Antigen-binding molecules and uses thereof

Abstract

The present invention relates generally to antibodies and antigen-binding fragments thereof, in particular those targeting cancer- associated antigens, compositions comprising the same, and methods and uses thereof for detecting cancer-associated antigens in tissues, including prostate cancer tissues. Also provided herein are methods for detecting prostate cancer in a subject, methods for detecting and measuring the severity of prostate cancer in a subject, methods for monitoring the progression of prostate cancer in a subject, methods for determining the likelihood of the presence of prostate cancer in a subject, methods for identifying a subject suffering from prostate cancer who is likely to respond to cancer therapy, methods for predicting the risk of recurrence of prostate cancer in a subject following treatment with a cancer therapy, methods for treating prostate cancer in a subject, methods of stratifying a subject for prostate cancer therapy, uses of anti-cancer agent in the manufacture of a medicament for treating prostate cancer in a subject, and an anti-cancer agent for use in the treatment of prostate cancer in a subject, based upon the detection of specific protein biomarkers with the antibodies described herein. Also contemplated are immunoassays, including immunohistochemistry (IHC) and immunofluorescence (IF), to detect specific protein biomarkers in biological samples. The preferred biomarkers include endosomal proteins, such as Adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 (APPL1), sortilin-1 (SORT1), Syndecan-1 (SDC1).

Description

[0001] Antigen-binding Molecules and Uses Thereof

[0002] FIELD

[0003] The present invention relates generally to antibodies and antigen-binding fragments thereof, in particular to those targeting cancer-associated antigens, compositions comprising the same, and methods and uses thereof.

[0004] RELATED APPLICATION DATA

[0005] The present application claims priority from Australian Patent Application No. 2024903409 filed on 22 October 2024 entitled “Antigen-binding Molecules and Uses Thereof’. The entire contents of which is hereby incorporated by reference.

[0006] SEQUENCE LISTING

[0007] The present application is filed together with a Sequence Listing in electronic form. The entire contents of the Sequence Listing are hereby incorporated by reference.

[0008] BACKGROUND

[0009] Prostate cancer is the second most commonly diagnosed cancer and the fifth leading cause of cancer-related death among men globally. Each year, more than 1 million new cases of prostate cancer are diagnosed, resulting in more than 350,000 deaths worldwide. Unfortunately, the burden of prostate cancer is expected to increase significantly over the next decade due to an exponentially growing and ageing population, highlighting the need for improved diagnostic and prognostic tools that allow for earlier identification of disease and better stratification of patients who are more likely to respond to cancer therapies.

[0010] A number of tests are currently used by clinicians to aid in the diagnosis and prognosis of prostate cancer, one of which is histopathology. This involves a tissue biopsy being taken from the prostate gland of a patient suspected of having prostate cancer. Tissue morphology is assessed using established diagnostic criteria on haematoxylin and eosin (H&E) stained tissue sections to confirm prostate cancer. The tissue sections are also graded using the Gleason system to determine the likely prognosis of the patient. However, histopathological analysis of prostate cancer biopsies by pathologists is inherently subjective; meaning the diagnostic and prognostic output from such a test is reliant on their accurate interpretation.

[0011] It has been recently shown that the expression of three endosomal proteins - Adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 (APPL1), Sortilin-1 (SORT1) and Syndecan-1 (SDC1) - in prostate cancer biopsies reduces subjectivity in the interpretation of tissue morphology with respect to diagnosis, and improves the reliability of the assessment of the likely prognosis of a patient using the Gleason system.

[0012] Given the role that these markers have in aiding in the diagnosis and prognosis of prostate cancer in patients, antibodies that specifically bind to each of these three markers, and the use of such antibodies to detect these markers in tissue samples, is needed.

[0013] SUMMARY

[0014] In certain embodiments, provided herein is an antibody that is capable of specifically binding to Adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 (APPL1), or an antigen-binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 1 ; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 2; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 3; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 4; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 5; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 6, wherein the CDR sequences are according to Kabat numbering.

[0015] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the VH comprises an amino acid sequence of SEQ ID NO: 19, or an amino acid sequence that has at least 80% sequence identity thereto. In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the VH comprises an amino acid sequence of SEQ ID NO: 19.

[0016] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the antibody comprises a heavy chain constant region (CH), wherein the CH comprises an amino acid sequence of SEQ ID NO: 20, or an amino acid sequence that has at least 80% sequence identity thereto.

[0017] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the CH comprises an amino acid sequence of SEQ ID NO: 20.

[0018] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the antibody comprises a heavy chain, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 21, or an amino acid sequence that has at least 80% sequence identity thereto.

[0019] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 21.

[0020] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the VL comprises an amino acid sequence of SEQ ID NO: 22, or an amino acid sequence that has at least 80% sequence identity thereto. In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the VL comprises an amino acid sequence of SEQ ID NO: 22.

[0021] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the antibody comprises a light chain constant region (CL), wherein the CL comprises an amino acid sequence of SEQ ID NO: 23, or an amino acid sequence that has at least 80% sequence identity thereto.

[0022] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the CL comprises an amino acid sequence of SEQ ID NO: 23.

[0023] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the antibody comprises a light chain, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 24, or an amino acid sequence that has at least 80% sequence identity thereto.

[0024] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 24.

[0025] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 25, or a nucleotide sequence that has at least 80% sequence identity thereto.

[0026] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 25.

[0027] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 26, or a nucleotide sequence that has at least 80% sequence identity thereto.

[0028] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an antigen-binding fragment thereof, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 26.

[0029] In certain embodiments, provided herein is an antibody that is capable of specifically binding to Sortilin-1 (SORT1), or an antigen-binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 27; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 28; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 29; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 30; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 31; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 32, wherein the CDR sequences are according to Kabat numbering. In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the VH comprises an amino acid sequence of SEQ ID NO: 45, or an amino acid sequence that has at least 80% sequence identity thereto. In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the VH comprises an amino acid sequence of SEQ ID NO: 45.

[0030] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the antibody comprises a heavy chain constant region (CH), wherein the CH comprises an amino acid sequence of SEQ ID NO: 46, or an amino acid sequence that has at least 80% sequence identity thereto.

[0031] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the CH comprises an amino acid sequence of SEQ ID NO: 46.

[0032] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the antibody comprises a heavy chain, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 47, or an amino acid sequence that has at least 80% sequence identity thereto.

[0033] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 47.

[0034] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the VL comprises an amino acid sequence of SEQ ID NO: 48, or an amino acid sequence that has at least 80% sequence identity thereto. In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the VL comprises an amino acid sequence of SEQ ID NO: 48.

[0035] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the antibody comprises a light chain constant region (CL), wherein the CL comprises an amino acid sequence of SEQ ID NO: 49, or an amino acid sequence that has at least 80% sequence identity thereto.

[0036] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the CL comprises an amino acid sequence of SEQ ID NO: 49.

[0037] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the antibody comprises a light chain, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 50, or an amino acid sequence that has at least 80% sequence identity thereto.

[0038] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 50.

[0039] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 51, or a nucleotide sequence that has at least 80% sequence identity thereto.

[0040] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 51.

[0041] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 52, or a nucleotide sequence that has at least 80% sequence identity thereto.

[0042] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or an antigen-binding fragment thereof, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 52.

[0043] In certain embodiments, provided herein is an antibody that is capable of specifically binding to Syndecan-1 (SDC1), or an antigen-binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 53; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 54; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 55; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 56; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 57; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 58, wherein the CDR sequences are according to Kabat numbering. In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an antigen-binding fragment thereof, wherein the VH comprises an amino acid sequence of SEQ ID NO: 71, or an amino acid sequence that has at least 80% sequence identity thereto. In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an antigen-binding fragment thereof, wherein the VH comprises an amino acid sequence of SEQ ID NO: 71.

[0044] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an antigen-binding fragment thereof, wherein the antibody comprises a heavy chain constant region (CH), wherein the CH comprises an amino acid sequence of SEQ ID NO: 72, or an amino acid sequence that has at least 80% sequence identity thereto.

[0045] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an antigen-binding fragment thereof, wherein the CH comprises an amino acid sequence of SEQ ID NO: 72. In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an antigen-binding fragment thereof, wherein the antibody comprises a heavy chain, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 73, or an amino acid sequence that has at least 80% sequence identity thereto.

[0046] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an antigen-binding fragment thereof, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 73.

[0047] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an antigen-binding fragment thereof, wherein the VL comprises an amino acid sequence of SEQ ID NO: 74, or an amino acid sequence that has at least 80% sequence identity thereto. In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an antigen-binding fragment thereof, wherein the VL comprises an amino acid sequence of SEQ ID NO: 74.

[0048] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an antigen-binding fragment thereof, wherein the antibody comprises a light chain constant region (CL), wherein the CL comprises an amino acid sequence of SEQ ID NO: 75, or an amino acid sequence that has at least 80% sequence identity thereto.

[0049] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an antigen-binding fragment thereof, wherein the CL comprises an amino acid sequence of SEQ ID NO: 75.

[0050] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an antigen-binding fragment thereof, wherein the antibody comprises a light chain, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 76, or an amino acid sequence that has at least 80% sequence identity thereto.

[0051] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an antigen-binding fragment thereof, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 76.

[0052] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an antigen-binding fragment thereof, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 77, or a nucleotide sequence that has at least 80% sequence identity thereto.

[0053] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an antigen-binding fragment thereof, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 77.

[0054] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC 1 , or an antigen-binding fragment thereof, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 78, or a nucleotide sequence that has at least 80% sequence identity thereto.

[0055] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC 1 , or an antigen-binding fragment thereof, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 78.

[0056] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein comprise a heavy chain constant region selected from the group consisting of IgA, IgGl, IgG2a, IgG2b, IgG3, IgG4, and IgM.

[0057] In certain embodiments, the anti-APPLl antibody, or antigen-binding fragment thereof, described herein comprises a heavy chain constant region of IgGl.

[0058] In certain embodiments, the anti-SORTl antibody, or antigen-binding fragment thereof, described herein comprises a heavy chain constant region of IgG2a.

[0059] In certain embodiments, the anti-SDCl antibody, or antigen-binding fragment thereof, described herein comprises a heavy chain constant region of IgG2b.

[0060] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are natural antibodies.

[0061] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are synthetic antibodies.

[0062] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are isolated antibodies.

[0063] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are monoclonal antibodies.

[0064] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are human antibodies.

[0065] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are humanized antibodies.

[0066] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are mouse antibodies.

[0067] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are chimeric antibodies.

[0068] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein comprise a light chain constant region of kappa or lambda light chain. In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein comprise a light chain constant region of kappa light chain.

[0069] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein comprise an Fc region.

[0070] In certain embodiments, the APPL1, SORT1 and SDC1 antigen-binding fragments described herein comprise a Fab, F(ab')2, Fv, or single chain Fv (scFv) fragment.

[0071] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein comprise a detectable label.

[0072] In certain embodiments, provided herein is a composition comprising one or more or all of: a) the anti-APPLl antibody, or antigen-binding fragments thereof, described herein; b) the anti-SORTl antibody, or antigen-binding fragments thereof, described herein; and c) the anti-SDCl antibody, or antigen-binding fragments thereof, described herein.

[0073] In certain embodiments, provided herein is a kit comprising one or more or all of:

[0074] a) the anti-APPLl antibody, or antigen-binding fragments thereof, described herein;

[0075] b) the anti-SORTl antibody, or antigen-binding fragments thereof, described herein; and

[0076] c) the anti-SDCl antibody, or antigen-binding fragments thereof, described herein.

[0077] In relation to the compositions and kits defined above the concentrations of the defined antibody, or antigen-binding fragments thereof is from lOOpg / mL - Ipg / mL.

[0078] In certain embodiments the compositions are buffered compositions comprising one or more of PBS, TRIS, Citrate or any other buffer that maintains the pH of the solution between 5.0 and 8.0. In certain embodiments the compositions further includes one or more preservatives selected from Azide, Proclin 300 or any other compatible preservative that prevents the growth and proliferation of contaminating microorganisms that may spoil the composition.

[0079] In certain embodiments the compositions may be stored between -80 degrees Celsius and 4 degrees Celsius for up to a year.

[0080] In certain embodiments, provided herein is a use of the antibodies, or antigen-binding fragments thereof, described herein, the composition described herein, or the kit described herein to detect at least one of APPL1, SORT1 and SDC1 in a biological sample.

[0081] In certain embodiments, provided herein is the antibodies, or antigen-binding fragments thereof, described herein, the composition described herein, or the kit described herein for use in detecting at least one of APPL1, SORT1 and SDC1 in a biological sample. In certain embodiments, the at least one of APPL1, S0RT1 and SDC1 are detected by immunohistochemistry (IHC) or immunofluorescence (IF).

[0082] In certain embodiments, provided herein is a method of determining the presence of prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigenbinding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the presence of prostate cancer.

[0083] In certain embodiments, provided herein is a method of determining the presence and severity of a prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the presence and severity of prostate cancer.

[0084] In certain embodiments, provided herein is a method of monitoring the progression of a prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen -binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the progression of prostate cancer.

[0085] In certain embodiments, provided herein is a method determining the likelihood of the presence of a prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen -binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the likelihood of the presence of a prostate cancer.

[0086] In certain embodiments, provided herein is a method of identifying a subject suffering from prostate cancer who is likely to be responsive to a cancer therapy, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the likelihood of the subject suffering prostate cancer being responsive to a cancer therapy.

[0087] In certain embodiments, provided herein is a method of predicting the risk of recurrence of prostate cancer in a subject following treatment with a cancer therapy, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is predictive of the risk of recurrence of prostate cancer.

[0088] In certain embodiments, provided herein is a method of treating prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative that the subject has prostate cancer, wherein where the subject is identified as having prostate cancer, treating the subject with a cancer therapy.

[0089] In certain embodiments, provided herein is a method of stratifying a subject for a prostate cancer therapy, the method comprising:

[0090] a) detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen-binding fragment thereof, described herein;

[0091] b) comparing one or more of the presence, level, secretion and distribution as detected in step a) to a reference; and

[0092] c) based on the comparison in step b), stratifying the subject for treatment with a prostate cancer therapy.

[0093] In certain embodiments, provided herein is a method for treating prostate cancer in a subject, the method comprising:

[0094] a) detecting the presence or likelihood of the presence of prostate cancer in the subject according to any one of the methods described herein; and

[0095] b) treating the subject in which prostate cancer is detected with a cancer therapy. In certain embodiments, provided herein is a use of an anti-cancer agent in the manufacture of a medicament for the treatment of prostate cancer, wherein the medicament is to be administered to a subject identified as having prostate cancer by detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigenbinding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDC1 antibody, or antigen-binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative that the subject has prostate cancer.

[0096] In certain embodiments, provided herein is a use of an anti-cancer agent in the manufacture of a medicament for the treatment of prostate cancer, wherein the medicament is to be administered to a subject in need thereof, wherein the presence or likelihood of the presence of prostate cancer has been determined in the subject according to any one of the methods described herein.

[0097] In certain embodiments, provided herein is an anti -cancer agent for use in the treatment of prostate cancer in a subject, wherein the treatment comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPLlis detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen -binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative that the subject has prostate cancer.

[0098] In certain embodiments, provided herein is an anti -cancer agent for use in the treatment of prostate cancer in a subject, the use comprising:

[0099] a) detecting the presence or likelihood of prostate cancer in the subject according to any one of the methods described herein; and

[0100] b) treating the subject in which the presence or likelihood of the presence of prostate cancer has been determined with an anti -cancer agent.

[0101] In certain embodiments, the at least one of APPL1, SORT1 and SDC1 are detected by immunohistochemistry (IHC) or immunofluorescence (IF).

[0102] BRIEF DESCRIPTION OF THE DRAWINGS

[0103] Certain embodiments are illustrated by the following drawings. It is to be understood that the following description is for the purpose of describing particular embodiments only and is not intended to be limiting with respect to the description.

[0104] Figure 1 shows the results of an ELISA assay evaluating the binding of the anti-APPLl antibody (clone 1E7-2) to the immobilized recombinant peptide antigen human APPL1 - UniProtKB accession # Q9UKG1 (SEQ ID NO: 79).

[0105] Figure 2 shows the results of an ELISA assay evaluating the binding of the anti-SORTl antibody (clone 9E10-2) to the immobilized recombinant peptide antigen human S0RT1 - UniProtKB accession # Q99523 (SEQ ID NO: 80).

[0106] Figure 3 shows the results of an ELISA assay evaluating the binding of the anti-SDCl antibody (clone 10A3-2) to the immobilized recombinant peptide antigen human SDC1 - UniProtKB accession # P18827 (SEQ ID NO: 81).

[0107] Figure 4 depicts the staining distribution of APPL1, SORT1 and SDC1 detected by the anti-APPL1 antibody (clone 1E7-2), anti-SORTl antibody (clone 9E10-2) and anti-SDCl antibody (clone 10A3-2), respectively, by IHC in formalin-fixed paraffin-embedded (FFPE) tissues from benign prostate gland, pre-prostate cancer conditions, and various manifestations of prostate cancer at various grades. H&E staining of the same tissues is also shown as a reference.

[0108] Figure 5 shows the sensitivity and specificity of combining the staining patterns of APPL1, SORT1 and SDC1, detected by the anti-APPLl antibody (clone 1E7-2), anti-SORTl antibody (clone 9E10-2) and anti-SDCl antibody (clone 10A3-2), respectively, by IHC in FFPE tissues, to discriminate between (A) low-grade prostate cancer tissue and (B) high-grade prostate cancer tissue. H&E staining of the same tissues is also shown as a reference.

[0109] DETAILED DESCRIPTION

[0110] Definitions

[0111] The term “antibody” as used herein refers to an immunoglobulin molecule that recognizes and specifically binds to a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combinations of the foregoing through at least one antigen recognition site within the variable region of the immunoglobulin molecule. Suitable antibodies will be known to persons skilled in the art, illustrative examples of which include natural antibodies, synthetic antibodies, isolated antibodies, monoclonal antibodies, polyclonal antibodies, human antibodies, humanized antibodies, mouse antibodies, chimeric antibodies, fusion proteins comprising an antibody, and any other modified immunoglobulin molecule so long as the antibodies exhibit the desired biological activity. Thus, in an embodiment, the antibody is selected from the group consisting of natural antibodies, synthetic antibodies, isolated antibodies, monoclonal antibodies, polyclonal antibodies, human antibodies, humanized antibodies, mouse antibodies, chimeric antibodies, fusion proteins comprising an antibody, and any other modified immunoglobulin molecule so long as the antibodies exhibit the desired biological activity. An antibody can be of any the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or subclasses (isotypes) thereof (e.g., IgGl, IgG2a, IgG2b, IgG3, IgG4, IgAl and IgA2), based on the identity of their heavy chain constant regions referred to as alpha (A), delta (D), epsilon (E), gamma (G), and mu (M), respectively. The different classes of immunoglobulins have different and well-known subunit structures and three-dimensional configurations. Antibodies can be naked or conjugated to other molecules such as detectable labels, toxins, radioisotopes, etc.

[0112] Antibodies are composed of two heavy chains and two light chains. Each heavy and light chain have a variable region, termed the heavy chain variable region (VH) and the light chain variable region (VL), respectively. Each heavy and light chain have a constant region, termed the heavy chain constant region (CH) and the light chain constant region (CL), respectively. Together, the VH and VL regions are responsible for binding the antigen recognised by the antibody. Typically, an immunoglobulin molecule has heavy (H) chains and light (L) chains interconnected by disulphide bonds.

[0113] The term “heavy chain” as used herein refers to any distinct type (e.g., alpha (A), delta (D), epsilon (E), gamma (G), and mu (M)), based on the amino acid sequence of the constant region, which gives rise to IgA, IgD, IgE, IgG, and IgM classes of antibodies, respectively, including subclasses of IgG (e.g., IgGl, IgG2a, IgG2b, IgG3, IgG4) and IgA (e.g., IgAl and IgA2). These heavy chain classes determine the functional activity of an antibody molecule. In specific embodiments, the heavy chain is a human heavy chain. In specific embodiments, the heavy chain is a rodent or murine heavy chain.

[0114] The term "light chain" as used herein refers to any distinct type (e.g., kappa (K) or lambda (L)) based on the amino acid sequence of the constant region. Light chain amino acid sequences are well known in the art. In specific embodiments, the light chain is a human light chain. In specific embodiments, the light chain is a rodent or murine light chain.

[0115] Each heavy and light chain contains a constant region and a variable region (the regions are also known as "domains"). In combination, the heavy and the light chain variable regions specifically bind the antigen. Light and heavy chain variable regions contain a "framework" region or "FRs" interrupted by three hypervariable regions, also called "complementarity determining regions" or "CDRs". The sequences of the framework regions of different light or heavy chains are relatively conserved within a species. The framework region of an antibody, that is the combined framework regions of the constituent light and heavy chains, largely adopt a P-sheet conformation and the CDRs form loops which connect, and in some cases form part of, the P-sheet structure. Thus, framework regions act to form a scaffold that provides for positioning the CDRs in correct orientation by inter-chain, non-covalent interactions.

[0116] The terms “variable region”, “variable domain” and the like, as used herein, are used interchangeably and are common in the art. The variable region typically refers to a portion of an antibody, generally, a portion of a light or heavy chain, which differ in sequence among antibodies and which are used in the binding and specificity of a particular antibody for its particular antigen. The variability in sequence is concentrated in the regions CDRs, while the more highly conserved regions in the variable domain are the FRs. Without wishing to be bound by any particular mechanism or theory; it is believed that the CDRs of the light and heavy chains are primarily responsible for the interaction and specificity of the antibody with antigen. In certain embodiments, the variable region is a human variable region. In certain embodiments, the variable region is a rodent or murine variable region.

[0117] The terms "constant region", "constant domain" and the like, as used herein, are used interchangeably herein and are common in the art. The constant region is an antibody portion (e.g., a carboxyl terminal portion of a light and / or heavy chain which is not directly involved in binding of an antibody to an antigen, but which can exhibit various effector functions, such as interaction with the Fc receptor). The constant region of an immunoglobulin molecule generally has a more conserved amino acid sequence relative to an immunoglobulin variable domain. In certain aspects, an antibody or antigen-binding fragment comprises a constant region or portion thereof that is sufficient for antibody-dependent cell-mediated cytotoxicity (ADCC).

[0118] The terms "anti-APPLl antibody", "APPL1 -antibody", "antibody that specifically binds to APPL1 " and the like, as used herein, are used interchangeably to refer to an antibody that is capable of specifically binding to APPL1.

[0119] The terms "anti-SORTl antibody", " S ORT 1 -antibody", "antibody that binds to SORT1" and the like, as used herein, are used interchangeably to refer to an antibody that is capable of specifically binding to SORT1.

[0120] The terms "anti-SDCl antibody", "SDCl-antibody", "antibody that binds to SDC1" and the like, as used herein, are used interchangeably to refer to an antibody that is capable of specifically binding to SDC 1.

[0121] The term “antigen-binding fragment" as used herein refers to a fragment of an antibody that retains the ability to specifically bind to the target antigen to which the parent antibody is capable of binding. An antigen-binding fragment will typically contain an antigen recognition site of an intact antibody (e.g., CDRs) sufficient to specifically bind to an antigen. Examples of antigen-binding fragments of antibodies include, but are not limited to, proteolytic antibody fragments (such as F(ab')2 fragments, Fab' fragments, Fab'- SH fragments and Fab fragments as are known in the art), and recombinant antibody fragments (such as sFv fragments, dsFv fragments, bispecific sFv fragments, bispecific dsFv fragments, F(ab)'2 fragments, single chain Fv proteins ("scFv"), disulphide stabilized Fv proteins ("dsFv"), diabodies, and triabodies (as are known in the art). An antigen-binding fragment of an antibody can be derived from any animal species, such as rodents (e g., mouse, rat, or hamster) and humans or can be artificially produced.

[0122] Persons skilled in the art will appreciate that an antigen-binding fragment of an anti-APPLl antibody may also be referred to as an "APPL1 -binding fragment", an antigen-binding fragment of an anti-SORTl antibody may also be referred to as a " SORT 1 -binding fragment", and antigenbinding fragment of an anti-SDCl antibody may also be referred to as an " SDC 1 -binding fragment" .

[0123] The terms "Kabat numbering", "Chothia numbering" and "IMGT numbering" as used herein are recognized in the art and refer to systems of numbering amino acid residues in the heavy and light chain variable regions of an antibody or an antigen-binding fragment thereof. In certain aspects, CDRs can be determined according to the Kabat numbering system. In certain aspects, CDRs can be determined according to the Chothia numbering system. In certain aspects, CDRs can be determined according to the IMGT numbering system. In a specific embodiment, the CDRs of the antibodies described herein have been determined according to the Kabat numbering system. In a specific embodiment, the CDRs of the antibodies described herein have been determined according to the Chothia numbering system. In a specific embodiment, the CDRs of the antibodies described herein have been determined according to the IMGT numbering system.

[0124] The term "monoclonal antibody" as used herein refers to a homogeneous antibody involved in the highly specific recognition and binding of a single antigenic determinant, or epitope. This is in contrast to polyclonal antibodies that typically include different antibodies directed against different antigenic determinants. Monoclonal antibodies can be made in any number of manners including, but not limited to, by hybridoma, phage selection, recombinant expression, and transgenic animals. Methods for the preparation of monoclonal antibodies include for example Kohler et al. (1975) Nature 256:495-497 (herein incorporated by reference); Kozbor et al. (1985) J. Immunol. Methods 81:31-42 (herein incorporated by reference); Cote et al. (1983) Proc. Natl. Acad. Sci 80:2026-2030 (herein incorporated by reference); and Cole et al. (1984) Mol. Cell Biol. 62: 109-120 (herein incorporated by reference).

[0125] The term "polyclonal antibody" as used herein refers to an antibody that is directed against a specific antigen that is derived from different B-cell lines. Methods for producing and isolating polyclonal antibodies from B-cell lines are known. Typically, polyclonal antibodies are obtained directly from an immunized subject, such as an immunized animal. Methods of immunization are known in the art.

[0126] The terms “specifically binding”, “immunospecifically binding”, “immunospecifically recognizing”, “specifically recognizing” and the like, as used herein, are used interchangeably in the context of antibodies or antigen-binding fragments thereof. These terms indicate that an antibody, or an antigen-binding fragment thereof, binds to an epitope via its antigen-binding domain and that the binding entails some complementarity between the antigen-binding domain and the epitope.

[0127] The term "epitope" as used herein is a term in the art and refers to a localized region of an antigen to which an antibody, or antigen-binding fragment thereof, can specifically bind. An epitope can be, for example, contiguous amino acids of a polypeptide (linear or contiguous epitope) or an epitope can, for example, come together from two or more non-contiguous regions of a polypeptide or polypeptides (conformational, non-linear, discontinuous, or non-contiguous epitope). In certain embodiments, the epitope to which an antibody or antigen-binding fragment thereof specifically binds can be determined by, e.g., NMR spectroscopy, X-ray diffraction crystallography studies, ELISA assays, hydrogen / deuterium exchange coupled with mass spectrometry (e.g., liquid chromatography electrospray mass spectrometry), array-based oligo-peptide scanning assays, and / or mutagenesis mapping (e.g., site-directed mutagenesis mapping).

[0128] The terms "sequence identity", "percent identity" and the like, as used herein, are used interchangeably and refer to the extent of identity between two sequences (e.g., amino acid sequences or nucleotide sequences). Sequence identity can be determined by aligning two sequences, introducing gaps to maximize identity between the sequences. Alignments can be generated using programs known in the art.

[0129] The sequence identity between two amino acid sequences or two nucleotide sequences may be 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% or anywhere in between.

[0130] The term "natural antibody" as used herein refers to antibodies that do not comprise any genetically introduced mutations. An antibody which comprises naturally occurring modifications, e.g., different allotypes, is thus to be understood as a "natural antibody" in the sense of the present invention.

[0131] The term "synthetic antibody" as used herein refers to antibodies that have been synthesised by chemical or recombinant techniques, and which retain the functional properties of the antibody. The term "isolated antibody" as used herein refers to antibodies that are substantially free from other materials. In one aspect, the term isolated antibody refers to an antibody separated from other materials that are present in a natural source, including DNAs, RNAs, other proteins or polypeptides, cells or cellular organelles, or tissues or organs. In another aspect, the term "isolated antibody" refers to an antibody that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. In another aspect, the term "isolated antibody" refers to antibodies which are isolated from other cellular antibodies and is meant to encompass both purified and recombinant antibodies.

[0132] The term "human antibody" as used herein is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. The human antibodies of the present invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo). However, the term "human antibody" as used herein, is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a rabbit, have been grafted onto human framework sequences. Thus, as used herein, the term "human antibody" refers to an antibody in which substantially every part of the protein (e.g., CDR, framework, light chain constant region, heavy chain constant region, hinge, light chain variable region, heavy chain variable region) is substantially non- immunogenic in humans, with only minor sequence changes or variations. Similarly, antibodies designated primate (e.g., monkey, baboon, chimpanzee, etc.), rodent (e.g., mouse, rat, rabbit, guinea pig, hamster, etc.) and other mammals designate such species, sub-genus, genus, sub-family, family specific antibodies. Further, chimeric antibodies include any combination of the above. Such changes or variations optionally and preferably retain or reduce the immunogenicity in humans or other species relative to non-modified antibodies. Thus, a human antibody is distinct from a chimeric or humanized antibody. It is pointed out that a human antibody can be produced by a non-human animal, prokaryotic, or eukaryotic cell that is capable of expressing functionally rearranged human immunoglobulin (e g., heavy chain and / or light chain) genes.

[0133] The term "humanized antibody" as used herein refers to forms of non-human (e.g., murine) antibodies that contain minimal non-human (e.g., murine) sequences. Typically, humanized antibodies are human immunoglobulins in which residues from the CDR are replaced by residues from the CDR of a non-human species (e.g., mouse, rat, rabbit, hamster, etc.) that have the desired specificity, affinity, and capability. Typically, humanized antibodies have constant regions and variable regions other than the CDRs derived substantially or exclusively from a human antibody and CDRs derived substantially or exclusively from a non-human antibody of interest. Humanized antibodies, or antibodies adapted for non-rejection by other mammals, may be produced by a suitable method known in the art, including for example resurfacing or CDR grafting. In resurfacing technology, molecular modelling, statistical analysis and mutagenesis are combined to adjust the non-CDR surfaces of variable regions to resemble the surfaces of known antibodies of the target host. Strategies and methods for the resurfacing of antibodies, and other methods for reducing immunogenicity of antibodies within a different host are known, for example as described in US patent 5,639,641. Humanized antibodies may also be made by CDR grafting, by substituting the CDRs of, for example, a mouse antibody, into a human framework domain.

[0134] Methods for humanizing antibodies are known. For example, the antibody may be generated as described in U.S. Pat. No. 6,180,370 (herein incorporated by reference); WO 92 / 22653 (herein incorporated by reference); Wright et al. (1992) Critical Rev. in Immunol. 12(3,4): 125-168 (herein incorporated by reference); and Gu et al. (1997) Thrombosis and Hematocyst 77(4):755-759) (herein incorporated by reference).

[0135] The term "mouse antibody" refers to antibodies in which the variable region sequences and the constant region sequences are derived from a mouse.

[0136] The term "chimeric antibody" refers to antibodies where the amino acid sequence is derived from two or more species. Typically, the variable region of both light and heavy chains corresponds to the variable region of antibodies derived from one species of mammals (e.g., mouse, rat, rabbit, etc.) with the desired specificity, affinity, and capability, while the constant regions are homologous to the sequences in antibodies derived from another species (usually human) to avoid eliciting an immune response in that species.

[0137] Techniques developed for the production of chimeric antibodies, for example the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, may be performed by a suitable method. For example, chimeric antibodies may be produced as described in Morrison, S. L. etal. (1984) Proc. Natl. Acad. Sci 81:6851-6855 (herein incorporated by reference); Neuberger, M. S. et al. (1984) Nature 312:604-608 (herein incorporated by reference); and Takeda, S. etal. (1985) Nature 314:452-454 (herein incorporated by reference).

[0138] The term "detectable label" as used herein refers to a molecule or material that can produce a detectable (such as visually, electronically or otherwise) signal that indicates the presence and / or concentration of the label in a sample. When conjugated to a specific binding molecule, the detectable label can be used to locate and / or quantify the target to which the specific binding molecule is directed. Thereby, the presence, level, secretion and distribution of the target in a sample can be detected by detecting the signal produced by the detectable label. A detectable label can be detected directly or indirectly, and several different detectable labels conjugated to different specific-binding molecules can be used in combination to detect one or more targets. For example, a first detectable label conjugated to an antibody specific to a target can be detected indirectly through the use of a second detectable label that is conjugated to a molecule that specifically binds the first detectable label. Multiple detectable labels that can be separately detected can be conjugated to different specific binding molecules that specifically bind different targets to provide a multiplexed assay that can provide simultaneous detection of the multiple targets in a sample. A detectable signal can be generated by any mechanism including absorption, emission and / or scattering of a photon (including radio frequency, microwave frequency, infrared frequency, visible frequency and ultra-violet frequency photons). Detectable labels include coloured, fluorescent, phosphorescent, and luminescent molecules and materials, and catalysts (such as enzymes) that convert one substance into another substance to provide a detectable difference (such as by converting a colourless substance into a coloured substance or vice versa, or by producing a precipitate or increasing sample turbidity). Particular examples of detectable labels include enzymes such as horseradish peroxidase, alkaline phosphatase, acid phosphatase, glucose oxidase, 0-galactosidase or - glucuronidase; and fluorophores such as fluoresceins, luminophores, coumarins, BODIPY dyes, resorufms, and rhodamines. Where the detectable label includes an enzyme, a detectable substrate such as a chromogen, a fluorogenic compound, or a luminogenic compound can be used in combination with the enzyme to generate a detectable signal. Particular examples of chromogenic compounds include diaminobenzidine (DAB), 4-nitrophenylphospate (pNPP), fast red, bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), BCIP / NBT, fast red, AP Orange, AP blue, tetramethylbenzidine (TMB), 2,2'- azino-di-[3-ethylbenzothiazoline sulphonate] (ABTS), o-dianisidine, 4- chloronaphthol (4-CN), nitrophenyl--D-galactopyranoside (ONPG), o- phenylenediamine (OPD), 5-bromo-4-chloro-3-indolyl- -galactopyranoside (X-Gal), methylumbelliferyl- -D-galactopyranoside (MU-Gal), p-nitrophenyl-a-D-galactopyranoside (PNP), 5-bromo-4-chloro-3-indolyl- -D-glucuronide (X-Gluc), 3-amino-9-ethyl carbazol (AEC), fuchsin, iodonitrotetrazolium (INT), tetrazolium blue and tetrazolium violet. The terms "subject", "patient" and the like, as used herein, are used interchangeably and refer to any mammal, including human, having or suspected of having a disease (e.g., prostate cancer). The terms "detection", "detect", "detecting" and the like, as used herein, are used interchangeably and refer to a qualitative and / or quantitative determination of one or more of the presence, level, secretion, and distribution of a given protein, in particular the proteins APPL1, SORT1 and SDC1. In another aspect, the terms "detection", "detect", "detecting" and the like, as used herein, are used interchangeably and refer to a qualitative and / or quantitative determination of one or more of the altered presence, level, secretion, and distribution of a given protein, in particular the proteins APPL1, SORT1 and SDC1. In certain embodiments, the determination is made directly (e.g., by determining absolute protein marker level in a first biological sample) or relatively (e.g., by comparing protein marker level of the first biological sample to the same protein marker level in a second biological sample or reference). The second biological sample or reference that the first biological sample is compared to may not be diseased. Examples of a non-diseased second biological sample or reference include, but are not limited to, normal or benign prostate tissue, a normal blood sample, or a normal plasma sample. The normal or benign prostate tissue may be one that is from the same subject or a different subject (i.e., a healthy subject). The normal blood sample or plasma sample may be one from a different subject (i.e., a healthy subject). The reference can also be determined by averaging levels of a particular protein, in particular the proteins APPL1, SORT1 and SDC1, from a population of samples that are not diseased. As will be appreciated in the art, once the "reference" APPL1, SORT1, and SDC1 level is known, it can be used repeatedly as a reference for comparison. Methods for the calculation or determination of the concentration of a protein marker are known in the art. The reference may also be a cut-off value (such as a predetermined cut-off value). In another aspect, the terms "detection", "detect", "detecting" and the like, as used herein, are used interchangeably and refer to the diagnosis of a disease.

[0139] The term "reference" as used herein refers to a non-diseased biological sample. Examples of a reference include, but are not limited to, normal or benign prostate tissue, a normal blood sample, or a normal plasma sample. The reference may be from the same subject that the biological sample being assessed for the detection of a given protein, in particular the proteins APPL1, SORT1 and SDC1, is from. The reference may be from a different subject (i.e., a healthy subject) that the biological sample being assessed for the detection of a given protein, in particular the proteins APPL1, SORT1 and SDC1, is from. Where the reference is a normal or benign prostate tissue, the reference may be from the same subject that the biological sample being assessed for the detection of a given protein, in particular the proteins APPL1, SORT1 and SDC1, is from, or from a different subject (i.e., a healthy subject) that the biological sample being assessed for the detection of a given protein, in particular the proteins APPL1, SORT1 and SDC1, is from. Where the reference is a normal blood sample or plasma sample, these may be from a different subject (i.e., a healthy subject) that the biological sample being assessed for the detection of a given protein, in particular the proteins APPL1, SORT1 and SDC1, is from. The reference can also be determined by averaging levels of a particular protein, in particular the proteins APPL1, SORT1 and SDC1, from a population of samples that are not diseased. As will be appreciated in the art, once the "reference" APPL1, SORT1, and SDC1 level is known, it can be used repeatedly as a reference for comparison. Methods for the calculation or determination of the concentration of a protein marker are known in the art. The reference may also be a cut-off value (such as a predetermined cut-off value). The term "diagnosis" as used herein encompasses the identification of the nature of a disease. The term "prognosis" as used herein encompasses a forecast as to the probable outcome of a disease, the prospects as to recovery from a disease as indicated by the nature and symptoms of a disease.

[0140] The terms “treating”, “treatment”, “treat” and the like, as used herein, are used interchangeably and refer to obtaining a desired effect in terms of improving the condition of the subject, ameliorating, arresting, suppressing, relieving and / or slowing the progression of one or more symptoms in the subject, a partial or complete stabilization of the subject, a regression of the one or more symptoms, or a cure of a disease, condition or state in the subject.

[0141] In certain embodiments, the treating comprises one or more of surgical intervention, radiation therapy and administration of an anti-cancer agent.

[0142] The terms “cancer therapy”, "prostate cancer therapy", and the like, as used herein, are used interchangeably and refer to one or more of surgical intervention, radiation therapy and administration of an anti-cancer agent to treat a subject. Suitable anti-cancer agents will be known to persons skilled in the art, illustrative examples of which include androgen-deprivation therapy (ADT) (such as leuprolide goserelin, triptorelin, histrelin, degerelix or surgical castration) or androgen receptor (AR) antagonists (such as MDV3100, ARN-509, flutamide, bicalutamide, nilutamide, or cyproterone acetate) or chemotherapeutics. Certain chemotherapeutics are well known for use against prostate cancer. These include capecitabine, carboplatin, cyclophosphamide (Cytoxan), cabazitaxel, daunorubicin, docetaxel (Taxotere), doxorubicin (Adriamycin), epirubicin (Ellence), fluorouracil (also called 5 -fluorouracil or 5-FU), gemcitabine, eribulin, ixabepilone, methotrexate, mitomycin C, mitoxantrone, paclitaxel (Taxol), thiotepa, vincristine, and vinorelbine. Other cancer therapies that are contemplated include checkpoint inhibitors and CAR-T cell therapy. Other illustrative examples of cancer therapies that are contemplated are described in Debela et al. (2021) SAGE Open Med. 12(9): 20503121211034366 (herein incorporated by reference); Posdzich et al. (2023) Cancers (Basel) 15(2): 461 (herein incorporated by reference); and Sumanasuriya et al. (2018) Cold Spring Harb Perspect Med 8(6): a030635 (herein incorporated by reference).

[0143] The term "biological sample" as used herein refers to any biological sample obtained from a subject, cell line, tissue, or other source of cells potentially expressing one or more of APPL1, SORT1 and SDC1. Such biological samples may have been processed and / or treated. For example, the biological sample may be untreated, diluted, a derivative, an extract, a treated form, precleared, filtered, desalted, concentrated, diluted, buffered, centrifuged, induced, pre-treated, processed to remove one or more components or impurities from the sample, sliced, fixed, adhered to a slide, or suitable combinations thereof. Non-limiting sources of a biological sample for use in the present invention include solid tissue, biopsy, ascites, aspirates, fluidic extracts, blood (including circulating tumor cells), plasma, serum, spinal fluid, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, urine, amniotic fluid, hair, tumors, organs, cell cultures and / or cell culture constituents. Methods for obtaining and processing tissue biopsies, which can be used, for example, in immunoassays such as IHC and IF, and for obtaining body fluids, from animals (e.g., humans) are well known in the art.

[0144] In an embodiment, the biological sample is a tissue, blood or plasma sample.

[0145] The phrase “likelihood of the presence of a prostate cancer” as used herein refers to how likely it is for a prostate cancer to be present in a subject. Elevated levels of at least APPL1, SORT1 and SDC1 indicate a likelihood (i.e., chance or risk) of the presence of prostate cancer in the subject. This could be, for example, a more than 10%, 20%, 30%, 40%, 50%, 60%, 70% 80%, 90% or 99 % likelihood of the presence of prostate cancer in the subj ect

[0146] The term “elevated level” as used herein may refer to an increase in level of at least 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times 12 times, 13 times, 14 times, 15 times, 16 times, 17 times, 18 times, 19 times, 20 times, 21 times, 22 times, 23 times, 24 times, 25 times, 26 times, 27 times, 28 times, 29 times, 30 times, 31 times, 32 times, 33 times, 34 times, 35 times, 36 times, 37 times, 38 times, 39 times, 40 times, 41 times, 42 times, 43 times, 44 times, 45 times, 46 times, 47 times, 48 times, 49 times, 50 times, 51 times, 52 times, 53 times, 54 times, 55 times, 56 times, 57 times, 58 times, 59 times, 60 times, 61 times, 62 times, 63 times, 64 times, 65 times, 66 times, 67 times, 68 times, 69 times, 70 times, 71 times, 72 times, 73 times, 74 times, 75 times, 76 times, 77 times, 78 times, 79 times, 80 times, 81 times, 82 times, 83 times, 84 times, 85 times, 86 times, 87 times, 88 times, 89 times, 90 times, 91 times, 92 times, 93 times, 94 times, 95 times, 96 times, 97 times, 98 times, 99 times or 100 times or anywhere in between as compared to a reference.

[0147] Throughout this specification, the singular forms "a", "and", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an antibody" includes a plurality of such antibodies.

[0148] Throughout this specification, unless the context requires otherwise, the word “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

[0149] Antibodies

[0150] In certain embodiments, provided herein is an antibody that is capable of specifically binding to Adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 (APPL1), or an APPL1 -binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 1 ; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 2; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 3; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 4; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 5; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 6, wherein the CDR sequences are according to Kabat numbering.

[0151] In certain embodiments, provided herein is an antibody that is capable of specifically binding to Adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 (APPL1), or an APPL 1 -binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 7; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 8; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 9; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 10; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 11; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 12, wherein the CDR sequences are according to Chothia numbering.

[0152] In certain embodiments, provided herein is an antibody that is capable of specifically binding to Adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 (APPL1), or an APPL 1 -binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 13; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 14; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 15; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 16; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 17; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 18, wherein the CDR sequences are according to IMGT numbering.

[0153] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPL 1 -binding fragment thereof, wherein the VH comprises an amino acid sequence of SEQ ID NO: 19, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0154] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPL 1 -binding fragment thereof, wherein the VH comprises an amino acid sequence of SEQ ID NO: 19.

[0155] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPLl-binding fragment thereof, wherein the antibody comprises a heavy chain constant region (CH), wherein the CH comprises an amino acid sequence of SEQ ID NO: 20, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0156] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPL1 -binding fragment thereof, wherein the CH comprises an amino acid sequence of SEQ ID NO: 20.

[0157] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPL1 -binding fragment thereof, wherein the antibody comprises a heavy chain, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 21, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0158] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPL1 -binding fragment thereof, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 21.

[0159] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPLl-binding fragment thereof, wherein the VL comprises an amino acid sequence of SEQ ID NO: 22, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0160] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPLl-binding fragment thereof, wherein the VL comprises an amino acid sequence of SEQ ID NO: 22.

[0161] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPLl-binding fragment thereof, wherein the antibody comprises a light chain constant region (CL), wherein the CL comprises an amino acid sequence of SEQ ID NO: 23, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0162] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPLl-binding fragment thereof, wherein the CL comprises an amino acid sequence of SEQ IDNO: 23.

[0163] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPLl-binding fragment thereof, wherein the antibody comprises a light chain, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 24, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0164] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPLl-binding fragment thereof, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 24.

[0165] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPLl-binding fragment thereof, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 25, or a nucleotide sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0166] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPLl-binding fragment thereof, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 25.

[0167] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPLl-binding fragment thereof, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 26, or a nucleotide sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0168] In certain embodiments, provided herein is an antibody that is capable of specifically binding to APPL1, or an APPLl-binding fragment thereof, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 26.

[0169] In certain embodiments, provided herein is an antibody that is capable of specifically binding to Sortilin-1 (SORT1), or a SORTl-binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 27; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 28; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 29; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 30; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 31; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 32, wherein the CDR sequences are according to Kabat numbering. In certain embodiments, provided herein is an antibody that is capable of specifically binding to Sortilin-1 (SORT1), or a SORTl-binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 33; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 34; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 35; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 36; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 37; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 38, wherein the CDR sequences are according to Chothia numbering. In certain embodiments, provided herein is an antibody that is capable of specifically binding to Sortilin-1 (SORT1), or a SORTl-binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 39; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 40; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 41; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 42; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 43; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 44, wherein the CDR sequences are according to IMGT numbering.

[0170] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, ora SORTl-binding fragment thereof, wherein the VH comprises an amino acid sequence of SEQ ID NO: 45, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0171] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, ora SORTl-binding fragment thereof, wherein the VH comprises an amino acid sequence of SEQ ID NO: 45.

[0172] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or a SORTl-binding fragment thereof, wherein the antibody comprises a heavy chain constant region (CH), wherein the CH comprises an amino acid sequence of SEQ ID NO: 46, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0173] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or a SORT 1 -binding fragment thereof, wherein the CH comprises an amino acid sequence of SEQ ID NO: 46.

[0174] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or a SORTl-binding fragment thereof, wherein the antibody comprises a heavy chain, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 47, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0175] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or a SORTl-binding fragment thereof, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 47.

[0176] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or a SORTl-binding fragment thereof, wherein the VL comprises an amino acid sequence of SEQ ID NO: 48, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0177] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or a SORTl-binding fragment thereof, wherein the VL comprises an amino acid sequence of SEQ ID NO: 48.

[0178] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or a SORTl-binding fragment thereof, wherein the antibody comprises a light chain constant region (CL), wherein the CL comprises an amino acid sequence of SEQ ID NO: 49, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0179] In certain embodiments, provided herein is an antibody that is capable of specifically binding to S0RT1, or a SORT 1 -binding fragment thereof, wherein the CL comprises an amino acid sequence of SEQ IDNO: 49.

[0180] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or a SORTl-binding fragment thereof, wherein the antibody comprises a light chain, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 50, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0181] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or a SORTl-binding fragment thereof, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 50.

[0182] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or a SORTl-binding fragment thereof, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 51, or a nucleotide sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0183] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or a SORTl-binding fragment thereof, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 51.

[0184] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or a SORTl-binding fragment thereof, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 52 or a nucleotide sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0185] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SORT1, or a SORTl-binding fragment thereof, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 52.

[0186] In certain embodiments, provided herein is an antibody that is capable of specifically binding to Syndecan-1 (SDC1), or an SDC1 -binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 53; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 54; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 55; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 56; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 57; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 58, wherein the CDR sequences are according to Kabat numbering. In certain embodiments, provided herein is an antibody that is capable of specifically binding to Syndecan-1 (SDC1), or an SDC1 -binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 59; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 60; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 61; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 62; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 63; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 64, wherein the CDR sequences are according to Chothia numbering. In certain embodiments, provided herein is an antibody that is capable of specifically binding to Syndecan-1 (SDC1), or an SDC1 -binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 65; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 66; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 67; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 68; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 69; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 70, wherein the CDR sequences are according to IMGT numbering.

[0187] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDCl-binding fragment thereof, wherein the VH comprises an amino acid sequence of SEQ ID NO: 71, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0188] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDCl-binding fragment thereof, wherein the VH comprises an amino acid sequence of SEQ ID NO: 71.

[0189] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDCl-binding fragment thereof, wherein the antibody comprises a heavy chain constant region (CH), wherein the CH comprises an amino acid sequence of SEQ ID NO: 72, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0190] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDC1 -binding fragment thereof, wherein the CH comprises an amino acid sequence of SEQ ID NO: 72.

[0191] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDC1 -binding fragment thereof, wherein the antibody comprises a heavy chain, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 73, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0192] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDCl-binding fragment thereof, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 73.

[0193] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDCl-binding fragment thereof, wherein the VL comprises an amino acid sequence of SEQ ID NO: 74, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0194] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDCl-binding fragment thereof, wherein the VL comprises an amino acid sequence of SEQ ID NO: 74.

[0195] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDCl-binding fragment thereof, wherein the antibody comprises a light chain constant region (CL), wherein the CL comprises an amino acid sequence of SEQ ID NO: 75, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0196] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDCl-binding fragment thereof, wherein the CL comprises an amino acid sequence of SEQ IDNO: 75.

[0197] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDCl-binding fragment thereof, wherein the antibody comprises a light chain, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 76, or an amino acid sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0198] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDCl-binding fragment thereof, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 76.

[0199] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDCl-binding fragment thereof, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 77, or a nucleotide sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0200] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDCl-binding fragment thereof, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 77.

[0201] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDCl-binding fragment thereof, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 78, or a nucleotide sequence that has at least 80% sequence identity thereto (e.g., at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or effectively identical, i.e., 100%).

[0202] In certain embodiments, provided herein is an antibody that is capable of specifically binding to SDC1, or an SDCl-binding fragment thereof, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 78.

[0203] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein comprise a heavy chain constant region selected from the group consisting of IgA, IgGl, IgG2a, IgG2b, IgG3, IgG4, and IgM. In certain embodiments, the anti-APPLl antibody, or antigen-binding fragment thereof, described herein comprises a heavy chain constant region of IgGl.

[0204] In certain embodiments, the anti-SORTl antibody, or antigen-binding fragment thereof, described herein comprises a heavy chain constant region of IgG2a.

[0205] In certain embodiments, the anti-SDCl antibody, or antigen-binding fragment thereof, described herein comprises a heavy chain constant region of IgG2b.

[0206] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are natural antibodies.

[0207] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are synthetic antibodies.

[0208] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are isolated antibodies.

[0209] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are monoclonal antibodies.

[0210] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are human antibodies.

[0211] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are humanized antibodies.

[0212] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are mouse antibodies.

[0213] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein are chimeric antibodies.

[0214] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein comprise a light chain constant region of kappa or lambda light chain.

[0215] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein comprise a light chain constant region of kappa light chain.

[0216] In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein comprise an Fc region.

[0217] In certain embodiments, the APPL1, SORT1 and SDC1 antigen-binding fragments described herein comprise a Fab, F(ab')2, Fv, or single chain Fv (scFv) fragment. In certain embodiments, the anti-APPLl, anti-SORTl, and anti-SDCl antibodies, or antigenbinding fragments thereof, described herein comprise a detectable label.

[0218] In certain embodiments, provided herein is a composition comprising the antibodies, or antigenbinding fragments thereof, described herein.

[0219] In certain embodiments, provided herein is a composition comprising an anti-APPLl antibody, or antigen-binding fragment thereof, described herein.

[0220] In certain embodiments, provided herein is a composition comprising an anti-SORTl antibody, or antigen-binding fragment thereof, described herein.

[0221] In certain embodiments, provided herein is a composition comprising an anti-SDCl antibody, or antigen-binding fragment thereof, described herein.

[0222] In certain embodiments, provided herein is a composition comprising an anti-APPLl antibody, or antigen-binding fragment thereof, and an anti-SORTl antibody, or antigen-binding fragment thereof, described herein.

[0223] In certain embodiments, provided herein is a composition comprising an anti-APPLl antibody, or antigen-binding fragment thereof, and an anti-SDCl antibody, or antigen-binding fragment thereof, described herein.

[0224] In certain embodiments, provided herein is a composition comprising an anti-SORTl antibody, or antigen-binding fragment thereof, and an anti-SDCl antibody, or antigen-binding fragment thereof, described herein.

[0225] The antibodies, or antigen-binding fragments thereof, described herein may be generated using known methods in the art. For the production of antibodies, various hosts including goats, rabbits, rats, mice, humans, and others, may be immunized by injection with the appropriate antigen. Depending on the host species, various adjuvants may be used to increase an immunological response. Such standard adjuvants include Freund's adjuvant, mineral gels such as aluminium hydroxide, and surface-active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol.

[0226] In certain embodiments, the antibodies, or antigen-binding fragments thereof, described herein comprise an affinity of at least 106M-1, at least 107M-1, at least lO^M'1, at least 109M-1, at least 1010M_1, at least lO^M'1, or at least 1012M-1to their target antigen.

[0227] It will be appreciated that the antibodies, or antigen-binding fragments thereof, described herein are directed to the human forms of APPL1, SORT1 and SDC1. However, it is to be appreciated that the detection of equivalent or synergistic forms of APPL1, SORT1 and SDC1 in other species is also contemplated.

[0228] Other types of antibodies, or antigen-binding fragments thereof, described herein are also contemplated. Detection of biomarkers

[0229] An anti-APPLl antibody, or antigen-binding fragment thereof, an anti-SORTl antibody, or antigen-binding fragment thereof, and an anti-SDCl antibody, or antigen-binding fragment thereof, described herein, can be used to detect APPL1, SORT1 and SDC1 protein levels, respectively, in a biological sample using methods known to those of skill in the art, including immunoassays such as immunohistochemistry (IHC) and immunofluorescence (IF). Other methods are also contemplated including, but not limited to, immunobinding, immunoblotting (e g., Western blot analysis), immunoprecipitation, immunoelectrophoresis, spectrophotometry, enzyme assays, mass spectrometry, and microscopy.

[0230] In certain embodiments, an anti-APPLl antibody, or antigen-binding fragment thereof, an anti-SORTl antibody, or antigen -binding fragment thereof, and an anti-SDCl antibody, or antigenbinding fragment thereof, described herein, can be used to detect one or more of the altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, respectively, in a biological sample using IHC.

[0231] In certain embodiments, an anti-APPLl antibody, or antigen-binding fragment thereof, an anti-SORTl antibody, or antigen -binding fragment thereof, and an anti-SDCl antibody, or antigenbinding fragment thereof, described herein, can be used to detect one or more of the altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, respectively, in a biological sample using IF.

[0232] IHC and IF are techniques often used to identify biomarkers (e.g., APPL1, SORT1 and SDC1) within the context of intact cells by labelling the samples with molecules that bind specifically to the biomarker in a manner that can be visualized on a microscope. By identifying the biomarker in the context of a tissue environment or cellular environment, spatial relationships between the biomarkers and other morphological or molecular features of the cell or tissue sample can be elucidated, which may reveal information that is not apparent from other molecular or cellular techniques. Quantification of biomarker levels in samples can also be determined by computer-aided methods and visually by eye.

[0233] Suitable detectable labels are known in the art and include enzyme labels, such as, horseradish peroxidase (HRP) and glucose oxidase; radioisotopes, such as iodine (1251,121I), carbon (14C), sulfur (35S), tritium (3H), indium (121In), and technetium ("Tc); haptens, fluorescent labels, phosphorescent molecules, chemiluminescent molecules, chromophores, luminescent molecules, photoaffnity molecules, coloured particles and / or ligands, such as biotin. In some embodiments, an enzyme (an enzyme tag) will generate a coloured product upon contact with a chromogenic substrate. Examples of suitable enzymes include urease, alkaline phosphatase, (horseradish) hydrogen peroxidase, P-galactosidase, P- glucuronidase acid phosphatase, and / or glucose oxidase. Examples of suitable fluorophores include fluoresceins, luminophores, coumarins, BODIPY dyes, resorufins, and rhodamines.

[0234] Such labels can be used to label an antibody, or antigen-binding fragment thereof, described herein. Alternatively, a second antibody or antigen-binding fragment thereof that recognizes an anti-APPLl antibody or antigen-binding fragment thereof, an anti-SORTl antibody or antigen-binding fragment thereof, or an anti-SDC 1 antibody or antigen-binding fragment thereof, described herein, can be labelled and used in combination with an anti-APPLl antibody or antigen-binding fragment thereof, an anti-SORTl antibody or antigen-binding fragment thereof, or an anti-SDCl antibody or antigen-binding fragment thereof, described herein, to detect APPL1, SORT1 and SDC1 protein levels, respectively. In some embodiments, the secondary antibody, or antigen-binding fragment thereof, include, but are not limited to, an anti-mouse antibody or an anti-rodent antibody. In some embodiments, the secondary antibody, or antigen-binding fragment thereof, is labelled with an enzyme (e.g., horseradish peroxidase) and detected with a substrate of the enzyme (e.g., 3,3'-diaminobenzidine (DAB)). Other examples of detectable substrates include a fluorogenic compound and a luminogenic compound. Other examples of chromogenic compounds include 4-nitrophenylphospate (pNPP), fast red, bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), BCIP / NBT, fast red, AP Orange, AP blue, tetramethylbenzidine (TMB), 2,2'-azino-di-[3-ethylbenzothiazoline sulphonate] (ABTS), o-dianisidine, 4- chloronaphthol (4-CN), nitrophenyl- -D-galactopyranoside (ONPG), o- phenylenediamine (OPD), 5-bromo-4-chloro-3-indolyl- -galactopyranoside (X-Gal), methylumbelliferyl-D-galactopyranoside (MU-Gal), p-nitrophenyl- a-D-galactopyranoside (PNP), 5-bromo-4-chloro-3-indolyl-D-glucuronide (X-Gluc), 3-amino-9-ethyl carbazol (AEC), fuchsin, iodonitrotetrazolium (INT), tetrazolium blue and tetrazolium violet.

[0235] Several methods are known in the art for the attachment or conjugation of an antibody to a detectable label (i.e., its conjugate moiety).

[0236] In certain embodiments, the detection of APPL1 protein, SORT1 protein, and SDC1 protein includes a qualitative and / or quantitative determination. In certain embodiments, the determination comprises determining whether the selected marker has one or more of an altered presence, level, secretion, and distribution. In certain embodiments, the determination is made directly (e g., by determining absolute protein level of at least one of APPL1, SORT1 and SDC1 in a first biological sample) or relatively (e.g., by comparing the protein level of at least one of APPL1, SORT1 and SDC1 in a first biological sample to the protein level of at least one of APPL1, SORT1 and SDC1 in a second biological sample or reference).

[0237] In certain embodiments, the present invention contemplates detecting at least one of APPL1, SORT1 and SDC1 by an immunoassay. Examples of immunoassays include, but are not limited to, IHC and IF.

[0238] In general, IHC and IF methods include obtaining a sample (e.g., a sample suspected of comprising at least one of APPL1, SORT1, and SDC1), and contacting the sample with at least one of an anti-APPL1 antibody, or an antigen-binding fragment thereof, an anti-SORTl antibody, or an antigenbinding fragment thereof, and an anti-SDCl antibody, or an antigen-binding fragment thereof, described herein, under conditions effective to allow the formation of immune complexes.

[0239] Contacting the biological sample with at least one of an anti-APPLl antibody, or an antigenbinding fragment thereof, an anti-SORTl antibody, or an antigen-binding fragment thereof, and an anti-SDCl antibody, or an antigen-binding fragment thereof, described herein, under effective conditions and for a period of time sufficient to allow the formation of immune complexes (primary immune complexes) generally comprises adding at least one of an anti-APPLl antibody, or an antigen-binding fragment thereof, an anti-SORTl antibody, or an antigen -binding fragment thereof, and an anti-SDCl antibody, or an antigen-binding fragment thereof, described herein, to the sample and incubating for a period of time sufficient for the antibody / antibodies to form immune complexes, i.e., to specifically bind to APPL1, SORT1, and SDC1 present in the biological sample. After this time, the sample-antibody composition, such as a tissue section, will generally be washed to remove any non-specifically bound antibody / antibodies, allowing only those antibodies specifically bound within the primary immune complexes to be detected.

[0240] In certain embodiments, the terms "the primary antibody", "the primary antibodies", "primary antibody", "primary antibodies", "first antibody", "first antibodies" and the like, as used herein, are used interchangeably to refer to at least one of the anti-APPLl antibodies, the anti-SORTl antibodies and the anti-SDCl antibodies described herein.

[0241] In general, the detection of immune complex formation is well known in the art and may be achieved through the application of numerous approaches. These methods are generally based upon the detection of a label or marker, such as any of those radioactive, fluorescent, biological and enzymatic tags. In some embodiments, a secondary binding agent, such as a second antibody and / or a biotin / avidin ligand binding arrangement, may be used in accordance with methodologies known in the art.

[0242] In certain embodiments, the first antibody that becomes bound to the target protein, forming primary immune complexes, may be detected by means of a second binding agent that can bind to the antibodies described herein. In these cases, the second binding agent may be linked to a detectable label. The second binding agent itself can be, for example, an antibody, which may thus be termed a "secondary" antibody, or a ligand. The primary immune complexes are contacted with the labelled, secondary binding agent under effective conditions and for a period of time sufficient to allow the formation of secondary immune complexes. The secondary immune complexes are then generally washed to remove any non-specifically bound labelled secondary binding agents, and the remaining label in the secondary immune complexes is then detected. Such methods can then be repeated to identify multiple target proteins in the one sample by subjecting the sample to continuous rounds of antigen retrieval, methods of which are known in the art.

[0243] Further methods contemplated include the detection of primary immune complexes by a two-step approach. A second binding agent, such as a secondary antibody, that can bind to the antibodies described herein, is used to form secondary immune complexes, as described herein. After washing, the secondary immune complexes are contacted with a third binding agent that can bind to the second antibody, under effective conditions and for a period of time sufficient to allow the formation of immune complexes (tertiary immune complexes). The third binding agent itself can be, for example, an antibody, which may thus be termed a "tertiary" antibody, or a ligand. The third binding agent is linked to a detectable label, allowing for detection of the tertiary immune complexes formed. This system may provide for signal amplification if this is desired and / or required. Such methods can then be repeated to identify multiple target proteins in the one sample by subjecting the sample to continuous rounds of antigen retrieval, methods of which are known in the art.

[0244] In another embodiment, a biotinylated monoclonal or polyclonal antibody is used to detect the target antigen(s), and a secondary antibody is then used to detect the biotin attached to the complexed antibody. In such a method, the sample is first incubated in a solution comprising the biotinylated monoclonal or polyclonal antibody. If the target antigen is present, the biotinylated monoclonal or polyclonal antibody specifically binds to the antigen to form a biotinylated antib ody / antigen complex. The antibody / antigen complex is then amplified by incubation in successive solutions of streptavidin (or avidin) and biotinylated DNA, and / or complementary biotinylated DNA, with each step adding additional biotin sites to the antibody / antigen complex. The amplification steps are repeated until a suitable level of amplification is achieved, at which point the sample is incubated in a solution comprising the secondary antibody that specifically binds biotin. The secondary antibody is labelled, for example, with an enzyme that can be used to detect the presence of the antibody / antigen complex by histoenzymology using a chromogen substrate. With suitable amplification, a conjugate can be produced that is macroscopically visible. In one embodiment, immunohistochemistry (IHC) is used for immunological detection of APPL1, SORT1 and SDC1. Using IHC, detection of APPL1, SORT1, or SDC1 in a sample can be achieved by targeting a sample with a binding agent, e.g., an anti-APPLl antibody, or antigen-binding fragment thereof, described herein, an anti-SORTl antibody, or an antigen-binding fragment thereof, described herein, and an anti-SDCl antibody, or an antigen-binding fragment thereof, described herein. The binding agent can be linked, either directly or indirectly, to a detectable label, or can be detected by another binding agent that is linked, either directly or indirectly, to a detectable label. In one embodiment, a HRP -conjugated secondary antibody is used in the IHC assay to detect the anti-APPLl antibody, or antigen-binding fragment thereof, the anti-SORTl antibody or antigen-binding fragment thereof, or the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, bound to APPL1, SORT1, or SDC1, respectively. In one embodiment, an alkaline phosphatase-conjugated secondary antibody is used in the IHC assay to detect the anti-APPLl antibody, or antigen-binding fragment thereof, the anti-SORTl antibody or antigen-binding fragment thereof, or the anti-SDC 1 antibody, or antigen-binding fragment thereof, described herein, bound to APPL1, SORT1, or SDC1, respectively.

[0245] In one embodiment, a HRP-conjugated secondary antibody is used in the IHC assay to detect the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, and an alkaline phosphatase-conjugated secondary antibody is used in the same IHC assay to detect the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, wherein the anti-APPLl antibody and the anti-SORTl antibody are of different species (e.g., human, mouse, rat, hamster, goat, etc.).

[0246] In one embodiment, a HRP-conjugated secondary antibody is used in the IHC assay to detect the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, and an alkaline phosphatase-conjugated secondary antibody is used in the same IHC assay to detect the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, wherein the anti-APPLl antibody and the anti-SDCl antibody are of different species (e.g., human, mouse, rat, hamster, goat, etc.). In one embodiment, a HRP-conjugated secondary antibody is used in the IHC assay to detect the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and an alkaline phosphatase-conjugated secondary antibody is used in the same IHC assay to detect the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, wherein the anti-SORTl antibody and the anti-SDCl antibody are of different species (e.g., human, mouse, rat, hamster, goat, etc.).

[0247] In one embodiment, a HRP-conjugated secondary antibody is used in the IHC assay to detect the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and an alkaline phosphatase-conjugated secondary antibody is used in the same IHC assay to detect the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, wherein the anti-SORTl antibody and the anti-APPLl antibody are of different species (e.g., human, mouse, rat, hamster, goat, etc.).

[0248] In one embodiment, a HRP -conjugated secondary antibody is used in the IHC assay to detect the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, and an alkaline phosphatase-conjugated secondary antibody is used in the same IHC assay to detect the anti-APPL1 antibody, or antigen-binding fragment thereof, described herein, wherein the anti-SDCl antibody and the anti-APPLl antibody are of different species (e.g., human, mouse, rat, hamster, goat, etc.).

[0249] In one embodiment, a HRP -conjugated secondary antibody is used in the IHC assay to detect the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, and an alkaline phosphatase-conjugated secondary antibody is used in the same IHC assay to detect the anti-SORT1 antibody, or antigen-binding fragment thereof, described herein, wherein the anti-SDCl antibody and the anti-SORTl antibody are of different species (e.g., human, mouse, rat, hamster, goat, etc.)

[0250] In one embodiment, the concentration of the anti-APPLl antibody or antigen-binding fragment thereof, described herein, used in the IHC assay is about 0.01 pg / mL to 10 pg / mL. In one embodiment, the concentration of the anti-APPLl antibody or antigen-binding fragment thereof, described herein, used in the IHC assay is about 0.02 pg / mL to 1 pg / mL. In one embodiment, the concentration of the anti-APPLl antibody or anti gen -binding fragment thereof, described herein, used in the IHC assay is about 0.1 pg / mL.

[0251] In one embodiment, the concentration of the anti-SORTl antibody or antigen-binding fragment thereof, described herein, used in the IHC assay is about 0.01 pg / mL to 10 pg / mL. In one embodiment, the concentration of the anti-SORTl antibody or antigen-binding fragment thereof, described herein, used in the IHC assay is about 0.02 pg / mL to 1 pg / mL. In one embodiment, the concentration of the anti-SORTl antibody or antigen-binding fragment thereof, described herein, used in the IHC assay is about 0.1 pg / mL.

[0252] In one embodiment, the concentration of the anti-SDCl antibody or antigen-binding fragment thereof, described herein, used in the IHC assay is about 0.01 pg / mL to 10 pg / mL. In one embodiment, the concentration of the anti-SDCl antibody or antigen-binding fragment thereof, described herein, used in the IHC assay is about 005 pg / mL to 3 pg / mL. In one embodiment, the concentration of the anti-SDCl antibody or antigen-binding fragment thereof, described herein, used in the IHC assay is about 1 pg / mL.

[0253] IHC can be performed on, for example, but not limited to, cells, cell pellets, tissues, preparations from blood, plasma, serum, and lymph fluid. In some embodiments, the samples are fixed samples. In some embodiments, the samples are paraffin-embedded samples. In some embodiments, the samples are formalin-fixed paraffin-embedded samples.

[0254] In an embodiment, wherein IHC is used for immunological detection of APPL1, SORT1 and SDC1, samples will be scanned using an appropriate slide scanner at an appropriate magnification or magnifications under appropriate conditions / settings in order to determine one or more of the presence, level, secretion and distribution of APPL1, SORT1 and SDC1. Appropriate slide scanners are known in the art. Appropriate magnifications and conditions / settings that will result in the acquisition of images for analysis are known in the art.

[0255] In one embodiment, immunofluorescence (IF) is used for immunological detection of APPL1, S0RT1 and SDC1. Using IF, detection of APPL1, SORT1, and SDC1 in a sample can be achieved by targeting a sample with a binding agent, e g., an anti-APPLl antibody, or an antigen-binding fragment thereof, an anti-SORTl antibody, or an antigen-binding fragment thereof, and an anti-SDC1 antibody, or an antigen-binding fragment thereof, described herein. The binding agent can be linked, either directly or indirectly, to a detectable label, or can be detected by another binding agent that is linked, either directly or indirectly, to a detectable label. In one embodiment, a fluorophore-conjugated secondary antibody is used in the IF assay to detect an anti-APPLl antibody, or an antigen-binding fragment thereof, described in, an anti-SORTl antibody, or an antigen-binding fragment thereof, described herein, or an anti-SDCl antibody, or an antigenbinding fragment thereof, described herein, bound to APPL1, SORT1 or SDC1, respectively. In one embodiment, a fluorophore-conjugated anti-APPLl antibody, or an antigen-binding fragment thereof, a fluorophore-conjugated anti-SORTl antibody, or an antigen-binding fragment thereof, and a fluorophore-conjugated anti-SDCl antibody, or an antigen-binding fragment thereof, described herein, are used in the IF assay to detect APPL1, SORT1 and SDC1, respectively. In one embodiment, a HRP-conjugated secondary antibody is used in the IF assay to detect an anti-APPLl antibody, or an antigen-binding fragment thereof, described in, an anti-SORTl antibody, or an antigen-binding fragment thereof, described herein, or an anti-SDCl antibody, or an antigenbinding fragment thereof, described herein, bound to APPL1, SORT1 or SDC1, respectively. The HRP enzyme can then be reacted with an appropriate substrate. Such substrates may include, but are not limited to, those bound to a chromogenic dye, which when catalysed by HRP, lead to the precipitation of insoluble, coloured precipitates at the site which the antigen (i.e., APPL1, SORT1, or SDC1) is found. Other substrates may include a fluorophore-conjugated tyramide molecule, which when catalysed by HRP, result in an antigen (i.e., APPL1, SORT1, or SDCl)-associated fluorescence signal. Following, such methods can be repeated to identify multiple target proteins in the one sample by subjecting the sample to continuous rounds of antigen retrieval, methods of which are known in the art.

[0256] In one embodiment, the concentration of the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, used in the IF assay is about 0.01 pg / mL to 10 pg / mL. In one embodiment, the concentration of the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, used in the IF assay is about 0.02 pg / mL to 1 pg / mL. In one embodiment, the concentration of the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, used in the IF assay is about 0.1 pg / mL.

[0257] In one embodiment, the concentration of the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, used in the IF assay is about 0.01 pg / mL to 10 pg / mL. In one embodiment, the concentration of the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, used in the IF assay is about 0.02 pg / mL to 1 pg / mL. In one embodiment, the concentration of the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, used in the IF assay is about 0.1 pg / mL.

[0258] In one embodiment, the concentration of the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, used in the IF assay is about 0.01 pg / mL to 10 pg / mL. In one embodiment, the concentration of the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, used in the IF assay is about 005 pg / mL to 3 pg / mL. In one embodiment, the concentration of the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, used in the IF assay is about 1 pg / mL. IF can be performed on, for example, but not limited to, cells, cell pellets, tissues, preparations from blood, plasma, serum, and lymph fluid. In some embodiments, the samples are fixed samples. In some embodiments, the samples are paraffin-embedded samples. In some embodiments, the samples are formalin-fixed paraffin-embedded samples.

[0259] In an embodiment, where IF is used for immunological detection of APPL1, SORT1 and SDC1, samples will be scanned using an appropriate slide scanner at an appropriate magnification or magnifications under appropriate conditions / settings in order to determine one or more of the presence, level, secretion and distribution of APPL1, SORT1 and SDC1. Appropriate slide scanners are known in the art. Appropriate magnifications and conditions / settings that will result in the acquisition of images for analysis are known in the art.

[0260] In certain embodiments, the sample which APPL1, SORT1, and SDC1 is detected in by the antibodies, or antigen-binding fragments thereof, described herein, is from a subject suffering from prostate cancer. Examples of prostate cancers are described herein.

[0261] Target antigens

[0262] The biology of each of the three target antigens, APPL1, SORT1 and SDC1 (also referred to interchangeably herein as "biomarkers" and "markers"), is considered to be connected to the pathogenic process of prostate cancer and represents key control points for other biology. "Adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1" or "APPL1" is a transcription factor that is also involved in endosome traffic and recycling and controls growth factor uptake and signalling. The transcription factor activity of APPL1 is evident particularly in prostatic intraepithelial neoplasia (PIN) tissue, where it stains a significant proportion (20-30%) of nuclei, and is presumably involved in regulating gene expression. "Sortilin-1" or "SORT1" is a key molecule in GLUT4 vesicle biogenesis and also interacts with GLUT1 to concertedly regulate sugar metabolism and the Warburg effect. All elements of the GLUT4 vesicle biogenesis and trafficking processes are androgen regulated (e.g., AS160). SORT1 also binds and regulates lipoprotein lipase (LPL), oxy sterol binding protein (OSBP) and progranulin (PGRN / GRN), and when downregulated this releases these ligand proteins to drive advanced cancer, which involves lipid metabolism, angiogenesis, and SDC1 biology. "Syndecan-1" or "SDC1" potentiates the advanced signalling and growth factor biology and also binds beta3 integrins, which is thought to drive platelet interaction and immune cloaking; and also activates Survivin to limit apoptosis. SDC1 engages extracellular matrix molecules like fibronectin (FN1), vitronectin (VTN), laminins and collagens through its heparin and chondroitin sulphate side chains, playing a role in attachment spreading and tissue invasion. The three key control points for prostate cancer pathogenesis are therefore depicted by APPL1, SORT1, and SDC1 and are representative of the wider pathogenic process, which involves other biomarkers, including those described above, which are involved in sugar and lipid metabolism together with inflammation, migration, signalling, immune cloaking and angiogenesis.

[0263] Because of the inter-related biology and different functional properties of APPL1, SORT1 and SDC1, they need to be used in concert to fully depict the pathogenesis and to inform about cancer progression and prognosis. This provides a set of changes to these biomarkers in prostate cancer cells / tissue and with a combination of these three biomarkers, effectively identifies critical changes in prostate cancer tissue when compared to control tissue. These biomarkers provide high sensitivity and specificity of for prostate cancer, especially when used in combination (> 95%). The detection of these biomarkers in other patient samples including blood and urine is implied by the known biology of these proteins and has been demonstrated by release from prostate cancer cells in vitro. In addition, a ratio of these biomarkers provides a risk assessment for the onset of clinical recurrence / metastasis in patients, enabling specific advice on therapeutic intervention. APPL1 undergoes a distribution change from clearly defined basal cell staining to a cytoplasmic distribution in PIN tissue, often with the staining of nuclear inclusions in selected cells. SDC1 has a very intense basal cell staining pattern in benign tissue, but is lost as PIN tissue forms. However, SORT1 clearly distinguishes between cribriform and fused glands in tissue / biopsy samples. SORT1 is optimal for this visualisation because the staining is polar, and the cells and borders are better distinguished, demonstrating clearly separated Gleason grade 3 glands compared to fused / cribriform glands. In Gleason grade 4 / 5 cancers where cells proliferate to form fused glands / sheets, APPL1 cannot differentiate the fused glands versus sheets of cells, whereas SDC1 indicates the presence of fused glands and combined with SORT1 confirms this morphology. Because APPL1 stains the stroma and appears more sheet like in all of the tissue samples / biopsy cores, whereas SORT1 and SDC1 do not, the spaces (indicating fused glands) or stroma (indicating sheets) are clearly distinguished with this combination of biomarkers. While there is considerable co-staining of the three biomarkers, higher amounts of APPL1 and SDC1 with reduced SORT1 signifies advanced cancer; the specific pattern of intense APPL1 staining and intense SDC1 staining, but with little or no SORT1 staining, is observed for patients at high risk of clinical recurrence (metastasis). The combination of APPL1 (due to its increasing intensity as the cancer progresses to an advanced stage) and SDC1 (due to its high intensity staining in advanced cancer and in migrating cancer cells) enables the effective detection of advanced cancer; this is balanced against SORT1 expression to make decisions on how advanced the cancer is.

[0264] In certain embodiments, an altered distribution of APPL1 as compared to a reference indicates the presence of prostate cancer (such as established prostate cancer or advanced prostate cancer) in a subject. The altered distribution may, for example, be a change from a basal cell staining in a reference to cytoplasmic distribution with staining of nuclear inclusions in a prostate cancer sample. APPL1 is optimal for scanning large areas of tissue to map the prostate cancer and identify the prostate cancer and its boundaries, wherein the stroma is not stained (no background).

[0265] In certain embodiments, a granular staining pattern in SORT1 indicates the presence of prostatic intraepithelial neoplasia (PIN) or established prostate cancer. In one embodiment, a decrease in the level of SORT1 as compared to a reference indicates the presence of an advanced cancer. In one embodiment, an altered distribution of SORT1 indicates the presence of an advanced cancer. The altered distribution may, for example, be a less granular and more dispersed pattern of staining.

[0266] In certain embodiments, an altered distribution of SDC1 as compared to a reference indicates the presence of prostate cancer (such as prostatic intraepithelial neoplasia (PIN), a primary prostate cancer (also referred to interchangeably herein as "established prostate cancer") or an advanced prostate cancer (also referred to interchangeably herein as "metastatic prostate cancer")) in a subject. The altered distribution may, for example, be a change from basal cell staining pattern in a reference to the loss of the basal cell staining pattern in a prostate cancer sample. SDC1 staining is frequently distributed in the same manner as APPL1, even though it is more distinct and granular, providing confirmation of areas of tissue that are prostate cancer, including identifying its boundaries.

[0267] Methods and Therapeutic Uses

[0268] In certain embodiments, provided herein is a method of determining the presence of prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein; (ii) SORT1 is detected with the anti-SORTl antibody, or antigenbinding fragment thereof, described herein; and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the presence of prostate cancer.

[0269] In an embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 or SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SORT1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of SORT1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 and SDC1.

[0270] In certain embodiments, provided herein is a method of determining the presence and severity of a prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen -binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the presence and severity of prostate cancer.

[0271] In an embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 or SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SORT1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of SORT1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 and SDC1.

[0272] In certain embodiments, provided herein is a method of monitoring the progression of a prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen -binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the progression of prostate cancer.

[0273] In an embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 or SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SORT1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of SORT1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 and SDC1.

[0274] In certain embodiments, provided herein is a method determining the likelihood of the presence of a prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen -binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the likelihood of the presence of a prostate cancer.

[0275] In an embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 or SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SORT1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of SORT1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 and SDC1.

[0276] In certain embodiments, provided herein is a method of identifying a subject suffering from prostate cancer who is likely to be responsive to a cancer therapy, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the likelihood of the subject suffering prostate cancer being responsive to a cancer therapy.

[0277] In an embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 or SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SORT1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of SORT1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 and SDC1.

[0278] In certain embodiments, provided herein is a method of predicting the risk of recurrence of prostate cancer in a subject following treatment with a cancer therapy, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is predictive of the risk of recurrence of prostate cancer.

[0279] In an embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 or SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SORT1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of SORT1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 and SDC1.

[0280] In certain embodiments, provided herein is a method of treating prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen-binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative that the subject has prostate cancer, wherein where the subject is identified as having prostate cancer, treating the subject with a cancer therapy. In an embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 or SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SORT1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of SORT1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 and SDC1.

[0281] In certain embodiments, provided herein is a method of stratifying a subject for treatment with a prostate cancer therapy, the method comprising:

[0282] a) detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the anti-APPLl antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the anti-SORTl antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the anti-SDCl antibody, or antigen-binding fragment thereof, described herein;

[0283] b) comparing one or more of the presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1 as detected in step a) to a reference; and

[0284] c) based on the comparison in step b), stratifying the subject for treatment with a prostate cancer therapy.

[0285] In an embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 or SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SORT1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of SORT1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 and SDC1.

[0286] In certain embodiments, provided herein is a method for treating prostate cancer in a subject, the method comprising:

[0287] a) detecting the presence or likelihood of the presence of prostate cancer in the subject according to any one of the methods described herein; and

[0288] b) where the presence or likelihood of the presence of prostate cancer has been determined in the subject, treating the subject with a cancer therapy.

[0289] In certain embodiments, provided herein is use of an anti-cancer agent in the manufacture of a medicament for the treatment of prostate cancer, wherein the medicament is to be administered to a subject identified as having prostate cancer by detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, S0RT1 and SDC1, wherein (i) APPL1 is detected with the antibody, or antigen-binding fragment thereof, described herein, (ii) SORT1 is detected with the antibody, or antigen-binding fragment thereof, described herein, and (iii) SDC1 is detected with the antibody, or antigen-binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative that a subject has prostate cancer.

[0290] In an embodiment, the use comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 or SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SORT1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of SORT1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 and SDC1.

[0291] In certain embodiments, provided herein is use of an anti-cancer agent in the manufacture of a medicament for the treatment of prostate cancer, wherein the medicament is to be administered to a subject in need thereof, wherein the presence or likelihood of the presence of prostate cancer has been determined in the subject according to any one of the methods described herein.

[0292] In certain embodiments, provided herein is an anti -cancer agent for use in the treatment of prostate cancer in a subject, wherein the treatment comprises identifying the subject as having prostate cancer by detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the antibody, or antigen-binding fragment thereof, described herein; (ii) SORT1 is detected with the antibody, or antigen-binding fragment thereof, described herein; and (iii) SDC1 is detected with the antibody, or antigen-binding fragment thereof, described herein, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative that the subject has prostate cancer.

[0293] In an embodiment, the treatment comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 or SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SORT1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of SORT1 and SDC1. In another embodiment, the method comprises detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of APPL1, SORT1 and SDC1.

[0294] In certain embodiments, provided herein is an anti -cancer agent for use in the treatment of prostate cancer in a subject, wherein the treatment comprises:

[0295] a) detecting the presence or likelihood of the presence of prostate cancer in the subject according to any one of the methods described herein; and b) where the presence or likelihood of the presence of prostate cancer has been determined in the subject, treating the subject with the anti -cancer agent.

[0296] In certain embodiments, the methods described herein further comprise obtaining a biological sample from the subject.

[0297] In certain embodiments, the methods described herein further comprise treating prostate cancer in a subject, wherein following the determination of the presence or the likelihood of the presence of prostate cancer in a subject, the subject is to be treated with a cancer therapy.

[0298] In certain embodiments, the methods described herein further comprise treating prostate cancer in a subject, wherein following the determination of the presence or the likelihood of the presence of prostate cancer in a subject, the subject is treated with an anti-cancer agent.

[0299] In certain embodiments, provided herein is a method of detecting APPL1, SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein.

[0300] In certain embodiments, provided herein is a method of detecting APPL1 using the antibodies, or antigen-binding fragments thereof, described herein.

[0301] In certain embodiments, provided herein is a method of detecting SORT1 using the antibodies, or antigen-binding fragments thereof, described herein.

[0302] In certain embodiments, provided herein is a method of detecting SDC1 using the antibodies, or antigen-binding fragments thereof, described herein.

[0303] In certain embodiments, provided herein is a method of detecting APPL1 and SORT1 using the antibodies, or antigen-binding fragments thereof, described herein.

[0304] In certain embodiments, provided herein is a method of detecting APPL1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein.

[0305] In certain embodiments, provided herein is a method of detecting SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein.

[0306] In certain embodiments, provided herein is a method of detecting at least one of APPL1, SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein.

[0307] In certain embodiments, provided herein is a method of detecting in a biological sample from a subject APPL1, SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein.

[0308] In certain embodiments, provided herein is a method of detecting in a biological sample from a subject APPL1 using the antibodies, or antigen-binding fragments thereof, described herein. In certain embodiments, provided herein is a method of detecting in a biological sample from a subject SORT1 using the antibodies, or antigen-binding fragments thereof, described herein. In certain embodiments, provided herein is a method of detecting in a biological sample from a subject SDC1 using the antibodies, or antigen-binding fragments thereof, described herein.

[0309] In certain embodiments, provided herein is a method of detecting in a biological sample from a subject APPL1 and SORT1 using the antibodies, or antigen-binding fragments thereof, described herein.

[0310] In certain embodiments, provided herein is a method of detecting in a biological sample from a subject APPL1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein.

[0311] In certain embodiments, provided herein is a method of detecting in a biological sample from a subject SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein.

[0312] In certain embodiments, provided herein is a method of detecting in a biological sample from a subject at least one of APPL1, SORT1 and SDC1 using the antibodies, or antigen -binding fragments thereof, described herein.

[0313] In certain embodiments, the methods described herein comprise detecting APPL1, SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that has not been processed and / or treated.

[0314] In certain embodiments, the methods described herein comprise detecting APPL1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that has not been processed and / or treated.

[0315] In certain embodiments, the methods described herein comprise detecting SORT1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that has not been processed and / or treated.

[0316] In certain embodiments, the methods described herein comprise detecting SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that has not been processed and / or treated.

[0317] In certain embodiments, the methods described herein comprise detecting APPL1 and SORT1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that has not been processed and / or treated.

[0318] In certain embodiments, the methods described herein comprise detecting APPL1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that has not been processed and / or treated.

[0319] In certain embodiments, the methods described herein comprise detecting SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that has not been processed and / or treated. In certain embodiments, the methods described herein comprise detecting at least one of APPL1, SORT1 and SDC1 using the antibodies, or antigen -binding fragments thereof, described herein, in a biological sample obtained from a subject that has not been processed and / or treated.

[0320] In certain embodiments, the methods described herein comprise detecting APPL1, SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that has been processed and / or treated.

[0321] In certain embodiments, the methods described herein comprise detecting APPL1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that has been processed and / or treated.

[0322] In certain embodiments, the methods described herein comprise detecting SORT1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that has been processed and / or treated.

[0323] In certain embodiments, the methods described herein comprise detecting APPL1 and SORT1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that has been processed and / or treated.

[0324] In certain embodiments, the methods described herein comprise detecting APPL1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that has been processed and / or treated.

[0325] In certain embodiments, the methods described herein comprise detecting SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that has been processed and / or treated.

[0326] In certain embodiments, the methods described herein comprise detecting at least one of APPL1, SORT1 and SDC1 using the antibodies, or antigen -binding fragments thereof, described herein, in a biological sample obtained from a subject that has been processed and / or treated.

[0327] In certain embodiments, the methods described herein comprise detecting APPL1, SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that is processed and / or treated concurrently when detecting APPL1, SORT1 and SDC1.

[0328] In certain embodiments, the methods described herein comprise detecting APPL1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that is processed and / or treated concurrently when detecting APPL1.

[0329] In certain embodiments, the methods described herein comprise detecting S0RT1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that is processed and / or treated concurrently when detecting SORT1. In certain embodiments, the methods described herein comprise detecting SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that is processed and / or treated concurrently when detecting SDC1.

[0330] In certain embodiments, the methods described herein comprise detecting APPL1 and SORT1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that is processed and / or treated concurrently when detecting APPL1 and SORT1.

[0331] In certain embodiments, the methods described herein comprise detecting APPL1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that is processed and / or treated concurrently when detecting APPL1 and SDC1.

[0332] In certain embodiments, the methods described herein comprise detecting SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, in a biological sample obtained from a subject that is processed and / or treated concurrently when detecting SORT1 and SDC1.

[0333] In certain embodiments, the methods described herein comprise detecting at least one of APPL1, SORT1 and SDC1 using the antibodies, or antigen -binding fragments thereof, described herein, in a biological sample obtained from a subject that is processed and / or treated concurrently when detecting at least one of APPL1, SORT1 and SDC1.

[0334] In certain embodiments, the methods described herein comprise processing a biological sample to allow for detection of APPL1, SORT1, and SDC1 using use of the antibodies, or antigen-binding fragments thereof, described herein.

[0335] In certain embodiments, the methods described herein comprise processing a biological sample to allow for detection of APPL1, SORT1, and SDC1, and detecting APPL1, SORT1 and SDC1 using use of the antibodies, or antigen-binding fragments thereof, described herein.

[0336] In certain embodiments, the methods described herein comprise obtaining a biological sample from a subject, processing the biological sample to allow for detection of APPL1, SORT1, and SDC1, and detecting APPL1, SORT1 and SDC1 using use of the antibodies, or antigen-binding fragments thereof, described herein.

[0337] In certain embodiments, the biological sample is selected from the group consisting of a blood sample, a plasma sample, a serum sample, a biopsy and a prostate tissue sample.

[0338] In certain embodiments, the biological sample is a biopsy or a tissue sample.

[0339] In certain embodiments, the biological sample is a blood sample obtained from a subject with prostate cancer.

[0340] In certain embodiments, the biological sample is a plasma sample obtained from a subject with prostate cancer. In certain embodiments, the biological sample is a serum sample obtained from a subject with prostate cancer.

[0341] In certain embodiments, the biological sample is a prostate cancer biopsy, or a part thereof, obtained from a subject with prostate cancer.

[0342] In certain embodiments, biological sample is a prostate cancer tissue sample, or a part thereof, obtained from a subject with prostate cancer.

[0343] In certain embodiments, the detection of one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, in the methods as described herein, is performed using an immunoassay.

[0344] In certain embodiments, the detection of one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, in the methods as described herein, is performed by immunohi stochemi stry .

[0345] In certain embodiments, the detection of one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, in the methods as described herein, is performed by immunofluorescence.

[0346] In certain embodiments, the detection of one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1 in a biological sample using the antibodies, or antigen-binding fragments thereof, described herein, in the methods as described herein, is performed using an immunoassay.

[0347] In certain embodiments, the detection of one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1 in a biological sample using the antibodies, or antigen-binding fragments thereof, described herein, in the methods as described herein, is performed by immunohistochemistry.

[0348] In certain embodiments, the detection of one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1 in a biological sample using the antibodies, or antigen-binding fragments thereof, described herein, in the methods as described herein, is performed by immunofluorescence.

[0349] In certain embodiments, the combined detection of APPL1 and SDC1 in a biological sample from a subject using the antibodies, or antigen-binding fragments thereof, described herein, can be used to define the onset / initiation of prostate cancer (e.g., PIN tissue formation).

[0350] In certain embodiments, the combined detection of APPL1 and SORT1 in a biological sample from a subject using the antibodies, or antigen-binding fragments thereof, described herein, can be used to identify and define an established prostate cancer. In certain embodiments, the combined detection of APPL1, SORT1 and SDC1 in a biological sample from a subject using the antibodies, or antigen-binding fragments thereof, described herein, can be used to identify an early stage of prostate cancer.

[0351] In certain embodiments, the methods described herein comprise the use of one or more reagents for processing a sample for analysis.

[0352] In certain embodiments, the methods described herein further comprise obtaining information relating to one or more clinical characteristics of the subject and using the information in combination with one or more of the presence, level, secretion and distribution of at least one of APPL1, SORT1, and SDC1, detected using the antibodies, or antigen-binding fragments thereof, described herein, to detect prostate cancer in the subject. In certain embodiments, the one or more clinical characteristics comprise one or more of age, body mass index, smoking, genetics and family history of cancer and / or prostate cancer.

[0353] In certain embodiments, the methods described herein further comprise obtaining information relating to one or more clinical characteristics of the subject and using the information in combination with one or more of the presence, level, secretion and distribution of at least one of APPL1, SORT1, and SDC1, detected by the antibodies, or antigen-binding fragments thereof, described herein, to detect the presence or absence of prostate cancer in the subject.

[0354] In certain embodiments, the methods described herein comprise using a computer processor means to process data associated with one or more of the presence, level, secretion and distribution of at least one of APPL1, SORT1, and SDC1, detected by the antibodies, or antigen-binding fragments thereof, described herein, to generate a likelihood and / or risk of the presence of prostate cancer in the subject. Examples of computer processor means are known in the art.

[0355] In certain embodiments, use of the antibodies, or antigen-binding fragments thereof, described herein, in the methods described herein, have a sensitivity of detection for prostate cancer of 0.60 or greater.

[0356] In certain embodiments, use of the antibodies, or antigen-binding fragments thereof, described herein, in the methods described herein, have a sensitivity of detection for prostate cancer of 0.70 or greater.

[0357] In certain embodiments, use of the antibodies, or antigen-binding fragments thereof, described herein, in the methods described herein, have a sensitivity of detection for prostate cancer of 0.80 or greater.

[0358] In certain embodiments, use of the antibodies, or antigen-binding fragments thereof, described herein, in the methods described herein, have a sensitivity of detection for prostate cancer of 0.90 or greater.

[0359] In certain embodiments, use of the antibodies, or antigen-binding fragments thereof, described herein, in the methods described herein, have a sensitivity of detection for prostate cancer of 0.95 or greater. In certain embodiments, use of the antibodies, or antigen-binding fragments thereof, described herein, in the methods described herein, have a specificity of detection for prostate cancer of 0.60 or greater.

[0360] In certain embodiments, use of the antibodies, or antigen-binding fragments thereof, described herein, in the methods described herein, have a specificity of detection for prostate cancer of 0.70 or greater.

[0361] In certain embodiments, use of the antibodies, or antigen-binding fragments thereof, described herein, in the methods described herein, have a specificity of detection for prostate cancer of 0.80 or greater.

[0362] In certain embodiments, use of the antibodies, or antigen-binding fragments thereof, described herein, in the methods described herein, have a specificity of detection for prostate cancer of 0.90 or greater.

[0363] In certain embodiments, use of the antibodies, or antigen-binding fragments thereof, described herein, in the methods described herein, have a specificity of detection for prostate cancer of 0.95 or greater.

[0364] In certain embodiments, the methods described herein comprise recommending a subject for active surveillance (i.e., monitoring for the presence or progression of a prostate cancer). For example, a subject who is found to have elevated levels of APPL1 and SORT1 and a decreased level of SDC1 as determined using the antibodies, or antigen-binding fragments thereof, described herein, as compared to a reference.

[0365] In certain embodiments, the detection in a biological sample from a subject of one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, using the of the antibodies, or antigen-binding fragments thereof, described herein, when compared to a reference, is useful to diagnose (i.e., detect the presence and / or the severity) prostate cancer in a subject, to screen for prostate cancer in a subject, for assessing prognosis of a subject, to determine the metastatic potential of a prostate cancer in a subject, to identify whether a subject is suffering from prostate cancer, to identify whether a subject is susceptible to prostate cancer, to determine the rate of relapse of prostate cancer in a subject, to determine the risk of mortality from prostate cancer in a subject, to stratify the prostate cancer in a subject, to discriminate between having prostate cancer and not having prostate cancer in a subject, to determine whether the prostate cancer is an organ confined cancer in a subject, to discriminate between prostate cancer and one or more of benign prostatic hyperplasia, prostatitis and an inflammatory condition of the prostate in a subject, to determine pathogenic progression in a subject, to assess whether the prostate cancer is slow growing, indolent, or aggressive in a subject, to exclude the presence of prostate cancer in a subject, to identify whether a subject is suitable for treatment and / or surgery for prostate cancer, and to determine the likelihood or risk of a subject having prostate cancer. In certain embodiments, the methods described herein may be adapted for high throughput analysis of samples. In certain embodiments, the level of at least one of APPL1, S0RT1, and SDC1 detected in a biological sample using the antibodies, or the antigen-binding fragments, described herein, is elevated when compared to a reference.

[0366] In certain embodiments, the level of at least one of APPL1, SORT1, and SDC1 detected in a biological sample using the antibodies, or the antigen-binding fragments, described herein, is decreased when compared to a reference.

[0367] In certain embodiments, the methods described herein can be used to detect a low or high level of APPL1, a low or high level of SORT1, and a low or high level of SDC1, when compared to a reference.

[0368] In certain embodiments, the secretion of at least one of APPL1, SORT1, and SDC1 detected in a biological sample using the antibodies, or the antigen-binding fragments, described herein, is elevated when compared to a reference.

[0369] In certain embodiments, the secretion of at least one of APPL1, SORT1, and SDC1 detected in a biological sample using the antibodies, or the antigen-binding fragments, described herein, is decreased when compared to a reference.

[0370] In certain embodiments, the methods described herein comprise detecting a low or high secretion of APPL 1 , a low or high secretion of SORT 1 , and a low or high secretion of SDC 1 , when compared to a reference.

[0371] In certain embodiments, the methods described herein determine the presence of a prostate cancer and distinguish between an early stage prostate cancer (e.g., prostatic intraepithelial neoplasia (PIN)), a primary prostate cancer, and an advanced prostate cancer, to determine the severity of the prostate cancer. In certain embodiments, the methods described herein determine the presence of a prostate cancer and distinguish between a prostatic intraepithelial neoplasia (PIN), a primary prostate cancer, and an advanced prostate cancer, to determine the progression of the prostate cancer. In certain embodiments, the methods described herein distinguish a metastatic prostate cancer from a non-metastatic prostate cancer (e.g., PIN and a primary prostate cancer).

[0372] In certain embodiments, the prostate cancer is of any one of stages 1 to 5. In an embodiment, the prostate cancer is stage 1. In an embodiment, the prostate cancer is stage 2. In an embodiment, the prostate cancer is stage 3. In an embodiment, the prostate cancer is stage 4. In an embodiment, the prostate cancer is stage 5.

[0373] In certain embodiment, the prostate cancer is any one of ISUP grades 1 to 5. In an embodiment, the prostate cancer is ISUP grade 1. In an embodiment, the prostate cancer is ISUP grade 2. In an embodiment, the prostate cancer is ISUP grade 3. In an embodiment, the prostate cancer is ISUP grade 4. In an embodiment, the prostate cancer is ISUP grade 5.

[0374] In certain embodiments, the prostate cancer has a Gleason Score of between 2-10. In an embodiment, the prostate cancer has a Gleason Score of 2. In an embodiment, the prostate cancer has a Gleason Score of 3. In an embodiment, the prostate cancer has a Gleason Score of 4. In an embodiment, the prostate cancer has a Gleason Score of 5. In an embodiment, the prostate cancer has a Gleason Score of 6. In an embodiment, the prostate cancer has a Gleason Score of 7. In an embodiment, the prostate cancer has a Gleason Score of 8. In an embodiment, the prostate cancer has a Gleason Score of 9. In an embodiment, the prostate cancer has a Gleason Score of 10. In certain embodiments, the prostate cancer is a low-grade prostate cancer. In certain embodiments, a low-grade prostate cancer refers to a prostate cancer with a Gleason Score of >2 and <6. In certain embodiments, a low-grade prostate cancer refers to a prostate cancer with an ISUP grade of 1.

[0375] In certain embodiments, the prostate cancer is a medium-grade prostate cancer. In certain embodiments, a medium-grade prostate cancer refers to a prostate cancer with a Gleason Score of 7. In certain embodiments, a medium-grade prostate cancer refers to a prostate cancer with an ISUP grade of 2 or grade 3.

[0376] In certain embodiments, the prostate cancer is a high-grade prostate cancer. In certain embodiments, a high-grade prostate cancer refers to a prostate cancer with a Gleason Score of >8 and <10. In certain embodiments, a high-grade prostate cancer refers to a prostate cancer with an ISUP grade of 4 or grade 5.

[0377] In certain embodiments, the prostate cancer is selected from a prostatic intraepithelial neoplasia (PIN), a primary prostate cancer, and an advanced prostate cancer. Other forms and / or grades of prostate cancer are contemplated. In certain embodiments, the antibodies, or antigen-binding fragments, described herein, differentiate such prostate cancers to aid a physician to recommend a beneficial and targeted therapy for improved outcomes for the patient. PIN is defined as neoplastic growth of epithelial cells within pre-existing benign prostatic acini or ducts (i.e., has progressed beyond hyperplasia). PIN satisfies many of the requirements for the event of transformation from a pre-malignant condition to a cancer (hyperplasia to neoplasia transformation). The term "PIN" as used herein is intended to encompass high-grade PIN (HGPIN), which is understood to have transited to prostate cancer neoplasia / malignancy or is formed as cancer progresses through ducts or into other tissue. HGPIN can be visualised with APPL1, SORT1 and SDC1 staining in prostate cancer patient tissue as “Roman bridges” in the ducts or with very strong APPL1 / SDC1 staining in ductal and tissue regions. APPL1, SORT1 and SDC1 therefore identify the transition from hyperplasia to neoplasia / prostate cancer.

[0378] In certain embodiments, the subject has an increased likelihood or risk of suffering from a prostate cancer. In certain embodiments, the subject is susceptible to a prostate cancer. In certain embodiments, the subject has one or more risk factors associated with a prostate cancer. In certain embodiments, the subject has an unknown likelihood or risk of suffering prostate cancer.

[0379] In certain embodiments, the subject has a measured or known PSA level.

[0380] In certain embodiments, the subject has one or more of the characteristics as described in any of the accompanying examples and / or figures.

[0381] In certain embodiments, the methods described herein comprise detecting prostate cancer in a subject substantially as described herein with reference to any of the accompanying examples and / or figures. In certain embodiments, the methods described herein further comprise first identifying the level of PSA expression in the subject and stratifying the expression of at least one of APPL1, SORT1, and SDC1 based on the PSA expression level in the subject.

[0382] In certain embodiments, the PSA is a level indicative of a low risk of a prostate cancer. In certain embodiments, the PSA level is less than 10 ng / mL.

[0383] In certain embodiments, the detection of at least one of APPL1, SORT1, and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, is performed in situ.

[0384] In certain embodiments, an increase in the levels of at least one of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, when compared to a reference, is indicative of the presence of prostate cancer in a subject.

[0385] In certain embodiments, an increase in the levels of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, when compared to a reference, is indicative of the presence of prostate cancer in a subject.

[0386] In certain embodiments, an increase in the level of APPL1 and an increase in the level of SORT1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, when compared to a reference, is indicative of the presence of prostate cancer in a subject.

[0387] In certain embodiments, an increase in the level of APPL1 and an increase in the level of SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, when compared to a reference, is indicative of the presence of prostate cancer in a subject.

[0388] In certain embodiments, an increase in the level of SORT1 and an increase in the level of SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, when compared to a reference, is indicative of the presence of prostate cancer in a subject.

[0389] In certain embodiments, an increase in the levels of at least one of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, when compared to a reference, is indicative of the presence of low-grade prostate cancer in a subject. In certain embodiments, an increase in the levels of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, when compared to a reference, is indicative of the presence of low-grade prostate cancer in a subject.

[0390] In certain embodiments, an increase in the level of APPL1 and an increase in the level of SORT1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, when compared to a reference, is indicative of the presence of low-grade prostate cancer in a subject. In certain embodiments, an increase in the level of APPL1, an increase in the level of SORT1, and a decrease in the level of SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, when compared to a reference, is indicative of the presence of low-grade prostate cancer in a subject. In certain embodiments, an increase in the levels of at least one of APPL1, S0RT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, as described herein, when compared to a reference, is indicative of the presence of high-grade prostate cancer in a subject. In certain embodiments, an increase in the levels of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, when compared to a reference, is indicative of the presence of high-grade prostate cancer in a subject.

[0391] In certain embodiments, an increase in the level of APPL1 and an increase in the level of SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, when compared to a reference, is indicative of the presence of high-grade prostate cancer in a subject. In certain embodiments, an increase in the level of APPL1, a decrease in the level of SORT1, and an increase in the level of SDC1, as detected by the antibodies, or antigen -binding fragments thereof, described herein, when compared to a reference, is indicative of the presence of highgrade prostate cancer in a subject.

[0392] In certain embodiments, the at least one of APPL1, SORT1 and SDC1 is increased in primary prostate cancer when compared to non-malignant tissue, as detected using the antibodies, or antigen-binding fragments thereof, described herein.

[0393] In certain embodiments, the levels of APPL1, SORT1 and SDC1 are increased in primary prostate cancer when compared to non-malignant tissue, as detected using the antibodies, or antigenbinding fragments thereof, described herein.

[0394] In certain embodiments, the levels of APPL1 and SORT1 are increased in primary prostate cancer tissue when compared to non-malignant tissue, as detected using the antibodies, or antigen-binding fragments thereof, described herein.

[0395] In certain embodiments, the levels of APPL1 and SDC1 are increased in primary prostate cancer tissue when compared to non-malignant tissue, as detected using the antibodies, or antigen-binding fragments thereof, described herein.

[0396] In certain embodiments, the levels of SORT1 and SDC1 are increased in primary prostate cancer tissue when compared to non-malignant tissue, as detected using the antibodies, or antigen-binding fragments thereof, described herein.

[0397] In certain embodiments, the levels of APPL1 and SORT1 are increased, and the level of SDC1 is decreased, in primary prostate cancer tissue when compared to non-malignant tissue, as detected using the antibodies, or antigen-binding fragments thereof, described herein.

[0398] In certain embodiments, the levels of APPL1 and SDC1 are increased, and the level of SORT1 is decreased, in primary prostate cancer tissue when compared to non-malignant tissue, as detected using the antibodies, or antigen-binding fragments thereof, described herein.

[0399] In certain embodiments, the level of at least one of APPL1, SORT1 and SDC1 are increased in primary prostate cancer tissue when compared to benign tissue, as detected using the antibodies, or antigen-binding fragments thereof, described herein.

[0400] In certain embodiments, the levels of APPL1, SORT1 and SDC1 are increased in primary prostate cancer tissue when compared to benign tissue, as detected using the antibodies, or antigen-binding fragments thereof, described herein.

[0401] In certain embodiments, the levels of APPL1 and SORT1 are increased in primary prostate cancer tissue when compared to benign tissue, as detected using the antibodies, or antigen-binding fragments thereof, described herein.

[0402] In certain embodiments, the levels of APPL1 and SDC1 are increased in primary prostate cancer tissue when compared to benign tissue, as detected using the antibodies, or antigen-binding fragments thereof, described herein.

[0403] In certain embodiments, the levels of SORT1 and SDC1 are increased in primary prostate cancer tissue when compared to benign tissue, as detected using the antibodies, or antigen-binding fragments thereof, described herein.

[0404] In certain embodiments, the levels of APPL1 and SORT1 are increased, and the level of SDC1 is decreased, in primary prostate cancer tissue when compared to benign tissue, as detected using the antibodies, or antigen-binding fragments thereof, described herein.

[0405] In certain embodiments, the levels of APPL1 and SDC1 are increased, and the level of SORT1 is decreased, in primary prostate cancer tissue when compared to benign tissue, as detected by the antibodies, or antigen-binding fragments thereof, described herein.

[0406] In certain embodiments, the levels of APPL1 and SDC1 are increased, and the level of SORT1 is decreased, in advanced prostate cancer when compared to primary prostate cancer, as detected by the antibodies, or antigen-binding fragments thereof, described herein.

[0407] In certain embodiments, one or more of the presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, is compared between at least two of non-malignant tissue, prostatic intraepithelial neoplasia, primary prostate cancer and metastatic prostate cancer.

[0408] In certain embodiments, the methods described herein comprise determining the ratio of the level of at least two of APPL1, SORT1 and SDC1, as detected using the antibodies, or antigen -binding fragments thereof, described herein.

[0409] In certain embodiments, an altered ratio of at least two of APPL1, SORT1 and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, is indicative of a prostate cancer in a subject. In certain embodiments, an altered ratio of at least two of APPL1, SORT1 and SDC1, as detected by the antibodies, or antigen-binding fragments thereof, described herein, when compared to equivalent ratios in non-malignant tissue is indicative of a prostate cancer in a subject. Other forms of comparison between different types of prostate tissue are as described herein. In certain embodiments, an increased ratio of APPL1 and SORT1 compared to SDC1, detected by the antibodies, or antigen-binding fragments thereof, described herein, is indicative of primary prostate cancer in a subject. In certain embodiments, an increased ratio of APPL1 and SORT1 compared to SDC1, detected by the antibodies, or antigen-binding fragments thereof, described herein is indicative of low-grade prostate cancer in a subject. In certain embodiments, an increased ratio of APPL1 and SDC1 compared to SORT1, detected by the antibodies, or antigen-binding fragments thereof, described herein is indicative of advanced prostate cancer in a subj ect. In certain embodiments, an increased ratio of APPL1 and SDC1 compared to SORT1, detected by the antibodies, or antigen-binding fragments thereof, described herein, is indicative of high-grade prostate cancer in a subject.

[0410] In certain embodiments, the methods described herein comprise comparing one or more of the presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, detected by the antibodies, or antigen-binding fragments thereof, described herein, with one or more other biomarkers known to be indicative of a prostate cancer in a subject and / or known to be indicative of the absence of a prostate cancer in a subject.

[0411] In certain embodiments, the methods described herein comprise comparing one or more of the presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, detected by the antibodies, or antigen-binding fragments thereof, described herein with one or more reference and / or control biomarkers.

[0412] In certain embodiments, the methods described herein comprise comparing the presence and / or level of at least one of APPL1, SORT1 and SDC1, detected by the antibodies, or antigen-binding fragments thereof, described herein, with the presence and / or level of one or more other biomarkers associated with an altered risk of prostate cancer and / or one or more other biomarkers known to be indicative of the presence or absence of prostate cancer in the subject.

[0413] In certain embodiments, the reference biomarker comprises an endogenous marker. In certain embodiments, the reference biomarker comprises an exogenous biomarker. For example, a sample may be spiked with an exogenous reference biomarker.

[0414] In certain embodiments, the risk of recurrence may be a low, intermediate or a high risk of recurrence.

[0415] In certain embodiments, a high level of APPL1 and SDC1 with minimal or no SORT1 when compared to a reference is predictive of clinical recurrence within about 50 months. In certain embodiments, a high level of APPL1 and SDC1 with small amounts of SORT1 when compared to a reference is predictive of clinical recurrence over about 120 months. In certain embodiments, a high level of APPL1, SDC1 and SORT1 when compared to a reference is predictive that a subject is unlikely to have a clinical recurrence.

[0416] In certain embodiments, treating a subject with a cancer therapy comprises one or more of surgical intervention, radiation therapy and administration of an anti-cancer agent.

[0417] In certain embodiments, the methods described are useful in companion diagnostics for assessing the suitability of AR therapeutic intervention, non-AR therapy selection, AR therapeutic monitoring and PET scan and radiation therapy.

[0418] In certain embodiments, the methods described herein comprise treating a prostate cancer in a subject by surgical intervention based on one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein.

[0419] In certain embodiments, the methods described herein comprise treating a prostate cancer in a subject by administering to the subject an effective amount of an anti-cancer agent based on one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein.

[0420] In certain embodiments, the methods described herein comprise treating a prostate cancer in a subject with radiation therapy based on one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein. Methods of radiation therapy for prostate cancer are known in the art.

[0421] In certain embodiments, treatment is initiated based on one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, when the altered presence, level, secretion and distribution of at least one of APPL1, SORT1, and SDC1 is indicative of the presence of prostate cancer and / or an increased likelihood or risk of prostate cancer.

[0422] In certain embodiments, one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, is indicative that a subject is suitable for treatment. In certain embodiments, one or more of an altered presence, level, secretion and distribution of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, is indicative that a subject is suitable for treatment. In certain embodiments, an increased level of at least one of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, is indicative that the subject is suitable for treatment. In certain embodiments, an increased level of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, is indicative that the subject is suitable for treatment. In certain embodiments, a decreased level of at least one of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, is indicative that the subject is suitable for treatment. In certain embodiments, a decreased level of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, is indicative that the subject is suitable for treatment. In certain embodiments, an upregulation of at least one of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, is indicative that the subject is suitable for treatment. In certain embodiments, an upregulation of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, is indicative that the subject is suitable for treatment. In certain embodiments, a downregulation of at least one of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, is indicative that the subject is suitable for treatment. In certain embodiments, a downregulation of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, is indicative that the subject is suitable for treatment. In certain embodiments, an upregulation of any one of APPL1, SORT1 and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, and / or a downregulation of any one of APPL1, SORT1, and SDC1, as detected using the antibodies, or antigen-binding fragments thereof, described herein, is indicative that the subject is suitable for treatment.

[0423] In certain embodiments, provided herein is a method of screening for prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein.

[0424] In certain embodiments, provided herein is a method of screening for prostate cancer, and determining the progression thereof, in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1 using the antibodies, or antigen-binding fragments thereof, described herein, wherein the altered presence, level, secretion and distribution of at least one of APPL1, SORT1, and SDC1 is indicative of prostate cancer and / or progression thereof in the subject.

[0425] All combinations of the detection of APPL1, SORT1 and SDC1, by the antibodies or antigenbinding fragments thereof, described herein, are contemplated to define the pathogenic process in prostate cancer.

[0426] The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgement or admission or any form of suggestion that the prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

[0427] All methods described herein can be performed in any suitable order unless indicated otherwise herein or clearly contradicted by context. The use of any and all examples, or exemplary language (e g., "such as") provided herein, is intended merely to better illuminate the example embodiments and does not pose a limitation on the scope of the claimed invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential.

[0428] The description provided herein is in relation to several embodiments which may share common characteristics and features. It is to be understood that one or more features of one embodiment may be combinable with one or more features of the other embodiments. In addition, a single feature or combination of features of the embodiments may constitute additional embodiments. The subject headings used herein are included only for the ease of reference of the reader and should not be used to limit the subject matter found throughout the disclosure or the claims. The subject headings should not be used in construing the scope of the claims or the claim limitations. Although the present disclosure has been described with reference to particular examples, it will be appreciated by those skilled in the art that the disclosure may be embodied in many other forms.

[0429] Table 1. Sequences

[0430] SEQ ID NO: Description Sequence

[0431] 1 HCDR1 of APPL1 antibody DAWMD

[0432] (Kabat numbering)

[0433] Amino acid sequence

[0434] 2 HCDR2 of APPL1 antibody EIRNRANNHATYYTESVKG (Kabat numbering)

[0435] Amino acid sequence

[0436] 3 HCDR3 of APPL1 antibody LDY

[0437] (Kabat numbering)

[0438] Amino acid sequence

[0439] 4 LCDR1 of APPL1 antibody KSGQSLLYSNGKTYLN

[0440] (Kabat numbering)

[0441] Amino acid sequence

[0442] 5 LCDR2 of APPL1 antibody LVSKLDS

[0443] (Kabat numbering)

[0444] Amino acid sequence

[0445] 6 LCDR3 of APPL1 antibody VQGSRLPWT

[0446] (Kabat numbering)

[0447] Amino acid sequence

[0448] 7 HCDR1 of APPL1 antibody GFTFSDA

[0449] (Chothia numbering)

[0450] Amino acid sequence

[0451] 8 HCDR2 of APPL1 antibody RNRANNHA

[0452] (Chothia numbering)

[0453] Amino acid sequence

[0454] 9 HCDR3 of APPL1 antibody LDY

[0455] (Chothia numbering)

[0456] Amino acid sequence

[0457] 10 LCDR1 of APPL1 antibody KSGQSLLYSNGKTYLN (Chothia numbering)

[0458] Amino acid sequence

[0459] 11 LCDR2 of APPL1 antibody LVSKLDS

[0460] (Chothia numbering)

[0461] Amino acid sequence

[0462] 12 LCDR3 of APPL1 antibody VQGSRLPWT

[0463] (Chothia numbering)

[0464] Amino acid sequence

[0465] 13 HCDR1 of APPL1 antibody GFTFSDAW

[0466] (IMGT numbering)

[0467] Amino acid sequence

[0468] 14 HCDR2 of APPL1 antibody IRNRANNHAT

[0469] (IMGT numbering)

[0470] Amino acid sequence

[0471] 15 HCDR3 of APPL1 antibody TDLDY

[0472]

[0473] (IMGT numbering) Amino acid sequence

[0474] LCDR1 of APPL1 antibody QSLLYSNGKTY (IMGT numbering)

[0475] Amino acid sequence

[0476] LCDR2 of APPL1 antibody LVS

[0477] (IMGT numbering)

[0478] Amino acid sequence

[0479] LCDR3 of APPL1 antibody VQGSRLPWT (IMGT numbering)

[0480] Amino acid sequence

[0481] VH of APPL1 antibody EVKFEESGGGLVQPGGSMK Amino acid sequence LSCTASGFTFSDAWMDWVR Q SPEKGLEW VAEIRNRANN HATYYTESVKGRFTISRDDS KSTVYLQMNNLRAEDTGIY YCTDLDYWGLGTTLTVSS CH of APPL1 antibody AKTTPPSVYPLAPGSAAQTN Amino acid sequence SMVTLGCLVKGYFPEPVTVT WNSGSLSSGVHTFPAVLQSD LYTLSSSVTVPSSTWPSQTV TCNVAHP AS STKVDKKIVPR DCGCKPCICTVPEVSSVFIFP PKPKDVLTITLTPKVTCWV DISKDDPEVQF S WFVDDVEV HTAQTKPREEQINSTFRSVSE LPIMHQDWLNGKEFKCRVN SAAFPAPIEKTISKTKGRPKA PQVYTIPPPKEQMAKDKVSL TCMITNFFPEDITVEWQWNG QPAENYKNTQPIMDTDGSYF VYSKLNVQKSNWEAGNTFT C S VLHEGLHNHHTEKSL SHS PGK

[0482] Heavy chain of APPL1 antibody EVKFEESGGGLVQPGGSMK Amino acid sequence LSCTASGFTFSDAWMDWVR Q SPEKGLEW VAEIRNRANN HATYYTESVKGRFTISRDDS KSTVYLQMNNLRAEDTGIY YCTDLDYWGLGTTLTVSSA KTTPPSVYPLAPGSAAQTNS MVTLGCLVKGYFPEPVTVT WNSGSLSSGVHTFPAVLQSD LYTLSSSVTVPSSTWPSQTV TCNVAHP AS STKVDKKIVPR DCGCKPCICTVPEVSSVFIFP PKPKDVLTITLTPKVTCWV DISKDDPEVQF S WFVDDVEV HTAQTKPREEQINSTFRSVSE LPIMHQDWLNGKEFKCRVN SAAFPAPIEKTISKTKGRPKA

[0483]

[0484] PQVYTIPPPKEQMAKDKVSL TCMITNFFPEDITVEWQWNG QPAENYKNTQPIMDTDGSYF VYSKLNVQKSNWEAGNTFT C S VLHEGLHNHHTEKSL SHS PGK VL of APPL1 antibody DIVMTQTPLTLSVTIGQPASI Amino acid sequence SCKSGQSLLYSNGKTYLNW LLKRPGQSPKRLIYLVSKLD SGVPDRFTGSGSGTDFTLKIS RVEAEDLGVYYCVQGSRLP WTFGGGTKLEIK CL of APPL1 antibody RADAAPTVSIFPPSSEQLTSG Amino acid sequence GASVVCFLNNFYPKDINVK WKIDGSERQNGVLNSWTDQ DSKDSTYSMSSTLTLTKDEY ERHNSYTCEATHKTSTSPIV KSFNRNEC

[0485] Light chain of APPL1 antibody DIVMTQTPLTLSVTIGQPASI Amino acid sequence SCKSGQSLLYSNGKTYLNW LLKRPGQSPKRLIYLVSKLD SGVPDRFTGSGSGTDFTLKIS RVEAEDLGVYYCVQGSRLP WTFGGGTKLEIKRADAAPT VSIFPPSSEQLTSGGASVVCF LNNFYPKDINVKWKIDGSER QNGVLNSWTDQDSKDSTYS MSSTLTLTKDEYERHNSYTC EATHKTSTSPIVKSFNRNEC

[0486] Heavy chain of APPL1 antibody GAAGTGAAGTTTGAGGAGT DNA sequence CTGGAGGAGGCTTGGTGCA ACCTGGAGGATCCATGAAA CTCTCTTGTACTGCCTCTGG ATTCACTTTTAGTGACGCC TGGATGGACTGGGTCCGCC AGTCTCCAGAAAAGGGGCT TGAGTGGGTTGCTGAAATT AGAAACAGAGCCAATAAT CATGCAACATACTATACTG AGTCTGTGAAAGGGAGGTT CACCATCTCAAGAGATGAT TCCAAAAGTACTGTCTACC TGCAAATGAATAATTTAAG AGCTGAAGACACTGGCATT TATTACTGTACGGACTTAG ACTACTGGGGCCTAGGCAC CACTCTCACAGTCTCCTCA GCCAAAACGACACCCCCAT CTGTCTATCCACTGGCCCC TGGATCTGCTGCCCAAACT AACTCCATGGTGACCCTGG

[0487]

[0488] GATGCCTGGTCAAGGGCTA TTTCCCTGAGCCAGTGACA GTGACCTGGAACTCTGGAT CCCTGTCCAGCGGTGTGCA CACCTTCCCAGCTGTCCTG CAGTCTGACCTCTACACTC TGAGCAGCTCAGTGACTGT CCCCTCCAGCACCTGGCCC AGCCAGACCGTCACCTGCA ACGTTGCCCACCCGGCCAG CAGCACCAAGGTGGACAA GAAAATTGTGCCCAGGGAT TGTGGTTGTAAGCCTTGCA TATGTACAGTCCCAGAAGT ATCATCTGTCTTCATCTTCC CCCCAAAGCCCAAGGATGT GCTCACCATTACTCTGACT CCTAAGGTCACGTGTGTTG TGGTAGACATCAGCAAGGA TGATCCCGAGGTCCAGTTC AGCTGGTTTGTAGATGATG TGGAGGTGCACACAGCTCA GACGAAACCCCGGGAGGA GCAGATCAACAGCACTTTC CGTTCAGTCAGTGAACTTC CCATCATGCACCAGGACTG GCTCAATGGCAAGGAGTTC AAATGCAGGGTCAACAGTG CAGCTTTCCCTGCCCCCAT CGAGAAAACCATCTCCAAA ACCAAAGGCAGACCGAAG GCTCCACAGGTGTACACCA TTCCACCTCCCAAGGAGCA GATGGCCAAGGATAAAGTC AGTCTGACCTGCATGATAA CAAACTTCTTCCCTGAAGA CATTACTGTGGAGTGGCAG TGGAATGGGCAGCCAGCG GAGAACTACAAGAACACTC AGCCCATCATGGACACAGA TGGCTCTTACTTCGTCTACA GCAAGCTCAATGTGCAGAA GAGCAACTGGGAGGCAGG AAATACTTTCACCTGCTCT GTGTTACATGAGGGCCTGC ACAACCACCATACTGAGAA GAGCCTCTCCCACTCTCCT GGTAAATGA

[0489] Light chain of APPL1 antibody GATATTGTGATGACCCAGA DNA sequence CTCCACTCACTTTGTCGGTT

[0490] ACCATTGGACAACCAGCCT

[0491]

[0492] CTATCTCTTGCAAGTCAGG TCAGAGTCTCTTATATAGT AATGGAAAGACCTATTTGA ATTGGTTATTAAAGAGGCC AGGCCAGTCTCCCAAGCGC CTAATCTATCTGGTGTCTA AACTGGACTCTGGAGTCCC TGACAGGTTCACTGGCAGT GGTTCAGGAACAGACTTTA CACTGAAAATCAGCAGAGT GGAGGCTGAGGATTTGGGA GTTTATTACTGCGTGCAAG GTTCACGTTTGCCGTGGAC GTTCGGTGGGGGCACCAAG CTGGAGATCAAACGGGCTG ATGCTGCACCAACTGTATC CATCTTCCCACCATCCAGT GAGCAGTTAACATCTGGAG GTGCCTCAGTCGTGTGCTT CTTGAACAACTTCTACCCC AAAGACATCAATGTCAAGT GGAAGATTGATGGCAGTGA ACGACAAAATGGCGTCCTG AACAGTTGGACTGATCAGG ACAGCAAAGACAGCACCT ACAGCATGAGCAGCACCCT CACGTTGACCAAGGACGAG TATGAACGACATAACAGCT ATACCTGTGAGGCCACTCA CAAGACATCAACTTCACCC ATTGTCAAGAGCTTCAACA GGAATGAGTGTTAG HCDR1 of SORT 1 antibody NYWMQ

[0493] (Kabat numbering)

[0494] Amino acid sequence

[0495] HCDR2 of SORT1 antibody AIYPVDGDTRYTQKFRG (Kabat numbering)

[0496] Amino acid sequence

[0497] HCDR3 of SORT 1 antibody GGDIRRSSYALDY (Kabat numbering)

[0498] Amino acid sequence

[0499] LCDR1 of SORT 1 antibody RASQSVSKSTYSYIH (Kabat numbering)

[0500] Amino acid sequence

[0501] LCDR2 of SORT 1 antibody YASNLES

[0502] (Kabat numbering)

[0503] Amino acid sequence

[0504] LCDR3 of SORT 1 antibody QHSWENPYT (Kabat numbering)

[0505] Amino acid sequence

[0506] HCDR1 of SORT 1 antibody GYTFTNY

[0507]

[0508] (Chothia numbering) Amino acid sequence

[0509] HCDR2 of S0RT1 antibody YPVDGD

[0510] (Chothia numbering)

[0511] Amino acid sequence

[0512] HCDR3 of SORT 1 antibody GGDIRRSSYALDY (Chothia numbering)

[0513] Amino acid sequence

[0514] LCDR1 of SORT 1 antibody RASQSVSKSTYSYIH (Chothia numbering)

[0515] Amino acid sequence

[0516] LCDR2 of SORT 1 antibody YASNLES

[0517] (Chothia numbering)

[0518] Amino acid sequence

[0519] LCDR3 of SORT 1 antibody QHSWENPYT (Chothia numbering)

[0520] Amino acid sequence

[0521] HCDR1 of SORT 1 antibody GYTFTNYW (IMGT numbering)

[0522] Amino acid sequence

[0523] HCDR2 of SORT1 antibody IYPVDGDT (IMGT numbering)

[0524] Amino acid sequence

[0525] HCDR3 of SORT 1 antibody AKGGDIRRS S YALDY (IMGT numbering)

[0526] Amino acid sequence

[0527] LCDR1 of SORT 1 antibody QSVSKSTYSY (IMGT numbering)

[0528] Amino acid sequence

[0529] LCDR2 of SORT 1 antibody YAS

[0530] (IMGT numbering)

[0531] Amino acid sequence

[0532] LCDR3 of SORT 1 antibody QHSWENPYT (IMGT numbering)

[0533] Amino acid sequence

[0534] VH of SORT1 antibody QVQLQQSGAELARPGASVK Amino acid sequence MSCKASGYTFTNYWMQWI KQRPGQGLEWIGAIYPVDG DTRYTQKFRGKATLTADKS SSTAYMQLNSLASEDSAVY YC AKGGDIRRS S YALD YWG QGTSVTVSS CH of SORT1 antibody AKTT AP S VYPLAP VCGDTTG Amino acid sequence S S VTLGCL VKGYFPEPVTLT WNSGSLSSGVHTFPAVLQSD LYTLSSSVTVTSSTWPSQSIT CNVAHPASSTKVDKKIEPRG PTIKPCPPCKCPAPNLLGGP S VFIFPPKIKD VLMISL SPIVTC VVVDVSEDDPDVQISWFVN NVEVHTAQTQTHREDYNST

[0535]

[0536] LRVVSALPIQHQDWMSGKE FKCKVNNKDLPAPIERTISKP KGSVRAPQVYVLPPPEEEMT KKQVTLTCMVTDFMPEDIY VEWTNNGKTELNYKNTEPV LDSDGSYFMYSKLRVEKKN WVERNSYSCSVVHEGLHNH HTTKSFSRTPGK

[0537] Heavy chain of SORT1 antibody QVQLQQSGAELARPGASVK Amino acid sequence MSCKASGYTFTNYWMQWI KQRPGQGLEWIGAIYPVDG DTRYTQKFRGKATLTADKS SSTAYMQLNSLASEDSAVY YCAKGGDIRRS S YALD YWG QGTSVTVSSAKTTAPSVYPL APVCGDTTGSSVTLGCLVK GYFPEPVTLTWNSGSLSSGV HTFP A VLQ SDL YTL S S S VT V TSSTWPSQSITCNVAHPASST KVDKKIEPRGPTIKPCPPCKC PAPNLLGGPSVFIFPPKIKDV LMISLSPIVTCVVVDVSEDDP DVQISWFVNNVEVHTAQTQ THREDYNSTLRVVSALPIQH QDWMSGKEFKCKVNNKDL PAPIERTISKPKGSVRAPQVY VLPPPEEEMTKKQVTLTCM VTDFMPEDIYVEWTNNGKT ELNYKNTEP VLD SDGS YFM YSKLRVEKKNWVERNSYSC SVVHEGLHNHHTTKSFSRTP GK VL of SORT1 antibody DIVLTQ SP ASL AVSLGQRATI Amino acid sequence SCRASQSVSKSTYSYIHWYQ QKPGQPPKLLIKYASNLESG VPARF SGSGSGTDFTLNIHPV EEEDSATYYCQHSWENPYT FGGGTKLEIK CL of SORT1 antibody RADAAPTVSIFPPSSEQLSGG Amino acid sequence ASVVCFLNNFYPKDINVKW KIDGSERQNGVLNSWTDQD SKDSTYSMSSTLTLTKDEYE RHNSYTCEATHKTSTSPIVK SFNRNEC

[0538] Light chain of SORT1 antibody DIVLTQ SP ASL AVSLGQRATI Amino acid sequence SCRASQSVSKSTYSYIHWYQ QKPGQPPKLLIKYASNLESG VPARF SGSGSGTDFTLNIHPV EEEDSATYYCQHSWENPYT FGGGTKLEIKRADAAPTVSIF PPSSEQLSGGASVVCFLNNF

[0539]

[0540] YPKDINVKWKIDGSERQNG VLNSWTDQDSKDSTYSMSS TLTLTKDEYERHNSYTCEAT HKTSTSPIVKSFNRNEC

[0541] Heavy chain of S0RT1 antibody CAGGTTCAGCTCCAGCAGT DNA sequence CTGGGGCTGAGCTGGCAAG ACCTGGGGCTTCAGTGAAG ATGTCCTGCAAGGCTTCTG GCTACACCTTTACTAACTA CTGGATGCAGTGGATAAAA CAGAGGCCTGGACAGGGTC TGGAATGGATTGGGGCTAT TTATCCTGTAGATGGTGAT ACTAGGTACACTCAGAAGT TCAGGGGCAAGGCCACATT GACTGCAGATAAATCCTCC AGCACAGCCTACATGCAAC TCAACAGTTTGGCATCTGA GGACTCTGCGGTCTATTAC TGTGCAAAGGGGGGGGAC ATACGACGATCCTCCTATG CTTTGGACTACTGGGGTCA AGGAACCTCTGTCACCGTC TCCTCAGCCAAAACAACAG CCCCATCGGTCTATCCACT GGCCCCTGTGTGTGGAGAT ACAACTGGCTCCTCGGTGA CTCTAGGATGCCTGGTCAA GGGTTATTTCCCTGAGCCA GTGACCTTGACCTGGAACT CTGGATCCCTGTCCAGTGG TGTGCACACCTTCCCAGCT GTCCTGCAGTCGACCTCTA CACCCTCAGCAGCTCAGTG ACTGTAACCTCGAGCACCT GGCCCAGCCAGTCCATCAC CTGCAATGTGCCCACCCGG CAAGCAGCACCAAGGTGG ACAAGAAAATTGAGCCCA GAGGGCCCACAATCAAGCC CTGTCCTCCATGCAAATGC CCAGCACCTAACCTCTTGG GTGGACCATCCGTCTTCAT CTTCCCTCCAAAGATCAAG GATGTACTCATGATCTCCC TGAGCCCCATAGTCACATG TGTGGTGGTGGATGTGAGC GAGGATGACCCAGATGTCC AGATCAGCTGGTTTGTGAA CAACGTGGAAGTACACACA GCTCAGACACAAACCCATA

[0542]

[0543] GAGAGGATTACAACAGTAC TCTCCGGGTGGTCAGTGCC CTCCCCATCCAGCACCAGG ACTGGATGAGTGGCAAGG AGTTCAAATGCAAGGTCAA CAACAAAGACCTCCCAGCG CCCATCGAGAGAACCATCT CAAAACCCAAAGGGTCAGT AAGAGCTCCACAGGTATAT GTCTTGCCTCCACCAGAAG AAGAGATGACTAAGAAAC AGGTCACTCTGACCTGCAT GGTCACAGACTTCATGCCT GAAGACATTTACGTGGAGT GGACCAACAACGGGAAAA CAGAGCTAAACTACAAGA ACACTGAACCAGTCCTGGA CTCTGATGGTTCTTACTTCA TGTACAGCAAGCTGAGAGT GGAAAAGAAGAACTGGGT GGAAAGAAATAGCTACTCC TGTTCAGTGGTCCACGAGG GTCTGCACAATCACCACAC GACTAAGAGCTTCTCCCGG ACTCCGGGTAAATGA

[0544] Light chain of S0RT1 antibody GACATTGTGCTGACACAGT DNA sequence CTCCTGCTTCCTTAGCTGTA TCTCTGGGGCAGAGGGCCA CCATCTCGTGCAGGGCCAG CCAAAGTGTCAGTAAATCT ACCTATAGTTATATCCACT GGTACCAACAGAAACCAG GACAGCCACCCAAACTCCT CATCAAATATGCATCCAAC CTAGAGTCTGGGGTCCCTG CCAGGTTCAGTGGCAGTGG GTCTGGGACAGACTTCACC CTCAACATCCATCCTGTGG AGGAGGAGGATAGTGCAA CATATTACTGTCAGCACAG TTGGGAGAATCCGTACACG TTCGGAGGGGGGACCAAG CTGGAAATAAAACGGGCTG ATGCTGCACCAACTGTATC CATCTTCCCACCATCCAGT GAGCAGTTAACATCTGGAG GTGCCTCAGTCGTGTGCTT CTTGAACAACTTCTACCCC AAAGACATCAATGTCAAGT GGAAGATTGATGGCAGTGA ACGACAAAATGGCGTCCTG

[0545]

[0546] AACAGTTGGACTGATCAGG ACAGCAAAGACAGCACCT ACAGCATGAGAGCACCCTC ACGTTGACCAAGGACGAGT ATGAACGACATAACAGCTA TACCTGTGAGGCCACTCAC AAGACATCAACTTCACCCA TTGTCAAGAGCTTCAACAG GAATGAGTGTTAG HCDR1 of SDC1 antibody DDYLN

[0547] (Kabat numbering)

[0548] Amino acid sequence

[0549] HCDR2 of SDC1 antibody VINPYNGGTTYNQKFKG (Kabat numbering)

[0550] Amino acid sequence

[0551] HCDR3 of SDC1 antibody GVWDMNAMDY

[0552] (Kabat numbering)

[0553] Amino acid sequence

[0554] LCDR1 of SDC1 antibody HASQNINVWLS

[0555] (Kabat numbering)

[0556] Amino acid sequence

[0557] LCDR2 of SDC1 antibody KASKLHT

[0558] (Kabat numbering)

[0559] Amino acid sequence

[0560] LCDR3 of SDC1 antibody QQGQSFPFT (Kabat numbering)

[0561] Amino acid sequence

[0562] HCDR1 of SDC1 antibody GYTFDDD

[0563] (Chothia numbering)

[0564] Amino acid sequence

[0565] HCDR2 of SDC1 antibody NPYNGG

[0566] (Chothia numbering)

[0567] Amino acid sequence

[0568] HCDR3 of SDC1 antibody GVWDMNAMDY (Chothia numbering)

[0569] Amino acid sequence

[0570] LCDR1 of SDC1 antibody HASQNINVWLS (Chothia numbering)

[0571] Amino acid sequence

[0572] LCDR2 of SDCl antibody KASKLHT

[0573] (Chothia numbering)

[0574] Amino acid sequence

[0575] LCDR3 of SDC1 antibody QQGQSFPFT (Chothia numbering)

[0576] Amino acid sequence

[0577] HCDR1 of SDC1 antibody GYTFDDDY (IMGT numbering)

[0578] Amino acid sequence

[0579] HCDR2 of SDC1 antibody INPYNGGT

[0580] (IMGT numbering)

[0581] Amino acid sequence

[0582]

[0583] HCDR3 of SDC1 antibody TRGVWDMNAMDY (IMGT numbering)

[0584] Amino acid sequence

[0585] LCDR1 of SDC1 antibody QNINVW

[0586] (IMGT numbering)

[0587] Amino acid sequence

[0588] LCDR2 of SDC1 antibody KAS

[0589] (IMGT numbering)

[0590] Amino acid sequence

[0591] LCDR3 of SDC1 antibody QQGQSFPFT (IMGT numbering)

[0592] Amino acid sequence

[0593] VH of SDC1 antibody EVQLQQSGPVLVTPGASVK Amino acid sequence MSCTTSGYTFDDDYLNWVK QSHGKSLEWIGVINPYNGGT TYNQKFKGKATLTVDKSST TAYMEVNSLTSEDSAVYYC TRGVWDMNAMDYWGQGT SVTVSS CH of SDC1 antibody AKTTPPSVYPLAPGCGDTTG Amino acid sequence SSVTLGCLVKGYFPESVTVT WNSGSLS S S VHTFP ALLQ SG LYTMS S S VTVP S STWP SQTV TCSVAHPASSTTVDKKLEPS GPISTINPCPPCKECHKCPAP NLEGGP S VFIFPPNIKD VLMI SLTPKVTCWVDVSEDDPD VRISWFVNNVEVHTAQTQT HREDYNSTIRVVSALPIQHQ DWMSGKEFKCKVNNKDLPS PIERTISKIKGLVRAPQVYILP PPAEQLSRKDVSLTCLVVGF NPGDISVEWTSNGHTEENYK DTAPVLDSDGSYFIYSKLDIK TSKWEKTDSFSCNVRHEGL KNYYLKKTISRSPGK

[0594] Heavy chain of SDC1 antibody EVQLQQSGPVLVTPGASVK Amino acid sequence MSCTTSGYTFDDDYLNWVK QSHGKSLEWIGVINPYNGGT TYNQKFKGKATLTVDKSST TAYMEVNSLTSEDSAVYYC TRGVWDMNAMDYWGQGT SVTVSSAKTTPPSVYPLAPG CGDTTGSSVTLGCLVKGYFP ES VT VTWNSGSL S S S VHTFP ALLQSGLYTMSSSVTVPSST WPSQTVTCSVAHPASSTTVD KKLEPSGPISTINPCPPCKEC HKCP APNLEGGP S VFIFPPNI KDVLMISLTPKVTCVVVDVS EDDPDVRISWFVNNVEVHT

[0595]

[0596] AQTQTHREDYNSTIRVVSAL PIQHQDWMSGKEFKCKVNN KDLPSPIERTISKIKGLVRAP QVYILPPPAEQLSRKDVSLT CL VVGFNPGDIS VEWT SNGH TEENYKDT APVLD SDGS YFI YSKLDIKTSKWEKTDSFSCN VRHEGLKNYYLKKTISRSPG K VL of SDC1 antibody DIQMNQ SP S SLS ASLGDTITI Amino acid sequence TCHASQNINVWLSWYQQKP GNIPKLLIYKASKLHTGVPL RFSGSGSGTGFTLTISSLQPE DFATYYCQQGQSFPFTFGSG TKLEIK CL of SDC1 antibody RADVAPTVSIFPPSSEQLTSG Amino acid sequence GASVVCFLNNFYPKDINVK WKIDGSERQNGVLNSWTDQ DSKDSTYSMSSTLTLTKDEY ERHNSYTCEATHKTSTSPIV KSFNRNEC

[0597] Light chain of SDC1 antibody DIQMNQ SP S SLS ASLGDTITI Amino acid sequence TCHASQNINVWLSWYQQKP GNIPKLLIYKASKLHTGVPL RFSGSGSGTGFTLTISSLQPE DFATYYCQQGQSFPFTFGSG TKLEIK RAD VAPTVSIFPP S S EQLTSGGASVVCFLNNFYPK DINVKWKIDGSERQNGVLN SWTDQDSKDSTYSMSSTLTL TKDEYERHNSYTCEATHKTS TSPIVKSFNRNEC

[0598] Heavy chain of SDC1 antibody GAGGTCCAACTGCAACAGT DNA sequence CTGGACCTGTGCTGGTGAC GCCTGGGGCTTCAGTGAAG ATGTCCTGTACGACTTCTG GATACACATTCGATGACGA CTATTTGAACTGGGTGAAG CAGAGCCATGGAAAGAGC CTTGAGTGGATTGGAGTTA TCAATCCTTACAACGGTGG TACTACCTACAACCAGAAG TTCAAGGGCAAGGCCACAT TGACTGTTGATAAGTCCTC CACTACAGCCTACATGGAA GTCAACAGCCTGACATCTG AGGATTCTGCCGTCTATTA CTGTACAAGAGGGGTTTGG GACATGAATGCTATGGACT ATTGGGGTCAAGGAACCTC AGTCACCGTCTCCTCAGCC

[0599]

[0600] AAAACAACACCCCCATCAG TCTATCCACTGGCCCCTGG GTGTGGAGATACAACTGGT TCCTCTGTGACTCTGGGAT GCCTGGTCAAGGGCTACTT CCCTGAGTCAGTGACTGTG ACTTGGAACTCTGGATCCC TGTCCAGCAGTGTGCACAC CTTCCCAGCTCTCCTGCAG TCTGGACTCTAACTATGAG CAGCTCAGTGACTGTCCCC TCCAGCACCTGGCCAAGTC AGACCGTCACCTGCAGCGT TGCTCACCCAGCCAGCAGC ACCACGGTGGACAAAAAA CTTGAGCCCAGCGGGCCCA TTTCAACAATCAACCCCTG TCCTCCATGCAAGGAGTGT CACAAATGCCCAGCTCCTA ACCTCGAGGGTGGACCATC CGTCTTCATCTTCCCTCCAA ATATCAAGGATGTACTCAT GATCTCCCTGACACCCAAG GTCACGTGTGTGGTGGTGG ATGTGAGCGAGGATGACCC AGACGTCCGGATCAGCTGG TTTGTGAACAACGTGGAAG TACACACAGCTCAGACACA AACCCATAGAGAGGATTAC AACAGTACTATCCGGGTGG TCAGTGCCCTCCCCATCCA GCACCAGGACTGGATGAGT GGCAAGGAGTTCAAATGCA AGGTCAACAACAAAGACCT CCCATCACCCATCGAGAGA ACCATCTCAAAAATTAAAG GGCTAGTCAGAGCTCCACA AGTATACATCTTGCCGCCA CCAGCAGAGCAGTTGTCCA GGAAAGATGTCAGTCTCAC TTGCCTGGTCGTGGGCTTC AACCCTGGAGACATCAGTG TGGAGTGGACCAGCAATGG GCATACAGAGGAGAACTA CAAGGACACCGCACCAGTC CTGGACTCTGACGGTTCTT ACTTCATATACAGCAAGCT CGATATAAAAACAAGCAA GTGGGAGAAAACAGATTCC TTCTCATGCAACGTGAGAC ACGAGGGTCTGAAAAATTA

[0601]

[0602] CTACCTGAAGAAGACCATC TCCCGGTCTCCGGGTAAAT GA

[0603] Light chain of SDC1 antibody GACATCCAGATGAACCAGT DNA sequence CTCCATCCAGTCTGTCTGC ATCCCTTGGAGACACAATT ACCATCACTTGCCATGCCA GTCAGAACATTAATGTTTG GTTAAGCTGGTACCAGCAG AAACCAGGAAATATTCCTA AACTCTTGATCTATAAGGC TTCCAAGTTGCACACAGGC GTCCCATTAAGGTTTAGTG GCAGTGGATCTGGAACAGG TTTCACATTAACCATCAGC AGCCTGCAGCCTGAAGACT TTGCCACTTACTACTGTCA ACAGGGTCAAAGTTTTCCA TTCACGTTCGGCTCGGGGA CAAAGTTGGAAATAAAAC GGGCTGATGTTGCACCAAC TGTATCCATCTTCCCACCAT CCAGTGAGCAGTTAACATC TGGAGGTGCCTCAGTCGTG TGCTTCTTGAACAACTTCT ACCCCAAAGACATCAATGT CAAGTGGAAGATTGATGGC AGTGAACGACAAAATGGC GTCCTGAACAGTTGGACTG ATCAGGACAGCAAAGACA GCACCTACAGCATGAGCAG CACCCTCACGTTGACCAAG GACGAGTATGAACGACATA ACAGCTATACCTGTGAGGC CACTCACAAGACATCAACT TCACCCATTGTCAAGAGCT TCAACAGGAATGAGTGTTA G

[0604] Human APPL1 amino acid MPGIDKLPIEETLEDSPQTRS sequence LLGVFEEDATAISNYMNQLY UniProtKB accession # Q9UKG1 Q AMHRI YD AQNEL S AATHL TSKLLKEYEKQRFPLGGDDE VMSSTLQQFSKVIDELSSCH AVLSTQLADAMMFPITQFKE RDLKEILTLKEVFQIASNDH D AAINRYSRL SKKRENDKV KYEVTEDVYTSRKKQHQTM MHYFCALNTLQYI<I<I<IALL EPLLGYMQAQISFFKMGSEN LNEQLEEFLANIGTSVQNVR REMD SDIETMQQTIEDLEVA

[0605]

[0606] SDPLYVPDPDPTKFPVNRNL TRKAGYLNARNKTGLVSST WDRQFYFTQGGNLMSQAR GD VAGGL AMD IDNC S VMA VDCEDRRYCFQITSFDGKKS SILQAESKKDHEEWICTINNI SKQI YL SENPEET AARVNQ S ALEAVTPSPSFQQRHESLRP AAGQSRPPTARTSSSGSLGS ESTNLAAL SLD SLVAPDTPIQ FDIISPVCEDQPGQAKAFGQ GGRRTNPFGESGGSTKSETE D SILHQLFIVRFLGSMEVK SD DHPDVVYETMRQILAARAIH NIFRMTESHLLVTCDCLKLI DPQTQVTRLTFPLPCVVLYA THQENKRLFGF VLRTS SGRS ESNL S S VCYIFESNNEGEKIC D S VGLAKQ I ALH AELDRR AS EKQKEIERVKEKQQKELNK QKQIEKDLEEQ SRLIAAS SRP NQASSEGQFVVLSSSQSEES DLGEGGKKRESEA

[0607] Human S0RT1 amino acid MERPWGAADGL SRWPHGL sequence GLLLLLQLLPPSTLSQDRLD UniProtKB accession # Q99523 APPPPAAPLPRWSGPIGVSW GLRAAAAGGAFPRGGRWRR SAPGEDEECGRVRDFVAKL ANNTHQHVFDDLRGSVSL S WVGDSTGVILVLTTFHVPLV IMTFGQSKLYRSEDYGKNFK DITDLINNTFIRTEFGMAIGP ENSGKVVLTAEVSGGSRGG RIFRS SDFAKNF VQTDLPFHP LTQMMYSPQNSDYLLALST ENGLWVSKNFGGKWEEIHK AVCLAKWGSDNTIFFTTYA NGSCKADLGALELWRTSDL GKSFKTIGVKIYSFGLGGRFL FASVMADKDTTRRIHVSTD QGDTWSMAQLPSVGQEQFY SILAANDDMVFMHVDEPGD TGFGTIFTSDDRGIVYSKSLD RHLYTTTGGETDFTNVT SLR GVYITSVLSEDNSIQTMITFD QGGRWTHLRKPENSECDAT AKNKNEC SLHIHAS YSISQK LNVPMAPLSEPNAVGIVIAH GSVGDAISVMVPDVYISDDG GYS WTKMLEGPHYYTILD S GGIIVAIEHSSRPINVIKFSTD

[0608]

[0609] EGQCWQTYTFTRDPIYFTGL ASEPGARSMNISIWGFTESFL TSQWVSYTIDFKDILERNCE EKDYTIWLAHSTDPEDYED GCILGYKEQFLRLRKSSVCQ NGRD YVVTKQP SICLC SLED FLCDFGYYRPENDSKCVEQP ELKGHDLEFCLYGREEHLTT NGYRKIPGDKCQGGVNPVR EVKDLKKKCTSNFLSPEKQN SKSNSVPIILAIVGLMLVTVV AGVLIVKKYVCGGRFLVHR YSVLQQHAEANGVDGVDAL DTASHTNKSGYHDDSDEDL LE

[0610] 81 Human SDC1 amino acid MRRAALWLWLC AL AL SLQP sequence ALPQIVATNLPPEDQDGSGD UniProtKB accession # P18827 DSDNFSGSGAGALQDITLSQ QTP STWKDTQLLTAIPT SPEP TGLEATAASTSTLPAGEGPK EGEAWLPEVEPGLTAREQE ATPRPRETTQLPTTHLASTTT ATT AQEP AT SHPHRDMQPG HHETSTPAGPSQADLHTPHT EDGGPSATERAAEDGASSQL PAAEGSGEQDFTFETSGENT AVVAVEPDRRNQ SPVDQGA TGASQGLLDRKEVLGGVIA GGLVGLIFAVCLVGFMLYR MKKKDEGSYSLEEPKQANG

[0611]

[0612] GAYQKPTKQEEFYA EXAMPLES EXAMPLE 1 - ELISA screening of antibodies

[0613] ELISA studies were performed with the anti-APPLl antibody (clone 1E7-2), the anti-SORTl antibody (clone 9E10-2), and the anti-SDCl antibody (clone 10A3-2), to evaluate binding to the immobilized peptide antigens APPL1, SORT1, and SDC1, respectively. A summary of the results are shown in Figures 1-3.

[0614] Immune assay plates were coated with the respective recombinant antigens: human APPL1 -UniProtKB accession # Q9UKG1 (SEQ ID NO: 79), human SORT1 - UniProtKB accession # Q99523 (SEQ ID NO: 80), or human SDC1 - UniProtKB accession # P18827 (SEQ ID NO: 81). Dilution series were generated for each antibody starting at 1 ng / mL and double diluting 9-fold to yield a 10-concentration series from 1 ng / mL to 1.95 pg / mL (i.e., 1:1 to 1:512 dilution).

[0615] The appropriate antibody dilutions were added to their respective wells in the recombinant antigen-coated ELISA plates.

[0616] Visualisation and absorbance was carried out by the addition of HRP-conjugated anti-mouse secondary reagent at the appropriate concentration followed by washing and addition of H2O2 substrate and visualising colour reagent. Absorbance readings were established spectrophotometrically (plate reader) at the appropriate wavelength.

[0617] The EC50 of the anti-APPLl antibody (clone 1E7-2) was ~20 ng / mL. The EC50 of the anti-SORTl antibody (clone 9E10-2) was ~80 ng / mL. The EC50 of the anti-SDCl antibody (clone 10A3-2) was ~25 ng / mL.

[0618] EXAMPLE 2 - APPL1, SORT1 and SDC1 staining using antibodies

[0619] The anti-APPLl antibody (clone 1E7-2), the anti-SORTl antibody (clone 9E10-2), and the anti-SDCl antibody (clone 10A3-2), were used to identify the staining distribution of APPL1, SORT1, and SDC1, respectively, by IHC in FFPE tissues from benign prostate gland, pre-prostate cancer conditions, and various manifestations of prostate cancer at various grades. A summary of the results are shown in Figure 4. The staining patterns of APPL1, SORT1 and SDC1 can be used to discriminate between low- and high-grade prostate cancer tissue. A summary of the results are shown in Figure 5.

[0620] The following IHC protocol was followed:

[0621] (a) Preparation of histology sample:

[0622] Block preparation

[0623] Paraffin wax embedded blocks were sectioned at 2 pm, floated (Reverse osmosis purified water at 42°C) onto coated Super frost Plus slides and air dried. Sections were then baked at 60°C for 1 hour and stored at 4°C. Serial sections were cut for all analysis with the first stained with routine H&E (outlined below) and the last section used as a negative control.

[0624] Sections were cut on a Microtome HM325 or the Leica HistoCore AUTOCUT microtome. (b) Hematoxylin and eosin (H&E) staining:

[0625] Reagents

[0626] • Ehrlich’s Haematoxylin

[0627] • Eosin Solution:

[0628] o 95% ethanol

[0629] o 1% aqueous eosin Y (E4009, Sigma-Aldrich)

[0630] o 1% phloxine (P2759, Sigma-Aldrich)

[0631] o Glacial acetic acid (0.05% (v / v)

[0632] • Acid Alcohol:

[0633] o 1% hydrochloric acid (30% stock) in 70% ethanol

[0634] • Ammonia water:

[0635] o 0.04% aqueous ammonia

[0636] Protocol

[0637] H&E sections were stained using an automated ST5010 Leica Autostainer XL as outlined in the table below. Sections were then cover slipped using coverslips with a thickness number of 1.5 ( 170 pm). _

[0638] Step Reagent Time

[0639] 1 Oven 10 minutes

[0640]

[0641] 2 Xylene 2 minutes

[0642] 3 Xylene 2 minutes

[0643] 4 100% ethanol 2 minutes

[0644] 5 100% ethanol 2 minutes

[0645] 6 90% ethanol 1 minutes

[0646] 7 Wash 1 2 minutes

[0647] 8 Hematoxylin 25 minutes

[0648] 9 Wash 2 2 minutes

[0649] 10 1% HC1 in 70% Ethanol 1 second

[0650] 11 Wash 3 3 minutes

[0651] 12 Ammonia water 2 minutes

[0652] 13 Wash 4 2 minutes

[0653] 14 RO water 1 minute

[0654] 15 Eosin 4 minutes

[0655] 16 Wash 5 2 minutes

[0656] 17 90% ethanol 1 minute

[0657] 18 100% ethanol 2 minutes

[0658] 19 100% ethanol 2 minutes

[0659] 20 Xylene 2 minutes

[0660] 21 Xylene 2 minutes

[0661] 22 Xylene

[0662] 23 Coverslip

[0663]

[0664] (c) Immunohistochemistry protocol:

[0665] Immerse sections in clean xylene for 5 minutes. Drain excess xylene and immerse sections in 100% ethanol. Agitate sections then check for remaining wax (white). Immerse sections for 1 minute; drain and place in 90% ethanol for an additional 1 minute. Immerse in running tap water for 2 minutes. If wax or ethanol is remaining, a streaming artefact will be observed. Antigen retrieval / Heat Induced Epitope Retrieval (HIER)

[0666] Immerse sections in citrate buffer pH 6 or TRIS EDTA pH 9. Ensure the last section in the rack is facing the others to avoid damaging the section during heating. Include another 250 mL of water to act as a heat sink if only using one. Heat on high for 4 minutes until boiling and continue on medium low for 15 minutes. Remove entire container and place in a cool water bath for 30 minutes. Wash sections in lx TBS for 5 minutes.

[0667] Quench endogenous peroxidase using freshly prepared 3% H2O2 in TBS for 5 minutes. Wash sections in lx TBS for 2 minutes. Apply DAKO Pap pen around sections. Do not allow sections to dry out.

[0668] Apply primary antibody (i.e., the anti-APPLl antibody (clone 1E7-2), anti-SORTl antibody (clone 9E10-2) or the anti-SDCl antibody (clone 10A3-2), to the sections. Ensure the solution reaches all the way to the pap pen to prevent drying. Incubate sections in a moist humid chamber for 1 hour at room temperature. If necessary, cover with parafilm.

[0669] Wash sections 3x in IxTBS for 2 minutes each.

[0670] Apply HRP-conjugated anti-mouse secondary reagent to the sections. Ensure the solution reaches all the way to the pap pen to prevent drying. Incubate sections in a moist humid chamber for 30 minutes at room temperature. If necessary, cover with parafilm.

[0671] Wash sections 3x in lx TBS for 2 minutes each.

[0672] Make DAB solution

[0673] 1 drop of DAB reagent in 1 mL of substrate solution during last 2-minute wash. Apply this DAB solution for exactly 10 minutes to the sections at room temperature. Immediately wash sections with distilled H2O. Continue washing with distilled H2O for 2 minutes.

[0674] Counter stain nuclei in Ehrlich’s Haematoxylin for 1 minute. After counter staining, immediately immerse sections in running RO H2O until the purple runs clear.

[0675] Differentiate the Haematoxylin staining with 1% Acid in 70% Alcohol. Immerse sections in the acid alcohol for 1-2 seconds and immediately wash in running RO H2O.

[0676] “Blue” in 0.04% Ammonia H2O for 1 minute. Following, wash in water.

[0677] Dehydrate in a graded series of ethanol concentrations, clear in xylene and mount in DPX Immerse sections in 90% ethanol for 10 seconds and agitate, transfer sections to 100% ethanol for a further 10 seconds. Clear sections for 15 seconds in xylene and mount using 24x50mm cover slips and DPX mountant. Allow to dry either over night at Room temperature or on the solid-state heat plate at 60° C.

[0678] Sections were imaged using a Zeiss Axioscan 7 in brightfield with a 10x, 20* and 40x objective.

Claims

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:

1. An antibody that is capable of specifically binding to Adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 (APPL1), or an antigen-binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 1; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 2; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 3; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 4; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 5; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 6, wherein the CDR sequences are according to Kabat numbering.

2. The antibody, or antigen-binding fragment thereof, of claim 1, wherein the VH comprises an amino acid sequence of SEQ ID NO: 19, or an amino acid sequence that has at least 80% sequence identity thereto.

3. The antibody, or antigen-binding fragment thereof, of claim 2, wherein the VH comprises an amino acid sequence of SEQ ID NO: 19.

4. The antibody, or antigen-binding fragment thereof, of any one of claims 1-3, wherein the antibody comprises a heavy chain constant region (CH), wherein the CH comprises an amino acid sequence of SEQ ID NO: 20, or an amino acid sequence that has at least 80% sequence identity thereto.

5. The antibody, or antigen-binding fragment thereof, of claim 4, wherein the CH comprises an amino acid sequence of SEQ ID NO: 20.

6. The antibody, or antigen-binding fragment thereof, of any one of claims 1-5, wherein the antibody comprises a heavy chain, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 21, or an amino acid sequence that has at least 80% sequence identity thereto.

7. The antibody, or antigen-binding fragment thereof, of claim 6, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 21.

8. The antibody, or antigen-binding fragment thereof, of any one of claims 1-7, wherein the VL comprises an amino acid sequence of SEQ ID NO: 22, or an amino acid sequence that has at least 80% sequence identity thereto.

9. The antibody, or antigen-binding fragment thereof, of claim 8, wherein the VL comprises an amino acid sequence of SEQ ID NO: 22.

10. The antibody, or antigen-binding fragment thereof, of any one of claims 1-9, whereinthe antibody comprises a light chain constant region (CL), wherein the CL comprises an amino acid sequence of SEQ ID NO: 23, or an amino acid sequence that has at least 80% sequence identity thereto.

11. The antibody, or antigen-binding fragment thereof, of claim 10, wherein the CL comprises an amino acid sequence of SEQ ID NO: 23.

12. The antibody, or antigen-binding fragment thereof, of any one of claims 1-11, wherein the antibody comprises a light chain, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 24, or an amino acid sequence that has at least 80% sequence identity thereto.

13. The antibody, or antigen-binding fragment thereof, of claim 12, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 24.

14. The antibody, or antigen-binding fragment thereof, of any one of claims 6-13, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 25, or a nucleotide sequence that has at least 80% sequence identity thereto.

15. The antibody, or antigen-binding fragment thereof, of claim 14, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 25.

16. The antibody, or antigen-binding fragment thereof, of any one of claims 12-15, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 26, or a nucleotide sequence that has at least 80% sequence identity thereto.

17. The antibody, or antigen-binding fragment thereof, of claim 16, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 26.

18. An antibody that is capable of specifically binding to Sortilin-1 (SORT1), or an antigenbinding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 27; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 28; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 29; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 30; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 31; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 32, wherein the CDR sequences are according to Kabat numbering.

19. The antibody, or antigen-binding fragment thereof, of claim 18, wherein the VH comprises an amino acid sequence of SEQ ID NO: 45, or an amino acid sequence that has at least 80% sequence identity thereto.

20. The antibody, or antigen-binding fragment thereof, of claim 19, wherein the VHcomprises an amino acid sequence of SEQ ID NO: 45.

21. The antibody, or antigen-binding fragment thereof, of any one of claims 18-20, wherein the antibody comprises a heavy chain constant region (CH), wherein the CH comprises an amino acid sequence of SEQ ID NO: 46, or an amino acid sequence that has at least 80% sequence identity thereto.

22. The antibody, or antigen-binding fragment thereof, of claim 21, wherein the CH comprises an amino acid sequence of SEQ ID NO: 46.

23. The antibody, or antigen-binding fragment thereof, of any one of claims 18-22, wherein the antibody comprises a heavy chain, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 47, or an amino acid sequence that has at least 80% sequence identity thereto.

24. The antibody, or antigen-binding fragment thereof, of claim 23, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 47.

25. The antibody, or antigen-binding fragment thereof, of any one of claims 18-24, wherein the VL comprises an amino acid sequence of SEQ ID NO: 48, or an amino acid sequence that has at least 80% sequence identity thereto.

26. The antibody, or antigen-binding fragment thereof, of claim 25, wherein the VL comprises an amino acid sequence of SEQ ID NO: 48.

27. The antibody, or antigen-binding fragment thereof, of any one of claims 18-26, wherein the antibody comprises a light chain constant region (CL), wherein the CL comprises an amino acid sequence of SEQ ID NO: 49, or an amino acid sequence that has at least 80% sequence identity thereto.

28. The antibody, or antigen-binding fragment thereof, of claim 27, wherein the CL comprises an amino acid sequence of SEQ ID NO: 49.

29. The antibody, or antigen-binding fragment thereof, of any one of claims 18-28, wherein the antibody comprises a light chain, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 50, or an amino acid sequence that has at least 80% sequence identity thereto.

30. The antibody, or antigen-binding fragment thereof, of claim 29, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 50.

31. The antibody, or antigen-binding fragment thereof, of any one of claims 23-30, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 51, or a nucleotide sequence that has at least 80% sequence identity thereto.

32. The antibody, or antigen-binding fragment thereof, of claim 31, wherein the heavychain is encoded by the nucleotide sequence of SEQ ID NO: 51.

33. The antibody, or antigen-binding fragment thereof, of any one of claims 29-32, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 52 or a nucleotide sequence that has at least 80% sequence identity thereto.

34. The antibody, or antigen-binding fragment thereof, of claim 33, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 52.

35. An antibody that is capable of specifically binding to Syndecan-1 (SDC1), or an antigen-binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VH) comprising three heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3 and a light chain variable region (VL) comprising three light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises an amino acid sequence of SEQ ID NO: 53; the HCDR2 comprises an amino acid sequence of SEQ ID NO: 54; and the HCDR3 comprises an amino acid sequence of SEQ ID NO: 55; and the LCDR1 comprises an amino acid sequence of SEQ ID NO: 56; the LCDR2 comprises an amino acid sequence of SEQ ID NO: 57; and the LCDR3 comprises an amino acid sequence of SEQ ID NO: 58, wherein the CDR sequences are according to Kabat numbering.

36. The antibody, or antigen-binding fragment thereof, of claim 35, wherein the VH comprises an amino acid sequence of SEQ ID NO: 71, or an amino acid sequence that has at least 80% sequence identity thereto.

37. The antibody, or antigen-binding fragment thereof, of claim 36, wherein the VH comprises an amino acid sequence of SEQ ID NO: 71.

38. The antibody, or antigen-binding fragment thereof, of any one of claims 35-37, wherein the antibody comprises a heavy chain constant region (CH), wherein the CH comprises an amino acid sequence of SEQ ID NO: 72, or an amino acid sequence that has at least 80% sequence identity thereto.

39. The antibody, or antigen-binding fragment thereof, of claim 38, wherein the CH comprises an amino acid sequence of SEQ ID NO: 72.

40. The antibody, or antigen-binding fragment thereof, of any one of claims 35-39, wherein the antibody comprises a heavy chain, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 73, or an amino acid sequence that has at least 80% sequence identity thereto.

41. The antibody, or antigen-binding fragment thereof, of claim 40, wherein the heavy chain comprises an amino acid sequence of SEQ ID NO: 73.

42. The antibody, or antigen-binding fragment thereof, of any one of claims 35-41, wherein the VL comprises an amino acid sequence of SEQ ID NO: 74, or an amino acidsequence that has at least 80% sequence identity thereto.

43. The antibody, or antigen-binding fragment thereof, of claim 42, wherein the VL comprises an amino acid sequence of SEQ ID NO: 74.

44. The antibody, or antigen-binding fragment thereof, of any one of claims 35-43, wherein the antibody comprises a light chain constant region (CL), wherein the CL comprises an amino acid sequence of SEQ ID NO: 75, or an amino acid sequence that has at least 80% sequence identity thereto.

45. The antibody, or antigen-binding fragment thereof, of claim 44, wherein the CL comprises an amino acid sequence of SEQ ID NO: 75.

46. The antibody, or antigen-binding fragment thereof, of any one of claims 35-45, wherein the antibody comprises a light chain, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 76, or an amino acid sequence that has at least 80% sequence identity thereto.

47. The antibody, or antigen-binding fragment thereof, of claim 46, wherein the light chain comprises an amino acid sequence of SEQ ID NO: 76.

48. The antibody, or antigen-binding fragment thereof, of any one of claims 40-47, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 77, or a nucleotide sequence that has at least 80% sequence identity thereto.

49. The antibody, or antigen-binding fragment thereof, of claim 48, wherein the heavy chain is encoded by the nucleotide sequence of SEQ ID NO: 77.

50. The antibody, or antigen-binding fragment thereof, of any one of claims 46-49, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 78, or a nucleotide sequence that has at least 80% sequence identity thereto.

51. The antibody, or antigen-binding fragment thereof, of claim 50, wherein the light chain is encoded by the nucleotide sequence of SEQ ID NO: 78.

52. A composition comprising one or more or all of:a) the antibody, or antigen-binding fragment thereof, of any one of claims 1-17; b) the antibody, or antigen-binding fragment thereof, of any one of claims 18-34; and c) the antibody, or anti gen -binding fragment thereof, of any one of claims 35-51.

53. A kit comprising one or more or all of:a) the antibody, or antigen-binding fragment thereof, of any one of claims 1-17; b) the antibody, or antigen-binding fragment thereof, of any one of claims 18-34; and c) the antibody, or antigen -binding fragment thereof, of any one of claims 35-51.

54. Use of the antibody, or antigen-binding fragment thereof, of any one of claims 1-51, thecomposition of claim 52, or the kit of claim 53 to detect at least one of APPL1, SORT1 and SDC1 in a biological sample.

55. The antibody, or antigen-binding fragment thereof, of any one of claims 1-51, the composition of claim 52, or the kit of claim 53 for use in detecting at least one of APPL1, SORT1 and SDC1 in a biological sample.

56. The use of claim 54, or the antibody, or antigen-binding fragment thereof, the composition, or the kit for use of claim 55, wherein the at least one of APPL1, SORT1 and SDC1 are detected by immunohistochemistry (H4C) or immunofluorescence (IF).

57. A method of determining the presence prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 1-17; (ii) SORT1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 18-34; and (iii) SDC1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 35-51, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the presence of prostate cancer.

58. A method of determining the presence and severity of a prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 1-17; (ii) SORT1 is detected with the antibody, or antigenbinding fragment thereof, of any one of claims 18-34; and (iii) SDC1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 35-51, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the presence and severity of prostate cancer.

59. A method of monitoring the progression of a prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 1-17; (ii) SORT1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 18-34; and (iii) SDC1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 35-51, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the progression of prostate cancer.

60. A method of determining the likelihood of the presence of a prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the antibody, or antigen-bindingfragment thereof, of any one of claims 1-17; (ii) SORT1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 18-34; and (iii) SDC1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 35-51, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the likelihood of the presence of a prostate cancer.

61. A method of identifying a subject suffering from prostate cancer who is likely to be responsive to a cancer therapy, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 1-17; (ii) SORT1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 18-34; and (iii) SDC1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 35-51, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative of the likelihood of the subject suffering prostate cancer being responsive to a cancer therapy.

62. A method of predicting the risk of recurrence of prostate cancer in a subject following treatment with a cancer therapy, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 1-17; (ii) SORT1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 18-34; and (iii) SDC1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 35-51, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is predictive of the risk of recurrence of prostate cancer.

63. A method of treating prostate cancer in a subject, the method comprising detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 1- 17; (ii) SORT1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 18-34; and (iii) SDC1 with the antibody, or antigen-binding fragment thereof, of any one of claims 35-51, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative that the subject has prostate cancer, wherein where the subject is identified as having prostate cancer, treating the subject with a cancer therapy.

64. A method of stratifying a subject for treatment with a prostate cancer therapy, the method comprising:a) detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the antibody, or antigen-binding fragment thereof, of anyone of claims 1-17; (ii) S0RT1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 18-34; and (iii) SDC1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 35-51,b) comparing the one or more of the altered presence, level, secretion and distribution as detected in step a) to a reference; andc) based on the comparison in step b), stratifying the subject for treatment with a prostate cancer therapy.

65. A method for treating prostate cancer in a subject, the method comprising:a) detecting the presence or likelihood of prostate cancer in the subject according to the method of any one of claims 57, 58 and 60, andb) where the presence or likelihood of the presence of prostate cancer has been determined in the subject, treating the subject with a cancer therapy.

66. Use of an anti-cancer agent in the manufacture of a medicament for the treatment of prostate cancer, wherein the medicament is to be administered to a subject identified as having prostate cancer by detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 1-17; (ii) SORT1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 18-34; and (iii) SDC1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 35-51, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative that a subject has prostate cancer.

67. Use of an anti-cancer agent in the manufacture of a medicament for the treatment of prostate cancer, wherein the medicament is to be administered to a subject in need thereof, wherein the presence or likelihood of the presence of prostate cancer has been determined in the subject according to the method of any one of claims 57, 58 and 60.

68. An anti-cancer agent for use in the treatment of prostate cancer in a subject, wherein the treatment comprises identifying the subject as having prostate cancer by detecting in a biological sample from the subject one or more of an altered presence, level, secretion and distribution of at least one of APPL1, SORT1 and SDC1, wherein (i) APPL1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 1- 17; (ii) SORT1 is detected with the antibody, or antigen-binding fragment thereof, of any one of claims 18-34; and (iii) SDC1 is detected with the antibody, or antigenbinding fragment thereof, of any one of claims 35-51, wherein the altered presence, level, secretion or distribution of at least one of APPL1, SORT1 and SDC1 when compared to a reference is indicative that the subject has prostate cancer.

69. An anti-cancer agent for use in the treatment of prostate cancer in a subject, wherein the treatment comprises:a) determining the presence or likelihood of the presence of prostate cancer in the subject according to the method of any one of claims 57, 58 and 60, andb) where the presence or likelihood of the presence of prostate cancer has been determined in the subject, treating the subject with the anti-cancer agent.

70. The method of any one of claims 57-65, the use of claim 66 or claim 67, or the anticancer agent for use of claim 68 or claim 69, wherein the at least one of APPL1, SORT1 and SDC1 are detected in by immunohistochemistry (IHC) or immunofluorescence (IF).

Images