glycosylase (UDG), various buffers and reagents, and antibodies or compounds that inhibit nucleic acid polymerase activity. The composition may also include a set of oligonucleotides or reagents necessary to perform a positive control reaction. The optimal amount of reagent used in a particular reaction can be easily determined by a person skilled in the art who knows the advantages of the present disclosure. The components of the composition may be present or stored in one or more containers prior to the reaction.

[0509]

[0510] III. Method for detecting n TNAs in a sample

[0511] In another aspect, a method for detecting n target nucleic acids (TNA) in a sample is provided, comprising the following steps:

[0512] (a) incubating n compositions for detecting n TNAs in a reaction vessel together with a sample suspected of containing at least one of n TNAs, and detecting a signal at n detection temperatures during the incubation;

[0513] Here, n is an integer greater than or equal to 2, and

[0514] Here, the incubation includes a plurality of reaction cycles, and the detection of the signal is performed in at least one of the plurality of reaction cycles, and

[0515] Here, each of the n compositions for detecting the n TNAs provides a signal change at a corresponding detection temperature among the n detection temperatures in the presence of the corresponding TNA, and the signal change indicates the presence of the corresponding TNA.

[0516] Here, among n compositions for detecting n TNAs, the composition for detecting the i-th TNA provides a signal change at the i-th detection temperature among n detection temperatures in the presence of the i-th TNA, and provides a constant signal at other detection temperatures.

[0517] Here, i represents an integer from 1 to n, the i-th detected temperature is lower than the i+1-th detected temperature, and

[0518] Here, within a temperature range covering all n detection temperatures, a composition for detecting the i-th TNA has one signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the i-th TNA, and one or two signal-constant temperature ranges (SCoTR) in which the signal is constant despite the presence of the i-th TNA, and

[0519] Here, the composition for detecting the i-th TNA is any one of the following:

[0520] (i) Under-Signal-Change-Type (UnderSC-Type) composition having a melting profile in which the signal-change temperature range is lower than the signal-constant temperature range,

[0521] (ii) an Inter-Signal-Change-Type (InterSC-Type) composition having a melting profile in which the signal-change temperature range is higher than one of two signal-constant temperature ranges and lower than the other of two signal-constant temperature ranges, and

[0522] (iii) Over-Signal-Change-Type (OverSC-Type) composition having a melting profile in which the signal-change temperature range is higher than the signal-constant temperature range,

[0523] Here, at least one of the n compositions for detecting n TNAs is an InterSC-type composition as described above, and

[0524] (b) A step of determining the presence of n TNAs from the signal detected in step (a), wherein the presence of the i-th TNA is determined by the change in the signal detected at the i-th detection temperature.

[0525]

[0526] Aspect III of the present disclosure, "a method for detecting n TNAs in a sample," utilizes Aspect I of the present disclosure, "a method for detecting TNAs in a sample by a competitive hybridization-based signaling assay," and Aspect II, "a composition for detecting TNAs in a sample by a competitive hybridization-based signaling assay." Common details between these are omitted to avoid excessive redundancy that would cause complexity to this specification.

[0527] The method of the present disclosure enables the detection of multiple TNAs in a single reaction vessel using a single type of label and a single type of detector by combining the disclosed composition with three previously known types of compositions (UnderSC-, InterSC-, and OverSC- types). In particular, the method of the present disclosure ensures that only a target signal indicating the presence of a single TNA is provided at each detection temperature by controlling the signal-change temperature range of the disclosed composition. Therefore, the presence of each TNA can be determined solely by the signal change (target signal) detected at each detection temperature. That is, the method according to the present disclosure has the advantage that the target signals of multiple TNAs are not mixed at each detection temperature, so it is not necessary to extract the target signal of each TNA.

[0528] In this document, "constant signal" means that the signal does not substantially change during the amplification response to the TNA. That is, the term "constant signal" refers to any or all signal patterns except for significant signal changes resulting from the amplification of the present TNA. In particular, the constant signal means no signal change. For example, if the signal does not exceed the intensity of the background signal or the signal intensity that may occur in the absence of the TNA during the amplification response, it may be described as "constant signal." In this document, "constant signal" may be used interchangeably with "unchanging signal" or "signal that does not show change."

[0529] In this invention, "change in signal" and / or "constant signal" are based on signals detected at the same temperature while performing an amplification reaction using the same composition. For example, "change in signal" and / or "constant signal" are referred to based on the difference between signal values ​​detected at the same temperature using n compositions; specifically, "change in signal" and / or "constant signal" are referred to based on (i) the difference between signal values ​​in multiple cycles detected at the same temperature or (ii) the difference between the "reference value" described below and the signal value detected at the same temperature as the temperature at which the reference value is set. That is, "change in signal" and / or "constant signal" are not referred to based on the difference between signal values ​​detected at different temperatures.

[0530] A method for detecting n TNAs according to the present disclosure uses n compositions corresponding to n TNAs. For example, when n is 2, a composition for detecting a first TNA and a composition for detecting a second TNA are used, and when n is 3, a composition for detecting a first TNA, a composition for detecting a second TNA, and a composition for detecting a third TNA are used.

[0531] The method according to the present disclosure uses a composition according to Embodiment II as at least one of n compositions. According to the method of the present disclosure, for example, when n is 2, at least one of the composition for detecting the first TNA and the composition for detecting the second TNA is a composition according to Embodiment II. Specifically, when n is 2, the signal generation methods of the composition for detecting the first TNA and the composition for detecting the second TNA may be combined as shown in Table 1 below. When n is 3, the composition for detecting the first TNA to the composition for detecting the third TNA may be combined as shown in Table 2. In Tables 1 and 2, "InterSC" refers to another InterSC-type composition that is not a composition according to the present disclosure.

[0532] n=2 1st TNA 2nd TNA 1 Under SC Composition of the present disclosure 2 Composition of the present disclosure Composition of the present disclosure 3 Composition of the present disclosure Inter SC 4 Inter SC Composition of the present disclosure 5 Composition of the present disclosure Over SC

[0533] n=3 1st TNA 2nd TNA 3rd TNA 1 Under SC Composition of the present disclosure Inter SC 2 Under SC Inter SC Composition of the present disclosure 3 Under SC Composition of the present disclosure Composition of the present disclosure 4 Composition of the present disclosure Inter SC Over SC 5 Inter SC Composition of the present disclosure Over SC 6 Composition of the present disclosure Composition of the present disclosure Over SC 7 Under SC Composition of the present disclosure Over SC 8 Composition of the present disclosure Composition of the present disclosure Composition of the present disclosure 9 Composition of the present disclosure Composition of the present disclosure Inter SC 10 Composition of the present disclosure Inter SC Composition of the present disclosure 11 Inter SC Composition of the present disclosure Composition of the present disclosure 12 Composition of the present disclosure Inter SC Inter SC 13 Inter SC Composition of the present disclosure Inter SC 14 Inter SC Inter SC Composition of the present disclosure

[0534] In one embodiment, the i-th detection temperature is selected within the signal-change temperature range of the composition for detecting the i-th TNA, wherein the i-th detection temperature is not included in the signal-change temperature range of the composition for detecting other TNAs.

[0535] In one embodiment, the signal-change temperature range of a composition for detecting the i-th TNA partially overlaps with the signal-change temperature range of a composition for detecting a TNA having an adjacent detection temperature, but does not overlap with the signal-change temperature range of a composition for detecting a TNA having a non-adjacent detection temperature. That is, the signal-change temperature range of any one of the compositions for detecting the TNA may overlap with the signal-change temperature range of a composition for detecting a TNA having an adjacent detection temperature, but neither of the two signal-change temperature ranges is completely contained within the other.

[0536] The term "adjacent detection temperatures" is used to refer to consecutive detection temperatures among n detection temperatures; for example, the detection temperatures adjacent to the i-th detection temperature are the i-1th detection temperature and the i+1th detection temperature.

[0537] In one embodiment, when n is 2, the composition for detecting the first TNA is the UnderSC- or InterSC-type composition, and the composition for detecting the second TNA is the InterSC- or OverSC-type composition.

[0538] In one embodiment, when n is 3 or greater, the composition for detecting the first TNA is an UnderSC-, InterSC-, or OverSC-type composition, and the composition for detecting the remaining TNA, excluding the composition for detecting the first TNA and the composition for detecting the nth TNA, is an InterSC-type composition.

[0539] Hereinafter, compositions that can be used in addition to the composition for detecting TNA according to the present disclosure will be described.

[0540] In one embodiment, the composition for detecting the i-th TNA includes a label that provides a signal dependent on the presence of the i-th TNA.

[0541] In one embodiment, the label is attached to the oligonucleotide or is inserted into the oligonucleotide during the incubation. That is, the composition for detecting TNA may include an oligonucleotide with the label attached from the beginning, or the label may be inserted into a newly generated oligonucleotide (e.g., an extended strand) during the incubation reaction to provide an oligonucleotide with the label attached.

[0542] In one embodiment, the label may be a single label or an interactive label.

[0543] In one embodiment, the composition for detecting the i-th TNA comprises an incorporating label that is inserted into an oligonucleotide during incubation and provides a signal dependent on the presence of the i-th TNA.

[0544] In one embodiment, the insertion label may be used in the process of generating a signal by inserting the label during primer extension (e.g., Plexor method, Sherrill CB, et al., Journal of the American Chemical Society, 126:4550-45569 (2004)). In addition, the insertion label may also be used in signal generation by hybridization formed in a manner dependent on the cleavage of a mediating oligonucleotide hybridized to TNA.

[0545] In one embodiment, the insertion label may generally be linked to a nucleotide. Additionally, a nucleotide having a non-natural base may be used.

[0546] As used herein, the term “non-natural base” refers to derivatives of natural bases such as adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U), which can form hydrogen-bonded base pairs. As used herein, the term “non-natural base” includes a base having a base pair pattern different from that of a natural base as a mother compound, as described, for example, in U.S. Patents No. 5,432,272, 5,965,364, 6,001,983, and 6,037,120. Base pairs between non-natural bases include two or three hydrogen bonds, as with natural bases. Additionally, base pairs between non-natural bases are also formed in a specific manner. Specific examples of non-natural bases include the following bases in base pair combinations: iso-C / iso-G, iso-dC / iso-dG, K / X, H / J, and M / N (see U.S. Patent No. 7,422,850).

[0547] In one embodiment, the composition for detecting the i-th TNA provides a hybrid that provides a signal change.

[0548] According to one embodiment, the composition for detecting the i-th TNA provides a hybrid that provides a signal change, and the signal-change temperature range of the composition for detecting the i-th TNA is determined dependently on the length and / or sequence of the hybrid.

[0549] In one embodiment, the hybrid that provides the signal change is a hybrid produced by hybridization between a labeled oligonucleotide and another oligonucleotide.

[0550] In one embodiment, the composition for detecting the i-th TNA provides a hybrid that provides a signal change, and the signal-change temperature range of the composition for detecting the i-th TNA is determined dependently on the length and / or sequence of the hybrid.

[0551] As used herein, the expression “a composition for detecting TNA provides a hybrid” means that it provides a hybrid in a combined form and / or a hybrid in a dissociated form. Likewise, as used herein, the expression “a composition for detecting TNA generates a hybrid during incubation” may be used to mean that it generates a hybrid in a combined form and / or a hybrid in a dissociated form during an incubation reaction.

[0552] As used herein, the term “hybrid providing a signal change” refers to a hybrid that provides a signal change indicating the presence of TNA, the content of which changes depending on the presence of TNA. The signal-providing hybrid provides a signal that is distinguished depending on whether it is in an association state or a dissociation state. In one embodiment, the signal-providing hybrid includes a label. Specifically, at least one label is connected to at least one of the two single strands constituting the hybrid.

[0553] In one embodiment, the composition for detecting the i-th TNA provides a signal from the label due to the binding of the hybridized compound providing the signal change or the dissociation of the hybridized compound providing the signal change.

[0554] In one embodiment, the hybrid compound providing the signal change is included from the beginning in the composition for detecting the i-th TNA.

[0555] In one embodiment, the hybrid that provides the signal change is generated during the amplification reaction for TNA.

[0556] In one embodiment, the dimer providing the signal change is a hybrid produced by hybridization between a labeled oligonucleotide and the TNA.

[0557] Signals resulting from hybridization between TNA and labeled oligonucleotides are described by the Scorpion method (Whitcombe et al., Nature Biotechnology 17:804-807 (1999)), the Sunrise (or Amplifluor) method (Nazarenko et al., Nucleic Acids Research, 25(12):2516-2521 (1997), and U.S. Patent No. 6,117,635), the Lux method (U.S. Patent No. 7,537,886), the Plexor method (Sherrill CB, et al., Journal of the American Chemical Society, 126:4550-4556 (2004)), the Molecular Beacon method (Tyagi et al., Nature Biotechnology v.14 MARCH 1996), the Hybeacon method (French DJ et al., Mol. Cell Probes, 15(6):363-374 (2001)), and adjacent hybridization. It can be produced by various methods including the probe method (Bernard PS et al., Anal. Biochem., 273:221 (1999)) and the LNA method (U.S. Patent No. 6,977,295).

[0558] In one embodiment, the hybrid providing the signal change is a hybrid provided by a cleavage reaction dependent on the presence of TNA.

[0559] For the above reaction, 5' nucleases and 3' nucleases, in particular nucleic acid polymerases having 5'-nuclease activity, nucleic acid polymerases having 3' nuclease activity, or FEN nucleases may be used.

[0560] In one embodiment, the signal change is caused by a hybridized product formed in a manner dependent on the cleavage of a mediating oligonucleotide specifically hybridized to TNA. As used herein, the term "mediating oligonucleotide" refers to an oligonucleotide that mediates the formation of a hybridized product not containing TNA.

[0561] In one embodiment, the cleavage of the mediating oligonucleotide itself does not generate a signal, and after hybridization and cleavage of the mediating oligonucleotide, the fragment (cleavage product) formed by the cleavage is involved in a continuous reaction for signal generation.

[0562] In one embodiment, the hybridization or cleavage of the mediating oligonucleotide itself does not generate a signal.

[0563] In one embodiment, the mediating oligonucleotide comprises an oligonucleotide that mediates the formation of a hybrid by hybridizing to TNA and cleaving to release a fragment.

[0564] In one embodiment, the fragment mediates the formation of a hybrid by extension of the fragment on a capture oligonucleotide.

[0565] According to one embodiment, the mediating oligonucleotide comprises (i) a targeting site comprising a nucleotide sequence that hybridizes to TNA and (ii) a tagging site comprising a nucleotide sequence that does not hybridize to TNA.

[0566] In one embodiment, the composition for detecting the i-th TNA comprises a tagging oligonucleotide that hybridizes to the TNA, and the cleavage reaction dependent on the presence of the TNA involves the cleavage reaction of the tagging oligonucleotide. The tagging oligonucleotide corresponds to an example of the aforementioned mediating oligonucleotide.

[0567] The signal from the dimer formed in a manner dependent on the cleavage of the above-mentioned mediating oligonucleotide can be generated by various methods including the PTOCE (PTO cleavage and extension) method (WO 2012 / 096523), the PCE-SH (PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization) method (WO 2013 / 115442) and the PCE-NH (PTO Cleavage and Extension-Dependent Non-Hybridization) method (PCT / KR2013 / 012312).

[0568] Various conventionally known signaling methods are applicable to UnderSC-, InterSC-, and OverSC-type compositions. For example, for UnderSC-type compositions, molecular beacon methods (Tyagi et al., Nature Biotechnology v.14 MARCH 1996), Lux methods using single-labeled oligonucleotides (U.S. Patent No. 7,537,886), hybridization probe methods using two probes labeled as a donor and an acceptor, respectively (Bernad et al., 147-148 Clin Chem 2000; 46), Scorpion primer methods (Whitcombe et al., 804-807, Nature Biotechnology v.17 AUGUST 1999 and U.S. Patent No. 6,326,145), or PTOCE-based methods using CTOs with both interacting dual labels linked to the 5'-templating site may be applied. Additionally, for OverSC-type compositions, a PTOCE-based method in which an interacting double label is inserted into the extended strand during the extension reaction of the PTO fragment may be applied. Furthermore, for InterSC-type compositions, a PTOCE-based method using a PTO to which one of the double labels is attached and a CTO to which the other of the double labels is attached may be applied.

[0569] In particular, as described above, various PTOCE-based methods can be applied to UnderSC-, InterSC-, or OverSC-type compositions depending on the type and location of the label. PTOCE-based methods typically involve the formation of an extension strand dependent on the presence of TNA. The term "PTOCE-based method" is used herein to encompass various methods for providing a signal, including the formation of an extension strand through the cleavage and extension of PTO. Examples of PTOCE-based methods include, but are not limited to, the PTOCE (PTO cleavage and extension) method (WO 2012 / 096523), the PCE-SH (PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization) method (WO 2013 / 115442), and the PCE-NH (PTO Cleavage and Extension-Dependent Non-Hybridization) method (WO 2014-104818). According to one embodiment of the present disclosure, a method using nucleic acid generated dependently on the presence of TNA is also included in the PTOCE-based method.

[0570]

[0571] The present invention will be described in more detail below through examples. These examples are intended to explain the invention more specifically, and it will be obvious to those skilled in the art that the scope of the invention as set forth in the appended claims is not limited by these examples.

[0572]

[0573] Examples

[0574]

[0575] Example 1: Detection of a single TNA using LO (1)

[0576] It was verified whether TNA could be detected in real time using the competitive hybridization-based signaling assay according to the present invention.

[0577]

[0578] <1-1> Preparation of Templates and Oligonucleotides

[0579] Genomic DNA of HPV 18 was used as the target nucleic acid (TNA). Forward primers, reverse primers, PTO, CTO, LO, and CO were designed as shown in Table 3 as oligonucleotides for the detection of HPV 18 TNA.

[0580] Target nucleic acid sequence number Oligo type sequence (5'-3')HPV 181 Forward primer TGCGGTGCCAGAAACCITTG2 Reverse primer ATGTCTTGCAATGTTGCCTTAIGTC3PTOAACCAGCTCGCAGCGTCGTTGGAGTCGTTCCTGTC[Spacer C3]4CTOCGCCGCGCGGCGCCGTCGGCCCTGCGTTAGCTGCGAGCTGGTT[Spacer C3]5LO[CAL Fluor Red 610]CGCCGCGCGGCGCCGTCGGCCCTG[BHQ-2]6COCAGGGCCIACGGCGCIGCGCGGCG[Spacer C3]

[0581] Specifically, the PTO was designed to include, in the order of 5' to 3', (i) a 5'-tagging site containing a nucleotide sequence that does not hybridize with the TNA and (ii) a 3'-targeting site containing a nucleotide sequence that can hybridize with the TNA.

[0582] The CTO was designed to include, in the order of 3' to 5', (i) a capturing site containing a nucleotide sequence capable of hybridizing with the PTO fragment and (ii) a templated site containing a nucleotide sequence that does not hybridize with the PTO.

[0583] LO is designed to include a nucleotide sequence hybridizable to a first extended strand (first ES) generated by extending the PTO fragment hybridized with the capturing site of the CTO along the template site of the CTO, and to have a reporter molecule (CAL Fluor Red 610) at the 5'-terminus and a quencher molecule (BHQ-2) at the 3'-terminus.

[0584] CO contains a nucleotide sequence capable of hybridizing to LO and is designed so that two complementary bases are substituted with deoxyinosine.

[0585] The 3'-terminuses of the above PTO, CTO, and CO were blocked with Spacer C3 to prevent elongation by DNA polymerase.

[0586]

[0587] <1-2> Real-time Polymerase Chain Reaction and Signal Detection

[0588] A real-time polymerase chain reaction was performed using the above oligonucleotide.

[0589] In Tube 1, 1 pg of HPV 18 genomic DNA as TNA, 8 pmole of forward primer (SEQ No. 1), 8 pmole of reverse primer (SEQ No. 2), 4 pmole of PTO (SEQ No. 3), 0.5 pmole of CTO (SEQ No. 4), 3 pmole of LO (SEQ No. 5), and 12 pmole of CO (SEQ No. 6) were mixed, and then 5 µl of 4X Enzyme Mix and 5 µl of 4X Buffer Mix (final, 0.8 mM dNTPs, 50 mM KCl, 3.5 mM MgCl2, 20 U of Taq DNA polymerase) (Nanohelix, Korea) were added to prepare a final reaction mixture of 20 µl.

[0590] A reaction mixture was prepared in tube 2 using distilled water as a negative control instead of TNA.

[0591] The tube containing the above reaction mixture was placed in a real-time thermal cycler (CFX96 Real-time Cycler, Bio-Rad) and denatured at 95°C for 15 minutes, and a cycle of 10 seconds at 95°C, 15 seconds at 60°C, 10 seconds at 72°C, 5 seconds at 75°C, and 5 seconds at 84°C was repeated 50 times. Signals were detected at 60°C (first detection temperature), 84°C (second detection temperature), and 95°C (third detection temperature) in each cycle.

[0592] Since the predicted Tm1 of the first hybrid between LO and CO was 76℃ and the predicted Tm2 of the second hybrid between LO and the first ES was 85℃, the first detection temperature was set to 60℃, which falls within the first signal-constant temperature range, the second detection temperature was set to 84℃, which falls within the signal-change temperature range, and the third detection temperature was set to 95℃, which falls within the second signal-constant temperature range.

[0593] According to the principle of the method of the present disclosure, when TNA is absent, at a first detection temperature (first signal-constant temperature range), a first hybrid is formed between LO and CO, the reporter molecule is unquenched, and a signal is generated; and at a second detection temperature (signal-change temperature range) and a third detection temperature (second signal-constant temperature range), the first hybrid is not formed between LO and CO, the reporter molecule is quenched, and no signal is generated. Additionally, when TNA is present, a PTO specifically hybridized to TNA is cleaved to generate a PTO fragment, and then the PTO fragment is annealed at the capturing site of the CTO and extended along the templating site of the CTO to form a first extended strand. Then, the first ES is hybridized with LO to form a second hybrid. The second hybridized compound maintains its double strand at both the first and second detection temperatures, causing the reporter molecule to unquench and generate a signal, while no signal is generated at the third detection temperature.

[0594] The amplification curves obtained at each detection temperature for the above tubes 1 and 2 are shown in FIG. 14.

[0595] As shown in Fig. 14, for tube 1 containing TNA, no signal change was observed at detection temperatures of 60°C, which is within the first signal-constant temperature range, and 95°C, which is within the second signal-constant temperature range, whereas a signal change (i.e., target signal) was observed at a detection temperature of 84°C, which is within the signal-change temperature range.

[0596] Meanwhile, for tube 2 (negative control) which does not contain TNA, no signal change was observed at 60°C, 84°C, and 95°C.

[0597] Specifically, a threshold of 200 was set based on the signal value of the negative control response (i.e., RFU: 0), and the threshold was applied to the amplification curve at each detection temperature. The cycle number at the point where the amplification curve intersects the threshold was determined as the threshold cycle (Ct). If the value of Ct was determined, it was determined that TNA was present, and if the value of Ct was not determined, it was determined that TNA was not present.

[0598] The Ct values ​​obtained for each amplification curve are shown in Table 4 below.

[0599] Tube Ct (Cycle threshold)60℃84℃95℃1N / A27.17N / A2N / AN / AN / A

[0600] N / A: Not Applicable

[0601] As shown in Table 4 above, for Tube 1, a Ct value of 27.17 was obtained at the signal-change temperature of 84°C, which confirmed the presence of TNA, and no Ct value was obtained at the signal constant temperatures of 60°C and 95°C.

[0602] The above results show that the presence of TNA can be determined by detecting a signal at a temperature within the signal-change temperature range using a competitive hybridization-based signaling assay according to the present disclosure. This also shows that the composition for detecting TNA according to the present disclosure is an InterSC-type composition.

[0603] As described above, the competitive hybridization-based signaling assay according to the present disclosure enables the identification of a target signal (i.e., a change in signal) by comparing it with a reference signal obtained from a negative control response.

[0604]

[0605] Example 2: Detection of a single TNA using LO (2)

[0606] It was verified whether TNA could be detected in real time using the competitive hybridization-based signaling assay according to the present invention.

[0607]

[0608] <2-1> Preparation of Templates and Oligonucleotides

[0609] Genomic DNA of HPV 18 was used as the target nucleic acid (TNA). Forward primers, reverse primers, PTO, CTO, LO, and CO were designed as shown in Table 5 as oligonucleotides for the detection of HPV 18 TNA.

[0610] Target nucleic acid sequence number oligotype sequence (5'-3') HPV 181 Forward primer TGCGGTGCCAGAAACCITTG2 Reverse primer ATGTCTTGCAATGTTGCCTTAIGTC7PTOATCGTTCGACGGGCGTCGTTGGAGTCGTTCCTGTC[Spacer C3]8CTOCGCTCGCGGCCCTTCGCCTGGCGGTTGGCTGCCCGTCGAACGAT[Spacer C3]9LOAGGCCGGATCGCTCGCTCGCGGCCCT[T(CAL Fluor Red 610)] CGCCTGGCGGTTGGC[BHQ-2]10COGCCAACCGCIAGGCGAAGGGCCGCGAGCGAICGATICGGCGCT[Spacer C3]

[0611] The PTO was designed to include, in the order of 5' to 3', (i) a 5'-tagging site containing a nucleotide sequence that does not hybridize with the TNA and (ii) a 3'-targeting site containing a nucleotide sequence that can hybridize with the TNA.

[0612] The CTO was designed to include, in the order of 3' to 5', (i) a capturing site containing a nucleotide sequence capable of hybridizing with the PTO fragment and (ii) a templated site containing a nucleotide sequence that does not hybridize with the PTO.

[0613] LO is designed to have a reporter molecule (CAL Fluor Red 610) at the 5'-capturing site and a quencher molecule (BHQ-2) at the 3'-terminal site in the order of 3' to 5', comprising (i) a capturing site containing a nucleotide sequence hybridizable to a first extension strand generated by extending the PTO fragment hybridized to the capturing site of the CTO along the templated site of the CTO, and (ii) a templated site containing a nucleotide sequence not hybridized to the first extension strand.

[0614] CO contains a nucleotide sequence capable of hybridizing to LO and is designed so that three complementary bases are substituted with deoxyinosine.

[0615] The 3'-terminuses of the above PTO, CTO, and CO were blocked with Spacer C3 to prevent elongation by DNA polymerase.

[0616]

[0617] <2-2> Real-time Polymerase Chain Reaction and Signal Detection

[0618] A real-time polymerase chain reaction was performed using the above oligonucleotide.

[0619] In Tube 1, 1 pg of HPV 18 genomic DNA as TNA, 8 pmole of forward primer (SEQ No. 1), 8 pmole of reverse primer (SEQ No. 2), 4 pmole of PTO (SEQ No. 7), 1 pmole of CTO (SEQ No. 8), 1 pmole of LO (SEQ No. 9), and 4 pmole of CO (SEQ No. 12) were mixed, and then 5 µl of 4X Enzyme Mix and 5 µl of 4X Buffer Mix (final, 0.8 mM dNTPs, 50 mM KCl, 3.5 mM MgCl2, 20 U of Taq DNA polymerase) (Nanohelix, Korea) were added to prepare a final reaction mixture of 20 µl.

[0620] A reaction mixture was prepared in tube 2 using distilled water as a negative control instead of TNA.

[0621] The tube containing the above reaction mixture was placed in a real-time thermal cycler (CFX96 Real-time Cycler, Bio-Rad) and denatured at 95°C for 15 minutes, and a cycle of 10 seconds at 95°C, 15 seconds at 60°C, 10 seconds at 72°C, 5 seconds at 75°C, and 5 seconds at 84°C was repeated 50 times. Signals were detected at 60°C (first detection temperature), 84°C (second detection temperature), and 95°C (third detection temperature) in each cycle.

[0622] Since the predicted Tm1 of the first hybrid between LO and CO was 81℃ and the predicted Tm2 of the second hybrid between LO and the first ES was 87℃, the first detection temperature was set to 60℃, which falls within the first signal-constant temperature range, the second detection temperature was set to 84℃, which falls within the signal-change temperature range, and the third detection temperature was set to 95℃, which falls within the second signal-constant temperature range.

[0623] According to the principle of the method of the present disclosure, when TNA is absent, at a first detection temperature (signal-constant temperature range), a first hybrid is formed between LO and CO, the reporter molecule is unquenched, and a signal is generated, and at a second detection temperature (signal-change temperature range) and a third detection temperature (second signal-constant temperature range), the first hybrid is not formed between LO and CO, the reporter molecule is quenched, and no signal is generated. Additionally, when TNA is present, PTO specifically hybridized to TNA is cleaved to generate a fragment, and then the PTO fragment is annealed at the capturing site of CTO and extended along the template site of CTO to form a first extension strand. Then, the first extension strand is hybridized at the capturing site of LO and extended along the template site of LO to form a second extension strand, which ultimately forms a second hybrid between the second extension strand and LO. The second hybridized compound maintains its double strand at both the first and second detection temperatures, causing the reporter molecule to unquench and generate a signal, while no signal is generated at the third detection temperature.

[0624] The amplification curves obtained at each detection temperature for the above tubes 1 and 2 are shown in FIG. 15.

[0625] As shown in Fig. 15, for tube 1 containing TNA, no signal change was observed at detection temperatures of 60°C, which is within the first signal-constant temperature range, and 95°C, which is within the second signal-constant temperature range, whereas a signal change (i.e., target signal) was observed at a detection temperature of 84°C, which is within the signal-change temperature range.

[0626] Meanwhile, for tube 2 (negative control) which does not contain TNA, no signal change was observed at 60°C, 84°C, and 95°C.

[0627] Specifically, a threshold of 200 was set based on the signal value of the negative control response (i.e., RFU: 0), and the threshold was applied to the amplification curve at each detection temperature. The cycle number at the point where the amplification curve and the threshold intersect was determined as the threshold cycle (Ct). If the value of Ct was determined, it was determined that TNA was present, and if the value of Ct was not determined, it was determined that TNA was not present.

[0628] The Ct values ​​obtained for each amplification curve are shown in Table 6 below.

[0629] Tube Ct (Cycle threshold)60℃84℃95℃1N / A29.26N / A2N / AN / AN / A

[0630] N / A: Not Applicable

[0631] As shown in Table 6 above, for Tube 1, a Ct value of 29.26 was obtained at the signal-change temperature of 84°C, which confirmed the presence of TNA.

[0632] The above results show that the presence of TNA can be determined by detecting a signal at a temperature within the signal-change temperature range using a competitive hybridization-based signaling assay according to the present disclosure. This also shows that the composition for detecting TNA according to the present disclosure is an InterSC-type composition.

[0633] As described above, the competitive hybridization-based signaling assay according to the present disclosure enables the identification of a target signal (i.e., a change in signal) by comparing it with a reference signal obtained from a negative control response.

[0634]

[0635] Example 3: Detection of multiple TNAs using LO (1)

[0636] It was confirmed whether multiple TNAs could be detected in real time using a single type of label in a single reaction vessel by combining the InterSC-type composition used in the competitive hybridization-based signaling assay according to the present invention with a conventionally known UnderSC-type composition.

[0637] To this end, two TNAs were prepared. To detect the first TNA, a PTOCE-based assay utilizing a CTO connected to an interaction double label was used. The PTOCE-based assay is an UnderSC signal generation method that exhibits a melting profile in which the signal-change temperature range is lower than the signal-constant temperature range. Meanwhile, to detect the second TNA, a competitive hybridization-based signaling assay according to the present disclosure was used. The competitive hybridization-based signaling assay according to the present disclosure is an InterSC signal generation method that exhibits a melting profile in which the signal-change temperature range is higher than the first signal-constant temperature range but lower than the second signal-constant temperature range.

[0638] By adjusting the signal-change temperature range of the above PTOCE-based assay and competitive hybridization-based signaling assay, it is possible to provide only a signal for one TNA at each of the two detection temperatures.

[0639]

[0640] <3-1> Preparation of Templates and Oligonucleotides

[0641] Genomic DNA of Human Papillomavirus 33 (accession number: NIBSC 14 / 260) was used as the first TNA, and genomic DNA of HPV 18 was used as the second TNA.

[0642] The first detection temperature for detecting a change in the signal indicating the presence of the first TNA was set to 60°C, and the second detection temperature for detecting a change in the signal indicating the presence of the second TNA was set to 84°C.

[0643] Subsequently, the oligonucleotides of the composition for detecting the first TNA and the composition for detecting the second TNA were designed as shown in Table 7 below.

[0644] Target nucleic acid sequence number Oligo type sequence (5'-3') HPV 33 11 HPV 33-Forward primer GGATGTAAGCCTCCAACAIGGG 12 HPV 33-Reverse primer TCCATGCAACCAAATCCTGTITCC 13 HPV 33-PTOAACCACCGCCTAGCAGGTGCTGCATTAGTACAAGCAAC[Spacer C3] 14 HPV 33-CTO[BHQ-1]TTTTTATTGATTTAAGT[T(CAL Fluor Red 610)]ATTGCTAGGCGGTGGTT[Spacer C3] HPV 18 1 HPV 18-Forward primer TGCGGTGCCAGAAACCITTG 2 HPV 18-Reverse primer ATGTCTTGCAATGTTGCCTTAIGTC 7 HPV 18-PTOATCGTTCGACGGGCGTCGTTGGAGTCGTTCCTGTC[Spacer C3] 15 HPV 18-CTOCGCTCGCTCGCGGCCCTTCGCCTGGCGGTTGGCTGCCCGTCGAACGAT[Spacer C3]16HPV 18-LOAGCGCCGGATCGCTCGCTCGCGGCCCT [T(CAL Fluor Red 610)] CGCCTGGCGGTTGGC[BHQ-1]17HPV 18-COGCCAACCGICAGGCGAAGGGCCICGAGIGAGCGATCCGGCGCT[Spacer C3]

[0645] A PTO for detecting HPV 33 was designed to include, in the 5' to 3' order, (i) a 5'-tagging site containing a nucleotide sequence that does not hybridize with TNA and (ii) a 3'-targeting site containing a nucleotide sequence that can hybridize with TNA.

[0646] A CTO for detecting HPV 33 was designed to have (i) a capturing site containing a nucleotide sequence capable of hybridizing with a PTO fragment and (ii) a templated site containing a nucleotide sequence not hybridizing with said PTO in the 3' to 5' order, and to have a quencher molecule (BHQ-1) at the 5'-terminus and a reporter molecule (CAL Fluor Red 610) at the 3'-targeting site.

[0647] The 3'-terminus of the above PTO and CTO were blocked with Spacer C3 to prevent elongation by DNA polymerase.

[0648] A PTO for detecting HPV 18 was designed to include, in the 5' to 3' order, (i) a 5'-tagging region containing a nucleotide sequence that does not hybridize with the TNA and (ii) a 3'-targeting region containing a nucleotide sequence that can hybridize with a second region of the TNA.

[0649] A CTO for detecting HPV 18 was designed to include, in the 3' to 5' order, (i) a capturing site containing a nucleotide sequence capable of hybridizing with a PTO fragment and (ii) a templated site containing a nucleotide sequence that does not hybridize with said PTO.

[0650] The LO for detecting HPV 18 is designed to have a reporter molecule (CAL Fluor Red 610) at the 5'-capturing site and a quencher molecule (BHQ-1) at the 3'-terminal site in the order of (i) a capturing site containing a nucleotide sequence hybridizable to a first extension strand formed by extending the PTO fragment hybridized to the capturing site of the CTO along the templated site of the CTO, and (ii) a templated site containing a nucleotide sequence not hybridized to the first extension strand, in the order of 3' to 5'.

[0651] CO for detecting HPV 18 contains a nucleotide sequence capable of hybridizing to LO and is designed so that three complementary bases are substituted with deoxyinosine.

[0652]

[0653] <3-2> Real-time Polymerase Chain Reaction and Signal Detection

[0654] Multiplex PCR was performed in a single reaction vessel using the above oligonucleotides.

[0655] In Tube 1, 500 fg of HPV 33 genomic DNA as TNA, HPV 33 forward primer 8 pmole (SEQ: 11), HPV 33 reverse primer 8 pmole (SEQ: 12), HPV 33-PTO 4 pmole (SEQ: 13), HPV 33-CTO 1 pmole (SEQ: 14) for HPV 33 TNA amplification, HPV 18 forward primer 8 pmole (SEQ: 1), HPV 18 reverse primer 8 pmole (SEQ: 2), HPV 18-PTO 4 pmole (SEQ: 7), HPV 18-CTO 1 pmole (SEQ: 15), HPV 18-LO 1 pmole (SEQ: 16), and HPV 18-CO4 After mixing pmole (sequence number: 17), 5 µl of 4X Enzyme Mix and 5 µl of 4X Buffer Mix (final, 0.8 mM dNTPs, 50 mM KCl, 3.5 mM MgCl2, 20 U of Taq DNA polymerase) (Nanohelix, Korea) were added to prepare a final reaction mixture of 20 µl.

[0656] A reaction mixture was prepared in tube 2 using 1 pg of HPV 18 genomic DNA as TNA.

[0657] A reaction mixture was prepared in tube 3 using 500 fg of HPV 33 genomic DNA and 1 pg of HPV 18 genomic DNA as TNA.

[0658] A reaction mixture was prepared in tube 4 using distilled water as a negative control instead of TNA.

[0659] The tube containing the above reaction mixture was placed in a real-time thermal cycler (CFX96 Real-time Cycler, Bio-Rad) and denatured at 95°C for 15 minutes, and the cycle of 95°C for 10 seconds, 60°C for 15 seconds, 72°C for 10 seconds, 75°C for 5 seconds, and 84°C for 5 seconds was repeated 50 times. The signal was detected at 60°C (first detection temperature), 84°C (second detection temperature), and 95°C (third detection temperature) in each cycle.

[0660] Since the predicted Tm1 of the extended dimer between HPV-33 CTO and the first ES was 67°C, the predicted Tm1 of the first hybrid between HPV 18-LO and HPV 18-CO was 81°C, and the predicted Tm2 of the second hybrid between HPV 18-LO and the first ES was 87°C, the first detection temperature was set to 60°C, which falls within the signal-change temperature range for HPV 33 TNA and the first signal-constant temperature range for HPV 18 TNA; the second detection temperature was set to 84°C, which falls within the signal-constant temperature range for HPV 33 TNA and the signal-change temperature range for HPV 18 TNA; and the third detection temperature was set to 95°C, which falls within the signal-constant temperature range for HPV 33 TNA and the second signal-constant temperature range for HPV 18 TNA.

[0661] According to the principles of the PTOCE assay and the method of the present disclosure, the PTOCE assay used to detect HPV 33 TNA exhibits a signal change in the presence of HPV 33 TNA at a first detection temperature and a constant signal at second and third detection temperatures despite the presence of HPV 33 TNA (i.e., the reporter moiety continues to be quenched by the quencher moiety regardless of the presence of HPV 33 TNA), whereas the competitive hybridization-based signaling assay according to the present disclosure used to detect HPV 18 TNA exhibits a signal change in the presence of HPV 18 TNA at a second detection temperature and a constant signal at the first and third detection temperatures despite the presence of HPV 18 TNA (i.e., at the first detection temperature, LO forms a first hybridization with CO and the reporter molecule is unquenched regardless of the presence of HPV 18 TNA, and at the third detection temperature, regardless of the presence of HPV 18 TNA The reporter molecule of LO is continuously quenched by the quencher molecule. Therefore, the presence of HPV 33 TNA can be determined at the first detection temperature, and the presence of HPV 18 TNA can be determined at the second detection temperature.

[0662] The amplification curves obtained at each detection temperature for the above tubes 1, 2, 3, and 4 are shown in FIG. 16.

[0663] As shown in Figure 16, in the case of tube 1 containing only HPV 33 TNA, no signal change was observed at 84°C and 95°C, whereas a signal change (target signal) was observed at 60°C.

[0664] Meanwhile, in the case of tube 2 containing only HPV 18 TNA, no signal change was observed at 60°C and 95°C, whereas a signal change (target signal) was observed at 84°C.

[0665] In addition, for tube 3 containing HPV 33 and HPV 18 TNA, signal changes were observed at 60°C, the detection temperature for HPV 33 TNA, and 84°C, the detection temperature for HPV 18 TNA, respectively, whereas no signal change was observed at 95°C despite the presence of HPV 33 and HPV 18 TNA.

[0666] Meanwhile, for tube 4 containing the negative control, no signal change was observed at 60°C, 84°C, and 95°C.

[0667] Specifically, a threshold of 200 was set based on the signal value of the negative control response (i.e., RFU: 0), and the threshold was applied to the amplification curve at each detection temperature. The cycle number at the point where the amplification curve and the threshold intersect was determined as the threshold cycle (Ct). If the value of Ct was determined, it was determined that TNA was present, and if the value of Ct was not determined, it was determined that TNA was not present.

[0668] The Ct values ​​obtained for each amplification curve are shown in Table 8 below.

[0669] Tube Ct (Cycle threshold)60℃84℃95℃125.22N / AN / A2N / A29.71N / A325.2030.80N / A4N / AN / AN / A

[0670] N / A: Not Applicable

[0671] As shown in Table 8 above, for Tube 1, a Ct value of 25.22 was obtained at the signal-change temperature of 60°C, confirming the presence of only HPV 33 TNA. For Tube 2, a Ct value of 29.71 was obtained at the signal-change temperature of 84°C, confirming the presence of only HPV 18 TNA. For Tube 3, Ct values ​​of 25.20 and 30.80 were obtained at 60°C and 84°C, respectively, confirming the presence of HPV 33 and HPV 18 TNA. Finally, for Tube 4, no Ct value was determined at 60°C, 84°C, or 95°C, confirming the absence of HPV 33 and HPV 18 TNA.

[0672]

[0673] Example 4: Detection of multiple TNAs using LO (2)

[0674] It was confirmed whether multiple TNAs could be detected in real time using a single type of label in a single reaction vessel by combining the InterSC-type composition used in the competitive hybridization-based signaling assay according to the present invention with a conventionally known UnderSC-type composition.

[0675] To this end, two TNAs were prepared. To detect the first TNA, a PTOCE-based assay using a CTO with an interaction double label was used, and to detect the second TNA, a competitive hybridization-based signaling assay according to the present disclosure was used.

[0676] By adjusting the signal-change temperature range of the above PTOCE-based assay and competitive hybridization-based signaling assay, it is possible to provide only a signal for one TNA at each of the two detection temperatures.

[0677]

[0678] <4-1> Preparation of Templates and Oligonucleotides

[0679] Genomic DNA of HPV 33 was used as the first TNA, and genomic DNA of HPV 18 was used as the second TNA.

[0680] The first detection temperature for detecting a change in the signal indicating the presence of the first TNA was set to 60°C, and the second detection temperature for detecting a change in the signal indicating the presence of the second TNA was set to 77°C.

[0681] Subsequently, the oligonucleotides of the composition for detecting the first TNA and the composition for detecting the second TNA were designed as shown in Table 9 below.

[0682] Target nucleic acid sequence number Oligo type sequence (5'-3') HPV 33 11 HPV 33-Forward primer GGATGTAAGCCTCCAACAIGGG 12 HPV 33-Reverse primer TCCATGCAACCAAATCCTGTITCC 13 HPV 33-PTOAACCACCGCCTAGCAGGTGCTGCATTAGTACAAGCAAC[Spacer C3] 14 HPV 33-CTO[BHQ-1]TTTTTATTGATTTAAGT[T(CAL Fluor Red 610)]ATTGCTAGGCGGTGGTT[Spacer C3] HPV 18 1 HPV 18-Forward primer TGCGGTGCCAGAAACCITTG 2 HPV 18-Reverse primer ATGTCTTGCAATGTTGCCTTAIGTC 3 HPV 18-PTOAACCAGCTCGCAGCGTCGTTGGAGTCGTTCCTGTC[Spacer C3] 4 HPV 18-CTOCGCCGCGCGGCGCCGTCGGCCCTGCGTTAGCTGCGAGCTGGTT[Spacer C3]18HPV 18-LO[T(CAL Fluor Red 610)]CCGCGCGGCGCCGTCGGCCCTG[BHQ-1]19HPV 18-COCAGGGCIGACGGCGICGCGCGG[Spacer C3]

[0683] A PTO for detecting HPV 33 was designed to include, in the 5' to 3' order, (i) a 5'-tagging site containing a nucleotide sequence that does not hybridize with TNA and (ii) a 3'-targeting site containing a nucleotide sequence that can hybridize with TNA.

[0684] A CTO for detecting HPV 33 was designed to have (i) a capturing site containing a nucleotide sequence capable of hybridizing with a PTO fragment and (ii) a templated site containing a nucleotide sequence not hybridizing with said PTO in the 3' to 5' order, and to have a quencher molecule (BHQ-1) at the 5'-terminus and a reporter molecule (CAL Fluor Red 610) at the 3'-targeting site.

[0685] The 3'-terminus of the above PTO and CTO were blocked with Spacer C3 to prevent elongation by DNA polymerase.

[0686] A PTO for detecting HPV 18 was designed to include, in the 5' to 3' order, (i) a 5'-tagging site containing a nucleotide sequence that does not hybridize with the TNA and (ii) a 3'-targeting site containing a nucleotide sequence that can hybridize with the TNA.

[0687] A CTO for detecting HPV 18 was designed to include, in the 3' to 5' order, (i) a capturing site containing a nucleotide sequence capable of hybridizing with a PTO fragment and (ii) a templated site containing a nucleotide sequence that does not hybridize with said PTO.

[0688] The LO for detecting HPV 18 is designed to have a reporter molecule (CAL Fluor Red 610) at the 5'-capturing site and a quencher molecule (BHQ-1) at the 3'-terminal site in the order of (i) a capturing site containing a nucleotide sequence hybridizable to a first extension strand formed by extending the PTO fragment hybridized to the capturing site of the CTO along the templated site of the CTO, and (ii) a templated site containing a nucleotide sequence not hybridized to the first extension strand, in the order of 3' to 5'.

[0689] CO for detecting HPV 18 contains a nucleotide sequence capable of hybridizing to LO and is designed so that three complementary bases are substituted with deoxyinosine.

[0690] The 3'-terminuses of the above PTO, CTO, and CO were blocked with Spacer C3 to prevent elongation by DNA polymerase.

[0691]

[0692] <4-2> Real-time Polymerase Chain Reaction and Signal Detection

[0693] Multiplex PCR was performed in a single reaction vessel using the above oligonucleotides.

[0694] In Tube 1, 500 fg of HPV 33 genomic DNA as TNA, HPV 33 forward primer 8 pmole (SEQ: 11), HPV 33 reverse primer 8 pmole (SEQ: 12), HPV 33-PTO 4 pmole (SEQ: 13), HPV 33-CTO 1 pmole (SEQ: 14) for HPV 33 TNA amplification, HPV 18 forward primer 8 pmole (SEQ: 1), HPV 18 reverse primer 8 pmole (SEQ: 2), HPV 18-PTO 4 pmole (SEQ: 3), HPV 18-CTO 0.5 pmole (SEQ: 4), HPV 18-LO 3 pmole (SEQ: 18), and HPV 18-CO 12 After mixing pmole (sequence number: 19), 5 µl of 4X Enzyme Mix and 5 µl of 4X Buffer Mix (final, 0.8 mM dNTPs, 50 mM KCl, 3.5 mM MgCl2, 20 U of Taq DNA polymerase) (Nanohelix, Korea) were added to prepare a final reaction mixture of 20 µl.

[0695] A reaction mixture was prepared in tube 2 using 1 pg of HPV 18 genomic DNA as TNA.

[0696] A reaction mixture was prepared in tube 3 using 500 fg of HPV 33 genomic DNA and 1 pg of HPV 18 genomic DNA as TNA.

[0697] A reaction mixture was prepared in tube 4 using distilled water as a negative control instead of TNA.

[0698] The tube containing the above reaction mixture was placed in a real-time thermal cycler (CFX96 Real-time Cycler, Bio-Rad) and denatured at 95°C for 15 minutes, and the cycle of 95°C for 10 seconds, 60°C for 15 seconds, 72°C for 10 seconds, 75°C for 5 seconds, and 84°C for 5 seconds was repeated 50 times. The signal was detected at 60°C (first detection temperature), 77°C (second detection temperature), and 95°C (third detection temperature) in each cycle.

[0699] Since the predicted Tm1 of the extended dimer between HPV-33 CTO and the first ES was 67°C, the predicted Tm1 of the first hybrid between HPV 18-LO and HPV 18-CO was 72°C, and the predicted Tm2 of the second hybrid between HPV 18-LO and the first ES was 82.5°C, the first detection temperature was set to 60°C, which falls within the signal-change temperature range for HPV 33 TNA and the first signal-constant temperature range for HPV 18 TNA; the second detection temperature was set to 77°C, which falls within the signal-constant temperature range for HPV 33 TNA and the signal-change temperature range for HPV 18 TNA; and the third detection temperature was set to 95°C, which falls within the signal-constant temperature range for HPV 33 TNA and the second signal-constant temperature range for HPV 18 TNA.

[0700] According to the principles of the PTOCE assay and the method of the present disclosure, the PTOCE assay used to detect HPV 33 TNA exhibits a signal change in the presence of HPV 33 TNA at a first detection temperature and a constant signal at second and third detection temperatures despite the presence of HPV 33 TNA (i.e., the reporter moiety continues to be quenched by the quencher moiety regardless of the presence of HPV 33 TNA), whereas the competitive hybridization-based signaling assay according to the present disclosure used to detect HPV 18 TNA exhibits a signal change in the presence of HPV 18 TNA at a second detection temperature and a constant signal at the first and third detection temperatures despite the presence of HPV 18 TNA (i.e., at the first detection temperature, LO forms a first hybridization with CO and the reporter molecule is unquenched regardless of the presence of HPV 18 TNA, and at the third detection temperature, regardless of the presence of HPV 18 TNA The reporter molecule of LO is continuously quenched by the quencher molecule. Therefore, the presence of HPV 33 TNA can be determined at the first detection temperature, and the presence of HPV 18 TNA can be determined at the second detection temperature.

[0701] The amplification curves obtained at each detection temperature for the above tubes 1, 2, 3, and 4 are shown in FIG. 17.

[0702] As shown in Figure 17, in the case of tube 1 containing only HPV 33 TNA, no signal change was observed at 77°C and 95°C, whereas a signal change (target signal) was observed at 60°C.

[0703] Meanwhile, in the case of tube 2 containing only HPV 18 TNA, no signal change was observed at 60°C and 95°C, whereas a signal change (target signal) was observed at 77°C.

[0704] In addition, for tube 3 containing HPV 33 and HPV 18 TNA, signal changes were observed at 60°C, the detection temperature for HPV 33 TNA, and 77°C, the detection temperature for HPV 18 TNA, respectively, whereas no signal change was observed at 95°C despite the presence of HPV 33 and HPV 18 TNA.

[0705] Meanwhile, for tube 4 containing the negative control, no signal change was observed at 60°C, 84°C, and 95°C.

[0706] Specifically, a threshold of 200 was set based on the signal value of the negative control response (i.e., RFU: 0), and the threshold was applied to the amplification curve at each detection temperature. The cycle number at the point where the amplification curve and the threshold intersect was determined as the threshold cycle (Ct). If the value of Ct was determined, it was determined that TNA was present, and if the value of Ct was not determined, it was determined that TNA was not present.

[0707] The Ct values ​​obtained for each amplification curve are shown in Table 10 below.

[0708] Tube Ct (Cycle threshold)60℃77℃95℃125.51N / AN / A2N / A28.56N / A326.1029.53N / A4N / AN / AN / A

[0709] N / A: Not Applicable

[0710] As shown in Table 10 above, for Tube 1, a Ct value of 25.51 was obtained at the signal-change temperature of 60°C, confirming the presence of only HPV 33 TNA. For Tube 2, a Ct value of 28.56 was obtained at the signal-change temperature of 77°C, confirming the presence of only HPV 18 TNA. For Tube 3, Ct values ​​of 26.10 and 29.53 were obtained at 60°C and 77°C, respectively, confirming the presence of HPV 33 and HPV 18 TNA. Finally, for Tube 4, no Ct value was determined at 60°C, 84°C, and 95°C, confirming the absence of HPV 33 and HPV 18 TNA.

[0711]

[0712] Collectively, the competitive hybridization-based signaling assay according to the present disclosure can not only detect the presence of a single TNA, but also, in combination with another signal generation method (e.g., UnderSC and / or InterSC and / or OverSC signal generation method), detect multiple TNAs using only a single detector with the same type of label in a single reaction vessel.

[0713]

[0714] Specific parts of the present invention have been described in detail above. It is evident to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A method for detecting a target nucleic acid (TNA) in a sample by a Competitive Hybrids-based Signaling Assay (CHYSA), comprising the following steps: (a) a step of contacting a sample suspected of containing TNA with a composition for detecting TNA, The above composition is (i) a labeled oligonucleotide (LO) comprising a nucleotide sequence hybridizable with the nucleic acid generated dependently on the presence of the TNA or the above, and a label attached thereto, and (ii) comprising a competing oligonucleotide (CO) having a nucleotide sequence that is hybridizable with the LO and competes with the nucleic acid generated dependently on the presence of the TNA or in hybridization with the LO, and The above LO can generate a background signal by forming a first hybridized compound through hybridization with the above CO, and the above LO can also generate a target signal by forming a second hybridized compound through hybridization with the above TNA or a nucleic acid generated dependent on the presence thereof. The melting temperature (Tm1) of the first hybrid compound and the melting temperature (Tm2) of the second hybrid compound are different, and the formation of the hybrid compound having a higher melting temperature among the first and second hybrid compounds is competitively advantageous compared to the formation of the hybrid compound having a lower melting temperature. (b) a step of performing an amplification reaction for the TNA under amplification conditions, As the amplification reaction proceeds, the formation of the second hybrid increases, thereby providing a target signal, and (c) A step of detecting the target signal, wherein the detected target signal indicates the presence of the TNA.

2. A method according to claim 1, wherein the LO has a reporter moiety and a quencher moiety positioned to generate a signal when the first hybridized compound and the second hybridized compound are formed.

3. A method according to claim 2, characterized in that, prior to the formation of the first hybrid or the second hybrid, the reporter moiety and the quencher moiety on the LO are in close proximity to each other so that the quencher moiety quenches the signal from the reporter moiety, whereas upon the formation of the first hybrid or the second hybrid, the reporter moiety and the quencher moiety on the LO are spatially separated from each other so that the quencher moiety unquenches the signal from the reporter moiety.

4. A method according to claim 1, wherein the LO has a single marker positioned to generate a signal when the first hybridized compound and the second hybridized compound are formed.

5. A method according to claim 1, characterized in that the CO has a nucleotide sequence of different length and / or different bases compared to the TNA or nucleic acid produced dependent on the presence thereof.

6. A method according to claim 1, characterized in that the CO comprises one or more non-complementary bases or universal bases for the LO.

7. A method according to claim 6, characterized in that the universal base is deoxyinosine.

8. A method according to claim 1, characterized in that the CO has a shorter length than the LO.

9. A method according to claim 1, characterized in that Tm1 is at least 3℃ lower than Tm2.

10. A method according to claim 1, characterized in that the 3'-ends of the CO and LO are blocked so as not to be extended.

11. A method according to claim 1, characterized in that the amplification reaction for the TNA is real-time PCR.

12. A method according to claim 1, wherein the composition further comprises a primer oligonucleotide (PO) for amplifying TNA.

13. A method according to claim 1, characterized in that the composition exhibits a melting profile having one Signal-Changing Temperature Range (SChTR) in which the signal changes depending on the presence of TNA, and two Signal-Constant Temperature Ranges (SCoTR) in which the signal remains constant despite the presence of TNA.

14. A method according to claim 1, wherein the signal-change temperature range is higher than the first signal-constant temperature range among the two signal-constant temperature ranges and lower than the second signal-constant temperature range among the two signal-constant temperature ranges.

15. A method according to claim 1, characterized in that during the amplification reaction, (i) when TNA is absent in the sample, only a first hybrid is formed to generate a background signal, and (ii) when TNA is present in the sample, a second hybrid is formed to generate a target signal.

16. A method according to claim 1, wherein the detection of the target signal is performed at a temperature favorable for either the first hybridization or the second hybridization to dissociate into two single strands while the other maintains a double strand.

17. A method according to claim 1, characterized in that the detection of the target signal is not performed at a temperature favorable for both the first hybrid and the second hybrid to dissociate into two single strands or to maintain a double strand.

18. A method according to claim 1, characterized in that the detection of the target signal is performed at a temperature between Tm1 and Tm2.

19. A method according to claim 1, characterized in that the detection of the target signal is performed by comparing the signal detected during the amplification reaction with the background signal.

20. A method according to claim 1, characterized in that the nucleic acid generated dependently on the presence of the TNA is a first extended strand (First Extended Strand, First ES) generated by the following step: (a3) A step of hybridizing a nucleic acid fragment generated from hybridization between TNA and an additional oligonucleotide with a Capturing and Templating Oligonucleotide (CTO); The above CTO comprises, in the 3' to 5' direction: (i) a capturing site comprising a nucleotide sequence capable of hybridizing with the nucleic acid fragment, and (ii) a templating site comprising a nucleotide sequence not hybridizing with the nucleic acid fragment, and the CTO does not include a label, The above nucleic acid fragment hybridizes with the capturing site of the CTO, and (a4) A step of generating a first ES by extending the nucleic acid fragment hybridized with the capturing site of the CTO along the templating site of the CTO using a DNA polymerase having 5' nuclease activity.

21. A method according to claim 20, wherein the LO has a nucleotide sequence capable of hybridizing with the portion of the first ES excluding the PTO fragment.

22. A method according to claim 1, characterized in that the nucleic acid generated dependently on the presence of the TNA is a second extended strand (Second Extended Strand, 2nd ES) generated by the following step: (a3) A step of hybridizing a nucleic acid fragment generated from hybridization between TNA and an additional oligonucleotide with a Capturing and Templating Oligonucleotide (CTO); The above CTO comprises, in the 3' to 5' direction: (i) a capturing site comprising a nucleotide sequence capable of hybridizing with the nucleic acid fragment, and (ii) a templating site comprising a nucleotide sequence not hybridizing with the nucleic acid fragment, and the CTO does not include a label, The above nucleic acid fragment hybridizes with the capturing site of the CTO, and (a4) A step of generating a first ES by extending the nucleic acid fragment hybridized with the capturing site of the CTO along the templating site of the CTO using a DNA polymerase having 5' nuclease activity. (a5) A step of hybridizing the first ES with the LO; The LO comprises (i) a capturing site comprising a nucleotide sequence capable of hybridizing with the first ES and (ii) a templating site comprising a nucleotide sequence not hybridizing with the first ES, and The above first ES is hybridized with the capturing portion of the LO; (a6) A step of generating a second ES by extending the first ES hybridized with the capturing site of the LO along the templating site of the LO using a DNA polymerase having 5' nuclease activity.

23. A method according to claim 22, wherein the LO has a nucleotide sequence capable of hybridizing with the portion of the second ES excluding the PTO fragment.

24. A method according to claim 20 or 22, wherein the nucleic acid fragment is generated by the following step: (a1) A step of hybridizing the above TNA with a primer oligonucleotide (PO) and a probing and tagging oligonucleotide (PTO); The above PO comprises a nucleotide sequence capable of hybridizing with the first region of TNA, and The above PTO comprises, in the 5' to 3' direction: (i) a 5'-tagging site comprising a nucleotide sequence that does not hybridize with TNA, and (ii) a 3'-targeting site comprising a nucleotide sequence capable of hybridizing with a second region of TNA, and The first region of the TNA is located toward the 3' end of the second region, and (a2) A step of contacting the product of step (a) with a DNA polymerase having 5' nuclease activity under conditions for cleavage of PTO; The above PO induces the cleavage of PTO by a DNA polymerase having 5' nuclease activity, thereby releasing a PTO fragment containing the 5'-tagging portion of the PTO, and The above PTO fragment is a nucleic acid fragment generated from the hybridization between TNA and PTO as an additional oligonucleotide.

25. A method according to claim 24, characterized in that the 3'-end of the PTO and CTO is blocked so as not to be extended.

26. A method according to claim 24, characterized in that the PO is close enough to the PTO to induce cleavage of the PTO by a DNA polymerase having 5' nuclease activity.

27. A method according to claim 24, characterized in that the PO induces cleavage of the PTO by a DNA polymerase having 5' nuclease activity through its extension.

28. A composition for detecting a target nucleic acid (TNA) in a sample by a Competitive Hybrids-based Signaling Assay (CHYSA), comprising: (i) a labeled oligonucleotide (LO) comprising a nucleotide sequence hybridizable with the nucleic acid generated dependently on the presence of the TNA or the above, and a label attached thereto, and (ii) A competing oligonucleotide (CO) having a nucleotide sequence capable of hybridizing with the LO and competing with the nucleic acid generated dependently on the presence of the TNA or its hybridization with the LO, The above LO can generate a background signal by forming a first hybridized compound through hybridization with the above CO, and the above LO can also generate a target signal by forming a second hybridized compound through hybridization with the above TNA or a nucleic acid generated dependent on the presence thereof. A composition in which the melting temperature (Tm1) of the first hybrid and the melting temperature (Tm2) of the second hybrid are different, and the formation of the hybrid having a higher melting temperature among the first and second hybrids is competitively advantageous than the formation of the hybrid having a lower melting temperature.

29. A composition according to claim 28, characterized in that the composition exhibits a melting profile having one Signal-Changing Temperature Range (SChTR) in which the signal changes depending on the presence of TNA, and two Signal-Constant Temperature Ranges (SCoTR) in which the signal remains constant despite the presence of TNA.

30. A composition according to claim 29, wherein the signal-change temperature range is higher than the first signal-constant temperature range among the two signal-constant temperature ranges and lower than the second signal-constant temperature range among the two signal-constant temperature ranges.

31. A method for detecting n target nucleic acids (TNA) in a sample, comprising the following steps: (a) incubating n compositions for detecting n TNAs in a reaction vessel together with a sample suspected of containing at least one of n TNAs, and detecting a signal at n detection temperatures during the incubation; Here, n is an integer greater than or equal to 2, and Here, the incubation includes a plurality of reaction cycles, and the detection of the signal is performed in at least one of the plurality of reaction cycles, and Here, each of the n compositions for detecting the n TNAs provides a signal change at a corresponding detection temperature among the n detection temperatures in the presence of the corresponding TNA, and the signal change indicates the presence of the corresponding TNA. Here, among n compositions for detecting n TNAs, the composition for detecting the i-th TNA provides a signal change at the i-th detection temperature among n detection temperatures in the presence of the i-th TNA, and provides a constant signal at other detection temperatures. Here, i represents an integer from 1 to n, the i-th detected temperature is lower than the i+1-th detected temperature, and Here, within a temperature range covering all n detection temperatures, a composition for detecting the i-th TNA has one signal-changing temperature range (SChTR) in which the signal changes depending on the presence of the i-th TNA, and one or two signal-constant temperature ranges (SCoTR) in which the signal is constant despite the presence of the i-th TNA, and Here, the composition for detecting the i-th TNA is any one of the following: (i) Under-Signal-Change-Type (UnderSC-Type) composition having a melting profile in which the signal-change temperature range is lower than the signal-constant temperature range, (ii) an Inter-Signal-Change-Type (InterSC-Type) composition having a melting profile in which the signal-change temperature range is higher than one of two signal-constant temperature ranges and lower than the other of two signal-constant temperature ranges, and (iii) Over-Signal-Change-Type (OverSC-Type) composition having a melting profile in which the signal-change temperature range is higher than the signal-constant temperature range, Herein, at least one of the n compositions for detecting n TNAs is an InterSC-type composition according to any one of claims 23 to 25, and (b) A step of determining the presence of n TNAs from the signal detected in step (a), wherein the presence of the i-th TNA is determined by the change in the signal detected at the i-th detection temperature.

32. A method according to claim 31, wherein the i-th detection temperature is selected within the signal-change temperature range of the composition for detecting the i-th TNA, and wherein the i-th detection temperature is not included in the signal-change temperature range of the composition for detecting other targets.

33. A method according to claim 31, characterized in that the signal-change temperature range of the composition for detecting the i-th TNA partially overlaps with the signal-change temperature range of the composition for detecting the TNA having an adjacent detection temperature, but does not overlap with the signal-change temperature range of the composition for detecting the TNA having a non-adjacent detection temperature.

34. A method according to claim 31, wherein when n is 2, the composition for detecting the first TNA is an UnderSC-type or InterSC-type composition, and the composition for detecting the second TNA is an InterSC-type or OVerSC-type composition.

35. A method according to claim 31, wherein when n is 3, the composition for detecting the first TNA is an UnderSC-type or InterSC-type composition, the composition for detecting the nth TNA is an InterSC-type or OverSC-type composition, and each composition for detecting TNA other than the first TNA and the nth TNA is an InterSC-type composition.

36. A method according to claim 31, characterized in that the detection of a signal at each of n detection temperatures is performed using a single type of detector.

37. A method according to claim 31, wherein the incubation comprises an amplification reaction to TNA.