Novel Anti-CD20 binding domains and uses thereof
The development of CD20-binding domains and CARs with specific CDR sequences addresses the limitations of existing therapies by enhancing T-cell activation and reducing toxicity, providing improved treatment options for cancer and autoimmune diseases.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-30
- Publication Date
- 2026-04-09
AI Technical Summary
Existing CD20-targeting therapies, such as rituximab and Ofatumumab, face challenges including patient non-response, resistance, and severe side effects, necessitating the development of alternative CD20-binding domains and chimeric antigen receptors (CARs) with improved potency and reduced toxicity for cancer and autoimmune disease treatment.
Development of CD20-binding domains with specific CDR sequences (HCDR1: GFTFDDYA, HCDR2: ISWNSGSI, HCDR3: AKDIQYGNYYYGMDV, LCDR1: QSVSSY, LCDR2: DAS, LCDR3: QQRSNWPIT) and corresponding CARs, which include spacers and intracellular signaling domains, for enhanced T-cell activation and reduced toxicity.
The new CD20-binding domains and CARs demonstrate improved efficacy in targeting CD20-expressing cells, enhancing T-cell activation and cytotoxicity, and reducing adverse effects, offering potential therapeutic benefits for cancer and autoimmune diseases.
Smart Images

Figure IMGF000025_0001 
Figure IMGF000026_0001 
Figure IMGF000026_0002
Abstract
Description
NOVEL ANTI-CD20 BINDING DOMAINS AND USES THEREOFSEQUENCE LISTING
[0001] This application incorporates by reference in its entirety the Sequence Listing XML file entitled “GAL-367-US-PSP.xml (50 KB), which was created on October 2, 2024, and filed electronically herewith.TECHNICAL FIELD
[0002] Herein is provided, inter alia, CD20-binding domains and chimeric antigen receptors (“CARs”), as well as corresponding nucleic acid molecules, vectors, cells, compositions, methods and uses, which are particularly useful in the prevention and / or treatment of cancer and / or autoimmune disease.BACKGROUND
[0003] CD20 is a transmembrane protein, encoded in humans by the MS4A1 gene, and is expressed on the surface of B lymphocytes during the development of a B lymphocyte from the early pre-B stage until terminal differentiation into plasmocytes, at which stage CD20 expression disappears. See Casan et al. (2018). In humans, CD20 is expressed as a single 297-amino acid isoform, assigned NCBI Accession No. NP 068769.2 (SEQ ID NO: 25). CD20 is also expressed on malignant B cells, in particular on more than 90% of B cell non-Hodgkin's lymphoma (“NHL”) cells and over 95% B-type Chronic Lymphocytic Leukemia (“B-CLL”) cells. Consequently, antibodies directed against CD20 have been used for the treatment of B-cell derived leukemia and lymphomas. To date, the most widely prescribed anti-CD20 antibody is rituximab, which is listed on the World Health Organization's List of Essential Medicines. See Ang et al. (2023). Specifically, rituximab (Rituxan) is a genetically engineered chimeric murine / human monoclonal antibody directed against CD20. See Casan et al. (2018) Rituximab is currently approved for the treatment of relapsed or refractory follicular lymphoma. Reports indicate that weekly infusions with rituximab resulted in overall response rates of 48%. However, many patients do not respond to rituximab treatment. In addition, responding patients often develop resistance to rituximab and eventually relapse.
[0004] Fully human monoclonal antibodies to CD20 have also been developed, for example Ofatumumab (CAS No. 679818-59-8) which has however received a black box warning due to side effects. Clinical Review Report 2021).
[0005] In addition to oncology, CD20 may also be linked to autoimmune diseases, in particular type 2 rheumatoid arthritis, vasculitis, lupus erythematosus (Casan et al. (2018)), and / or multiple sclerosis See Hauser et al. (2023).SUMMARY
[0006] There is a need for an alternative CAR directed against CD20 which is not associated with the disadvantages of prior constructs, e.g., to provide new methods of treatment for cancer and / or autoimmune diseases. As such, herein is provided, inter alia, CD20-binding domains and corresponding CD20-targetting chimeric antigen receptor (CARs) based on the same. T cells expressing such CARs are particularly usefulin the prevention and / or treatment of cancer and / or autoimmune diseases. Moreover, such T cells may show improved potency, and / or reduced toxicity.
[0007] Accordingly, in some aspects, herein is provided inter alia, a CD20-binding domain comprising: a) a heavy chain variable (“VH”) domain comprising the following complementarity determining regions (“CDRs”):HCDR1 - GFTFDDYA (SEQ ID NO: 1),HCDR2 - ISWNSGSI (SEQ ID NO: 2), and / orHCDR3 - AKDIQYGNYYYGMDV (SEQ ID NO: 3); and / or b) a light chain variable (VL) domain comprising the following CDRs:LCDR1 - QSVSSY (SEQ ID NO: 4),LCDR2 - DAS (SEQ ID NO: 5), and / orLCDR3 - QQRSNWPIT (SEQ ID NO: 6).
[0008] Accordingly, in some aspects, herein is provided inter alia, a CD20-binding domain comprising: a) a heavy chain variable (VH) domain comprising the following complementarity determining regions (CDRs):HCDR1 - GFTFDDYA (SEQ ID NO: 1),HCDR2 - ISWNSGSI (SEQ ID NO: 2),HCDR3 - AKDIQYGNYYYGMDV (SEQ ID NO: 3); and b) a light chain variable (VL) domain comprising the following CDRs:LCDR1 - QSVSSY (SEQ ID NO: 4), LCDR2 - DAS (SEQ ID NO: 5), and LCDR3 - QQRSNWPIT (SEQ ID NO: 6).
[0009] In some aspects, a) the sequence of the VH domain may i) share at least 95% sequence identity with the sequence of SEQ ID NO: 7, and / or ii) have at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitutions compared to SEQ ID NO: 7; and / or b) the sequence of the VL domain may i) share at least 95% sequence identity with the sequence of SEQ ID NO: 8, and / or ii) have at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitutions compared to SEQ ID NO: 8.
[0010] In some aspects, the CD20-binding domain may comprise a fusion protein, e.g., a single chain fragment variable (“scFv”) construct. In some aspects, the scFv may be in the orientation VH-VL. In others, it may be in the orientation VL-VH. In either case, the VH and VL domains may be separated, directly or indirectly, by an intervening linker sequence (e.g., a G4S sequence such as SEQ ID NO: 24, or a fragment comprising at least 5 contiguous amino acids thereof).
[0011] In some aspects, the CD20-binding domain may comprise a sequence sharing at least 90% sequence identity with the sequence of SEQ ID NO: 9. In some aspects, the CD20-binding domain may comprise a sequence having at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitutions compared to SEQ ID NO: 9.
[0012] In some aspects, the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and / or LCDR3 may be located within a human antibody framework.
[0013] Herein is also provided inter alia, a CD20-targeting CAR comprising any of the CD20-binding domains provided herein. In some aspects, the CAR comprises a spacer between the CD20-binding domain and a transmembrane domain. In some aspects, the spacer may comprise: a human an IgGl Fc domain; an IgGl hinge; or a CD8 stalk. In some aspects, the spacer may comprise an IgGl hinge or a CD8 stalk. In some aspects, the CAR may comprise an intracellular T cell signaling domain.
[0014] In some aspects, the intracellular T-cell signaling domain may comprise one or more endodomains selected from the group consisting of: a CD28 endodomain, a 4-1BB endodomain, a 0X40 endodomain and a CD3c endodomain. In some aspects, the intracellular T-cell signaling domain may comprise a 4-1BB endodomain and / or a CD3c endodomain. In some aspects, the intracellular T cell signaling domain may comprise a CD28 endodomain, a 0X40 endodomain and / or a CD3c endodomain. In some aspects, the intracellular T-cell signaling domain comprises at least one of a 4-1BB endodomain and a CD3c endodomain. In some aspects, the intracellular T cell signaling domain comprises at least one of a CD28 endodomain, an 0X40 endodomain and a CD3c endodomain.
[0015] In some aspects, the CAR may comprise a sequence sharing at least 80% sequence identity with a sequence shown in any one of SEQ ID NOs: 9 to 17, or a fragment thereof, wherein the CAR retains its capacity to i) bind CD20 and ii) induce T cell signaling. In a particular aspect, the CAR may comprise a sequence sharing at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% sequence identity with any one of SEQ ID NOs: 9 to 17, or with a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, or 80 contiguous amino acids or nucleotides (as the case may be), of any one of SEQ ID NOs: 9-17.
[0016] Herein is also provided inter alia, a nucleic acid molecule encoding any of the CD20-binding domains provided herein. In a particular aspect, herein is provided inter alia, a vector comprising a nucleic acid sequence encoding any CD20-binding domain provided herein (e.g., a vector comprising a nucleic acid sequence encoding a CAR provided herein). In some aspects, the nucleic acid sequence encoded by the vector may be operably linked to a regulatory element such as a promoter (e.g., a cell or tissue -specific promoter).
[0017] Herein is also provided inter alia, a cell comprising any CD20-binding domain, CAR, nucleic acid molecule, and / or vector provided herein. In some aspects, the cell may be a cytolytic immune cell, such as a T cell or a natural killer (“NK”) cell.
[0018] Herein is also provided inter alia, a composition comprising a plurality of any of the cells provided herein. In some aspects, herein is also provided inter alia, a method for making any of the cells provided herein, comprising transducing or transfecting a cell with any of the nucleic acid molecules or a vectors provided herein.
[0019] Herein is also provided inter alia, a method for making a composition, comprising transducing or transfecting ex vivo a plurality of cells obtained from a subject with a nucleic acid molecule or a vectorprovided herein. In some aspects, the plurality of cells may be obtained from a sample from the subject such as a blood sample or a derivative thereof, e.g., a peripheral blood mononuclear cell (“PBMC”) sample.
[0020] Herein is also provided inter alia, a pharmaceutical composition comprising any CD20-binding domain, CAR, nucleic acid molecule, vector, cell, or cell composition provided herein, together with at least one pharmaceutically acceptable carrier, diluent, or excipient.
[0021] The CD20-binding domain, CAR, nucleic acid molecule, vector, cell, or cell composition, may therefore be used in the manufacture of a pharmaceutical composition for treating cancer and / or autoimmune disease.
[0022] The pharmaceutical compositions provided herein may be for use as a medicament.
[0023] Accordingly, herein is also provided inter alia, a method for treating cancer and / or autoimmune disease comprising administering an effective amount of a pharmaceutical composition, provided herein, to a subject in need thereof.
[0024] In some aspects, the method may comprise (i) transducing or transfecting ex vivo a plurality of cells obtained from a subject with the pharmaceutical composition, wherein the pharmaceutical composition comprises a nucleic acid molecule or a vector provided herein, and (ii) administering the transduced or transfected cells back into the subject.
[0025] The pharmaceutical compositions provided herein may be for use in treating cancer and / or autoimmune disease.
[0026] Other objects and advantages will become apparent to those skilled in the art from a consideration of the ensuing detailed description.DESCRIPTION OF THE FIGURES
[0027] FIG. 1 : Overview of chimeric antigen receptors and their endodomains. This figure illustrates (a) a basic schema of a CAR; and of (b) first generation CARs, (c) second generation CARs, and (d) third generation CARs.
[0028] FIG. 2: Provides a schematic of a “Binder A” CAR comprising an anti-CD20 scFv (VH- (GGGGSjs-VL), triple alanine residues (AAA) encoded by a Notl restriction site, a CD8a hinge (CD8 H), a CD8a transmembrane domain (CD8 TM), a costimulatory domain (4-1BB), and a signaling domain (CD3zeta).
[0029] FIGs. 3A-C: Provide graphs showing surface expression of CARs on transduced human primary T cells measured by a PE-conjugated anti-G4S linker antibody. The CAR-negative and -positive T cell populations are in gray (A) and black (B), respectively. The percent positivity rates are shown.
[0030] FIG. 4: Provides graphs showing the killing activity of “Binder A” CAR (filled triangles), ofatumumab CAR (filled square), and untransduced cells (filled circles) against CD20-positive (Raji & Daudi) and CD20-negative human cancer cell lines (K562).
[0031] FIG. 5: Provides graphs showing cytokine release by untransduced cells (1), and human primary T cells transduced with ofatumumab CAR (2) or a “Binder A” CAR (3), when incubated with CD20- positive and CD20-negative human cancer cell lines.
[0032] FIG. 6: Top: Localization of ofatumumab somatic hypermutations on the cryo-EM structure of the CD20-ofatumumab complex. The structure of the protein complex is represented, and the amino acid residues are annotated by using the molecular visualization system PyMOL (version 2.5.4) and the IMGT number scheme, respectively. PDB, Protein Data Bank.
[0033] FIG. 7 1 = Binder A, 2 = Ofatumumab, 3=Ofatumuab_N35D, 4=Ofatumumab_T55G, 5 = Ofatumumab_K85N.Expression and purification of antibodies and their monomers by SEC. Purity and intensity of proteins in each collected fraction were analyzed on SDS-PAGE and graphs were embedded into the SEC graphs. The molecular weight standards for SDS-PAGE are shown on the left of the graphs and the related fraction numbers from SEC are indicated on the top. The elution volumes for each peak of the samples are indicated on the top of the peaks in the graphs.
[0034] FIG. 8: Binding of binder A, ofatumumab, and ofatumumab variants to K562-CD20 cells as measured by flow cytometry. Bound antibodies were detected by 1:500 diluted APC -conjugated anti -FLAG tag antibody.
[0035] FIG. 9: Statistical analysis of antibody binding to K562-CD20 cells at concentrations of 40, 200, and 1000 nM, respectively. Statistical analysis was performed using two-way ANOVA. ****, P0.0001; ***, P0.001; **, PO.Ol; *, P .05; ns, not significant; MFI: median fluorescence intensity.
[0036] FIG. 10. Comparative binding strength of binder A and ofatumumab to K562 cells expressing different CD20 variants as measured by flow cytometry. Bound antibodies were detected by 1:500 diluted APC-conjugated anti-FLAG tag antibody. Statistical analysis was performed for each of the variants between binder A and ofatumumab using two-way ANOVA. ****, PO.0001; ***, PO.001; **, PO.Ol; *, PO.05; ns, not significant.DETAILED DESCRIPTIONDefinitions
[0037] The following terms are intended to have the meanings presented therewith below and are useful in understanding the description and intended scope of the aspects herein provided.
[0038] When describing aspects herein provided, which may include nucleic acid sequences, nucleic acid molecules, vectors, cells, compositions, pharmaceutical compositions, binding domains, CARs, methods and uses, etc., the following terms, if present, have the following meanings unless otherwise indicated. It should also be understood that when described herein any of the moieties defined forth below may be substituted with a variety of substituents, and that the respective definitions are intended to include such substituted moieties within their scope as set out below.
[0039] The articles “a” and “an” may be used herein to refer to one or to more than one ( / .e. at least one) of the grammatical objects of the article.
[0040] The term “antibody” means monoclonal antibodies (“mAbs”), including any isotype, such as, IgG, IgM, IgA, IgD and IgE. An IgG antibody is comprised of two identical heavy chains and two identical light chains that are joined by disulfide bonds. Each heavy and light chain contains a constant region and avariable region. Each variable region contains three segments called “complementarity-determining regions” (CDRs) or “hypervariable regions,” which are primarily responsible for binding an epitope of an antigen. They are referred to as CDR1, CDR2, and CDR3, numbered sequentially from the N-terminus. The more highly conserved portions of the variable regions outside of the CDRs are called the “framework regions.” An “antibody fragment” means an Fv, an scFv, a dsFv, an Fab, an F(ab')2 fragment, an F(ab') fragment, or other fragment, which contains at least one variable heavy or variable light chain, each containing one or more CDRs and framework regions. The CDRs provided herein are defined using the IMGT numbering scheme. See Dondelinger et al. (2018). However, it should be understood that alternative CDR sequences may be selected from the VH and VL sequences described herein (e.g. using the Kabat, Chothia, or Martin numbering schemes, and that any such alternative CDRs may be used in the constructs described herein in place of the corresponding IMGT-numbered CDRs).
[0041] “ VH” refers to the variable region of an immunoglobulin heavy chain of an antibody, or antibody fragment. The CDRs of the VH are referred to as HCDR1, HCDR2, and HCDR3.
[0042] “ VL” refers to the variable region of the immunoglobulin light chain of an antibody, or antibody fragment. The CDRs of the VL are referred to as LCDR1, LCDR2, and LCDR3.
[0043] The term “CD20” refers to the protein known as CD20 or B-lymphocyte surface antigen Bl, having the following synonyms: MS4A1, Bl, Bp35, CD20, CVID5, LEU-16, MS4A2, S7, membrane spanning 4- domains Al, FMC7. Human CD20 wild-type has Uniprot reference Pl 1836 & P19437, and has been assigned the NCBI Genbank Accession No. NP 068769.2 (SEQ ID NO: 25).
[0044] The terms “antigen-binding domain,” “binding domain,” or “binder” are used interchangeably herein to refer to a protein domain (e.g., portion of an antibody, portion of an antibody fragment, or portion of a CAR) that recognizes an antigen. Numerous antigen-binding domains are known in the art, including those based on the antigen-binding site of an antibody. The binding domain may be a full-length antibody or an antibody fragment. It may be a full-length antibody, an Fv, single chain variable fragment (scFv), dsFv, an F(ab) fragment, an F(ab')2 fragment, an F(ab') fragment, a single-domain antibody (sdAb), a VHH / nanobody, a nanobody, an affibody, a fibronectin artificial antibody scaffold, an anticalin, an affilin, a DARPin, a VNAR, an iBody, an affimer, a fynomer, a domain antibody (DAb), an abdurin / nanoantibody, a centyrin, an alphabody, a nanofitin or a D domain. In particular, the term refers to a full-length antibody, an Fv, a single chain variable fragment (scFv), a dsFv, an F(ab) fragment, an F(ab')2 fragment, or an F(ab') fragment. In a particular embodiment, it refers to an scFv.
[0045] The antigen-binding domain may specifically recognize an antigen, i.e. it may specifically bind to the antigen (such as CD20). “Specific binding” in the context of the present disclosure may mean binding with an affinity corresponding to a KD of about 10 M or less, such as about 10xM or less, such as about I O9M or less, about 1019M or less, or about 10 " M or even less when determined for instance by surface plasmon resonance (“SPR”) technology in a BIAcore 3000 instrument using the antigen-binding domain as the analyte. This term also may mean that the antigen-binding domain binds to the predetermined antigen / epitope with an affinity corresponding to a KD that is at least ten-fold lower, such as at least 100 fold lower, for instance at least 1000 fold lower, such as at least 10,000 fold lower, for instance at least100,000 fold lower than its affinity for binding to a non-specific antigen (e.g., bovine serum albumin, casein) other than the predetermined antigen or a closely-related antigen. The amount with which the affinity is lower is dependent on the KD of the antigen-binding domain, so that when the KD of the antigenbinding domain is very low (that is, the antigen-binding domain is very specific), then the amount with which the affinity for the antigen is lower than the affinity for a non-specific antigen may be at least 10,000- fold. The term “KD” as used herein, means the dissociation rate constant of a particular antigen-binding domain and antigen interaction.
[0046] The binding domain (e.g., scFv) may be part of a chimeric antigen receptor (CAR). It may provide an antigen-targeting capability (in other words, the capability to bind to a desired antigen) of the CAR. CARs that comprise the CD20-binding domains provided herein may be referred to as “CD20-targetting CARs” due to their ability to bind CD20 via the binder component of the CAR. CARs that comprise the CD20-binding domains provided herein may also be referred to as CARs that specifically target CD20 expressing cells, or CARs that specifically bind to CD20 expressing cells. Methods for determining specific binding are well known in the art, see for example the examples section below.
[0047] The term “CAR” refers to chimeric antigen receptor, which is a chimeric type I trans-membrane protein which connects an extracellular antigen-recognizing domain (binder) to an intracellular signalling domain (endodomain). The binder is typically derived from antibody fragments (e.g., scFv, Fab, VHH, scFab), ligands of receptors (e.g., peptides) or from Dectins. A spacer domain is usually used to isolate the binder from the membrane and to allow it to achieve a suitable orientation. A common spacer domain used is the Fc of IgGl. More compact spacers may suffice, e.g., the stalk from CD8a or the IgGl hinge alone, depending on the antigen. A trans-membrane domain anchors the protein in the cell membrane and connects the spacer to the endodomain. Early CAR designs had endodomains derived from the intracellular parts of either the y chain of the FceRl or CD3L Consequently, these first-generation receptors transmitted immunological signal 1, which was sufficient to trigger T-cell killing of cognate target cells but failed to fully activate the T-cell to proliferate and survive. To overcome this limitation, compound endodomains have been constructed: fusion of the intracellular part of a T-cell co-stimulatory molecule to that of CD3c results in second generation receptors which can transmit an activating and co-stimulatory signal simultaneously after antigen recognition. The co-stimulatory domain most commonly used is that of CD28. This supplies the most potent co-stimulatory signal - namely immunological signal 2, which triggers T-cell proliferation. Some receptors have also been described which include TNF receptor family endodomains, such as the closely related 0X40 and 4-1BB which transmit survival signals. Even more potent third generation CARs have now been described which have endodomains capable of transmitting activation, proliferation and survival signals. When the CAR binds the target-antigen, this results in the transmission of an activating signal to the T-cell it is expressed on. Thus, the CAR directs the specificity and cytotoxicity of the T cell towards tumour cells expressing the targeted antigen.
[0048] A CAR may have the general structure: (i) an antigen-binding domain; (ii) a spacer; (iii) a transmembrane domain; and (iv) an intracellular domain which comprises or associates with a signalling domain (see FIG. 1).
[0049] The nucleic acid molecules, vectors, binding domains, CARs, cells, and compositions provided herein provided herein may be in isolated form. The term “isolated” means a substance in a form and / or environment that does not occur in nature. Non-limiting examples of isolated substances include (1) any substance that does not occur naturally, (2) any substance including, but not limited to, any nucleic acid, protein, peptide, cell, which is at least partially removed of one or more or all of the constituents that occur naturally with which it is associated in nature; (3) any substance modified by man in relation to that substance found in nature; and / or (4) any substance modified by increasing the amount of the substance in relation to other components with which it is naturally associated (e.g., enriched).
[0050] “Pharmaceutically acceptable” means approved or approvable by a regulatory agency of the Federal or a state government or the corresponding agency in countries other than the United States, or that is listed in the U.S. Pharmacopoeia or other generally recognized pharmacopoeia for use in animals, and more particularly, in humans.
[0051] “Subject” includes humans. The terms “human,” “patient,” and “subject” are used interchangeably herein.
[0052] “ Administered” or “administration” includes but is not limited to delivery of a drug by an injectable form, such as, for example, an intravenous, intramuscular, intradermal or subcutaneous route or mucosal route, for example, as a nasal spray or aerosol for inhalation or as an ingestible solution, capsule or tablet. Preferably, the administration is by an injectable form.
[0053] “ Effective amount” means the amount of a composition provided herein that, when administered to a subject for treating a disease, is sufficient to effect such treatment for the disease. The “effective amount” can vary depending on the composition, the disease and its severity, and the age, weight, etc., of the subject to be treated.
[0054] The term “prophylaxis” is related to “prevention,” and refers to a measure or procedure the purpose of which is to prevent, rather than to treat or cure a disease. Non-limiting examples of prophylactic measures may include the administration of vaccines; the administration of low molecular weight heparin to hospital patients at risk for thrombosis due, for example, to immobilization; and the administration of an anti- malarial agent such as chloroquine, in advance of a visit to a geographical region where malaria is endemic or the risk of contracting malaria is high.
[0055] “Treating” or “treatment” of any disease or disorder refers, in one embodiment, to ameliorating the disease or disorder (i.e. arresting the disease or reducing the manifestation, extent or severity of at least one of the clinical symptoms thereof). In another embodiment “treating” or “treatment” refers to ameliorating at least one physical parameter, which may not be discernible by the subject. In yet another embodiment, “treating” or “treatment” refers to modulating the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both. In a further embodiment, “treating” or “treatment” relates to slowing the progression of the disease.
[0056] As used herein, the term “autoimmune disease” refers to diseases that result when the acquired immune system mistakenly attacks the body's own tissues. In particular, the term refers to rheumatoid arthritis (“RA”), chronic obstructive pulmonary disease (“COPD”), asthma, bronchitis, systemic lupuserythematosus (“SLE”), cutaneous lupus erythematosus (“CLE”), lupus nephritis, dermatomyositis, Sjogren’s syndrome, multiple sclerosis, psoriasis, dry eye disease, type I diabetes mellitus, atopic dermatitis, thyroiditis, contact dermatitis, eczematous dermatitis, inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis), atherosclerosis, chronic active hepatitis, scleroderma, pemphigus, and Hashimoto's thyroiditis and amyotrophic lateral sclerosis. More particularly, the term refers to systemic lupus erythematosus (SLE).
[0057] As used herein the term “cancer” refers to diseases caused by an uncontrolled division of abnormal cells in a part of the body. In particular, the term refers to metastatic tumour cell types (such as but not limited to, melanoma, lymphoma, leukaemia, fibrosarcoma, rhabdomyosarcoma, and mastocytoma) and types of tissue carcinoma (such as but not limited to, colorectal cancer, prostate cancer, small cell lung cancer and non-small cell lung cancer, breast cancer, pancreatic cancer, bladder cancer, renal cancer, gastric cancer, glioblastoma, primary liver cancer, ovarian cancer, prostate cancer and uterine leiomyosarcoma). More particularly, the term refers to haematological cancer.
[0058] The term “haematological cancer” includes blood-borne tumours and diseases or disorders involving abnormal cell growth and / or proliferation in tissues of hematopoietic origin, such as lymphomas, leukaemia’s, and myelomas. More particularly, the term refers to Non-Hodgkin’s lymphoma (“NHL”), acute myeloid leukaemia (“AML”), and acute lymphoblastic leukaemia (“ALL”) and chronic lymphoblastic leukaemia (“CLL”).
[0059] Non-Hodgkin’s lymphoma (“NHL”) is a heterogeneous malignancy originating from lymphocytes. In the United States, the incidence is estimated at 65,000 / year with mortality of approximately 20,000 (American Cancer Society, 2006; and SEER Cancer Statistics Review). The disease can occur in all ages, the usual onset begins in adults over 40 years, with the incidence increasing with age. NHL is characterized by a clonal proliferation of lymphocytes that accumulate in the lymph nodes, blood, bone marrow and spleen, although any major organ may be involved. The current classification system used by pathologists and clinicians is the World Health Organization (“WHO”) Classification of Tumours, which organizes NHL into precursor and mature B-cell or T-cell neoplasms. The PDQ is currently dividing NHL as indolent or aggressive for entry into clinical trials. The indolent NHL group is comprised primarily of follicular subtypes, small lymphocytic lymphoma, MALT (mucosa-associated lymphoid tissue), and marginal zone; indolent encompasses approximately 50% of newly diagnosed B-cell NHL patients. Aggressive NHL includes patients with histologic diagnoses of primarily diffuse large B cell lymphoma (DLBL, “DLBCL”, or DLCL) (40% of all newly diagnosed patients have diffuse large cell lymphoma), Burkitt's, and mantle cell lymphoma (“MCL”). The most commonly used agents for combination chemotherapy include cyclophosphamide, vincristine and prednisone (CVP); or cyclophosphamide, adriamycin, vincristine, prednisone (CHOP). Approximately 70% to 80% of patients will respond to their initial chemotherapy, duration of remissions last about 2-3 years. Ultimately, the majority of patients relapse. The discovery and clinical use of the anti-CD20 antibody, rituximab, has provided significant improvements in response and survival rate. The current standard of care for most patients is rituximab + CHOP (R-CHOP) or rituximab + CVP (R-CVP). Rituximab therapy has been shown to be efficacious in several types of NHL and iscurrently approved as a first line treatment for both indolent (follicular lymphoma) and aggressive NHL (diffuse large B cell lymphoma). However, there are significant limitations of anti-CD20 monoclonal antibody (mAb), including primary resistance (50% response in relapsed indolent patients), acquired resistance (50% response rate upon re-treatment), rare complete response (2% complete response rate in relapsed population), and a continued pattern of relapse.
[0060] Chronic lymphocytic leukaemia (also known as "chronic lymphoid leukaemia" or "CLL"), is a type of adult leukaemia caused by an abnormal accumulation of B lymphocytes. In CLL, the malignant lymphocytes may look normal and mature, but they are not able to cope effectively with infection. CLL is the most common form of leukaemia in adults. Men are twice as likely to develop CLL as women. However, the key risk factor is age. Over 75% of new cases are diagnosed in patients over age 50. More than 10,000 cases are diagnosed every year and the mortality is almost 5,000 a year (American Cancer Society, 2006; and SEER Cancer Statistics Review). CLL is an incurable disease but progresses slowly in most cases. Many people with CLL lead normal and active lives for many years. Because of its slow onset, early-stage CLL is generally not treated since it is believed that early CLL intervention does not improve survival time or quality of life. Instead, the condition is monitored over time. Initial CLL treatments vary depending on the exact diagnosis and the progression of the disease. There are dozens of agents used for CLL therapy. Combination chemotherapy regimens such as FCR (fludarabine, cyclophosphamide and rituximab), and BR (Ibrutinib and rituximab) are effective in both newly -diagnosed and relapsed CLL. Allogeneic bone marrow (stem cell) transplantation is rarely used as a first-line treatment for CLL due to its risk.
[0061] Another type of leukaemia is Small lymphocytic lymphoma (“SLL”) that is considered a CLL variant that lacks the clonal lymphocytosis required for the CLL diagnosis, but otherwise shares pathological and immunophenotypic features (Campo et al. 2011). The definition of SLL requires the presence of lymphadenopathy and / or splenomegaly. Moreover, the number of B lymphocytes in the peripheral blood should not exceed 5E+09 / L. The incidence of SLL is approximately 25% of CLL in the US (Dores et al. 2007).
[0062] Another type of leukaemia is acute lymphoblastic leukaemia (ALL), also known as acute lymphocytic leukaemia. ALL is characterized by the overproduction and continuous multiplication of malignant and immature white blood cells (also known as lymphoblasts) in the bone marrow. 'Acute' refers to the undifferentiated, immature state of the circulating lymphocytes ("blasts"), and that the disease progresses rapidly with life expectancy of weeks to months if left untreated.
[0063] The terms “combination” or “pharmaceutical combination” refer to the administration of one therapy in addition to another therapy. As such, “in combination with” includes simultaneous (e.g., concurrent) and consecutive administration in any order.
[0064] As noted above, herein are provided inter alia, CD20-binding domains and CARs, as well as corresponding nucleic acid molecules, vectors, cells, compositions, methods and uses, which are particularly useful in the prevention and / or treatment of cancer and / or autoimmune disease.CD20-binding domains
[0065] In one embodiment is provided a CD20-binding domain comprising a heavy chain variable (VH) domain comprising the following complementarity determining regions (CDRs):HCDR1 - GFTFDDYA (SEQ ID NO: 1),HCDR2 - ISWNSGSI (SEQ ID NO: 2), and / orHCDR3 - AKDIQYGNYYYGMDV (SEQ ID NO: 3).
[0066] In another embodiment is provided a CD20-binding domain comprising a heavy chain variable(VH) domain comprising the following complementarity determining regions (CDRs):HCDR1 - GFTFDDYA (SEQ ID NO: 1),HCDR2 - ISWNSGSI (SEQ ID NO: 2), andHCDR3 - AKDIQYGNYYYGMDV (SEQ ID NO: 3).
[0067] In one embodiment is provided a CD20-binding domain comprising a light chain variable region(VL) having CDRs with the following sequences:LCDR1 - QSVSSY (SEQ ID NO: 4),LCDR2 - DAS (SEQ ID NO: 5), and / orLCDR3 - QQRSNWPIT (SEQ ID NO: 6).
[0068] In another embodiment is provided a CD20-binding domain comprising a light chain variable region (VL) having CDRs with the following sequences:LCDR1 - QSVSSY (SEQ ID NO: 4),LCDR2 - DAS (SEQ ID NO: 5), andLCDR3 - QQRSNWPIT (SEQ ID NO: 6).
[0069] In a particular embodiment is provided a CD20-binding domain comprising: a) a heavy chain variable (VH) domain comprising the following complementarity determining regions (CDRs):HCDR1 - GFTFDDYA (SEQ ID NO: 1),HCDR2 - ISWNSGSI (SEQ ID NO: 2), and / orHCDR3 - AKDIQYGNYYYGMDV (SEQ ID NO: 3); and b) a light chain variable (VL) domain comprising the following CDRs:LCDR1 - QSVSSY (SEQ ID NO: 4),LCDR2 - DAS (SEQ ID NO: 5), and / orLCDR3 - QQRSNWPIT (SEQ ID NO: 6).
[0070] In a particular embodiment is provided a CD20-binding domain comprising: a) a heavy chain variable (VH) domain comprising at least one of the following CDRs:HCDR1 - GFTFDDYA (SEQ ID NO: 1),HCDR2 - ISWNSGSI (SEQ ID NO: 2), andHCDR3 - AKDIQYGNYYYGMDV (SEQ ID NO: 3); and b) a light chain variable (VL) domain comprising at least one of the following CDRs:LCDR1 - QSVSSY (SEQ ID NO: 4),LCDR2 - DAS (SEQ ID NO: 5), andLCDR3 - QQRSNWPIT (SEQ ID NO: 6).
[0071] In a particular embodiment is provided a CD20-binding domain comprising: a) a heavy chain variable (VH) domain comprising at least one of the following CDRs:HCDR1 - GFTFDDYA (SEQ ID NO: 1),HCDR2 - ISWNSGSI (SEQ ID NO: 2), andHCDR3 - AKDIQYGNYYYGMDV (SEQ ID NO: 3); or b) a light chain variable (VL) domain comprising at least one of the following CDRs:LCDR1 - QSVSSY (SEQ ID NO: 4), LCDR2 - DAS (SEQ ID NO: 5), and LCDR3 - QQRSNWPIT (SEQ ID NO: 6).
[0072] In another particular embodiment is provided a CD20-binding domain comprising: a) a heavy chain variable (VH) domain comprising the following complementarity determining regions (CDRs):HCDR1 - GFTFDDYA (SEQ ID NO: 1),HCDR2 - ISWNSGSI (SEQ ID NO: 2),HCDR3 - AKDIQYGNYYYGMDV (SEQ ID NO: 3); and b) a light chain variable (VL) domain comprising the following CDRs:LCDR1 - QSVSSY (SEQ ID NO: 4),LCDR2 - DAS (SEQ ID NO: 5),LCDR3 - QQRSNWPIT (SEQ ID NO: 6).
[0073] In some aspects, one or more mutations (substitutions, additions or deletions) may be introduced into one or more of the CDRs in the CD20-binding domains provided herein without negatively affecting CD20-binding activity of the CD20-binding domain. In one embodiment, one or more CDR within the CD20-binding domain may have one, two or three amino acid mutations. In a particular embodiment, one or more CDR within the CD20-binding domain may have one or two amino acid mutations only. In a more particular embodiment, one or more CDR within the CD20-binding domain may have one amino acid mutation only. In a most particular embodiment, each CDR has no mutation. In some embodiments, the mutations, if present, comprise one or more conservative substitutions of amino acids present in the sequences described herein.
[0074] In one embodiment is provided a CD20-binding domain comprising a heavy chain variable (VH) domain comprising the following complementarity determining regions (CDRs):HCDR1 having a sequence with at least 80% sequence identity to GFTFDDYA (SEQ ID NO: 1);HCDR2 having a sequence with at least 94% sequence identity to ISWNSGSI (SEQ ID NO: 2); and HCDR3 having a sequence with at least 88% sequence identity to AKDIQYGNYYYGMDV (SEQ ID NO: 3).
[0075] In one embodiment is provided a CD20-binding domain comprising a light chain variable region (VL) having CDRs with the following sequences:LCDR1 having a sequence with at least 92% sequence identity to QSVSSY (SEQ ID NO: 4);LCDR2 having a sequence with at least 85% sequence identity to DAS (SEQ ID NO: 5); andLCDR3 having a sequence with at least 90% sequence identity to QQRSNWPIT (SEQ ID NO: 6).
[0076] In a particular embodiment is provided a CD20-binding domain comprising: a) a heavy chain variable (VH) domain comprising the following complementarity determining regions (CDRs):HCDR1 having a sequence with at least 80% sequence identity to GFTFDDYA (SEQ ID NO: 1);HCDR2 having a sequence with at least 94% sequence identity to ISWNSGSI (SEQ ID NO: 2); and HCDR3 having a sequence with at least 88% sequence identity to AKDIQYGNYYYGMDV (SEQ ID NO: 3); and b) a light chain variable (VL) domain comprising the following CDRs:LCDR1 having a sequence with at least 92% sequence identity to QSVSSY (SEQ ID NO: 4);LCDR2 having a sequence with at least 85% sequence identity to DAS (SEQ ID NO: 5); andLCDR3 having a sequence with at least 90% sequence identity to QQRSNWPIT (SEQ ID NO: 6).
[0077] The CDRs may be in the format of any appropriate CD20-binding domain provided herein (e.g., the CD20 binding domain may be a full-length antibody, or an antibody fragment comprising the recited CDRs It may be a full-length antibody, an Fv, a single chain antibody fragment (scFv), a dsFv, an F(ab) fragment, an F(ab')2 fragment, an F(ab') fragment, a single domain antibody (sdAb), a VHH / nanobody, a nanobody, an affibody, a fibronectin artificial antibody scaffold, an anticalin, an affilin, a DARPin, a VNAR, an iBody, an affimer, a fynomer, a domain antibody (DAb), an abdurin / nanoantibody, a centyrin, an alphabody, a nanofitin or a D domain. In particular, the term refers to a full-length antibody, an Fv, a single chain antibody fragment (scFv), a dsFv, an F(ab) fragment, an F(ab')2 fragment, an F(ab') fragment.
[0078] The binding domain may be non-human, chimeric, humanised or fully human.
[0079] The CDRs may be in the format of a single-chain variable fragment (scFv), which is a fusion protein of the heavy variable region (VH) and light chain variable region (VL) of an antibody, typically connected with a short linker peptide of about 10 to about 25 amino acids (or a length comprising any integer value between 10 and 25). The scFv may be in the orientation VH-VL (i.e. the VH being N-terminal to the VL). In other aspects, the scFv may be in the orientation VL-VH. Accordingly, the CDRs may be grafted into the framework of a scFv.
[0080] The CD20-binding domain provided herein may comprise a variant of the sequence shown as SEQ ID NO: 7, 8, or 9, wherein the variant has at least 80, 85, 90, 95, 98 or 99% sequence identity to SEQ ID NO: 7, 8, or 9, provided that the variant sequence also retains the capacity to bind CD20 (when in conjunction with a complementary VL or VH domain, if appropriate). The percentage identity between two polypeptide sequences may be readily determined by programs such as BLAST which is freely available at http: / / blast.ncbi.nlm.nih.gov.
[0081] In one embodiment is provided a CD20-binding domain comprising:(a) a light chain variable (VL) domain comprising an amino acid sequence of SEQ ID NO: 8; and(b) a heavy chain variable (VH) domain variant of SEQ ID NO: 48; wherein the heavy chain variable (VH)domain variant differs from the amino acid sequence of SEQ ID NO:48 by one, two or at most three amino acid substitutions selected from T55G, N35D and / or K85N, wherein the numbering is according to the IM GT numbering scheme.
[0082] In one embodiment is provided a CD20-binding domain comprising:(a) a light chain variable (VL) domain comprising an amino acid sequence of SEQ ID NO: 8; and(b) a heavy chain variable (VH) domain variant of SEQ ID NO: 48; wherein the heavy chain variable (VH) domain variant differs from the amino acid sequence of SEQ ID NO:48 by one amino acid substitutions selected from the group consisting of T55G, N35D and / or K85N, wherein the numbering is according to the IMGT numbering scheme.
[0083] In one embodiment is provided a CD20-binding domain comprising:(a) a light chain variable (VL) domain comprising an amino acid sequence of SEQ ID NO: 8; and(b) a heavy chain variable (VH) domain variant of SEQ ID NO: 48; wherein the heavy chain variable (VH) domain variant differs from the amino acid sequence of SEQ ID NO:48 by two amino acid substitutions selected from the group consisting of: T55G, N35D and K85N, wherein the numbering is according to the IMGT numbering scheme.
[0084] In one embodiment is provided a CD20-binding domain comprising:(a) a light chain variable (VL) domain comprising an amino acid sequence of SEQ ID NO: 8; and(b) a heavy chain variable (VH) domain variant of SEQ ID NO: 48; wherein the heavy chain variable (VH) domain variant differs from the amino acid sequence of SEQ ID NO:48 by the amino acid substitution T55G, and optionally by one or at most two further amino acid substitutions selected from the group consisting of: N35D and K85N, wherein the numbering is according to the IMGT numbering scheme.
[0085] In one embodiment is provided a CD20-binding domain comprising:(a) a light chain variable (VL) domain comprising an amino acid sequence of SEQ ID NO: 8; and(b) a heavy chain variable (VH) domain variant of SEQ ID NO: 48; wherein the heavy chain variable (VH) domain variant differs from the amino acid sequence of SEQ ID NO:48 by the following three amino acid substitutions: N35D, T55G and K85N, wherein the numbering is according to the IMGT numbering scheme.
[0086] In one embodiment is provided a CD20-binding domain comprising: a) a heavy chain variable (VH) domain comprising the following complementarity determining regions (CDRs):HCDR1 - GFTFDDYA (SEQ ID NO: 1) or GFTFNDYA (SEQ ID NO: 50),HCDR2 - ISWNSGSI (SEQ ID NO: 2), andHCDR3 - AKDIQYGNYYYGMDV (SEQ ID NO: 3); and b) a light chain variable (VL) domain comprising the following CDRs:LCDR1 - QSVSSY (SEQ ID NO: 4),LCDR2 - DAS (SEQ ID NO: 5), andLCDR3 - QQRSNWPIT (SEQ ID NO: 6),wherein the heavy chain (VH) domain further comprises (i) glycine at position 55 and / or (ii) asparagine at position 85, wherein the numbering is according to the IM GT numbering scheme.
[0087] “Retaining capacity to bind CD20” refers to the ability of a variant of a CD20-binding domain herein provided (e.g., comprising at least 80, 85, 90, 95, 98 or 99% sequence identity to SEQ ID NO: 7, 8 or 9 and / or comprising one or more mutations introduced into one or more of the CDRs in the CD20- binding domains provided herein) to bind to a CD20 protein, or a fragment thereof (e.g., a fragment comprising at least 20, 240, 60, 80 or 100 contiguous amino acids of SEQ ID NO: 25). For example, a variant CD20-binding domain may have the same or similar binding properties as a non-variant CD20- binding domain herein provided (e.g., the binder of SEQ ID NO: 9). For example, a variant CD20-binding domain may bind with an affinity the same as or similar to a non-variant CD20-binding domain herein provided (e.g., the binder of SEQ ID NO: 9). For example, a variant CD20-binding domain may have a Ka and / or Kd the same as or similar to a non-variant CD20-binding domain herein provided (e.g., the binder of SEQ ID NO: 9).
[0088] In a particular embodiment, the VH domain of the CD20-binding domain provided herein comprises a sequence having at least 95% sequence identity (i.e., at least 95, at least 96, at least 97, at least 98, at least 99, or 100%) compared to the sequence of SEQ ID NO: 7. In one example, the VH domain of the CD20-binding domain provided herein comprises the sequence of SEQ ID NO: 7.
[0089] In a particular embodiment, the VL domain of the CD20-binding domain provided herein comprises a sequence having at least 95% sequence identity (i.e., at least 95, at least 96, at least 97, at least 98, at least 99, or 100%) compared to the sequence of SEQ ID NO: 8. In one example, the VL domain of the CD20-binding domain provided herein comprises the sequence of SEQ ID NO: 8.
[0090] In a particular embodiment, the VH domain of the CD20-binding domain provided herein comprises a sequence having at least 95% sequence identity (i.e., at least 95, at least 96, at least 97, at least 98, at least 99, or 100%) compared to the sequence of SEQ ID NO: 7 or the VL domain of the CD20- binding domain provided herein comprises a sequence having at least 95% sequence identity (i.e., at least 95, at least 96, at least 97, at least 98, at least 99, or 100%) compared to the sequence of SEQ ID NO: 8.
[0091] In a particular embodiment, the VH domain of the CD20-binding domain provided herein comprises a sequence having at least 95% sequence identity (i.e., at least 95, at least 96, at least 97, at least 98, at least 99, or 100%) compared to the sequence of SEQ ID NO: 7 and the VL domain of the CD20- binding domain provided herein comprises a sequence having at least 95% sequence identity (i.e., at least 95, at least 96, at least 97, at least 98, at least 99, or 100%) compared to the sequence of SEQ ID NO: 8.
[0092] In a particular embodiment, the VH domain of the CD20-binding domain provided herein has at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitutions compared to the sequence of SEQ ID NO: 7 or the VL domain of the CD20-binding domain provided herein has at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitutions compared to the sequence of SEQ ID NO: 8.
[0093] In a particular embodiment, the VH domain of the CD20-binding domain provided herein has at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitutions compared to thesequence of SEQ ID NO: 7 and the VL domain of the CD20-binding domain provided herein has at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitutions compared to the sequence of SEQ ID NO: 8.
[0094] In one embodiment, the VH domain of the CD20-binding domain provided herein comprises the sequence of SEQ ID NO: 7 and the VL domain comprises the sequence of SEQ ID NO: 8.
[0095] In one embodiment, the CD20-binding domain provided herein comprises a sequence having at least 95% sequence identity (i.e., at least 95, at least 96, at least 97, at least 98, at least 99, or 100%) compared to the sequence of SEQ ID NO: 9. In another embodiment, the CD20-binding domain provided herein has at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitutions compared to the sequence of SEQ ID NO: 9. In one example, the CD20-binding domain provided herein comprises the sequence of SEQ ID NO: 9.
[0096] The CDRs contribute to the formation of the antigen-binding, or more specifically, epitope binding site of the antigen-binding domains (e.g., antibodies or antibody fragments provided herein). “Epitope” refers to a determinant that interacts with a specific antigen binding site in the variable region of an antibody molecule known as a paratope. Epitopes are groupings of moieties such as amino acids or sugar side chains and usually have specific structural characteristics, as well as specific charge characteristics. A single antigen may have more than one epitope.
[0097] The epitope may comprise amino acid residues directly involved in the binding (also called immunodominant component of the epitope) and other amino acid residues, which are not directly involved in the binding, such as amino acid residues which are effectively blocked by the specifically antigen binding peptide; in other words, the amino acid residue is within the footprint of the specifically antigen binding peptide.
[0098] Epitopes may be either conformational or linear. A conformational epitope is produced by spatially juxtaposed amino acids from different segments of the linear polypeptide chain. A linear epitope is one produced by adjacent amino acid residues in a polypeptide chain. Conformational and non-conformational epitopes may be distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents.
[0099] Antibodies that recognize the same epitope can be verified in a simple immunoassay showing the ability of one antibody to block the binding of another antibody to a target antigen.
[0100] Herein, it is shown that “Binder A” exhibits improved activity in comparison with other CD20 binders (e.g., ofatumumab), and in particular displays more potent killing of target cells, such as target cancer cells, which may result in superior antitumor efficacy.Chimeric Antigen Receptors (CARs)
[0101] Chimeric antigen receptors (CARs), also known as chimeric T cell receptors, artificial T cell receptors and chimeric immunoreceptors, are engineered receptors, which graft a desired specificity onto an immune effector cell. In a classical CAR, the specificity of an antibody or antibody fragment is grafted onto a T cell. CAR-encoding nucleic acids may be transferred to T cells using, for example, retroviralvectors. In this way, many cancer-specific T cells can be generated for adoptive cell transfer. Phase I clinical studies of this approach show efficacy.
[0102] The target antigen-binding domain of a CAR is commonly fused via a spacer and transmembrane domain to an endodomain. The endodomain may comprise or associate with an intracellular T -cell signaling domain. When the CAR binds the target-antigen, this results in the transmission of an activating signal to the T-cell it is expressed on.
[0103] Examples of CARs and variants thereof are provided herein. Typically, A CAR comprises an antigen-binding domain, a transmembrane domain and an endodomain. Target antigen-binding domains provided herein are discussed in detail above (see “CD20-binding domains”). Details of other component parts of a CAR provided herein are described below.
[0104] Suitably, the CAR may comprise a sequence having at least 80% sequence identity to a sequence shown in any one of SEQ ID NO: 9 to 17, wherein the CAR retains its capacity to i) bind CD20 and ii) induce T cell signaling. “Retaining capacity to bind CD20” is defined elsewhere herein. “Retaining capacity induce T cell signaling” refers to refers to the ability of a variant of a CAR provided herein (e.g., comprising at least 80, 85, 90, 95, 98 or 99% sequence identity to any one of SEQ ID NO: 9 to 17 and / or comprising one or more mutations introduced into one or more of the CDRs in the CD20-binding domains provided herein) to recognize antigens presented on antigen presenting cells, and lead to a cascade of signaling events resulting in T cell effector function at the same concentration and / or in the same timescale as a non-variant CAR provided herein. For example, a similar or same amount of a variant CAR may induce the same or similar level of T cell signaling as a non-variant CAR provided herein. Suitable variant component parts for the CARs provided herein are described in more detail below.Transmembrane Domains
[0105] In one embodiment, there is provided a CAR comprising a transmembrane domain which spans the membrane. In a particular embodiment, the transmembrane comprises a hydrophobic alpha helix. In a more particular embodiment, the transmembrane domain is derived from CD28, or CD8. In a more particular embodiment, the transmembrane domain is the transmembrane domain of human CD28, or human CD8. In some embodiments, the transmembrane domain is derived from CD8. In a more particular embodiment, the transmembrane domain is the transmembrane domain of human CD8. In a most particular embodiment, the transmembrane domain is according to SEQ ID NO: 12.Endodomains
[0106] The endodomain is the signal-transmission portion of the CAR. After antigen recognition, receptors cluster and a signal is transmitted to the cell. The most commonly used endodomain component is that of CD3c which contains 3 IT AMs. This transmits an activation signal to the T cell after an antigen is bound. CD3c may not provide a fully competent activation signal and additional co-stimulatory signaling may be needed. For example, endodomains from CD28, or 0X40 or 4-1BB can be used with CD3c to transmit a proliferative / survival signal, or all three can be used together.
[0107] Early CAR designs had endodomains derived from the intracellular parts of either the y chain of the FceRl or CD3L Consequently, these first-generation receptors transmitted immunological signal 1,which was sufficient to trigger T-cell killing of cognate target cells but failed to fully activate the T-cell to proliferate and survive. To overcome this limitation, compound endodomains were constructed. Fusion of the intracellular part of a T-cell co-stimulatory molecule to that of CD3c resulted in second generation receptors which could transmit an activating and co-stimulatory signal simultaneously after antigen recognition. The co-stimulatory domain most commonly used was that of CD28. This supplies the most potent co-stimulatory signal, namely immunological signal 2, which triggers T-cell proliferation. Some receptors were also described which included TNF receptor family endodomains such as 0X40 and 4- IBB which transmit survival signals. Finally, even more potent third generation CARs were described which had endodomains capable of transmitting activation, proliferation and survival signals. CARs and their different generations are summarized in FIG. 1.
[0108] In one embodiment, there is provided a CAR comprising combinations of one or more of the C D3c endodomain, the 4- IBB endodomain, the 0X40 endodomain and the CD28 endodomain. In a particular embodiment, the endodomain is a fusion of 4-1BB and CD3^, CD28 and CD3^, or CD28, 4-1BB and CD3^. In a more particular embodiment, the endodomain is a fusion of 4-1BB and CD3L In a most particular embodiment, the endodomain is a fusion of 4-1BB and CD3c wherein the 4-1BB is according to SEQ ID NO: 13 or a variant thereof having at least 80% identity, and the CD3c is according to SEQ ID NO: 14 or a variant thereof having at least 80% identity. In a most particular embodiment, the endodomain is a fusion of 4-1BB and CD3c wherein the 4-1BB is according to SEQ ID NO: 13, and the CD3^ is according to SEQ ID NO: 14.
[0109] A variant sequence may have at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity to SEQ ID NO: 18 provided that the sequence provides an effective transmembrane domain / intracellular T cell signaling domain.Signal Peptides or Leader peptides
[0110] The CAR herein provided may comprise a signal peptide (or leader peptide) so that when the CAR is expressed inside a cell, such as a T-cell, the nascent protein is directed to the endoplasmic reticulum and subsequently to the cell surface, where it is expressed. The core of the signal peptide may contain a long stretch of hydrophobic amino acids that has a tendency to form a single alpha-helix. The signal peptide may begin with a short positively charged stretch of amino acids, which helps to enforce proper topology of the polypeptide during translocation. At the end of the signal peptide there is typically a stretch of amino acids that is recognized and cleaved by signal peptidase. Signal peptidase may cleave either during or after completion of translocation to generate a free signal peptide and a mature protein. The free signal peptides are then digested by specific proteases. The signal peptide may be at the amino terminus of the molecule.[oni] The CAR herein provided may have the general (N- terminal to C-terminal) configuration of: Signal peptide - CD20-binding domain - spacer domain - transmembrane domain / intracellular T cell signaling domain.
[0112] In one embodiment, there is provided a CAR comprising a signal peptide according to the SEQ ID NO: 17 or a variant thereof having 5, 4, 3, 2 or 1 amino acid mutations (insertions, substitutions, or additions) provided that the signal peptide still functions to cause cell surface expression of the CAR. Ina particular embodiment, the signal peptide according to SEQ ID NO: 17. Methods for determining cell surface expression of a CAR are well known in the art and can be used to determine suitable signal peptide variants.
[0113] The signal peptide of SEQ ID NO: 17 is compact and highly efficient. It is predicted to give about 95% cleavage after the terminal glycine, giving efficient removal by signal peptidase.Spacers
[0114] The CAR herein provided may comprise a spacer sequence to connect the CD20-binding domain with the transmembrane domain and spatially separate the CD20-binding domain from the endodomain. A flexible spacer allows to the CD20-binding domain to orient in different directions to enable CD20 binding.
[0115] The spacer sequence may, for example, comprise an IgGl Fc region, an IgGl hinge or a CD8 stalk, or a combination thereof. The spacer may alternatively comprise an alternative sequence which has similar length and / or domain spacing properties as an IgGl Fc region, an IgGl hinge or a CD8 stalk. A human IgGl spacer may be altered to remove Fc binding motifs.
[0116] In one embodiment, there is provided a CAR comprising a spacer. In a particular embodiment, the spacer is a CD8 stalk. In a more particular embodiment, the spacer is according to SEQ ID NO: 11 or a variant thereof having at least 80% identity. In a most particular embodiment, the spacer is according to SEQ ID NO: 11.Full constructs
[0117] In one embodiment, there is provided a CAR comprising: a) a CD20-binding domain b) a transmembrane domain, and / or c) an endodomain.
[0118] In one embodiment, there is provided a CAR comprising: a) a CD20-binding domain b) a hinge domain c) a transmembrane domain, and / or d) an endodomain.
[0119] In one embodiment, there is provided a CAR comprising: a) a CD20-binding domain b) a CD8a hinge domain, c) a CD8a transmembrane domain, and d) an endodomain, comprising a 4- IBB endodomain and a CD3c endodomain.
[0120] In a particular embodiment, there is provided a CAR comprising: a) a CD20-binding domain, comprising SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, b) a CD8a hinge domain according to SEQ ID NO: 11 c) a CD8a transmembrane domain according to SEQ ID NO: 12, and / ord) an endodomain, comprising a 4-1BB endodomain according to SEQ ID NO: 13 and a CD3c endodomain according to SEQ ID NO: 14.
[0121] In a particular embodiment, there is provided a CAR according to SEQ ID NO: 20.
[0122] Herein are provided inter alia, nucleic acids that encodes a CD20-binding domain provided herein.
[0123] In a particular embodiment, there is provided a nucleic acid molecule encoding a CD20-binding domain having the amino acid sequence of SEQ ID NO: 9.Vectors
[0124] Herein are provided inter alia, vectors which comprise a nucleic acid sequence provided herein. Such a vector may be used to introduce the nucleic acid sequence into a host cell so that it expresses and produces a CD20-binding domain or CAR herein provided.
[0125] The vector may, for example, be a plasmid or a viral vector, such as a retroviral vector or a lentiviral vector.
[0126] The vector may be capable of transfecting or transducing a cell, such as a cytolytic immune cell. In a particular example, the cell may be a T cell or a natural killer (NK) cell.
[0127] In a particular embodiment, there is provided a vector according to SEQ ID NO: 22.
[0128] In another particular embodiment, there is provided a vector according to SEQ ID NO: 23.Recombinant Cells
[0129] Herein is also provided, inter alia, a recombinant cell which comprises a nucleic acid herein provided. In some aspects, is provided a recombinant cell which expresses a CD20-binding domain or CAR herein provided, at the cell surface. The recombinant cell may be a cytolytic immune cell, such as a T-cell or natural killer (NK) cell.
[0130] A recombinant cell capable of expressing a CAR herein provided may be made by transducing or transfecting a cell with CAR-encoding nucleic acid. The CAR-expressing recombinant cell herein provided may be generated ex vivo. The recombinant cell may be from a cell sample, such as a peripheral blood mononuclear cell (PBMC) sample from the patient or a donor, recombinant cells may be activated and / or expanded prior to being transduced with CAR-encoding nucleic acid, for example by treatment with an anti-CD3 monoclonal antibody.Pharmaceutical Compositions
[0131] Herein are also provided pharmaceutical compositions containing a CD20-binding domain, CAR, nucleic acid molecule, vector, recombinant cell, or plurality of recombinant cells, herein provided together with a pharmaceutically acceptable carrier, diluent and / or excipient, and optionally one or more further pharmaceutically active polypeptides and / or compounds. Such a formulation may, for example, be in a form suitable for intravenous infusion.
[0132] Such compositions can be prepared in a manner well known in the pharmaceutical art and generally, a composition herein provided is administered in a pharmaceutically effective amount. The amount of composition herein provided actually administered will typically be determined by a physician, in the light of the relevant circumstances, including the condition to be treated, the chosen route of administration, theactual composition herein provided administered, the age, weight, and response of the individual patient, the severity of the patient’s symptoms, and the like.
[0133] The compositions provided herein can be administered to the subject by any conventional route, including injection or by gradual infusion over time. The administration may, for example, be by infusion or by intramuscular, intravascular, intracavity, intracerebral, intralesional, rectal, subcutaneous, intradermal, epidural, intrathecal, percutaneous administration.
[0134] The compositions provided herein may be in any form suitable for the above modes of administration. For example, compositions comprising cells may in any form suitable for infusion. As further examples, suitable forms for parenteral injection (including, subcutaneous, intramuscular, intravascular or infusion) include a sterile solution, suspension, or emulsion. Alternatively, the route of administration may be by direct injection into the target area, or by regional delivery or by local delivery. The identification of suitable dosages of the compositions herein provided is well within the routine capabilities of a person of skill in the art.
[0135] The compositions for oral administration can take the form of bulk liquid solutions or suspensions, or bulk powders. More commonly, however, the compositions are presented in unit dosage forms to facilitate accurate dosing. The term “unit dosage forms” refers to physically discrete units suitable as unitary dosages for human subjects and other mammals, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient, vehicle, or carrier.
[0136] Injectable compositions are typically based upon injectable sterile saline or phosphate-buffered saline, or other injectable carriers known in the art.Methods of treatment
[0137] CAR-expressing cells herein provided may be capable of killing cancer cells, such as B-cell lymphoma cells. CAR-expressing cells, such as T-cells or NK cells, may either be created ex vivo either from a patient's own peripheral blood (1st party), or in the setting of a haematopoietic stem cell transplant from donor peripheral blood (2nd party), or peripheral blood from an unconnected donor (3rd party). Alternatively, CAR-expressing cells may be derived from ex vivo differentiation of inducible progenitor cells or embryonic progenitor cells to cells such as T-cells. In these instances, CAR cells are generated by introducing DNA or RNA coding for the CAR by one of many means including transduction with a viral vector, transfection with DNA or RNA. T or NK cells expressing a CAR molecule herein provided may be used for the treatment of a cancerous disease, in particular, cancerous diseases associated with CD20 expression.
[0138] A method for the treatment of disease relates to the therapeutic use of a cell or population of cells herein provided. In this respect, the cells may be administered to a subject having an existing disease or condition in order to lessen, reduce or improve at least one symptom associated with the disease and / or to slow down, reduce or block the progression of the disease. The method herein provided may cause or promote cell mediated killing of CD20-expressing cells, such as B cells.
[0139] In one embodiment, there is provided a method for treating and / or preventing a disease, which comprises the step of administering a pharmaceutical composition herein provided to a subject. In a particular embodiment, the disease is cancer. In a more particular embodiment, the cancer is selected from metastatic tumour cell types (such as but not limited to, melanoma, lymphoma, leukemia, fibrosarcoma, rhabdomyosarcoma, and mastocytoma) and types of tissue carcinoma (such as but not limited to, colorectal cancer, prostate cancer, small cell lung cancer and non-small cell lung cancer, breast cancer, pancreatic cancer, bladder cancer, renal cancer, gastric cancer, glioblastoma, primary liver cancer, ovarian cancer, prostate cancer and uterine leiomyosarcoma). In a most particular embodiment, the cancer is hematological cancer. In yet a most particular embodiment, the hematological cancer is selected from lymphomas, leukemias, and myelomas. In a further most particular embodiment, the hematological cancer is selected from to non-Hodgkin’s lymphoma (NHL), acute myeloid leukaemia (AML), and acute lymphoblastic leukaemia (ALL) and chronic lymphoblastic leukaemia (CLL).
[0140] In one embodiment herein provided, there is provided a method for treating and / or preventing a disease, which comprises the step of administering a pharmaceutical composition herein provided, to a subject. In a particular embodiment, the disease is an autoimmune disease. In a more particular embodiment, the autoimmune disease is selected from rheumatoid arthritis (RA), COPD, asthma, bronchitis, systemic lupus erythematosus (SLE), cutaneous lupus erythematosus (CLE), lupus nephritis, dermatomyositis, Sjogren’s syndrome, multiple sclerosis, psoriasis, dry eye disease, type I diabetes mellitus, atopic dermatitis, thyroiditis, contact dermatitis, eczematous dermatitis, inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis), atherosclerosis and amyotrophic lateral sclerosis. In a more particular embodiment, the autoimmune disease is, the term refers to systemic lupus erythematosus (SLE).
[0141] In one embodiment, there is provided a method for treating and / or preventing a disease, the method comprising the following steps:(i) isolating a cell -containing sample from a subject;(ii) transducing or transfecting the cells (as described elsewhere herein); and(iii) administering the cells obtained in (ii) to the subject.
[0142] In one embodiment, there is provided a pharmaceutical composition herein provided, for use in treating and / or preventing a disease. In a particular embodiment, the disease is cancer. In a more particular embodiment, the cancer is selected from metastatic tumour cell types (such as but not limited to, melanoma, lymphoma, leukemia, fibrosarcoma, rhabdomyosarcoma, and mastocytoma) and types of tissue carcinoma (such as but not limited to, colorectal cancer, prostate cancer, small cell lung cancer and non-small cell lung cancer, breast cancer, pancreatic cancer, bladder cancer, renal cancer, gastric cancer, glioblastoma, primary liver cancer, ovarian cancer, prostate cancer and uterine leiomyosarcoma). In a most particular embodiment, the cancer is hematological cancer. In yet a most particular embodiment, the hematological cancer is selected from lymphomas, leukemias, and myelomas. In a further most particular embodiment, the hematological cancer is selected from to non-Hodgkin’s lymphoma (NHL), acute myeloid leukaemia (AML), and acute lymphoblastic leukaemia (ALL) and chronic lymphoblastic leukaemia (CLL).
[0143] In one embodiment, there is provided a pharmaceutical composition herein provided, for use in treating and / or preventing a disease. In a particular embodiment, the disease is an autoimmune disease. In a more particular embodiment, the autoimmune disease is selected from rheumatoid arthritis (RA), COPD, asthma, bronchitis, systemic lupus erythematosus (SLE), cutaneous lupus erythematosus (CLE), lupus nephritis, dermatomyositis, Sjogren’s syndrome, multiple sclerosis, psoriasis, dry eye disease, type I diabetes mellitus, atopic dermatitis, thyroiditis, contact dermatitis, eczematous dermatitis, inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis), atherosclerosis and amyotrophic lateral sclerosis. In a more particular embodiment, the autoimmune disease is, the term refers to systemic lupus erythematosus (SLE).
[0144] In one embodiment, there is provided the use of a cell expressing a CAR herein provided, in the manufacture of a medicament for treating and / or preventing a disease. In a particular embodiment, the disease is cancer. In a more particular embodiment, the cancer is selected from metastatic tumour cell types (such as but not limited to, melanoma, lymphoma, leukemia, fibrosarcoma, rhabdomyosarcoma, and mastocytoma) and types of tissue carcinoma (such as but not limited to, colorectal cancer, prostate cancer, small cell lung cancer and non-small cell lung cancer, breast cancer, pancreatic cancer, bladder cancer, renal cancer, gastric cancer, glioblastoma, primary liver cancer, ovarian cancer, prostate cancer and uterine leiomyosarcoma). In a most particular embodiment, the cancer is hematological cancer. In yet a most particular embodiment, the hematological cancer is selected from lymphomas, leukaemia, and myelomas. In a further most particular embodiment, the hematological cancer is selected from to non-Hodgkin’s lymphoma (NHL), acute myeloid leukaemia (AML), and acute lymphoblastic leukaemia (ALL) and chronic lymphoblastic leukaemia (CLL).
[0145] In one embodiment, there is provided the use of a cell expressing a CAR herein provided, in the manufacture of a medicament for treating and / or preventing a disease. In a particular embodiment, the disease is an autoimmune disease. In a more particular embodiment, the autoimmune disease is selected from rheumatoid arthritis (RA), COPD, asthma, bronchitis, systemic lupus erythematosus (SLE), cutaneous lupus erythematosus (CLE), lupus nephritis, dermatomyositis, Sjogren’s syndrome, multiple sclerosis, psoriasis, dry eye disease, type I diabetes mellitus, atopic dermatitis, thyroiditis, contact dermatitis, eczematous dermatitis, inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis), atherosclerosis and amyotrophic lateral sclerosis. In a more particular embodiment, the autoimmune disease is, the term refers to systemic lupus erythematosus (SLE).
[0146] Injection dose levels range from about 0. 1 mg / kg / h to at least 10 mg / kg / h, all for from about 1 to about 120 h and especially 24 to 96 h. A preloading bolus of from about 0.1 mg / kg to about 10 mg / kg or more may also be administered to achieve adequate steady state levels. The maximum total dose is not expected to exceed about 1 g / day for a 40 to 80 kg human patient.
[0147] For the prophylaxis and / or treatment of long-term conditions, such as degenerative conditions, the regimen for treatment usually stretches over many months or years so oral dosing is preferred for patient convenience and tolerance. With oral dosing, one to four (1-4) regular doses daily, especially one to three (1-3) regular doses daily, typically one to two (1-2) regular doses daily, and most typically one (1) regulardose daily are representative regimens. Alternatively for long lasting effect drugs, with oral dosing, once every other week, once weekly, and once a day are representative regimens. In particular, dosage regimen can be every 1-14 days, more particularly 1-10 days, even more particularly 1-7 days, and most particularly 1-3 days.
[0148] When used to prevent the onset of a condition, a composition herein provided, will be administered to a patient at risk for developing the condition, typically on the advice and under the supervision of a physician, at the dosage levels described above. Patients at risk for developing a particular condition generally include those that have a family history of the condition, or those who have been identified by genetic testing or screening to be particularly susceptible to developing the condition.
[0149] A composition herein provided can be administered as the sole active agent or it can be administered in combination with other therapeutic agents, including other compositions herein provided, that demonstrate the same or a similar therapeutic activity and that are determined to be safe and efficacious for such combined administration. In a specific embodiment, co-administration of two (or more) agents allows for significantly lower doses of each to be used, thereby reducing the side effects seen.
[0150] In one embodiment, a composition herein provided, is administered as a medicament. In a specific embodiment, said composition additionally comprises a further active ingredient. In another embodiment, the composition herein provided, is co-administered with a further active ingredient for the same and / or another disease.
[0151] By co-administration is included any means of delivering two or more therapeutic agents to the patient as part of the same treatment regime, as will be apparent to the skilled person. Whilst the two or more agents may be administered simultaneously in a single formulation, i.e. as a single pharmaceutical composition, this is not essential. The agents may be administered in different formulations and at different times.
[0152] The aspects herein provided will now be further described by way of examples, which are meant to serve to assist one of ordinary skill in the art in carrying out the aspects herein provided and are not intended in any way to limit the scope herein provided.EXAMPLESExample 1. Materials and Methods1.1. Cells, plasmids, and other reagents
[0153] Human peripheral blood pan-T cells were purchased from Stemcell Technologies. All other cell lines were purchased from ATCC. The lentiviral plasmid vector pLV-tEFla-8BBz was designed and generated. The PE-conjugated anti-G4S linker antibody for detection of CAR surface expression was a product of Cell Signaling Technology.Table I. Cell linesTable II. Major reagents and suppliesTable III. Definition of abbreviationsExample 2. Cloning, generation, and characterization of Binder A CAR and ofatumumab CAR with CD8« hinge, CD8« transmembrane domain and 4-1 BB costimulatory domain by using a lentiviral vector (pLV-tEFl«-8BBz)
[0154] The following primers were used and were synthesized by GENEWIZ:SEQ ID NO: 26: OFAF, 5'-GATGACGATAAGGGCGAAGTGCAGCTGGTGGAG-3' (sense);SEQ ID NO: 27: OF AR, 5'-TGCCGGCGTGGTAGTTTTAATCTCCAGTCGTG-3' (antisense);SEQ ID NO: 28: pABc-Binderlnsert-Linear-F, 5'-GCGGCCGCTACTACC-3' (sense) andSEQ ID NO: 29: pABc-Binderlnsert-Linear-R, 5'-TCTAGAAGGGATGAGCAGG-3' (antisense).
[0155] The “Binder A” CAR was cloned using a “Binder A” scFv gene fragment synthesized by Integrated DNA Technologies and PCR-amplified with primers OFAF and OF AR. The PCR product was digested with Xbal and Notl restriction enzymes and cloned into the pLV-tEFla-8BBz vector with built-in CD8a hinge, CD8a transmembrane domain, 4- IBB costimulatory domain, and CD3 zeta domain.
[0156] Ofatumumab CAR was cloned using Gibson Assembly® (New England BioLabs). The ofatumumab gene fragment appended with complementary sequences of the pLV-tEFla-8BBz vector was synthesized by GENEWIZ. The pLV-tEFla-8BBz vector was linearized by PCR amplification with the plasmid as a template and primers pABc-Binderlnsert-Linear-F and pABc-Binderlnsert-Linear-R. The ofatumumab gene fragment was then assembled into the linearized pLV-tEFla-8BBz vector by using Gibson Assembly® according to the manufacturer’s instructions.2.1. Lentiviral production
[0157] Lentiviruses encoding the CARs were produced by using the LV-MAX™ lentiviral production system and lentiviral titers were briefly evaluated by using Lenti-X™ GoStix™ Plus or qPCR Lentivirus Titer Kit according to the manufacturer’s instructions.2.2. Transduction of primary T cells
[0158] Human peripheral blood pan-T cells were activated by using T Cell TransAct™ according to the manufacturer’s instruction. For transduction, 250 pl lentiviruses were first diluted in 250 pl TexMACS™ medium containing 20 pg ml;1protamine sulfate and 100 lU / mL IL-2, and then added into 106activated T cells in 1 mL TexMACS™ medium supplemented with 10 pg mL'1(final concentration) protamine sulfate and 50 lU / mL (final concentration) IL-2 in 12-well plates. After incubation at 37°C for 24 h, 1 mL medium was gently removed from each well and 2 mL fresh TexMACS™ medium containing 100 lU / mL IL-2 was added into each well of the 12-well plates. Transduced T cells were passaged every 2-3 days at a seed density of 5 * 105cells / mL in TexMACS™ supplemented with 100 lU / mL IL-2. For detection of CAR expression on the surface of transduced T cells, 106cells were mixed with 1:100 diluted PE-conjugated anti-G4S linker antibody and 1 : 1000 diluted SYTOX™ red dead cell stain, and incubated on ice for 30 min. The cells were washed with 200 pl PBS (pH7.4) containing 0.5% BSA (PBSA), resuspended in 100 pl PBSA, and used for flow cytometry analysis.2.3. Cytotoxicity assay
[0159] Target cell lines were transduced with lentiviruses encoding firefly luciferase, as described above for transduction of primary T cells, except that different medium was used and IL-2 was not added. Transduced cells with stable expression of luciferase were selected by adding puromycin and zeocin at final concentrations of 1 and 0.5 pg mL1, respectively.
[0160] For cytotoxicity assay, 104target cells with luciferase expression were mixed with transduced primary T cells at different effector : target (E:T) ratios in 100 pl TexMACS™ medium in each well of 96- well plates. Background luminescence signal was generated by treating target cells with 1% Tween-20. After 96-h incubation, assays were developed by using Promega Steady-Gio® luciferase assay system according to the manufacturer’s instructions. Percent lysis was calculated by using the formula: [1- (Luminescence of target cells plus effector cells - luminescence of target cells treated with Tween- 20) / (luminescence of target cells only - luminescence of target cells treated with Tween-20)] x 100.2.4. Cytokine release assay
[0161] 50 pl supernatant was collected from each well of the 96-well plates in a separate cytotoxicity assay after 24-h incubation. Cytokine levels were measured by using MACSPlex cytokine basic kit, MACSPlex cytokine 12 standard, MACSPlex IL-2 reagent kit, MACSPlex IFN-y reagent kit and MACSPlex TNF-a reagent kit according to the manufacturer’s instructions.2.5. Results and Discussion2.5.1. Generation of Binder A CAR and ofatumumab CAR with CD8a hinge, CD8a transmembrane domain and 4-1 BB costimulatory domain by using a research lentivirai vector
[0162] A second-generation CAR was generated with Binder A scFv (in VH-VL orientation with three repeats of the G4S motif as a linker), CD8a hinge, CD8a transmembrane domain, 4-1BB costimulatory domain and CD3 zeta domain by using a pLV-tEFla-8BBz vector generated in-house. The lentivirai vector uses a truncated version of human elongation factor-1 alpha (tEFla) as a promoter. The use of Notl restriction site for cloning introduced three additional alanine residues in between the scFv and CD8a hinge sequences. Ofatumumab CAR was generated the same way as a comparator.2.5.2. Cytotoxicity and cytokine release of human primary T cells transduced with Binder A CAR
[0163] To test cytotoxicity of the CAR against cancer cells expressing CD20, human primary T cells were transduced with lentiviruses encoding the CARs. Binder A CAR showed comparable surface expression with ofatumumab CAR on day 7 post transduction (FIG. 3). In a 96-h cytotoxicity assay conducted between day 7 and day 11 post transduction with two CD20-positive B cell lines (Raji and Daudi) and a CD20- negative cell line (K562), Binder A CAR showed better killing activity than ofatumumab CAR against both CD20-positive B cell lines even at very low E:T ratios (FIG. 4). No dose-dependent obvious killing of K562 cells was observed with both CARs, suggesting their cytotoxicity for Raji and Daudi cells should be mediated by interaction with CD20.
[0164] To test cytokine release induced by the CAR-T, supernatant was collected from each well of the 96-well plates in a separate 24-h assay and used for quantification of levels of IL-2, IFN-y, and TNF-a. The results showed that when incubated with CD20-positive Raji cell line at an E:T ratio of approximately 0.8: 1, Binder A CAR induced higher levels of IL-2 and IFN-y than ofatumumab CAR (FIG. 5). Both CARs showed robust, but comparable, release of all three cytokines when incubated with Daudi cells. No elevated release of cytokines was observed with the CD20-negative cell line K562, suggesting CD20-specific activation and signaling of the T cells transduced with the CARs.
[0165] These results show that Binder A may exhibit a better profile than ofatumumab against CD20, in particular improved cell-killing activity.Example 3. Comparison of Binder A, ofatumumab, and ofatumumab variants3.1. Overview
[0166] To evaluate the effects of the mutations on the binding activity of binder A and elucidate the mechanisms underlying the increased cytotoxicity of Binder A CAR, compared to Ofatumumab, three ofatumumab variants carrying a single mutation were prepared.3.2. Protocol3.2.1. Cells, plasmids, and other reagents
[0167] We purchased human peripheral blood pan-T cells from Stemcell Technologies. Expi293F cells were purchased from Gibco. Raji, Daudi, and K562 cell lines were purchased from ATCC. K562-CD20 cell line was generated in house by lentiviral transfection of K562 cell line. The lentiviral plasmid vector pLV-tEFla-8BBz and the mammalian expression vector pABm3.2 were designed and generated in our laboratory. The PE-conjugated anti-G4S linker antibody for detection of CAR surface expression was a product of Cell Signaling Technology. The APC-conjugated anti-FLAG tag antibody was purchased from BioLegend.3.2.2. Cloning of binder A, ofatumumab, and ofatumumab variants with a single amino acid mutation to germline residues in the scFv format
[0168] For cloning of binder A, we used the following primers synthesized by GENEWIZ:1217, 5’- TAGGAAGCTTTTAAAACAGC-3’ (sense) SEQ ID NO: 36;2204, 5’- TCCATAAGCTCCGGAGAT-3’ (antisense) SEQ ID NO: 37;1218, 5'-ATCTCCGGAGCTTATGGAGAGGTGCAGCTGGTGGAA-3' (sense) SEQ ID NO: 38; 2213, 5’- GCTGTTTTAAAAGCTTCCTAGCCCTTATCGTCATCGTC-3’ (antisense) SEQ ID NO: 39.
[0169] The binder A gene fragment was PCR amplified with a binder A-encoding plasmid as a template and primers 1218 and 2213. The pABm3.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1217 and 2204. The binder A gene fragment was then assembled into the linearized pABm3.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.
[0170] For cloning of ofatumumab, we used the following primers synthesized by GENEWIZ: 1217, 5’- TAGGAAGCTTTTAAAACAGC-3’ (sense) SEQ ID NO: 36;2204, 5’- TCCATAAGCTCCGGAGAT-3’ (antisense) SEQ ID NO: 37;1231, 5’- ATCTCCGGAGCTTATGGAGAAGTGCAGCTGGTGGAG-3’ (sense) SEQ ID NO: 40; 2213, 5’- GCTGTTTTAAAAGCTTCCTAGCCCTTATCGTCATCGTC-3’ (antisense) SEQ ID NO: 41.
[0171] The ofatumumab gene fragment was PCR amplified with an ofatumumab-encoding plasmid as a template and primers 1231 and 2213. The pABm3.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1217 and 2204. The ofatumumab gene fragment was then assembled into the linearized pABm3.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.
[0172] For cloning of the ofatumumab variant with N35D mutation (Ofatumumab_N35D), we used the following primers, which were synthesized by GENEWIZ: 1217, 5’- TAGGAAGCTTTTAAAACAGC-3’ (sense) SEQ ID NO: 36;2204, 5’- TCCATAAGCTCCGGAGAT-3’ (antisense) SEQ ID NO: 37;1231, 5’- ATCTCCGGAGCTTATGGAGAAGTGCAGCTGGTGGAG-3’ (sense) SEQ ID NO: 40; 2213, 5’- GCTGTTTTAAAAGCTTCCTAGCCCTTATCGTCATCGTC-3’ (antisense) SEQ ID NO: 41; 1212, 5’- TTCACCTTTGACGATTATGCC-3’ (sense) SEQ ID NO: 42, and 2199, 5’ - GGCATAATCGTCAAAGGTGAA-3’ (antisense) SEQ ID NO: 43.
[0173] Two ofatumumab fragments carrying the mutation were first PCR amplified with an ofatumumab- encoding plasmid as a template and primer pairs 1231 / 2199 and 2213 / 1212, respectively. Then, the full- length ofatumumab_N35D gene fragment was amplified by overlapping PCR with the two ofatumumab fragments at the same molarity and primers 1231 and 2213. The pABm3.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1217 and 2204. The ofatumumab_N35D gene fragment was then assembled into the linearized pABm3.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.
[0174] For cloning of the ofatumumab variant with T55G mutation (Ofatumumab_T55G), we used the following primers, which were synthesized by GENEWIZ:1217, 5’- TAGGAAGCTTTTAAAACAGC-3’ (sense) SEQ ID NO: 36;2204, 5’- TCCATAAGCTCCGGAGAT-3’ (antisense) SEQ ID NO: 37;1231, 5’- ATCTCCGGAGCTTATGGAGAAGTGCAGCTGGTGGAG-3’ (sense) SEQ ID NO: 40; 2213, 5’- GCTGTTTTAAAAGCTTCCTAGCCCTTATCGTCATCGTC-3’ (antisense) SEQ ID NO: 41;1213, 5’- TGGGTCTCAGGTATTAGTTGG-3’ (sense) SEQ ID NO: 44 and2200, 5’ - CCAACTAATACCTGAGACCCA -3’ (antisense) SEQ ID NO: 45.
[0175] Two ofatumumab fragments carrying the mutation were first PCR amplified with an ofatumumab- encoding plasmid as a template and primer pairs 1231 / 2200 and 1213 / 2213, respectively. Then, the full- length ofatumumab_T55G gene fragment was amplified by overlapping PCR with the two ofatumumab fragments at the same molarity and primers 1231 and 2213. The pABm3.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1217 and 2204. The ofatumumab_T55G gene fragment was then assembled into the linearized pABm3.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.
[0176] For cloning of the ofatumumab variant with K85N mutation (Ofatumumab K85N), we used the following primers, which were synthesized by GENEWIZ: 1217, 5’- TAGGAAGCTTTTAAAACAGC-3’ (sense) SEQ ID NO: 36;2204, 5’- TCCATAAGCTCCGGAGAT-3’ (antisense) SEQ ID NO: 37;1231, 5’- ATCTCCGGAGCTTATGGAGAAGTGCAGCTGGTGGAG-3’ (sense) SEQ ID NO: 40; 2213, 5’- GCTGTTTTAAAAGCTTCCTAGCCCTTATCGTCATCGTC-3’ (antisense) SEQ ID NO: 41;1214, 5’- AACGCCAAGAACTCCCTGTAT -3’ (sense) SEQ ID NO: 46 and2201, 5’- ATACAGGGAGTTCTTGGCGTT -3’ (antisense) SEQ ID NO: 47.
[0177] Two ofatumumab fragments carrying the mutation were first PCR amplified with an ofatumumab- encoding plasmid as a template and primer pairs 1231 / 2201 and 1214 / 2213, respectively. Then, the full- length ofatumumab_K85N gene fragment was amplified by overlapping PCR with the two ofatumumab fragments at the same molarity and primers 1231 and 2213. The pABm3.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1217 and 2204. The ofatumumab_K85N gene fragment was then assembled into the linearized pABm3.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.3.2.3. Expression and purification of binder A, ofatumumab, and ofatumumab variants
[0178] Expi293F cells were transfected with plasmids encoding binder A, ofatumumab, ofatumumab_N35D, ofatumumab_T55G, or ofatumumab_K85N with both hexahistidine and FLAG tags at the C termini by using the ExpiFectamin 293 kit according to the manufacturer’s instructions. After 6 days of incubation, the supernatant was harvested by centrifugation at 8000 g for 10 min, and then concentrated and dialyzed with PBS by using a protein concentrator with a cutoff of 10 kDa. After dialysis, the proteins were purified by using the Ni-NTA agarose resin according to the manufacturer’s instructions. Eluted proteins were dialyzed against PBS by using a protein concentrator with a cutoff of 10 kDa. Oligomerization states of the dialyzed proteins were analyzed, and monomers were isolated by sizeexclusion chromatography (SEC) with a Superdex 200 column. (FIG. 6)Table IV. Molecular weight standards and their elution volumes for SEC.3.2.4. Cell binding of binder A, ofatumumab, and ofatumumab variants
[0179] Binding of binder A, ofatumumab, and ofatumumab variants to K562-CD20 and K562 cells was measured by flow cytometry (FIG 8). Briefly, antibodies were five-fold serially diluted from 2000 to 0.0256 nM in PBS containing 3% BSA (assay buffer). Cells were collected by centrifugation at 500 g for 10 min and resuspended in the assay buffer at a density of 4E6 cells / mL. 50 pL of the serially diluted antibodies was mixed with 50 pL of the cells leading to the final antibody concentrations serially diluted from 1000 to 0.0128 nM. After incubation on ice for 30 min, cells were washed 3 times with 100 pL assay buffer by centrifuging at 500 g for 3 min in each wash. After washing, cells were resuspended in 100 pL of 1:500 diluted secondary antibody (APC-conjugated anti-FLAG). After incubation on ice for 30 min, cells were washed 3 times with 100 pL assay buffer by centrifuging at 500 g for 3 min in each wash. Cells were then resuspended in 100 pL assay buffer and used for flow cytometry analysis. Median fluorescence intensity (MFI) was calculated to quantify the cell binding affinities of each antibody.Table V. Flow cytometry binding to K562-CD20 cells of binder A, ofatumumab, and ofatumumab variants.Table VI. Cell binding affinity comparison between Binder A, Ofatumumab, and variants at 3 concentrations3.3. Results
[0180] All antibodies in the scFv format were cloned into a mammalian expression vector pABm3.2 by using Gibson Assembly®. They were expressed in the Expi293F cell cultures and purified from the supernatants with yields of 18.9, 12.6, 19, 18.9, and 19.8 mg L-l for binder A, ofatumumab, ofatumumab_N35D, ofatumumab_T55G, and ofatumumab_K85N, respectively.
[0181] The purified antibodies migrated on a reducing SDS-PAGE with an apparent molecular weight of approximately 30 kDa, comparable to their calculated molecular weights (28.8, 28.3, 28.3, 28.3, and 28.3 kDa, respectively) including the His and FLAG tags (FIG. 7). The oligomerization states of the purified proteins were analyzed by using SEC (FIG. 6). Monomers were isolated, confirmed by reloading onto the SEC column, and used for cell binding measurement.
[0182] Binding of antibodies to CD20-negative K562 and CD20-overexpressing K562 (K562-CD20) cells was measured by flow cytometry (FIG. 8). Binder A showed an EC50 of 55.5 nM for K562-CD20 cells, about 5 -fold higher than that (EC50, 10.5 nM) of ofatumumab.
[0183] The decrease in the cell binding affinity of binder A compared to ofatumumab was statistically significant at the highest concentrations tested (40, 200, and 1000 nM) (FIG. 9). Ofatumumab_N35D and ofatumumab_K85N had comparable affinities (EC50, H.8 and 11.2 nM, respectively) with ofatumumab, while the T55G mutation resulted in a significantly decreased affinity (EC50, 17.3 nM) of ofatumumab_T55G when measured at 40 and 200 nM concentrations. At 40 nM concentration,ofatumumab_N35D also showed a statistically significant decrease of binding compared to ofatumumab, although with a comparable EC50. None of the ofatumumab variants showed detectable binding to the CD20-negative K562 cells, suggesting they are highly specific to CD20.
[0184] Binder A CAR showed higher killing activity than ofatumumab CAR against both CD20-positive B cell lines, Raji and Daudi, even at very low E:T ratios (FIG. 4), as well as distinguished cytokine profiles (FIG. 5).
[0185] The decreased affinity of binder A compared to the wild-type ofatumumab may result in lower trogocytosis, (Joly and Hudrisier 2003) which has been identified as one of the mechanisms for tumor escape from CAR-T therapies by mediating antigen loss on cancer cells and fratricide of CAR-T cells (Olson et al. 2022).
[0186] CAR with a lower affinity may result in reduced trogocytosis compared to those with higher affinity, (Olson et al. 2022), higher efficacy and persistence (Ghorashian et al. 2019). Furthermore, CAR- T cells with higher affinity binders are more prone to exhaustion and activation-induced cell death (Mao et al. 2022). Therefore, Binder A-based CARs may exhibit reduced trogocytosis and exhaustion than the wildtype ofatumumab-based counterparts.Example 4. Epitope mapping via alanine scanning4.1. Principle
[0187] Alanine scanning mutagenesis is a commonly employed method for epitope mapping, involving the systematic substitution of individual amino acid residues to identify critical residues essential for antibody -antigen binding. (Weiss et al. 2000)4.2. Cloning of CD20 variants with a single mutation to alanine and EGFP fused to their C termini for detection of expression
[0188] EGFP -fused CD20 WT were cloned using the following primers, synthesized by GENEWIZ:1262, 5’-TAGGAAGCTTTTAAAACAGCTCTG-3’ (sense) SEQ ID NO: 56,2242, 5’-GGTGGCTGGGTACCTCCT-3’ (anti-sense) SEQ ID NO: 57,1263, 5’-AATGACAGCTCTCCTATGGTGAGCAAGGGCGAG-3’ (sense) SEQ ID NO: 58,1264, 5’-AGGTACCCAGCCACCATGACAACACCCAGAAATTCA-3’ (sense) SEQ ID NO: 59,2243, 5’-AGCTGTTTTAAAAGCTTCCTACTTGTACAGCTCGTCCAT-3’ (anti-sense) SEQ ID NO: 60, and2244, 5’-GCCCTTGCTCACCATAGGAGAGCTGTCATTTTCTAT-3’ (anti-sense) SEQ ID NO: 61.
[0189] The CD20 fragment was PCR amplified with a CD20-encoding plasmid as a template and primers 1264 and 2244. The EGFP fragment was PCR amplified with an EGFP -encoding plasmid as a template and primers 1263 and 2243. Then, the EGFP -fused CD20 gene fragment was amplified by overlapping PCR with the two fragments at the same molarity and primers 1264 and 2243. The pLV2.2 vector, which was derived from pLV-tEFla-8BBz by replacing the tEFla promoter with the SFFV promoter, was linearized by PCR amplification with the plasmid as a template and primers 1262 and 2242. The EGFP -fused CD20gene fragment was then assembled into the linearized pLV2.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.
[0190] EGFP -fused CD20 (I76A were cloned using the following primers, synthesized by GENEWIZ: 1262, 5’-TAGGAAGCTTTTAAAACAGCTCTG-3’ (sense) SEQ ID NO: 56,2242, 5’-GGTGGCTGGGTACCTCCT-3’ (anti-sense) SEQ ID NO: 57,1264, 5’-AGGTACCCAGCCACCATGACAACACCCAGAAATTCA-3’ (sense) SEQ ID NO: 59,2243, 5’-AGCTGTTTTAAAAGCTTCCTACTTGTACAGCTCGTCCAT-3’ (anti-sense) SEQ ID NO: 60,1265, 5’-CCAGCAGGGGCCTATGCACCC-3’ (sense) SEQ ID NO: 62, and2245, 5’-GGGTGCATAGGCCCCTGCTGG-3’ (anti-sense) SEQ ID NO: 63.
[0191] Two EGFP-fused CD20 (I76A) fragments were first PCR amplified with the EGFP-fused CD20 WT-encoding plasmid as a template and primer pairs 1264 / 2245 and 1265 / 2243, respectively. Then, the full-length EGFP-fused CD20 (I76A) gene fragment was amplified by overlapping PCR with the two fragments at the same molarity and primers 1264 and 2243. The pLV2.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1262 and 2242. The EGFP-fused CD20 (I76A) gene fragment was then assembled into the linearized pLV2.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.
[0192] EGFP-fused CD20 (Y77A) were cloned using the following primers, synthesized by GENEWIZ: 1262, 5’-TAGGAAGCTTTTAAAACAGCTCTG-3’ (sense) SEQ ID NO: 56,2242, 5’-GGTGGCTGGGTACCTCCT-3’ (anti-sense) SEQ ID NO: 57,1264, 5’-AGGTACCCAGCCACCATGACAACACCCAGAAATTCA-3’ (sense) SEQ ID NO: 59,2243, 5’-AGCTGTTTTAAAAGCTTCCTACTTGTACAGCTCGTCCAT-3’ (anti-sense) SEQ ID NO: 60,1266, 5’- GCAGGGATCGCTGCACCCATC-3’ (sense) SEQ ID NO: 64, and2246, 5’-GATGGGTGCAGCGATCCCTGC-3’ (anti-sense) SEQ ID NO: 65.
[0193] Two EGFP-fused CD20 (Y77A) fragments were first PCR amplified with the EGFP-fused CD20 WT-encoding plasmid as a template and primer pairs 1264 / 2246 and 1266 / 2243, respectively. Then, the full-length EGFP-fused CD20 (Y77A) gene fragment was amplified by overlapping PCR with the two fragments at the same molarity and primers 1264 and 2243. The pLV2.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1262 and 2242. The EGFP-fused CD20 (Y77A) gene fragment was then assembled into the linearized pLV2.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.
[0194] EGFP-fused CD20 (H145A) were cloned using the following primers, synthesized by GENEWIZ: 1262, 5’-TAGGAAGCTTTTAAAACAGCTCTG-3’ (sense) SEQ ID NO: 56,2242, 5’-GGTGGCTGGGTACCTCCT-3’ (anti-sense) SEQ ID NO: 57,1264, 5’-AGGTACCCAGCCACCATGACAACACCCAGAAATTCA-3’ (sense) SEQ ID NO: 59,2243, 5’-AGCTGTTTTAAAAGCTTCCTACTTGTACAGCTCGTCCAT-3’ (anti-sense) SEQ ID NO: 60, 1275, 5’-AAAATTTCCGCTTTTTTAAAAATGGAGAGT-3’ (sense) SEQ ID NO: 80, and2255, 5’-TTTTAAAAAAGCGGAAATTTTAATATTAAGTATGTCCAT-3’ (anti-sense) SEQ ID NO: 81.
[0195] Two EGFP -fused CD20 (H145A) fragments were first PCR amplified with the EGFP -fused CD20 WT-encoding plasmid as a template and primer pairs 1264 / 2255 and 1275 / 2243, respectively. Then, the full-length EGFP-fused CD20 (H145A) gene fragment was amplified by overlapping PCR with the two fragments at the same molarity and primers 1264 and 2243. The pLV2.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1262 and 2242. The EGFP-fused CD20 (H145A) gene fragment was then assembled into the linearized pLV2.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.
[0196] EGFP-fused CD20 (Y161A) were cloned using the following primers, synthesized by GENEWIZ: 1262, 5’-TAGGAAGCTTTTAAAACAGCTCTG-3’ (sense) SEQ ID NO: 56,2242, 5’-GGTGGCTGGGTACCTCCT-3’ (anti-sense) SEQ ID NO: 57,1264, 5’-AGGTACCCAGCCACCATGACAACACCCAGAAATTCA-3’ (sense) SEQ ID NO: 59,2243, 5’-AGCTGTTTTAAAAGCTTCCTACTTGTACAGCTCGTCCAT-3’ (anti-sense) SEQ ID NO: 60,1268, 5’- CACACACCAGCTATTAAC ATA-3’ (sense) SEQ ID NO: 66, and2248, 5’-TATGTTAATAGCTGGTGTGTG-3’ (anti-sense) SEQ ID NO: 67.
[0197] Two EGFP-fused CD20 (Y161A) fragments were first PCR amplified with the EGFP-fused CD20 WT-encoding plasmid as a template and primer pairs 1264 / 2248 and 1268 / 2243, respectively. Then, the full-length EGFP-fused CD20 (Y161A) gene fragment was amplified by overlapping PCR with the two fragments at the same molarity and primers 1264 and 2243. The pLV2.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1262 and 2242. The EGFP-fused CD20 (Y161A) gene fragment was then assembled into the linearized pLV2.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.
[0198] EGFP-fused CD20 (N163 A) were cloned using the following primers, synthesized by GENEWIZ: 1262, 5’-TAGGAAGCTTTTAAAACAGCTCTG-3’ (sense) SEQ ID NO: 56,2242, 5’-GGTGGCTGGGTACCTCCT-3’ (anti-sense) SEQ ID NO: 57,1264, 5’-AGGTACCCAGCCACCATGACAACACCCAGAAATTCA-3’ (sense) SEQ ID NO: 59,2243, 5’-AGCTGTTTTAAAAGCTTCCTACTTGTACAGCTCGTCCAT-3’ (anti-sense) SEQ ID NO: 60,1269, 5’- ACACCATATATTGCCATATACAACTGT-3’ (sense) SEQ ID NO: 68, and2249, 5’- ACAGTTGTATATGGCAATATATGGTGT-3’ (anti-sense) SEQ ID NO: 69.
[0199] Two EGFP-fused CD20 (N 163 A) fragments were first PCR amplified with the EGFP-fused CD20 WT-encoding plasmid as a template and primer pairs 1264 / 2249 and 1269 / 2243, respectively. Then, the full-length EGFP-fused CD20 (N163A) gene fragment was amplified by overlapping PCR with the two fragments at the same molarity and primers 1264 and 2243. The pLV2.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1262 and 2242. The EGFP-fused CD20 (N163A) gene fragment was then assembled into the linearized pLV2.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.
[0200] EGFP-fused CD20 (N166A) were cloned using the following primers, synthesized by GENEWIZ: 1262, 5’-TAGGAAGCTTTTAAAACAGCTCTG-3’ (sense) SEQ ID NO: 56,2242, 5’-GGTGGCTGGGTACCTCCT-3’ (anti-sense) SEQ ID NO: 57,1264, 5’-AGGTACCCAGCCACCATGACAACACCCAGAAATTCA-3’ (sense) SEQ ID NO: 59,2243, 5’-AGCTGTTTTAAAAGCTTCCTACTTGTACAGCTCGTCCAT-3’ (anti-sense) SEQ ID NO: 60,1270, 5’- AACATATACGCCTGTGAACCA-3’ (sense) SEQ ID NO: 70, and2250, 5’-TGGTTCACAGGCGTATATGTT-3’ (anti-sense) SEQ ID NO: 71.
[0201] Two EGFP -fused CD20 (N166A) fragments were first PCR amplified with the EGFP -fused CD20 WT-encoding plasmid as a template and primer pairs 1264 / 2250 and 1270 / 2243, respectively. Then, the full-length EGFP -fused CD20 (N166A) gene fragment was amplified by overlapping PCR with the two fragments at the same molarity and primers 1264 and 2243. The pLV2.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1262 and 2242. The EGFP -fused CD20 (N166A) gene fragment was then assembled into the linearized pLV2.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.
[0202] EGFP-fused CD20 (E168A) were cloned using the following primers, synthesized by GENEWIZ: 1262, 5’-TAGGAAGCTTTTAAAACAGCTCTG-3’ (sense) SEQ ID NO: 56,2242, 5’-GGTGGCTGGGTACCTCCT-3’ (anti-sense) SEQ ID NO: 57,1264, 5’-AGGTACCCAGCCACCATGACAACACCCAGAAATTCA-3’ (sense) SEQ ID NO: 59,2243, 5’-AGCTGTTTTAAAAGCTTCCTACTTGTACAGCTCGTCCAT-3’ (anti-sense) SEQ ID NO: 60,1271, 5’- TACAACTGTGCACCAGCTAAT-3’ (sense) SEQ ID NO: 72, and2251, 5’-ATTAGCTGGTGCACAGTTGTA-3’ (anti-sense) SEQ ID NO: 73.
[0203] Two EGFP-fused CD20 (El 68 A) fragments were first PCR amplified with the EGFP-fused CD20 WT-encoding plasmid as a template and primer pairs 1264 / 2251 and 1271 / 2243, respectively. Then, the full-length EGFP-fused CD20 (E168A) gene fragment was amplified by overlapping PCR with the two fragments at the same molarity and primers 1264 and 2243. The pLV2.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1262 and 2242. The EGFP-fused CD20 (E168A) gene fragment was then assembled into the linearized pLV2.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.
[0204] EGFP-fused CD20 (N171 A) were cloned using the following primers, synthesized by GENEWIZ: 1262, 5’-TAGGAAGCTTTTAAAACAGCTCTG-3’ (sense) SEQ ID NO: 56,2242, 5’-GGTGGCTGGGTACCTCCT-3’ (anti-sense) SEQ ID NO: 57,1264, 5’-AGGTACCCAGCCACCATGACAACACCCAGAAATTCA-3’ (sense) SEQ ID NO: 59,2243, 5’-AGCTGTTTTAAAAGCTTCCTACTTGTACAGCTCGTCCAT-3’ (anti-sense) SEQ ID NO: 60,1272, 5’- GAACCAGCTGCTCCCTCTGAG-3’ (sense) SEQ ID NO: 74, and2252, 5’ - CTCAGAGGGAGCAGCTGGTTC-3’ (anti-sense) SEQ ID NO: 75.
[0205] Two EGFP-fused CD20 (N171 A) fragments were first PCR amplified with the EGFP-fused CD20 WT-encoding plasmid as a template and primer pairs 1264 / 2252 and 1272 / 2243, respectively. Then, the full-length EGFP-fused CD20 (N171A) gene fragment was amplified by overlapping PCR with the two fragments at the same molarity and primers 1264 and 2243. The pLV2.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1262 and 2242. The EGFP-fused CD20 (N171A)gene fragment was then assembled into the linearized pLV2.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.
[0206] EGFP-fused CD20 (E174A) were cloned using the following primers, synthesized by GENEWIZ: 1262, 5’-TAGGAAGCTTTTAAAACAGCTCTG-3’ (sense) - - SEQ ID NO: 56,2242, 5’-GGTGGCTGGGTACCTCCT-3’ (anti-sense) SEQ ID NO: 57,1264, 5’-AGGTACCCAGCCACCATGACAACACCCAGAAATTCA-3’ (sense) SEQ ID NO: 59,2243, 5’-AGCTGTTTTAAAAGCTTCCTACTTGTACAGCTCGTCCAT-3’ (anti-sense) SEQ ID NO: 60,1273, 5’- AATCCCTCTGCGAAAAACTCC-3’ (sense) SEQ ID NO: 76, and2253, 5’-GGAGTTTTTCGCAGAGGGATT-3’ (anti-sense) SEQ ID NO: 77.
[0207] Two EGFP-fused CD20 (El 74 A) fragments were first PCR amplified with the EGFP-fused CD20 WT-encoding plasmid as a template and primer pairs 1264 / 2253 and 1273 / 2243, respectively. Then, the full-length EGFP-fused CD20 (E174A) gene fragment was amplified by overlapping PCR with the two fragments at the same molarity and primers 1264 and 2243. The pLV2.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1262 and 2242. The EGFP-fused CD20 (E174A) gene fragment was then assembled into the linearized pLV2.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.
[0208] EGFP-fused CD20 (K175A) were cloned using the following primers, synthesized by GENEWIZ: 1262, 5’-TAGGAAGCTTTTAAAACAGCTCTG-3’ (sense) SEQ ID NO: 56,2242, 5’-GGTGGCTGGGTACCTCCT-3’ (anti-sense) SEQ ID NO: 57,1264, 5’-AGGTACCCAGCCACCATGACAACACCCAGAAATTCA-3’ (sense) SEQ ID NO: 59,2243, 5’-AGCTGTTTTAAAAGCTTCCTACTTGTACAGCTCGTCCAT-3’ (anti-sense) SEQ ID NO: 60,1274, 5’-CCCTCTGAGGCAAACTCCCCA-3’ (sense) SEQ ID NO: 78, and2254, 5’-TGGGGAGTTTGCCTCAGAGGG-3’ (anti-sense) SEQ ID NO: 79.
[0209] Two EGFP-fused CD20 (KI 75 A) fragments were first PCR amplified with the EGFP-fused CD20 WT-encoding plasmid as a template and primer pairs 1264 / 2254 and 1274 / 2243, respectively. Then, the full-length EGFP-fused CD20 (K175A) gene fragment was amplified by overlapping PCR with the two fragments at the same molarity and primers 1264 and 2243. The pLV2.2 vector was linearized by PCR amplification with the plasmid as a template and primers 1262 and 2242. The EGFP-fused CD20 (K175A) gene fragment was then assembled into the linearized pLV2.2 vector by using Gibson Assembly® according to the manufacturer’s instructions.4.3. Transduction of K562 cells for generation of cell lines expressing different CD20 variants
[0210] For transduction of K562 cells, 250 pL lentiviruses were first diluted in 250 pL IMDM medium with 10% FBS and 60 pg ml1protamine sulfate. Then, the mixture was added into 106K562 cells in 1 mL IMDM medium with 10% FBS in 12-well plates. After incubation at 37°C for 24 h, 1 mL medium was gently removed from each well and 2 mL IMDM medium with 10% FBS was added into each well of the 12-well plates. Transduced cells were passaged every 2-3 days at a seed density of 5 * 105cells / mL in IMDM medium with 10% FBS. For measuring expression of the EGFP-fused CD20 proteins on the surfaceof transduced K562 cells, 105transduced cells were washed with 200 |iL PBS (pH7.4) containing 0.5% BSA (PBSA), resuspended in 100 pL PBSA, and used for flow cytometry analysis.4.4. Binding of binder A and ofatumumab to K562 cells expressing different CD20 variants
[0211] Binding of binder A and ofatumumab to K562 cells expressing EGFP-fused CD20 variants with a single alanine mutation was measured by flow cytometry. Briefly, monomeric antibodies were diluted from 200 nM in PBS containing 3% BSA (assay buffer). All K562 cell lines were collected by centrifugation at 500 g for 10 min and resuspended in the assay buffer at a density of 4E6 cells / ml. 50 pL of the diluted antibodies was mixed with 50 pL of the cells leading to the final antibody concentrations of 100 nM. After incubation on ice for 30 min, cells were washed 3 times with 200 pL assay buffer by centrifuging at 500 g for 3 min in each wash. After washing, cells were resuspended in 100 pL of 1:500 diluted secondary antibody (APC-conjugated anti-FLAG). After incubation on ice for 30 min, cells were washed 3 times with 200 pL assay buffer by centrifuging at 500 g for 3 min in each wash. Cells were then resuspended in 100 pL assay buffer and used for flow cytometry analysis. Median Fluorescence Intensity (MFI) of GFP and APC was calculated to quantify the cell binding strength of each antibody.4.5. Selection of amino acid residues on CD20 interacting with ofatumumab for alanine scanning for fine epitope mapping of binder A
[0212] To elucidate the mechanisms underlying the substantially different binding affinities of binder A and ofatumumab for CD20, we performed fine epitope mapping by using alanine scanning. 10 amino acid residues (176, Y77, H145, Y161, N163, N166, E168, N171, E174 and K175) on CD20 were identified by analyzing the cryo-EM structure of the ofatumumab-CD20 complex that interact with ofatumumab. Accordingly, 10 CD20 variants with a single mutation to alanine were generated by fusing to the N terminus of EGFP for expression detection and cloned into the pLV2.2 lentiviral vector. K562 cells were transduced with lentiviruses encoding the CD20-EGFP fusion proteins. Expression of the fusion proteins and binding strength of the antibodies were measured by using EGFP and APC-conjugated anti-FLAG, respectively.4.6. Results
[0213] Binding of antibodies to K562 cells expressing wild-type CD20 (K562-CD20 WT) and CD20 variants was measured in duplicate by flow cytometry. Relative binding strength of the CD20 variants compared to the CD20 WT was calculated after normalization against expression levels measured by EGFP (FIG. 10). Each of the Y77A, H145A and N163 A mutations decreased the binding of ofatumumab by >50% suggesting that these three residues are the core epitope of ofatumumab on CD20. In contrast, all mutations except K175A caused a >50% change of binding of binder A suggesting a more dispersed core epitope of binder A on CD20. Notably, the binding of binder A to all CD20 variants except CD20 (N163A) was statistically significantly decreased or increased compared to ofatumumab. In addition, the K175 mutation had no effects on ofatumumab binding while leading to significantly decreased binding of binder A suggesting that the KI 75 residue is involved in the interaction with binder A but not with ofatumumab (FIG. 10). Taken together, our results suggest that the three germline mutations (N35D, T55G and K85N) result in a substantial change of the epitope of binder A compared to ofatumumab.
[0214] The dispersed core epitope and the additional interaction with the KI 75 residue of CD20 may result in binder A-based CARs with more resistance to point mutation-mediated escape.Table VII. Epitope relative binding ratio based on CD20 WT for Binder A & Ofatumumab
[0215] It will be appreciated by those skilled in the art that the foregoing descriptions are exemplary and explanatory in nature and intended to illustrate the aspects herein provided and its preferred embodiments. Through routine experimentation, an artisan will recognize apparent modifications and variations that may be made without departing from the spirit of the aspects herein disclosed. All such modifications coming within the scope of the appended claims are intended to be included therein. Thus, the aspects herein disclosed are intended to be defined not by the above description, but by the following claims and their equivalents.
[0216] All publications, including but not limited to patents and patent applications, cited in this specification are herein incorporated by reference as if each individual publication are specifically and individually indicated to be incorporated by reference herein as though fully set forth.
[0217] It should be understood that factors such as the differential cell penetration capacity of the various compositions can contribute to discrepancies between the activity of the compositions in the in vitro biochemical and cellular assays.REFERENCESAng, Zhiwei, Luca Paruzzo, Katharina E. Hayer, et al. 2023. “Alternative Splicing of Its 5'-UTR Limits CD20 mRNA Translation and Enables Resistance to CD20-Directed Immunotherapies.” Blood 142 (20): 1724-39. https: / / doi.org / 10.1182 / blood.2023020400.Campo, Elias, Steven H. Swerdlow, Nancy L. Harris, Stefano Pileri, Harald Stein, and Elaine S. Jaffe. 2011. “The 2008 WHO Classification of Lymphoid Neoplasms and beyond: Evolving Concepts and Practical Applications.” Blood 117 (19): 5019-32. https: / / doi.org / 10.1182 / blood-2011-01-293050.Casan, J. M. L., J. Wong, M. J. Northcott, and S. Opat. 2018. “Anti-CD20 Monoclonal Antibodies: Reviewing a Revolution.” Human Vaccines & Immunotherapeutics 14 (12): 2820-41. https: / / doi.org / 10.1080 / 21645515.2018.1508624.Clinical Review Report: Ofatumumab (Kesimpta): (Novartis Pharmaceuticals Canada Inc.): Indication: Multiple Sclerosis, Relapsing-Remitting. 2021. CADTH Common Drug Reviews. Canadian Agency for Drugs and Technologies in Health. http: / / www.ncbi.nlm.nih.gov / books / NBK572484 / .Dondelinger, Mathieu, Patrice Filee, Eric Sauvage, et al. 2018. “Understanding the Significance and Implications of Antibody Numbering and Antigen-Binding Surface / Residue Definition.” Frontiers in Immunology 9 (October): 2278. https: / / doi.org / 10.3389 / fimmu.2018.02278.Dores, Graca M., William F. Anderson, Rochelle E. Curtis, et al. 2007. “Chronic Lymphocytic Leukaemia and Small Lymphocytic Lymphoma: Overview of the Descriptive Epidemiology.” British Journal of Haematology 139 (5): 809-19. https: / / doi.Org / 10.l ll l / j.1365-2141.2007.06856.x.Ghorashian, Sara, Anne Marijn Kramer, Shimobi Onuoha, et al. 2019. “Enhanced CAR T Cell Expansion and Prolonged Persistence in Pediatric Patients with ALL Treated with a Low- Affinity CD 19 CAR.” Nature Medicine 25 (9): 1408-14. https: / / doi.org / 10.1038 / s41591-019-0549-5.Hauser, Stephen L., Ludwig Kappos, Amit Bar-Or, et al. 2023. “The Development of Ofatumumab, a Fully Human Anti-CD20 Monoclonal Antibody for Practical Use in Relapsing Multiple Sclerosis Treatment.” Neurology andTherapy 12 (5): 1491-515. https: / / doi.org / 10.1007 / s40120-023-00518- 0.Joly, Etienne, and Denis Hudrisier. 2003. “What Is Trogocytosis and What Is Its Purpose?” Nature Immunology 4 (9): 815-815. https: / / doi.org / 10.1038 / ni0903-815.Mao, Rui, Wanqing Kong, and Yukai He. 2022. “The Affinity of Antigen-Binding Domain on the Antitumor Efficacy of CAR T Cells: Moderate Is Better.” Frontiers in Immunology 13. https : / / www.frontiersin. org / article s / 10.3389 / fimmu.2022.1032403.Olson, Michael L., Erica R. Vander Mause, Sabarinath V. Radhakrishnan, et al. 2022. “Low-Affinity CAR T Cells Exhibit Reduced Trogocytosis, Preventing Rapid Antigen Loss, and Increasing CAR T Cell Expansion.” Leukemia 36 (7): 7. https: / / doi.org / 10.1038 / s41375-022-01585-2.Weiss, Gregory A., Colin K. Watanabe, Alan Zhong, Audrey Goddard, and Sachdev S. Sidhu. 2000. “Rapid Mapping of Protein Functional Epitopes by Combinatorial Alanine Scanning.” Proceedings of the National Academy of Sciences 97 (16): 8950-54. https: / / doi.org / 10.1073 / pnas.160252097.SEQUENCE LISTINGNote: The CDR sequences in the Sequence Listing below (e.g., SEQ ID Nos: 1-6) are defined using the IM GT numbering scheme. It is understood that in other aspects, alternative CDR sequences may be defined based upon other numbering scheme known in the art (e.g., the Kabat, Chothia, and Martin numbering schemes) and constructs using one or more CDR sequences based on these alternative numbering schemes are also contemplated by the present disclosure.
Claims
CLAIMS1. A CD20-binding domain comprising: a) a heavy chain variable (VH) domain comprising at least one of the following complementarity determining regions (CDRs):HCDR1 - GFTFDDYA (SEQ ID NO: 1), HCDR2 - ISWNSGSI (SEQ ID NO: 2), andHCDR3 - AKDIQYGNYYYGMDV (SEQ ID NO: 3); and b) a light chain variable (VL) domain comprising at least one of the following CDRs:LCDR1 - QSVSSY (SEQ ID NO: 4),LCDR2 - DAS (SEQ ID NO: 5), and LCDR3 - QQRSNWPIT (SEQ ID NO: 6).
2. The CD20-binding domain according to claim 1, wherein a) the sequence of the VH domain i) shares at least 95% sequence identity with the sequence of SEQ ID NO: 7, or ii) has at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitutions compared to SEQ ID NO: 7; and b) the sequence of the VL domain i) shares at least 95% sequence identity with the sequence of SEQ ID NO: 8, or has at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitutions compared to SEQ ID NO: 8.
3. The CD20-binding domain according to claim 1, wherein a) the sequence of the VH domain i) shares at least 95% sequence identity with the sequence of SEQ ID NO: 7, or ii) has at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitutions compared to SEQ ID NO: 7; or b) the sequence of the VL domain i) shares at least 95% sequence identity with the sequence of SEQ ID NO: 8, or has at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitutions compared to SEQ ID NO: 8.
4. The CD20-binding domain according to any one of the preceding claims, wherein the CD20- binding domain comprises an scFv.
5. The CD20-binding domain according to claim 4, wherein a) the scFv comprises the VH domain N-terminal to the VL domain, optionally connected by an intervening linker sequence; or b) the scFv comprises the VL domain N-terminal to the VH domain, optionally connected by an intervening linker sequence.
6. The CD20-binding domain according to claim 5, wherein the linker sequence of a) and or b) comprises the amino acid sequence of SEQ ID NO: 24, or a fragment comprising at least 5contiguous amino acids thereof.
7. The CD20-binding domain according to any one of the preceding claims, wherein the CD20- binding domain comprises a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 9.
8. The CD20-binding domain according to any one of the preceding claims, wherein HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 and LCDR3 are located within a human antibody framework.
9. The CD20-binding domain according to claim 7 or claim 8, wherein the CD20-binding domain comprises an scFv.
10. A CD20-binding domain comprising:(a) a light chain variable (VL) domain comprising an amino acid sequence of SEQ ID NO: 8; and(b) a heavy chain variable (VH) domain variant of SEQ ID NO: 48; wherein the heavy chain variable (VH) domain variant differs from the amino acid sequence of SEQ ID NO:48 by one, two or at most three amino acid substitutions selected from T55G, N35D and / or K85N, wherein the numbering is according to the IMGT numbering scheme.
11. The CD20-binding domain of claim 10, wherein the heavy chain variable (VH) domain variant differs from the amino acid sequence of SEQ ID NO:48 by one amino acid substitution selected from the group consisting of: T55G, N35D and K85N.
12. The CD20-binding domain of claim 11, wherein the heavy chain variable (VH) domain variant differs from the amino acid sequence of SEQ ID NO:48 by two amino acid substitutions selected from the group consisting of: T55G, N35D and K85N.
13. The CD20-binding domain of any one of claims 10 to 12, wherein the heavy chain variable (VH) domain variant differs from the amino acid sequence of SEQ ID NO:48 by the amino acid substitution T55G, and optionally by one or at most two further amino acid substitutions selected from the group consisting of: N35D and K85N.
14. The CD20-binding domain of claim 13, wherein the heavy chain variable (VH) domain variant differs from the amino acid sequence of SEQ ID NO:48 by the following three amino acid substitutions: N35D, T55G and K85N.
15. A CD20-binding domain comprising: a) a heavy chain variable (VH) domain comprising the following complementarity determining regions (CDRs):HCDR1 - GFTFDDYA (SEQ ID NO: 1) or GFTFNDYA (SEQ ID NO: 50),HCDR2 - ISWNSGSI (SEQ ID NO: 2), andHCDR3 - AKDIQYGNYYYGMDV (SEQ ID NO: 3); andb) a light chain variable (VL) domain comprising the following CDRs:LCDR1 - QSVSSY (SEQ ID NO: 4),LCDR2 - DAS (SEQ ID NO: 5), andLCDR3 - QQRSNWPIT (SEQ ID NO: 6), wherein the heavy chain (VH) domain further comprises (i) glycine at position 55 and / or (ii) asparagine at position 85, wherein the numbering is according to the IMGT numbering scheme.
16. A CD20-targeting chimeric antigen receptor (CAR) comprising the CD20-binding domain according to any one of claims 1 to 9, and a transmembrane domain.
17. The CAR according to claim 10, wherein the CAR comprises a spacer between the CD20-binding domain and the transmembrane domain.
18. The CAR according to claim 11, wherein the spacer comprises: a human an IgGl Fc domain; an IgGl hinge; or a CD 8 stalk.
19. The CAR according to claim 12, wherein the spacer comprises an IgGl hinge or a CD8 stalk.
20. The CAR according to any one of claims 10 to 13, wherein the CAR comprises an intracellular T cell signaling domain.
21. The CAR according to claim 14, wherein the intracellular T cell signaling domain comprises one or more endodomains selected from the group consisting of: a CD28 endodomain, a 4-1BB endodomain, a 0X40 endodomain and a CD3c endodomain.
22. The CAR according to claim 15, wherein the intracellular T-cell signaling domain comprises at least one of a 4-1BB endodomain and a CD3^ endodomain.
23. The CAR according to claim 15, wherein the intracellular T cell signaling domain comprises at least one of a CD28 endodomain, an 0X40 endodomain and a CD3c endodomain.
24. A nucleic acid molecule encoding a CD20-binding domain according to any one of claims 1 to 9, or a CAR according to any one of claims 10 to 17.
25. A vector comprising a nucleic acid sequence encoding a CD20-binding domain according to any one of claims 1 to 9, or a CAR according to any one of claims 10 to 17.
26. A recombinant cell comprising a CD20-binding domain according to any one of claims 1 to 9, a CAR according to any one of claims 10 to 17, a nucleic acid molecule according to claim 18, or a vector according to claim 19.
27. A composition comprising a plurality of recombinant cells according to claim 20.
28. A method for making a recombinant cell according to claim 20 comprising transducing or transfecting a cell with a nucleic acid molecule according to claim 18 or a vector according to claim 19.
29. A method for making a composition according to claim 21, comprising transducing or transfecting ex vivo a plurality of cells obtained from a subject with a nucleic acid molecule according to claim 18 or a vector according to claim 19.
30. A pharmaceutical composition comprising a CD20-binding domain according to any one of claims 1 to 9, a CAR according to any one of claims 10 to 17, a nucleic acid molecule according to claim 18, a vector according to claim 19, a recombinant cell according to claim 20, or a composition according to claim 21, together with a pharmaceutically acceptable carrier, diluent or excipient.
31. The pharmaceutical composition according to claim 24 for use as a medicament.
32. A method for treating cancer and / or autoimmune disease comprising administering an effective amount of the pharmaceutical composition according to claim 24 to a subject in need thereof.
33. The method according to claim 24, wherein the method comprises (i) transducing or transfecting ex vivo a plurality of cells obtained from a subject with the pharmaceutical composition, wherein the pharmaceutical composition comprises a nucleic acid molecule according to claim 18 or a vector according to claim 19, and (ii) administering the transduced or transfected cells back into the subject.
34. The pharmaceutical composition according to claim 24 for use in treating cancer and / or autoimmune disease.
Citation Information
Patent Citations
CD20 specificity chimeric antigen receptor and application thereof
CN106397608A
Humanized Anti-CD20 chimeric antigen receptor
JP2015092865A
Chimeric antigen receptors targeting CD20
US20240115605A1
Human monoclonal antibodies against CD20
WO2004035607A2
Compositions and methods for CD20 immunotherapy
WO2017161353A1