Use of raddeanoside r8 in preparation of DKK1 inhibitor and cancer therapeutic drug
By using the molecular docking and protein binding of Raddeanoside R8 with DKK1, a DKK1 inhibitor was developed, which solves the cancer problem caused by abnormal DKK1 expression in existing technologies and achieves effective treatment for cervical cancer and liver cancer.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SHANGHAI TOPSCIENCE CO LTD
- Filing Date
- 2025-10-22
- Publication Date
- 2026-05-21
AI Technical Summary
Existing technologies have failed to effectively inhibit the abnormal expression of DKK1 protein, leading to malignant transformation and increased invasiveness of cancer. There is a lack of effective DKK1 inhibitors for the treatment of cancers expressing DKK1.
Using Raddeanoside R8 or its pharmaceutically acceptable salts, we will validate its binding ability to DKK1 at the molecular docking and protein levels to develop DKK1 inhibitors and cancer therapeutics, particularly for cervical and liver cancer, that inhibit cell viability and invasiveness.
Raddeanoside R8 significantly inhibits the expression and activity of DKK1, reducing the growth and invasiveness of cancer cells, and providing a new drug option for the prevention and treatment of DKK1-related cancers.
Smart Images

Figure CN2025129421_21052026_PF_FP_ABST
Abstract
Description
Application of Raddeanoside R8 in the Preparation of DKK1 Inhibitors and Cancer Therapeutic Drugs Technical Field
[0001] This invention belongs to the field of biomedicine and relates to the application of Raddeanoside R8 in the preparation of DKK1 inhibitors and cancer treatment drugs. Background Technology
[0002] DKK1 is a secreted protein with a molecular weight of approximately 29 kDa. DKK1 primarily inhibits the canonical Wnt / β-catenin signaling pathway by binding to the co-receptors LRP5 / 6 of the Wnt signaling pathway. Under normal physiological conditions, DKK1 participates in regulating cell proliferation, differentiation, and migration by inhibiting Wnt / β-catenin signaling.
[0003] DKK1 is aberrantly expressed in various cancers, particularly in cervical cancer and esophageal squamous cell carcinoma, where it is highly expressed. High levels of DKK1 expression are associated with malignant transformation, increased invasiveness, and poor prognosis in tumors. Therefore, DKK1 is considered a potential therapeutic target, and the development of inhibitors targeting DKK1 holds promise for inhibiting tumor growth and spread.
[0004] Blocking DKK1 can reduce its inhibitory effect on the Wnt signaling pathway, thereby promoting normal Wnt / β-catenin signaling and helping to inhibit the growth and proliferation of tumor cells. Summary of the Invention
[0005] This invention discovered a binding pocket between Raddeanoside R8 and DKK1 through molecular docking, and demonstrated the inhibitory effect of Raddeanoside R8 on DKK1 activity at the transcriptional, protein, and cellular levels. Raddeanoside R8 can affect the survival and invasiveness of DKK1-expressing cancer cells by inhibiting DKK1. The purpose of this invention is to provide new applications for Raddeanoside R8, specifically in the preparation of DKK1 inhibitors and cancer therapeutic drugs.
[0006] The objective of this invention is achieved through the following technical solution:
[0007] Use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of DKK1 inhibitors.
[0008] The use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of cancer therapeutics. The cancer referred to is a cancer expressing DKK1.
[0009] The use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of a cervical cancer treatment drug. Further, the cervical cancer treatment drug is a drug that inhibits the viability of cervical cancer cells.
[0010] The use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of a liver cancer therapeutic agent. Further, the liver cancer therapeutic agent is a drug that inhibits the invasive ability of liver cancer cells.
[0011] The present invention has the following advantages and beneficial effects: The present invention has discovered a new pharmaceutical value of Raddeanoside R8, and provides a new drug for the prevention and treatment of DKK1 inhibition and DKK1-expressing cancers. Attached Figure Description
[0012] Figure 1 shows the molecular docking diagram of Raddeanoside R8 and DKK1 protein. A: DKK1 docking conformation with Raddeanoside R8; B: Raddeanoside R8 with DKK1 highest affinity conformation; C: Interaction between Raddeanoside R8 and DKK1.
[0013] Figure 2 shows the surface plasmon resonance binding of Raddeanoside R8 to DKK1 protein.
[0014] Figure 3 shows the results of the half-maximal inhibitory concentration (IC50) of Raddeanoside R8 in SiHa cells. In Figure 3, A represents the IC50 of Raddeanoside R8 in SiHa cells without DKK1 protein; B represents the IC50 of Raddeanoside R8 in SiHa cells with DKK1 protein.
[0015] Figure 4 shows the effect of Raddeanoside R8 addition on DKK1 transcription levels.
[0016] Figure 5 shows a microscopic observation (A) and a cell count (B) of Raddeanoside R8 inhibiting HepG2 cell invasion. Detailed Implementation
[0017] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.
[0018] The HepG2 and SiHa cells used in the following examples are human liver cancer and cervical cancer cell lines expressing DKK1 protein, respectively. The statistical analysis of the results of the examples was performed using a two-tailed unpaired t-test: P < 0.05, P < 0.01, P < 0.001, P < 0.001, P < 0.0001.
[0019] Example 1
[0020] During the docking process between DKK1 and Raddeanoside R8, the molecular docking mode of DKK1 and Raddeanoside R8 was analyzed using AutoDock 4.2 software. The structure ID of DKK1, 3S8V, was obtained from the RCSB database. This structure is an LRP6-DKK1 complex. LRP6 protein was removed using molecular manipulation environment software, and DKK1 and Raddeanoside R8 underwent pretreatment processes including hydrogenation, dehydration, protonation, and energy minimization. The two-dimensional and three-dimensional structures of Raddeanoside R8 were plotted using ChemBioDraw Ultra 14.0 and ChemBio3D Ultra 14.0, respectively. The binding pocket of DKK1 and Raddeanoside R8 was predicted using computational simulation methods. The docking score of DKK1 and Raddeanoside R8 was -5.9409. The interaction was analyzed using the online protein-ligand interaction analyzer service, and the results are shown in Figure 1.
[0021] Example 2
[0022] The equilibrium dissociation constants of DKK1 and Raddeanoside R8 were determined using surface plasmon resonance (SPR) technology, further demonstrating the interaction between DKK1 protein and Raddeanoside R8. DKK1 protein was immobilized on a carboxyl sensor chip (Nicoya, Canada). The chip was rinsed with phosphate-buffered saline (pH 7.4) to obtain a stable detection baseline. Raddeanoside R8 at elevated concentrations (0.015625 μmol, 0.03125 μmol, 0.0625 μmol, 0.25 μmol, 0.5 μmol, 1 μmol) was injected into the chip. Phosphate-buffered saline was used as a negative control. The cycle rate was set to 20 μL / min. The obtained data were analyzed using TraceDrawer software. The interaction between DKK1 and Raddeanoside R8 was evaluated using binding reaction kinetic parameters. As shown in Figure 2, the equilibrium dissociation constant of DKK1 and Raddeanoside R8 was calculated to be 6.12 × 10^-6 mol / L using TraceDrawer software, further indicating that DKK1 and Raddeanoside R8 have a strong binding force.
[0023] Example 3
[0024] Cultured human cervical cancer SiHa cells (5 × 10^5 cells / mL) and different concentrations of Raddeanoside R8 (20, 40, 60, and 80 μmol) were incubated with 20 μmol of protein DKK1 or an equal volume of culture medium for 48 hours. A blank control group was prepared using 0.1% dimethyl sulfoxide as solvent. Cell viability was determined using a cell counting kit-8 (absorbance A450 value of the treatment group / absorbance A450 value of the blank control group × 100%). The half-maximal inhibitory concentration (IC50) of Raddeanoside R8 on cell viability was calculated using the IC50 calculation function in GraphPad Prism v5.0 software.
[0025] As shown in Figure 3, cell viability decreased with increasing Raddeanoside R8 concentration, while the addition of DKK1 protein had a more significant inhibitory effect on this result. Figures 3A and 3B show that a Raddeanoside R8 concentration of approximately 39.56 μmol inhibited SiHa cell viability by 50%, while in the DKK1 protein-added group, a Raddeanoside R8 concentration of approximately 50.43 μmol was required to achieve the same level of inhibition. This indicates that Raddeanoside R8 can inhibit the proliferation of DKK1-expressing cells, and the expression level of DKK1 affects the effectiveness of Raddeanoside R8.
[0026] Example 4
[0027] Overnight cultured HepG2 cells (5 × 10^5 cells / mL) were incubated for 12 hours with Raddeanoside R8 at concentrations of 0, 1, 5, 10, and 20 μM. The culture medium was then washed off with phosphate-buffered saline. Total ribonucleic acid (RNA) was extracted from the cells using TRIzol reagent (Ingenieur Biosciences). RNA was reverse transcribed, and complementary deoxyribonucleic acid (CRNA) was prepared using a first-strand complementary deoxyribonucleic acid (CRNA) synthesis kit (Thermo Fisher Scientific). Gene expression was then analyzed by real-time quantitative polymerase chain reaction (PCR) using SYBR Select Master Mix, primers, and a Bio-Rad Laboratories real-time polymerase chain reaction (PCR) system. Messenger RNA expression was normalized to glyceraldehyde-3-phosphate dehydrogenase using the formula (∆Ct = Ct target gene - Ct internal reference gene), and expressed as relative messenger RNA expression (∆∆Ct = 2 − (∆Ct sample − ∆Ct control)). Each expression analysis was performed in at least three independent biological replicates. All experimental procedures were performed according to the manufacturer's (Thermo Fisher Scientific) instructions. The primer sequences used for gene expression analysis are as follows:
[0028] DKK1 forward primer: CTTGGTACCGAGCTCGGATCCATGATGGCTCTGGGCGC
[0029] DKK1 reverse primer: GAAGGGCCCTCTAGACTCGAGGTGTCTCTGACAAGTGTGAAGCCTAGAAG
[0030] Internal reference glyceraldehyde-3-phosphate dehydrogenase forward primer: GGAGCGAGATCCCTCCAAAAT
[0031] Internal control glyceraldehyde-3-phosphate dehydrogenase reverse primer: GGCTGTTGTCATACTTCTCATGG
[0032] As shown in Figure 4, the transcription level of the DKK1 gene gradually decreased with the increase of Raddeanoside R8 concentration, indicating that Raddeanoside R8 has an inhibitory effect on DKK1 expression.
[0033] Example 5
[0034] The day before the experiment, the matrix gel was taken out from -20℃ and placed in a 4℃ refrigerator overnight to allow it to melt from a solid state to a liquid state. The next day, the matrix gel was diluted at a ratio of 1:9 and used to coat the upper surface of the bottom membrane of the Transwell chamber. Then, it was placed in a 37℃ incubator to air dry overnight.
[0035] HepG2 cells were pipetted into Transwell chambers with a cell suspension volume of 200 μL and a cell count of 2 × 10⁵. 20 μmol Raddeanoside R8 and 10 μmol endotoxin-free DKK1 protein or 20 μmol Raddeanoside R8 were added to the suspension. A control group without added reagents was used. Freshly prepared complete culture medium was then added to the lower chamber, and the chambers were incubated at 37°C for 48 hours.
[0036] Remove the chamber with tweezers, remove any remaining culture medium with a pipette, and then soak it in methanol solution for 20 minutes. Finally, soak the chamber three times with phosphate-buffered saline solution for 5 minutes each time. After air-drying the chamber in a fume hood, soak it in 0.5% crystal violet solution for 20 minutes. Soak the Transwell chamber again with phosphate-buffered saline solution, and then observe the chamber under a microscope.
[0037] The results are shown in Figures 5A and 5B. Compared with the control group, the invasion ability of HepG2 cells with Raddeanoside R8 was significantly reduced. However, the addition of DKK1 protein could alleviate this inhibition, indicating that Raddeanoside R8 mainly affects the invasion ability of HepG2 cells by binding to DKK1 and inhibiting the activity of DKK1.
[0038] The above embodiments are only used to help illustrate the present invention. The implementation of the present invention is not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention should be considered as equivalent substitutions and are included within the protection scope of the present invention.
Claims
1. Use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of DKK1 inhibitors.
2. The use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of cancer therapeutic drugs.
3. Use according to claim 2, characterized in that: The cancer mentioned is one that expresses DKK1.
4. The use of addeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of cervical cancer treatment drugs.
5. Use according to claim 4, characterized in that: The cervical cancer treatment drug mentioned above is a drug that inhibits the survival of cervical cancer cells.
6. The use of Raddeanoside R8 or a pharmaceutically acceptable salt thereof in the preparation of drugs for the treatment of liver cancer.
7. Use according to claim 6, characterized in that: The aforementioned liver cancer treatment drug is a drug that inhibits the invasive ability of liver cancer cells.