C1q as target to treat fatigue

Abstract

The present invention relates to compounds which are capable to bind the complement component 1, subcomponent q (C1q) and to inhibit its biological activity. More in particular, the present invention discloses the usage of said compounds to prevent or treat fatigue as comorbidity in autoimmune disease.

Description

[0001] C1q as target to treat fatigue

[0002] Field of the invention

[0003] The present invention relates to compounds which are capable to bind the complement component 1 , subcomponent q (C1q) and to inhibit its biological activity. More in particular, the present invention discloses the usage of said compounds to prevent or treat fatigue as comorbidity in autoimmune disease.

[0004] Background art

[0005] Fatigue is a common and persistent complication of some autoimmune diseases -such as inflammatory bowel disease (IBD) and multiple sclerosis (MS)- that is not adequately addressed by existing treatments, as current therapies primarily focus on controlling the inflammatory response, rather than alleviating fatigue itself. Consequently, fatigue often continues to affect patients even after the disease is well-managed. For IBD, the clinical trials for fatigue have been reviewed by Truyens et al. (2024)

[0001] . Non-pharmacological trials for fatigue in IBD include psychosocial interventions, physical activity and diet. Pharmacological interventions included thiamine, antidepressants, tryptophan and methylphenidate. Physical exercise seems to be alleviating fatigue in IBD patients, while other interventions had no or limited positive impact. Fatigue is a prevalent and debilitating symptom in multiple sclerosis, affecting 36.5-78% of patients, and effective treatments for MS-related fatigue remain elusive. A systematic review found modest to no effectiveness in both pharmacological and psychosocial / psychological interventions (Lee et al., 2008). C1q is a key protein within the complement component 1 complex, which plays a crucial role in the classical complement pathway of the innate immune system. By binding to antibody-antigen complexes, C1q initiates a series of immune responses, including inflammation, opsonization, and lysis, to help eliminate pathogens such as bacteria and viruses. In addition, C1q is involved in other pathways via its collagen-like tail (cC1q) and globular head (gC1q), which each can interact with biological structures such as pathogen- associated or danger-associated molecular patterns. For example, C1q affects phagocytosis, chemotaxis, apoptosis, and cytokine / chemokine production^, 3], C1q also has an immunomodulatory role, possibly by keeping dendritic cells in an immature phenotype and by controlling the activation of B and T cells. Moreover, membrane-anchored versus soluble C1q also have their own, opposing roles in cell proliferation. It is unknown whether C1q plays a role during fatigue. Brief description of the figures

[0006] Figure 1. Mice with asymptomatic chronic colitis show reduced spontaneous activity and neuroinflammation, with C1q emerging as a hub gene that interacts with common dysregulated genes in both the gut and brain. (A) Induction of acute (aDSS) and extinguished chronic colitis (cDSS) through administration of 2% dextran sodium sulphate (DSS) via the drinking water. (B) Disease activity index (DAI), and (C) voluntary wheel running activity before (baseline) and after induction of chronic colitis (final). (D) Consensus module identified by weighted correlation network analysis consisting of 123 genes co-expressed at colon and choroid plexus (i.e. the blood-cerebrospinal fluid barrier). (E) Cytoscape network figure of the top 25 edges of the module in choroid plexus. (F) Representative 3D structures of microglia in prefrontal cortex, and (G) microglia volume in prefrontal cortex. (H) serum C1q concentration evaluated via ELISA. *P<0.05;

[0007] **P<0.01; ***P<0.001.

[0008] Figure 2. Asymptomatic IBD patients who experience improvements in fatigue also show a reduction in serum C1q concentrations. C1q levels were measured in the serum of patients with IBD in remission who showed a decrease of at least 4 points on the fatigue visual analogue scale (fVAS) after 8 weeks of treatment with either 5-hydroxytryptophan (n=6) or placebo (n=6), compared to patients who did not exhibit a drop in fVAS after 8 weeks of 5-hydroxytryptophan (n=6) or placebo (n=6). *p<0.05.

[0009] Figure 3. Anti-C1q treatment reverses neuroinflammation in mice with asymptomatic chronic colitis. (A) Chronic colitis was induced with cyclic administration of DSS. One week after the last week of DSS, either isotype or a C1 q-inhibiting antibody (M 1.21. DS) were injected intraperitoneally at 100 mg / kg. (B) DAI of mice during the course of colitis induction and isotype or M1.21.DS administration. (C) Gene expression of Lcn2, S100a8, and S100a9 in the frontal cortex of isotype or M1.21.DS antibody treated mice.

[0010] Figure 4. Complement component 1 induces a drop in barrier function of choroid plexus cells, and induced microglia activation. (A) A transwell with choroid plexus endothelial cells (iHCPEnCs) on top and choroid plexus epithelial cells (HIBCPP) on the bottom was placed in a well in which microglial cells (HMC3) were seeded. (B) TEER measurement of the transwell with iCHPEnCs and HIBCPP cells after cell seeding and during 44 hours of C1q administration. (C) Change in TEER of the transwell with iCHPEnCs and HIBCPP cells after 24 and 44 hours of C1q administration. (D) Expression of TNF, CD68 and P2RY12 in microglia cells.

[0011] Description of the invention

[0012] Hence, the present invention relates in first instance to a compound that binds to C1q and inhibits the activity of C1q for use to prevent and / or treat fatigue as comorbidity in autoimmune disease patients wherein said compound is a small molecule, an RNA-based compound or an antibody (Ab).

[0013] The terms ‘a compound that binds to C1q and inhibits the activity of C1q’ relate to any molecule or compound that is capable to physically bind to C1 q or its encoding mRNA and to -as such- inhibit the bioactivity of C1q. The latter ‘bioactivity’ can -for example- be ‘the capability to induce phagocytosis, chemotaxis, apoptosis, or cytokine / chemokine production’ which can be determined by any assay known in the art. Examples of the latter compounds are: Anti-C1q antibodies (developed at Annexon, US), which reduce neuroinflammation in an experimental model of colitis as is disclosed in the present invention, a nanobody (doi: https: / / pmc.ncbi.nlm.nih.qov / articles / PMC7396675 / ), and peptide inhibitors (eg doi: 10.4049 / jimmunol.167.12.7052)

[0014] The term ‘small molecule’ or micromolecule is a low molecular weight (< 1000 dalton) organic compound that may regulate a biological process, with a size in the order of 1 nm .

[0015] The term ‘RNA-based compound’ relates to RNA molecules such as antisense oligonucleotides (ASOs), small interfering RNA (siRNAs), and microRNAs (miRNAs) which can directly target mRNAs and noncoding RNAs (ncRNAs) through Watson-Crick base-pairing. The latter is -for example- reviewed by Zhu et al (2022)[5],

[0016] The term ‘antibody’ relates in essence to an ‘antibody or a variant or fragment thereof’ characterized as being able to specifically bind to an C1q surface epitope. The term thus relates to an antibody or any part thereof, or, an antigen-binding fragment thereof, particularly of the F(ab’)2, F(ab) or single chain Fv (scFv) type, or any other type of recombinant antibody known in the art such as a nanobody.

[0017] The phrase "specifically (or selectively) detects (or binds) an C1q surface epitope”, when referring to an antibody, refers to a binding reaction that is determinative of the presence of the protein in a heterogeneous population of proteins and other biologies. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular protein at least two times the background and do not substantially bind in a significant amount to other proteins present in the sample. Specific binding to an antibody under such conditions may require an antibody that is selected for its specificity for a particular protein. For example, polyclonal antibodies raised to marker "X" from a specific species can be selected to obtain only those polyclonal antibodies that are specifically immunoreactive with marker "X" and not with other proteins, except for polymorphic variants and alleles of marker "X". This selection may be achieved by subtracting out antibodies that cross-react with marker "X" molecules from other species. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein (see, e.g., Harlow & Lane, Antibodies, A Laboratory Manual (1988), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity). Typically, a specific or selective reaction will be at least twice background signal or noise and more typically more than 10 to 100 times background. More specifically, the present invention relates to a compound as described above wherein said autoimmune disease is IBD or MS. In other words, the present invention relates to a method to prevent and / or treat fatigue as comorbidity in an autoimmune disease of a subject in need thereof comprising administering a therapeutically effective amount of a compound as described above.

[0018] The term ‘compound’ as used herein relates more precisely to ‘a pharmaceutical composition’ comprising a small molecule, an RNA-based compound or an Ab as indicated above and which is further formulated to be compatible with its intended route of administration. Hence, suitable diluents, solvents, antioxidants, chelating agents, buffers, carriers, isotonic agents, binding agents, adjuvants, flavoring agents, propellants, detergents and the like which are described in detail in -for example- WO 03 / 004989 can be added to a small molecule, an RNA-based compound or Ab as described above.

[0019] It is further understood that appropriate doses of said compositions (which can also be denominated as drugs or pharmaceutical compositions or compounds) depends upon a number of factors within the knowledge of the ordinary skilled physician. The dose of these compounds will vary, for example, depending upon the identity, size, and condition of the patient being treated, upon the route of administration of said compounds (i.e. parenteral (intravenous, intradermal, subcutaneous), oral, transdermal, transmucosal or rectal) and upon the effect which the skilled physician desires the compound to have.

[0020] More specifically, the present invention relates to a method as describe above wherein said autoimmune disease is inflammatory bowel disease (IBD) or multiple sclerosis (MS).

[0021] Examples

[0022] METHODS

[0023] Animals for behavioral test. Female C57BL / 6J mice (Charles River Laboratories) were housed in a temperature-controlled room at 20°C with a 12h-12h dark-light cycle in filter-top cages. During behavioral testing, mice were housed in a 10h-14h dark-light cycle in individually ventilated cages. Animals had free access to water and commercial chow. At least three cage switches were performed randomized across the different cages before the initiation of the experiments to minimize cage effects due to differences in gut microbiota on the outcomes. The mice acclimatized for one week before undergoing baseline behavioral testing. Animal experiments were performed according to the institutional guidelines approved by the local ethics committee of Ghent University, registered as ECD 19 / 51 and ECD22 / 81.

[0024] Colitis induction and assessment. Colitis was initiated in 9-10 week old mice. To induce chronic colitis, mice received 2% dextran sodium sulfate (molecular weight 36,000-50,000 Da, MP Biomedicals) via drinking water for one week, followed by two weeks of normal drinking water. This cycle was repeated three times, after which mice were left to recover for two additional weeks before sampling. Acute colitis (aDSS) was induced by one week of 2% DSS treatment, with sampling at day 7. Control mice received normal drinking water. Body weight, stool consistency, and fecal blood loss (Helena Laboratories) were recorded three times per week and was compiled in a disease activity score (DAI).

[0025] Behavioral test. Spontaneous wheel running activity was recorded in the light phase between 9 am and 6 pm. Mice were placed in a new cage equipped with a polycarbonate running wheel (Columbus Instruments), which they were allowed to use freely for 24 hours. The number of wheel revolutions were recorded per five min and the data was captured with the Wheel Counter software.

[0026] RNA sequencing and data pre-processing. Distal colon and choroid plexus (pooled from the fourth and lateral ventricles) were isolated, snap frozen and stored at -80°C. Total RNA was extracted using the Aurum™ Total RNA Mini Kit (7326820; Bio-Rad Laboratories). The concentration and purity of the RNA was determined using NanoDrop technology (Eppendorf) and Bioanalyzer analysis. Samples with an OD260 / OD280 ratio <1.8 or >2.1 and RNA integrity number (RIN) <8 were excluded for further analysis. RNA sequencing of the choroid plexus and distal colon was performed at the VIB Nucleomics Core (Leuven, Belgium) using Illumina technology. Pre-processing of the data included quality trimming by trimming low quality ends (<Q20) with FastX 0.0.14. Reads shorter than 35 bp after trimming were removed. Next adapters were trimmed, only at the end (at least 10 bp overlap and 90% match) with cutadapt 1.15. Reads that were shorter than 35 bp after adapter trimming were also removed. In a following step quality filtering was performed, using FastX 0.0.14 and ShortRead 1.40.0. PolyA-reads (more than 90% of the bases equal A), ambiguous reads, low quality reads (more than 50% of the bases < Q25) and artifact reads (all but three bases in the read equal one base type) were removed. Finally, contaminants were removed using bowtie 2.3.3.1 , reads that aligned to phix illumine were removed. The pre-processed reads were aligned to the reference genome of mus musculus (GRCm3873). The number of reads in the alignments that overlapped with gene features were counted with featurecounts 1 .5.3. Next, the data of raw counts were merged with the reference gene annotation and genes for which all samples had less than one counts-per-million were removed (total of 26,790 genes), and the analysis was continued with 19,813 genes.

[0027] Weighted correlation network analysis (WGCNA). The R package WGCNA was used to identify shared co-expression modules between choroid plexus and distal colon based on transcriptomics data. The transcriptomics count matrix was pre-processed by low counts filtering, TMM normalization, and log counts per million transformation using the R package edgeR, followed by outlier removal based on hierarchical clustering (five mice were removed for distal colon). Next, a common set of 3331 highly variable genes (variance > 0.1) was selected over all samples in distal colon and choroid plexus. To approach scale-free co-expression networks, the optimal soft thresholding power to which co-expression similarity was subsequently raised was 11. Signed co-expression networks were constructed with the robust biweight mid-correlation coefficient and modules of highly co-expressed genes were detected by clustering on the dissimilarity of the topological overlap, which is the normalized count of shared neighbours in the network, using the following parameters: a minimum number of genes per gene module of 30, a deepSplit of two and a mergeCutHeight of 0.2 in the hybrid dynamic tree-cutting algorithm. Hubs of the co-expression modules were identified through WGCNA and Cytoscape.

[0028] Assessment of microglia and astrocyte 3D morphology. Mice were transcardially perfused with PBS supplemented with 0.2% heparin, followed by brain dissection. The right brain hemisphere was stored in 4% paraformaldehyde (PFA) overnight, after which samples were embedded in 5% low gelling temperature agarose (Sigma-Aldrich). Sections of 50 pm were cut using the Leica vibratome and stored in 0.01% sodium azide in PBS before staining. Brain sections were incubated in blocking buffer consisting of PBS, 0.5% Triton-X and 5% normal goat serum for 1 h. The sections were stained overnight at 4°C with anti-ionized calcium-binding adapter molecule 1 antibody (microglia; dilution 1 :500, Wako Chemicals), followed by a 2h incubation with secondary goat-anti-rabbit DY633 (dilution 1 :1000, Thermo Fisher) at room temperature. Nuclei were counterstained using DAPI and samples were mounted with Mowiol or PVA and DABCO (Sigma). Images were obtained with a Zeiss LSM 780 confocal microscope. The number of microglia were manually counted in the prefrontal cortex using QuPath version 0.3.241. For 3D reconstruction of microglia, Z-stack images were taken with a Zeiss LSM 880 (Zeiss), using a Plan-Apochromat 40 x 1.3 oil DIC UV-IR M27 objective. The 3D reconstructions and measurements (i.e. volume) were done by filament tracing algorithm from Imaris software (Bitplane). In every mouse, the morphology of 2 to 4 intact microglia was assessed both in the prefrontal cortex (layer 5).

[0029] Isolation of serum. Blood was sampled by cardiac puncture and collected in Eppendorf tubes to prepare serum. Tubes were centrifuged twice for 10 min at 4°C and 9168 g, and serum was stored at -20°C until analysis.

[0030] Serum samples of IBD patients. The samples were selected from biobanked samples collected during our clinical trial focused on treating fatigue, as published in Truyens et al (Gastroenterology 2022; 163(5) : 1294- 1305. e3).

[0031] ELISA. Serum C1Q for mouse (Hycult Biotech) and human (Fisher Scientific) concentrations were measured according to the manufacturer’s protocol.

[0032] Animals for anti-C1q treatment. Female C57BI / 6JRj mice (Janvier) were housed in a temperature-controlled room at 20°C with a 12h-12h dark-light cycle in filter-top cages. Animals had free access to water and commercial chow. To minimize gut microbiome-driven cage effects, at least three cage switches were performed randomly across the different cages before the initiation of the experiments [6], Upon arrival in the animal facility, the mice acclimatized for one week. Animal experiments were performed according to the institutional guidelines approved by the local ethics committee of the Faculty of Medicine and Health Sciences of Ghent University, registered as ECD 24 / 59.

[0033] Colitis induction for anti-C1q treatment. Chronic colitis was induced in 11 -week-old mice by administration of dextran sodium sulphate (DSS; molecular weight 36.000-50.000 Da; 160110; MP Biomedicals) in three cycles, each consisting of one week of DSS administration via the drinking water and two weeks of normal drinking water. During the first cycle, 2.5% DSS was given and during the second and the third cycle, 2% of DSS was supplied. One week after the last week of DSS administration, isotype or M 1.21. DS (both provided by Annexon Biosciences) were given intraperitoneally every 3 days at 100 mg / kg. Body weight, stool consistency, and fecal blood loss were recorded three times a week and scored according to the Disease Activity Index (DAI). qPCR. Frontal cortex tissue of the left hemisphere was isolated, snap frozen and stored at -80°C. RNA was isolated using the RNeasy Plus Mini Kit (74134, Qiagen). After cDNA synthesis using the SensiFASTTM cDNA Synthesis Kit (BIO-65053, Bioline), qPCR was performed of Lcn2 (Fw primer: 5’GCAGGTGGTACGTTGTGGG 3’; Rev primer:

[0034] 5’CTCTTGTAGCTCATAGATGGTGC 3’), S100a8 (Fw primer: 5’

[0035] AAATCACCATGCCCTCTACAAG 3’; Rev primer: 5’CCCACTTTTATCACCATCGCAA 3’), and S100a9 (Fw primer: 5’ATACTCTAGGAAGGAAGGACACC 3’; Rev primer: 5’TCCATGATGTCATTTATGAGGGC 3’). The reference genes used were Hmbs (Fw primer: 5’AAGGGCTTTTCTGAGGCACC 3’; Rev primer: 5’AGTTGCCCATCTTTCATCACTG 3’) and Hprt (Fw primer: 5’GTTAAGCAGTACAGCCCCAAA 3’; Rev primer:

[0036] 5’AGGGCATATCCAACAACAAACTT 3’).

[0037] Maintenance of cell cultures. HIBCPPs were generously provided by Prof. Dr. H. Ishikawa (Nippon Dental University) under a material transfer agreement and cultured in Dulbecco’s Modified Eagle Medium (DMEM / F12, Gibco, 31331-028) supplemented with 10% fetal bovine serum (FBS, ThermoFisher, A5256801) and 0.05% insulin (Sigma-Aldrich, 19278). iHCPEnCs were kindly supplied by Prof. Dr. H. Schroten (University of Heidelberg) under a material transfer agreement and maintained in Complete Classic Medium (Cell Systems, 4Z0-500) using flasks coated with Attachment Factor (Cell Systems, 4Z0-500). HMC3 cells (CRL-3304, ATCC) were cultured in Eagle’s Minimum Essential Medium (EMEM, ATCC, 30-2003) supplemented with 10% FBS. Gibco™ Antibiotic-Antimycotic solution (penicillin, streptomycin, and Amphotericin B; Thermo Fisher Scientific, 15240062) was added to the culture media at a concentration of 1 %.

[0038] In vitro assessment of C1q. The blood-cerebrospinal fluid barrier was modelled using HIBCPP cells and iHCPEnCs according to [7], HIBCPP cells were seeded on the outside of inverted ThinCerts™ (day 0). After 24 hours, the ThinCerts™ were turned upside down to their original position and were hanged in a 24-well plate. On day 4, iHCPEnCs were seeded on the inside of the ThinCerts™. TEER measurement and medium renewal occured daily. HMC3 cells were seeded on the bottom of a 24-well plate on day 7 of the experiment. On day 8, the ThinCerts™ with the iHCPEnCs and the HIBCPP cells were hanged in the 24-well plate that contained the HMC3 cells. At the same time, native human C1q (negative for LPS, ab282858, Abeam) was added to the inside of the ThinCerts™ at 50 pg / mL or 250 pg / mL for 24 or 44 hours. RNA was isolated using the Rneasy Plus Micro Kit (74034, Qiagen). cDNA synthesis was performed using the SensiFAST™ cDNA Synthesis Kit (BIO-65053, Bioline). qPCR was performed on RNA from HMC3 cells of TNFa (Fw primer: 5’CCTGCCCCAATCCCTTTATT 3’; Rev primer: 5’CCCTAAGCCCCCAATTCTCT 3’), CD68 (Fw primer: 5’CTGGCTGTGCTTTTCTCGGG 3’; Rev primer: 5’CTCTGTAACCGTGGGTGTCA 3’), and P2RY12 (Fw primer:

[0039] 5’AGACCACCAGGCCATTTA 3’; Rev primer: 5’CAGACTAGACCGAACTCTGAT 3’) using ACTB (Fw primer: 5’GGACTTCGAGCAAGAGATGG 3’; Rev primer: 5’AGCACTGTGTTGGCGTACAG 3’) and GAPDH (Fw primer: 5’TGCACCACCAACTGCTTAGC 3’; Rev primer: 5’GGCATGGACTGTGGTCATGAG 3’) as reference genes.

[0040] Statistical analysis. Data were analyzed and visualized using the GraphPad Prism Software, and RStudio version 2023.12.1. A two-tailed t-test was used in case of normal distribution of the data, the Mann-Whitney U test was used for data with a non-normal distribution. When multiple t- tests were performed, multiple comparison correction was applied following the two-stage step- up approach (Benjamini, Krieger, and Yekutieli). Wheel running activity was determined by a linear mixed model in R with treatment, time of the day, and timepoint (before or after DSS treatment) as predictor variables (package: emmeans; function: Imm). Statistical significance was defined as a p-value < 0.05.

[0041] RESULTS

[0042] Laboratory mice that had recovered from inflammatory bowel disease revealed reduced wheelrunning activity (Fig 1A-C), and persistent neuroinflammation in the prefrontal cortex (Figi F-G), which is a site of the brain involved in social behaviour. An integrative analysis of gut and brain tissues in these mice identified C1q as a key "hub" gene (Figi D-E), meaning that C1q interacts with a wide range of other genes in both the gut and brain, indicating a potential causal link to ongoing neuroinflammation. Further analysis demonstrated a correlation between serum levels of C1q and the degree of brain inflammation (Fig 1 H), prompting an investigation into C1q serum levels in IBD patients experiencing fatigue versus those without. To explore this connection, samples from a randomized clinical trial designed to alleviate fatigue in IBD patients in remission by administering 5-hydroxytryptophan (5-HT) were examined[4]. Approximately 40% of patients in both groups reported some degree of fatigue relief (35.6% after 5-HT; 37.6% after placebo). Moreover, the decrease in fatigue score was significant in both groups compared to baseline (P=0.003 after 5-HT; P<0.001 after placebo (Fig 2)). Interestingly, serum C1q levels significantly decreased in patients who had a decrease in fatigue score of at least 4 points (on a scale of 1 to 10) compared to baseline, while this was not the case for patients who did not have a drop in fatigue score (Fig 2).

[0043] Mice treated with an antibody targeting C1q after the induction of colitis developed less neuroinflammation in the cortical brain regions as compared to treatment with an isotype control (Fig 3), which suggests a causal role between C1q activity and neuroinflammation. This causal role was confirmed in vitro, showing that C1q on itself can activate microglia through interaction with choroid plexus cells, which are the cells that compose the blood-cerebrospinal fluid barrier (Fig 4).

[0044] References Truyens, M., et al., Prevalence of Fatigue and Unrecognized Depression in Patients with Inflammatory Bowel Disease in Remission under Immunosuppressants and Biologicals. J Clin Med, 2021. 10(18). Galvan, M.D., M.C. Green lee- Wacker, and S.S. Bohlson, C1q and phagocytosis: the perfect complement to a good meal. J Leukoc Biol, 2012. 92(3): p. 489-97. Kishore, U., N.M. Thielens, and C. Gaboriaud, Editorial: State-of -the- Art Research on C1q and the Classical Complement Pathway. Front Immunol, 2016. 7: p. 398. Truyens, M., et al., Effect of 5-Hydroxytryptophan on Fatigue in Quiescent Inflammatory Bowel Disease: A Randomized Controlled Trial. Gastroenterology, 2022. 163(5): p. 1294- 1305 e3. Zhu, Y, et al., RNA-based therapeutics: an overview and prospectus. Cell Death Dis, 2022. 13(7): p. 644. Laukens D, Brigitta B, Raes J, De Vos M, Vandenabeele P. Heterogeneity of the gut microbiome in mice: guidelines for optimizing experimental design to increase reproducibility. FEMS Microbiol Rev 2016;40(1):117-32. IF: 13.244, citations: 174 https: / / star-protocols.cell.com / protocols / 2131

Claims

Claims 1 . A compound that binds to C1 q and inhibits the activity of C1 q for use to prevent and / or treat fatigue as comorbidity in autoimmune disease patients wherein said compound is a small molecule, an RNA-based compound or an antibody.

2. A compound according to claim 1 wherein said autoimmune disease is inflammatory bowel disease (IBD) or multiple sclerosis (MS).

3. A method to prevent and / or treat fatigue as comorbidity in an autoimmune disease of a subject in need thereof comprising administering a therapeutically effective amount of a compound according to claims 1-2.

4. A method according to claim 3 wherein said autoimmune disease is IBD or MS.

Images