Double-stranded RNA for regulating ALK7 expression, conjugate thereof, pharmaceutical composition thereof, and use thereof
By developing double-stranded RNA and its conjugates that regulate ALK7 expression and target adipose tissue, the problems of muscle loss and poor tolerance of existing weight-loss drugs have been solved, achieving safe and effective treatment for obesity and diabetes.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SUZHOU SIRAN BIOTECHNOLOGY CO LTD
- Filing Date
- 2025-11-10
- Publication Date
- 2026-05-15
AI Technical Summary
Existing weight-loss drugs, such as GLP-1R agonists, have problems such as muscle loss, poor tolerance, and weight rebound during the weight loss process, and there is a lack of safe and effective drugs for treating obesity and diabetes.
Develop a double-stranded RNA and its conjugates that regulate ALK7 expression, and through targeted delivery to adipose tissue, inhibit ALK7 expression, regulate adipocyte function, reduce obesity, and improve diabetes-related symptoms.
It has achieved safe and effective reduction of obesity, improved glucose tolerance and insulin resistance, avoided muscle atrophy and weight rebound, and provided a potential treatment option for obesity and diabetes.
Smart Images

Figure CN2025133818_15052026_PF_FP_ABST
Abstract
Description
A double-stranded RNA that regulates ALK7 expression, its conjugates, pharmaceutical compositions, and their uses. Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to a double-stranded RNA that regulates ALK7 expression, its conjugates, pharmaceutical compositions, and uses. Background Technology
[0002] Obesity is a chronic, complex disease defined by the excessive deposition of fat that can lead to health problems. Obesity increases the risk of type 2 diabetes and heart disease, affects bone health and the reproductive system, and increases the risk of certain cancers. Obesity impacts quality of life, such as sleep and activity levels. The obesity epidemic has become a serious health problem threatening global and national public health. According to a recent research report published in *The Lancet*... 1 In 2022, the global obese population exceeded one billion. Since 1990, the number of obese adults worldwide has more than doubled, and the number of obese children and adolescents (aged 5 to 19) has tripled. Data also shows that in 2022, 43% of adults were overweight. In March 2023, the 2023 World Obesity Atlas, released on the World Obesity Federation's website, predicted that by 2035, more than 4 billion people worldwide will be obese or overweight, accounting for 51% of the global population.
[0003] Obesity is a global health challenge with limited drug treatment options. Internationally approved weight-loss drugs mainly include orlistat, phentermine, phentermine-topiramate, naltrexone-bupropion, liraglutide (3mg), and semaglutide (2.4mg). GLP-1R agonists, such as semaglutide, are currently the most popular weight-loss drugs. However, studies show that these drugs have some problems during weight loss. For example, semaglutide significantly reduces lean body mass, with approximately 40% of weight loss coming from bone and muscle loss. Furthermore, GLP-1R agonists suppress the reward system, resulting in poor tolerability; after one year, 68% of users no longer tolerate them. Most importantly, most patients experience rapid weight regain after discontinuing GLP-1R agonists, leading to long-term drug dependence. Therefore, developing weight-loss drugs with good tolerability, no risk of weight rebound, and no side effects such as muscle atrophy remains crucial.
[0004] ALK-7, also known as ACVR1C, is a type I receptor serine-threonine kinase that mediates inhibitory and stimulatory signals of growth and differentiation by binding to members of the TGF-β superfamily. ALK-7, by binding to specific ligands such as Nodal, activin B, and growth differentiation factor (GDF), can activate signaling pathways such as Smads, thereby regulating the proliferation, differentiation, and apoptosis of various cells.2 According to literature3, in genetically obese mice (TSOD) and high-fat diet-induced obese mouse models, ALK7 mAb treatment significantly reduced obesity and improved glucose tolerance and insulin resistance; furthermore, ALK7 mAb downregulated GDF3 in ATM by inhibiting IL-1β production in S100A8 / A9 cells and downstream adipose tissue macrophages (ATM). 4 Furthermore, studies have found that human genome sequencing results indicate that loss-of-function mutations in the ACVR1C gene can affect body fat distribution and reduce the risk of type 2 diabetes. 5 These findings support the feasibility of using ALK7 as a potential target for treating obesity and diabetes.
[0005] 1.NCD Risk Factor Collaboration(NCD-RisC)(2024).Worldwide trends in underweight and obesity from1990to 2022:a pooled analysis of 3663population-representative studies with 222million children,adolescents,and adults.Lancet(London,England),403(10431),1027-1050.
[0006] 2. Schmierer, B., & Hill, CS (2007). TGFbeta-SMAD signal transduction: molecular specificity and functional flexibility. Nature reviews. Molecular cell biology, 8(12), 970-982.
[0007] 3.ogosawa,S.,&Izumi,T.(2013).Roles of activin receptor-like kinase 7signaling and its target,peroxisome proliferator-activated receptorγ,in lean and obese adipocytes.Adipocyte,2(4),246-250.
[0008] 4. Zhao, M., Okunishi, K., Bu, Y., Kikuchi, O., Wang, H., Kitamura, T., & Izumi, T. (2023). Targeting activin receptor-like kinase 7ameliorates adiposity and associated metabolic disorders. JCI insight, 8(4), e161229.
[0009] 5.Emdin,CA,Khera,AV,Aragam,K.,Haas,M.,Chaffin,M.,Klarin,D.,Natarajan,P.,Bick,A.,Zekavat,SM,Nomura,A.,Ardissino,D.,Wi lson,JG,Schunkert,H.,McPherson,R.,Watkins,H.,Elosua,R.,Bown,MJ,Samani,NJ,Baber,U.,Erdmann,J.,Kathiresan,S.(2019).DNA Sequence Variation in ACVR1C Encoding the Activin Receptor-Like Kinase 7Influences Body Fat Distribution and Protects Against Type 2Diabetes.Diabetes,68(1),226-234. Summary of the Invention
[0010] The purpose of this invention is to provide a double-stranded RNA that regulates ALK7 expression, its conjugates, pharmaceutical compositions, and uses.
[0011] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0012] The first aspect of the present invention provides a double-stranded RNA comprising a sense strand and an antisense strand, wherein each nucleotide in the double-stranded RNA is independently a modified or unmodified nucleotide; the sense strand comprises a nucleotide sequence selected from the nucleotide sequences shown in SEQ ID NO. 1 to 425 or a nucleotide sequence with no more than 3 nucleotide mutations thereof, and the antisense strand comprises a nucleotide sequence selected from the nucleotide sequences shown in SEQ ID NO. 426 to 850 or a nucleotide sequence with no more than 5 nucleotide mutations thereof.
[0013] According to some embodiments, the positive strand comprises a nucleotide sequence with no more than two nucleotide mutations and no more than one nucleotide mutation of any one of the nucleotide sequences shown in SEQ ID NO. 1 to 425. Further, the positive strand comprises the nucleotide sequences shown in SEQ ID NO. 1 to 425.
[0014] According to some implementations, the nucleotide mutation of the positive strand can be at any position in the nucleotide sequence, such as the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, or nineteenth positions, in the 5' to 3' direction.
[0015] According to certain embodiments, the antisense strand comprises a nucleotide sequence with no more than 5 nucleotide mutations, no more than 4 nucleotide mutations, no more than 3 nucleotide mutations, no more than 2 nucleotide mutations, or no more than 1 nucleotide mutation among any one of the nucleotide sequences shown in SEQ ID NO. 426 to 850. Further, the antisense strand comprises the nucleotide sequences shown in SEQ ID NO. 426 to 850.
[0016] According to some implementations, the nucleotide mutation of the antisense strand can be at any position in the nucleotide sequence, such as the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, nineteenth, twentieth, and twenty-first positions, for example, any one, two, three, four, or five of these positions.
[0017] According to some embodiments, the antisense strand comprises 18 to 23 nucleotides, such as 18, 19, 20, 21, 22, or 23 nucleotides. Further, the nucleotide length of the antisense strand is 21 nt.
[0018] According to some embodiments, the positive strand comprises 16 to 21 nucleotides, such as 16, 17, 18, 19, 20, or 21 nucleotides. Further, the nucleotide length of the positive strand is 19 nt.
[0019] According to some embodiments, the sense strand and the antisense strand are at least partially anticomplementary to form a double-stranded structure. Further, the double-stranded structure has no more than 3 base mismatches, no more than 2 base mismatches, and no more than 1 base mismatch. Further, the sense strand and the antisense strand are completely anticomplementary. The partial anticomplementary or complete reactive complementarity does not take into account the prominent bases of the antisense strand.
[0020] According to some embodiments, the 3' of the antisense strand has one, two, or three base protrusions.
[0021] According to certain specific embodiments, the double-stranded RNA is selected from the sequences shown in Table 1.
[0022] According to certain specific embodiments, the double-stranded RNA is selected from:
[0023] (a) The sense strand comprises the nucleotide sequence shown in SEQ ID NO.9 or a nucleotide sequence with no more than 2 nucleotide mutations thereof, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.434 or a nucleotide sequence with no more than 2 nucleotide mutations thereof;
[0024] (b) The sense strand comprises the nucleotide sequence shown in SEQ ID NO.275 or a nucleotide sequence with no more than two nucleotide mutations thereof, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.700 or a nucleotide sequence with no more than two nucleotide mutations thereof;
[0025] (c) The sense strand comprises the nucleotide sequence shown in SEQ ID NO. 283 or a nucleotide sequence with no more than two nucleotide mutations thereof, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO. 708 or a nucleotide sequence with no more than two nucleotide mutations thereof; or
[0026] (d) The sense strand contains the nucleotide sequence shown in SEQ ID NO.299 or a nucleotide sequence with no more than two nucleotide mutations thereof, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.724 or a nucleotide sequence with no more than two nucleotide mutations thereof.
[0027] According to certain specific embodiments, the double-stranded RNA is selected from:
[0028] (a) The sense strand comprises the nucleotide sequence shown in SEQ ID NO.9 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.434 or a nucleotide sequence with no more than one nucleotide mutation therein;
[0029] (b) The sense strand comprises the nucleotide sequence shown in SEQ ID NO.275 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.700 or a nucleotide sequence with no more than one nucleotide mutation therein;
[0030] (c) The sense strand comprises the nucleotide sequence shown in SEQ ID NO. 283 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO. 708 or a nucleotide sequence with no more than one nucleotide mutation therein; or
[0031] (d) The sense strand contains the nucleotide sequence shown in SEQ ID NO.299 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.724 or a nucleotide sequence with no more than one nucleotide mutation therein.
[0032] According to certain specific embodiments, the double-stranded RNA is selected from:
[0033] (a) The sense strand contains the nucleotide sequence shown in SEQ ID NO. 9, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 434;
[0034] (b) The sense strand comprises the nucleotide sequence shown in SEQ ID NO.275, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.700;
[0035] (c) The sense strand comprises the nucleotide sequence shown in SEQ ID NO. 283, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO. 708; or
[0036] (d) The sense strand contains the nucleotide sequence shown in SEQ ID NO.299, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.724.
[0037] According to certain specific implementations, at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen nucleotides in the sense strand or the antisense strand are all modified nucleotides.
[0038] According to certain specific embodiments, at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight phosphate ester groups in the sense chain or the antisense chain are phosphate ester groups with modifying groups. Specifically, the phosphate ester groups with modifying groups are thiophosphate ester groups.
[0039] According to certain specific embodiments, the 5' end base of the positive chain and / or the 3' end base of the positive chain are connected to a reverse debased deoxyribose residue containing a phosphate ester group or a thiophosphate ester group.
[0040] In this application, the positions of bases in the sense strand and / or antisense strand are calculated based on the bases in the sequence, without including reverse desaturated deoxyribose residues.
[0041] According to certain specific embodiments, the modified nucleotide is selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, nucleotide analogs, or any combination of two or more thereof.
[0042] According to certain specific embodiments, the phosphate ester group with the modifying group is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphate diester bond of the phosphate ester group with a sulfur atom.
[0043] According to certain specific embodiments, the modified nucleotide is a 2'-methoxy modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-O-CH2-CH2-O-CH3 modified nucleotide, a 2'-O-CH2-CH=CH2 modified nucleotide, a 2'-CH2-CH2-CH=CH2 modified nucleotide, a 2'-deoxy nucleotide, a 2'-methoxyethyl modified nucleotide, a phosphate thioester bond modified nucleotide, a VP modified nucleotide, LNA, ENA, cET BNA, UNA, GNA, and One or more combinations thereof, wherein R1 is H, OH or CH3, and Base is a natural nucleobase, a modified nucleobase, a universal base or a H atom.
[0044] According to certain specific embodiments, the positive chain contains a 2'-methoxy modified nucleotide, a 2'-fluoro modified nucleotide, and a thiophosphate group.
[0045] According to certain specific embodiments, the antisense strand contains a 2'-methoxy modified nucleotide, a 2'-fluoro modified nucleotide, and a thiophosphate group.
[0046] According to some specific embodiments, the 2'-methoxy modified nucleotide in the positive strand is located at any one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fifteen, or sixteenth position from the first to the sixth, eighth, tenth, twelfth to the last position, in the 5' to 3' direction.
[0047] According to some other specific embodiments, the 2'-methoxy modified nucleotide in the positive strand is located at any one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, or sixteenth position from the first to the sixth, tenth to the last position, in the 5' to 3' direction.
[0048] According to some specific embodiments, the 2'-fluorinated nucleotide in the positive strand is located at any one, two, or three positions among the seventh, ninth, and eleventh positions, in the 5' to 3' direction.
[0049] According to some other specific embodiments, the 2'-fluorinated nucleotide in the positive strand is located at any one, two, or three positions among the seventh, eighth, and ninth positions, in the 5' to 3' direction.
[0050] According to some more specific embodiments, in the direction from 5' to 3', the 2'-methoxy modified nucleotides in the positive strand are located at the first to sixth, eighth, tenth, twelfth to last positions, and the 2'-fluorinated modified nucleotides in the positive strand are located at the seventh, ninth and eleventh positions.
[0051] According to some other, more specific embodiments, in the direction of 5' to 3', the 2'-methoxy modified nucleotides in the positive strand are located at the first to sixth positions and the tenth to last positions, and the 2'-fluorinated modified nucleotides in the positive strand are located at the seventh, eighth, and ninth positions.
[0052] According to certain specific embodiments, in the direction from 5' to 3', at least one, at least two, at least three, or at least four of the following nucleotides in the positive strand are linked by thiophosphate groups: the first and second nucleotides, the second and third nucleotides, the last and last second nucleotides, and the last second and last third nucleotides.
[0053] In other embodiments, when the bases at the 5' end of the positive chain and / or the bases at the 3' end of the positive chain are connected to a reverse debased deoxyribose residue containing a thiophosphate group, the bases of the positive chain are connected by a phosphate group.
[0054] According to some specific embodiments, in the direction from 5' to 3', any one, two, three or four nucleotides at the second, sixth, fourteenth or sixteenth position of the antisense strand are 2'-fluorinated nucleotides.
[0055] According to some other specific embodiments, in the direction from 5' to 3', any one, two, or three nucleotides at the second, fourteenth, and sixteenth positions of the antisense strand are 2'-fluorinated nucleotides.
[0056] According to certain specific embodiments, in the direction from 5' to 3', any one, two, three, four, five, six, or seven nucleotides at positions 2, 3, 4, 5, 6, 7, and 8 of the antisense strand are... (These four structural formulas are anti-off-target modified nucleotides).
[0057] According to some further embodiments, in the direction from 5' to 3', any one, two, or three nucleotides at positions 6, 7, and 8 of the antisense strand are the aforementioned off-target modified nucleotides.
[0058] According to certain specific embodiments, in the direction from 5' to 3', any one or more nucleotides at positions other than those mentioned above in the antisense strand are nucleotides modified with 2'-methoxy groups.
[0059] According to some further embodiments, the 2'-methoxy modified nucleotide in the antisense strand is located at any one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fifteen, seventeen to the last position, in the 5' to 3' direction.
[0060] According to some further embodiments, the 2'-methoxy modified nucleotide in the antisense strand is located at any one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, or eighteenth position in the first, third to thirteenth, fifteenth, seventeenth to last position, in the 5' to 3' direction.
[0061] According to some further embodiments, in the direction of 5' to 3', the 2'-methoxy modified nucleotides in the antisense strand are located at the first, third to fifth, seventh to thirteenth, fifteenth, seventeenth to last positions, and the 2'-fluorinated modification is located at the second, sixth, fourteenth, and sixteenth positions of the antisense strand.
[0062] According to some further embodiments, in the 5' to 3' direction, the first, third to fifth, ninth to thirteenth, fifteenth, seventeenth to last nucleotides of the antisense strand are 2'-methoxy modified nucleotides, and the second, fourteenth, and sixteenth positions of the antisense strand are 2'-fluorinated modified nucleotides; any one of the sixth to eighth positions of the antisense strand is the aforementioned off-target modified nucleotide, and the remaining two positions are 2'-methoxy modified nucleotides.
[0063] According to certain specific embodiments, in the direction from 5' to 3', at least one, at least two, at least three, or at least four of the following nucleotides in the antisense strand are linked by phosphate thioester groups: the first and second nucleotides, the second and third nucleotides, the last and last second nucleotides, and the last second and last third nucleotides.
[0064] According to certain specific embodiments, the first nucleotide of the antisense strand contains a VP modification.
[0065] According to certain specific embodiments, the double-stranded RNA is selected from the sequences shown in Table 2.
[0066] According to certain specific embodiments, the double-stranded RNA is selected from:
[0067] (a) The justice chain contains UmsUmsGmUmGmUmGfAfUfUmCmUmUmCmAmAmAmCmUm, and the antisense chain
[0068] Includes AmsGfsUmUmUmGfAmAmGmAmAmUmCmAfCmAfCmAmAmsAmsAm;
[0069] (b) The justice chain contains UmsAmsUmUmAmAmGfAfAfGmAmCmUmAmUmAmUmCmUm; the antisense chain contains AmsGfsAmUmAmUfAmGmUmCmUmUmCmUmUmAfAmUmAmsCmsGm.
[0070] (c) The justice chain contains AmsUmsAmUmCmUmCfAfAfCmUmUmUmGmUmGmUmCmAm, and the antisense chain contains UmsGfsAmCmAmCfAmAmAmGmUmUmGmAfGmAfUmAmUmsAmsGm; or
[0071] (d) The justice chain contains UmsAmsAmUmGmAmUfGfAfUmAmAmUmUmAmUmGmUmUm, and the antisense chain contains AmsAfsCmAmUmAfAmUmUmAmUmCmAmUfCmAfUmUmAmsGmsGm.
[0072] In this application, the double-stranded RNA can regulate the expression of ALK7, and further, the double-stranded RNA can inhibit the expression of ALK7.
[0073] A second aspect of the present invention provides a double-stranded RNA conjugate comprising the above-described double-stranded RNA and a conjugating group conjugated to any position of the double-stranded RNA.
[0074] According to certain specific embodiments, the structural formula of the conjugated group is shown in general formula (Ⅰ): Formula (Ⅰ); wherein: B is a natural nucleobase, a modified nucleobase, a universal base, or a H atom; R1 and R2 are independently selected from H, OH, halogen, NH2, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, S-CH3, NCH3(CH3) or OCH2CH2OCH3; m and n are independently selected from 1, 2 or 3;
[0075] Z is absent or selected from one of the groups shown in formulas (Z1)-(Z4):
[0076] R4 is selected from H, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl and C2-C6 alkynyl;
[0077] X either does not exist or is selected from one or more linkage combinations of groups shown in formulas (A1)-(A12) below:
[0078] R3 is selected from H, halogen, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl and C2-C6 alkynyl;
[0079] j is an integer between 1 and 10; k is a number between 1, 2, 3, or 4.
[0080] Y is selected from one of the groups shown in formulas (Y1)-(Y10):
[0081] Where p is selected from integers between 5 and 25; This indicates the site where a group is covalently bonded.
[0082] Furthermore, both R1 and R2 are H.
[0083] Furthermore, both m and n are 1.
[0084] Furthermore, Z is absent, or is a group as shown in formula (Z3), where R4 is H. Even further, Z is absent.
[0085] Furthermore, X is absent, is a combination of the group shown in formula (A6) and the group shown in formula (7), is a group shown in formula (A6), is a combination of the group shown in formula (A2) and the group shown in formula (A6), or is a group shown in formula (A12), where j is 1 and R3 is H. Even further, X is absent. Even further, X is a combination of a group shown in formula (A6) and a group shown in formula (7), is a group shown in formula (A6), is a combination of a group shown in formula (A2) and a group shown in formula (A6), or is a group shown in formula (A12), where j is 1 and R3 is H.
[0086] Further, Y is a group represented by formula (Y1), formula (Y6), formula (Y7), formula (Y8), or formula (Y10). Even further, Y is a group represented by formula (Y1), and p is an integer selected from 5 to 18. Even further, Y is a group represented by formula (Y1), and p is 13, 14, 15, 16, 17, or 18.
[0087] According to some more specific embodiments, the group represented by general formula (Ⅰ) is selected from the following structures:
[0088] Where B is a base A, T, C, G or U.
[0089] Furthermore, B can be a base at any position in the double-stranded RNA.
[0090] According to some specific embodiments, the two linking sites of the group shown in general formula (I) are linked to adjacent nucleotides in the double-stranded RNA via phosphodiester bonds or thiophosphate diester bonds.
[0091] According to some specific embodiments, the group represented by general formula (I) is located at any position of the positive chain, for example, the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, or nineteenth positions starting from the 5' end. Further, the group represented by general formula (I) is located at any one or more positions from the 1st, 4th to the 8th positions starting from the 5' end of the positive chain. Even further, the group represented by general formula (I) is located at any one or more positions from the 5th, 6th, and 7th positions starting from the 5' end of the positive chain.
[0092] According to some specific embodiments, the conjugating group includes a group conjugated to the 5' end and / or 3' end of the double-stranded RNA. When the conjugate group is attached to the 5' end of a double-stranded RNA, it is called SA191. When the conjugate group is attached to the 3' end of a double-stranded RNA, it is called SA192.
[0093] Furthermore, the conjugating group is derived from the precursor compound.
[0094] Furthermore, the structural formula of the siRNA conjugate is as follows: (SA191-siRNA) or (siRNA-SA192), where Y is O or S.
[0095] Furthermore, This represents the positive strand of the siRNA.
[0096] Furthermore, the conjugation group comprises a conjugation group with a structural formula as shown in general formula (Ⅰ) and a conjugation group derived from the compound SA192.
[0097] Furthermore, the conjugating group includes conjugating groups with a structural formula as shown in general formula (I) at any one or more of the 5th, 6th, and 7th positions from the 5' end on the positive strand of the double-stranded RNA, and conjugating groups at the 5' end and / or 3' end of the double-stranded RNA.
[0098] Furthermore, the conjugating group includes SA196 conjugated at any one or more of positions 5, 6, and 7 from the 5' end of the positive strand of the double-stranded RNA, and conjugated at the 5' end and / or 3' end of the double-stranded RNA. The structural formula of the conjugated group shown in SA196 is as follows:
[0099] According to some specific embodiments, the double-stranded RNA conjugates are shown in Table 4.
[0100] According to some specific embodiments, the double-stranded RNA conjugate is selected from:
[0101] (a) The justice chain contains UmsUmsGmUmGmU-SA196GfAfUfUmCmUmUmCmAmAmAmsCmsUmSA192, and the antisense chain contains VPAmsGfsUmUmUmGfAmAmGmAmAmUmCmAfCmAfCmAfCmAmAmsAmsAm;
[0102] (b) The justice chain contains SA191UmsUmsGmUmGmU-SA196GfAfUfUmCmUmUmCmAmAmAmsCmsUm, and the antisense chain contains VPAmsGfsUmUmUmGfAmAmGmAmAmUmCmAfCmAfCmAfCmAmAmsAmsAmsAm;
[0103] (c) The justice chain contains UmsAmsUmUmAmA-SA196GfAfAfGmAmCmUmAmUmAmUmsCmsUmSA192, and the antisense chain contains VPAmsGfsAmUmAmUfAmGmUmCmUmUmCmUmUmCmUfUmAfAmUmAmsCmsGm;
[0104] (d) The justice chain contains SA191UmsAmsUmUmAmA-SA196GfAfAfGmAmCmUmAmUmAmUmsCmsUm, and the antisense chain contains VPAmsGfsAmUmAmUfAmGmUmCmUmUmCmUmUmCmUfUmAfAmUmAmsCmsGm;
[0105] (e) The justice chain contains AmsUmsAmUmCmU-SA196CfAfAfCmUmUmUmGmUmGmUmsCmsAmSA192, and the antisense chain contains VPUmsGfsAmCmAmCfAmAmAmGmUmUmGmAfGmAfUmAmUmsAmsGm;
[0106] (f) The justice chain contains SA191AmsUmsAmUmCmU-SA196CfAfAfCmUmUmUmGmUmGmUmsCmsAm; the antisense chain contains VPUmsGfsAmCmAmCfAmAmAmGmUmUmGmAfGmAfUmAmUmsAmsGm; or
[0107] (g) The justice chain contains UmsAmsAmUmGmA-SA196UfGfAfUmAmAmUmUmAmUmGmsUmsUmSA192, and the antisense chain contains VPAmsAfsCmAmUmAfAmUmUmAmUmCmAmUfCmAfUmUmAmsGmsGm.
[0108] A third aspect of the present invention provides a pharmaceutical composition comprising the above-described double-stranded RNA or the above-described double-stranded RNA conjugate, and a pharmaceutically acceptable carrier or excipient.
[0109] According to certain specific embodiments, the pharmaceutical composition is used to regulate ALK7 expression. Further, the pharmaceutical composition is used to inhibit ALK7 expression.
[0110] The present invention also provides the use of the above-mentioned double-stranded RNA, the above-mentioned double-stranded RNA conjugate, and the above-mentioned pharmaceutical composition in the preparation of medicaments for treating and / or preventing ALK7 expression-related diseases and / or symptoms.
[0111] The ALK7 expression-related diseases and / or conditions are selected from metabolic syndrome, type II diabetes, prediabetes, lipid metabolism disorders, hypertension, cardiovascular disease, and weight imbalance.
[0112] The present invention also provides the use of the above-mentioned double-stranded RNA, the above-mentioned double-stranded RNA conjugate, and the above-mentioned pharmaceutical composition in the preparation of medicaments for treating and / or preventing obesity.
[0113] The present invention also provides a method for treating and / or preventing ALK7 expression-related diseases and / or conditions in a subject, comprising administering to the subject an effective amount of the double-stranded RNA as described above, the double-stranded RNA conjugate as described above, and / or the pharmaceutical composition as described above.
[0114] Furthermore, the ALK7 expression-related diseases and / or conditions are selected from metabolic syndrome, type II diabetes, prediabetes, lipid metabolism disorders, hypertension, cardiovascular disease, and weight imbalance.
[0115] Furthermore, the ALK7 expression is associated with obesity as a disease and / or condition.
[0116] Furthermore, the subject is a mammal, furthermore, the subject is a primate, and furthermore, the subject is a human.
[0117] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art:
[0118] The double-stranded RNA that regulates ALK7 expression, its conjugates, and pharmaceutical compositions disclosed in this invention can target ACVR1C and can be delivered to adipose tissue using small nucleic acid delivery technology, which is expected to provide a safer and more effective treatment option for patients with weight loss needs and diabetes. Attached Figure Description
[0119] Figure 1 shows the residual expression level of ALK7 mRNA in mice of the double-stranded RNA conjugate of Example 6.
[0120] Figure 2 shows the residual expression level of ALK7 mRNA in DIO mice of the double-stranded RNA conjugate of Example 7.
[0121] Figure 3 shows the rate of change in body weight of the double-stranded RNA conjugate in DIO mice in Example 7;
[0122] Figure 4 shows the feeding statistics of the double-stranded RNA conjugate in DIO mice in Example 7;
[0123] Figure 5 shows the weights of the double-stranded RNA conjugate of Example 7 in DIO mice, including mesenteric fat, pgWAT, iWAT, quadriceps femoris muscle, gastrocnemius muscle, and tibialis anterior muscle.
[0124] Figure 6 shows the residual expression level of ALK7 mRNA in cynomolgus monkeys of the double-stranded RNA conjugate of Example 8.
[0125] Figure 7 shows the residual expression level of ALK7 mRNA in cynomolgus monkeys of the double-stranded RNA conjugate of Example 9.
[0126] Figure 8 shows the residual expression level of ALK7 mRNA in cynomolgus monkeys of the double-stranded RNA conjugate of Example 10.
[0127] Figure 9 shows the in vitro activity of the double-stranded RNA conjugate of Example 11. Detailed Implementation
[0128] It should be noted that, unless otherwise defined, the technical or scientific terms used in this application shall have the ordinary meaning as understood by one of ordinary skill in the art.
[0129] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the raw materials, reagents, and other materials used in the following embodiments are commercially available products. The sense and antisense strand sequences in this application are in the order from the 5' end to the 3' end.
[0130] definition
[0131] In the foregoing and hereinafter, "2'-fluorinated nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribosyl group is replaced by fluorine. Similarly, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, and 2'-deoxynucleotides all refer to nucleotides in which the hydroxyl group at the 2' position of the ribosyl group is replaced by the corresponding substituent group. VP-modified nucleotides refer to nucleotides in which the phosphate group of the nucleotide is replaced by a vinyl phosphate group. In some embodiments, the 5' terminal phosphate group of the antisense strand is replaced by VP.
[0132] "Alkyl" includes straight-chain, branched, or cyclic saturated alkyl groups. For example, alkyl groups include, but are not limited to, methyl, ethyl, propyl, cyclopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, n-pentyl, cyclohexyl, and similar groups. For instance, "C1-6" in "C1-6 alkyl" refers to a group containing 1, 2, 3, 4, 5, or 6 carbon atoms arranged in a straight-chain, branched, or cyclic form.
[0133] "Alkoxy" herein refers to an alkyl group that is attached to the remainder of a molecule by an oxygen atom (-O-alkyl), wherein the alkyl group is as defined herein. Non-limiting examples of alkoxy groups include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, n-pentoxy, etc.
[0134] "Nucleotide analogues" refer to groups that can replace nucleotides in nucleic acids, but whose structure differs from that of adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides, or thymine deoxyribonucleotides. Examples include isonucleotides, bridged nucleic acids (BNAs), or acyclic nucleotides.
[0135] BNA refers to a restricted or inaccessible nucleotide. BNA can contain a five-membered, six-membered, or seven-membered ring with a "fixed" C3'-endoglycan condensation bridging structure. This bridge is typically incorporated into the 2'-, 4'-position of the ribose to provide a 2',4'-BNA nucleotide, such as LNA, ENA, cET BNA, etc., where LNA is shown in formula (1), ENA in formula (2), and cET BNA in formula (3).
[0136] Acyclic nucleotides are a class of nucleotides formed by opening the sugar ring of a nucleotide, such as unopened nucleic acids (UNA) or glycerol nucleic acids (GNA or SAFE-01). UNA is shown in formula (4), GNA in formula (5), and SAFE-01 in formula (6).
[0137] In formulas (4), (5) and (6) above, R is selected from H, OH or alkoxy (O-alkyl).
[0138] Heteronucleotides are compounds formed by changing the position of the bases in the ribose ring of a nucleotide. For example, compounds formed by moving the bases from the 1'-position to the 2'-position or 3'-position of the ribose ring, as shown in formula (7) or (8):
[0139] In the compounds of formulas (7)-(8) above, Base represents a nucleic acid base, such as A, U, G, C or T; R is selected from H, OH, F or non-fluorine groups as described above.
[0140] In some embodiments, the nucleotide analog is selected from one of the following: isonucleotides, LNA, ENA, cET BNA, UNA, GNA, and SAFE-01. In some embodiments, the siRNA of the present invention contains deoxynucleotides, which may be dA, dT, dC, or dG.
[0141] In the preceding and following text, "thiophosphate group" refers to a thiophosphate group in which an oxygen atom in the phosphodiester bond is replaced by a sulfur atom. "5'-phosphonucleotide" refers to the structure of the following formula:
[0142] In the foregoing and hereinafter, the terms "complementary" and "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art: in a double-stranded nucleic acid molecule, the bases of one strand are paired with bases of the other strand in a complementary manner. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair consists of one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the complementary strand can be inferred from its sequence. Correspondingly, "mismatch" in the art means, in the case of a double-stranded nucleic acid, that the bases at corresponding positions are not paired in a complementary manner.
[0143] As will be understood by those skilled in the art in the foregoing and hereinafter, "nucleotide mutation" can also be described as a base mutation, such as the substitution, deletion, or addition of a nucleotide, preferably a substitution. For example, a nucleotide substitution refers to a change in the type of base of a nucleotide at the same position compared to another nucleotide sequence. For instance, if a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position in the former is U, C, G, or T, this is considered a nucleotide mutation at that position between the two nucleotide sequences. In some embodiments, replacing a nucleotide at the original position with a baseless nucleotide or its equivalent can also be considered a nucleotide mutation at that position. A baseless nucleotide refers to a monomeric compound formed when a nucleic acid base in a nucleotide is replaced by other groups or hydrogen atoms, including, but not limited to, substituted or unsubstituted aromatic or heteroaryl groups.
[0144] In the foregoing and hereinafter, double-stranded RNA is referred to as siRNA in some embodiments.
[0145] In the preceding and following text, "protruding end" refers to one or more unpaired nucleotides that protrude from the double-stranded structure of an siRNA when one 3' end of one strand extends beyond the 5' end of the other strand, or vice versa. "Blunt end" or "flat-ended" means that there are no unpaired nucleotides at that end of the siRNA, i.e., no nucleotide protrusions. A "flat-ended" siRNA is a double-stranded siRNA that is double-stranded throughout its entire length, meaning there are no nucleotide protrusions at either end of the molecule.
[0146] In the foregoing and hereinafter, particularly in the description of methods for preparing siRNA, pharmaceutical compositions, or siRNA conjugates of this disclosure, unless otherwise specified, the nucleoside monomer refers to a modified or unmodified nucleoside phosphorus amide monomer used in solid-phase phosphorus amide synthesis, depending on the type and sequence of nucleotides in the siRNA or siRNA conjugate to be prepared. Solid-phase phosphorus amide synthesis is a method used in RNA synthesis that is well known to those skilled in the art. All nucleoside monomers used in this disclosure are commercially available.
[0147] In the context of this disclosure, unless otherwise stated, "conjugation" refers to the covalent connection between two or more chemical parts, each having a specific function; correspondingly, "conjugated compound" refers to a compound formed by the covalent connection of these chemical parts. Further, "siRNA conjugated compound" refers to a compound formed by the covalent attachment of one or more chemical parts having a specific function to siRNA. siRNA conjugated compounds should be understood, depending on the context, as a collective term for multiple siRNA conjugated compounds or a siRNA conjugated compound represented by a specific chemical formula. In the context of this disclosure, "conjugated molecule" should be understood as a specific compound that can be reactively conjugated to siRNA to ultimately form the siRNA conjugated compounds of this disclosure.
[0148] Various hydroxyl protecting groups may be used in this disclosure. Generally, protecting groups insensitize chemical functional groups to specific reaction conditions and can be added to and removed from the functional group in a molecule without substantially impairing the rest of the molecule. Representative hydroxyl protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed., John Wiley & Sons, New York, 1991, all of which are incorporated herein by reference in their entirety. In some embodiments, the protecting group is stable under basic conditions but can be removed under acidic conditions. Non-exclusive examples of hydroxyl protecting groups that may be used herein include dimethoxytriphenylmethyl (DMT), monomethoxytriphenylmethyl, 9-phenylxanthine-9-yl (Pixyl), and 9-(p-methoxyphenyl)xanthine-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups that may be used herein include Tr (triphenylmethyl), MMTr (4-methoxytriphenylmethyl), DMTr (4,4'-dimethoxytriphenylmethyl), and TMTr (4,4',4”-trimethoxytriphenylmethyl).
[0149] As used in this specification, "optional" or "optionally" means that the event or condition described thereafter may or may not occur, and the description includes both the occurrence and non-occurrence of the event or condition.
[0150] The term “subject” as used herein refers to any animal, such as a mammal or marsupial. Subjects of this disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, rabbits, sheep, rats, and any kind of poultry.
[0151] As used herein, “treatment” refers to a method of achieving a beneficial or desired outcome, including but not limited to treatment benefits. A “treatment benefit” means the eradication or improvement of the underlying disorder being treated. Furthermore, a treatment benefit is achieved by eradicating or improving one or more physical symptoms associated with the underlying disorder, thereby observing improvement in the subject, even though the subject may still be suffering from the underlying disorder.
[0152] As used herein, “prevention” refers to methods for obtaining a beneficial or desired outcome, including but not limited to preventive benefits. To obtain a “preventive benefit,” siRNA, siRNA conjugates, or pharmaceutical compositions may be given to subjects at risk of developing a specific disease, or to subjects who report one or more physiological symptoms of a disease, even if a diagnosis of the disease may not have been made.
[0153] The pharmaceutically acceptable carriers described in this disclosure can be carriers conventionally used in the field of siRNA delivery, such as, but not limited to, magnetic nanoparticles (e.g., Fe3O4 or Fe2O3-based nanoparticles), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), and poly(2-aminoethyl ethylene) phosphate. The excipients may be one or more of phosphate, PPEEA, and poly(2-dimethylaminoethyl methacrylate) (PDMAEMA) and their derivatives. The excipients may be one or more of a variety of formulations or compounds conventionally used in the art. For example, other pharmaceutically acceptable excipients may include at least one of pH buffers, protectants, and osmotic regulators.
[0154] In this application, uppercase letters A, C, G, and U represent adenosine-3'-phosphate, cytidine-3'-phosphate, guanosine-3'-phosphate, and uridine-3'-phosphate, respectively; lowercase letter m indicates that the nucleotide adjacent to the left of m is a 2'-methoxy modified nucleotide; lowercase letter f indicates that the nucleotide adjacent to the left of f is a 2'-fluoro modified nucleotide; Tgn represents (S)-ethylene glycol-5'-methyluridine. Lowercase letter s in the middle of uppercase letters indicates that the two nucleotides adjacent to s are linked by a thiophosphate group; when s is the first 3' terminus, it indicates that the nucleotide adjacent to the left of s has a thiophosphate group at its end. IB: reverse debasing deoxyribose residue, wherein the phosphate ester bond in IB can be replaced by a thiophosphate bond.
[0155] As used in this article, a hyphen ("-") that is not between two letters or two symbols or It is used to indicate the location of the substituent connection point. This refers to a single-stranded oligonucleotide, such as the positive strand of siRNA.
[0156] The technical solution provided by the present invention will be further described below with reference to specific embodiments. The following embodiments are for illustrative purposes only and do not limit the scope of protection of the present invention. Unless otherwise specified, such reagents can be obtained from any molecular biology reagent supplier and possess the quality / purity standards required for molecular biology applications.
[0157] Example 1: Design and Synthesis of siRNA
[0158] If the actual source of the reagents is not specified in the text, such reagents can be obtained from any molecular biology reagent supplier and must meet the quality / purity standards required for molecular biology applications.
[0159] 1) siRNA design: Human ACVR1C (NM_001111033.2) was used as the target gene to design 19 / 21nt siRNAs in accordance with the general rules for active siRNAs. Preferred sequences were obtained through preliminary screening. A detailed list of unmodified sense and antisense sequences is shown in Table 1 below, and a detailed list of modified sense and antisense sequences is shown in Table 2 below.
[0160] 2) siRNA synthesis: siRNA sequences were synthesized at a density of 200 nanomolars (nmol) using solid-support-mediated phosphoramide chemistry on a Dr. Oligo48 Biolytic synthesizer. The solid support was a universal solid support (Shenzhen DouDian Biotechnology). Nucleoside monomers, such as 2'-F RNA and 2'-O-methyl RNA, were purchased from Shanghai Zhaowei or Suzhou Jima. The coupling time for all phosphoramides (50 mM acetonitrile solution) was 6 min. 5-ethylthio-1H-tetrazole (ETT) was used as the activator (0.6 M acetonitrile solution). 0.22 M PADS dissolved in a 1:1 volume ratio of acetonitrile and trimethylpyridine (Suzhou Kelama) was used as the sulfidation reagent, with a sulfidation reaction time of 3 min. Iodopyridine / aqueous solution (Kelama) was used as the oxidant, with an oxidation reaction time of 2 min.
[0161] After solid-phase synthesis, the oligonucleotides were cleaved from the solid support and soaked in a 3:1 solution of 28% ammonia and ethanol at 50°C for 16 hours. The mixture was then centrifuged at high speed, and the supernatant was transferred to another centrifuge tube. After concentration and evaporation to dryness, purification was performed using C18 reversed-phase chromatography with a mobile phase of 0.1M TEAA and acetonitrile. DMTr was removed using 3% trifluoroacetic acid solution. The target oligonucleotides were collected, lyophilized, identified as the target product by LC-MS, and then quantified by UV (260 nm).
[0162] The obtained single-stranded oligonucleotides were annealed in equimolar ratios according to the complementary pairing of two sequences. The resulting double-stranded siRNA was then dissolved in 1X PBS and adjusted to the required concentration for the experiment. These monomers are interconnected to form oligonucleotides via 5'-3'-phosphodiester bonds.
[0163] Table 1
[0164] Table 2
[0165] Example 2 Synthesis of siRNA conjugates
[0166] I. Preparation of precursor compound U-SA196
[0167] The synthesis examples are illustrated using U-SA196 as an example. The synthesis routes for other bases (A, G, C)-SA196 are similar.
[0168] 2.1 Preparation of intermediate 2-1
[0169] Compound docosyl alcohol (6.0 mmol, 1.96 g) (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) was placed in a clean, dry reaction flask, and 50 mL of dichloromethane was added. Then, Dys-Martin oxidant (2.0 equiv, 12.0 mmol, 5.1 g) was slowly added under ice-water bath conditions, and the mixture was stirred at room temperature for 2 hours. After the reaction, 100 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The resulting crude product, an oily compound 2-1, was used directly in the next step without further purification. Compound 2-1 molecular formula: C 22 H 44 O, molecular weight: 324.3, LC-MS found 325.6 (M+H).
[0170] 2.2 Preparation of intermediate 2-2
[0171] Methyl 3-hydroxypropionate (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.2 equiv, 7.2 mmol, 749.2 mg) was placed in a clean, dry reaction flask. 50 mL of tetrahydrofuran was added, and the solution was purged with argon for protection. Diisopropylaminolithium (2.0 equiv, 12.0 mmol, 6.0 mL, 2.0 M in hexane) was slowly added at -70 °C, followed by stirring under argon protection for 0.5 hours. Then, compound 2-1 (1.0 equiv, 6.0 mmol, 1.95 g) was slowly added to the reaction solution, followed by stirring under argon protection for 10 minutes. The reaction was quenched with 60 mL of saturated ammonium chloride solution. The organic phase was separated, and the aqueous phase was extracted twice with ethyl acetate. The organic phases were combined, dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 0-50 / 50) to give a colorless oily compound 2-2 (1.77 g, 4.14 mmol, 69% yield). Compound 2-2 molecular formula: C 26 H 52 O4, molecular weight: 428.3, LC-MS yielded 429.6 (M+H).
[0172] 2.3 Preparation of intermediate 2-3
[0173] Compound 2-2 (4.14 mmol, 1.77 g) and imidazole (4.0 equiv, 16.56 mmol, 1.13 g) were placed in a clean, dry reaction flask. 50 mL of N,N-dimethylformamide was added, followed by the slow addition of tert-butyldimethylchlorosilane (3.0 equiv, 12.42 mmol, 1.87 g) at room temperature. The mixture was then stirred overnight at room temperature. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-5 / 1) to give a colorless oily compound 2-3 (2.2 g, 3.35 mmol, 81% yield). The molecular formula of compound 2-3 is C2. 38 H 80 O4Si2, molecular weight: 656.4, LC-MS showed 657.4 (M+H).
[0174] 2.4 Preparation of intermediate 2-4
[0175] Compound 2-3 (3.35 mmol, 2.2 g) was placed in a clean, dry reaction flask, and 60 mL of tetrahydrofuran was added. This solution was purged with argon. The reaction solution was cooled to -70 °C, and diisobutylaluminum hydride (2.2 equiv, 6.7 mmol, 6.7 mL, 1.0 M in THF) was slowly added dropwise under argon protection. After the addition was complete, the temperature was raised to 0 °C and stirring was continued for one hour. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 150 mL of saturated potassium sodium tartrate solution. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 1) to give a pale yellow oily compound 2-4 (1.58 g, 2.5 mmol, 75% yield). The molecular formula of compound 2-4 is: C 37 H 80 O3Si2, molecular weight: 628.5, LC-MS yielded 651.3 (M+Na).
[0176] 2.5 Preparation of intermediate 2-5
[0177] Compound 2-4 (2.5 mmol, 1.58 g) was placed in a clean, dry reaction flask, and 50 mL of anhydrous tetrahydrofuran was added. Triphenylphosphine (2.0 equiv, 5.0 mmol, 1.32 g) and 3-benzoyluracil (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.1 equiv, 2.75 mmol, 0.6 g) were added dropwise under argon protection. The mixture was then stirred overnight at room temperature. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 4) to give the oily compound 2-5 (1.86 g, 2.25 mmol, 90% yield). The molecular formula of compound 2-5 is: C 48 H 86 N2O5Si2, molecular weight: 826.6, LC-MS yielded 827.5 (M+H).
[0178] 2.6 Preparation of intermediates 2-6
[0179] Compound 2-5 (2.25 mmol, 1.86 g) was placed in a clean, dry reaction flask, and 30 mL of methanol was added. Then, a methanol solution of sodium methoxide (3.0 equiv, 6.75 mmol, 1.21 g, 30% wt in MeOH) was added, and the mixture was stirred at room temperature for 5 hours. After the reaction, dilute hydrochloric acid was added to adjust the pH to neutral. The reaction solution was directly concentrated to obtain the crude product, a white solid compound 2-6, which was directly added to the next reaction without further purification. The molecular formula of compound 2-6 is C2. 41 H 82 N2O4Si2, molecular weight: 722.5, LC-MS showed a molecular weight of 723.4 (M+H).
[0180] 2.7 Preparation of intermediates 2-7
[0181] Compound 2-6 (2.25 mmol, 1.63 g) was placed in a clean, dry reaction flask, and 50 mL of tetrahydrofuran was added, followed by tetrabutylammonium fluoride (4.0 equiv, 9.0 mmol, 9.0 mL, 1.0 M in THF). The mixture was stirred overnight at room temperature. After the reaction, 150 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 1-10 / 1) to give an oily compound 2-7 (990.0 mg, 2.0 mmol, 89% two-step yield). The molecular formula of compound 2-7 is: C2 29 H 54 N2O4, molecular weight: 494.4, LC-MS yielded 495.3 (M+H).
[0182] 2.8 Preparation of intermediates 2-8
[0183] Compound 2-7 (2.0 mmol, 990.0 mg) was placed in a clean, dry reaction flask, and 50 mL of pyridine was added. Then, 4,4'-bismethoxytriphenylmethyl chloride (1.5 equiv, 3.0 mmol, 1.02 g) was added at room temperature, followed by stirring overnight at room temperature. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1) to give a pale yellow oily compound 2-8 (1.19 g, 1.5 mmol, 75% yield). The molecular formula of compound 2-8 is C2. 50 H 72 N2O6, molecular weight: 796.5, LC-MS showed a molecular weight of 797.5 (M+H).
[0184] 2.9 Preparation of precursor compound U-SA196
[0185] Compound 2-8 (1.5 mmol, 1.19 g) was placed in a clean, dry reaction flask, and 50 mL of anhydrous dichloromethane was added. Under argon protection at room temperature, compounds 2-cyanoethyl N,N,N',N'-tetraisopropylphosphonamide (2.0 equiv, 3.0 mmol, 0.9 g) and 4,5-dicyanimidazole (1.5 equiv, 2.25 mmol, 0.27 g) were added, and the mixture was stirred at room temperature for one hour. After the reaction, 50 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered, and concentrated. The crude product was then subjected to a C8 reversed-phase column (size: 30 μm). A colorless oily compound, U-SA196 (946.7 mg, 0.95 mmol, 63% yield), was prepared by gradient elution (water / acetonitrile = 95 / 5-0 / 100) from commercially available stock purchased from Shanghai Boyun Biotechnology Co., Ltd. The molecular formula of compound U-SA196 is: C2 59 H 89 N4O7P, molecular weight: 996.5, LC-MS yielded 995.4 (MH). 1 H NMR(400MHz, DMSO-d6)δ11.16(s,1H),7.43(dd,J=10.1,7.9Hz,1H),7.37–7.23(m,4H),7.21–7.15 (m,5H),6.86–6.80(m,4H),5.52–5.42(m,1H),3.94–3.84(m,1H),3.83–3.75(m,1H),3.72(s,6H), 3.70–3.55(m,3H),3.53–3.42(m,2H),3.23–3.15(m,1H),3.14–3.02(m,1H),3.01–2.87(m,1H),2. 72–2.62(m,2H),2.44–2.35(m,1H),1.29–1.17(m,41H),1.12–1.01(m,12H),0.84(t,J=6.7Hz,3H). 31 P NMR (162MHz, DMSO-d6): δ147.96, 147.61, 146.97, 146.94.
[0186] II. Preparation of the precursor compound SA192-PS
[0187] 3.1 Preparation of intermediate 3-1
[0188] Compound (R)-(+)-N-benzyl-3-hydroxypyrrolidine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (16.9 mmol, 3.0 g) and imidazole (3.0 equiv, 50.7 mmol, 3.45 g) were placed in a clean, dry reaction flask. 50 mL of acetonitrile was added, followed by the slow addition of tert-butyldimethylchlorosilane (1.3 equiv, 21.9 mmol, 3.31 g) at room temperature. The mixture was then stirred at room temperature for 4 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-5 / 1) to give a colorless oily compound 3-1 (4.9 g, 16.8 mmol, 99% yield). The molecular formula of compound 3-1 is: C 17 H 29 ONSi, molecular weight: 291.2, LC-MS yielded 292.4 (M+H).
[0189] 3.2 Preparation of intermediate 3-2
[0190] Compound 3-1 (16.8 mmol, 4.9 g) was placed in a clean, dry reaction flask, and 100 mL of methanol was added. Palladium on carbon (wet basis, 10% Pd / C) (10% wt, 490.0 mg) was added at room temperature under hydrogen atmosphere, followed by stirring at room temperature for 4 hours. After the reaction, the palladium on carbon was removed by filtration, and the filtrate was concentrated to give the crude product, a white solid compound 3-2 (3.31 g, 16.5 mmol, 98% yield), which was directly added to the next reaction without purification. The molecular formula of compound 3-2 is C3. 10 H 23 ONSi, molecular weight: 201.1, LC-MS yielded 202.3 (M+H).
[0191] 3.3 Preparation of intermediate 3-3
[0192] N-benzyloxycarbonylserine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (15.0 mmol, 3.58 g), compound 3-2 (1.1 equiv, 16.5 mmol, 3.31 g), 4-dimethylaminopyridine (20 mol%, 3.0 mmol, 366.5 mg), and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (1.5 equiv, 45.0 mmol, 4.31 g) were placed in clean, dry reaction flasks, 100 mL of dichloromethane was added, and the mixture was stirred at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 10 / 1-1 / 3) to give a white solid compound 3-3 (4.5 g, 10.65 mmol, 63% two-step yield). The molecular formula of compound 3-3 is C3. 21 H 34 O5N2Si, molecular weight: 422.2, LC-MS yielded 423.3 (M+H). 1 H NMR (400MHz, CDCl3): δ7.35–7.29(m,5H),5.96(dd,J=14.3,8.3Hz,1H),5.10(s,2H),4.61–4.40(m,2H),3.85–3.68(m,2H),3.65–3.4 9(m,2H),3.41(d,J=12.7Hz,1H),3.31(s,1H),1.95(qdd,J=15.0,11.8,5.3Hz,2H),1.77(s,1H),0.86(s,9H),0.06(d,J=3.1Hz,6H).
[0193] 3.4 Preparation of intermediate 3-4
[0194] Compound 3-3 (10.65 mmol, 4.5 g) was placed in a clean, dry reaction flask, and 100 mL of pyridine was added. Then, 4,4'-bismethoxytriphenylmethyl chloride (1.2 equiv, 12.78 mmol, 4.32 g) was added at room temperature, followed by stirring at room temperature for 2 hours. After the reaction, 150 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 20 / 1-1 / 1) to give a pale yellow oily compound 3-4 (7.56 g, 10.43 mmol, 98% yield). The molecular formula of compound 3-4 is: C 42 H 52O7N2Si, molecular weight: 724.3, LC-MS showed 747.4 (M+Na). 1 HNMR (400MHz, CDCl3): δ7.35–7.31(m,1H),7.28(d,J=4.7Hz,4H),7.27–7.23(m,2H),7.23–7.14(m,5H) ,7.13–7.11(m,2H),6.80–6.78(m,1H),6.76(dd,J=7.7,5.4Hz,4H),5.72(dd,J=22.7,8.3Hz,1H),5.08 –4.99(m,2H),4.69–4.59(m,1H),4.35–4.30(m,1H),3.73(dd,J=4.5,3.7Hz,6H),3.65–3.44(m,2H),3. 36–3.20(m,3H),1.86–1.81(m,1H),1.70(s,1H),0.80(d,J=13.1Hz,9H),-0.02(dd,J=14.9,4.2Hz,6H).
[0195] 3.5 Preparation of intermediate 3-5
[0196] Compound 3-4 (10.43 mmol, 7.56 g) was placed in a clean, dry reaction flask, and 100 mL of methanol was added. Palladium on carbon (wet basis, 10% Pd / C) (10% wt, 750.0 mg) was added at room temperature under hydrogen atmosphere, followed by stirring at room temperature for 12 hours. After the reaction, the palladium on carbon was removed by filtration, and the filtrate was concentrated to give the crude product, a white solid compound 3-5 (6.0 g, 10.22 mmol, 98% yield), which was directly added to the next reaction without purification. The molecular formula of compound 3-5 is C3. 34 H 46 O5N2Si, molecular weight: 590.3, LC-MS yielded 591.6 (M+H).
[0197] 3.6 Preparation of intermediates 3-6
[0198] Ethyl hydroxyacetate (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (5.0 mmol, 520.5 mg) was placed in a clean, dry reaction flask. 20 mL of N,N-dimethylformamide was added, and sodium hydride (60% dispersed in mineral oil) (2.0 equiv, 10.0 mmol, 400.0 mg) was slowly added under ice-water bath conditions. The mixture was then stirred at room temperature for 0.5 hours. Tert-butyl 16-bromohexadecanoate (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (1.1 equiv, 5.5 mmol, 2.15 g) was slowly added under ice-water bath conditions, and stirring continued at room temperature for 2 hours. After the reaction, water was slowly added dropwise to quench the reaction mixture, followed by the addition of 50 mL of ethyl acetate. The mixture was washed with 50 mL of saturated brine, the organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 1-5 / 1) to give a colorless oily compound 3-6 (1.44 g, 3.6 mmol, 72% yield). Compounds 3-6 Molecular formula: C 23 H 44 O5, molecular weight: 400.3, LC-MS yielded 401.4 (M+H). 1 H NMR (400MHz, CDCl3) δ4.07(s,2H),3.75(s,3H),3.51(t,J=6.7Hz,2H),2.19(t,J=7.5Hz,2H),1.65–1.55(m,5H),1.44(s,9H),1.27–1.25(m,21H).
[0199] 3.7 Preparation of intermediates 3-7
[0200] Compound 3-6 (3.6 mmol, 1.44 g) was placed in a clean, dry reaction flask, and 5 mL of trifluoroacetic acid was added. The mixture was then stirred at room temperature for 1 hour. After the reaction, a saturated sodium bicarbonate solution was slowly added dropwise to adjust the pH of the reaction solution to approximately 5. Then, 50 mL of ethyl acetate was added, and the mixture was washed with 50 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The resulting crude product, 1.2 g of a colorless oily compound 3-7, was used directly in the next reaction without purification. The molecular formula of compound 3-7 is C3. 19 H 36 O5, molecular weight: 344.2, LC-MS yielded 343.4 (MH).
[0201] 3.8 Preparation of intermediate 3-8
[0202] Compounds 3-5 (1.9 mmol, 1.13 g), 3-7 (1.1 equiv, 2.1 mmol, 722.8 mg), 4-dimethylaminopyridine (20 mol%, 0.38 mmol, 46.4 mg), and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (1.5 equiv, 2.85 mmol, 546.3 mg) were placed in clean, dry reaction flasks, and 50 mL of dichloromethane was added. The mixture was stirred at room temperature for 2 hours. After the reaction, 100 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 1-10 / 1) to give a pale yellow oily compound 3-8 (1.6 g, 1.75 mmol, 92% yield). The molecular formula of compound 3-8 is C3. 53 H 80 O9N2Si, molecular weight: 916.5, LC-MS yielded 917.6 (M+H).
[0203] 3.9 Preparation of intermediates 3-9
[0204] Compound 3-8 (1.75 mmol, 1.6 g) was placed in a clean, dry reaction flask, and 30 mL of tetrahydrofuran was added. Tetrabutylammonium fluoride (1.0 M in THF) (2.0 equiv, 3.5 mmol, 3.5 mL) was then added at room temperature, followed by stirring at room temperature for 2 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1) to give a pale yellow oily compound 3-9 (1.2 g, 1.5 mmol, 86% yield). The molecular formula of compound 3-9 is C3. 47 H 66 O9N2, molecular weight: 802.4, LC-MS yielded 801.6 (MH).
[0205] 3.10 Preparation of precursor compound SA192
[0206] Compounds 3-9 (1.5 mmol, 1.2 g) were placed in a clean, dry reaction flask, and 30 mL of pyridine was added. Then, 4-dimethylaminopyridine (1.0 equiv, 1.5 mmol, 183.3 mg) and succinic anhydride (2.0 equiv, 3.0 mmol, 300.0 mg) were added at room temperature, and the mixture was stirred for 12 hours at room temperature. After the reaction, 50 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 50 / 1-8 / 1) to prepare a colorless oily compound SA192 (992.3 mg, 1.1 mmol, 74% yield). The molecular formula of compound SA192 is: C 51 H 70 N2O 12 Molecular weight: 902.4, LC-MS yielded 901.3 (MH). 1 H NMR(400MHz, DMSO-d6)δ8.12(t,J=8.4Hz,1H),7.35–7.27(m,4H),7.23–7.18(m,5H),6.88–6.85(m,4 H),5.24(d,J=15.6Hz,1H),4.84–4.70(m,1H),4.06(s,2H),3.73(s,6H),3.70(d,J=2.4Hz,1H),3.63 (s,3H),3.56(dt,J=15.5,7.3Hz,2H),3.42(dd,J=12.5,6.0Hz,3H),3.32(s,br,4H),3.22–3.17(m,1 H),3.06–3.02(m,1H),2.39–2.23(m,2H),2.21–1.94(m,3H),1.52–1.38(m,4H),1.32–1.18(m,23H).
[0207] 3.11 Precursor compound SA192-PS
[0208] SA192 (0.903 g, 1.000 mmol), HBTU (0.570 g, 1.500 mmol), and DIEA (0.258 g, 2.000 mmol) were mixed and dissolved in 100 ml of acetonitrile. The mixture was stirred at room temperature for 5 minutes. Ammonia methyl resin (10.000 g, 100-200 mesh, loading 430 μmol / g, purchased from Nankai Hecheng Company) was added to the reaction solution. The mixture was then shaken at 25 °C at a speed of 240 rpm for 18 hours. After filtration, the filter cake was washed twice with 100 ml of dichloromethane each time and three times with acetonitrile. The mixture was then dried under vacuum overnight. Subsequently, the raw materials (CapA 111.000 ml, CapB 13.300 ml, 4-dimethylaminopyridine 9.060 g, and acetonitrile 100 ml) were added according to the feed ratio to carry out the capping reaction. The mixture was placed on a shaker at 25°C and the rotation speed was 250 rpm for 6 hours. The reaction solution was filtered, and the filter cake was washed three times with 100 ml of acetonitrile each time. The mixture was then filtered until dry and dried overnight under reduced pressure using a vacuum oil pump to obtain 10.400 g of SA192-PS compound with a loading of 96.000 μmol / g.
[0209] Among them, CAP A is acetic anhydride and acetonitrile in a volume ratio of 1:4. CAP B is N-methylimidazolium, pyridine, and acetonitrile in a volume ratio of 2:3:5. HBTU is benzotriazole-N,N,N',N'-tetramethylurea hexafluorophosphate, CAS No.: 94790-37-1. DIEA is N,N-diisopropylethylamine, CAS No.: 7087-68-5.
[0210] The PS in the precursor compound SA192-PS, i.e., in the structural formula It is an aminomethyl resin, specifically an aminomethyl polystyrene resin.
[0211] III. Preparation of precursor compound SA191
[0212] Compounds 3-9 (1.0 mmol, 802.1 mg) were placed in a clean, dry reaction flask, and 20 mL of anhydrous dichloromethane was added. Under argon protection at room temperature, compounds 2-cyanoethyl N,N,N',N'-tetraisopropylphosphonamide (2.0 equiv, 2.0 mmol, 602.8 mg) and 4,5-dicyanimidazole (1.5 equiv, 1.5 mmol, 177.2 mg) were added, and the mixture was stirred for one hour at room temperature. After the reaction, 30 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 50 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered, and concentrated. The crude product was then subjected to chromatography on a C18 reversed-phase column (size: 30 μm). A colorless oily compound SA191 (751.9 mg, 0.75 mmol, 75% yield) was prepared using commercially available reagent (MeCN:H2O = 85%:15%) purchased from Shanghai Boyun Biotechnology Co., Ltd. The molecular formula of compound SA191 is: C2 56 H 83 O 10 N4P, molecular weight: 1002.5, LC-MS yielded 1025.3 (M+Na). 1 H NMR (400MHz, DMSO-d6): δ8.13–8.07(m,1H),7.36–7.27(m,4H),7.23–7.18(m,5H),6.87(d,J=8.0Hz,4H),4.88 –4.77(m,1H),4.52(s,br,1H),4.06(s,2H),3.73(s,6H),3.70–3.65(m,2H),3.63(s,3H),3.60–3.46(m,4H),3 .43–3.38(m,3H),3.22–3.15(m,1H),3.03(dt,J=14.4,7.2Hz,1H),2.78–2.70(m,2H),2.14–1.93(m,4H),1.48 (dd,J=13.4,6.7Hz,4H),1.22–1.18(m,23H),1.15–1.05(m,10H),1.06(d,J=6.7Hz,1H),1.00(d,J=6.7Hz,1H). 31 P NMR (162MHz, DMSO-d6): δ147.06,146.81,146.74,146.66.
[0213] IV. Preparation of siRNA conjugates
[0214] Using the solid-phase phosphorous amide method, precursor compounds SA191, SA192-PS, or SA51 prepared in the above steps are used as the starting cycle. Nucleoside monomers are sequentially linked from the 3'-5' direction according to the nucleotide arrangement, and a U-SA196 conjugated monomer is linked at a fixed position. Each linkage of a nucleoside monomer involves four steps: deprotection, coupling, capping, and oxidation or sulfidation. The sense and antisense chains are synthesized under the same conditions.
[0215] Instruments used: Biolytic Dr. Oligo 48 solid-phase synthesizer, DS0200 Embed CPG Frits universal synthesis column from DouDian Biotechnology, and DC189650 (80mg) 96-well desalting column from DouDian Biotechnology. Reagents used for the synthesis of siRNA conjugates are shown in Table 3.
[0216] Table 3
[0217] The synthesis conditions are as follows:
[0218] Nucleoside monomers were provided in 0.05 M acetonitrile solution. The deprotection reaction conditions were the same for each step: 25 °C, 3 min reaction time, DCA as the deprotection reagent, and 180 μL injection volume.
[0219] The coupling reaction conditions were identical for each step, including a temperature of 25°C and a reaction time of 3 minutes. The injection volume of the nucleoside monomer was 90 μL, and the injection volume of the ACT catalyst was 110 μL.
[0220] Each capping step was performed under identical conditions, including a temperature of 25°C and a reaction time of 2 minutes. The capping reagent solution was a 1:1 molar ratio of CapA to CapB. The injection volume of the capping reagent was 180 μL.
[0221] The oxidation reaction conditions were the same for each step, including a temperature of 25°C, a reaction time of 3 minutes, and an injection volume of 180 μL for the oxidizing reagent OXD.
[0222] The vulcanization reaction conditions were identical for each step, including a temperature of 25°C, a reaction time of 4 minutes, and a 0.05 M PADS pyridine acetonitrile solution as the vulcanizing agent. The injection volume of the vulcanizing agent was 180 μL.
[0223] After the last nucleoside monomer was ligated, the nucleic acid sequence ligated on the solid-phase support was sequentially cut, deprotected, purified, and desalted, and then freeze-dried to obtain the sense and antisense strands, wherein:
[0224] The cleavage and deprotection conditions were as follows: The synthesized nucleotide sequence linked to the vector was added to a mixture of ammonia and ethanol in a 3:1 ratio to a volume of 0.8 mL. The reaction was carried out at 50 °C for 15 h. The remaining vector was removed by filtration, and the supernatant was concentrated to dryness under vacuum.
[0225] The purification and desalting conditions are as follows: Desalting was performed using a C18 reversed-phase column. Specific conditions include:
[0226] (1) Sample preparation
[0227] Add 0.1M TEAA (triethylamine acetate) to the oligonucleotide sample to a volume of 0.8mL.
[0228] (2) Activation of 96-well plate
[0229] Activation: 0.8 mL of acetonitrile was passed through each well of a 96-well plate for activation;
[0230] Equilibration: Equilibrate the 96-well plate with 0.8 mL of TEAA (pH 7.0) solution.
[0231] (3) The purification process shall be carried out in the following order:
[0232] Pass 0.8 mL of a solution containing oligonucleotides through a desalting column;
[0233] Wash the 96-well plate twice with 0.8 mL of 6.5% ammonia to remove failed sequences;
[0234] Rinse the 96-well plate twice with 0.8 mL of deionized water to remove salts;
[0235] The 96-well plate was washed three times with 0.8 mL of 3% trifluoroacetic acid to remove DMT, and the adsorbed layer was observed to turn orange-red.
[0236] Rinse the 96-well plate with 0.8 mL of 0.1 M TEAA;
[0237] Rinse the 96-well plate twice with 0.8 mL of deionized water to remove trifluoroacetic acid and residual salts;
[0238] Elute with 0.6 mL of 20% acetonitrile and collect and freeze-dry.
[0239] The detection method is as follows: The purity of the sense and antisense strands was detected and the molecular weight was analyzed using Waters Acquity UPLC-LTQ LCMS (column: ACQUITY UPLC BEH C18). The measured values are consistent with the theoretical values, indicating that the synthesized compound is the target compound.
[0240] The annealing procedure is as follows: The sense and antisense strands obtained in the above steps are dissolved separately in water for injection to prepare solutions ranging from 0.1 mg / mL to 40 mg / mL. The solutions are then calibrated to an equimolar ratio using a concentration meter, heated at 90°C for 5 minutes, and then slowly cooled naturally to allow them to form a double-stranded structure through hydrogen bonding. Samples are taken and sent for SEC purity testing of the product. The double-stranded samples are then lyophilized. The sequences of the siRNA conjugates are shown in Table 4.
[0241] Table 4
[0242] The structural formula of the "SA51-SA51-SA51" conjugate is: in This represents the double strand formed by siRNA, where X is O.
[0243] Example 3: Single-concentration in vitro screening of ACVR1C sequences: Dual luciferase assay
[0244] 1) Cell culture and plasmid / siRNA co-transfection
[0245] HEK293 cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum and grown at 37°C and 5% CO2 until approximately 90% confluence. The cells were then resuspended after trypsin digestion. The mRNA fragment from the human ACVR1C reference sequence (NM_001111033.2) was cloned into the dual-luciferase psiCHECK2™ vector to construct the psiCHECK-ACVR1C plasmid. The dual-luciferase plasmid and siRNA (final siRNA concentration added to cells was 10 nM) were co-transfected into 15,000 cells using Lipofectamine™ 2000 (Thermo, 11668019). Using 96-well plates, 0.2 μl of Lipofectamine™ 2000 was added to each well of 19.8 μl of Opti-MEM containing 20 ng of the corresponding plasmid vector and siRNA, and incubated at room temperature for 10 minutes before adding the mixture to the 96-well plates. Then, cells resuspended in 100 μl of fresh complete culture medium were added. The cells were incubated for 24 hours, and luciferase (Yisheng Biotechnology, 11405ES80) was detected.
[0246] 2) Dual luciferase assay
[0247] Twenty-four hours after siRNA transfection, dual-luciferase assays were performed, measuring both firefly luciferase (internal control) and Renilla luciferase (PolyA followed by a target sequence, fused into a single mRNA). Following the product manual (Yisheng Biotechnology, 11405ES80), the luminescence signal of firefly luciferase was first detected on a multi-functional microplate reader (Bioteck, Synergy LX), followed by the luminescence signal of Renilla luciferase. The detection order of Renilla luciferase on the microplate should be the same as that of firefly luciferase. The ratio of the Renilla luciferase signal readings from each well to the firefly luciferase (control) signal was normalized, and then compared with cells transfected with the same plasmid but not treated with siRNA to assess siRNA activity. All transfections were performed in replicates.
[0248] The results are expressed as the remaining percentage relative to the control group without siRNA (control group is 100%). The results of the ACVR1C siRNA activity assessment at a concentration of 10 nM in the psiCHECK system are shown in Table 5. The smaller the remaining percentage, the higher the inhibitory activity of the siRNA.
[0249] Table 5
[0250] Example 4: Dual-concentration in vitro screening of ACVR1C sequences: Dual luciferase assay
[0251] 1) Cell culture and plasmid / siRNA co-transfection
[0252] HEK293 cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2 until approximately 90% confluence. Cells were then resuspended after trypsin digestion. The mRNA fragment from the human ACVR1C reference sequence (NM_001111033.2) was cloned into the dual-luciferase psiCHECK2™ vector to construct the psiCHECK-ACVR1C plasmid. The dual-luciferase plasmid and siRNA (final siRNA concentrations added to cells were 10 nM and 0.1 nM) were co-transfected into 15,000 cells using Lipofectamine™ 2000 (Thermo, 11668019). Using 96-well plates, 0.2 μl of Lipofectamine™ 2000 was added to each well of 19.8 μl of Opti-MEM containing 20 ng of the corresponding plasmid vector and siRNA, and incubated at room temperature for 10 minutes before adding the mixture to the 96-well plates. Then, cells resuspended in 100 μl of fresh complete culture medium were added. The cells were incubated for 24 hours, and luciferase (Yisheng Biotechnology, 11405ES80) was detected.
[0253] 2) Dual luciferase assay
[0254] Twenty-four hours after siRNA transfection, dual-luciferase assays were performed, measuring both firefly luciferase (internal control) and Renilla luciferase (PolyA followed by a target sequence, fused into a single mRNA). Following the product manual (Yisheng Biotechnology, 11405ES80), the luminescence signal of firefly luciferase was first detected on a multi-functional microplate reader (Bioteck, Synergy LX), followed by the luminescence signal of Renilla luciferase. The detection order of Renilla luciferase on the microplate should be the same as that of firefly luciferase. The ratio of the Renilla luciferase signal readings from each well to the firefly luciferase (control) signal was normalized, and then compared with cells transfected with the same plasmid but not treated with siRNA to assess siRNA activity. All transfections were performed in replicates.
[0255] The results are expressed as the remaining percentage relative to the control group without siRNA (control group is 100%). The activity evaluation results of ACVR1C siRNA at 10 nM and 0.1 nM concentrations in the psiCHECK system are shown in Table 6. The smaller the remaining percentage, the higher the inhibitory activity of siRNA.
[0256] Table 6
[0257] Example 5: Activity of siRNA conjugates in HDI mice
[0258] In this embodiment, based on the preliminary screening results, siRNA was selected for conjugation synthesis, and its in vivo activity was evaluated in an HDI mouse model.
[0259] At least 14 days prior to administration of the conjugate, six- to eight-week-old female Balb / C mice (Zhejiang Vital River) were used to construct mice expressing humanized ALK7 via high-pressure tail vein injection. 2 μg of a plasmid containing the ALK7 mRNA sequence was injected into the mice via the tail vein over 5–7 seconds to generate the ALK7-SEAP mouse model (Zhang G et al., “High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA.” Human Gene Therapy 1999 Vol. 10, pp. 1735-1737.). Inhibition of ALK7 expression by the ALK7 siRNA conjugate led to inhibition of secretory alkaline phosphatase (SEAP) expression. One day prior to administration, serum was collected via orbital blood sampling. Serum SEAP expression levels were measured using the Phospha-Light SEAP reporter gene analysis system (Invitrogen) according to the product instructions, and mice were grouped based on mean SEAP levels. Mice in the experimental group were given the conjugate, while mice in the solvent group were given phosphate-buffered saline (PBS). The conjugate was administered subcutaneously at a dose of 1 mg / kg per mouse. Blood samples were collected on days 7, 14, 21, 28, and 35 after administration. Serum was collected, and the SEAP expression level in the serum was measured using the Phospha-Light SEAP reporter gene analysis system (Invitrogen) according to the product instructions.
[0260] The SEAP level of each animal after drug administration was divided by the SEAP level before drug administration. This residual expression level was then compared with the PBS group to determine the expression ratio "normalized to pre-treatment". The results of the residual expression levels compared with the PBS control group are shown in Table 7. Compounds with better activity were further studied.
[0261] Table 7
[0262] Example 6: In vivo testing of the activity of the conjugate in mice
[0263] SPF-grade female C57BL / 6J mice aged 6-8 weeks, weighing 20±2g, were selected. Before administration, the mice were weighed and observed. Animals with uniform weight and normal condition were randomly divided into groups of 4 mice each. The experimental group received the conjugate, while the solvent group received phosphate-buffered saline (PBS). The conjugate was administered subcutaneously at a dose of 1 mg / kg per mouse. Fourteen days after administration, the animals were euthanized, and inguinal white adipose tissue (iWAT) and perigonadal white adipose tissue (pgWAT) were collected. The expression level of ALK7 mRNA was detected using qPCR.
[0264] Target gene mouse ALK7 primers:
[0265] Forward primer: ATGCTAACCAACGGGAAAGAG (SEQ ID NO.851)
[0266] Reverse primer: GGAAGGTGCAGTGTGATATTGT (SEQ ID NO.852)
[0267] GAPDH primers for internal reference gene:
[0268] Forward primer: TGCACCACCAACTGCTTAG (SEQ ID NO.853)
[0269] Reverse primer: GATGCAGGGATGATGTTC (SEQ ID NO.854).
[0270] Results are expressed as the residual expression level of the siRNA-treated group compared to the solvent group (the solvent group was 100%). The sequences of the conjugates used for injection are shown in Table 4, and they were prepared according to the method in Example 2. The residual expression levels of ALK7 mRNA in mouse iWAT and pgWAT after using the test conjugates are shown in Figure 1. The results showed that SD007278 had the best activity and was used for efficacy testing in DIO mice.
[0271] Example 7: DIO Efficacy Evaluation in Mice
[0272] SPF-grade male DIO mice were selected and acclimatized using a high-fat diet. After acclimatization, they were divided into groups of eight mice each based on their body weight. The solvent group was administered phosphate-buffered saline (PBS), while the experimental group was administered the conjugate subcutaneously at a dose of 3 mg / kg. Administration was weekly for 17 weeks, followed by a 5-week withdrawal period.
[0273] During the animal experiments, body weight and food intake were recorded weekly. At the end of the experiment, the animals were euthanized, and inguinal subcutaneous fat (iWAT) and gonadal fat (pgWAT) were collected to detect the expression level of ALK7 mRNA. Mesenteric fat, inguinal fat, gonadal fat, tibialis anterior muscle, gastrocnemius muscle, and quadriceps femoris muscle were also collected, weighed, and their contents were recorded.
[0274] Figure 2 shows the residual expression levels of ALK7 mRNA in mouse iWAT and pgWAT compared to the PBS group after treatment with the test conjugate. Body weight is expressed as the rate of change in body weight compared to pre-treatment levels, as shown in Figure 3. Food intake statistics are shown in Figure 4. Figure 5 shows the weights of mesenteric white adipose tissues (mWAT), pgWAT, iWAT, quadriceps femoris muscle (Quads), gastrocnemius muscle (Gastroc), and tibialis anterior muscle (TA) in different experimental groups.
[0275] The results showed that the SD007278 administration group significantly reduced ALK7 mRNA expression levels in adipose tissue. After 3 weeks of administration, body weight increased slowly compared to the PBS group, reaching a significant level by week 5. Body composition analysis indicated that the SD007278 administration group achieved specific fat reduction while maintaining muscle mass, without affecting the animals' feed intake.
[0276] Example 8: In vivo evaluation of siRNA conjugate activity in non-human primates (NHP)
[0277] In this embodiment, the in vivo activity of siNRA conjugates SD007278 and SD007317 was evaluated in non-human primate (NHP) cynomolgus monkeys.
[0278] Healthy female cynomolgus macaques aged 3-5 years were selected, with two macaques per group. Grouping was initiated 3 days prior to drug administration, and subcutaneous abdominal fat samples were collected for subsequent ALK7 mRNA detection. SD007278 was administered subcutaneously on day 0 at a dose of 3 MPk. Animal experiments, as well as corresponding animal husbandry and quarantine, were conducted by WuXi AppTec. Subcutaneous abdominal fat samples were collected on days 14, 28, 56, 84, and 112 post-administration, and ALK7 mRNA expression levels were detected using qPCR.
[0279] Primers for the target gene, cynomolgus monkey ALK7:
[0280] Forward primer: TCCCAAACCAGTGGCAAAGT (SEQ ID NO.855);
[0281] Reverse primer: TACGAGAGCAGTTAGGCGG (SEQ ID NO.856);
[0282] GAPDH primers for internal reference gene:
[0283] Forward primer: TGCACCACCAACTGCTTAGC (SEQ ID NO.857);
[0284] Reverse primer: ACTGTGGTCATGAGTCCTTCCA (SEQ ID NO.858).
[0285] Figure 6 shows the residual ALK7 mRNA expression level after administration to the subcutaneous fat of cynomolgus monkeys, compared to before administration. The maximum KD (knockdown) activity was greater than 90%, and the knockdown activity remained greater than 80% for 112 days. Further extending the experiment to 140 days, the knockdown activity was still greater than 75%, demonstrating good efficacy and long-term effectiveness.
[0286] Example 9: Evaluation of siRNA conjugate activity in non-human primate cynomolgus monkeys (NHP)
[0287] In this embodiment, the in vivo activity of siNRA conjugates SD007309 and SD007320 was evaluated in non-human primate (NHP) cynomolgus monkeys. The synthesis of the conjugates is described in Example 2.
[0288] Healthy female cynomolgus macaques aged 3-5 years were selected, with two macaques per group. Grouping was initiated 7 days prior to drug administration, and subcutaneous abdominal fat samples were collected for subsequent ALK7 mRNA detection. SD007278 was administered subcutaneously on day 0 at a dose of 3 MPk. Animal experiments, as well as related animal husbandry and quarantine, were conducted by WuXi AppTec. Subcutaneous abdominal fat samples were collected on days 14, 28, 56, 84, and 112 post-administration, and ALK7 mRNA expression levels were detected using qPCR.
[0289] Figure 7 shows the residual ALK7 mRNA expression level after administration to subcutaneous fat of cynomolgus monkeys compared to before administration. All conjugates achieved a maximum KD (knockdown) activity of more than 90%, and the knockdown activity remained greater than 80% for 112 days. Further extending the experiment to 140 days, it was found that the knockdown activity could still reach more than 75%, demonstrating good efficacy and long-term effectiveness.
[0290] Example 10: Evaluation of siRNA conjugate activity in non-human primate cynomolgus monkeys (NHP)
[0291] In this embodiment, the in vivo activity of siNRA conjugates SD007308 and SD007310 was evaluated in non-human primate (NHP) cynomolgus monkeys. The synthesis of the conjugates is described in Example 2.
[0292] Healthy female cynomolgus macaques aged 3-5 years were selected, with two macaques in each group. Grouping was initiated 7 days prior to drug administration, and subcutaneous abdominal fat samples were collected for subsequent ALK7 mRNA detection. SD007278 was administered subcutaneously on day 0 at a dose of 3 MPk. Animal experiments, as well as corresponding animal husbandry and quarantine, were conducted by WuXi AppTec. Subcutaneous abdominal fat samples were collected on day 14 post-administration, and ALK7 mRNA expression levels were detected using qPCR.
[0293] Figure 8 shows the residual ALK7 mRNA expression level after administration to subcutaneous fat of cynomolgus monkeys compared to before administration. All conjugates achieved a maximum KD (knockdown) activity of more than 90%.
[0294] Example 11: In vitro activity assessment of siRNA conjugates
[0295] In this embodiment, the activity of the siRNA conjugate was evaluated in vitro using Huh7 cells. The in vitro activity of the siRNA conjugate SD007689 was evaluated in Huh7 cells at 11 concentrations (starting from 10 nM, 2.5-fold dilution, 11 concentrations).
[0296] Huh7 cells were cultured in DMEM high-glucose medium (Gibco, C11995500BT) containing 10% fetal bovine serum at 37°C and 5% CO2. Cells were then resuspended after trypsin digestion. Different concentrations of siRNA were co-transfected into 2x10 cells using RNAiMAX (Thermo, 13778150). 4 Cells were used. In a 96-well plate, 0.3 μL of RNAiMAX was added to each well of 19.7 μL of Opti-MEM (Gibco, 31985070) containing siRNA, and incubated at room temperature for 15 minutes. The mixture was then added to the 96-well plate, followed by cells resuspended in 80 μL of fresh DMEM high-glucose medium (Gibco, C11995500BT) containing 10% fetal bovine serum. After incubation for 24 hours, RNA was extracted using a tissue cell extraction kit (Zhiang Biotechnology, MNTR / FX96), and cDNA was reverse transcribed (Takara, 6210B). The expression level of the ALK7 gene was measured by probe-based qPCR (Applied Biosystems, 4444964). Specific procedures are detailed in the corresponding instruction manual.
[0297] ALK7 primers for the target gene:
[0298] Forward primer: TCCCAAACCAGTGGCAAAGT (SEQ ID NO.855);
[0299] Reverse primer: TACGAGAGCAGTTAGGCGG (SEQ ID NO.856);
[0300] GAPDH primers for internal reference gene:
[0301] Forward primer: TGCACCACCAACTGCTTAGC (SEQ ID NO.857);
[0302] Reverse primer: ACTGTGGTCATGAGTCCTTCCA (SEQ ID NO.858);
[0303] The IC50 was calculated relative to the ALK7 mRNA expression level in cells not treated with siRNA (which is 100%), and the results are shown in Figure 9. The results show that SD007689 has good in vitro activity and is expected to have good in vivo activity.
[0304] Studies have shown that the siRNA and its conjugates in this application have good tolerability, low risk of weight rebound and side effects such as muscle atrophy, and are expected to provide a safer and more effective treatment option for patients who need to lose weight.
Claims
1. A double-stranded RNA comprising a sense strand and an antisense strand, characterized in that: Each nucleotide in the double-stranded RNA is independently modified or unmodified; the sense strand comprises a nucleotide sequence selected from the nucleotide sequences shown in SEQ ID NO. 1 to 425 or a nucleotide sequence with no more than 3 nucleotide mutations; the antisense strand comprises a nucleotide sequence selected from the nucleotide sequences shown in SEQ ID NO. 426 to 850 or a nucleotide sequence with no more than 5 nucleotide mutations.
2. The double-stranded RNA according to claim 1, characterized in that: The antisense strand comprises 18 to 23 nucleotides, more specifically 20 to 22 nucleotides, and further, the nucleotide length of the antisense strand is 21 nt; or, the double-stranded RNA is capable of inhibiting ALK7 expression.
3. The double-stranded RNA according to claim 1 or 2, characterized in that: (a) The sense strand comprises the nucleotide sequence shown in SEQ ID NO.9 or a nucleotide sequence with no more than 2 nucleotide mutations thereof, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.434 or a nucleotide sequence with no more than 2 nucleotide mutations thereof; (b) The sense strand comprises the nucleotide sequence shown in SEQ ID NO.275 or a nucleotide sequence with no more than two nucleotide mutations thereof, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.700 or a nucleotide sequence with no more than two nucleotide mutations thereof; (c) The sense strand comprises the nucleotide sequence shown in SEQ ID NO. 283 or a nucleotide sequence with no more than two nucleotide mutations thereof, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO. 708 or a nucleotide sequence with no more than two nucleotide mutations thereof; or (d) The sense strand contains the nucleotide sequence shown in SEQ ID NO.299 or a nucleotide sequence with no more than two nucleotide mutations thereof, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.724 or a nucleotide sequence with no more than two nucleotide mutations thereof.
4. The double-stranded RNA according to claim 3, characterized in that: (a) The sense strand comprises the nucleotide sequence shown in SEQ ID NO.9 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.434 or a nucleotide sequence with no more than one nucleotide mutation therein; (b) The sense strand comprises the nucleotide sequence shown in SEQ ID NO.275 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.700 or a nucleotide sequence with no more than one nucleotide mutation therein; (c) The sense strand comprises the nucleotide sequence shown in SEQ ID NO. 283 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO. 708 or a nucleotide sequence with no more than one nucleotide mutation therein; or (d) The sense strand contains the nucleotide sequence shown in SEQ ID NO.299 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.724 or a nucleotide sequence with no more than one nucleotide mutation therein.
5. The double-stranded RNA according to claim 4, characterized in that: (a) The sense strand contains the nucleotide sequence shown in SEQ ID NO. 9, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 434; (b) The sense strand comprises the nucleotide sequence shown in SEQ ID NO.275, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.700; (c) The sense strand comprises the nucleotide sequence shown in SEQ ID NO. 283, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO. 708; or (d) The sense strand contains the nucleotide sequence shown in SEQ ID NO.299, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.
724.
6. The double-stranded RNA according to any one of claims 1 to 5, characterized in that: The sense strand and the antisense strand are at least partially anticomplementary to form a double-stranded structure; and / or, at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide; and / or, at least one phosphate group is a phosphate group with a modifying group; and / or, the 5' terminal nucleotide of the sense strand and / or the 3' terminal nucleotide of the sense strand are linked to an anti-base deoxyribose residue containing a phosphate group or a thiophosphate group.
7. The double-stranded RNA according to claim 6, characterized in that: The modified nucleotide is selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, nucleotide analogs, or any combination of two or more thereof; and / or, the phosphate ester group having the modifying group is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphodiester bond of the phosphate ester group with a sulfur atom.
8. The double-stranded RNA according to claim 6, characterized in that: The modified nucleotides are 2'-methoxy modified nucleotides, 2'-fluoro modified nucleotides, 2'-O-CH2-CH2-O-CH3 modified nucleotides, 2'-O-CH2-CH=CH2 modified nucleotides, 2'-CH2-CH2-CH=CH2 modified nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl modified nucleotides, phosphate thioester bond modified nucleotides, VP modified nucleotides, LNA, ENA, cET, BNA, UNA, GNA, and One or more combinations thereof, wherein R1 is H, OH or CH3, and Base is a natural nucleobase, a modified nucleobase, a universal base or a H atom.
9. The double-stranded RNA according to any one of claims 1 to 8, characterized in that: The sense strand contains a 2'-methoxy modified nucleotide, a 2'-fluoro modified nucleotide, and a thiophosphate group; and / or, the antisense strand contains a 2'-methoxy modified nucleotide, a 2'-fluoro modified nucleotide, and a thiophosphate group.
10. The double-stranded RNA according to claims 1 to 9, characterized in that: In the 5' to 3' direction, any one or more nucleotides at positions 7, 9, and 11 of the positive strand are 2'-fluorinated nucleotides; or, any one or more nucleotides at positions 7, 8, and 9 of the positive strand are 2'-fluorinated nucleotides; and / or, In the 5' to 3' direction, any one or more nucleotides at positions 1 to 6, 8, 10, 12 to the last position of the positive strand are 2'-methoxy modified nucleotides; or, any one or more nucleotides at positions 1 to 6, 10 to the last position of the positive strand are 2'-methoxy modified nucleotides; and / or, In the 5' to 3' direction, at least one of the following nucleotide linkages in the positive strand is a phosphate thioester linkage: the first and second nucleotides, the second and third nucleotides, the last and last second nucleotides, and the last second and last third nucleotides; or, In the 5' to 3' direction, any one or more nucleotides at the second, sixth, fourteenth, and sixteenth positions of the antisense strand are 2'-fluorinated nucleotides; or, any one or more nucleotides at the second, fourteenth, and sixteenth positions of the antisense strand are 2'-fluorinated nucleotides; and / or, In the 5' to 3' direction, at least one of the following nucleotide linkages in the antisense strand is a phosphate thioester linkage: the first and second nucleotides, the second and third nucleotides, the last and last second nucleotides, and the last second and last third nucleotides; and / or, Following the 5' to 3' direction, any one or more nucleotides at positions 2 to 8 of the antisense strand are... And / or, In the antisense strand, one or more nucleotides at positions other than those described above are 2'-methoxy modified nucleotides; and / or, The first nucleotide of the antisense strand, in the 5' to 3' direction, contains a VP modification.
11. The double-stranded RNA according to any one of claims 1 to 10, characterized in that: The double-stranded RNA is selected from the sequences shown in Table 1 or Table 2.
12. The double-stranded RNA according to any one of claims 1 to 11, characterized in that: (a) The justice chain contains UmsUmsGmUmGmUmGfAfUfUmCmUmUmCmAmAmAmCmUm; the antisense chain contains AmsGfsUmUmUmGfAmAmGmAmAmUmCmAfCmAfCmAfCmAmAmsAmsAm. (b) The justice chain contains UmsAmsUmUmAmAmGfAfAfGmAmCmUmAmUmAmUmCmUm; the antisense chain contains AmsGfsAmUmAmUfAmGmUmCmUmUmCmUmUmAfAmUmAmsCmsGm. (c) The justice chain contains AmsUmsAmUmCmUmCfAfAfCmUmUmUmGmUmGmUmCmAm, and the antisense chain contains UmsGfsAmCmAmCfAmAmAmGmUmUmGmAfGmAfUmAmUmsAmsGm; or (d) The justice chain contains UmsAmsAmUmGmAmUfGfAfUmAmAmUmUmAmUmGmUmUm, and the antisense chain contains AmsAfsCmAmUmAfAmUmUmAmUmCmAmUfCmAfUmUmAmsGmsGm.
13. A double-stranded RNA conjugate, characterized in that: It includes the double-stranded RNA as described in any one of claims 1 to 12, and a conjugating group conjugated to any position of the double-stranded RNA.
14. The double-stranded RNA conjugate according to claim 13, characterized in that: The conjugating group includes a conjugating group with a structural formula as shown in general formula (Ⅰ) conjugated at any position on the double-stranded RNA, and / or a conjugating group conjugated at the 5' end and / or 3' end of the double-stranded RNA. Wherein: B is a natural nucleobase, a modified nucleobase, a universal base, or an H atom; R1 and R2 are independently selected from H, OH, halogen, NH2, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, S-CH3, NCH3(CH3) or OCH2CH2OCH3; m and n are each independently selected from 1, 2, or 3; Z is absent or selected from one of the groups shown in formulas (Z1)-(Z4): R4 is selected from H, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl and C2-C6 alkynyl; X either does not exist or is selected from one or more linkage combinations of groups shown in formulas (A1)-(A12) below: R3 is selected from H, halogen, C1-C6 alkyl, C1-C6 alkoxy, C3-C7 cycloalkyl, C2-C6 alkenyl and C2-C6 alkynyl; j is an integer between 1 and 10; k is a number between 1, 2, 3, or 4. Y is selected from one of the groups shown in formulas (Y1)-(Y10): Where p is selected from integers between 5 and 25; This indicates the site where a group is covalently bonded.
15. The double-stranded RNA conjugate according to claim 14, characterized in that: The group represented by general formula (Ⅰ) is selected from the following structures: Wherein, B is a natural nucleobase, a modified nucleobase, a universal base, or an H atom; further, B is a base at any position of the double-stranded RNA.
16. The double-stranded RNA conjugate according to claim 14 or 15, characterized in that: The conjugating groups include conjugating groups with the structural formula shown in general formula (I) conjugated at any one or more of the 5th, 6th, and 7th positions from the 5' end of the positive strand of the double-stranded RNA, and conjugating groups conjugated at the 5' end and / or the 3' end of the double-stranded RNA. (SA191 or SA192).
17. The double-stranded RNA conjugate according to any one of claims 13 to 16, characterized in that: The double-stranded RNA conjugates are shown in Table 4.
18. The double-stranded RNA conjugate according to claim 17, characterized in that: (a) The justice chain contains UmsUmsGmUmGmU-SA196GfAfUfUmCmUmUmCmAmAmAmsCmsUmSA192, and the antisense chain contains VPAmsGfsUmUmUmGfAmAmGmAmAmUmCmAfCmAfCmAfCmAmAmsAmsAm; (b) The justice chain contains SA191UmsUmsGmUmGmU-SA196GfAfUfUmCmUmUmCmAmAmAmsCmsUm, and the antisense chain contains VPAmsGfsUmUmUmGfAmAmGmAmAmUmCmAfCmAfCmAfCmAmAmsAmsAmsAm; (c) The justice chain contains UmsAmsUmUmAmA-SA196GfAfAfGmAmCmUmAmUmAmUmsCmsUmSA192, and the antisense chain contains VPAmsGfsAmUmAmUfAmGmUmCmUmUmCmUmUmCmUfUmAfAmUmAmsCmsGm; (d) The justice chain contains SA191UmsAmsUmUmAmA-SA196GfAfAfGmAmCmUmAmUmAmUmsCmsUm, and the antisense chain contains VPAmsGfsAmUmAmUfAmGmUmCmUmUmCmUmUmCmUfUmAfAmUmAmsCmsGm; (e) The justice chain contains AmsUmsAmUmCmU-SA196CfAfAfCmUmUmUmGmUmGmUmsCmsAmSA192, and the antisense chain contains VPUmsGfsAmCmAmCfAmAmAmGmUmUmGmAfGmAfUmAmUmsAmsGm; (f) The justice chain contains SA191AmsUmsAmUmCmU-SA196CfAfAfCmUmUmUmGmUmGmUmsCmsAm; the antisense chain contains VPUmsGfsAmCmAmCfAmAmAmGmUmUmGmAfGmAfUmAmUmsAmsGm; or (g) The justice chain contains UmsAmsAmUmGmA-SA196UfGfAfUmAmAmUmUmAmUmGmsUmsUmSA192, and the antisense chain contains VPAmsAfsCmAmUmAfAmUmUmAmUmCmAmUfCmAfUmUmAmsGmsGm; The structural formula of the conjugated group shown in SA196 is as follows:
19. A pharmaceutical composition, characterized in that: It includes double-stranded RNA as described in any one of claims 1 to 12 or double-stranded RNA conjugates as described in any one of claims 13 to 18, and pharmaceutically acceptable carriers or excipients.
20. Use of the double-stranded RNA of any one of claims 1 to 12, or the double-stranded RNA conjugate of any one of claims 13 to 18, or the pharmaceutical composition of claim 19 in the preparation of a medicament for treating and / or preventing ALK7 expression-related diseases and / or conditions.