Cancer-associated mimotopes, masked protease-activatable receptors, and methods of using same for detecting cancer
Engineered protease-activatable receptors address the limitations of current cancer detection methods by using synthetic Notch constructs and mimotopes to induce detectable signals in immune cells, enhancing sensitivity and specificity for early cancer diagnosis.
Patent Information
- Application Number
- PCT/US2025/051289
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-16
- Filing Date
- 2025-10-16
- Publication Date
- 2026-04-23
AI Technical Summary
Existing cancer detection methods face challenges in achieving high sensitivity and specificity, particularly for nascent tumors, due to poor influx and clearance of biomarkers from tumor vasculature and secretion by healthy tissues, limiting the effectiveness of current screening tests.
Development of engineered protease-activatable receptors (PARs) comprising a synthetic Notch construct, antigen-binding domain, mimotopes, and protease-cleavable linkers, which upon protease cleavage, induce expression of detectable signals in immune cells, allowing for cancer detection through biological fluid analysis.
The PARs enable sensitive and specific detection of cancer by releasing reporter molecules upon protease cleavage, providing a reliable method for early cancer diagnosis with minimal false positives.
Smart Images

Figure IMGF000058_0001 
Figure IMGF000059_0001 
Figure IMGF000059_0002
Abstract
Description
CANCER-ASSOCIATED MIMOTOPES, MASKED PROTEASE-ACTIVATABLE RECEPTORS, AND METHODS OF USING SAME FOR DETECTING CANCERCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] Tills application claims the benefit of priority to U.S. Provisional Application No. 63 / 707,941 , filed October 16, 2024, which is incorporated by reference herein in its entirety.GOVERNMENT SUPPORT CLAUSE
[0002] This invention was made with government support under Grant No. AY2AX0000006 awarded by the Advanced Research Projects Agency for Health (ARPA-H) and CA280832 awarded by the National Cancer Institute of the National Institutes of Health. The Government has certain rights in the invention.BACKGROUND
[0003] Early detection of cancer has the potential to enable clinical intervention at treatable disease stages and drive durable therapeutic responses, as exemplified by five-year survival rates above 60% for cancers in most anatomical sites when still localized at diagnosis. Screening tests such as mammograms, colonoscopies, and Papanicolaou tests have provided success stories for lowering the number of cancer deaths via early detection in asymptomatic populations. Still, accurate screening tests are only available for a small subset of indications, as population-scale deployment of early detection tests requires near-perfect specificity to prevent lengthy diagnostic odysseys that can result from false positives. Most approaches under investigation focus on abundance-based biomarkers in blood like shed proteins, circulating tumor cells, cell-free DNA, and cancer exosomes. However, poor influx into tumor vasculature, clearance from circulation, and secretion by healthy tissues or non-cancerous conditions limit their use for detecting nascent tumors, prompting efforts to increase sensitivity at high specificity cutoffs. Accordingly, there is a need for improved compositions and methods for cancer detection. These needs and others are at least partially satisfied by the present disclosure.SUMMARY
[0004] In some aspects, disclosed herein is a mimotope including about 80%’ similarity or more to any one of SEQ ID NOS: 5-105.
[0005] In some aspects, also disclosed herein is an engineered protease activatable receptor (PAR) including: i) a synthetic Notch (synNotch) construct including: a signal peptide; anantigen-binding domain; a synNotch core; and a transcription factor; ii) any of the disclosed mimotopes, wherein the mimotope binds to the antigen -binding domain; and iii) a protease- cleavable linker connecting the synNotch construct to the mimotope.
[0006] In some aspects, also disclosed herein is an engineered protease activatable receptor (PAR) including: i) a synthetic Notch (synNotch) construct including: a signal peptide; an antigen-binding domain; a synNotch core; and a transcription factor; ii) a mimotope that binds to the antigen-binding domain; and iii) a protease-cleavable linker connecting the synNotch construct to the mimotope, wherein the protease-cleavable linker is cleaved by a protease that is enriched in a tumor or a cancer expressing an antigen that binds to the antigen-binding domain.
[0007] In some aspects, also disclosed herein is an immune cell including: a) any of the disclosed engineered PARs; and b) a reporter nucleic acid encoding: i) a promoter that is activatable by transcription factor; and ii) a reporter molecule (including, but not limited to reporter molecules linked to a secretion tag ); wherein, upon cleavage of the protease-cleavable linker by a protease in the presence of an antigen that binds to the antigen-binding domain, the mimotope is released from the antigen-binding domain and the antigen -binding domain binds to its cognate antigen, thereby causing the transcription factor to be released from the synNotch construct and bind to the promoter, thereby inducing expression of the detectable signal linked to the secretion tag.
[0008] In some aspects, also disclosed herein is an immune cell including: a) an engineered protease activatable receptor (PAR) including: i) a synthetic Notch (synNotch) construct including: a signal peptide; an antigen-binding domain; a synNotch core; and a transcription factor; ii) a mimotope that binds to the antigen-binding domain; iii) a protease-cleavable linker connecting the synNotch construct to the mimotope; b) a reporter nucleic acid encoding: i) a promoter that is activatable by transcription factor; and ii) a reporter molecule (including, but not limited to reporter molecules linked to a secretion tag); wherein, upon cleavage of the protease-cleavable linker by a protease in the presence of an antigen that binds to the antigenbinding domain, the mimotope is released from the antigen-binding domain and the antigenbinding domain binds to its cognate antigen, thereby causing the transcription factor to be released from the synNotch construct and bind to the promoter, thereby inducing expression of the detectable signal linked to the secretion tag.
[0009] In some aspects, also disclosed herein is a method of detecting cancer in a subject, the method including: a) administering any of the disclosed immune cells to the subject, wherein the protease-cleavable linker is cleaved by a cancer-associated protease or a tumor-associated protease; b) collecting a biological fluid sample (including, but not limited to urine, blood, saliva, breath, sputum, bone marrow, cerebrospinal fluid (CSF), plasma, synovial fluid, nasal lavage, cell lysate, oral mucosa, nasal mucosa, vaginal mucosa, and / or rectal mucosa) from the subject; and c) detecting presence or absence of the reporter molecule in the biological fluid sample, thereby detecting presence or absence of cancer.
[0010] Other systems, methods, features and / or advantages will be or may become apparent to one with skill in the art upon examination of the following drawings and detailed description. It is intended that all such additional systems, methods, features and / or advantages be included within this description and be protected by the accompanying claims.BRIEF DESCRIPTION OF FIGURES
[0011] FIGURES 1A-1D depicts HER2 (Trastuzumab) PAR activation in engineered primary human T cells. FIG. 1A shows a flow histogram of T cells expressing PARs cocultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. IB shows quantification of percentage of BFP activation signal from FIG. 1 A. FIGS. 1C-1D show urinary detection of liver metastases using the hEGFR PAR T cell sensor. FIG. 1C shows total Nluc excreted in urine between 22-24 hours post-injection of PAR T cells. Statistical analysis was performed using an unpaired two-sided Student’s t-test (mean ± s.e.m., n=5 independent urine samples collected from mice). *P < 0.05 , **P < 0.01. FIG. ID shows ROC curves and AUC values of urinary Nluc signals from mice bearing MC38 tumors administered different doses of the PAR T cell sensor.
[0012] FIGURES 2A-2B depicts EGFR (Cetuximab) PAR activation in engineered primary human T cells. FIG. 2A shows a flow histogram of T cells expressing PARs cocultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 2B shows quantification of percentage of BFP activation signal from FIG. 2A.
[0013] FIGURES 3A-3B depict the BCMA.PA5 mask and PAR against aBCMA scFv. FIG. 3A shows BCMA.PA5 (Teclistamab) PARS are minimally expressed on the T cell surface as evidenced by expression of scFv binders (BCMA) on lentivirally transduced primary human T cells. Flow histogram of FLAG-tagged scFv binder cell surface expression using allophycocyanin-conjugated anti-FLAG monoclonal antibody is shown. FIG. 3B shows quantification of scFV binding to BCMA.PA5 mask with or without BCMA antigen addition. BCMA.PA5 mask shows reduced binding by scFv with BCMA antigen addition.
[0014] FIGURES 4A-4B depict the B2M-scFv-RAN3.Isolate.5 mask and PAR against aB2M. FIG. 4A shows B2M-scFv-RAN3.Isolate.5 (A 16041 A) PAR minimally expressed on the T cell surface as evidenced by surface expression of scFv binders on lentivirally transduced primary human T cells. A flow histogram of FLAG-tagged scFv binder cell surface expression using allophycocyanin-conjugated anti-FLAG monoclonal antibody is shown. FIG. 4B shows quantification of scFv binding to B2M-scFv-RAN3.Isolate.5 mask with or without mB2M antigen addition. Addition of competitive antigen decreases scFv binding.
[0015] FIGURES 5A-5C depict B2M-scFv-RAN2.Isolate.5 (A16041A) PAR activation in engineered primary human T cells and the B2M-scFv-RAN2.Isolate.5 mask against aB2M. FIG. 5A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells cocultured with target antigen positive cancer cells). FIG. 5B shows quantification of percentage of BFP activation signal from FIG. 5A. FIG. 5C shows quantification of scFv binding to B2M- scFv-RAN2.Isolate.5 mask with or without mB2M antigen addition. Addition of competitive antigen decreases scFv binding.
[0016] FIGURES 6A-6C depict B2M-scFv-pWTP.Isolate.10 (A16041A) PAR activation in engineered primary human T cells and the B2M-scFv-pWTP.Isolate.10 mask against aB2M. FIG. 6A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co- cultured with target antigen positive cancer cells). FIG. 6B shows quantification of percentage of BFP activation signal from FIG. 6A. FIG. 6C shows quantification of scFv binding to B2M- scFv-pWTP.Isolate.10 mask with or without mB2M antigen addition. Addition of competitive antigen decreases scFv binding.
[0017] FIGURES 7A-7B depict B2M-scFv-pWTP010203.Isolate.10 (A16041A) PAR activation in engineered primary human T cells. FIG. 7A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple- PAR T cells co-cultured with target antigen positive cancer cells). FIG. 7B shows quantification of percentage of BFP activation signal from FIG. 7A.
[0018] FIGURES 8A-8C depict B7H3-scFv-RAN3. Isolate.6 (376.96) PAR activation in engineered primary human T cells and B7H3-scFv-RAN3.Isolate.6 mask against aB7H3. FIG. 8A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple— PAR T cells co- cultured with target antigen positive cancer cells). FIG. 8B shows quantification of percentage of BFP activation signal from FIG. 8A. FIG. 8C shows quantification of scFv binding toB7H3-scFv-RAN3.1solate.6 mask with or without B / H3 antigen addition. Addition of competitive antigen decreases scFv binding.
[0019] FIGURES 9A-9C depict B7H3-scFv-RAN2.Isolate.5 (376,96) PAR activation in engineered primary human T cells and B7H3-scFv-RAN2.Isolate.5 mask against aB7H3. FIG. 9A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells cocultured with target antigen positive cancer cells). FIG. 9B shows quantification of percentage of BFP activation signal from FIG. 9A. FIG. 9C shows quantification of scFv binding to B7H3-scFv-RAN2.Isolate.5 mask with or without B7H3 antigen addition. Addition of B7H3 antigen blocks scFv binding.
[0020] FIGURES 10A-10C depict B7H3-scFv-RAN2. Isolate.7 (376.96) PAR activation in engineered primary human T cells and B7H3-scFv-RAN2. Isolate.7 mask against aB7H3. FIG. 10A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple— PAR T cells co-cultured with target antigen positive cancer cells). FIG. 10B shows quantification of percentage of BFP activation signal from FIG. 10A. FIG. 10C shows quantification of scFv binding to B7H3-scFv-RAN2.Isolate.7 mask with or without B7H3 antigen addition. Addition of B7H3 antigen blocks scFv binding.
[0021] FIGURES 11A-11B depict CAIX (12H8) PAR activation in engineered primary human T cells. FIG. 11A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple— PAR T cells co-cultured with target antigen positive cancer cells). FIG. 11B shows quantification of percentage of BFP activation signal from FIG. 11A.
[0022] FIGURES 12A-12C depict CD70-scFv-RAN2. Isolate.1 (Cusatuzumab) PAR activation in engineered primary human T cells and CD70-scFv-p WTP. Isolate.1 mask against aCD70. FIG. 12A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple— PAR T cells co-cultured with target antigen positive cancer cells). FIG. 12B shows quantification of percentage of BFP activation signal from FIG. 12A. FIG. 12C shows quantification of scFv binding to CD70-scFv-pWTP.Isolate.l mask with or without CD70 antigen addition. Addition of competitive antigen decreases scFv binding.
[0023] FIGURES 13A-13C depict CEA (COL-1) PAR activation in engineered primary human T cells and CEA DRG mask against aCEA. FIG. 13A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activationsignal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 13B shows quantification of percentage of BFP activation signal from FIG. 13A. FIG. 13C shows antigen binding of CEA DRG mask versus CEA control, with or without thrombin addition. DEA DRG mask shows reduced antigen binding compared to CEA control, and addition of thrombin increases its antigen binding.
[0024] FIGURES 14A-14C depict CEA-scFv-RAN3-Isolate.2 (Labetuzumab) PAR activation in engineered primary human T cells and CEA-scFv-RAN3. Isolate.1 mask against aCEA. FIG. 14A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 14B shows quantification of percentage of BFP activation signal from FIG. 14A. FIG. 14C shows antigen binding of CEA- scFv-R AN3. Isolate.1 mask against aCEA with or without thrombin addition. Addition of thrombin increases antigen binding.
[0025] FIGURES 15A-15B depict CLDN18.2 (163E12) PAR activation in engineered primary human T ceils. FIG. 15A shows a flow histogram of T ceils expressing PARs co- cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 15B shows quantification of percentage of BFP activation signal from FIG. ISA.
[0026] FIGURES 16A-16C depict CLDN18.2-scFv-RAN3.Isolate.2 (Zolbetuximab) PAR activation in engineered primary human T cells and CLDN18.2-scFv-RAN3.Isolate.2 mask against aCLDN18.2. FIG. 16A shows a flow histogram of T cells expressing PARs co- cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple- PAR T cells co-cultured with target antigen positive cancer cells). FIG. 16B shows quantification of percentage of BFP activation signal from FIG. 16A. FIG. 16C shows antigen binding of CLDN18.2-scFv-RAN3.Isolate.2 mask versus CLDN18.2 control, with or without thrombin addition. CLDN18.2-scFv-RAN3.Isolate.2 mask shows reduced antigen binding to CLDN18.2 control, and addition of thrombin increases its antigen binding.
[0027] FIGURES 17A-17B depict cMET (huAbF46) PAR activation in engineered primary human T cells. FIG. 17A shows a flow histogram of T cells expressing PARs co- cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 17B shows quantification of percentage of BFP activation signal from FIG. 17A.
[0028] FIGURE 18 depicts that sDTR PAR. l (KM35 / 966) is successfully expressed on the T cell surface. FIG. 18 shows surface expression of scFv binders on lentivirally transducedprimary human T cells. Flow histogram of FLAG tagged scFv binder cell surface expression using allophycocyanin-conjugated anti-FLAG monoclonal antibody is shown.
[0029] FIGURE 19 depicts that sDTR PAR.2 (KM35 / 966) is successfully expressed on the T cell surface. FIG. 19 shows surface expression of scFv binders on lentivirally transduced primary human T cells. Flow histogram of FLAG tagged scFv binder cell surface expression using allophycocyanin-conjugated anti-FLAG monoclonal antibody is shown.
[0030] FIGURE 20 depicts that sDTR PAR.31KM35 / 966) is successfully expressed on the T cell surface. FIG. 20 shows surface expression of scFv binders on lentivirally transduced primary human T cells. Flow histogram of FLAG tagged scFv binder cell surface expression using allophycocyanin-conjugated anti-FLAG monoclonal antibody is shown.
[0031] FIGURE 21 depicts that sDTR PAR.4 (KM35 / 966) is successfully expressed on the T cell surface. FIG. 21 shows surface expression of scFv binders on lentivirally transduced primary human T cells. Flow histogram of FLAG tagged scFv binder cell surface expression using allophycocyanin-conjugated anti-FLAG monoclonal antibody is shown.
[0032] FIGURES 22A-22B depict that DTRv3.Bl (KM35 / 966) PAR is successfully expressed on the T cell surface and DTRv3.Bl mask against asDTR. FIG. 22A shows surface expression of scFv binders on lentivirally transduced primary human T cells as evidenced by flow histogram of FLAG tagged scFv binder cell surface expression using allophycocyanin- conjugated anti-FLAG monoclonal antibody is shown. FIG. 22B show's antigen binding of DTRv3.Bl mask versus DTR control, with or without thrombin addition. DTRv3.B l mask shows reduced antigen binding to D I R control, and addition of thrombin increases its antigen binding.
[0033] FIGURES 23A-23B depict DTRv3.E2 (KM35 / 966) PAR successfully expressed on the T cell surface and DTRv3.E2 mask against asDTR. FIG. 23A shows surface expression of scFv binders on lentivirally transduced primary human T cells as evidenced by flow' histogram of FLAG tagged scFv binder cell surface expression using allophycocyanin- conjugated anti-FLAG monoclonal antibody is shown. FIG. 23B shows antigen binding of DTRv3.E2 mask versus DTR control, with or without thrombin addition. DTRv3.E2 mask shows reduced antigen binding to DIR control, and addition of thrombin increases its antigen binding.
[0034] FIGURES 24A-24B depicts that DTRV3-mAb-RAN2. Isolate.1 (KM35 / 966) PAR is successfully expressed on the T cell surface and DTRV3-mAb-RAN2.Isolate.l mask against asDTR. FIG. 24A shows surface expression of scFv binders on lentivirally transduced primary human T cells as evidenced by flow histogram of FLAG tagged scFv binder cell surfaceexpression using allophycocyanin-conjugated anti-FLAG monoclonal antibody is shown. FIG. 24B shows antigen binding of DTRV3-mAb-RAN2. Isolate.1 mask versus DTR control with or without antigen competition.
[0035] FIGURES 25A-25B depict FAP (NI-206.82C2) PAR activation in engineered primary human T cells. FIG. 25A shows a flow histogram of T cells expressing PARs cocultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 25B shows quantification of percentage of BFP activation signal from FIG. 25A.
[0036] FIGURES 26A-26C depict GD2-scFv-RAN2.Isolate.l (Naxitamab) PAR activation in engineered primary human T cells and GD2-scFv-RAN2.Isolate.l mask against aGD2. FIG. 26A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey - PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 26B shows quantification of percentage of BFP activation signal from FIG. 26A. FIG. 26C shows scFv binding to GD2- scFv-RAN2.Isolate.l mask and GD2-scFv-RAN2. Isolate.9 mask, with or without the addition of a competitive antigen. GD2-scFv-RAN2.Isolate. l mask and GD2-scFv-RAN2.Isolate.9 are bound well by the aGD2 scFv, and addition of GD2 antigen blocks scFv binding.
[0037] FIGURES 27A-27C depict GD2-scFv-pWTP.Isolate.4 (Naxitamab) PAR activation in engineered primary human T cells and GD2-scFv-pWTP.Isolate.4 mask against aGD2. FIG. 27A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 27B shows quantification of percentage of BFP activation signal from FIG. 27A. FIG. 27C shows scFv binding to GD2- scFv-pWTP.Isolate.2, GD2-scFv-pWTP.Isolate.3, GD2-scFv-pWTP.Isolate.4, and GD2-scFv- pWTP. Isolate.13 mask with or without the addition of a competitive antigen. All GD2 masks are bound well by the the aGD2 scFv, and addition of GD2 antigen blocks scFv binding.
[0038] FIGURES 28A-28C depict GPC3-mAb-pWTP3.Isolate. l l (GC33) PAR activation in engineered primary human T cells and GPC3-mAb-pWTP3.Isolate.l l mask against aGPC3. FIG. 28A shows a flow histogram of I' cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 28B shows quantification of percentage of BFP activation signal from FIG. 28A. FIG. 28C shows antigen binding of GPC3-mAb-pWTP3.Isolate.3, GPC3-mAb-pWTP3. Isolate.?, and GPC3-mAb- pWTP3. Isolate.11 mask versus GPC3 control, with or without thrombin addition. All GPC3masks show reduced antigen binding to GPC3 control, and addition of thrombin increases its antigen binding.
[0039] FIGURES 29A-29C depict GPC3-mAb-pWTP2.Isolate. 1 (GC33) PAR activation in engineered primary human T cells and GPC3-mAb-p WTP2. Isolate.1 mask against <xGPC3. FIG. 29A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 29B shows quantification of percentage of BFP activation signal from FIG. 29A. FIG. 28C shows antibody binding to GPC3-mAb-pWTP2.Isolate.l, GPC3-mAb-pWTP2.Isolate.4, and GPC3-mAb- pWTP2. Isolate.15 mask with or without competitive antigen. GPC3-mAb-p WTP2. Isolate. 1 mask is bound well by the aGPC3, and addition of GPC3 antigen blocks scFv binding.
[0040] FIGURES 30A-30B depict MSLN (15B6) PAR activation in engineered primary human T cells. FIG. 30A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer ceils). FIG. 30B shows quantification of percentage of BFP activation signal from FIG. 30A.
[0041] FIGURES 31A-31B depict MUC16ecto (4H11) PAR activation in engineered primary human T ceils. FIG. 31A shows a flow histogram of T ceils expressing PARs co- cultured with cancer cells for 24 hours to look for BFP activation signal (grey - PAR T ceils only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 31B shows quantification of percentage of BFP activation signal from FIG. 31A.
[0042] FIGURES 32A-32C depict PSCA (1A11) PAR activation in engineered primary human T cells and PSCA.VDD mask against aPSCA. FIG. 32A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 32B shows quantification of percentage of BFP activation signal from FIG. 32A. FIG. 32C shows antigen binding of PSCA.VDD mask versus PSCA control, with or without thrombin addition. PSCA.VDD mask shows reduced antigen binding to PSCA control, and addition of thrombin increases its antigen binding.
[0043] FIGURES 33A-33C depict PSMA.28 (J591 ) PAR activation in engineered primary human T cells and PSMA.28 mask against aPSMA. FIG. 33A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 33B shows quantification of percentage of BFP activation signal from FIG.33A. FIG. 33C shows antigen binding of PSMA.28 mask versus PSMA control, with or without thrombin addition. PSMA.28 mask shows reduced antigen binding to PSMA control, and addition of thrombin increases it antigen binding.
[0044] FIGURES 34A-34C depict PSMA. Al (J591) PAR activation in engineered primary human T cells and PSMA. Al mask against aPSMA. FIG. 34A shows a flow histogram of T cells expressing PARs co-cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 34B shows quantification of percentage of BFP activation signal from FIG. 34A. FIG. 34C shows antigen binding of PSMA. Al versus PSMA control, with or without thrombin addition. PSMA.A1 shows reduced antigen binding to PSMA control, and addition of thrombin increases its antigen binding.
[0045] FIGURES 35A-35B depict EpCAM (EpAb2-6) HL PAR activation in engineered primary human T cells. FIG. 35A shows a flow histogram of T cells expressing PARs co- cultured with cancer cells for 24 hours to look for BFP activation signal (grey = PAR T cells only; purple= PAR T cells co-cultured with target antigen positive cancer cells). FIG. 35B shows quantification of percentage of BFP activation signal from FIG . 35A.
[0046] FIGURES 36A-36I depict that tlirombin-activable HER2 PAR T cells detect extracellular thrombin activity. FIG. 36A is a schematic of PAR including a masked scFv integrated with synNotch receptor design where the receptor is blocked from antigen binding by a peptide mimotope connected via a substrate linker. FIG. 36B shows, after linker proteolysis, scFv engagement triggers release of the transcription factor Gal4-VP64 to drive BFP reporter expression by the UAS promoter. Substrate linker sequence LVPRGSG (SEQ ID NO: 110) is cleavable by thrombin (Thrb). FIG. 36C shows a flow histogram of BFP expression by primary human T cells engineered with PAR, displaying either a substrate linker cleavable by thrombin (Thrb; LVPRGSG (SEQ ID NO: 110)) or a control linker (GSGGSG (SEQ ID NO: 113)), after co-incubation with both Thrb and HER2-positive MDA-MB-468 breast cancer cells at a 1:1 cell ratio. FIG. 36D shows a representative flow histogram and frequency bar plot of Thrb-activatable PAR T cells stained with recombinant HER2 after coincubation with Thrb, or Thrb and its inhibitor (inh.) bivalirudin for 30 min at 37°C. FIG. 36E shows a representative flow histogram and frequency bar plot of BFP expression by PAR T cells co-incubated with HER2+ MDA-MB-468 cells at a 1:1 cell with and without incubation with Thrb or bivalirudin for 24 h at 37°C. FIG. 36F shows cell surface proteolysis kinetics tracking the loss of myc tag after the addition of Thrb (5 nM). Data points were fitted to a one- phase exponential decay model. FIG. 36G shows cell surface kinetics tracking the restorationof myc tag after complete linker cleavage with Thrb (200 nM) for 30 min followed by the removal of Thrb. Data points were fitted to a one-phase association model. FIG. 36H shows BFP reporter expression kinetics of thrombin-activatable IIER2 PAR T cells co-incubated with HER2+ MDA-MB-468 cells after addition of Thrb (200 nM). Data points were fitted to a one- phase association model. FIG. 361 BFP reporter decay kinetics following removal of Thrb and HER2+ tumor cells. Data points were fitted to a one-phase exponential decay. One-way ANOVA and mean ± SD is depicted, n = 3 biologically independent wells, ****P<0.0001.
[0047] FIGURES 37A-37I depict characterization of PAR sensitivity and activation kinetics. FIG. 37A shows a schematic of gene circuits for (i) masked Protease- Activatable Receptor (PAR) and (ii) PAR-activated blue fluorescent protein (BFP) reporter. FIGS. 37B- 37C show dose response of BFP reporter activation of HER2 PAR T cells engineered with Thrb-activatable linker (LVPRGSG (SEQ ID NO: 110)) upon addition of Thrb (200 nM) with varying levels of IIER2 expressed by MDA-MB-468 cancer cells (FIG. 37B) and the concentration of Thrb in co-culture (FIG. 37C). FIG. 37D shows a schematic of myc tag staining to monitor substrate cleavage. FIG. 37E shows flow plots of primary human T cells engineered with Thrb-activatable PAR show a decrease myc tag staining upon proteolysis for 30 min at 37°C. FIG. 37F is a histogram showing proteolysis kinetics measured by loss of staining with arnyc tag antibody upon Thrb addition (5 nM). FIG. 37G shows, after complete cleavage is reached (200 nM Thrb for 30 min), removal of Thrb induces recovery of amyc tag staining indicating substrate turnover. FIG. 3711 is a histogram showing BFP reporter expression kinetics upon Thrb addition (200 nM). FIG> 371 shows, after 24 hours incubation, removal of Thrb and HER2+ tumor cells. Mean + SD is depicted, n = 3 biologically independent wells.
[0048] FIGURES 38A-38B depict that hEGFR PARs require a protease and a tumor antigen for cell activation. FIGS. 38A-38B show a flow histogram (FIG. 38A) and bar plots (FIG. 38B) of primary murine T cells engineered with thrombin-activatable (LVPRGSG (SEQ ID NO: 110)) or control (GSGGSG (SEQ ID NO: 113)) hEGFR PARs show that expression of the BFP reporter requires both thrombin (Thrb) and hEGFR-positive MC38 colon cancer cells (+ + condition).
[0049] FIGURES 39A-39C depict orthogonal activation of PAR T cells expressing protease-selective substrates. FIG. 39A shows primary human T cells were engineered to express an HER2 RAR with substrate linkers LVPRGSG (SEQ ID NO: 110), IEFDSG (SEQ ID NO: 111), or PLGLAG (SEQ ID NO: 1 12), which are selective for the proteases Thrb, GzmB, or MMP9, respectively. The substrate linker GSGGSG (SEQ ID NO: 113) was used asa negative control. Each PAR T cell was separately co-incubated with HER2-positive MDA- MB-468 cells with the target or non-target protease (50 nM) at 37°C for 24 hours. FIGS, 39B- 39B show a representative flow histogram (FIG. 39B) and bar plots (FIG. 39C) of BFP expression frequency show selective activation of PAR T cells after incubation with the target protease, but not with a non-target protease. One-way ANOVA, mean + SD is depicted, n = 3 biologically independent wells, ****P<0.0001.
[0050] FIGURES 40A-40I depict that masked PAR T cells detect tumors while minimizing background from off-tumor antigen-expressing tissues. FIG. 40A shows dose response of reporter activation of hEGFR synNotch and hEGFR PAR T cells engineered with control linker (SGGS (SEQ ID NO: 114)) upon co-incubation with varying levels of EGFR Fc plate bound. FIG. 40B shows a schematic of the B-hEGFR transgenic mouse model, in which the mouse EGFR extracellular domain was replaced with the human counterpart. hEGFR- expressing tissues engage hEGFR scFv, triggering Gal4-VP64 release and reporter expression from the UAS promoter in synNotch receptors. FIGS. 40C-40D show engineered primary mouse T cells expressing hEGFR synNotch and EGFR PAR T cells encoding a control linker (GSGGSG (SEQ ID NO: 1 13)) with mCherry reporter were injected into B-hEGFR. Organs were dissociated to isolate single cells 24 hours post i.v. injection. T cell activation (gated on CD45+CD3+GFP+) at each site was assessed by mCherry expression as shown in representative flow plots (FIG. 40C) and quantified frequency of mcherry reporter expression (FIG. 40D). ****P<0.0001, ***P<0.001, **P<0.01, Two-way ANOVA, n = 3 biological replicates, error bars depict mean + SD. FIG. 40E shows a schematic of hEGFR PAR T cells blocked from binding to its cognate antigen by a masking peptide mimotope. After linker proteolysis by MC38 tumor secreted proteases, scFv engagement to drive BFP reporter expression. FIG. 40F shows a representative flow' histogram and frequency bar plot of BFP reporter expression by PAR T cells encoding tumor cleavable linker including RPLGLAGK (SEQ ID NO: 324), PAALRA (SEQ ID NO: 325), and KPLGLWAR (SEQ ID NO: 326) coincubated with hEGFR expressing MC38 cancer cells at a 1:1 cell for 24 h at 37°C. FIGS. 40G-40H show that thirteen million hEGFR synNotch, PAR T cells encoding GSGGSG (SEQ ID NO: 113) control (FIG. 40G) or KPLGLWAR (SEQ ID NO: 326) substrates (FIG. 40H) were injected i.v. into hEGFR+ MC38 tumor-bearing mice (-100 mm3) and naive mice. Urine was collected for a three-hour window one day after injection and luminescence w'as quantified using a standard curve of recombinant NLuc. 'I -test and mean + SD is depicted, n - 6-12 biological replicates, ***P<0.001. FIG. 401 shows receiver operating characteristic (ROC)curves and area under the curve (AUG) values showing diagnostic performance of hEGFR PAR T cell sensors (AUC = 0.96, 95% CI = 0.87-1.00, P = 0.002).
[0051] FIGURES 41A-41D depict that off-tumor hEGFR expression in the B-hEGFR transgenic mouse model induced reporter activation of hEGFR synNotch. FIG. 41A shows a schematic of the B-hEGFR transgenic mouse model, in which the mouse EGFR extracellular domain was replaced with the human counterpart. hEGFR-expressing tissues engage cdiEGFR scFv, triggering Gal4-VP64 release and reporter expression from the UAS promoter in synNotch receptors. FIGS. 41B-41C show representative flow plots (FIG. 41B) and bar graphs (FIG. 41 C) of human EGFR expression in tissues including liver, lung, kidneys, heart and stomach in B-hEGFR and C57BL / 6 (B6) mice. ****P<0.()()01, ***P<0.001, Two-way ANOVA, n = 3 biological replicates, error bars depict mean ± SD. FIG. 41D shows engineered primary mouse T cells expressing hEGFR synNotch and a BFP reporter were injected into B- hEGFR and B6 mice. Twenty-four hours post injection, organs were dissociated to isolate single cells. Reporter-activated PAR T cells (CD45+CD3+mCherry+) at each site was assessed by BFP expression.
[0052] FIGURES 42A-42B depict that KPLGLWAR (SEQ ID NO: 326) substrates leverage tumor overexpression of MMPs for activation. FIG. 42A shows MMP protease expression in MC38 cancer cells. One million cancer cells were cultured at 37°C for 48 hours. The supernatant was collected and analyzed by ELISA. ****P<0.0001, Two-way ANOVA, n = 3 biological replicates, mean ± SD is depicted. FIG. 42B shows the fluorescence of samples containing either the KPLGLWAR (SEQ ID NO: 326) or GSGGSG (SEQ ID NO: 113) (control) fluorogenic peptides after incubation with recombinant proteases (50 nM) for 30 min at 37°C.
[0053] FIGURES 43A-43C depict hEGFR PAR T cells engineered to secrete NLuc enable tumor detection. FIG. 43A shows the half-life of 200 fmol recombinant NLuc in blood and accumulated NLuc urine clearance after i.v. injection. Data was fitted to a one-phase exponential decay or association model, n = 3 biological replicates, error bars depict mean ± SD. FIG. 43B shows a gene map of PAR-activated secretable NLuc reporter. FIG. 43C shows IVIS images and quantification of luminescence from primary mouse T cells coexpressing PAR-activated NLuc reporter and monoclonal PAR displaying KPLGLWAR (SEQ ID NO: 326) linker or GSGGS control after co-incubation with either 11EGFR+ or hEGFR- MC.38 cancer cells for 24 hours at 37°C. One-way ANOVA, **** PcO.0001, n - 6 biological replicates, error bars depict mean ± SD.
[0054] FIGURES 44A-44B depict urinary detection of hEGFR+ MC38 tumors using T cells engineered with hEGFR synNoich and hEGFR PAR encoding the GSGGSG (SEQ ID NO: 113) control substrate. Urine was collected over a three-hour window one day after injection, and luminescence was quantified using a standard curve of recombinant NLuc. FIG. 44A shows a standard curve of recombinant NLuc quantified with the 1VIS Spectrum CT system. FIG. 44B shows IVIS images of urine collected over a three-hour window one day after injection.
[0055] FIGURES 45A-45B depict orthogonal activation of a three -plex mixture of PAR T cells expressing protease-selective substrates. FIG. 45A shows PAR T cells expressing the LVPRGSG (SEQ ID NO: 110), IEFDSG (SEQ ID NO: 111), or PLGLAG (SEQ ID NO: 112) substrate linker were labeled with CellTraceIMFar Red, CFSE, or Blue dye, respectively. A three-plex mixture containing approximately equal frequency of each PAR T cell population was co-incubated with either Thrb, GzmB, or MMP9 and HER2-positive MDA-MB-468 cancer cells. FIG. 45B shows bar plots of the frequency distribution of T cells that were positive for CelUTace™ Far Red, CFSE, or Blue dye after gating into BFP-positive PAR T cells from the three-plex mixture, demonstrating orthogonal activation. One-way ANOVA, mean ± SD is depicted, n = 3 biologically independent wells, ***P<0.001, ****P<0.0001.
[0056] FIGURES 46A-46F depict that PAR T cell display identifies orthogonal substrates for recombinant human proteases in vitro. FIG. 46A shows a schematic of in vitro screening via PAR T cell display. T cells were engineered by lentiviral transduction to express a library of HER2 PARs that display all possible 4-aniino-acid substrate linkers, corresponding to a library diversity of 160,000. To map protease substrates, the PAR T cell library was coincubated with one of 25 proteases and HER2 -positive MDA-MB-468 breast cancer cells. Cells were then sorted for BFP expression, and their genomic DNA was analyzed by next-generation sequencing (NGS) to identify cleaved substrate sequences. FIG. 46B shows a representative dot plot showing the fold-change in amplicon frequency of substrate linkers after cleaving the PAR T cell library with thrombin. FIG. 46C shows a heat map of the log2 fold-change in amplicon frequency for 16,947 substrate linkers tested against 25 proteases, following downselection from the initial library of approximately 160,000 substrates through bootstrapping. FIG. 46D shows frequency of the dipeptide motif PR appearing in the downslected set of 16,947 substrates from the respective protease’s cluster. FIG. 46E shows the sequence logo generated from position-specific sequence matrix of substrates in thrombin cluster. FIG . 46F shows independent validation of hit sequences from in vitro screening using monoclonal PAR T cells. A hit sequence from each cluster was validated by co-incubation ofmonoclonal HER2 PAR T cells displaying the hit sequence with HER2 -positive MDA-MB- 468 cells and either the target protease or each of the 24 non-target proteases at 37°C for 24 hours. The heat map shows the average frequency of BFP-positive PAR T cells, n = 3 biologically independent wells.
[0057] FIGURES 47A-47B depict distribution of a PAR T cell library. T cells were engineered by lentiviral transduction to express a library of HER2 PARs that display 4-amino- acid substrate linkers, corresponding to a theoretical library diversity of 160,000. Histograms depict frequency distribution of substrates in a PAR plasmid DNA library (FIG. 47A) and a T cell-encoded PAR library (FIG. 47B).
[0058] FIGURES 48A-48C depict a bootstrapping algorithm to identify substrates with minimal sampling bias. FIG. 48A shows a heat map summarizing log2 of fold-change in amplicon frequency of all -160,000 substrates after PAR T cell display against 25 proteases. FIG. 48B shows a schematic of algorithm to bootstrap wells containing 2 million substrate linkers from the non-enriched library and filter out sequences predicted to have high sampling bias. FIG. 48C shows a heat map which demonstrates that bootstrapping algorithm includes substrates predicted to have lower variance across wells from random sampling and excludes substrates predicted to have higher variance.
[0059] FIGURES 49 depicts identification of orthogonal protease substrates by PAR T cell display. Heat map of fold-change in amplicon frequency of SGGS (SEQ ID NO: 114) control linker and 25 selected hit substrates against 25 proteases. Fold-change values were normalized for each substrate linker.
[0060] FIGURE 50 depicts independent validati on of hit sequences from in vitro screening using monoclonal PAR T cells. Hit sequences from each cluster were validated by coincubation of monoclonal HER2 PAR T cells encoding individual hit sequences with MDA- MB-468 HER2+ cells and each target protease at 37°C for 24 hours. The bar plot shows the average PART cell BEP reporter expression. *P<0.05, **P<0,01, ***P<0.001, ****P<0.0001, two-way ANOVA comparing with no protease samples, n = 3 biologically independent wells.
[0061] FIGURES 51A-51F depict deep profiling of the substrate repertoire of MDA-MB- 468 tumors by in vivo PAR T cell display. FIG. 51A shows a schematic of in vivo PAR T cell display for substrate discovery followed by validation of substrate selectivity in separate cohorts of animals. For discovery, an approximately 10-fold representation of a 4-mer library (ten million cells) of HER2 PAR T cells was intravenously (i.v.) injected in NSG mice bearing subcutaneous HER2+ MDA-MB-468 tumors. Twenty-four hours post injection, BFP-positive T cells were isolated from tumor, blood, and non-tumor organs (spleen, liver, lungs) andenriched substrates were identified by NGS. For validation, the top hits were cloned as monoclonal PARs into T cells with a reporter cassette modified to express firefly luciferase (Flue) to allow validation of tumor selectivity by bioluminescent imaging of tumors and major organs. FIGS. 51B-51C show representative flow plots (FIG. 51B) and quantified frequency (FIG. SIC) of BFP expression by PAR T cells in indicated tissues 24 hours after i.v. injection of PAR T cell library to naive NSG mice or mice bearing HER2 -positive or HER2-negative MDA-MB-468 tumors. One-way ANOVA and Tukey post-test and correction, mean + SD is depicted, n = 3, ***P < 0.001. FIG. 51D shows NGS data depicting the frequency of amplicons encoding each substrate linker enriched in the tumor compared to blood, spleen, liver, and lungs. The four highly enriched sequences selected for validation - YPFP (SEQ ID NO: 320), LPQY (SEQ ID NO: 321), YWDM (SEQ ID NO: 322), and WETH (SEQ ID NO: 323) -- are indicated in green. FIG. 51E shows bioluminescent images of MDA-MB-468 tumors and organs (liver, spleen, lungs, kidneys, brain, heart, and tumor) harvested from mice after the administration of PAR T cells displaying substrate YPFP (SEQ ID NO: 320), LPQY (SEQ ID NO: 321), YWDM (SEQ ID NO: 322), WETH (SEQ ID NO: 323), or SGGS (SEQ ID NO: 114) (control). The T cells were modified to include the firefly luciferase (Flue) gene to report on PAR activation. FIG. 51F shows biodistribution of luminescent signal for PAR T cells displaying each hit sequence or SGGS (SEQ ID NO: 114) control. One-way ANOVA and Tukey post-test and correction, * *** P < 0.0001, n = 4 biological replicates, error bars depict mean ± SD.
[0062] FIGURE 52 depicts a gating strategy to sort reporter-activated PAR T cells from tumor for in vivo PAR T cell display screening.
[0063] FIGURES 53A-53B depict validation of substrates identified by in vivo PAR T cell display. FIG. 53A shows a gene map of PAR-activated firefly luciferase (Flue) luminescent reporter and quantification of luminescence from primary human T cells co-expressing PAR- activated Flue reporter and monoclonal PAR displaying either a thrombin-cleavable linker (LVPRGSG (SEQ ID NO: 110)) or control linker (GSGGSG (SEQ ID NO: 113)) after coincubation with Thrb and HER2+ MDA-MB-468 cells for 24 hours at 37°C. (T-test, ****Pc0.0001, n = 3 biological replicates, error bars depict mean + SD). FIG. 53B shows T cells were transduced to co-express the Flue reporter cassette along with a monoclonal PAR encoding the indicated hit sequence (YPFP (SEQ ID NO: 320), LPQY (SEQ ID NO: 321), YWDM (SEQ ID NO: 322), or WETH (SEQ ID NO: 323)) identified from in vivo PAR T cell display screening, or SGGS (SEQ ID NO: 114) as a control linker. Twenty-four hours after injection to mice bearing HER2+ MDA-MB-468 tumors, tumor and organs were excised andsubmerged in luciferin as shown in representative bioluminescent images to determine biodistribution of activated PARs.
[0064] FIGURES 54A-54C depict MMP expression in MDA-MB-468 HER2+ cancer cells and xenograft tumors enabling LPQY (SEQ ID NO: 321) substrate cleavage. FIG. 54A shows one million cancer cells (1 mL) were cultured at 37°C for 24 hours. Tumors were isolated and dissociated in tissue protein extraction buffer containing protease inhibitor cocktail. The supernatant was collected and analyzed by ELISA. (T-test, **P < 0.01, ***P < 0.001, n = 3 biological replicates, error bars depict mean ± SD). FIG. 54B shows an illustration of fluorogenic peptide design using the LPQY (SEQ ID NO: 321) substrate sequence identified from in vivo PAR T cell display, with a fluorophore 5-FAM and quencher DABCYL pair. FIG. 54C shows bar graphs plotting the fluorescence of samples containing either the LPQY (SEQ ID NO: 321) or SGGS (SEQ ID NO: 114) (control) fluorogenic peptides after incubation with recombinant proteases (50 nM) for 30 min at 37°C.
[0065] FIGURE 55 depicts that activation of T cell sensors requires both tumor-selective proteases and antigens. Mice bearing MDA-MB-468 HER2+ tumor were i.t. injected with the broad-spectrum matrix metalloproteinase inhibitor marimastat one day before i.v. injection of PAR T cell sensors encoding the LPQY (SEQ ID NO: 321) substrate linker. Luminescence images (left) and quantification of excised tumors (right) were acquired 24 hours after T cell sensor injection. One-way ANOVA and Tukey post-test and correction, *P < 0.05, n --- 4 biological replicates, error bars depict mean ± SD.
[0066] FIGURES 56A-56F depict a bespoke imaging probe designed from PAR discovery detects MDA-MB-468 tumors. FIG. 56A shows a schematic of a PEGylated near-infrared (NIR) fluorescent imaging probe designed by flanking LPQY or control SGGS with a NIR fluorophore (suIfo-Cyanine7) and quencher (Tide Quencher 7WS) pair, followed by conjugation to 20k 8-arm PEG. FIG. 56B shows NIR fluorescence of sample after incubation of NIRE probe by a panel of recombinant MMPs at 37°C for 24 hours. ****P<0.0001, oneway ANOVA and Tukey post-test and correction, n = 3 biological replicates, mean ± SD is depicted. FIG. 56C shows a schematic of in vivo experimental design where the NIRE probe is administered either by i.v. or i.t. in NSG mice bearing MDA-MB-468 tumors. Probe cleavage by tumor-associated proteases abrogates fluorescent quenching, resulting in increased fluorescent signals detectable by imaging. FIG. 56D shows kinetics of tumor fluorescence determined by live animal fluorescence imaging after i.t. injection (3 nmol) of 8-arm PEG NIRE probes. *P<0.05, **P < 0.01, one-way ANOVA, n = 3 biological replicates, mean ± SD is depicted. FIGS. 56E-56F show images and quantification of tumor fluorescence determinedby fluorescence imaging of live animals (FIG. 56E) and excised tumors (FIG. 56F) 24 hours after i.v. injection (5 nmol) of the probes. T-tesi, *P < 0.05, **P < 0.01, n = 3 biological replicates, error bars depict mean ± SD.
[0067] FIGURES 57A-57G depict that OncoSCOUT detects small tumors via urinary synthetic biomarkers and outperform CA 15-3 and ctDNA in diagnostic benchmarking. FIG. 57A shows five million IIER2 PAR T cells encoding LPQY (SEQ ID NO: 321) or SGGS (SEQ ID NO: 114) control substrates were injected i.v. into HER2+ MDA-MB-468 tumor-bearing mice (~100 mm3) and naive mice. FIGS. 57B-57C show that urine was collected for a three- hour window one day after injection (FIG. 57B) and longitudinally for up to 7 days (FIG. 57C), and luminescence was quantified using a standard curve of recombinant NLuc. Two- way AN OVA, mean + SD is depicted. FIG. 57D shows serum CA 15-3 levels measured by ELISA in tumor-bearing mice at indicated tumor size intervals compared to naive controls. FIG. 57E shows frequency of mutant DNA amplicons in plasma from naive and MDA-MB- 468 tumor-bearing mice. Plasma was collected from the same cohort used for PAR T cell sensor evaluation. Targeted sequencing was performed using the OncoZoom panel. FIG. 57F shows OncoSCOUT expressing the LPQY (SEQ ID NO: 321) substrate secretes NLuc urinary reporters, enabling detection of sub-30 mm3tumors. Fifty million HER2 PAR T cells were intravenously injected into HER2+ MDA-MB-468 tumor-bearing and naive mice. Urine was collected for a three -hour window one day after T cell administration, and NLuc luminescence was quantified using the IVIS Spectrum CT system with a recombinant NLuc standard curve. ****P<0.0001, **P<0.01, *P<0.05, one-way ANOVA, n = 5-13 biological replicates, mean + SD is depicted. FIG. 57G shows ROC curves and AUC values showing diagnostic performance of CA 15-3, ctDNA and OncoSCOUT across a tumor size range of 10-800 mm3. DeLong test was used for the statistical evaluation of the AUC.
[0068] FIGURE 58 depicts CA 15-3 secretion by established human breast cancer lines. Secretion level of CA 15-3 in culture media of human breast cancer cell lines including MDA- MB-468, MDA-MB-231, T47D and MCF7 and 293T (control) measured by ELISA.
[0069] FIGURES 59A-59C depict benchmarking diagnostic performance of OncoSCOUT using blood biomarkers. FIG. 59A shows a dot plot of serum C A 15-3 biomarker levels in naive (dash line) and tumor-bearing mice (5-500 mm3), measured by ELISA. Dashed line indicates average value for naive mice. FIG. 59B shows a dot plot of number of mutant amplicons detected from plasma across the tumor size range (2-800 mm3) same cohort with PAR T cells. Target sequencing was performed using the OncoZoom panel. FIG. 59C shows a dot plot showing urinary NLuc signal across the tumor size range (2-800 mm3). Fifty millionHER2 PAR T cells encoding the LPQY (SEQ ID NO: 321) substrate were injected i.v. into HER2+ MDA-MB-468 tumor-bearing and naive mice. Urine was collected, and luminescence of NLuc reporters was analyzed using an IVIS Spectrum CT system and quantified with a standard curve of recombinant NLuc.
[0070] FIGURES 60A-60C depict ROC curves and AUC values for tumor detection. FIGS. 60A-60C show ROC curves and AUC values using CA 15-3 (FIG. 60A), ctDNA (FIG. 60B), and OncoSCOUT expressing the LPQY (SEQ ID NO: 321) substrate (FIG. 60C), n = 5- 13 biological replicates.
[0071] FIGURE 61 depicts antigen binding of BCMA.PA1 mask with or without BCMA antigen addition. BCMA.PA1 mask shows reduced antigen binding with antigen addition (wZ mAb + wZ Ag).
[0072] FIGURE 62 depicts antigen binding of B7H3-scFv-pWTP.Isolate.16 mask after incubation with antibody or antibody that had been pre-incubated with its target antigen.
[0073] FIGURE 63 depicts scFv binding to displayed CAIX ISO3 mask with or without CAIX antigen addition. CAIX. isol shows reduced scFv binding with antigen addition (w / scFv + wZ Ag).
[0074] FIGURE 64 depicts antigen binding of CEA.B5 mask versus CEA control, with or without thrombin addition. CEA.B5 mask shows reduced antigen binding to CEA control, and addition of thrombin increases its antigen binding.
[0075] FIGURE 65 depicts antigen binding of CEA.Al mask versus CEA control, with or without thrombin addition. CEA.Al mask shows reduced antigen binding to CEA control, and addition of thrombin increases its antigen binding.
[0076] FIGURE 66 depicts antigen binding of CEA.C3 mask versus CEA control, with or without thrombin addition. CEA.C3 mask shows reduced antigen binding to CEA control, and addition of thrombin increases its antigen binding.
[0077] FIGURE 67 depicts antigen binding of CEA.B2 mask versus CEA control, with or without thrombin addition. CEA.B2 mask shows reduced antigen binding to CEA control, and addition of thrombin increases its antigen binding.
[0078] FIGURE 68 depicts antigen binding of CLDN18.2.11 mask versus CLDN18.2 control, with or without thrombin addition. CLDN18.2.11 mask shows reduced antigen binding to CLDN18.2 control, and addition of thrombin increases its antigen binding.
[0079] FIGURE 69 depicts antigen binding of CLDN18.2.12 mask versus CLDN18.2 control, with or without thrombin addition. CLDN18.2.12 mask shows reduced antigen binding to CLDN18.2 control, and addition of thrombin increases its antigen binding.
[0080] FIGURE 70 depicts antigen binding of CLDN 18.2.44 mask versus CLDN18.2 control, with or without thrombin addition. CLDN18.2.44 mask shows reduced antigen binding to CLDN18.2 control, and addition of thrombin increases its antigen binding.
[0081] FIGURE 71 depicts antigen binding of CLDN18.2 1-15 mask versus CLDN18.2 control, with or without thrombin addition. CLDN18.2 1-15 mask shows reduced antigen binding to CLDN18.2 control, and addition of thrombin increases its antigen binding.
[0082] FIGURE 72 depicts antigen binding of CLDN18.2 1-8 mask versus CLDN18.2 control, with or without thrombin addition. CLDN18.2 1-8 mask shows reduced antigen binding to CLDN18.2 control, and addition of thrombin increases its antigen binding.
[0083] FIGURE 73 depicts scFv binding to displayed cMET-2C mask, with or without the addition of a competitive antigen. cMET-2C mask is bound well by the acMET scFv, and addition of cMET antigen blocks scFv binding.
[0084] FIGURE 74 depicts antigen binding of DTRv3. ALF6 mask versus DTRv3 control, with or without thrombin addition. DTRv3.ALF6 mask shows reduced antigen binding to DTRv3 control, and addition of thrombin increases its antigen binding.
[0085] FIGURE 75 depicts antigen binding of DTRv3.ALG 1 mask versus DTRv3 control, with or without thrombin addition. DTR.ALG1 mask shows reduced antigen binding to DTRv3 control, and addition of thrombin increases its antigen binding.
[0086] FIGURE 76 depicts antigen binding of DTRv3.ALH5 mask versus DTR v3 control, with or without thrombin addition. DTRv3.ALH5 mask shows reduced antigen binding to DTRv3 control, and addition of thrombin increases its antigen binding.
[0087] FIGURE 77 depicts antibody binding comparison of DTRv3 peptide candidates (DTRV3-mAb-RAN2. Isolate.! mask, DTRV3-mAb-RAN3. Isolate.6 mask, and DTRV3- mAb-RAN3. Isolate.1 mask).
[0088] FIGURE 78 depicts antigen binding of DTRV3-mAb-pWTP.Isolate.2 mask.
[0089] FIGURE 79 depicts scFv binding to displayed FAP-2B mask, with or without the addition of a competitive antigen. FAP-2B mask is bound well by the aFAP scFv, and addition of FAP antigen blocks scFv binding.
[0090] FIGURE 80 depicts scFv binding of FAP-3J mask, with or without the addition of a competitive antigen. FAP-3J mask binds well to the aFAP scFv, and addition of antigen blocks its scFv binding.
[0091] FIGURE 81 depicts antigen binding of GD2-scFv-RAN3-Isolate.l mask, GD2- scFv-RAN3-Isolate.7 mask, and GD2-scFv-RAN3-Isolate.15 mask.
[0092] FIGURE 82 depicts antigen binding of GD2JEDP mask versus GD2 control, with or without thrombin addition. GD2_EDP mask shows reduced antigen binding compared to GD2 control, and addition of thrombin increases its antigen binding.
[0093] FIGURE 83 depicts mAb binding to displayed GPC3-iso6 mimotope (GPC3-mAb- pWTPl.Isolate.6 mask and GPC3-mAb-pWTPl. Isolate.13 mask), with or without the addition of a competitive antigen. GPC3-iso6 displayed peptides are bound well by the aGPC3 mAb, and addition of GPC3 antigen blocks scFv binding.
[0094] FIGURE 84 depicts antigen binding of GPC3.B1 mask versus GPC3 control, with or without thrombin addition. GPC3.B 1 mask show's reduced antigen binding to GPC3 control, and addition of thrombin increases its antigen binding.
[0095] FIGURE 85 depicts antigen binding of GPC3.C6 mask versus GPC3 control, with or without thrombin addition. GPC3.C6 mask shows reduced antigen binding to GPC3 control, and addition of thrombin increases its antigen binding.
[0096] FIGURE 86 depicts antigen binding of GPC3.G4 mask versus GPC3 control, with or without thrombin addition. GPC3.G4 mask shows reduced antigen binding to GPC3 control, and addition of thrombin increases its antigen binding.
[0097] FIGURE 87 depicts antigen binding of GPC3.B4 mask versus GPC3 control, with or without thrombin addition. GPC3.B4 mask shows reduced antigen binding to GPC3 control, and addition of thrombin increases its antigen binding.
[0098] FIGURE 88 depicts antigen binding of GPC3.B5 mask versus GPC3 control, with or without thrombin addition. GPC3.B5 mask shows reduced antigen binding to GPC3 control, and addition of thrombin increases its antigen binding.
[0099] FIGURE 89 depicts antigen binding of GPC3 1-1 mask versus GPC3 control, with or without thrombin addition. GPC3 1-1 mask shows reduced antigen binding to GPC3 control, and addition of thrombin increases its antigen binding.
[0100] FIGURE 90 depicts antigen binding of MSLN.A1 mask versus MSLN control, with or without thrombin addition. MSLN. Al mask shows reduced antigen binding to MLSN control, and addition of thrombin increases its antigen binding.
[0101] FIGURE 91 depicts antigen binding of MSLN .E4 mask versus MSLN control , with or without thrombin addition. MSLN.E4 mask shows reduced antigen binding to MSLN control, and addition of thrombin increases its antigen binding.
[0102] FIGURE 92 depicts antigen binding of MSLN.G3 mask versus MSLN control, with or without thrombin addition. MSLN.G3 mask shows reduced antigen binding to MSLN control, and addition of thrombin increases its antigen binding.
[0103] FIGURE 93 depicts scFv binding of MUC16ecto pWTP-Sl-isol mask, with or without the addition of a competitive antigen. MUC16ecto pWTP-Sl-isol mask is bound well by the aMUC16ecto scFv, and addition of MUC16ecto antigen blocks its scFv binding.
[0104] FIGURE 94 depicts scFv binding of MUC16ecto pWTP-Sl-iso5 mask, with or without the addition of a competitive antigen. MUC 16ecto pWTP-S l-iso5 mask is bound well by the aMUC16ecto scFv, and addition of MUC16ecto antigen blocks its scFv binding.
[0105] FIGURE 95 depicts scFv binding to displayed MUC16ecto RAN2-Sl-iso2 mask, with or without the addition of a competitive antigen. MUC16ecto RAN2-Sl-iso2 mask is bound well by aMUC16ecto scFv, and addition of MUC16ecto antigen blocks its scFv binding.
[0106] FIGURE 96 depicts scFv binding to displayed MUC16ecto RAN2-Sl-iso3 mask, with or without the addition of a competitive antigen. MUC16ecto RAN2-Sl-iso3 mask is bound well by aMUC 16ecto scFv, and addition of MUC 16ecto antigen blocks its scFv binding.
[0107] FIGURE 97 depicts scFv binding to displayed MUC16ecto RAN2-Sl-iso4 mask, with or without the addition of a competitive antigen. MUC16ecto RAN2-Sl-iso4 mask is bound well by aMUC16ecto scFv, and addition of MUC16ecto antigen blocks its scFv binding.
[0108] FIGURE 98 depicts scFv binding to displayed MUC16ecto RAN2-Sl-iso5 mask, with or without the addition of a competitive antigen. MUC16ecto RAN2-Sl-iso5 mask is bound well by aMUC16ecto scFv, and addition of MUC16ecto antigen blocks its scFv binding.
[0109] FIGURE 99 depicts scFv binding to displayed MUC16ecto RAN2-Sl-isolO mask, with or without the addition of a competitive antigen. MUC16ecto RAN2-Sl-isolO mask is bound well by aMUC16ecto scFv, and addition of MUC16ecto antigen blocks its scFv binding.
[0110] FIGURE 100 depicts scFv binding to displayed MUC 16ecto RAN2-S1-isol2 mask, with or without the addition of a competitive antigen. MUC16ecto RAN2-Sl-isol2 mask is bound well by aMUC16ecto scFv, and addition of MUC16ecto antigen blocks its scFv binding.
[0111] FIGURE 101 depicts scFv binding to displayed MUC 16ecto RAN3-S 1 -iso2 mask, with or without the addition of a competitive antigen. MUC16ecto RAN3-Sl-iso2 mask is bound well by aMUC16ecto scFv, and addition of MUC16ecto antigen blocks its scFv binding.
[0112] FIGURE 102 depicts scFv binding to displayed MUC16ecto RAN3-Sl-iso6 mask, with or without the addition of a competitive antigen. MUC16ecto RAN3-Sl-iso6 mask is bound well by aMUC 16ecto scFv, and addition of MUC 16ecto antigen blocks its scFv binding.
[0113] FIGURE 103 depicts scFv binding to displayed MUC 16ecto RAN3-Sl-isol0 mask, with or without the addition of a competitive antigen. MUC16ecto RAN3-Sl-isol0 maskis bound well by aMUC16ecto scFv, and addition of MUC16ecto antigen blocks its scFv binding.
[0114] FIGURE 104 depicts antigen binding of PSCA.T40 mask versus PSCA control, with or without thrombin addition. PSCA.T40 mask shows reduced antigen binding to PSCA control, and addition of thrombin increases its antigen binding.
[0115] FIGURE 105 depicts antigen binding of PSCA.T44 mask versus PSCA control, with or without thrombin addition. PSCA.T44 mask shows reduced antigen binding to PSCA control, and addition of thrombin increases its antigen binding.
[0116] FIGURE 106 depicts antigen binding of PSCA 2-8 mask versus PSCA control, with or without thrombin addition. PSCA 2-8 mask shows reduced antigen binding to PSCA control, and addition of thrombin increases its antigen binding.
[0117] FIGURE 107 depicts antigen binding of PSMA.66 mask versus PSMA control, with or without thrombin addition. PSMA.66 mask shows reduced antigen binding to PSM A control, and addition of thrombin increases its antigen binding.
[0118] FIGURE 108 depicts antigen binding of PSMA.ALA1 mask versus PSMA control, with or without thrombin addition. PSMA. ALAI mask shows reduced antigen binding to PSMA control, and addition of thrombin increases its antigen binding.
[0119] FIGURE 109 depicts antigen binding of PSMA.ALA2 mask versus PSMA control, with or without thrombin addition. PSMA.ALA2 mask shows reduced antigen binding to PSMA control, and addition of thrombin increases its antigen binding.
[0120] FIGURE 110 depicts antigen binding of PSMA.ALA3 mask versus PSMA control, with or without thrombin addition. PSMA.ALA3 mask shows reduced antigen binding to PSMA control, and addition of thrombin increases its antigen binding.
[0121] FIGURE 111 depicts antigen binding of PSMA.ALB4 mask versus PSMA control, with or without thrombin addition. PSMA.ALB4 mask shows reduced antigen binding to PSMA control, and addition of thrombin increases its antigen binding.
[0122] FIGURE 112 depicts antigen binding of PSMA.ALD5 mask versus PSMA control, with or without thrombin addition. PSMA.ALD5 mask shows reduced antigen binding to PSMA control, and addition of thrombin increases its antigen binding.
[0123] FIGURE 113 depicts scFv binding to displayed ROR1-1L mask, with or without the addition of a competitive antigen. ROR1-1L mask displayed peptide is bound well by the aRORl scFv, and addition of ROR1 antigen blocks scFv binding.
[0124] FIGURE 114 depicts scFv binding of R0R1-3G mask, with or without the addition of a competitive antigen. ROR1-3G mask binds well to the aRORl scFv, and addition of antigen blocks its scFv binding.
[0125] FIGURE 115 depicts antigen binding of TnMUCl -iso4 mask versus TnMUCl control, with or without thrombin addition. TnMUCl -iso4 mask shows reduced antigen binding to TnMUCl control, and addition of thrombin increases its antigen binding.DETAILED DESCRIPTION
[0126] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate aspects, can also be provided in combination with a single aspect. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single aspect, can also be provided separately or in any suitable subcombination. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Methods and materials similar' or equivalent to those described herein can be used in the practice or testing of the present disclosure.
[0127] In this specification and in the claims that follow, reference will be made to a number of terms, which shall be defined to have the following meanings:
[0128] As used herein, “comprising” is to be interpreted as specifying the presence of the stated features, integers, s teps, or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps, or components, or groups thereof. Moreover, each of the terms “by”, “comprising,” “comprises”, “comprised of,” “including,” “includes,” “included,” “involving,” “involves,” “involved,” and “such as” are used in their open, non-limiting sense and may be used interchangeably. Further, the term “comprising” is intended to include examples and aspects encompassed by the terms “consisting essentially of” and “consisting of.” Similarly, the term “consisting essentially of” is intended to include examples encompassed by the term “consisting of.
[0129] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a compound”, “a composition”, or “a cancer”, includes, but is not limited to, two or more such compounds, compositions, or cancers, and the like.
[0130] It should be noted that ratios, concentrations, amounts, and other numerical data can be expressed herein in a range format. It can be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of theother endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it can be understood that the particular value forms a further aspect. For example, if the value “about 10” is disclosed, then “10” is also disclosed.
[0131] When a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. For example, where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure, e.g. the phrase “x to y” includes the range from ‘x’ to *y’ as well as the range greater than ‘x’ and less than ‘y’ . The range can also be expressed as an upper limit, e.g. ‘about x, y, z, or less’ and should be interpreted to include the specific ranges of ‘about x’, ‘about y’, and ‘about z’ as well as the ranges of Tess than x’, less than y’, and ‘less than z’. Likewise, the phrase ‘about x, y, z, or greater’ should be interpreted to include the specific ranges of ‘about x’, ‘about y’, and ‘about z’ as well as the ranges of ‘greater than x’, greater than y’, and ‘greater than z’. In addition, the phrase “about ‘x’ to ‘y’”, where ‘x’ and ‘y’ are numerical values, includes “about ‘x’ to about ‘y’”.
[0132] It is to be understood that such a range format is used for convenience and brevity, and thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. To illustrate, a numerical range of “about 0.1 % to 5%” should be interpreted to include not only the explicitly recited values of about 0.1% to about 5%, but also include individual values (e.g., about 1%, about 2%, about 3%, and about 4%) and the subranges (e.g., about 0.5% to about 1.1%; about 5% to about 2.4%; about 0.5% to about 3.2%, and about 0.5%’ to about 4.4%, and other possible sub-ranges) within the indicated range.
[0133] As used herein, the terms “about,” “approximate,” “at or about,” and “substantially” mean that the amount or value in question can be the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art such that equivalent results or effects are obtained. In somecircumstances, the value that provides equivalent results or effects cannot be reasonably determined. In such cases, it is generally understood, as used herein, that “about” and “at or about” mean the nominal value indicated ±10% variation unless otherwise indicated or inferred. In general, an amount, size, formulation, parameter or other quantity or characteristic is “about,” “approximate,” or “at or about” whether or not expressly stated to be such. It is understood that where “about,” “approximate,” or “at or about” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.
[0134] As used herein, the term “effective amount” refers to an amount that is sufficient to achieve the desired modification of a physical property of the composition or material. For example, an “effective amount” of a monomer refers to an amount that is sufficient to achieve the desired improvement in the properly modulated by the formulation component, e.g. desired antioxidant release rate or viscoelasticity. The specific level in terms of wt% in a composition required as an effective amount will depend upon a variety of factors including the amount and type of monomer, amount and type of polymer, e.g., acrylamide, amount of antioxidant, and desired release kinetics.
[0135] As used herein, the term “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms but is generally insufficient to cause adverse side effects. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drags used in combination or coincidental with the specific compound employed and like factors within the knowledge and expertise of the health practitioner and which may be well known in the medical arts. In the case of treating a particular disease or condition, in some instances, the desired response can be inhibiting the progression of the disease or condition. This may involve only slowing the progression of the disease temporarily. However, in other instances, it may be desirable to halt the progression of the disease permanently. This can be monitored by routine diagnostic methods known to one of ordinary skill in the art for any particular disease. The desired response to treatment of the disease or condition also can be delaying the onset or even preventing the onset of the disease or condition.
[0136] For example, it is well within the skill of the art to start doses of a compound at levels lower than those required to achieve the desired therapeutic effect and to graduallyincrease the dosage until the desired effect is achieved. If desired, the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, single dose compositions can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. It is generally preferred that a maximum dose of the pharmacological agents of the invention (alone or in combination with other therapeutic agents) be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.
[0137] A response to a therapeutically effective dose of a disclosed drug delivery composition can be measured by determining the physiological effects of the treatment or medication, such as the decrease or lack of disease symptoms following administration of the treatment or pharmacological agent. Other assays will be known to one of ordinary skill in the ait and can be employed for measuring the level of the response. The amount of a treatment may be varied for example by increasing or decreasing the amount of a disclosed compound and / or pharmaceutical composition, by changing the disclosed compound and / or pharmaceutical composition administered, by changing the route of administration, by changing the dosage timing and so on. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products.
[0138] As used herein, the term “prophylactically effective amount” refers to an amount effective for preventing onset or initiation of a disease or condition.
[0139] As used herein, the term “prevent” or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed.
[0140] As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
[0141] As used interchangeably herein, “subject,” “individual,” or “patient” can refer to a vertebrate organism, such as a mammal (e.g. human). "Subject" can also refer to a cell, a population of cells, a tissue, an organ, or an organism, preferably to human and constituents thereof.
[0142] As used herein, the terms "treating" and "treatment" can refer generally to obtaining a desired pharmacological and / or physiological effect. The effect can be, but does not necessarily have to be, prophylactic in terms of preventing or partially preventing a disease, symptom or condition thereof. The effect can be therapeutic in terms of a partial or complete cure of a disease, condition, symptom or adverse effect attributed to the disease, disorder, or condition. The term "treatment" as used herein can include any treatment of a disease disorder in a subject, particularly a human and can include any one or more of the following: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., mitigating or ameliorating the disease and / or its symptoms or conditions. The term "treatment" as used herein can refer to both therapeutic treatment alone, prophylactic treatment alone, or both therapeutic and prophylactic treatment. Those in need of treatment (subjects in need thereof) can include those already with the disorder and / or those in which the disorder is to be prevented. As used herein, the term "treating", can include inhibiting the disease, disorder or condition, e.g., impeding its progress; and relieving the disease, disorder, or condition, e.g., causing regression of the disease, disorder and / or condition. Treating the disease, disorder, or condition can include ameliorating at least one symptom of the particular disease, disorder, or condition, even if the underlying pathophysiology is not affected, e.g., such as treating the pain of a subject by administration of an analgesic agent even though such agent does not treat the cause of the pain.
[0143] As used herein, “dose,” “unit dose,” or “dosage” can refer to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of a disclosed compound and / or a pharmaceutical composition thereof calculated to produce the desired response or responses in association with its administration.
[0144] As used herein, “therapeutic” can refer to treating, healing, and / or ameliorating a disease, disorder, condition, or side effect, or to decreasing in the rate of advancement of a disease, disorder, condition, or side effect.
[0145] The terms “nucleic acid” and “nucleic acid sequence” refer to a nucleotide, oligonucleotide, polynucleotide (which terms may be used interchangeably), or any fragment thereof. These phrases also refer to DNA or RNA of genomic or synthetic origin (which may be single-stranded or double-stranded and may represent the sense or the antisense strand).
[0146] Reference also is made herein to peptides, polypeptides, proteins and compositions comprising peptides, polypeptides, and proteins. As used herein, a polypeptide and / or proteinis defined as a polymer of amino acids, typically of length ^ 100 amino acids (Garrett & Grisham, Biochemistry, 2nd edition, 1999, Brooks / Cole, 110). A peptide is defined as a short polymer of amino acids, of a length typically of 2.0 or less amino acids, and more typically of a length of 12 or less amino acids (Garrett & Grisham, Biochemistry, 2nd edition, 1999, Brooks / Cole, 110).
[0147] A “functional fragment” as referred to herein comprises a portion of a polypeptide which retains its functional ability.
[0148] As disclosed herein, exemplary peptides, polypeptides, proteins may comprise, consist essentially of, or consist of any reference amino acid sequence disclosed herein, or variants of the peptides, polypeptides, and proteins may comprise, consist essentially of, or consist of an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to any amino acid sequence disclosed herein. Variant peptides, polypeptides, and proteins may include peptides, polypeptides, and proteins having one or more amino acid substitutions, deletions, additions and / or amino acid insertions relative to a reference peptide, polypeptide, or protein. Also disclosed are nucleic acid molecules that encode the disclosed peptides, polypeptides, and proteins (e.g., polynucleotides that encode any of the peptides, polypeptides, and proteins disclosed herein and variants thereof).
[0149] The term “amino acid,” includes but is not limited to amino acids contained in the group consisting of alanine (Ala or A), cysteine (Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), phenylalanine (Phe or F), glycine (Gly or G), histidine (His or H), isoleucine (lie or I), lysine (Lys or K), leucine (Leu or L), methionine (Met or M), asparagine (Asn or N), proline (Pro or P), glutamine (Gin or Q), arginine (Arg or R), serine (Ser or S), threonine (Thr or T), valine (Vai or V), tryptophan (Trp or W), and tyrosine (Tyr or Y) residues. The term “amino acid residue” also may include amino acid residues contained in the group consisting of homocysteine, 2-Aminoadipic acid, N-Ethylasparagine, 3-Aminoadipic acid, Hydroxylysine, P-alanine, P- Amino-propionic acid, allo-Hydroxylysine acid, 2-Aminobutyric acid, 3-Hydroxyproline, 4- Aminobutyric acid, 4-Hydroxyproline, piperidinic acid, 6- Aminocaproic acid, Isodesmosine, 2-Aminoheptanoic acid, allo-Isoleucine, 2- Aminoisobutyric acid, N-Methylglycine, sarcosine, 3-Aminoisobutyric acid, N- Methylisoleucine, 2-Aminopimelic acid, 6-N-Methyllysine, 2, 4-Diamino butyric acid, N- Methylvaline, Desmosine, Norvaline, 2,2 ' -Diaminopimelic acid, Norleucine, 2,3- Diaminopropionic acid, Ornithine, and N-Ethylglycine. 'Typically, the amide linkages of thepeptides are formed from an amino group of the backbone of one amino acid and a carboxyl group of the backbone of another amino acid.
[0150] The peptides, polypeptides, and proteins disclosed herein may be modified to include non-amino acid moieties. Modifications may include but are not limited to carboxylation (e.g., N-terminal carboxylation via addition of a di-carboxylic acid having 4-7 straight-chain or branched carbon atoms, such as glutaric acid, succinic acid, adipic acid, and 4,4-dimethylglutaric acid), amidation (e.g., C -terminal amidation via addition of an amide or substituted amide such as alkylamide or dialkylamide), PEGylation (e.g., N-terminal or C- terminal PEGylation via additional of polyethylene glycol), acylation (e.g., O-acylation (esters), N-acylation (amides), S-acylation (thioesters)), acetylation (e.g., the addition of an acetyl group, either at the N -terminus of the protein or at lysine residues), formylation lipoylation (e.g., attachment of a lipoate, a C8 functional group), myristoylation (e.g., attachment of myristate, a C14 saturated acid), palmitoylation (e.g., attachment of palmitate, a C16 saturated acid), alkylation (e.g., the addition of an alkyl group, such as an methyl at a lysine or arginine residue), isoprenylation or prenylation (e.g., the addition of an isoprenoid group such as farnesol or geranylgeraniol), amidation at C -terminus, glycosylation (e.g., the addition of a glycosyl group to either asparagine, hydroxylysine, serine, or threonine, resulting in a glycoprotein). Distinct from glycation, which is regarded as a nonenzymatic attachment of sugars, polysialylation (e.g., the addition of polysialic acid), glypiation (e.g., glycosylphosphatidylinositol (GPI) anchor formation, hydroxylation, iodination (e.g., of thyroid hormones), and phosphorylation (e.g., the addition of a phosphate group, usually to serine, tyrosine, threonine or histidine).
[0151] Variants comprising deletions relative to a reference amino acid sequence or nucleotide sequence are contemplated herein. A “deletion” refers to a change in the amino acid or nucleotide sequence that results in the absence of one or more amino acid residues or nucleotides relative to a reference sequence. A deletion removes at least 1, 2, 3, 4, 5, 10, 20, 50, 100, or 200 amino acids residues or nucleotides. A deletion may include an internal deletion or a terminal deletion (e.g., an N-terminal truncation or a C -terminal truncation or both of a reference polypeptide or a 5 ' -terminal or 3 ' -terminal truncation or both of a reference polynucleotide).
[0152] Variants comprising a fragment of a reference amino acid sequence or nucleotide sequence are contemplated herein. A “fragment” is a portion of an amino acid sequence or a nucleotide sequence which is identical in sequence to but shorter in length than the referencesequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one nucleotide / amino acid residue. For example, a fragment may comprise from 5 to 1000 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. In some embodiments, a fragment may comprise at least 5, 10, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. Fragments may be preferentially selected from certain regions of a molecule, for example the N-terminal region and / or the C-terminal region of a polypeptide or the 5 ' -terminal region and / or the 3 ’ terminal region of a polynucleotide. The term “ at least a fragment ” encompasses the full length polynucleotide or full length polypeptide.
[0153] Variants comprising insertions or additions relative to a reference sequence are contemplated herein. The words “insertion” and “addition” refer to changes in an amino acid or nucleotide sequence resulting in the addition of one or more amino acid residues or nucleotides. An insertion or addition may refer to 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, or 200 amino acid residues or nucleotides.
[0154] Fusion proteins and fusion polynucleotides also are contemplated herein. A “fusion protein” refers to a protein formed by the fusion of at least one peptide, polypeptide, protein or variant thereof as disclosed herein to at least one molecule of a heterologous peptide, polypeptide, protein or variant thereof. The heterologous protein(s) may be fused at the N- terminus, the C -terminus, or both termini. A fusion protein comprises at least a fragment or variant of the heterologous protein(s) that are fused with one another, preferably by genetic fusion (i.e., the fusion protein is generated by translation of a nucleic acid in which a polynucleotide encoding all or a portion of a first heterologous protein is joined in-frame with a polynucleotide encoding all or a portion of a second heterologous protein). The heterologous protein(s), once part of the fusion protein, may each be referred to herein as a “portion”, “region” or “moiety” of the fusion protein.
[0155] A fusion polynucleotide refers to the fusion of the nucleotide sequence of a first polynucleotide to the nucleotide sequence of a second heterologous polynucleotide (e.g., the 31end of a first polynucleotide to a 5 ' end of the second polynucleotide). Where the first and second polynucleotides encode proteins, the fusion may be such that the encoded proteins are in-frame and results in a fusion protein. The first and second polynucleotide may be fused suchthat the first and second polynucleotide are operably linked (e.g., as a promoter and a gene expressed by the promoter as discussed below).
[0156] A “full length” polynucleotide sequence is one containing at least a translation initiation codon (e.g., methionine) followed by an open reading frame and a translation termination codon. A “full length” polynucleotide sequence encodes a “full length” polypeptide sequence.
[0157] A “variant,” “mutant,” or “derivative” of a particular nucleic acid sequence may be defined as a nucleic acid sequence having at least 50% sequence identity to the particular nucleic acid sequence over a certain length of one of the nucleic acid sequences using biastn with the “BLAST 2 Sequences” tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences — a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). In some embodiments a variant polynucleotide may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to a reference polynucleotide.
[0158] Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences due to the degeneracy of the genetic code. It is understood that changes in a nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid sequences that all encode substantially the same protein.
[0159] “Operably linked” refers to the situation in which a first nucleic acid sequence is placed in a functional relationship with a second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Operably linked DNA sequence s may be in close proximity or contiguous and, where necessary to join two protein coding regions, in the same reading frame.
[0160] A “recombinant nucleic acid” is a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two or more otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques such as those described in Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1 3, Cold Spring Harbor Press, Plainview N.Y. The term recombinant includes nucleic acids that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid. Frequently, a recombinant nucleic acidmay include a nucleic acid sequence operably linked to a promoter sequence. Such a recombinant nucleic acid may be part of a vector that is used, for example, to transform a cell.
[0161] “Transformation” describes a process by which exogenous DNA is introduced into a recipient cell. Transformation may occur under natural or artificial conditions according to various methods well known in the art, and may rely on any known method for the insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic host cell. The method for transformation is selected based on the type of host cell being transformed and may include, but is not limited to, bacteriophage or viral infection, electroporation, heat shock, lipofection, and particle bombardment. The term “transformed cells” includes stably transformed cells in which the inserted DNA is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome, as well as transiently transformed cells which express the inserted DNA or RNA for limited periods of time.
[0162] “Substantially isolated or purified” nucleic acid or amino acid sequences are contemplated herein. The term “substantially isolated or purified” refers to nucleic acid or amino acid sequences that are removed from their natural environment, and are at least 60% free, preferably at least 75% free, and more preferably at least 90% free, even more preferably at least 95% free from other components with which they are naturally associated.MIMOTOPES
[0163] In some aspects, disclosed herein is a mimotope including about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88% similarity or more, about 89% similarity or more, about 90% similarity or more, about 91 % similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to any one of SEQ ID NOS: 5- 105.
[0164] In some aspects, also disclosed herein is a mask construct including any of the disclosed mimotopes, an antigen-binding domain to which the mimotope can bind, and a protease-cleavable linker. In some aspects, the mask construct can further include a cell adhesion molecule, a signal peptide, and / or a detectable tag. In some aspects, the mask construct can include 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mimotopes.
[0165] In some aspects, the mimotope can be linked to the antigen-binding domain. For example, in some aspects, the mimotope can be linked to the antigen-binding domain by theprotease-cleavable linker and / or one or more spacers. Examples of protease-cleavable linkers and spacers are discussed in further detail below. As used herein, it is understood that the term “linked” or “connected,” in reference to a structural connection between two peptides, can refer to either direct linking of the two peptides by a peptide bond, or indirect linking of the two peptides with one or more additional peptides, spacers, or other molecules (e.g., nucleotides, sugars, polymers, etc.) interspersed between the two “linked” peptides. In some aspects, when the mimotope is bound and linked to the antigen-binding domain, the mimotope can block the antigen-binding domain from binding to its cognate antigen. Upon cleavage of the protease- cleavable linker, the mimotope can be released from the antigen -binding domain, thereby allowing the antigen-binding domain to bind to its cognate antigen.
[0166] In some aspects, a first end of the antigen-binding domain can be linked to the mimotope, and a second end of the antigen-binding domain can be linked to a cell adhesion protein, for example, a yeast display protein. Example yeast display proteins include, but are not limited to, Aga2, Agal, Flol, Flol l, Sedl, Cwp2, Pirl, Pir2, Sagl (a-agglutinin), and Tipi. In some aspects, the cell adhesion protein can include about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about84% similarity or more, about 85% similarity or more, about 86% similarity or more, about87% similarity or more, about 88% similarity or more, about 89% similarity or more, about90% similarity or more, about 91 % similarity or more, about 92% similarity or more, about93% similarity or more, about 94% similarity or more, about 95% similarity or more, about96% similarity or more, about 97% similarity or more, about 98% similarity or more, about99% similarity or more, about 100% similarity) to SEQ ID NO: 130.
[0167] In some aspects, a first end of the mimotope can be linked to a signal peptide, and a second end of the mimotope can be linked to the antigen-binding domain. Examples of signal peptides are described in further detail below.
[0168] In some aspects, the linkage between the mimotope and the signal peptide can be interspersed by one or more detectable tags, for example, a FLAG tag (e.g., SEQ ID NO: 119). In some aspects, the detectable tag can be placed in the linkage between the mimotope and the signal peptide such that, when the mimotope is bound to the antigen-binding domain, the detectable tag cannot be detected.
[0169] In some aspects, the mask construct can include about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88% similarity or more, about 89% similarity or more,about 90% similarity or more, about 91% similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to any one of SEQ ID NOS: 189-277.Also considered herein are truncated versions of SEQ ID NOS: 189-277 spanning from the first amino acid of the mimotope through the last amino acid of the antigen -binding domain. ENGINEERED PROTEASE ACTIVATABLE RECEPTORS
[0170] In some aspects, disclosed herein is an engineered protease activatable receptor (PAR) including: i) a synthetic Notch (synNotch) construct including: a signal peptide; an antigen-binding domain; a synNotch core; and a transcription factor; and ii) a mimotope that binds to the antigen-binding domain.
[0171] In some aspects, the engineered PAR can include 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 mimotopes. In some aspects, the mimotope can include about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88% similarity or more, about 89% similarity or more, about 90% similarity or more, about 91% similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to any one or more of SEQ ID NOS: 1- 105.
[0172] In some aspects, the mimotope can be linked to the antigen-binding domain. Eor example, in some aspects, the mimotope can be linked to the antigen-binding domain by the protease-cleavable linker and / or one or more spacers. Examples of protease-cleavable linkers and spacers are discussed in further detail below. In some aspects, when the mimotope is bound and linked to the antigen-binding domain, the mimotope can block the antigen-binding domain from binding to its cognate antigen. Upon cleavage of the protease-cleavable linker, the mimotope can be released from the antigen-binding domain, thereby allowing the antigenbinding domain to bind to its cognate antigen.
[0173] In some aspects, a first end of the antigen-binding domain can be linked to the mimotope, and a second end of the antigen-binding domain can be linked to the synNotch core. In some aspects, a first end of the synNotch core can be linked to the antigen- binding domain, and a second end of the synNotch core can be linked to the transcription factor.
[0174] In some aspects, a first end of the mimotope can be linked to a signal peptide, and a second end of the mimotope can be linked to the antigen -binding domain. Examples of signal peptides are described in further detail below.
[0175] In some aspects, the linkage between the mimotope and the signal peptide can be interspersed by one or more detectable tags, for example, a FLAG tag (e.g., SEQ ID NO: 119). In some aspects, the detectable tag can be placed in the linkage between the mimotope and the signal peptide such that, when the mimotope is bound to the antigen-binding domain, the detectable tag cannot be detected.
[0176] In some aspects, the engineered PAR can further include one or more spacers, for example, on one or both ends of the protease-cleavable linker. In some aspects, the spacers can be glycine-glycine-serine (GGS) spacer peptides. In some aspects, the GGS spacer peptides can be repeated 1, 2, 3, 4, or 5 times on either side of the protease-cleavable linker. In some aspects, the spacers can independently be GGSGGSGGS (SEQ ID NO: 1 15) or GGSGGSGGSGGSGGS (SEQ ID NO: 116). In some aspects, the spacers can independently be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length. In some aspects, the protease-cleavable linker and spacers can have the sequence GGS- X-GGS (SEQ ID NO: 117), wherein X is the protease-cleavable linker.
[0177] In some aspects, the protease-cleavable linker can be cleaved by a protease that is associated with healthy tissue. For example, in some aspects, the protease-cleavable linker can be cleaved by a tissue-specific protease. Example cell-specific proteases include, but are not limited to, neutrophil serine proteases such as cathepsin G, neutrophil elastase, and proteinase 3, mucosa-associated lymphoid tissue 1 (MALT1), granzymes, and cysteine proteinases of the caspase family, such as caspase-3,-6,-7,-8.
[0178] In some aspects, the tissue can be kidney tissue, and the protease-cleavable linker can include any one of SEQ ID NOS: 782-791. In some aspects, the tissue can be liver tissue, and the protease-cleavable linker can include any one of SEQ ID NOS: 792-801. In some aspects, the tissue can be lung tissue, and the protease-cleavable linker can include any one of SEQ ID NOS: 802-811. In some aspects, the tissue can be heart tissue, and the protease- cleavable linker can include any one of SEQ ID NOS: 812-821. In some aspects, the tissue can be blood, and the protease-cleavable linker can include any one of SEQ ID NOS: 822-831. In some aspects, the tissue can be spleen tissue, and the protease-cleavable linker can include any one of SEQ ID NOS: 832-841. In some aspects, the tissue can be lymph node tissue, and the pro tease-cleav able linker can include any one of SEQ ID NOS: 842-851. In some aspects, the tissue can be stomach tissue, and the protease-cleavable linker can include any one of SEQ IDNOS: 852-861. In some aspects, the tissue can be ovarian tissue, and the protease-cleavable linker comprise any one of SEQ ID NOS: 862-871. In some aspects, the tissue can be uterine tissue, and the protease-cleavable linker can include any one of SEQ ID NOS: 872-881. In some aspects, the tissue can be mammary gland tissue, and the protease-cleavable linker can include any one of SEQ ID NOS: 882-891. In some aspects, the tissue can be prostate tissue, and the protease-cleavable linker can include any one of SEQ ID NOS: 892-901. In some aspects, the tissue can be testicular tissue, and the prostate-cleavable linker comprises any one of SEQ ID NOS: 902-911. In some aspects, the tissue can be intestinal tissue, and the protease- cleavable linker can include any one of SEQ ID NOS: 912-921. In some aspects, the tissue can be bladder tissue, and the protease-cleavable linker can include any one of SEQ ID NOS: 922- 931. In some aspects, the tissue can be brain tissue, and the protease-cleavable linker can include any one of SEQ ID NOS: 932-941. In some aspects, the tissue can be thymic tissue, and the protease-cleavable linker can include any one of SEQ ID NOS: 942-951 .
[0179] In some aspects, the protease-cleavable linker can be cleaved by a protease that is associated with a disease or disorder. Proteases known to be associated with diseases or disorders include, but are not limited to, serine proteases, cysteine proteases, aspartate proteases, threonine proteases, glutamic acid proteases, metalloproteases, asparagine peptide lyases, serum proteases, cathepsins, Cathepsin B, Cathepsin C, Cathepsin D, Cathepsin E, Cathepsin K, Cathepsin L, kallikreins, hKl, hKIO, hK15, plasmin, collagenase, Type IV collagenase, stromelysin, Factor Xa, chymotrypsin-like protease, trypsin-like protease, elastase-like protease, subtilisin-like protease, actinidain, bromelain, calpain, caspases, caspase-3, Mirl-CP, papain, HIV-1 protease, HSV protease, CMV protease, chymosin, renin, pepsin, matriptase, legumain, plasmepsin, nepenthesin, metalloexopeptidases, metalloendopeptidases, matrix metalloproteases (MMP), MMP1, MMP2, MMP3, MMP8, MMP9, MMP13, MMP11, MMP14, urokinase plasminogen activator (uPA), enterokinase, prostate-specific antigen (PSA, hK3), interleukin- 10 converting enzyme, thrombin, FAP (FAP- a), dipeptidyl peptidase, meprins, granzymes and dipeptidyl peptidase IV (DPPIV / CD26).
[0180] In some aspects, the protease-cleavable linker can be cleaved by a cancer-associated protease or a tumor-associated protease. Example cancer-associated and tumor-associated proteases include, but are not limited to, cathepsin B, cathepsin D, cathepsin E, cathepsin K, cathepsin L, kallikrein 1, kallikrein 3 (PSA), kallikrein 10, kallikreinlS, uPA, uPAR, caspases, matrix metalloproteinases such as MMP1, MMP2, MMP8, MMP9, MMP13, MMP14, and ADAM.
[0181] In some aspects, the protease-cleavable linker can be cleaved by a protease that is enriched in a tumor or a cancer expressing an antigen that binds to the antigen-binding domain.
[0182] In some aspects, the cancer can be breast cancer, and the protease-cleavable linker can include any one of SEQ ID NOS: 320-323 or any one of SEQ ID NOS: 576-662. In some aspects, the cancer can be colon cancer, and the protease-cleavable linker can include any one of SEQ ID NOS: 324-326 or any one of SEQ ID NOS: 663-682. In some aspects, the cancer can be small cell lung carcinoma, and the protease-cleavable linker can include any one of SEQ ID NOS: 683-702. In some aspects, the cancer can be ovarian cancer, and the protease- cleavable linker can include any one of SEQ ID NOS: 693-712. In some aspects, the cancer can be prostate cancer, and the protease-cleavable linker can include any one of SEQ ID NOS: 713-732. In some aspects, the cancer can be liver cancer, and the protease-cleavable linker can include SEQ ID NO: 375, SEQ ID NO: 411, SEQ ID NO: 425, SEQ ID NO: 435, SEQ ID NO: 458, SEQ ID NO: 473, SEQ ID NO: 518, SEQ ID NO: 556, SEQ ID NO: 568, or any one of SEQ ID NOS: 733-743. In some aspects, the cancer can be adenocarcinoma, and the protease- cleavable linker can include SEQ ID NO: 468, SEQ ID NO: 567, or any one of SEQ ID NOS: 744-761. In some aspects, the cancer can be renal cancer, and the protease-cleavable linker can include any one of SEQ ID NOS: 762-781.
[0183] In some aspects, the antigen can be HER2, and the protease-cleavable linker can include any one of SEQ ID NOS: 320-323. In some aspects, the antigen can be EGFR, and the pro tease-cleav able linker can include any one of SEQ ID NOS: 324-326.
[0184] In some aspects, the protease-cleavable linker can be cleaved by thrombin and can include any one of SEQ ID NOS: 106-110 or any one of SEQ ID NOS: 396-405. In some aspects, the protease-cleavable linker can be cleaved by granzyme B and can include SEQ ID NO: H I or any one of SEQ ID NOS: 446-455. In some aspects, the protease-cleavable linker can be cleaved by MMP9 and can include SEQ ID NO: 112 or any one of SEQ ID NOS: 546- 555. In some aspects, the protease-cleavable linker can be cleaved by CASP1 and can include any one of SEQ ID NOS: 327-336. In some aspects, the protease-cleavable linker can be cleaved by CASP3 and can include any one of SEQ ID NOS: 337-346. In some aspects, the protease-cleavable linker can be cleaved by CASP8 and can include any one of SEQ ID NOS: 347-356. In some aspects, the protease-cleavable linker can be cleaved by CTSD and can include any one of SEQ ID NOS: 357-366. In some aspects, the protease-cleavable linker can be cleaved by CTSE and can include any one of SEQ ID NOS: 367-376. In some aspects, the pro tease-cleav able linker can be cleaved by CTSG and can include any one of SEQ ID NOS: 377-385. In some aspects, the protease-cleavable linker can be cleaved by CTSS and caninclude any one of SEQ ID NOS: 386-395. In some aspects, the protease-cleavable linker can be cleaved by FAP and can include any one of SEQ ID NOS: 406-415. In some aspects, the protease-cleavable linker can be cleaved by FXIA and can include any one of SEQ ID NOS: 416-425. In some aspects, the protease-cleavable linker can be cleaved by GGT1 and can include any one of SEQ ID NOS: 426-435. In some aspects, the protease-cleavable linker can be cleaved by GZMA and can include any one of SEQ ID NOS: 436-445. In some aspects, the protease-cleavable linker can be cleaved by H20S and can include any one of SEQ ID NOS: 456-465. In some aspects, the protease-cleavable linker can be cleaved by KLK2 and can include any one of SEQ ID NOS: 466-475. In some aspects, the protease-cleavable linker can be cleaved by MMP1 and can include any one of SEQ ID NOS: 476-485. In some aspects, the protease-cleavable linker can be cleaved by MMP10 and can include any one of SEQ ID NOS: 486-495. In some aspects, the protease-cleavable linker can be cleaved by MMP12 and can include any one of SEQ ID NOS: 496-505. In some aspects, the protease-cleavable linker can be cleaved by MMP13 and can include any one of SEQ ID NOS: 506-515. In some aspects, the protease-cleavable linker can be cleaved by MMP2 and can include any one of SEQ ID NOS: 516-525. In some aspects, the protease-cleavable linker can be cleaved by MMP3 and can include any one of SEQ ID NOS: 526-535. In some aspects, the protease-cleavable linker can be cleaved by MMP8 and can include any one of SEQ ID NOS: 536-545. In some aspects, the protease-cleavable linker can be cleaved by TPA and can include any one of SEQ ID NOS: 556-565. In some aspects, the protease-cleavable linker can be cleaved by UP A and can include any one of SEQ ID NOS: 566-575.
[0185] In some aspects, the synNotch core can include an extracellular domain comprising about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88% similarity or more, about 89% similarity or more, about 90% similarity or more, about 91% similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to SEQ ID NO: 124 or SEQ ID NO: 125.
[0186] In some aspects, the synNotch core can include a juxtamembrane domain comprising about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88%’similarity or more, about 89% similarity or more, about 90% similarity or more, about 91% similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to SEQ ID NO: 12.6.
[0187] In some aspects, the synNotch core can include a transmembrane domain comprising about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88% similarity or more, about 89% similarity or more, about 90% similarity or more, about 91% similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to SEQ ID NO: 127 or SEQ ID NO: 128.
[0188] In some aspects, the synNotch core can include about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88% similarity or more, about 89% similarity or more, about 90% similarity or more, about 91% similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to SEQ ID NO: 129.
[0189] In some aspects, the signal peptide can include about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85% similarity or more, about 86% similarity or more, about 87% similarity or more, about 88% similarity or more, about 89% similarity or more, about 90% similarity or more, about 91% similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity ) to SEQ ID NO: 120 or SEQ ID NO: 121.
[0190] In some aspects, the antigen-binding domain can be a single-chain fragment variable (scFv) or a nanobody.
[0191] In some aspects, the antigen-binding domain can bind to an antigen that is associated with a disease or disorder. For example, in some aspects, the antigen-binding domain can bind to a cancer-associated antigen or a tumor-associated antigen.
[0192] In some aspects, the antigen-binding domain can bind to HER2, EGER, BCMA, B2M, B7-H3, CAIX, CD70, CEA, CLDN18.2, cMET, sDTR, FAP, GD2, GPC3, MSLN, MUClbecto, PSCA, PSMA, EpCAM, ROR1, or TnMucl. In some aspects, the antigen -binding domain can include about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about85% similarity or more, about 86% similarity or more, about 87% similarity or more, about88% similarity or more, about 89% similarity or more, about 90% similarity or more, about91% similarity or more, about 92% similarity or more, about 93% similarity or more, about94% similarity or more, about 95% similarity or more, about 96% similarity or more, about97% similarity or more, about 98% similarity or more, about 99% similarity or more, about100% similarity) to any one of SEQ ID NOS: 131-153.
[0193] In some aspects, the engineered PAR can include about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84% similarity or more, about 85%’ similarity or more, about 86% similarity or more, about 87% similarity or more, about 88% similarity or more, about 89% similarity or more, about 90% similarity or more, about 91% similarity or more, about 92% similarity or more, about 93% similarity or more, about 94% similarity or more, about 95% similarity or more, about 96% similarity or more, about 97% similarity or more, about 98% similarity or more, about 99% similarity or more, about 100% similarity) to any one of SEQ ID NOS: 154- 188.IMMUNE CELLS
[0194] In some aspects, disclosed herein is an immune cell including: a) any of the disclosed engineered PARs; and b) a reporter nucleic acid encoding: i) a promoter that is activatable by transcription factor; and ii) a reporter molecule (including, but not limited to reporter molecules linked to a secretion tag); wherein, upon cleavage of the protease-cleavable linker by a protease in the presence of an antigen that binds to the antigen-binding domain , the mimotope is released from the antigen-binding domain and the antigen -binding domain binds to its cognate antigen, thereby causing the transcription factor to be released from the synNotch construct and bind to the promoter, thereby inducing expression of the detectable signal linked to the secretion tag.
[0195] In some aspects, the transcription factor can be Gal4-VP64 and the promoter can include UAS. In some aspects, the promoter can be repeated 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times. In some aspects, the promoter can include one or more additional promoters in addition to the promoter that is activatable by the transcription factor. Example promoters include, but are not limited to, a CMV core promoter, a SV40 core promoter, a EFla (EEF1A1) core promoter, a Ubiquitin C (UBC) core promoter, a CAG core promoter, a PGK core promoter, a SFFV core promoter, a hTERT core promoter, a T7 core promoter, a TRE core promoter, a Pol II core promoter, a Pol III (U6, Hl) core promoter, a ACTB core promoter, a RPL13A core promoter, a GAPDH core promoter, a TK core promoter, a Vimentin core promoter, a RSV core promoter, a Minimal CMV core promoter, a MET25 core promoter, a ADH1 core promoter, a I EFl core promoter, a GALI core promoter, a TPI1 core promoter, a AOX1 core promoter, and a nnitl core promoter.
[0196] In some aspects, the reporter molecule can include a fluorophore or fluorescent molecule, a bioluminescent molecule, or a chemiluminescent molecule. Example reporter molecules include, but are not limited to, luciferase (e.g., NanoLuc, GlowLuc, RedLuc, Emerald Luc, Luc2, Flue, GLuc (Gaussia luciferase), CLuc (Cypridina luciferase), ELuc (Enhanced beetle luciferase), SLuc (Synthetic luciferase), pLuc (Photinus pyralis luciferase variant), RLuc (Renilla luciferase), ALuc (Artificial luciferase series), UltraLuc, TurboLuc), green fluorescent protein (GFP), yellow fluorescent protein (YFP), blue fluorescent protein (BFP), cyane fluorescent protein (CFP), monomeric red fluorescent protein (mRFP), Discosoma striata (DsRed), mCherry, mOrange, tdTomato, mSTrawberry, mPlum, photoactivatable GFP (PA-GFP), Venus, Kaede, monomeric kusabira orange (mKO), Dronpa, enhanced CFP (ECFP), Emerald, Cyan fluorescent protein for energy transfer (CyPet), super CFP (SCFP), Cerulean, photoswitchable CFP (PS-CFP2), photoactivatable RFP1 (PA-RFP1 ), photoactivatable mCherry (PA-mCherry), monomeric teal fluorescent protein (mTFPl), Eos fluorescent protein (EosFP), Dendra, TagBFP, TagRFP, enhanced YFP (EYFP), Topaz, Citrine, yellow fluorescent protein for energy transfer (YPet), super YFP (SYFP), enhanced GFP (EGFP), Superfolder GFP, T30 Sapphire, Fucci, mK02, mOrange2, mApple, Sirius, Azurite, EBFP, EBFP2, 6-FAMTm, TETTm, JOET'M HEXTM, VICO, cyanine 3, ROXTM, EC Red 640, cyanine 5, fluorescein isothiocyanate (FITC), rhodamine, TRITC (tetramethyl rhodamine isothiocyanate), Oregon Green, Pacific Blue, Pacific Green, Pacific Orange, Texas Red, Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 647, Alexa Fluor 680, and Alexa Fluor 750. In some aspects, the reporter molecule can include a DNA barcode sequence,an RNA barcode sequence, or a peptide barcode sequence. In some aspects, the reporter molecule can include a VHH nanobody, a knottin, or any other small peptides or proteins.
[0197] In some aspects, the reporter molecule can be filtered in the urine. As such, the kidney can serve to concentrate the reporter molecule in the urine by reabsorption of water, thereby concentrating the reporter molecule in the urine and enabling detection of even small quantities of reporter molecules. In this way, even small tumors which only activate small quantities of engineered PARs can be detected. In some aspects, the reporter molecule can be less than about 50 kDa (e.g., less than about 45 kDa, less than about 40 kDa, less than about 35 kDa, less than about 30 kDa, less than about 25 kDa, less than about 20 kDa, less than about 15 kDa, less than about 10 kDa, less than about 5 kDa).
[0198] In some aspects, the secretion tag can include a signal peptide, for example, any of the signal peptides disclosed herein. In some aspects, the secretion tag can include about 80% similarity or more (e.g., about 81% similarity or more, about 82% similarity or more, about 83% similarity or more, about 84%’ similarity or more, about 85% similarity or more, about86% similarity or more, about 87% similarity or more, about 88% similarity or more, about89% similarity or more, about 90% similarity or more, about 91% similarity or more, about92% similarity or more, about 93% similarity or more, about 94% similarity or more, about95% similarity or more, about 96% similarity or more, about 97% similarity or more, about98% similarity or more, about 99% similarity or more, about 100% similarity) to any one of SEQ ID NOS: 121-123.
[0199] In some aspects, the immune cell can be a T cell, an invariant natural killer T (iNKT) cell, a macrophage, or a natural killer cell. In some aspects, the immune cell can be an autologous immune cell or an allogenic immune cell.METHODS
[0200] Previous PARs have been used only for in vivo detection of cancers, due in part to the use of large, non-secretable reporter molecules which could not be secreted by the immune cell and, for example, enter the blood or the urine. In contrast, the disclosed PARs and immune cells including said PARs, particularly through the use of small, secretable reporter molecules (including, but not limited to, reporter molecules linked to secretion tags) can be used for in vitro and / or or ex vivo and allow for minimally invasive detection by collecting and analyzing biological fluid samples (including, but not limited to urine, blood, saliva, breath, sputum, bone marrow, cerebrospinal fluid (CSF), plasma, synovial fluid, nasal lavage, cell lysate, oral mucosa, nasal mucosa, vaginal mucosa, and / or rectal mucosa). As discussed above, this can allow the concentration of reporter molecules in the biological fluid sample to detect even verysmall tumors. This can also enable more widespread applicability of the disclosed methods, as detection can occur through simple visual observation of the reporter molecule in the biological fluid sample, without requiring imaging or analysis equipment.
[0201] In some aspects, disclosed herein is a method of detecting cancer in a subject, the method including: a) administering any of the disclosed immune cells to the subject, wherein the protease-cleavable linker is cleaved by a cancer-associated protease or a tumor-associated protease; b) collecting a biological fluid sample from the subject; and c) detecting presence or absence of the reporter molecule in the biological fluid sample, thereby detecting presence or absence of cancer.
[0202] In some aspects, the immune cell can be administered intravenously.
[0203] In some aspects, the biological fluid sample can be a urine, blood, saliva, breath, sputum, bone marrow', cerebrospinal fluid (CSF), plasma, synovial fluid, nasal lavage, cell lysate, oral mucosa, nasal mucosa, vaginal mucosa, and / or rectal mucosa. In some aspects, a cell or tissue sample can be used in lieu of or in addition to a biological fluid sample.
[0204] In some aspects, step c) can occur in vitro, in vivo, or ex vivo. In some aspects, step c) can include detecting presence or absence of the reporter molecule using one or more imaging techniques, sequencing techniques, assays, or other analysis techniques known in the art for detecting the disclosed reporter molecules. In some aspects, particularly when the reporter molecule is fluorescent, chemiluminescent, or bioluminescent, step c) can include visually observing presence or absence of fluorescence / chemiluininescence / bioluininescence in the biological fluid sample.
[0205] In some aspects, step c) can further include quantifying the reporter molecule. For example, in some aspects, the quantity of the reporter molecule can be used to determine severity or extent of the cancer, cancer stage, and / or size or volume of the cancer.
[0206] In some aspects, at least a portion of the cancer can be HER2+, EGFR+, BCMA+, B2M+, B7-H3+, CAIX+, CD70+, CEA+, CLDN18.2+, cMET+, sDTR+, FAP+, GD2+, GPC3+, MSLN+, MUC16ecto+, PSCA+, PSMA+, EpCAM+, ROR1+, and / or TnMucl+.
[0207] Example cancers include, but are not limited to, breast cancer, lung cancer, pancreatic cancer, gastric cancer, colon cancer, acoustic neuroma, adenocarcinoma, adrenal gland cancer, anal cancer, angiosarcoma (e.g., lymphangiosarcoma, lymphangioendotheliosarcoma, hemangiosarcoma), appendix cancer, benign monoclonal gammopathy, biliary cancer (e.g., cholangiocarcinoma), bladder cancer, breast cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of the breast, mammary cancer, medullary carcinoma of the breast), brain cancer (e.g., meningioma; glioma, e.g., astrocytoma,oligodendroglioma; medulloblastoma), bronchus cancer, carcinoid tumor, cervical cancer (e.g., cervical adenocarcinoma), choriocarcinoma, chordoma, craniopharyngioma, colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma), epithelial carcinoma, ependymoma, endotheliosarcoma (e.g., Kaposi's sarcoma, multiple idiopathic hemorrhagic sarcoma), endometrial cancer (e.g., uterine cancer, uterine sarcoma), esophageal cancer (e.g., adenocarcinoma of the esophagus, Barrett's adenocarinoma), Ewing's sarcoma, eye cancer (e.g., intraocular melanoma, retinoblastoma), familiar hypereosinophilia, gall bladder cancer, gastric cancer (e.g., stomach adenocarcinoma), gastrointestinal stromal tumor (GIST), head and neck cancer (e.g., head and neck squamous cell carcinoma, oral cancer (e.g., oral squamous cell carcinoma (OSCC), throat cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer)), hematopoietic cancers (e.g., leukemia such as acute lymphocytic leukemia (ALL) (e.g., B-cell ALL, T-cell ALL), acute myelocytic leukemia (AMI.) (e.g., B-cell AML, T-cell AML.), chronic myelocytic leukemia (CML) (e.g., B-cell CML, T-cell CML), and chronic lymphocytic leukemia (CLL) (e.g., B-cell CLL, T-cell CLL); lymphoma such as Hodgkin lymphoma (HL) (e.g., B-cell HL, T-cell HL) and non-Hodgkin lymphoma (NHL) (e.g., B-cell NHL such as diffuse large cell lymphoma (DLCL) (e.g., diffuse large B-cell lymphoma (DLBCL)), follicular lymphoma, chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL), mantle cell lymphoma (MCL), marginal zone B-cell lymphomas (e.g., mucosa-associated lymphoid tissue (MALT) lymphomas, nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma), primary mediastinal B-cell lymphoma, Burkitt lymphoma, lymphoplasmacytic lymphoma (i.e., “Waldenstrom's macroglobulinemia”), hairy cell leukemia (HCL), immunoblastic large cell lymphoma, precursor B -lymphoblastic lymphoma and primary central nervous system (CNS) lymphoma; and T-cell NHL such as precursor T-lymphoblastic lymphoma / leukemia, peripheral T-cell lymphoma (PTCL) (e.g., cutaneous T-cell lymphoma (CTCL) (e.g., mycosis fungiodes, Sezary syndrome), angioimmunoblastic T-cell lymphoma, extranodal natural killer T-cell lymphoma, enteropathy type T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, anaplastic large cell lymphoma); a mixture of one or more leukemia / lymphoma as described above; and multiple myeloma (MM)), heavy chain disease (e.g., alpha chain disease, gamma chain disease, mu chain disease), hemangioblastoma, inflammatory myofibroblastic tumors, immunocytic amyloidosis, kidney cancer (e.g., nephroblastoma a.k.a. Wilms' tumor, renal cell carcinoma), liver cancer (e.g., hepatocellular cancer (HCC), malignant hepatoma), lung cancer (e.g., bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung), leiomyosarcoma (LMS), mastocytosis (e.g., systemicmastocytosis), myelodysplastic syndrome (MDS), mesothelioma, myeloproliferative disorder (MPD) (e.g., polycythemia Vera (PV), essential thrombocytosis (ET), agnogenic myeloid metaplasia (AMM) a.k.a. myelofibrosis (MF), chronic idiopathic myelofibrosis, chronic myelocytic leukemia (CML), chronic neutrophilic leukemia (CNL), hypereosinophilic syndrome (HES)), neuroblastoma, neurofibroma (e.g., neurofibromatosis (NF) type 1 or type 2, schwannomatosis), neuroendocrine cancer (e.g., gastroenteropancreatic neuroendoctrine tumor (GEP-NET), carcinoid tumor), osteosarcoma, ovarian cancer (e.g., cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma), papillary adenocarcinoma, pancreatic cancer (e.g., pancreatic adenocarcinoma, intraductal papillary mucinous neoplasm (IPMN), Islet cell tumors), penile cancer (e.g., Paget's disease of the penis and scrotum), pinealoma, primitive neuroectodermal tumor (PNT), prostate cancer (e.g., prostate adenocarcinoma), rectal cancer, rhabdomyosarcoma, salivary gland cancer, skin cancer (e.g., squamous cell carcinoma (SCC), keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)), small bowel cancer (e.g., appendix cancer), soft tissue sarcoma (e.g., malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myxosarcoma), sebaceous gland carcinoma, sweat gland carcinoma, synovioma, testicular- cancer (e.g., seminoma, testicular embryonal carcinoma), thyroid cancer (e.g., papillary carcinoma of the thyroid, papillary thyroid carcinoma (PTC), medullary thyroid cancer), urethral cancer, vaginal cancer and vulvar cancer (e.g., Paget's disease of the vulva).
[0208] In some aspects, the method can further include, if presence of the cancer is detected, administering one or more anti-cancer treatments to the subject, for example, chemotherapy, radiation therapy, and / or immunotherapy (e.g., immune cell therapy and / or checkpoint inhibitor therapy).
[0209] In some aspects, the method can be repeated over time to monitor progression of the cancer. For example, in some aspects, the method can be repeated 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59,60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84,85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more times. In some aspects, the method can be repeated daily. In some aspects, the method can be repeated every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, or more. In some aspects, the method can be repeated every week, every 2 weeks, every 3 weeks, every 4 weeks, or more. In some aspects, the method can be repeated every month, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months,every 9 months, every 10 months, every 11 months, every 12 months, or more. In some aspects, the method can be repeated every year, every 2 years, every 3 years, every 4 years, every 5 year's, or more.EXAMPLESExample 1: Programming T cells for Early Cancer Detection with Customized Protease-Activatable Receptors
[0210] Early cancer detection can improve patient outcomes, yet most tumor-shed biomarkers lack sensitivity for early-stage disease. This study reports OncoSCOUT, a cancer detection strategy that uses T cells engineered with a protease-activatable receptor (PAR) to enable conditional recognition of tumor cells and subsequent release of a synthetic biomarker for detection in urine. These PARs include masked synthetic Notch receptors in which antigen binding is blocked by a peptide mimotope tethered via a protease-cleavable linker. This study shows that PAR T cell activation is dependent on both extracellular protease activity and tumor antigen engagement, leading to significantly reduced off-tumor activation and enhanced spatial specificity. To identify receptors with selective tumor activation in vivo, this study engineers T cells with a HER2 -targeting PAR library displaying 160,000 unique 4-mer amino acid linkers and identified multiple valiants significantly enriched in a HER2-positive cancer xenograft model. Using a single customized PAR, this study demonstrates OncoSCOUT for the detection of tumors as small as 10-30 mm3with significantly improved sensitivity than both the protein biomarker CA 15-3 and a 20-plex circulating tumor DNA (ctDNA) assay.Introduction
[0211] Early detection of cancer has the potential to enable clinical intervention at treatable disease stages and drive durable therapeutic responses, as exemplified by five-year survival rates above 60% for cancers in most anatomical sites when still localized at diagnosis. Screening tests such as mammograms, colonoscopies, and Papanicolaou tests have provided success stories for lowering the number of cancer deaths via early detection in asymptomatic populations. Still, accurate screening tests are only available for a small subset of indications, as population-scale deployment of early detection tests requires near-perfect specificity to prevent lengthy diagnostic odysseys that can result from false positives. Most approaches under investigation focus on abundance-based biomarkers in blood like shed proteins, circulating tumor cells, cell-free DNA, and cancer exosomes. However, poor influx into tumor vasculature, clearance from circulation, and secretion by healthy tissues or non-cancerous conditions limit their use for detecting nascent tumors, prompting efforts to increase sensitivity at high specificity cutoffs. For example, multi-cancer tests based on cell-free DNA leverage largemultianalyte panels (e.g., >1 million methylation sites) integrated with machine learning to train classifiers with higher accuracy and the ability to predict cancer location.
[0212] Compared to abundance-based readouts, activity-based detection via administration of protease-activatable sensors has emerged as an approach to produce higher signal -to-noise ratios due to the catalytic turnover of multiple substrates by a single protease and the low baseline of non-endogenous synthetic reporters. Proteolytic events play broad roles in cancer by breaking down and remodeling extracellular matrix molecules, activating soluble and transmembrane signaling pathways, and regulating enzyme functions. Consequently, proteases mediate processes fundamental to the initiation of nascent tumors like angiogenesis, growth factor signaling, and immune evasion. The ubiquitous dysregulation of cancer-associated proteases has motivated the design of protease-activatable sensors including fluorogenic imaging probes to identify sites of residual disease during surgery, PET probes that use proteolysis as a molecular trigger to drive their accumulation on the cell membrane, and substrate-based probes that release barcoded reporters as synthetic biomarkers to detect early cancer or response to drugs. Most of these examples rely on peptide substrates presented on inorganic, polymeric, or protein carriers. However, living cells provide a chassis to selectively infiltrate the tumor microenvironment and genetically encode complex biosensing circuits based on molecular patterns like tumor-associated antigens and metabolic profiles.
[0213] Here this study describes an approach for early cancer detection via synthetic biomarkers of protease cleavage via on-target unmasking of T cells (OncoSCOUT). OncoSCOUT leverages T cells engineered to express protease-activatable receptors (PARs), which integrate masked single-chain variable fragments (scFv) with synthetic Notch (synNotch) receptor design to increase specificity by requiring a combination of cancer- associated proteases and antigens for activation. In their initial state, PARs are blocked from antigen binding by a peptide mimotope “mask” connected via a substrate linker. Following linker proteolysis by an extracellular protease, the exposed scFv can then bind to a cell-surface antigen, triggering synNotch signaling and production of bio-orthogonal reporters. This study develops an in vivo discovery pipeline to perform deep profiling of the substrate repertoire in solid tumors by adoptively transferring a library of PAR T cells displaying -160,000 substrate linkers to mice bearing breast xenograft tumors. By designing custom PAR T cells with hit substrate sequences, this study demonstrates that OncoSCOUT detects tumors as small as 10- 30 mm3via the production of urinary biomarkers, resulting in higher accuracy than the FDA- approved blood biomarker CA 15-3 and a 20-plex ctDNA test. These results support the development of OncoSCOUT for early cancer detection with improved specificity.Results
[0214] Masked protease-activatable receptors require an extracellular protease and a tumor antigen for cell activation: The study designed PARs by incorporating a masked scFv with the previously described design of a synNotch receptor (FIG. 36A and FIG. 37 A). It was postulated that cleavage of the substrate linker by an extracellular protease would release the peptide mimotope to unmask the scFv for binding, thereby triggering release of the Gal4-VP64 transcription factor to drive reporter expression through the UAS promoter (FIG. 36B). To test tills, the study first cloned PARs using scFv sequences derived from anti-human epidermal growth factor receptor 2 (aHER2; trastuzumab) and anti-human epidermal growth factor receptor (ahEGFR; cetuximab), along with their respective validated peptide niiniotopes (LLGPYEL WELSH (SEQ ID NO: 1) and CISPRGCPDGPYVMY (SEQ ID NO: 5)). For each PAR, the study generated constructs using either a substrate linker (LVPRGSG (SEQ ID NO: 1 10)) selective for the protease thrombin (Thrb) or a flexible GSGGSG (SEQ ID NO: 113) linker as a negative control (FIG. 36C and FIGS. 38A-38B). The study expressed these PARs and a UAS-driven blue fluorescent protein (BEP) reporter in primary T cells. In co-cuiture studies, reporter expression by Thrb-activatable HER2 PAR T cells was detected only when both HER2 -positive cancer cells and recombinant Thrb were present simultaneously. hEGFR PAR T cells similarly required both Thrb and hEGFR-positive cancer cells for activation, whereas T cells expressing either HER2 or hEGFR PARs with the GSGGSG (SEQ ID NO: 1 13) linker were not activated under any of the tested conditions (FIG. 36C and FIGS. 38A- 38B). Using HER2 PAR T cells, the study confirmed that reporter expression depended on both the number of antigen-positive tumor cells in co-culture (FIG. 37B) and the concentration of Thrb in the supernatant (FIG. 37C). Furthermore, PAR activation required proteolytic activity of Thrb rather than merely abundance, as both the binding of recombinant HER2 antigen to PARs (FIG. 36D) and downstream reporter expression (FIG. 36E) were disrupted by bivalirudin, a peptide inhibitor of Thrb.
[0215] To quantify the kinetics of mimotope removal from the cell surface, the study stained HER2 PAR T cells for the Myc tag epitope, which was cloned upstream of the mimotope to monitor substrate cleavage (FIGS. 37D-37E). Immediately following the addition of Thrb, it was observed that linker proteolysis occurred rapidly, with a half-life of approximately ~22 minutes (FIG. 36F and FIG. 37F). Considering that cells can internalize their cell surface equivalents at a rate of one to five times per hour, it was reasoned that if the protease was no longer present, cleaved PARs on the cell surface would be replaced by their fully masked counterparts through receptor recycling. To test tills , the study cleaved PARs withThrb, then transferred these T cells to fresh media to remove Thrb and monitored the reappearance of the Myc tag, which reached half-maximum expression with a characteristic response time of ~8.7 hours (FIG. 36G and FIG. 37G). Last, the study quantified the kinetics of BFP reporter expression by sampling HER2 PAR T cells continuously co-cultured with HER2-positive MDA-MB-468 cells and Thrb. It was determined that the half-maximum BFP expression time constant was ~61 hours (FIG. 36H and FIG. 3711), and the reporter expression half-life was ~68 hours following the removal of Thrb and tumor cells (FIG. 361 and FIG. 371). The data indicated that a peptide substrate displayed by a PAR remains accessible for cleavage by an extracellular protease, that an unmasked PAR is free to bind to its target antigen to drive downstream reporter expression, and that the masked state can be restored once the target protease is removed.
[0216] To assess whether PAR T cells can be engineered to differentiate on- and off-target proteolysis, the study cloned IIER2 PARs using the sequences LVPRGSG (SEQ ID NO: 110), IEFDSG (SEQ ID NO: 111), and PLGLAG (SEQ ID NO: 112) as on-target substrate linkers for the proteases Thrb, granzyme B (GzmB) and matrix metalloproteinase (MMP) 9, respectively. The study co-cultured monoclonal populations of IIER2 PAR T cells displaying one substrate with HER2 -positive MDA-MB-468 cancer cells along with either recombinant Thrb, GzmB, or MMP9 (FIGS. 39A-39C). All three PAR T cells significantly upregulated BFP reporter expression (PcO.OOOl) when treated with their respective on-target protease but not with off-target proteases, while T cells encoding the GSGGSG (SEQ ID NO: 113) linker expressed BFP at basal levels, thereby indicating that peptide substrates retain their proteolytic activation and specificity when displayed on PARs as linkers.
[0217] Masked PARs increase specificity in off-tumor sites with antigen expression: Most tumor-associated antigens are also expressed in normal tissues, which can lead to off-tumor binding and receptor activation. It was postulated that PARs can minimize antigen-induced signaling in off-tumor organs when linkers remain intact. To test this, the study cloned primary murine T cells to express either a hEGFR PAR with the proteolytically stable GSGGSG (SEQ ID NO: 113) linker or an hEGFR synNotch receptor including the identical scFv sequence without the linker and peptide mimotope. synNotch T cells exhibited dose-dependent activation (KD= 7.1 nM) in presence of recombinant hEGFR coated on a plate whereas GSGGSG (SEQ ID NO: 113) PAR T cells were insensitive to all tested concentrations (FIG. 40A). To assess whether PARs retain their ability to block antigen binding in vivo, the study used a transgenic mouse model (B -hEGFR mouse) in which the murine EGFR protein is modified with the extracellular domain of the human counterpart (FIG. 40B). In this model, hEGFR is expressedill normal organs (liver, lung, kidneys, heart, and stomach; FIGS. 41A-41C) and can bind and activate hEGFR synNotch T cells in naive mice after systemic infusion (FIG. 41D). Using this model, the study tested whether GSGGSG (SEQ ID NO: 113) PARs mask activation compared to synNotch receptors. Twenty-four hours after intravenous administration, PAR expression resulted in a significant >75% reduction in the percentage of BFP reporter-positive cells compared to synNotch T cells for all organs tested (FIGS. 40C-40D), confirming that PARs can mask activation from antigen alone to increase tissue specificity in vivo.
[0218] To evaluate whether PAR T cells can lead to on-tumor activation, the study engineered ahEGFR PARs where the GSGGSG (SEQ ID NO: 113) linker was replaced with one of three substrates (RPLGLAGK (SEQ ID NO: 324), PAALRA (SEQ ID NO: 325), and KPLGLWAR (SEQ ID NO: 326)) previously shown to be selectively cleaved by MMPs. It was confirmed that hEGFR PAR T cells displaying each of these linkers were activated upon co-culture with hEGFR-expressing MC38 colorectal cancer cells (FIGS. 40E-40F), which overexpress MMPs (e.g., MMP1, 2, 9, 10; FIG. 42A). Among the tested substrates, KPLGLWAR (SEQ ID NO: 326) led to the highest PAR activation and was selected for further studies. Using a fluorogenic peptide containing KPLGLWAR (SEQ ID NO: 326) flanked with a fluorophore (5(6)-carboxyfluorescein, FAM) and quencher (DABCYL) pair, the study confirmed that incubation with several MMPs (MMP1, 7, 12, 13) leads to increased fluorescence whereas minimal activation was observed with 12 other proteases (FIG. 42B), indicating that KPLGLWAR (SEQ ID NO: 326) is selectively cleaved by cancer-associated MMPs.
[0219] The study next tested whether KPLGLWAR (SEQ ID NO: 326) PAR T cells can detect tumors in vivo. The study selected NanoLuc (NLuc) luciferase as a reporter for urinary detection given its rapid renal clearance kinetics (half-life: 17.4 min; -40.6% urinary recovery within 17.7 min; FIG. 43A). Substitution of the UAS-BFP reporter with a UAS-NLuc cassette that includes a secretion tag enabled KPLGLWAR (SEQ ID NO: 326) PAR T cells to secrete NLuc upon co-culture with hEGFR+ MC38 cells, resulting in 1.7-fold higher luminescent signal in the conditioned media compared to co-culture with antigen-negative cells (FIGS. 43B- 43C). For cancer detection, the study intravenously administered hEGFR synNotch and PAR T cells displaying either the tumor-selective KPLGLWAR (SEQ ID NO: 326) linker or GSGGSG (SEQ ID NO: 113) as a negative control in naive mice and mice bearing 11EGFR+ MC38 flank tumors. One day after T cell infusion, the study collected urine for a three-hour window, then quantified NLuc reporters by bioluminescent imaging (FIG. 40G and FIG. 44A). The study used B -hEGFR mice to account for background from off-tumor antigen expression.synNotch T cells produced similarly high levels of urinary reporters in both naive and tumorbearing mice while GSGGSG (SEQ ID NO: 113) PARs led to reduced reporter secretion in both cohorts. By contrast, KPLGLWAR (SEQ ID NO: 326) PAR T cells produced a significant >4-fold elevation in NLuc reporters in tumor-bearing mice compared to naive mice (FIGS. 40G-40H and FIG. 44B). Using receiver-operating characteristic (ROC) analysis, it was confirmed that KPLGLWAR (SEQ ID NO: 326) PAR T cells accurately discriminated tumorbearing mice (area-under-the-curve (AUROC) = 0.96; FIG. 401). These results indicate that PARs derived from tumor-selective substrates can mask background activation from off-tumor antigen expression while restoring signaling in the tumor to sensitively detect cancer.
[0220] Screening for on-target substrate linkers via PAR T cell display: To extend PARs for detection of human tumors, the study sought to identify substrates selectively cleaved in human cancers. In vitro methods for substrate selection using chemically synthesized peptide libraries have proved useful for identifying potential protein targets, deciphering substrate cleavage motifs, and quantifying enzyme kinetics but do not account for the tight spatial regulation of protease activity that occurs in living animals. While phage, yeast, and bacteria display can evaluate degenerate peptide libraries or those that tile the human proteome, outside of reports that used in vivo phage libraries to identify cryptic cleavage motifs or activatable cell penetrating peptides, the vast majority of previous studies select sequences based on their ability to bind to target tissue rather than their ability to be cleaved by proteases. Therefore, the study sought to evaluate whether PAR T cells displaying a library of substrate linkers could be applied for deep profiling of the substrate repertoire in human cancers in vivo. Toward this goal, the study first tested PAR T cell display in in vitro studies. The study assessed whether PAR T cells maintain linker-specific activation when in a small polyclonal mixture by labeling T cells displaying PLGLAG (SEQ ID NO: 112), IEFDSG (SEQ ID NO: 111), and LVPRGSG (SEQ ID NO: 110) linkers with either blue (CellTrace™ Blue), green (CeilTrace™ CFSE), or red (CellTrace™ Far Red) fluorescent dyes, respectively (FIG. 45 A). The study then combined these cells at a -1:1:1 ratio and co-cultured them with HER2 -positive cancer cells and either Thrb, GzmB, or MMP9. In samples treated with Thrb, it was found that approximately 90% of BFP reporter-positive T cells displayed the on-target substrate (LVPRGSG (SEQ ID NO: 110)) compared to T cells that displayed either the substrate for GzmB (2.6%) or MMP9 (4.0%) (FIG. 45B). Similarly, treatment of co-cultures with GzmB or MMP9 led to selective enrichment of cells displaying the respective on-target substrate (80.2% IEFDSG (SEQ ID NO: 111) for GzmB and 64.9% PLGLAG (SEQ ID NO: 1 12) for MMP9).
[0221] The study next validated that deep profiling with large libraries of PARs can identify on-target protease substrates in an in vitro setting. The study expressed a library of HER2 PARs with fully randomized substrate linkers four amino acids in length (4-mers) in primary human T cells. The resulting substrate distribution was unimodal, and >99% of all possible 4-mers (158,825 of 160,000 sequences) were detectable by next-generation sequencing (NGS; FIG. 46A and FIGS. 47A-47B). The study then individually incubated the library with 25 proteases across the five major catalytic classes (serine, aspartic, threonine, metalio, and cysteine) in co-culture with HER2 -positive MDA-MB-468 cancer cells. After 24 hours, BFP reporter-positive T cells were sorted and analyzed by NGS to quantify the enrichment in amplicon frequency for each substrate compared to the respective frequency in the untreated PAR T cell library (FIGS. 46A-46B), revealing distinct substrate clusters for each of the 25 proteases tested (FIG. 48A). To address potential sampling bias in the library that could lead to differences in NGS read counts apart from protease activity, the study performed a bootstrapping analysis to simulate sampling of the PAR library across 100 experimental wells (FIGS. 48B-48C). This analysis revealed 16,947 substrates that were likely to be sampled uniformly in all wells. Filtering the amplicon enrichment data using this downselected list of substrates retained the presence of distinct clusters of substrates enriched by different proteases (FIG. 46C and FIG. 48A). To support the validity of the observed substrate clusters, the study evaluated the frequency of substrates containing ProArg within each protease-specific cluster as Thrb and tissue-type plasminogen activator (tPA) are known to preferentially cleave after proline-arginine (ProArg) residues in the P2 and Pl positions. It was found that the clusters associated with Thrb and CPA had the highest percentage of ProArg motifs (FIG. 46D). This was further supported by position-specific scoring matrix (PSSM) analysis, which revealed that proline and arginine were among the two most frequent residues in positions 1-3 and 2-4, respectively, for sequences in the thrombin cluster (FIG. 46E).
[0222] To experimentally validate that hits from PAR T cell display are on-target substrates, the study selected one of the 20 most enriched sequences from each of the 25 protease-substrate clusters (FIG. 49), engineered monoclonal T cell sensors using each of the 25 selected substrates, and tested receptor activation by on- and off-target proteases. Notably, all sensors were significantly activated (P<0.0001 ) by their respective on-target protease (FIG. 46F and FIG. 50), and fourteen showed high selectivity with no detectable activation by any of the other proteases tested (P>0.05). These included substrates cleaved by collagenases (MPLD, APHK, and LPTD for MMP-1, MMP-8, and MMP-13, respectively), cathepsins (TTLF and EFLA for CTSD and CTSE, respectively), and caspases (TDVD and FDQD for CASP1 andCASP3, respectively) despite the redundancy in protease selectivity for native protein substrates within these families. Based on these results, the study applied PAR T cell display in vivo to profile the substrate repertoire of solid tumors.
[0223] Deep profiling of the substrate repertoire of breast cancer xenografts in living mice via PAR T cell display: Protease activity is tightly regulated in vivo via mechanisms such as spatial sequestration, expression as zymogens, suppression by pan -inhibitors, and dependence on pH or cofactors. Therefore, defining the substrate repertoire of solid tumors can accelerate the design of protease-activatable sensors, yet methods that permit deep profiling of the extracellular microenvironment of cancer remain notably limited. The study sought to determine whether in vivo PAR T cell display in mice bearing human xenograft tumors can nominate tumor-selective substrate sequences. To achieve this, primary human T cells displaying the 4-mer HER2 PAR library were adoptively transferred by intravenous administration to NSG mice bearing either HER2-positive or HER2-negative MDA-MB-468 breast tumors (FIG. 51 A). Flow analysis of tissue homogenates revealed a significant increase in the percentage of BFP-positive T cells isolated from HER2-positive tumors (19.6%) compared to those isolated from IIER2 -negative tumors (4.6%) (FIGS. 51B-51C and FIG. 52). By contrast, background PAR T cell activation in the blood, spleen, liver, and lungs, which may arise from mechanisms like ligand-independent activation, showed no statistically significant differences between tumor-bearing and naive mice. To identify tumor-selective substrates, the study performed NGS on BFP-positive T cells from HER2+ tumor-bearing mice and discovered 441 substrate amplicons that were significantly enriched in the tumor compared to the blood, spleen, liver, and lungs (FIG. 5 ID).
[0224] PAR T cells informed by in vivo display exhibit tumor-selective activation: The study selected 4 sequences - YPFP (SEQ ID NO: 320), LPQY (SEQ ID NO: 321), WETH (SEQ ID NO: 32.3), and YWDM (SEQ ID NO: 322) - with high enrichment in the tumor relative to the other tissues for validation using monoclonal PAR T cells. The study cloned a UAS-Firefly luciferase (Flue) reporter gene to quantify sensor activation by bioluminescent imaging (FIG. 53A). Adoptive transfer of each of the four sensors into separate cohorts of mice resulted in significantly higher luminescent signals in the tumor compared to the liver, spleen, lungs, kidneys, brain, and heart (PcO.OOOl for YPFP (SEQ ID NO: 320), LPQY (SEQ ID NO: 321), and YWDM (SEQ ID NO: 322); P<0.001 for WETH (SEQ ID NO: 323)) (FIGS. 51E- 5 IF and FIG. 53B). By contrast, the administration of T cells displaying an SGGS (SEQ ID NO: 1 14) control linker did not lead to measurable increases in tumor signal above background levels.
[0225] As LPQY (SEQ ID NO: 321) demonstrated the highest tumor-to-organ signal ratio, the study advanced this sequence for further validation to confirm that activation of PAR T cells is mediated by tumor-selective proteases. As MDA-MB-468 tumors express several MMPs at high levels in vivo (MMP1, 8, 9, 10, 12, and 13) (FIG. 54A), it was reasoned that tumor-associated MMP activity may contribute to cleavage of LPQY (SEQ ID NO: 321). Using a FAM / DABCYL fluorogenic peptide, the study tested that LPQY (SEQ ID NO: 321) is selectively cleaved by 8 MMPs with minimal activity from 17 other proteases (FIGS. 54B- 54C). Next, the study confirmed this by systemically administering LPQY (SEQ ID NO: 321) HER2 PAR T cells in HER2+ tumor-bearing mice pre-treated with an intratumoral injection of the broad-spectrum MMP inhibitor marimastat. Sensor activation was significantly reduced in marimastat-treated tumors compared with untreated HER2+ tumors. The study also observed reduced Flue reporter levels in cohorts with HER2 -negative tumors with or without marimastat treatment, confirming that activation of LPQY (SEQ ID NO: 321) PAR T cells is bothprotease- and antigen-dependent (FIG. 55). These results demonstrate that PAR T cell display in living animals enables the discovery of peptide substrates for cancer detection.
[0226] Bespoke imaging probe detects tumors without loss in selectivity: Protease activatable probes for fluorescence-guided surgery have either received regulatory approval or are under clinical evaluation for soft tissue sarcoma and breast cancer. The study therefore sought to determine whether a substrate validated by PAR T cell display could be applied across different platforms to design a customized imaging probe that retains high tumorselectivity. To enable in vivo imaging by near-infrared fluorescence (N1RF), the study designed the peptide probe with a near-infrared fluorophore and quencher pair and conjugated it to 8- arm polyethylene glycol (PEG) (FIG. 56A) to increase peptide circulation time and tumor accumulation by passive diffusion. It was confirmed that the LPQY (SEQ ID NO: 321) NIRF probe could be cleaved by MMPs while the SGGS (SEQ ID NO: 114) probe remained uncleaved (FIG. 56B). Next, the study evaluated the in vivo performance of this imaging probe, which highlighted tumors with elevated fluorescent signals compared to a probe that was synthesized using the SGGS (SEQ ID NO: 114) substrate when administered either intratumorally (FIGS. 56C-56D) or intravenously to account for circulation (FIGS. 56E-56F). Taken together, these results indicate that a substrate identified from unbiased discovery can be developed into a bespoke imaging probe for cancer detection.
[0227] OncoSCOUT enables urinary detection of small tumors: Biofluid-based biomarkers such as tumor-shed proteins and circulating tumor DNA hold promise for early cancer detection, yet most approaches to date do not achieve the high positive predictive valuerequired to minimize false positives for deployment in population-scale settings. Therefore, the study evaluated OncoSCOUT as an approach for detection of nascent tumors by intravenously administering PAR T cells designed to shed NLuc biomarkers into urine (FIG. 57A). Whereas T cells expressing SGGS (SEQ ID NO: 114) control linkers did not differentiate tumor-bearing mice from naive controls, LPQY (SEQ ID NO: 321) T cell sensors detected tumors with significantly higher levels of NLuc in urine one day after infusion (FIG. 57B). Given that T cells can be retained in tumors, the study tested whether longitudinally tracking urinary NLuc levels can improve detection accuracy. Elevated urinary reporters were produced for at least one week, and the NLuc signal accumulated over 7 days improved separation of tumor-bearing from naive mice (0.18 fmol higher (0.40 (tumor) - 0.22 (naive)) across days 1-7 vs. 0.07 fmol higher (0.12 - 0.05) on day 1 alone; FIG. 57C).
[0228] To assess whether OncoSCOUT detects early-stage tumors, the study benchmarked the limit of detection against CA 15-3 and circulating tumor DNA (ctDNA). CA 15-3 is an FDA-approved protein biomarker used to monitor progression and recurrence of breast tumors and shed by human breast cancer lines including MDA-MB-468 (FIG. 58). However, serum levels of CA 15-3 were elevated only for tumors larger than 100 mm3(FIG. 57D and FIG. 59A) with levels for mice with smaller tumors consistent with the expected physiological range of 0-30 U / mL. ctDNA assays have been FDA-approved to monitor minimal residual disease in colorectal, bladder, and breast cancers and are being developed for multi-cancer early detection. The study used a targeted amplicon sequencing panel that covers over 2,900 known hotspots for mutations in human cancers to identify a fingerprint of 20 mutations across 17 oncogenes and tumor suppressor genes in the gDN A of MDA-MB-468 breast cancer cells that were not present in healthy human T cells, including both single-nucleotide polymorphisms and indels (TABLE 1 and TABLE 2). To directly compare the performance of OncoSCOUT with ctDNA, the study injected LPQY (SEQ ID NO: 321) PAR T cells and, after 24 hours, collected plasma and urine from the same cohort of naive and tumor-bearing mice. The study- compared the total frequency of the 20 mutant amplicons to baseline levels in plasma from naive mice. ctDNA levels significantly increased for mice with 30-100 mm3tumors but not tumors below 30 mm3(FIG. 57E and FIG. 59B). By contrast, OncoSCOUT detected tumors as small as 10-30 mmJvia elevated urinary reporter levels (FIG. 57F and FIG. 59C), leading to significantly higher detection accuracy (AUROC=0.96) than both CA 15-3 (AUROC=0.57, P=0.04) and ctDNA (AUROC=0.67, P=0.03) for 10-30 mm3tumors (FIG. 57G and FIGS. 60A- 60C). These results indicate that OncoSCOUT can achieve earlier cancer detection compared to multiple classes of blood biomarkers.TABLE 1. Mutational fingerprint for MDA-MB-468 cancer cells. Mutations use HGVS nomenclature. Brackets indicate a mutation in only one allele. Counts per million reads were determined by sequencing the genomic DNA of primary human T cells or MDA-MB-468 cancer cells using the CleanPiex OncoZooni Cancer Hotspot Kit. Values shown are mean of two technical replicates. WT = wild-type amplicon, MUT = mutant amplicon.TABLE 2. Forward amplicon sequences for mutational fingerprint for MDA-MB-468 cancer cells.Discussion
[0229] The emergence of cell therapies and continual progress in synthetic biosensing circuits are motivating efforts to assess their potential as diagnostics, furthered by opportunities to lower the cost and improve the tolerability of engineered cells through recent advances in nonviral and in vivo cell manufacturing pipelines, tolerance of allogeneic sources, and humanization of synthetic components. The study developed T cell sensors that express masked protease-activatable receptors to selectively detect tumors via protease- and antigen-dependentsynthetic Notch receptor signaling. This study showed that T cells can be programmed as OncoSCOUT via a substrate linker to require cleavage by on-target proteases and developed a discovery pipeline using in vivo PAR T cell display to profile the substrate repertoire of solid tumors and select tumor-selective linkers. This study demonstrated that the ability of living immune cells to home to sites of disease can be leveraged for accurate detection of <30 mm’ tumors, consistent with previous work using macrophages as sensors of metabolic alterations to similarly detect tumors smaller than the -200 mm3detection limit of clinical positron emission tomography (PET) imaging. In tills study, the ability of T cells to persist in vivo also enabled detection of urinary biomarkers for at least one week in preclinical models, in contrast to most existing in vivo sensors such as molecular imaging probes that are read out within a few hours of administration. This may present strategies to use longitudinal measurements from a single infusion to increase specificity for early cancer detection, such as by confirming disease detection at a secondary timepoint or using cumulative signals to increase signal-to- noise ratios. Moreover, stem-like and memory T cell phenotypes have been shown to extend long-term persistence, supporting future longitudinal studies to evaluate T cell sensors for minimal residual disease detection and recurrence monitoring as some cancers can remain dormant for years after seemingly effective treatment.
[0230] Most surface display technologies like phage and yeast display primarily rely on binding to an affinity support through substrate linkers which, upon cleavage, release the phage or yeast for expansion and sequencing. By contrast, the study opted to express PAR libraries in primary human T cells to ensure compatibility with human tumors. Extending in vitro results to an in vivo context requires careful consideration because proteases are tightly regulated across tissues and their substrate promiscuity makes it likely that multiple proteases may act on any given sequence. Therefore, a key distinction of this study compared to other peptide display technologies is its focus on discovering substrates in living animals based on their selectivity for tumor tissue, which contains a diverse array of proteases, rather than targeting a single protease. Notably, this study discovered multiple substrates that were enriched in MDA- MB-468 breast tumors, including LPQY (SEQ ID NO: 321) that showed broad selectivity for a variety of MMPs in vitro and was inactivated in the presence of an MMP inhibitor in vivo. This paired with ELISA quantification of the tumor homogenates and the known roles of MMPs in tumor biology indicate that LPQY (SEQ ID NO: 321) is likely cleaved by a combination of MMPs in vivo.
[0231] While this screening pipeline directly supports discovery of PARs and design of T cell sensors, in the future, PAR profiling of tumors can accelerate the development of protease-activatable medicines across platforms. The data showing that the peptide LPQY (SEQ ID NO: 321) maintained tumor selectivity when formulated as a PEGylated imaging probe, similar to the FDA-approved cathepsin-activatable agent pegulicianine, outlines a potential strategy to integrate PAR display for drug design. Notably, although there are recognized differences in the protease proteome across species, approximately 500 murine proteases are orthologues of human enzymes, and pegulicianine and other activatable fluorescent probes in clinical efficacy studies have been shown to work similarly in mice and humans.
[0232] In summary, tills study outlines the use of PARs for deep profiling of the substrate repertoire in cancer and demonstrates the application of living T cell sensors, OncoSCOUT that express PARs for sensitive tumor detection. Additional work in the future to expand PARs to target different surface antigens could provide opportunities to define the molecular ‘coordinates’ of cancer based on proteolytic activity.Materials and Methods
[0233] Animal model: Female NSG mice (6- to 12-week-old), male and female C57BL / 6J, male and female B-hEGFR mice (5- to 12-week-old) were used at the outset of all experiments. NSG mice were bred in-house using breeding pairs purchased from The Jackson Laboratory. C57BL / 6J mice were purchases from The Jackson Laboratory. B-hEGFR mice expressing human EGFR were bred in-house using breeding pairs purchased from Biocytogen. In B-hEGFR mice, exons 2—17 of the mouse EGFR gene encoding the extracellular domain were replaced with the human counterparts, while the transmembrane, cytoplasmic, promoter, 5’ signal peptide, and 3’UTR regions were retained. Chimeric EGFR expression is driven by the endogenous mouse EGFR promoter, with native mouse EGFR transcription and translation disrupted. All animal procedures were approved by the Georgia Tech Institutional Animal Care and Use Committee (protocol no. A100190, A100191, A100193 and A100677). All authors complied with relevant ethical regulations while conducting this study.
[0234] Cell lines: Human embryonic kidney 293T and MDA-MB-468 cell lines were obtained from the American Type Culture Collection. MC38 cell line was a gift from the National Cancer Institute and D. Vignali, University of Pittsburgh). The cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM, Corning) supplemented with 10% fetal bovine serum (FBS, Sigma-Aldrich) and 1 % penicillin / streptomycin (Gibco). HER2-positive MDA-MB-468 cells were transduced by retrovirus with full-length human FIER2 and sorted by fluorescence-activated cell sorting (FACS) to >95% purity. EGFR-positive MC38 cells were transduced by lentivirus with truncated human EGFR and FACS sorted to >97% purity.
[0235] Primary human T cell isolation from healthy donors: Peripheral blood mononuclear cells (PBMCs) were obtained from healthy donors (IRB no. H20288) by venipuncture and isolated by density gradient using Lymphocyte Separation Media (Corning). CD3+ T cells were enriched from PBMCs using EasySep Human CD3 Cell Isolation kits (Stem Cell Technologies) according to the manufacturer’s instructions. Isolated CD3+ T cells were cultured in human T cell media including X-VIVO 10 (Lonza), 5% human AB serum (Valley Biomedical), 10 mM N-acetyl L-cysteine (Sigma- Aldrich), and 55 pM P-mercaptoethanol (Sigma- Aldrich) supplemented with 50 units per ml human IL-2 (Corning). All cells were cultured at 37°C in 5% CO2.
[0236] Primary murine T cell isolation: Mouse T cells (mTCs) were isolated from healthy C57BL / 6J mouse spleens using the same protocol of previous work. CD3+ T cells were enriched from splenocytes using EasySep mouse T Cell Isolation kits (Stem Cell Technologies) according to the manufacturer’s instructions. Isolated T cells were then stimulated with mouse CD3 / CD28 dynabead (Thermo fisher) with a 1: 1 ratio and cultured in mouse T cell media (m'l'CM) including RPMI-1640 (HyClone) with 10% Fetal Bovine Serum (FBS, Sigma- Aldrich), lx MEM nonessential amino acids and 1 mM sodium pyruvate (Corning), 55 pM p- mercaptoethanol (Sigma- Aldrich), supplementing with 100 units per ml human IL-2 (Corning ). Cells were cultured at 37°C in 5% CO2 and maintained at IxlO6cells / mL.
[0237] Masked anti-HER2 synNotch and masked anti-EGFR synNotch plasmid construction: Anti-HER2 synNotch receptors and response elements were obtained from Addgene# 85424 and 79130, respectively. The DNA sequence encoding a human CD8a signal peptide (MALPVTALLLPLALLLHAARP (SEQ ID NO: 121)), myc-tag (EQKLISEEDL (SEQ ID NO: 118)), peptide mimotope (LLGPYEL WELSH (SEQ ID NO: 1)), and protease substrate flanked by GS linkers was codon-optimized and cloned into the N-temiinus of the scFv in the anti-HER2 synNotch-Gal4VP64 construct. Anti-EGFR was cetuximab-derived scFv and cloned into pMKO.l retroviral vector which included synNotch receptors and response elements. The DNA sequence encoding mouse CD8a signal peptide (MASPLTRFLSLNLLLLGESIILGSGEA (SEQ ID NO: 120)), myc-tag, EGFR peptide mimotope (QGQSGQCISPRGCPDGPYVMY (SEQ ID NO: 4)), non-cleavable sequence (GSGGSG (SEQ ID NO: 1 13)), thrombin cleavable substrate (LVPRGSG (SEQ ID NO: 110)) or MC38 tumor specific substrate (RPLGLAGK (SEQ ID NO: 324), PAALRA (SEQ ID NO: 325), KPLGLWAR (SEQ ID NO: 326)) were codon-optimized for murine and cloned into the EGFR synNotch construct. All cloning was performed using amplification by polymerase chain reaction with Phusion DNA Polymerase (New England Biolabs) and restriction enzymedigestion. Plasmids were verified by Sanger sequencing (Eurofins Genomics), whole plasmid sequencing (Priniordium Labs), and / or next-generation sequencing (Admera Health) prior to use. Plasmid DNA was purified using the E.Z.N.A.™ Endo Free Plasmid Maxi Kit (Omega Bio-Tek). For generations of plasmid libraries for substrate screening, an oligo library of 160,000 sequences encoding the fully degenerate 4-mer substrate library was synthesized (Twist Bioscience) and cloned into the masked anti-HER2 synNotch receptor plasmid.
[0238] Lentiviral production and human T cell transduction: Lenti virus was produced by co-transfection of lentiviral expression plasmids withpsPAX2 and pMD2.G using TransIT- L'TT transfection reagent (Mims Bio) and HEK293T cells. Viral supernatant was collected after 48 hours, concentrated using PEG-it Vims Precipitation Solution (System Biosciences) following the manufacturer’s protocol, and stored at -80°C until use. Activated human T cells were co-transduced by mixing two viral constructs encoding the PAR (Multiplicity of infection (MOr)=l) and the synNotch-activated reporter (MOI=5). Concentrated lentivims was used to transduce T cells by addition to a 24-well suspension culture plate coated with retronectin (Takara) according to the manufacturer’s instmctions, followed by centrifugation at l,200xg for 90 minutes at 37°C. Activated human T cells were added to each well in human T cell media supplemented with 100 units / mL of human IL-2, and the plate was spun at l,200xg for 60 minutes at 37°C. Cells were incubated on the vims-coated plate for 24 hours before expansion, and transduction efficiency was evaluated by flow cytometry analysis of cells stained with anti-myc tag antibodies and cells expressing mCherry. Seven days after activation, T cells were supplemented with Dynabeads at a 1:1 bead to cell ratio. The beads were removed on day 9. Cells were maintained at a concentration of 7x105 to 2x106 cells / mL until day 10- 14 for use in downstream assays. To minimize manufacturing bias of library production, a minimum 10-fold representation of the library was maintained at each step — plasmid amplification, lentivims production, T cell transduction, and maintenance.
[0239] Retroviral production and mouse T cell transduction: Retro vims wras produced by co-transfection with pCL-Eco and pMKO.l retroviral vectors encoding EGFR PAR or Luminescence reporter in HEK293T cells using TransIT-293. Cell supernatant was collected 24 and 48 hours later and combined for filtering through a 0.22 pm rapid-flow filter unit (Nalgene). The retrovirus was store at -80 °C until use. Activated mouse T cells were cotransduced by mixing two retrovirus encoding the 11EGFR PAR and the synNotch-activated luminescent reporters. The mixture of 1 mL retrovirus and 4 ng / mL polybrene with le6 T cells were added to a 24-well suspension plate pre-coated with retronectin (Takara), followed by centrifugation at 2000 xg at 32 °C for 2 h. And 1 mL of fresh mTCM supplemented with IL-2(100 units / ml) were added on the top of each well after 4 h of centrifugation. The transduced T ceils were cultured in the 24-well plate overnight and transferred to the centrifugation tubes and spined down at 1000 xg at RT for 5 min to remove the virus, following by resuspension in mTCM with IL-2, and seeded to a flask at a concentration of le6 celis / niL for expansion. T cell transduction was check after 24 and 48 hours by flow cytometry for expression of niyc-tag and mCherry (or eGFP). Dynabeads were removed 48 hours post transduction. The transduced cells were then either sorted for co-expression of niyc+ and mCherry+ (or eGFP+) and maintained at le6 cells / mL for further in vitro studies or injected to mice for in vivo studies.
[0240] In vitro PAR T cell activation: Target cancer cells were seeded in a 96-well plate overnight. PAR T cells were co-incubated with seeded cancer cells with or without target protease at a 1:1 ratio at 37°C. The cultures were analyzed for reporter expression after 24 h with a BD Fortessa (BD Biosciences; FACSDiva v8 software) or Aurora (Cytek Biosciences; SpectroFlo v3.2.1 software) flow cytometer. All flow cytometry analysis was performed with FlowJo software.
[0241] hEGFR synNotch and hEGFR PAR T cell activation in B-hEGFR mice model: PAR T cells were generated by co-transducing mouse ( 1 )3 T cells with retroviral constructs encoding EGFR synNotch or PAR, along with mCherry reporters. Transduced T cells were intravenously injected into B-hEGFR mice. Twenty-four hours after injection, the mice were euthanized, and the liver, lungs, kidneys, heart, and stomach were harvested. T cells were isolated from each organ and stained with Live / Dead NIR (Thermo Fisher), aCD45-PE-Cy7, and aCD3-BV750, each at a 1:50 dilution from stock concentrations. Stained ceils were analyzed on an Aurora flow cytometer (Cytek Biosciences) using SpectroFlo v3.2.1 software.
[0242] Synthesis of fluorogenic peptide substrate: Protease substrate peptides with 5(6)- carboxyfluorescein (FAM) fluorophore and N-[4-(4-dimethylamino)phenylazo]benzoic acid (DABCYL) quencher (FAM-[Substrate]-(K-DABCYL)-NH2) were synthesized in-house using the Liberty Blue peptide synthesizer (CEM). The peptide synthesis scale used was 0.025 mmol, and low-loading rink amide resin (CEM) was used. Amino acids (Chem-Impex) were resuspended in dimethylformamide (0.2 M), as were all synthesis buffers. Activator buffer used was diisopropylcarbodiimide (DIG; Sigma) (0.25 M) and the activator base buffer was Oxyma (0.25 M; CEM), while the deprotection buffer was piperidine (20% v / v; Sigma). After synthesis, peptides were cleaved off resin using with a mixture of 92.5% trifluoroacetic acid, 2.5% water, 2.5% triisopropylsilane, and 2.5% 3,6-dioxa-l,8-octane-dithiol for 30-45 minutes at 41 °C using Razor (CEM). After cleavage, peptides were precipitated in ice-cold diethyl ether and vacuum-dried overnight. Peptides were validated by liquid chromatography-mass spectrometry (1260 Infinity II HPLC and single quadrupole LC / MSD, Agilent). Purity of all peptides was >80%.
[0243] Fluorogenic substrate cleavage assay: Fluorogenic peptides (5 pM) were mixed with recombinant proteases (50 nM, diluted according to manufacturer’s buffer) or tissue lysate and incubated at 37°C. Fluorescence was measured by Cytation 5 plate reader (Biotek; Gen5 software). Protease concentrations were 50 nM unless otherwise specified. For preparing tissue lysate, tumor and organs were isolated and dissociated using FastPrep-24 homogenizer (MP Biomedicals) with beads (Lysing Matrix D, MP Biomedicals) in tissue protein extraction buffer (T-PER, ThermoFisher). Homogenate was isolated by centrifugation at 14,000xg for 5 minutes.
[0244] Circulation half-life and urine clearance of recombinant NLuc: Recombinant NanoLuc (NLuc) (200 frnol) was administered intravenously to naive NSG mice. At designated time points post-administration, blood and urine were collected from separate cohorts of mice. Serum was isolated by centrifugation. Samples were mixed with the Nano-GloIMLive Cell Assay System (Promega) and immediately analyzed. Luminescence was quantified using a standard curve generated with recombinant NLuc.
[0245] PAR T cell sensor for tumor detection via urinary synthetic biomarkers: PAR T cells were injected i.v. into tumor-bearing mice and naive mice. Urine was collected for a three-hour window one day after injection or longitudinally for up to 7 days Luminescence was quantified using a standard curve of recombinant NLuc.
[0246] Mapping human protease-substrate repertoire: HER2 PAR T cell library was generated by co-transducing 10 million CD3+ 'I' cells with a HER2 PAR lenti viral library encoding 160,000 substrates sequences (MOI 1) and a lenti virus encoding the synNotch- activated BFP reporter (MOI 5). 2 million FACS-sorted cells were coincubated with one million HER2 expressing MDA-MB-468 cells with or without target protease (100 nM) at 37°C for 24 hours. After incubation for 24 h, activated PAR cells were sorted (FACSAria, BD Biosciences) on BFP expression and pelleted at lOOOxg for 3 min before genomic DNA (gDNA) isolation.
[0247] Mapping substrate repertoire in breast tumor model: Ten million FACS-sorted T cells expressing the PAR library were intravenously injected into naive mice or mice bearing HER2-negative or HER2-positive MDA-MB-468 tumors (-100 mm3in size). Twenty-four hours after injection, mice were euthanized, and the tumor, spleen, blood, liver, and lungs were collected to isolate T cells. The tumors were minced and digested for 30 min in RPMI with 0. 1 nig / mL DNase (Roche) and 0.2 mg / mL collagenase P (Roche) at 37°C. Digested tumors werepassed over a 75 um cell strainer before cells were collected by centrifugation, treated with red blood cell (RBC) lysis buffer (Biolegend), washed with PBS, and resuspended in FACS buffer (lx DPBS, 2% FBS, 1 mM EDTA, 25 mM HEPES). Spleens were gently dissociated using frosted glass slides before splenocytes were centrifuged at lOOOxg for 5 min, resuspended in RBC lysis buffer for 5 min at 4°C, washed with PBS, and resuspended in FACS buffer. For blood, 500 pL was collected prior to euthanasia in an EDTA-coated tube. Blood samples were mixed with 5 mL of red blood cell lysis for 5 min at 4°C, washed with PBS, and resuspended in FACS buffer. Livers were forced through a 75 pm cell strainer using the barrel of 5 mL syringe and centrifuged at 500xg for 10 min. The pellets were suspended in 8 mL of 40% Percoll (in RPMI) and overlaid on 5 mL of a 67% Percoll fraction. Percoll gradient separation was performed by centrifugation at 840xg for 20 min at room temperature. The lymphocytes were collected at the interface, washed, and resuspended in FACS buffer. The lungs were minced and digested for 30 min in RPMI with 0.1 mg / mL DNase (Roche) and 0.2 mg / mL collagenase D (Roche) at 37°C. The digested lungs were passed over a 75 pm cell strainer, followed by centrifugation at 500xg for 5 min. The cells were then treated with red blood cell lysis buffer (Biolegend), washed with PBS, and resuspended in FACS buffer. The isolated cells from each organ were stained with ctCD3 (300406) at 1 : 100 dilution from stock concentrations. Stained cells were analyzed and sorted for BFP expression using a FACSAria (BD Biosciences; FACSDiva software).
[0248] Genomic DNA purification and NGS library preparation: The gDNA of sorted BFP+ T cells was extracted using QIAprep Spin Miniprep Kit according to manufacturer’s protocol. At least two million unsorted library cells (>10 times the diversity of the library) were collected from culture and prepared as an input sample for each screen. The library was amplified with the following primers, which contain overhangs encoding the binding sites and adaptors: F5’ TGCTTGGTCCTTATGAGCTG (SEQ ID NO: 318) and R5’ GTGAGGCTCTGCAGGTTATTG (SEQ ID NO: 319). Library preparation and NGS sequencing (50 million paired end reads) were performed by Admera Health using an Illumina NovaSeq.
[0249] Extraction of amplicon counts from NGS paired end reads: Raw FASTQ sequencing files containing paired end reads were analyzed using custom code on R. Briefly, the code used the ShortRead package to iteratively input forward and reverse reads, filter out misaligned and low-quality (Phred<30) paired-end reads, and translate reads into amino acid sequences. Sequences were further filtered by excluding sequences with mismatches in the 9 residues upstream or downstream of the random 4-mer region and sequences in which the 4-nier region encoded a stop codon. The final list of sequences was tabulated into amplicon counts and exported to Microsoft Excel for hit selection.
[0250] Analysis and hit selection for in vitro screening: To generate the initial heat map without bootstrapping, the study converted amplicon counts for samples generated from each protease into frequencies, which were normalized to fold-changes using the corresponding frequencies in the original library. Substrates were clustered based on the protease that generated the highest fold-change value for each sequence. Heat maps were generated from the log2 fold-change values using the Seaborn package on Python. Bootstrapping analysis was performed using custom code on R. Hits were selected by rank-ordering the substrates in each protease’s cluster based on highest fold-change in amplicon frequency and choosing one of the top 20 substrates.
[0251] Analysis and hit selection for in vivo screening: The study converted amplicon counts for samples generated from each organ (tumor, blood, spleen, liver, and lungs) into frequencies. Substrates that were not detected in the tumor were excluded from further analysis. For all remaining substrates, the study calculated the ratio of the frequency in the tumor to the frequency in each of the non-tumor organs and determined which substrates had tumor-to- organ ratios greater than 1.96 standard deviations above the mean, corresponding to a P-value of 0.05. Tumor-selective substrates were defined as substrates with significant tumor selectivity (P < 0.05) compared to all four non-tumor organs.
[0252] In vivo bioluminescence imaging to validated PAR encoded hit substrates: PAR T cells were generated by co-transducing CD3+ T cells with lentiviral constructs for HER2 PAR encoding hit substrate sequences (YPFP (SEQ ID NO: 320), L PQY (SEQ ID NO: 321), YWDM (SEQ ID NO: 322) and WETH (SEQ ID NO: 323)) and Firefly luciferase (Flue) reporters. Five million PAR T cells were intravenously injected into mice bearing HER2- expressing MDA-MB-468 tumors (100 mm3). Twenty-four hours after injection, mice were euthanized, and the tumor, spleen, blood, liver, lungs, kidneys, brain, and heart were harvested. The organs were immersed in D-luciferase (Gold Biotechnology, 90 pg / mL) solution for 30 min. Flue activity was measured using an IVIS Spectrum CT (PerkinElmer).
[0253] Synthesis of 8-arm PEG near-infrared fluorescent probe: Peptides (Fmoc-GG- [Substrate]-GGXkC-NH2; lower-case represents d-amino acid, X represents L- propargylglycine) containing the LPQY (SEQ ID NO: 321) hit substrate or the SGGS (SEQ ID NO: 114) control sequence were synthesized in-house by Fmoc solid phase peptide synthesis on a Liberty Blue peptide synthesizer (CEM) using low-loading rink amide resin (CEM). Fmoc deprotection was performed on Liberty Blue, and resin-coupled peptides were N-terminallylabeled with Tide Quencher 7WS (TQ7) succinimidyl ester (AAT Bioquest) in dimethyl sulfoxide with 4-10 eq. triethylamine at 37C for 2 hours. Peptides, which were synthesized with propargylglycine, were cleaved from resin and labeled with sulfo-cyanine7 azide (Lumiprobe) by copper(I)-catalyzed azide-alkyne cycloaddition (CuAAC). CuAAC reaction was performed using copper(II) sulfate, tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), ascorbic acid, and aminoguanidine in phosphate -buffered saline (PBS) at 37C overnight. The resulting near-infrared fluorescent (NIRF) peptides were purified on a 1260 Infinity II HPLC system (Agilent) until a purity of 80% was achieved. NIRF peptides were conjugated to 20 kDa 8-arm polyethylene glycol maleirnide (PEG-MAL; Creative PEGWorks, catalog # PSB-862) in PBS (pH 7.2) at room temperature overnight; 2 mM ethylenediaminetetraacetic acid was added to the reaction to reduce formation of disulfide bonds between peptides. Unreacted maleirnide groups were quenched with L-cysteine, and PEG NIRF probes were purified by fast performance liquid chromatography (AKTA Pure, GE Healthcare; Unicorn software) using a size exclusion column (Superdex 200 Increase 10-300 GL).
[0254] Near-infrared fluorescent probe with hit substrate for tumor detection: LPQY (SEQ ID NO: 321) or SGGS (SEQ ID NO: 1 14) NIRF Cy7 / TQ7-labeled PEG probes were injected intratumorally (3 nmol) or intravenously (5 nmole) into mice bearing HER2- expressing MDA-MB-468 tumors. After injection for 24 h, mice were anaesthetized with isoflurane gas, and fluorescence signal was measured using an IVIS Spectrum CT. Tumor fluorescence was measured post-necropsy using Odyssey CLx (LI-COR; ImageStudio software).
[0255] Plasma preparation and ctDNA mutation analysis: Blood was collected via terminal cheek bleed into EDTA-coated tubes and maintained on ice until processing. Plasma was separated by two-step centrifugation: 1,600 x g for 10 min at 4 °C, followed by 14,000 x g for 10 min at 4 °C to remove residual debris. The clarified plasma was stored at -80 °C until further use. ctDNA was extracted using the Mag-Bind™ cfDNA Kit (Omega Bio-tek) according to the manufacturer’s protocol. Library preparation and next-generation sequencing (NGS) were performed by Admera Health using the OncoZoom™ Cancer Panel (Paragon Genomics). For identifying the mutational fingerprint, sequencing data from gDNA of MDA- MB-468 cells was processed by filtering out low-quality reads (Phred score < 30), and forward read amplicons that were not found in healthy human T cells and were distinct from the Genome Reference Consortium Human Build 38 sequence were identified as mutant amplicons. For analysis of plasma samples, the total read count was quantified as all reads with Phred score > 30. Reads for each mutant amplicon were further processed by removingmisaligned paired-end reads. Subsequently, the ratio of reads across the 20 identified mutant amplicons to the total read count was quantified for each mouse.
[0256] Statistical analysis: Appropriate statistical analyses were performed using GraphPad Prism (*P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001). Central values represent mean and error bars depict SD. At least 3 replicates were used for all statistical analyses. Flow cytometry data were analyzed using FlowJo X (Flow Jo, LLC). Power analyses were performed using G*Power 3.1 (HHUD). NIRF images were analyzed using Image Studio (LI-COR). Ex vivo and in vivo luminescence data were collected and analyzed with Living Image 4.4.5 (PerkinElmer). Figures were designed in Adobe Illustrator.EXAMPLE ASPECTS
[0257] Example 1: A mimotope comprising about 80% similarity or more to any one of SEQ ID NOS: 5-105.
[0258] Example 2: An engineered protease activatable receptor (PAR) comprising: i) a synthetic Notch (synNotch) construct comprising: a signal peptide; an antigen-binding domain; a synNotch core; and a transcription factor; ii) the mimotope of any examples herein, particularly Example 1 , wherein the mimotope binds to the antigen-binding domain; and iii) a protease-cleavable linker connecting the synNotch construct to the mimotope.
[0259] Example 3: The engineered PAR of any examples herein, particularly Example 2, wherein the protease-cleavable linker is cleaved by a protease that is associated with healthy tissue.
[0260] Example 4: The engineered PAR of any examples herein, particularly Example 3, wherein the protease-cleavable linker is cleaved by a tissue-specific protease.
[0261] Example 5: The engineered PAR of any examples herein, particularly Example 4, wherein the tissue is kidney tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 782-791; wherein the tissue is liver tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 792-801 ; wherein the tissue is lung tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 802-811; wherein the tissue is heart tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 812-821; wherein the tissue is blood, and the protease-cleavable linker comprises any one of SEQ ID NOS: 822-831 ; wherein the tissue is spleen tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 832-841; wherein the tissue is lymph node tissue, and the protease- cleavable linker comprises any one of SEQ ID NOS: 842-851; wherein the tissue is stomach tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 852-861; wherein the tissue is ovarian tissue, and the protease-cleavable linker comprise any one of SEQ ID NOS :862-871; wherein the tissue is uterine tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 872-881 ; wherein the tissue is mammary gland tissue, and the protease- cleavable linker comprises any one of SEQ ID NOS: 882-891; wherein the tissue is prostate tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 892-901; wherein the tissue is testicular tissue, and the prostate-cleavable linker comprises any one of SEQ ID NOS: 902-911 ; wherein the tissue is intestinal tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 912-921; wherein the tissue is bladder tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 922-931; wherein the tissue is brain tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 932-941; or wherein the tissue is thymic tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 942-951.
[0262] Example 6: The engineered PAR of any examples herein, particularly Example 2, wherein the protease-cleavable linker is cleaved by a protease that is associated with a disease or disorder.
[0263] Example 7: The engineered PAR of any examples herein, particularly Example 6, wherein the protease-cleavable linker is cleaved by a cancer-associated protease or a tumor- associated protease.
[0264] Example 8: The engineered PAR of any examples herein, particularly Example 7, wherein the protease-cleavable linker is cleaved by a protease that is enriched in a tumor or a cancer expressing an antigen that binds to the antigen-binding domain.
[0265] Example 9: The engineered PAR of any examples herein, particularly Examples 7- 8, wherein the cancer is breast cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 320-323 or any one of SEQ ID NOS: 576-662; wherein the cancer is colon cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 324-326 or any one of SEQ ID NOS: 663-682; wherein the cancer is small cell lung carcinoma, and the protease-cleavable linker comprises any one of SEQ ID NOS: 683-702; wherein the cancer is ovarian cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 693-712; wherein the cancer is prostate cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 713-732; wherein the cancer is liver cancer, and the protease-cleavable linker comprises SEQ ID NO: 375, SEQ ID NO: 411, SEQ ID NO: 425, SEQ ID NO: 435, SEQ ID NO: 458, SEQ ID NO: 473, SEQ ID NO: 518, SEQ ID NO: 556, SEQ ID NO: 568, or any one of SEQ ID NOS: 733-743; wherein the cancer is adenocarcinoma, and the protease-cleavable linker comprises SEQ ID NO: 468, SEQ ID NO: 567, or any one of SEQ ID NOS: 744-761;wherein the cancer is renal cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 762-781.
[0266] Example 10: The engineered PAR of any examples herein, particularly Example 9, wherein the antigen is HER2, and the protease-cleavable linker comprises any one of SEQ ID NOS: 320-323; or wherein the antigen is EGER, and the protease-cleavable linker comprises any one of SEQ ID NOS: 324-326.
[0267] Example 11: The engineered PAR of any examples herein, particularly Examples 2-10, wherein the protease-cleavable linker is cleaved by thrombin and comprises any one of SEQ ID NOS: 106-110 or any one of SEQ ID NOS: 396-405; wherein the protease-cleavable linker is cleaved by granzyme B and comprises SEQ ID NO: 111 or any one of SEQ ID NOS: 446-455; wherein the protease-cleavable linker is cleaved by MMP9 and comprises SEQ ID NO: 112 or any one of SEQ ID NOS: 546-555; wherein the protease-cleavable linker is cleaved by CASP1 and comprises any one of SEQ ID NOS: 327-336; wherein the protease-cleavable linker is cleaved by CASP3 and comprises any one of SEQ ID NOS: 337-346; wherein the protease-cleavable linker is cleaved by CASP8 and comprises any one of SEQ ID NOS: 347- 356; wherein the protease-cleavable linker is cleaved by CTSD and comprises any one of SEQ ID NOS: 357-366; wherein the protease-cleavable linker is cleaved by CTSE and comprises any one of SEQ ID NOS: 367-376; wherein the protease-cleavable linker is cleaved by CTSG and comprises any one of SEQ ID NOS: 377-385; wherein the protease-cleavable linker is cleaved by CTSS and comprises any one of SEQ ID NOS: 386-395; wherein the protease- cleavable linker is cleaved by FAP and comprises any one of SEQ ID NOS: 406-415; wherein the protease-cleavable linker is cleaved by FXIA and comprises any one of SEQ ID NOS: 416- 425; wherein the protease-cleavable linker is cleaved by GGT1 and comprises any one of SEQ ID NOS: 426-435; wherein the protease-cleavable linker is cleaved by GZMA and comprises any one of SEQ ID NOS: 436-445; wherein the protease-cleavable linker is cleaved by H2.0S and comprises any one of SEQ ID NOS: 456-465; wherein the protease-cleavable linker is cleaved by KLK2 and comprises any one of SEQ ID NOS: 466-475; wherein the protease- cleavable linker is cleaved by MMP1 and comprises any one of SEQ ID NOS: 476-485; wherein the protease-cleavable linker is cleaved by MMP10 and comprises any one of SEQ ID NOS: 486-495; wherein the protease-cleavable linker is cleaved by MMP12 and comprises any one of SEQ ID NOS: 496-505; wherein the protease-cleavable linker is cleaved by MMP13 and comprises any one of SEQ ID NOS: 506-515; wherein the protease-cleavable linker is cleaved by MMP2 and comprises any one of SEQ ID NOS: 516-525; wherein the protease- cleavable linker is cleaved by MMP3 and comprises any one of SEQ ID NOS: 526-535;wherein the protease-cleavable linker is cleaved by MMP8 and comprises any one of SEQ ID NOS: 536-545; wherein the protease-cleavable linker is cleaved by TP A and comprises any one of SEQ ID NOS: 556-565; or wherein the protease-cleavable linker is cleaved by UPA and comprises any one of SEQ ID NOS: 566-575.
[0268] Example 12: An engineered protease activatable receptor (PAR) comprising: i) a synthetic Notch (synNotch) construct comprising: a signal peptide; an antigen-binding domain; a synNotch core; and a transcription factor; ii) a mimotope that binds to the antigen-binding domain; and iii) a protease-cleavable linker connecting the synNotch construct to the mimotope, wherein the protease-cleavable linker is cleaved by a protease that is enriched in a tumor or a cancer expressing an antigen that binds to the antigen-binding domain.
[0269] Example 13: The engineered PAR of any examples herein, particularly Example12, wherein the cancer is breast cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 320-323 or any one of SEQ ID NOS: 576-662; wherein the cancer is colon cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 324-326 or anyone of SEQ ID NOS: 663-682; wherein the cancer is small cell lung carcinoma, and the protease-cleavable linker comprises any one of SEQ ID NOS: 683-702; wherein the cancer is ovarian cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 693-712; wherein the cancer is prostate cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 713-732; wherein the cancer is liver cancer, and the protease-cleavable linker comprises SEQ ID NO: 375, SEQ ID NO: 411, SEQ ID NO: 425, SEQ ID NO: 435, SEQ ID NO: 458, SEQ ID NO: 473, SEQ ID NO: 518, SEQ ID NO: 556, SEQ ID NO: 568, or any one of SEQ ID NOS: 733-743; wherein the cancer is adenocarcinoma, and the protease-cleavable linker comprises SEQ ID NO: 468, SEQ ID NO: 567, or any one of SEQ ID NOS: 744-761; wherein the cancer is renal cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 762-781.
[0270] Example 14: The engineered PAR of any examples herein, particularly Example13, wherein the antigen is HER2, and the protease-cleavable linker comprises any one of SEQ ID NOS: 320-323; or wherein the antigen is EGER, and the protease-cleavable linker comprises any one of SEQ ID NOS: 324-326.
[0271] Example 15: The engineered PAR of any examples herein, particularly Examples 12-14, wherein the mimotope comprises about 80% similarity or more to any one of SEQ ID NOS: 1-105.
[0272] Example 16: An immune cell comprising: a) the engineered PAR of any examples herein, particularly Examples 2-15; and b) a reporter nucleic acid encoding: i) a promoter thatis activatable by transcription factor; and ii) a reporter molecule linked to a secretion tag; wherein, upon cleavage of the protease-cleavable linker by a protease in the presence of an antigen that binds to the antigen-binding domain, the mimotope is released from the antigenbinding domain and the antigen-binding domain binds to its cognate antigen, thereby causing the transcription factor to be released from the synNotch construct and bind to the promoter, thereby inducing expression of the detectable signal linked to the secretion tag.
[0273] Example 17: An immune cell comprising: a) an engineered protease activatable receptor (PAR) comprising: i) a synthetic Notch (synNotch) construct comprising: a signal peptide; an antigen -bin ding domain; a synNotch core; and a transcription factor; ii) a mimotope that binds to the antigen-binding domain; iii) a protease-cleavable linker connecting the synNotch construct to the mimotope; b) a reporter nucleic acid encoding: i) a promoter that is activatable by transcription factor; and ii) a reporter molecule linked to a secretion tag; wherein, upon cleavage of the protease-cleavable linker by a protease in the presence of an antigen that binds to the antigen-binding domain, the mimotope is released from the antigen-binding domain and the antigen-binding domain binds to its cognate antigen, thereby causing the transcription factor to be released from the synNotch construct and bind to the promoter, thereby inducing expression of the detectable signal linked to the secretion tag.
[0274] Example 18: The immune cell of any examples herein, particularly Example 17, wherein the mimotope comprises about 80% similarity or more to any one of SEQ ID NOS: 1 - 105.
[0275] Example 19: The immune cell of any examples herein, particularly Examples 17- 18, wherein the protease-cleavable linker is cleaved by a protease that is associated with healthy tissue.
[0276] Example 20: The immune cell of any examples herein, particularly Example 19, wherein the protease-cleavable linker is cleaved by a tissue-specific protease.
[0277] Example 21: The immune cell of any examples herein, particularly Example 20, wherein the tissue is kidney tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 782-791; wherein the tissue is liver tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 792-801; wherein the tissue is lung tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 802-81 1 ; wherein the tissue is heart tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 812-821; wherein the tissue is blood, and the protease-cleavable linker comprises any one of SEQ ID NOS: 822-831; wherein the tissue is spleen tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 832-841; wherein the tissue is lymph node tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 842-851; wherein the tissue is stomach tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 852-861; wherein the tissue is ovarian tissue, and the protease-cleavable linker comprise any one of SEQ ID NOS : 862-871; wherein the tissue is uterine tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 872-881; wherein the tissue is mammary gland tissue, and the protease- cleavable linker comprises any one of SEQ ID NOS: 882-891; wherein the tissue is prostate tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 892-901; wherein the tissue is testicular tissue, and the prostate-cleavable linker comprises any one of SEQ ID NOS: 902-911; wherein the tissue is intestinal tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 912-921; wherein the tissue is bladder tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 922-931; wherein the tissue is brain tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 932-941; or wherein the tissue is thymic tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 942-951.
[0278] Example 22: The immune cell of any examples herein, particularly Examples 17- 18, wherein the protease-cleavable linker is cleaved by a protease that is associated with a disease or disorder.
[0279] Example 23: The immune cell of any examples herein, particularly Example 22, wherein the protease-cleavable linker is cleaved by a cancer-associated protease or a tumor- associated protease.
[0280] Example 24: The immune cell of any examples herein, particularly Example 23, wherein the protease-cleavable linker is cleaved by a protease that is enriched in a tumor or a cancer expressing an antigen that binds to the antigen-binding domain.
[0281] Example 25: The immune cell of any examples herein, particularly Examples 23- 24, wherein the cancer is breast cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 320-323 or any one of SEQ ID NOS: 576-662; wherein the cancer is colon cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 324-326 or anyone of SEQ ID NOS: 663-682; wherein the cancer is small cell lung carcinoma, and the protease-cleavable linker comprises any one of SEQ ID NOS: 683-702; wherein the cancer is ovarian cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 693-712; wherein the cancer is prostate cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 713-732; wherein the cancer is liver cancer, and the protease-cleavable linker comprises SEQ ID NO: 375, SEQ ID NO: 411, SEQ ID NO: 425, SEQ ID NO: 435, SEQ ID NO: 458, SEQ ID NO: 473, SEQ ID NO: 518, SEQ ID NO: 556, SEQ ID NO: 568, or any oneof SEQ ID NOS: 733-743; wherein the cancer is adenocarcinoma, and the protease-cleavable linker comprises SEQ ID NO: 468, SEQ ID NO: 567, or any one of SEQ ID NOS: 744-761; wherein the cancer is renal cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 762-781.
[0282] Example 26: The immune cell of any examples herein, particularly Example 25, wherein the antigen is IIER2, and the protease-cleavable linker comprises any one of SEQ ID NOS: 320-323; or wherein the antigen is EGER, and the protease-cleavable linker comprises any one of SEQ ID NOS: 324-326.
[0283] Example 27: The immune cell of any examples herein, particularly Examples 17- 26, wherein the protease-cleavable linker is cleaved by thrombin and comprises any one of SEQ ID NOS: 106-110 or any one of SEQ ID NOS: 396-405; wherein the protease-cleavable linker is cleaved by granzyme B and comprises SEQ ID NO: 111 or any one of SEQ ID NOS: 446-455; wherein the protease-cleavable linker is cleaved by MMP9 and comprises SEQ ID NO: 112 or any one of SEQ ID NOS: 546-555; wherein the protease-cleavable linker is cleaved by CASP1 and comprises any one of SEQ ID NOS: 327-336; wherein the protease-cleavable linker is cleaved by CASP3 and comprises any one of SEQ ID NOS: 337-346; wherein the protease-cleavable linker is cleaved by CASP8 and comprises any one of SEQ ID NOS: 347- 356; wherein the protease-cleavable linker is cleaved by CTSD and comprises any one of SEQ ID NOS: 357-366; wherein the protease-cleavable linker is cleaved by CTSE and comprises any one of SEQ ID NOS: 367-376; wherein the protease-cleavable linker is cleaved by CTSG and comprises any one of SEQ ID NOS: 377-385; wherein the protease-cleavable linker is cleaved by CTSS and comprises any one of SEQ ID NOS: 386-395; wherein the protease- cleavable linker is cleaved by FAP and comprises any one of SEQ ID NOS: 406-415; wherein the protease-cleavable linker is cleaved by FXIA and comprises any one of SEQ ID NOS: 416- 425; wherein the protease-cleavable linker is cleaved by GGT1 and comprises any one of SEQ ID NOS: 426-435; wherein the protease-cleavable linker is cleaved by GZMA and comprises any one of SEQ ID NOS: 436-445; wherein the protease-cleavable linker is cleaved by H20S and comprises any one of SEQ ID NOS: 456-465; wherein the protease-cleavable linker is cleaved by KLK2 and comprises any one of SEQ ID NOS: 466-475; wherein the protease- cleavable linker is cleaved by MMP1 and comprises any one of SEQ ID NOS: 476-485; wherein the protease-cleavable linker is cleaved by MMP10 and comprises any one of SEQ ID NOS: 486-495; wherein the protease-cleavable linker is cleaved by MMP12 and comprises any one of SEQ ID NOS: 496-505; wherein the protease-cleavable linker is cleaved by MMP13 and comprises any one of SEQ ID NOS: 506-515; wherein the protease-cleavable linker iscleaved by MMP2 and comprises any one of SEQ ID NOS: 516-525; wherein the protease- cleavable linker is cleaved by MMP3 and comprises any one of SEQ ID NOS: 526-535; wherein the protease-cleavable linker is cleaved by MMP8 and comprises any one of SEQ ID NOS: 536-545; wherein the protease-cleavable linker is cleaved by TPA and comprises anyone of SEQ ID NOS: 556-565; or wherein the protease-cleavable linker is cleaved by UP A and comprises any one of SEQ ID NOS: 566-575.
[0284] Example 28: The immune cell of any examples herein, particularly Examples 17-27, wherein the synNotch core comprises: an extracellular domain comprising about 80% similarity or more to SEQ ID NO: 124 or SEQ ID NO: 125; a juxtamembrane domain comprising about 80%’ similarity or more to SEQ ID NO: 126; and a transmembrane domain comprising about 80% similarity or more to SEQ ID NO: 127 or SEQ ID NO: 128.
[0285] Example 29: The immune cell of any examples herein, particularly Examples 17-28, wherein the synNotch core comprises about 80% similarity or more to SEQ ID NO: 129.
[0286] Example 30: The immune cell of any examples herein, particularly Examples 17-29, wherein the signal peptide comprises about 80% similarity or more to SEQ ID NO: 120 or SEQ ID NO: 121.
[0287] Example 31: The immune cell of any examples herein, particularly Examples 17-30, wherein the antigen-binding domain is a single-chain fragment variable (scFv) or a nanobody.
[0288] Example 32: The immune cell of any examples herein, particularly Examples 17-31, wherein the antigen-binding domain binds to an antigen that is associated with a disease or disorder.
[0289] Example 33: The immune cell of any examples herein, particularly Example 32, wherein the antigen-binding domain binds to a cancer-associated antigen or a tumor-associated antigen.
[0290] Example 34: The immune cell of any examples herein, particularly Example 33, wherein the antigen-binding domain binds to HER2, EGER, BCMA, B2M, B7-H3, CAIX, CD70, CEA, CLDN18.2, cMET, sDTR, FAP, GD2, GPC3, MSLN, MUC16ecto, PSCA, PSMA, EpCAM, ROR1, or TnMucl.
[0291] Example 35: The immune cell of any examples herein, particularly Example 34, wherein the antigen-binding domain comprises about 80% similarity or more to any one of SEQ ID NOS: 131-153.
[0292] Example 36: The immune cell of any examples herein, particularly Examples 17- 35, wherein the transcription factor is Gal4-VP64 and the promoter comprises UAS.
[0293] Example 37: The immune cell of any examples herein, particularly Examples 17-36, wherein the reporter molecule comprises a fluorophore or fluorescent molecule, a bioluminescent molecule, or a chemiluminescent molecule.
[0294] Example 38: The immune cell of any examples herein, particularly Examples 17-37, wherein the reporter molecule comprises a DNA barcode sequence, an RNA barcode sequence, or a peptide barcode sequence.
[0295] Example 39: The immune cell of any examples herein, particularly Examples 17-38, wherein the secretion tag comprises about 80% similarity or more to any one of SEQ ID NOS: 121-123.
[0296] Example 40: The immune cell of any examples herein, particularly Examples 17-39, wherein the immune cell is a T cell, an invariant natural killer T (iNKT) cell, a macrophage, or a natural killer cell.
[0297] Example 41: The immune cell of any examples herein, particularly Examples 17-40, wherein the immune cell is an autologous immune cell or an allogenic immune cell.
[0298] Example 42: The immune cell of any examples herein, particularly Examples 17-41, wherein the engineered PAR comprises about 80% similarity or more to any one of SEQ ID NOS: 154-188.
[0299] Example 43: A method of detecting cancer in a subject, the method comprising: a) administering the immune cell of any examples herein, particularly Examples 16-42 to the subject, wherein the protease-cleavable linker is cleaved by a cancer-associated protease or a tumor-associated protease; b) collecting a biological fluid sample from the subject; and c) detecting presence or absence of the reporter molecule in the biological fluid sample, thereby detecting presence or absence of cancer.
[0300] Example 44: The method of any examples herein, particularly Example 43, wherein the immune cell is administered intravenously.
[0301] Example 45: 'The method of any examples herein, particularly Examples 43-44, wherein the biological fluid sample is urine, blood, saliva, breath, sputum, bone marrow, cerebrospinal fluid (CSF), plasma, synovial fluid, nasal lavage, cell lysate, oral mucosa, nasal mucosa, vaginal mucosa, and / or rectal mucosa.
[0302] Example 46: The method of any examples herein, particularly Examples 43-45, wherein step c) further comprises quantifying the reporter molecule.
[0303] Example 47: The method of any examples herein, particularly Example 46, wherein the quantity of the reporter molecule is used to determine severity or extent of the cancer, cancer stage, and / or size or volume of the cancer.
[0304] Example 48: The method of any examples herein, particularly Examples 43-47, wherein at least a portion of the cancer is HER2+, EGFR+, BCMA+, B2M+, B7-H3+, CATX+, CD70+, CEA+, CLDN18.2+, cMET+, sDTR+, FAP+, GD2+, GPC3+, MSLN+, MUC16ecto+, PSCA+, PSMA+, EpCAM+, R0R1+, and / or TnMucl+.
[0305] Example 49: The method of any examples herein, particularly Examples 43-48, further comprising, if presence of the cancer is detected, administering one or more anti-cancer treatments to the subject.
[0306] Example 50: The method of any examples herein, particularly Examples 43-49, wherein the method is repeated over time to monitor progression of the cancer.
[0307] The following patents, applications and publications as listed below and throughout this document are hereby incorporated by reference in their entirety herein.Reference ListAalipour, A., el al. (2019). Engineered immune cells as highly sensitive cancer diagnostics.Nature Biotechnology 37, 531-539. 10.1038 / S41587-019-0064-8.Ala-aho, R., and Kahari, V.-M. (2005). Collagenases in cancer. Biochimie 87, 273-286.Alien, G.M., et al. Synthetic cytokine circuits that drive T cells into immune-excluded tumors. Science 378, eabal624. 10.1126 / science.abal 624.Amini, A.P.. et al. (2022). Multiscale profiling of protease activity in cancer. Nat Commun 13, 5745. 10.1038 / S41467-022-32988-5.An, G., et al. (2021). Effects of niiR93 on epithelialtomesenchymal transition and vasculogenic mimicry in triplenegative breast cancer ceils. Mol Med Rep 23, 1. 10.3892 / mmr.2020.11668.Backes, B.J., et al. (2000). Synthesis of positional-scanning libraries of fluorogenic peptide substrates to define the extended substrate specificity of plasmin and thrombin. Nature Biotechnology 18, 187-193. 10.1038 / 72642.Berger, A.B., et al. (2004). Activity-based protein profiling: applications to biomarker discovery, in vivo imaging and drug discovery. Am J Pharmacogenomics 4, 371-381. 10.2165 / 00129785 -200404060-00004.Bettegowda, C., et al. (2014). Detection of circulating tumor DNA in early- and late-stage human malignancies. Sci Transl Med 6, 224ra224. 10.1 126 / scitranslmed.3007094.Boettcher, A., et al. (2010). Fragment-Based Screening by Biochemical Assays: Systematic Feasibility Studies with Trypsin and MMP12. SEAS Discovery 15, 1029-1041.Bond, J.S. (2019). Proteases: History, discovery, and roles in health and disease. J Biol Chem 294, 1643-1651. 10.1074 / jbc.™118.004156.Bonnans, C., et al. (2014). Remodelling the extracellular matrix in development and disease. Nature Reviews Molecular Cell Biology 15, 786-801. 10.1038 / nrm3904.Butenas, S., et al. (1997). Analysis of Tissue Plasminogen Activator Specificity Using Peplidyl Fluorogenic Substrates. Biochemistry 36, 2123-2131. 10. 1021 / bi9617670.Cazanave, S.C., et al. (2021). Peptide-based urinary monitoring of fibrotic nonalcoholic steatohepatitis by mass-barcoded activity-based sensors. Science Translational Medicine 13, eabe8939. doi:10.1126 / scitranslmed.abe8939.Choe, J.H., et al. (2021). SynNotch-CAR T cells overcome challenges of specificity, heterogeneity, and persistence in treating glioblastoma. Science Translational Medicine 13, eabe7378. 10. 1126 / scitranslmed.abe7378.Cohen, J.D., et al. (2018). Detection and localization of surgically resectable cancers with a multi-analyte blood test. Science 359, 926-930. 10.H26 / science.aar3247.Cravatt, B.F., et al. (2008). Activity-based protein profiling: from enzyme chemistry to proteomic chemistry. Annu Rev Biochem 77, 383-414.10.1146 / annurev.biochem.75. 101304.124125.Cristofanilli, M., et al. (2004). Circulating tumor cells, disease progression, and survival in metastatic breast cancer. N Engl J Med 351, 781-791. 10.1056 / NEJMoa040766.Das, S., et al. (2024). Biomarkers in Cancer Detection, Diagnosis, and Prognosis. Sensors 24, 37.Dawson, S.J., et al. (2013). Analysis of circulating tumor DNA to monitor metastatic breast cancer. N Engl J Med 368, 1199-1209. 10.1056 / NEJMoal213261.DeGolier, K.R., et al. (2025). Antigen experience history directs distinct functional states of CD8+ CAR T cells during the antileukemia response. Nature Immunology 26, 68-81. 10.1038 / s41590-024-02034- 1.Delbeke, D., et al. (2006). Procedure Guideline for Tumor Imaging with 18F- FDG PET / CT 1.0. Journal of Nuclear Medicine 47, 885-895.Depil, S., et al. (2020). ‘Off-the-shelf’ allogeneic CAR T cells: development and challenges. Nature Reviews Drug Discovery 19, 185-199. 10.1038 / s41573-019-0051-2.Desnoyers, L.R., et al. (2013). Tumor-specific activation of an EGFR-targeting probody enhances therapeutic index. Sci Transl Med 5, 207ral44. 10.1126 / scitranslmed.3006682.Doan, A.E., et al. (2024). FOXOl is a master regulator of memory programming in CAR T cells. Nature 629, 211-218. 10.1038 / s41586-024-07300-8.Dudani, J.S., et al. (2018). Classification of prostate cancer using a protease activity nanosensor library. Proc Natl Acad Sci U S A 115, 8954-8959. 10.1073 / pnas.1805337115.Duffy, M.J., et al. (2010). CA 15-3: LTses and limitation as a biomarker for breast cancer. Clinica Chimica Acta 411, 1869-1874.Ebeling, F.G., et al. (2002). Serum CEA and CA 15-3 as prognostic factors in primary breast cancer. Br J Cancer 86, 1217-1222. 10.1038 / sj.bjc.6600248.Erdi, Y.E. (2012). Limits of Tumor Detectability in Nuclear Medicine and PET. Mol Imaging Radionucl Ther 21, 23-28. 10.42747Mirt.138.Faucher, F.F., et al. (2023). Protease Activated Probes for Real-Time Ratiometric Imaging of Solid Tumors. ACS Cent Sci 9, 1059-1069. 10.1021 / acscentsci .3c00261.Ferrall-Fairbanks, M.C., et al. (2020). Reassessing enzyme kinetics: Considering protease-as- substrate interactions in proteolytic networks. Proceedings of the National Academy of Sciences 117, 3307-3318. 10.1073 / pnas.l912207117.Finck, A.V., et al. (2022). Engineered cellular immunotherapies in cancer and beyond. Nature Medicine 28, 678-689. 10.1038 / s41591-022-01765-8.Flugel, C.L., et al. (2023). Overcoming on-target, off-tumour toxicity of CAR T cell therapy for solid tumours. Nature Reviews Clinical Oncology 20, 49-62. 10.1038 / s41571-022-00704- 3.Fortelny, N„ et al. (2014). Network Analyses Reveal Pervasive Functional Regulation Between Proteases in the Human Protease Web. PLOS Biology 12, e!001869.10.1371 / journal .pbio .1001869.Fritsch, K., et al. (2013). Suppression of granzyme B activity and caspase-3 activation in leukaemia cells constitutively expressing the protease inhibitor 9. Annals of Hematology 92, 1603-1609. 10.1007 / S00277-013-1846-6.Galizia, G., et al. (2007). Cetuximab, a chimeric human mouse anti-epidermal growth factor receptor monoclonal antibody, in the treatment of human colorectal cancer. Oncogene 26, 3654-3660. 10.1038 / sj .one.1210381.Gamboa, L., et al. (2025). Sensitizing solid tumors to CAR-mediated cytotoxicity by lipid nanoparticle delivery of synthetic antigens. Nature Cancer 6, 1073-1087. 10.1038 / s43018-025- 00968-5.Grant, B.D., and Donaldson, J.G. (2009). Pathways and mechanisms of endocytic recycling. Nat Rev Mol Cell Biol 10, 597-608. 10.1038 / nrm2755.Hao, L., et al. (2021). Microenvironment-triggered multimodal precision diagnostics. Nature Materials 20, 1440-1448. 10.1038 / s41563-021-01042-y.Harris, J.M., and Chess, R.B. (2003). Effect of pegylation on pharmaceuticals. Nature Reviews Drug Discovery 2, 214-221. 10.1038 / nrdl033.Hori, S.S., and Gambhir, S.S. (2011). Mathematical model identifies blood biomarker-based early cancer detection strategies and limitations. Sci Transl Med 3, 109ral l6. 10.1126 / scitranslmed.3003110.Irvine, D.J., et al. (2022). The future of engineered immune cell therapies. Science 378, 853- 858. doi : 10.1126 / science.abq6990.Jiang, B., et al. (2005). A novel peptide isolated from a phage display peptide library with trastuzumab can mimic antigen epitope of HER-2. J Biol Chem 280, 4656-4662. 10.1074 / jbc.M411047200.Kalager, M., et al. (2010). Effect of Screening Mammography on Breast-Cancer Mortality in Norway. New England Journal of Medicine 363, 1203-1210. doi:10.1056 / NEJMoa!000727.Karl sen, M.A., et al. (2012). Evaluation of HE4, CA125, risk of ovarian malignancy algorithm (ROMA) and risk of malignancy index (RMI) as diagnostic tools of epithelial ovarian cancer in patients with a pelvic mass. Gynecol Oncol 127, 379-383. 10.1016 / j.ygyno.2012.07.106.Khersonsky, O., and Tawfik, D.S. (2010). Enzyme promiscuity: a mechanistic and evolutionary perspective. Annu Rev Biochem 79, 471-505. 10.1146 / annurev-biochem- 030409-143718.Kirkpatrick, J.D., et al. (2020). Urinary detection of lung cancer in mice via noninvasive pulmonary protease profiling. Sci Transl Med 12. 10.1126 / scitranslmed.aaw0262.Klein, E. A., et al. (2021). Clinical validation of a targeted methylation-based multi-cancer early detection test using an independent validation set. Ann Oncol 32, 1 167-1177. 10.1016 / j . annonc.2021 .05.806.Kwon, E.J., et al (2017). Ultrasensitive tumour-penetrating nanosensors of protease activity. Nat Biomed Eng 1. 10. 1038 / s41551-017-0054.Kwong, G.A., Ghosh, S., Gamboa, L., Patriotis, C., Srivastava, S., and Bhatia, S.N. (2021). Synthetic biomarkers: a twenty-first century path to early cancer detection. Nature Reviews Cancer 21, 655-668. 10.1038 / s41568-021-00389-3.Kwong, G.A., et al. (2013). Mass-encoded synthetic biomarkers for multiplexed urinary monitoring of disease. Nature Biotechnology 31, 63-70. 10.1038 / nbt,2464.Lagadic-Gossmann, D., et al. (2004). Alterations of intracellular pH homeostasis in apoptosis: origins and roles. Cell Death & Differentiation 11, 953-961. 10.1038 / sj.cdd.4401466.Lanahan, C.R., et al. (2021). Performance of a novel protease-activated fluorescent imaging system for intraoperative detection of residual breast cancer during breast conserving surgery. Breast Cancer Res Treat 187, 145-153. 10.1007 / sl0549-021-06106-w.Lawrence, R., et al. (2023). Circulating tumour cells for early detection of clinically relevant cancer. Nature Reviews Clinical Oncology 20, 487-500. 10.1038 / s41571-023-00781-y.Lennon, A.M., et al. (2020). Feasibility of blood testing combined with PET-CT to screen for cancer and guide intervention. Science 369. 10.1126 / science.abb9601.Li, Q„ et al. (2017). Profiling Protease Specificity: Combining Yeast ER Sequestration Screening (YESS) with Next Generation Sequencing. ACS Chemical Biology 12, 510-518. 10.1021 / acschembio .6 b00547.Li, Z„ et al. (2024). Engineering cells for therapy and diagnosis. Nature Reviews Bioengineering 2, 770-784. 10.1038 / s44222-024-00198-x.Liu, M.C., et al. (2020). Sensitive and specific multi-cancer detection and localization using methylation signatures in cell-free DNA. Ann Oncol 31, 745-759.10.1016 / j.annonc.2020.02.011.Liu, X., et al. (2015). Affinity-Tuned ErbB2 or EGER Chimeric Antigen Receptor T Cells Exhibit an Increased Therapeutic Index against Tumors in Mice. Cancer Research 75, 3596- 3607. 10.1 158 / 0008-5472.Can-15-0159.Long, Z. (2020). Computational analysis of the metal selectivity of matrix metalloproteinase 8. PLoS One 15, e0243321. 10.1371 / journal.pone.0243321.Lopez-Otin, C., and Bond, J.S. (2008). Proteases: multifunctional enzymes in life and disease. J Biol Chem 283, 30433-30437. 10.1074 / jbc.R800035200.Mac, Q.D., et al. (2019). Non-invasive early detection of acute transplant rejection via nanosensors of granzyme B activity. Nature Biomedical Engineering 3, 281-291. 10. 1038 / s41551-019-0358-7.Mac, Q.D., et al. (2022). Urinary detection of early responses to checkpoint blockade and of resistance to it via protease-cleaved antibody-conjugated sensors. Nat Biomed Eng 6, 310-324. 10.1038 / s41551-022-00852-y.Magnani, C.F., et al. (2020). Transposon-Based CAR T Cells in Acute Leukemias: Where are We Going? Cells 9. 10.3390 / cells9061337.Maheswaran, S., et al. (2008). Detection of mutations in EGFR in circulating lung-cancer cells. N Engl J Med 359, 366-377. 10.1056 / NEJMoa0800668.Mason, S.D., and Joyce, J.A. (201 1). Proteolytic networks in cancer. Trends Cell Biol 21, 228- 237. 10.1016 / j.tcb.2010.12.002.Mo, F., et al. (2021). Engineered off-the-shelf therapeutic T cells resist host immune rejection. Nature Biotechnology 39, 56-63. 10.1038 / s41587-020-0601-5.Moretti, A., et al. (2022). The Past, Present, and Future of Non- Viral CAR T Cells. Front Immunol 13, 867013. 10.3389 / fimmu.2022.867013.Morsut, L., et al. (2016). Engineering Customized Cell Sensing and Response Behaviors Using Synthetic Notch Receptors. Cell 164, 780-791. 10.1016 / j.cell.2016.01.012.Nguyen, Q.T., et al. (2010). Surgery with molecular fluorescence imaging using activatable cell-penetrating peptides decreases residual cancer and improves survival. Proceedings of the National Academy of Sciences 107, 4317-4322. doi:10.1073 / pnas.0910261107.Nilsson, J., et al. (2009). Prostate cancer-derived urine exosomes: a novel approach to biomarkers for prostate cancer. Br J Cancer 100, 1603-1607. 10.1038 / sj.bjc.6605058.Olson, E.S., et al. (2010). Activatable cell penetrating peptides linked to nanoparticles as dual probes for in vivo fluorescence and MR imaging of proteases. Proc Natl Acad Sci U S A 107, 4311-4316. 10.1073 / pnas.0910283107.Overall, C.M. (2002). Molecular determinants of metalloproteinase substrate specificity. Molecular Biotechnology 22, 51-86. 10.1385 / MB:22:l:051.Page, M.J., et al. (2015). Non-invasive imaging and cellular tracking of pulmonary emboli by near-infrared fluorescence and positron-emission tomography. Nature Communications 6, 8448. 10.1038 / ncomms9448.Pan, H., et al. (2017). 20- Year Risks of Breast-Cancer Recurrence after Stopping Endocrine Therapy at 5 Years. New England Journal of Medicine 377, 1836-1846. doi: 10.1056 / NEJMoal701830.Pan, J., et al. (2016). Colonoscopy Reduces Colorectal Cancer Incidence and Mortality in Patients With Non-Malignant Findings: A Meta- Analysis. Am J Gastroenterol 111, 355-365. 10.1038 / ajg.2015.418.Pasqualini, R., and Ruoslahti, E. (1996). Organ targeting in vivo using phage display peptide libraries. Nature 380, 364-366. 10.1038 / 380364a0.Perez-Silva, J.G., et al. (2016). The Degradome database: expanding roles of mammalian proteases in life and disease. Nucleic Acids Res 44, D351-355. 10.1093 / nar / gkv 1201.Perna, F., et al. (2024). CAR T-cell toxicities: from bedside to bench, how novel toxicities inform laboratory investigations. Blood Adv 8, 4348-4358.10.1182 / bloodadvances.2024013044.Pieiko, K., et al. (2021). In vivo phage display: identification of organ-specific peptides using deep sequencing and differential profiling across tissues. Nucleic Acids Res 49, e38. 10.1093 / nar / gkaal279.Puente, X.S., et al. (2003). Human and mouse proteases: a comparative genomic approach. Nature Reviews Genetics 4, 544-558. 10. 1038 / nrgl 111.Radisky, E.S. (2024). Extracellular proteolysis in cancer: Proteases, substrates, and mechanisms in tumor progression and metastasis. J Biol Chem 300, 107347. 10.1016 / j.jbc.2024.107347.Roybal, K.T., et al. (2016). Precision Tumor Recognition by T Cells With Combinatorial Antigen-Sensing Circuits. Cell 164, 770-779. 10.1016 / j.cell.2016.01.011.Ryu, J.M., et al. (2023). Prognostic Impact of Elevation of Cancer Antigen 15-3 (CA15-3) in Patients With Early Breast Cancer With Normal Serum CA15-3 Level. J Breast Cancer 26, 126-135. 10.4048 / jbc.2023.26.el7.Sandersjoo, L., et al. (2.017). Protease substrate profiling using bacterial display of selfblocking affinity proteins and flow-cytometric sorting. Biotechnology Journal 12, 1600365.Sannian, L.E., et al M. (2016). Bifunctional Probes of Cathepsin Protease Activity and pH Reveal Alterations in Endolysosomal pH during Bacterial Infection. Cell Chem Biol 23, 793- 804. 10.1016 / j.chembiol.2016.05.019.Schrag, 19., et al. (2023). Blood-based tests for multicancer early detection (PATHFINDER): a prospective cohort study. The Lancet 402, 1251-1260. 10.1016 / 80140-6736(23)01700-2.Shin, H., et al. (2023). Single test-based diagnosis of multiple cancer types using Exosome- SERS-AI for early stage cancers. Nature Communications 14, 1644. 10.1038 / s41467-023- 37403-1.Siegel, R.L., et al. (2024). Cancer statistics, 2024. CA Cancer J Clin 74, 12-49. 10.3322 / caac.21820.Sivakumar, A., et al. (2025). AND-gated protease-activated nanosensors for programmable detection of anti-tumour immunity. Nature Nanotechnology 20, 441-450. 10. 1038 / s41565-024- 01834-8.Smith, B.L., et al. (2023). Intraoperative Fluorescence Guidance for Breast Cancer Lumpectomy Surgery. NEJM Evid 2, EVIDoa2200333. 10.1056 / EVIDoa2200333.Smith, T.T., et al. (2017). In situ programming of leukaemia-specific T cells using synthetic DN A nanocarriers. Nature Nanotechnology 12, 813-820. 10.1038 / nnano.2017.57.Soh, U.J., et al. (2010). Signal transduction by protease-activated receptors. Br J Pharmacol 160, 191-203. 10.1111 / j.l476-5381.2010.00705.x.Speers, A.E., and Cravatt, B.F. (2004). Profiling Enzyme Activities In vivo Using Click Chemistry Methods. Chemistry & Biology 11, 535-546.Steinman, R.M., et al (1983). Endocytosis and the recycling of plasma membrane. J Ceil Biol 96, 1-27. 10.1083 / jcb.96.1.1.Su, F.-Y., et al. (2022). In vivo mRNA delivery to virus-specific T cells by light-induced ligand exchange of MHC class I antigen-presenting nanoparticles. Science Advances 8, eabm7950. doi: 10.1126 / sciadv.abm7950.Suk, J.S., et al. (2016). PEGylation as a strategy for improving nanoparticle-based drug and gene delivery. Advanced Drug Delivery Reviews 99, 28-51. 10.1016 / j.addr.2015.09.012.Varadarajan, N., et al. (2005). Engineering of protease variants exhibiting high catalytic activity and exquisite substrate selectivity. Proceedings of the National Academy of Sciences 102, 6855-6860. 10.1073 / pnas.0500063102.Veronese, F.M., and Pasut, G. (2005). PEGylation, successful approach to drug delivery. Drug Discovery Today 10, 1451-1458. 10.1016 / S1359-6446(05)03575-0.Vindigni, A., et al. (1997). Site-specific dissection of substrate recognition by thrombin. Nature Biotechnology 15, 891-895. 10.1038 / nbt0997-891.Vizovisek, M., et al. (2021). The Tumor Proteolytic Landscape: A Challenging Frontier in Cancer Diagnosis and Therapy. Int J Mol Sei 22. 10.3390 / ijms22052514.Weidmann, H., et al. (2017). The plasma contact system, a protease cascade at the nexus of inflammation, coagulation and immunity. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1864, 2118-2127.Whitley, MJ., et al. (2016). A mouse-human phase 1 co-clinical trial of a protease-activated fluorescent probe for imaging cancer. Sei Transl Med 8, 320ra324.10.1126 / scitranslmed.aad0293.Whitney, M., et al. (2010). Parallel in vivo and in vitro selection using phage display identifies protease-dependent tumor-targeting peptides. J Biol Chem 285, 22532-22541. 10.1074 / jbc.Ml 10.138297.Widen, J.C., et al. (2021). AND-gate contrast agents for enhanced fluorescence-guided surgery. Nat Biomed Eng 5, 264-277. 10.1038 / s41551-020-00616-6.Williams, J.Z., et al. (2020). Precise T cell recognition programs designed by transcriptionally linking multiple receptors. Science 370, 1099-1104. 10.1126 / science.abc6270.Winkler, J., et al. (2020). Concepts of extracellular matrix remodelling in tumour progression and metastasis. Nature Communications 11, 5120. 10.1038 / s41467-020-18794-x.Yang, Z.J., et al. (2020). Engineering of an enhanced synthetic Notch receptor by reducing ligand-independent activation. Communications Biology 3, 116. 10.1038 / s42003-020-0848-x.Yi, L., et al. (2013). Engineering of TEV protease variants by yeast ER sequestration screening (YESS) of combinatorial libraries. Proc Natl Acad Sei U S A 110, 7229-7234. 10.1073 / pnas.1215994110.Zhao, N., et al. (2021). In vivo Measurement of Granzyme Proteolysis from Activated Immune Cells with PET. ACS Cent Sci 7, 1638-1649. 10.1021 / acscentsci.lc00529.Zhou, J., et al. (2020). Deep profiling of protease substrate specificity enabled by dual random and scanned human proteome substrate phage libraries. Proceedings of the National Academy of Sciences 117, 25464-25475. doi: l().1073Zpnas.2009279H7.Zhu, I., et al. (2022). Modular design of synthetic receptors for programmed gene regulation in cell therapies. Cell 185, 1431-1443.el416. 10.1016 / j.cell.2022.03.023.SEQUENCESMIMOTOPESSTRUCTURAL SEQUENCESANTIGEN -BINDING DOMAINSFELL PAR SEQUENCESFELL MASK SEQUENCESNUCLEIC ACID SEQUENCESPROTEASE CLEAVABLE LINKERSFELL PAR SEQUENCES (KEY)FELL MASK SEQUENCES (KEY)
Claims
CLAIMS1. A mimotope comprising about 80% similarity or more to any one of SEQ ID NOS: 5- 105.
2. An engineered protease activatable receptor (PAR) comprising: i) a synthetic Notch (synNotch) construct comprising: a signal peptide; an antigen -binding domain; a synNotch core; and a transcription factor; ii) the mimotope of claim 1, wherein the mimotope binds to the antigen -bin ding domain; and iii) a protease-cleavable linker connecting the synNotch construct to the mimotope.
3. The engineered PAR of claim 2, wherein the protease-cleavable linker is cleaved by a protease that is associated with healthy tissue.
4. The engineered PAR of claim 3, wherein the protease-cleavable linker is cleaved by a tissue-specific protease.
5. The engineered PAR of claim 4, wherein the tissue is kidney tissue, and the protease- cleavable linker comprises any one of SEQ ID NOS: 782-791; wherein the tissue is liver tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 792-801; wherein the tissue is lung tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 802-811; wherein the tissue is heart tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 812-821 ; wherein the tissue is blood, and the protease-cleavable linker comprises any one ofSEQ ID NOS: 822-831; wherein the tissue is spleen tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 832-841 ;wherein the tissue is lymph node tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 842-851; wherein the tissue is stomach tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 852-861; wherein the tissue is ovarian tissue, and the protease-cleavable linker comprise any one of SEQ ID NOS: 862-871 ; wherein the tissue is uterine tissue, and the protease-cleavable linker comprises anyone of SEQ ID NOS: 872-881; wherein the tissue is mammary gland tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 882-891; wherein the tissue is prostate tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 892-901 ; wherein the tissue is testicular tissue, and the prostate-cleavable linker comprises anyone of SEQ ID NOS: 902-911; wherein the tissue is intestinal tissue, and the protease-cleavable linker comprises anyone of SEQ ID NOS: 912-921; wherein the tissue is bladder tissue, and the protease-cleavable linker comprises anyone of SEQ ID NOS: 922-931; wherein the tissue is brain tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 932-941; or wherein the tissue is thymic tissue, and the protease-cleavable linker comprises anyone of SEQ ID NOS: 942-951.
6. The engineered PAR of claim 2, wherein the protease-cleavable linker is cleaved by a protease that is associated with a disease or disorder.
7. The engineered PAR of claim 6, wherein the protease-cleavable linker is cleaved by a cancer-associated protease or a tumor-associated protease.
8. The engineered PAR of claim 7, wherein the protease-cleavable linker is cleaved by a protease that is enriched in a tumor or a cancer expressing an antigen that binds to the antigen-binding domain.
9. The engineered PAR of any one of claims 7-8, wherein the cancer is breast cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 320-323 or any one of SEQ ID NOS: 576-662; wherein the cancer is colon cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 324-326 or any one of SEQ ID NOS: 663-682; wherein the cancer is small cell lung carcinoma, and the protease-cleavable linker comprises any one of SEQ ID NOS: 683-702; wherein the cancer is ovarian cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 693-712; wherein the cancer is prostate cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 713-732; wherein the cancer is liver cancer, and the protease-cleavable linker comprises SEQ ID NO: 375, SEQ ID NO: 41 1, SEQ ID NO: 425, SEQ ID NO: 435, SEQ ID NO: 458, SEQ ID NO: 473, SEQ ID NO: 518, SEQ ID NO: 556, SEQ ID NO: 568, or any one of SEQ ID NOS: 733-743; wherein the cancer is adenocarcinoma, and the protease-cleavable linker comprises SEQ ID NO: 468, SEQ ID NO: 567, or any one of SEQ ID NOS: 744-761; wherein the cancer is renal cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 762-781 .
10. The engineered PAR of claim 9, wherein the antigen is HER2, and the protease- cleavable linker comprises any one of SEQ ID NOS: 320-323; or wherein the antigen is EGER, and the protease-cleavable linker comprises any one of SEQ ID NOS: 324-326.11 . The engineered PAR of any one of claims 2-10, wherein the protease-cleavable linker is cleaved by thrombin and comprises any one of SEQ ID NOS: 106-110 or any one of SEQ ID NOS: 396-405; wherein the protease-cleavable linker is cleaved by granzyme B and comprises SEQ ID NO: 1 1 1 or any one of SEQ ID NOS: 446-455; wherein the protease-cleavable linker is cleaved by MMP9 and comprises SEQ ID NO: 112 or any one of SEQ ID NOS: 546-555; wherein the protease-cleavable linker is cleaved by CASP1 and comprises any one of SEQ ID NOS: 327-336;wherein the protease -cleavable linker is cleaved by CASP3 and comprises any one of SEQ ID NOS: 337-346; wherein the protease-cleavable linker is cleaved by CASP8 and comprises any one of SEQ ID NOS: 347-356; wherein the protease-cleavable linker is cleaved by CTSD and comprises any one of SEQ ID NOS: 357-366; wherein the protease-cleavable linker is cleaved by CTSE and comprises any one of SEQ ID NOS: 367-376; wherein the protease-cleavable linker is cleaved by CTSG and comprises any one of SEQ ID NOS: 377-385; wherein the protease-cleavable linker is cleaved by CTSS and comprises any one of SEQ ID NOS: 386-395; wherein the protease-cleavable linker is cleaved by FAP and comprises any one of SEQ ID NOS: 406-415; wherein the protease -cleavable linker is cleaved by FXIA and comprises any one of SEQ ID NOS: 416-425; wherein the protease-cleavable linker is cleaved by GGT1 and comprises any one of SEQ ID NOS: 426-435; wherein the protease-cleavable linker is cleaved by GZMA and comprises any one of SEQ ID NOS: 436-445; wherein the protease -cleavable linker is cleaved by H20S and comprises any one of SEQ ID NOS: 456-465; wherein the protease-cleavable linker is cleaved by KLK2 and comprises any one of SEQ ID NOS: 466-475; wherein the protease-cleavable linker is cleaved by MMP1 and comprises any one of SEQ ID NOS: 476-485; wherein the protease-cleavable linker is cleaved by MMP10 and comprises any one of SEQ ID NOS: 486-495; wherein the protease-cleavable linker is cleaved by MMP12 and comprises any one of SEQ ID NOS: 496-505; wherein the protease-cleavable linker is cleaved by MMP13 and comprises any one of SEQ ID NOS: 506-515; wherein the protease-cleavable linker is cleaved by MMP2 and comprises any one of SEQ ID NOS: 516-525;wherein the protease -cleavable linker is cleaved by MMP3 and comprises any one of SEQ ID NOS: 526-535; wherein the protease-cleavable linker is cleaved by MMP8 and comprises any one of SEQ ID NOS: 536-545; wherein the protease-cleavable linker is cleaved by TP A and comprises any one of SEQ ID NOS: 556-565; or wherein the protease-cleavable linker is cleaved by UP A and comprises any one of SEQ ID NOS: 566-575.
12. An engineered protease activatable receptor (PAR) comprising: i) a synthetic Notch (synNotch) construct comprising: a signal peptide; an antigen-binding domain; a synNotch core; and a transcription factor; ii) a mimotope that binds to the antigen-binding domain; and iii) a protease-cleavable linker connecting the synNotch construct to the mimotope, wherein the protease-cleavable linker is cleaved by a protease that is enriched in a tumor or a cancer expressing an antigen that binds to the antigen-binding domain.
13. The engineered PAR of claim 12, wherein the cancer is breast cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 320-323 or any one of SEQ ID NOS: 576-662; wherein the cancer is colon cancer, and the protease-cleavable linker comprises anyone of SEQ ID NOS: 324-326 or any one of SEQ ID NOS: 663-682; wherein the cancer is small cell lung carcinoma, and the protease-cleavable linker comprises any one of SEQ ID NOS: 683-702; wherein the cancer is ovarian cancer, and the protease-cleavable linker comprises anyone of SEQ ID NOS: 693-712; wherein the cancer is prostate cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 713-732; wherein the cancer is liver cancer, and the protease-cleavable linker comprises SEQ ID NO: 375, SEQ ID NO: 41 1, SEQ ID NO: 425, SEQ ID NO: 435, SEQ ID NO: 458, SEQID NO: 473, SEQ ID NO: 518, SEQ ID NO: 556, SEQ ID NO: 568, or any one of SEQ ID NOS: 733-743; wherein the cancer is adenocarcinoma, and the protease-cleavable linker comprises SEQ ID NO: 468, SEQ ID NO: 567, or any one of SEQ ID NOS: 744-761; wherein the cancer is renal cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 762-781 .
14. The engineered PAR of claim 13, wherein the antigen is HER2, and the protease- cleavable linker comprises any one of SEQ ID NOS: 320-323; or wherein the antigen is EGER, and the protease-cleavable linker comprises any one of SEQ ID NOS: 324-326.
15. The engineered PAR of any one of claims 12-14, wherein the mimotope comprises about 80% similarity or more to any one of SEQ ID NOS: 1-105.
16. An immune cell comprising: a) the engineered PAR of any one of claims 2-15; and b) a reporter nucleic acid encoding: i) a promoter that is activatable by transcription factor; and ii) a reporter molecule linked to a secretion tag; wherein, upon cleavage of the protease-cleavable linker by a protease in the presence of an antigen that binds to the antigen-binding domain, the mimotope is released from the antigen-binding domain and the antigen -binding domain binds to its cognate antigen, thereby causing the transcription factor to be released from the synNotch construct and bind to the promoter, thereby inducing expression of the detectable signal linked to the secretion tag.
17. An immune cell comprising: a) an engineered protease activatable receptor (PAR) comprising: i) a synthetic Notch (synNotch) construct comprising: a signal peptide; an antigen-binding domain; a synNotch core; and a transcription factor; ii) a mimotope that binds to the antigen-binding domain;iii) a protease -cleavable linker connecting the synNotch construct to the mimotope; b) a reporter nucleic acid encoding: i) a promoter that is activatable by transcription factor; and ii) a reporter molecule linked to a secretion tag; wherein, upon cleavage of the protease-cleavable linker by a protease in the presence of an antigen that binds to the antigen-binding domain, the mimotope is released from the antigen-binding domain and the antigen- binding domain binds to its cognate antigen, thereby causing the transcription factor to be released from the synNotch construct and bind to the promoter, thereby inducing expression of the detectable signal linked to the secretion tag.
18. The immune cell of claim 17, wherein the mimotope comprises about 80% similarity or more to any one of SEQ ID NOS: 1-105.
19. The immune cell of any one of claims 17-18, wherein the protease-cleavable linker is cleaved by a protease that is associated with healthy tissue.
20. The immune cell of claim 19, wherein the protease-cleavable linker is cleaved by a tissue-sped tic protease.
21. The immune cell of claim 20, wherein the tissue is kidney tissue, and the protease- cleavable linker comprises any one of SEQ ID NOS: 782-791; wherein the tissue is liver tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 792-801; wherein the tissue is lung tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 802-811; wherein the tissue is heart tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 812-821; wherein the tissue is blood, and the protease-cleavable linker comprises any one of SEQ ID NOS: 822-831; wherein the tissue is spleen tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 832-841; wherein the tissue is lymph node tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 842-851;wherein the tissue is stomach tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 852-861; wherein the tissue is ovarian tissue, and the protease-cleavable linker comprise any one of SEQ ID NOS: 862-871; wherein the tissue is uterine tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 872-881 ; wherein the tissue is mammary gland tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 882-891; wherein the tissue is prostate tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 892-901; wherein the tissue is testicular tissue, and the prostate-cleavable linker comprises any one of SEQ ID NOS: 902-911 ; wherein the tissue is intestinal tissue, and the protease-cleavable linker comprises anyone of SEQ ID NOS: 912-921; wherein the tissue is bladder tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 922-931; wherein the tissue is brain tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 932-941; or wherein the tissue is thymic tissue, and the protease-cleavable linker comprises any one of SEQ ID NOS: 942-951 .
22. The immune cell of any one of claims 17-18, wherein the protease-cleavable linker is cleaved by a protease that is associated with a disease or disorder.
23. The immune cell of claim 22, wherein the protease-cleavable linker is cleaved by a cancer-associated protease or a tumor- associated protease.
24. The immune cell of claim 23, wherein the protease-cleavable linker is cleaved by a protease that is enriched in a tumor or a cancer expressing an antigen that binds to the antigen-binding domain.
25. The immune cell of any one of claims 23-24, wherein the cancer is breast cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 320-323 or any one of SEQ ID NOS: 576-662;wherein the cancer is colon cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 324-326 or any one of SEQ ID NOS: 663-682; wherein the cancer is small cell lung carcinoma, and the protease-cleavable linker comprises any one of SEQ ID NOS: 683-702; wherein the cancer is ovarian cancer, and the protease-cleavable linker comprises any one of SEQ ID NOS: 693-712; wherein the cancer is prostate cancer, and the protease-cleavable linker comprises anyone of SEQ ID NOS: 713-732; wherein the cancer is liver cancer, and the protease-cleavable linker comprises SEQ ID NO: 375, SEQ ID NO: 411, SEQ ID NO: 425, SEQ ID NO: 435, SEQ ID NO: 458, SEQ ID NO: 473, SEQ ID NO: 518, SEQ ID NO: 556, SEQ ID NO: 568, or any one of SEQ ID NOS: 733-743; wherein the cancer is adenocarcinoma, and the protease-cleavable linker comprises SEQ ID NO: 468, SEQ ID NO: 567, or any one of SEQ ID NOS: 744-761; wherein the cancer is renal cancer, and the protease-cleavable linker comprises anyone of SEQ ID NOS: 762-781.
26. The immune cell of claim 25, wherein the antigen is HER2, and the protease- cleavable linker comprises any one of SEQ ID NOS: 320-323; or wherein the antigen is EGER, and the protease-cleavable linker comprises any one of SEQ ID NOS: 324-326.
27. The immune cell of any one of claims 17-26, wherein the protease-cleavable linker is cleaved by thrombin and comprises any one of SEQ ID NOS: 106-110 or any one of SEQ ID NOS: 396-405; wherein the protease-cleavable linker is cleaved by granzyme B and comprises SEQ ID NO: 111 or any one of SEQ ID NOS: 446-455; wherein the protease -cleavable linker is cleaved by MMP9 and comprises SEQ ID NO: 112 or any one of SEQ ID NOS: 546-555; wherein the protease-cleavable linker is cleaved by CASP1 and comprises any one of SEQ ID NOS: 327-336; wherein the protease-cleavable linker is cleaved by CASP3 and comprises any one of SEQ ID NOS: 337-346;wherein the protease -cleavable linker is cleaved by CASP8 and comprises any one of SEQ ID NOS: 347-356; wherein the protease-cleavable linker is cleaved by CTSD and comprises any one of SEQ ID NOS: 357-366; wherein the protease-cleavable linker is cleaved by CTSE and comprises any one of SEQ ID NOS: 367-376; wherein the protease-cleavable linker is cleaved by CTSG and comprises any one of SEQ ID NOS: 377-385; wherein the protease-cleavable linker is cleaved by CTSS and comprises any one of SEQ ID NOS: 386-395; wherein the protease-cleavable linker is cleaved by FAP and comprises any one of SEQ ID NOS: 406-415; wherein the protease-cleavable linker is cleaved by FXIA and comprises any one of SEQ ID NOS: 416-425; wherein the protease -cleavable linker is cleaved by GGT1 and comprises any one of SEQ ID NOS: 426-435; wherein the protease-cleavable linker is cleaved by GZMA and comprises any one of SEQ ID NOS: 436-445; wherein the protease-cleavable linker is cleaved by H20S and comprises any one of SEQ ID NOS: 456-465; wherein the protease -cleavable linker is cleaved by KLK2 and comprises any one of SEQ ID NOS: 466-475; wherein the protease-cleavable linker is cleaved by MMP1 and comprises any one of SEQ ID NOS: 476-485; wherein the protease-cleavable linker is cleaved by MMP10 and comprises any one of SEQ ID NOS: 486-495; wherein the protease-cleavable linker is cleaved by MMP12 and comprises any one of SEQ ID NOS: 496-505; wherein the protease-cleavable linker is cleaved by MMP13 and comprises any one of SEQ ID NOS: 506-515; wherein the protease-cleavable linker is cleaved by MMP2 and comprises any one of SEQ ID NOS: 516-525; wherein the protease-cleavable linker is cleaved by MMP3 and comprises any one of SEQ ID NOS: 526-535;wherein the protease -cleavable linker is cleaved by MMP8 and comprises any one of SEQ ID NOS: 536-545; wherein the protease-cleavable linker is cleaved by TPA and comprises any one of SEQ ID NOS: 556-565; or wherein the protease-cleavable linker is cleaved by UPA and comprises any one of SEQ ID NOS: 566-575.
28. The immune cell of any one of claims 17-27, wherein the synNotch core comprises: an extracellular domain comprising about 80% similarity or more to SEQ ID NO: 124 or SEQ ID NO: 125; a juxtamembrane domain comprising about 80% similarity or more to SEQ ID NO: 126; and a transmembrane domain comprising about 80% similarity or more to SEQ ID NO: 127 or SEQ ID NO: 128.
29. The immune cell of any one of claims 17-28, wherein the synNotch core comprises about 80% similarity or more to SEQ ID NO: 129.
30. The immune cell of any one of claims 17-29, wherein the signal peptide comprises about 80% similarity or more to SEQ ID NO: 120 or SEQ ID NO: 121.
31. The immune cell of any one of claims 17-30, wherein the antigen-binding domain is a single-chain fragment variable (scFv) or a nanobody.
32. The immune cell of any one of claims 17-31, wherein the antigen-binding domain binds to an antigen that is associated with a disease or disorder.
33. The immune cell of claim 32, wherein the antigen-binding domain binds to a cancer- associated antigen or a tumor-associated antigen.
34. The immune cell of claim 33, wherein the antigen-binding domain binds to HER2, EGFR, BCMA, B2M, B7-H3, CAIX, CD70, CEA, CLDN18.2, cMET, sDl’R, FAP, GD2, GPC3, MSLN, MUC16ecto, PSCA, PSMA, EpCAM, ROR1, or TnMucl.
35. The immune cell of claim 34, wherein the antigen-binding domain comprises about 80% similarity or more to any one of SEQ ID NOS: 131-153.
36. The immune cell of any one of claims 17-35, wherein the transcription factor is Gal4- VP64 and the promoter comprises UAS.
37. The immune cell of any one of claims 17-36, wherein the reporter molecule comprises a fluorophore or fluorescent molecule, a bioluminescent molecule, or a chemiluminescent molecule.
38. The immune cell of any one of claims 17-37, wherein the reporter molecule comprises a DNA barcode sequence, an RNA barcode sequence, or a peptide barcode sequence.
39. The immune cell of any one of claims 17-38, wherein the secretion tag comprises about 80% similarity or more to any one of SEQ ID NOS: 121-123.
40. The immune cell of any one of claims 17-39, wherein the immune cell is a T cell, an invariant natural killer T (iNKT) cell, a macrophage, or a natural killer cell.
41. The immune cell of any one of claims 17-40, wherein the immune cell is an autologous immune cell or an allogenic immune cell.
42. The immune cell of any one of claims 17-41, wherein the engineered PAR comprises about 80% similarity or more to any one of SEQ ID NOS: 154-188.
43. A method of detecting cancer in a subject, the method comprising: a) administering the immune cell of any one of claims 16-42 to the subject, wherein the protease-cleavable linker is cleaved by a cancer-associated protease or a tumor-associated protease; b) collecting a biological fluid sample from the subject: and c) detecting presence or absence of the reporter molecule in the biological fluid sample, thereby detecting presence or absence of cancer.
44. The method of claim 43, wherein the immune cell is administered intravenously.
45. The method of any one of claims 43-44, wherein the biological fluid sample is urine, blood, saliva, breath, sputum, bone marrow, cerebrospinal fluid (CSF), plasma, synovial fluid, nasal lavage, cell lysate, oral mucosa, nasal mucosa, vaginal mucosa, and / or rectal mucosa.
46. The method of any one of claims 43-45, wherein step c) further comprises quantifying the reporter molecule.
47. The method of claim 46, wherein the quantity of the reporter molecule is used to determine severity or extent of the cancer, cancer stage, and / or size or volume of the cancer.
48. The method of any one of claims 43-47, wherein at least a portion of the cancer is HER2+, EGFR+, BC.MA-I-, B2M-F, B7-II34-, CAIX+, CD70+, CEA+, CLDN18.2H-, cMET+, sDTR+, FAP+, GD2+, GPC3+, MSLN+, MUC16ecto+, PSCA+, PSMA+, EpCAM+, R0R1+, and / or TnMucl+.
49. The method of any one of claims 43-48, further comprising, if presence of the cancer is detected, administering one or more anti-cancer treatments to the subject.
50. The method of any one of claims 43-49, wherein the method is repeated over time to monitor progression of the cancer.