Compositions and methods for inhibiting expression of coagulation factor xi (FXI)
FXI gene-specific RNAi agents, utilizing dsRNA with modified nucleotides, address the challenge of increased bleeding risks from current anticoagulants by efficiently inhibiting FXI expression, offering a safer treatment for thromboembolic conditions.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SHANGHAI ARGO BIOPHARMACEUTICAL CO LTD
- Filing Date
- 2025-11-12
- Publication Date
- 2026-05-21
AI Technical Summary
Current anticoagulants for treating thromboembolic conditions, such as venous thrombosis and pulmonary embolism, pose a risk of increased bleeding, and there is a need for alternative therapies that can reduce FXI levels without this risk.
Development of FXI gene-specific RNAi agents, comprising double-stranded ribonucleic acid (dsRNA) with specific sense and antisense strands, designed to selectively inhibit FXI gene expression in vivo and in vitro, using modified nucleotides and phosphate mimics to enhance efficacy.
The RNAi agents effectively decrease FXI expression, providing a therapeutic approach to treat thromboembolic conditions while minimizing the risk of bleeding.
Smart Images

Figure CN2025134281_21052026_PF_FP_ABST
Abstract
Description
COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF COAGULATION FACTOR XI (FXI)Field of the Invention
[0001] The invention relates, in part, to compositions and methods that can be used to inhibit coagulation factor XI (FXI) gene expression.Background
[0002] The dynamic balance of the circulatory system requires mechanisms that prevent blood loss, as well as those that counteract inappropriate intravascular obstructions. Plasma Coagulation Factor XI (hereinafter referred to as "FXI" ) synthesized in the liver, is a member of the coagulation cascade "intrinsic pathway" , an essential component of the contact activation pathway, is conducive to the production of thrombin, which in turn is an important component that is engaged in the fibrin formation and offers protection from fibrinolysis. High levels of FXI are one of the risk factors for venous thrombosis. Thromboembolism may cause conditions such as deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. Factor XI deficiency (also known as plasma thromboplastin antecedent (PTA) deficiency, Rosenthal syndrome and hemophilia C) is an autosomal recessive disease associated with a tendency to bleed. Most patients with Factor XI deficiency do not bleed spontaneously but can bleed seriously after trauma. Low levels of Factor XI can also occur in other disease states, including Noonan syndrome.
[0003] The most commonly used anticoagulants, warfarin, heparin, low molecular weight heparin (LMWH) , and newer direct oral anticoagulants (DOAC) for the treatment of thrombotic disease, all possess significant drawbacks. For example, direct oral anticoagulants (DOAC) Rivaroxaban, Dabigatran, and Edoxaban all exhibit increased bleeding, especially increased GI bleeding risk. Currently, there remains a need for therapies to treat thromboembolic conditions without the risk of increased bleeding.
[0004] Accordingly, there is a need to find alternative treatments for thrombotic diseases with more attractive clinical profiles. One of the crucial technologies for developing RNAi drugs targeting FXI represents a novel approach to reducing FXI levels and treating FXI-related diseases, such as thromboembolic conditions without increasing bleeding risk (thromboembolic conditions such as vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD) , including thrombosis associated with dialysis, or other procoagulant condition) . Also provided herein RNAi drugs targeting FXI to an animal at risk for inflammatory disease.Summary of the Invention
[0005] In general, the present disclosure features novel FXI gene-specific RNAi agents, compositions that include FXI RNAi agents, and methods for inhibiting expression of a FXI gene in vitro and / or in vivo using the FXI RNAi agents and compositions that include FXI RNAi agents described herein. The FXI RNAi agents described herein can selectively and efficiently decrease, inhibit, or silence expression of a FXI gene in a subject, e.g., a human or animal subject.
[0006] According to an aspect of the invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of coagulation factor XI (FXI) is provided, wherein the dsRNA agent includes a sense strand and an antisense strand, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from sequence of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from sequence of SEQ ID NO: 2, wherein the sense strand and the antisense strand can be partially, substantially, or fully complementary to each other.
[0007] In some embodiments, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences of nucleotides 143-173, 150-180, 380-410, 384-414, 389-419, 402-432, 419-449, 428-458, 536-566, 1141-1171, 1488-1518, 1561-1591, 2111-2141, 2112-2142, 2113-2143, 2115-2145, 2111-2145 of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of the target region of FXI mRNA transcript, wherein the sense strand and the antisense strand can be partially, substantially, or fully complementary to each other.
[0008] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences of nucleotides 145-171, 152-178, 386-412, 382-408, 404-430, 430-456, 1490-1516, 1563-1589, 2113-2139, 2114-2140, 2115-2141, 2117-2143, 2113-2143 of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of the target region of FXI mRNA transcript, wherein the sense strand and the antisense strand can be partially, substantially, or fully complementary to each other.
[0009] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences of nucleotides 148-168, 155-175, 385-405, 389-409, 394-414, 407-427, 424-444, 433-453, 541-561, 1146-1166, 1493-1513, 1566-1586, 2116-2136, 2117-2137, 2118-2138, 2120-2140, 2116-2140 of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of the target region of FXI mRNA transcript, wherein the sense strand and the antisense strand can be partially, substantially, or fully complementary to each other.
[0010] In some embodiments, the target region of the FXI mRNA transcript is any one of nucleotides of SEQ ID NO: 1. In some embodiments, the target region of FXI mRNA transcript is any one of corresponding positions disclosed in Table 1. In some embodiments, wherein said antisense strand comprises a region of complementarity to part of an mRNA encoding FXI mRNA which comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides differing by no more than 0, 1, 2, or 3 nucleotides from the complement of any one of nucleotides SEQ ID NO: 1. In some embodiments, wherein said antisense strand comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides differing by no more than 0, 1, 2, or 3 nucleotides from the complement of any one of nucleotides the target region is any one of corresponding positions disclosed in Table 1.
[0011] In some embodiments, the FXI RNA transcript is SEQ ID NO: 1.
[0012] In some embodiments, wherein the dsRNA agent includes a sense strand and an antisense strand, wherein the region of complementarity includes at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally comprising a targeting ligand.
[0013] In some embodiments, wherein the dsRNA agent includes a sense strand and an antisense strand, nucleotide positions 2 to 18 in the antisense strand comprising a region of complementarity to a FXI RNA transcript, wherein the region of complementarity includes at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally comprising a targeting ligand.
[0014] In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent is fully complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments, the dsRNA agent includes a sense strand sequence set forth in any one of Tables 1-3, wherein the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In certain embodiments, the dsRNA agent includes a sense strand sequence set forth in any one of Tables 1-3, wherein the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent includes an antisense strand sequence set forth in any one of Tables 1-3. In some embodiments, the dsRNA agent includes the sequences set forth as a duplex sequence in any of Tables 1-3.
[0015] In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to part of a FXI RNA transcript, which comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides from any one of the antisense sequences listed in any one of Tables 1-3.
[0016] In some embodiments, the sense strand and the antisense strand may be the same length or different lengths. In some embodiments, each strand is no more than 40 nucleotides in length. In some embodiments, each strand is no more than 30 nucleotides in length. In some embodiments, each strand is no more than 25 nucleotides in length. In some embodiments, each strand is no more than 23 nucleotides in length. In some embodiments, each strand is no more than 21 nucleotides in length. In some embodiments, the sense and antisense strands of the RNAi agents can each be 15 to 49 nucleotides in length. In some embodiments, the antisense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the length of the sense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. In some embodiments, the sense strand and the antisense strand are both 21 nucleotides in length.
[0017] In some embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity is between 15 and 23 nucleotides in length. In some embodiments, the region of complementarity is 19-21 nucleotides in length. In some embodiments, the region of complementarity is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
[0018] In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to part of a FXI RNA transcript which comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides with 0, 1, 2, 3, 4 or 5 mismatches. In some embodiments, the dsRNA agent includes a sense strand and an antisense strand forming a double stranded region, wherein said antisense strand comprises a region of complementarity to a target region of a FXI RNA transcript which comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides with 0, 1, 2, 3, 4 or 5 mismatches.
[0019] In some embodiments, the dsRNA agent includes at least one modified nucleotide. In certain embodiments, all or substantially all of the nucleotides of the antisense strand are modified nucleotides. In some embodiments, at least one of the modified nucleotides comprises: 2’ -O-methyl nucleotide, 2’ -fluoro nucleotide, 2’ -deoxy nucleotide, 2’ 3’ -seco nucleotide mimic, locked nucleotide, unlocked nucleic acid nucleotide (UNA) , glycol nucleic acid nucleotide (GNA) , 2’ -F-Arabino nucleotide, 2’ -methoyxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted abasic nucleotide, inverted 2’ -OMe nucleotide, inverted 2’ -deoxy nucleotide, isomannide nucleotide, 2’ -amino-modified nucleotide, 2’ -alkyl-modified nucleotide, mopholino nucleotide, and 3’-OMe nucleotide, a nucleotide including a 5’ -phosphorothioate group, a 5'-phosphonate modified nucleotide or a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2’ -amino-modified nucleotide, a phosphoramidite, or a non-natural base including nucleotide.
[0020] In some embodiments, the dsRNA agent further comprises a phosphate or phosphate mimic. In some embodiments, a 5’ -phosphate or 5’ -phosphate mimic is introduced at the 5'-terminal nucleotide of the antisense strand. In some embodiments, the phosphate mimic is a 5'-vinyl phosphonate (VP) . In certain embodiments, the phosphate mimic of the 5'-terminal nucleotide has a fragment represented by the following formula:
[0021] Wherein: Q8 is O, S, SO, SO2, PR16R17 or NR11; R16 and R17 are independently (=O) , (=S) , OH, SH, C1-C6 alkyl, NR18R19; R16 and R17 are independently (=O) , (=S) , OH, SH, C1-C6 alkyl, NR18;
[0022] Ra and Rc are each independently selected from hydroxyl or protected hydroxyl, sulfhydryl or protected sulfhydryl, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, protected or optional substituted amino, natural or modified nucleosides; and Rb is O or S or NR12,R12 is hydrogen, C1-C6 alkyl, amino protecting group;
[0023] the substituents in the substituted amino group are selected from: optionally substituted C1-C6alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, sulfinyl, sulfonyl,acetyl;
[0024] R11, R18 and R19 are independently H, optionally substituted C1-C6 alkyl, optionally substitutedC1-C6 alkoxy, methanesulfonyl, sulfonic acid group;
[0025] each substituted group comprises one or more optional substituent groups independentlyselected from: halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylsulfhydryl, CN;
[0026] indicates the linkage to the remainder of the 5'-terminal nucleotide. In certainembodiments, wherein Q8 is bonded to the 4'-carbon or 5'-carbon of the sugar or sugar surrogatemoiety of the 5'-terminal nucleotide.
[0027] In a particular embodiments, in the provided phosphate mimic of the 5'-terminal nucleotidefragment, Q8 in formula (I) is S, SO or SO2.
[0028] In some embodiments, the dsRNA agent includes an E-vinylphosphonate nucleotide at the5′ end of the antisense strand.
[0029] In some embodiments, the dsRNA agent includes a 5'-phosphate mimic nucleotiderepresented by formula ( I ) or their stereoisomers or racemates at the 5'-end of the guide strand:
[0030] wherein: Q8 is O, S, SO, SO2, PR16R17 or NR11; R16 and R17 are independently (=O) , (=S) , OH,SH, C1-C6 alkyl, NR18R19; Ra and Rc are each independently selected from hydroxyl or protectedhydroxyl, sulfhydryl or protected sulfhydryl, optionally substituted C1-C6 alkyl , optionallysubstituted C1-C6 alkoxy , protected or optionally substituted amino, natural or modified nucleosides;and Rb is O or S or NR12, R12 is hydrogen, C1-C6 alkyl, amino protecting group;
[0031] Q1 and Q2 are each independently H, halogen, -CN, optionally substituted C1-C6 alkyl;
[0032] the substituents in the substituted amino group are selected from: optionally substituted C1-C6alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, sulfinyl, sulfonyl,acetyl;
[0033] R11, R18 and R19 are independently H, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, methanesulfonyl, and sulfonic acid group;
[0034] Z is a nucleoside containing a sugar or sugar surrogate moiety;
[0035] T3 is an internucleotide linking group that connects the 5'-terminal nucleotide of formula (I) or its stereoisomer to the remainder of the 5′-end of the guide strand;
[0036] each substituted group comprises one or more substituent groups optionally independently selected from: halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylsulfhydryl, CN.
[0037] In a particular embodiments, in the provided nucleotide, Q8 in formula (I) is S, SO or SO2. In a particular embodiments, in the provided nucleotide, Q1 and Q2 in formula (I) are each independently H. In a particular embodiments, in the nucleotide provided in formula (I) , in the nucleoside of the sugar or sugar surrogate moiety, the sugar or sugar surrogate moiety includes a 5 membered furanose ring, a non-furanose ring or 5-6 membered carbocyclic system or open system. In a particular embodiments, in the nucleotide provided in Formula (I) , in the nucleoside of the sugar or sugar-surrogate moiety, the sugar-surrogate moiety is selected from morpholinyl, cyclohexenyl, cyclohexyl, cyclopentyl, pyranyl, cyclohexanol. In a particular embodiments, in the nucleoside of the sugar or sugar surrogate moiety, the sugar moiety is a furanose. In a particular embodiments, the nucleoside of the sugar or sugar surrogate moiety includes an unlocked nucleobase analog (UNA) or a glycerol nucleobase analog (GNA) . In a particular embodiment, the nucleosides of the sugar or sugar surrogate moiety include locked nucleic acid (LNA) or bridged nucleic acid (BNA) . In a particular embodiment, nucleotide of formula (I) are provided, wherein Q8 is bonded to the 4'-carbon or 5'-carbon of the sugar or sugar surrogate moiety. In particular embodiments, nucleotide of formula (I) is provided, wherein Rb is oxygen. In a particular embodiment, nucleotide of formula (I) is provided, wherein, Ra and Rc are each independently selected from OH, SH, NH2, NHSO2CH3.
[0038] In some embodiments, the dsRNA agent includes a 5'-phosphate mimic nucleotide at the 5′-end of the guide strand select from the following structures or their stereoisomers or racemates: or their stereoisomers or racemates,
[0039] represents the linking moiety to the remainder of the 5′-end of the guide strand.
[0040] In certain embodiments, internucleotide linking group is independently select from: a phosphodiester linking group, a phosphotriester linking group, or a phosphorothioate linking group, phosphorodithioate linking group, alkylphosphonate linking group, aminophosphonate linking group , phosphonate linking group , phosphinate linking group , phosphorothioamidate linking group and phosphoramidate linking groups. For illustrating the 5'-phosphate mimic nucleotide Phos-15-1*, where the phosphodiester linkage is replaced by a phosphorothioate linkage, the following structures are presented.
[0041] In some embodiments, all or substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides.
[0042] In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from a 2’ -O-methyl nucleotide, a 2’ -fluoro nucleotide and an UNA modified nucleotide, wherein less than 6 modified nucleotides are 2’ -fluoro nucleotides. In some embodiments, the antisense strand comprises 3 or 5 2’ -fluoro nucleotides, preferably, the antisense strand comprises 5 2’ -fluoro nucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from a 2’ -O-methyl nucleotide and a 2’ -fluoro nucleotide, wherein less than 4 modified nucleotides are 2’ -fluoro nucleotides. In certain embodiments, the sense strand comprises 3 2’ -fluoro nucleotides. In some embodiments, the antisense strand comprises at least one UNA modified nucleotide and 5 2’ -fluoro nucleotides. In some embodiments, the antisense strand comprises 5 2’ -fluoro nucleotides at positions 2, 5, 12, 14 and 18 counting from the first matching position of the 5’ end, and the rest 2’ -O-methyl nucleotides. In some embodiments, the antisense strand comprises 5 2’ -fluoro nucleotides at positions 2, 7, 12, 14 and 16 counting from the first matching position of the 5’ end, and the rest 2’ -O-methyl nucleotides. In some embodiments, the antisense strand comprises one UNA modified nucleotide at position 7 and 5 2’ -fluoro nucleotides at positions 2, 5, 12, 14 and 18 counting from the first matching position of the 5’ end, and the rest 2’ -O-methyl nucleotides. In some embodiments, the antisense strand comprises one UNA modified nucleotide at position 7 and 5 2’ -fluoro nucleotides at positions 2, 7, 12, 14 and 16 counting from the first matching position of the 5’ end, and the rest 2’-O-methyl nucleotides. In some embodiments, the sense strand comprises 3 2’ -fluoro nucleotides at positions 8, 11 and 13 counting from the first matching position of the 3’ end, and the rest 2’ -O-methyl nucleotides. In some embodiments, the sense strand comprises 3 2’ -fluoro nucleotides at positions 9, 11 and 13 counting from the first matching position of the 3’ end, and the rest 2’ -O-methyl nucleotides. In some embodiments, the modified sense strand is a modified sense strand sequence set forth in one of Tables 2-3. In some embodiments, the modified antisense strand is a modified antisense strand sequence set forth in one of Tables 2-3.
[0043] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of coagulation factor XI (FXI) is provided, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a FXI RNA transcript, wherein each strand is about 15 to about 30 nucleotides in length, wherein the sense strand sequence may be represented by formula (II) : 5′- (N′L) n′N′L N′L N′L N′L N′F N′L N′F N′L N′N1 N′N2 N′L N′L N′L N′L N′L (N′L) m′-3′ formula (II)
[0044] wherein:
[0045] each N′F represents a 2'-fluoro-modified nucleotide; each N′N1 and N′N2 independently represents a modified or unmodified nucleotide; each N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and m′ and n′ are each independently an integer of 0 to 7.
[0046] In some embodiments, N′N1 and N′N2 include only one 2'-Fluorine modified nucleotides.
[0047] In some embodiments, N′N1 independently represents a 2'-fluoro-modified nucleotide, optionally, N′N2 independently represents a 2’ -O-methyl -modified nucleotide.
[0048] In some embodiments, N′N2 independently represents a 2'-fluoro-modified nucleotide, optionally, N′N1 independently represents a 2’ -O-methyl -modified nucleotide.
[0049] In some embodiments, each N′L independently represents a 2’ -O-methyl nucleotide.
[0050] In some embodiments, m′ is 2 and n′ is 4, or m′ is 2 and n′ is 2. In some embodiments, m′ is 1 and n′ is 4, or m′ is 1 and n′ is 2. In some embodiments, m′ is 0 and n′ is 4, or m′ is 0 and n′ is 2.
[0051] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of coagulation factor XI (FXI) is provided, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a FXI RNA transcript, wherein each strand is about 18 to about 30 nucleotides in length, wherein the antisense strand sequence may be represented by formula (III) : 3′- (NL) n NM1 NL NM2 NL NF NL NM3 NL NL NL NL NM4 NL NM5 NL NL NF Nz -5′ formula (III)
[0052] wherein:
[0053] each NF represents a 2'-fluoro-modified nucleotide; each NM1, NM2, NM3, NM4, and NM5 independently represents a modified or unmodified nucleotide; each NL and / or Nz independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and n is an integer of 0 to 7.
[0054] In some embodiments, NM1, NM2, NM3, NM4, NM5, and NM6 have only three 2'-fluoro-modified nucleotides. In some embodiments, NM1, NM2, NM3, NM4, NM5, and NM6 independently represents a 2'-fluoro-modified nucleotide, a 2’ -O-methyl nucleotide, an UNA modified nucleotide or a nucleotide comprising phosphate mimic. In some embodiments, the modified nucleotide is a modified nucleotide defined above. In some embodiments, each NL and / or Nz independently represents a 2’ -O-methyl nucleotide.
[0055] In some embodiments, NM2, NM3 and NM5 each independently represents a 2'-fluoro-modified nucleotide, optionally, NM1, NM4 and NM6 independently represents a 2’ -O-methyl -modified nucleotide.
[0056] In some embodiments, NM2, NM4 and NM5 each independently represents a 2'-fluoro-modified nucleotide, optionally, NM1, NM3 and NM6 independently represents a 2’ -O-methyl -modified nucleotide.
[0057] In some embodiments, NM1, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide, optionally, NM2, NM4 and NM5 independently represents a 2’ -O-methyl -modified nucleotide.
[0058] In some embodiments, NM2, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide, optionally, NM1, NM4 and NM5 independently represents a 2’ -O-methyl -modified nucleotide.
[0059] In some embodiments, NM2, NM4 and NM6 each independently represents a 2'-fluoro-modified nucleotide, optionally, NM1, NM3 and NM5 independently represents a 2’ -O-methyl -modified nucleotide.
[0060] In some embodiments, NM1, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide and NM5 represents an UNA modified nucleotide, optionally, NM2 and NM4 independently represents a 2’ -O-methyl -modified nucleotide.
[0061] In some embodiments, NM2, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide and NM5 represents an UNA modified nucleotide, optionally, NM1 and NM4 independently represents a 2’ -O-methyl -modified nucleotide.
[0062] In some embodiments, NM2, NM4 and NM6 each independently represents a 2'-fluoro-modified nucleotide and NM5 represents an UNA modified nucleotide, optionally, NM1 and NM3 independently represents a 2’ -O-methyl -modified nucleotide.
[0063] In some embodiments, the dsRNA agent includes at least one modified nucleotide. In certain embodiments, all or substantially all of the nucleotides of the antisense strand are modified nucleotides
[0064] In some embodiments, the Nz nucleotide is VPu*, which has the structure
[0065] In some embodiments, t the Nz nucleotide is selected from the group consisting of or their stereoisomers or racemates.
[0066] In some embodiments, n is 1, or n is 2, or n is 3.
[0067] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of coagulation factor XI (FXI) is provided, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein said sense strand is complementary to the antisense strand, wherein said antisense strand comprises a region of complementarity to a FXI RNA transcript, wherein the region of complementarity comprises at least 15 contiguous nucleotides, wherein the dsRNA duplex represented by formula (IV) :
[0068] sense: 5′- (N′L) n′N′L N′L N′L N′L N′F N′L N′F N′L N′N1 N′N2 N′L N′L N′L N′L N′L (N′L) m′-3′
[0069] antisense: 3′- (NL) n NM1 NL NM2 NL NF NL NM3 NL NL NL NL NM4 NL NM5 NL NL NF Nz -5′ formula (IV)
[0070] wherein:
[0071] each strand is about 18 to about 30 nucleotides in length;
[0072] each NF and N′F independently represents a 2'-fluoro-modified nucleotide; NM1, NM2, NM3, NM4, NM5, N′N1, and N′N2 each independently represents a modified or unmodified nucleotide; N′N1 and N′N2 include only one 2'-Fluorine modified nucleotides; each Nz, NL, and N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and m′, n′and n are each independently an integer of 0 to 7.
[0073] In some embodiments, NM1, NM2, NM3, NM4, NM5, and NM6 have only three 2'-fluoro-modified nucleotides, N′N1 and N′N2 include only one 2'-Fluorine modified nucleotides. In some embodiments, the modified nucleotide is a modified nucleotide defined above. In some embodiments, each Nz, NL, and / or N′L independently represents a 2’ -O-methyl nucleotide.
[0074] In some embodiments, N′N1 independently represents a 2'-fluoro-modified nucleotide, optionally, optionally, N′N2 independently represents a 2’ -O-methyl -modified nucleotide.
[0075] In some embodiments, N′N2 independently represents a 2'-fluoro-modified nucleotide, optionally, optionally, N′N1 independently represents a 2’ -O-methyl -modified nucleotide.
[0076] In some embodiments, m′ is 2 and n′ is 4, or m′ is 2 and n′ is 2. In some embodiments, m′ is 1 and n′ is 4, or m′ is 1 and n′ is 2.
[0077] In some embodiments, NM1, NM2, NM3, NM4, NM5, and NM6 have only three 2'-fluoro-modified nucleotides. In some embodiments, NM1, NM2, NM3, NM4, NM5, and NM6 independently represents a 2'-fluoro-modified nucleotide, a 2’ -O-methyl nucleotide, an UNA modified nucleotide or a nucleotide comprising phosphate mimic.
[0078] In some embodiments, NM2, NM3 and NM5 each independently represents a 2'-fluoro-modified nucleotide, optionally, NM1, NM4 and NM6 independently represents a 2’ -O-methyl -modified nucleotide.
[0079] In some embodiments, NM2, NM4 and NM5 each independently represents a 2'-fluoro-modified nucleotide, optionally, NM1, NM3 and NM6 independently represents a 2’ -O-methyl -modified nucleotide.
[0080] In some embodiments, NM1, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide, optionally, NM2, NM4 and NM5 independently represents a 2’ -O-methyl -modified nucleotide.
[0081] In some embodiments, NM2, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide, optionally, NM1, NM4 and NM5 independently represents a 2’ -O-methyl -modified nucleotide.
[0082] In some embodiments, NM2, NM4 and NM6 each independently represents a 2'-fluoro-modified nucleotide, optionally, NM1, NM3 and NM5 independently represents a 2’ -O-methyl -modified nucleotide.
[0083] In some embodiments, NM1, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide and NM5 represents an UNA modified nucleotide, optionally, NM2 and NM4 independently represents a 2’ -O-methyl -modified nucleotide.
[0084] In some embodiments, NM2, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide and NM5 represents an UNA modified nucleotide, optionally, NM1 and NM4 independently represents a 2’ -O-methyl -modified nucleotide.
[0085] In some embodiments, NM2, NM4 and NM6 each independently represents a 2'-fluoro-modified nucleotide and NM5 represents an UNA modified nucleotide, optionally, NM1 and NM3 independently represents a 2’ -O-methyl -modified nucleotide.
[0086] In some embodiments, the Nz nucleotide is VPu*, which has the structure
[0087] In some embodiments, t the Nz nucleotide is selected from the group consisting of or their stereoisomers or racemates.
[0088] In some embodiments, n is 1, or n is 2, or n is 3.
[0089] In some embodiments, any one of the sense and antisense strands of nucleotide modified is a modified nucleotide defined above.
[0090] In certain embodiments, the dsRNA agent includes at least one phosphorothioate internucleoside linkage. In certain embodiments, the sense strand includes at least one phosphorothioate internucleoside linkage. In some embodiments, the antisense strand includes at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand includes 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages. In some embodiments, the antisense strand includes 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages. In some embodiments, the sense strand and the antisense strand each independently comprise two phosphorothioate linkages at the 5’ -terminus. In some embodiments, the sense strand and the antisense strand each independently comprise two phosphorothioate linkages at the 3’ -terminus.
[0091] In some embodiments, the dsRNA agent comprises one or more chirally modified internucleotide linkages. In some embodiments, the antisense strand of the dsRNA agent comprises one or more chirally modified internucleotide linkages. In some embodiments, the sense strand of the dsRNA agent comprises one or more chirally modified internucleotide linkages. In some embodiments, only the antisense strand of the dsRNA agent comprises one or more chirally modified internucleotide linkages, and all the linkages of the sense strand are achiral or racemic. In some embodiments, the one or more chirally modified internucleotide linkages are introduced to 5' end, 3' end, or both 5' end and 3' end of each strand. In some embodiments, the one or more chirally modified internucleotide linkages are introduced to 5' end, 3' end, or both 5' end and 3' end of antisense strand. In some embodiments, the one or more chirally modified internucleotide linkages are introduced to 5' end, 3' end, or both 5' end and 3' end of sense strand. In some embodiments, the first, the second or both the first and the second internucleotide linkages at the 5' terminal of antisense strand (counting from the 5' end) are chirally modified internucleotide linkages. In some embodiments, the first internucleotide linkage at the 5'-end of antisense strand (counting from the 5'-end) is a chirally modified internucleotide linkage. In some embodiments, the first internucleotide linkage at the 5'-end of antisense strand (counting from the 5'-end) is a chirally modified internucleotide linkage, and the first internucleotide linkage at the 3'-end of antisense strand is achiral or racemic (counting from the 3'-end) . In some embodiments, only the first internucleotide linkage at the 5'end of antisense strand is a chirally modified internucleotide linkage, and the rest internucleotide linkages of antisense strand are achiral or racemic. In some embodiments, the first, second or both first and second internucleotide linkages at the 3' end of antisense strand (counting from the 3' end) are chirally modified internucleotide linkages. In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkages. In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkages, the first internucleotide linkage at the 5' end of antisense strand is achiral or racemic. In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkages, the rest internucleotide linkages of antisense strand are achiral or racemic.
[0092] In some embodiments, the chirally modified internucleotide linkages being bonded together by bonds including asymmetric phosphorus atoms, and absolute configurations of the asymmetric phosphorus atoms being regulated. In some embodiments, the chirally modified internucleotide linkages comprise asymmetric phosphorus atoms, wherein the asymmetric phosphorus atom is in either Rp or Sp configuration, or combination thereof.
[0093] In some embodiments, the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration. In some embodiments, the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration, and the first internucleotide linkage at the 3' end of antisense strand is achiral or racemic. In some embodiments, the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration, and the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Sp configuration. In some embodiments, the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic. In some embodiments, the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration, and the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Sp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic.
[0094] In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration. In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration, and the first internucleotide linkage at the 5' end of antisense strand is achiral or racemic. In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Rp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic. In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Sp configuration. In some embodiments, the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkages is Sp configuration, and the first internucleotide linkage at the 5' end of antisense strand is achiral or racemic. In some embodiments, only the first internucleotide linkage at the 3' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Sp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic.
[0095] In some embodiments, the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Sp configuration. In some embodiments, the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkages is Sp configuration, and the first internucleotide linkage at the 3' end of antisense strand is achiral or racemic. In some embodiments, only the first internucleotide linkage at the 5' end of antisense strand is a chirally modified internucleotide linkage, wherein the asymmetric phosphorus atom of the chirally modified internucleotide linkage is Sp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic.
[0096] In some embodiments, at least one of the chirally modified internucleotide linkages is a chirally modified phosphorothioate (PS) linkage. In some embodiments, the first internucleotide linkage counting from the 5'-end of antisense strand is a chirally modified phosphorothioate linkage, and the phosphorus of the phosphorothioate internucleotide linkage is in Rp configuration. In some embodiments, the first internucleotide linkage counting from the 5'-end of antisense strand is a phosphorothioate linkage, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Rp configuration, and the first internucleotide linkage counting from the 3'-end of antisense strand is achiral or racemic. In some embodiments, the first internucleotide linkage counting from the 5'-end of antisense strand is a phosphorothioate linkage, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Rp configuration, and the first internucleotide linkage counting from the 3'-end of antisense strand is a phosphorothioate linkage, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Sp configuration, . In some embodiments, chirally modified internucleotide linkages is a phosphorothioate linkage only occur at the first internucleotide linkage at the 5' end of antisense strand, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Rp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic.
[0097] In some embodiments, the first internucleotide linkage counting from the 3'-end of antisense strand is a phosphorothioate linkage, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Sp configuration. In some embodiments, the first internucleotide linkage counting from the 3'-end of antisense strand is a phosphorothioate linkage, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Sp configuration, and the first internucleotide linkage counting the 5' end of antisense strand is achiral or racemic. In some embodiments, the first internucleotide linkage counting from the 3'-end of antisense strand is a phosphorothioate linkage, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Sp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic.
[0098] In some embodiments, the first and the second internucleotide linkages counting from the 3' end of antisense strand are racemic phosphorothioate internucleotide, and the first internucleotide linkage counting from the 5' end of antisense strand is a phosphorothioate internucleotide linkage in Rp configuration, and the second internucleotide linkage counting from the 5'-end of antisense strand is an achiral phosphodiester linkage (PO) and the rest internucleotide linkages of antisense strand are achiral or racemic. In some embodiments, the first and the second internucleotide linkages counting from the 3'-end of antisense strand are racemic phosphorothioate linkages, and the first internucleotide linkage counting from the 5'-end of antisense strand is a Rp phosphorothioate linkage, and optionally, the rest internucleotide linkages of antisense strand are achiral phosphodiester linkages (PO) . In some embodiments, the first and the second internucleotide linkages counting from the 3'-end of antisense strand are racemic phosphorothioate linkages, and the first internucleotide linkage counting from the 5'-end of antisense strand is a Rp phosphorothioate linkage, the second internucleotide linkages counting from the 5'-end of antisense strand are racemic phosphorothioate linkages, and optionally, the rest internucleotide linkages of antisense strand are achiral phosphodiester linkages (PO) . In some embodiments, the first and the second internucleotide linkages counting from the 5'-end of antisense strand are racemic phosphorothioate linkages, and the first internucleotide linkage counting from the 3'-end of antisense strand is a Sp phosphorothioate linkage, and optionally the rest internucleotide linkages of antisense strand are achiral phosphodiester linkages (PO) .
[0099] In some embodiments, the dsRNA agent includes a 5'-phosphate mimic nucleotide by Rp configuration phosphorothioate linking introduced at the 5′-end of the guide strand. In some embodiments, the dsRNA agent includes a 5'-phosphate mimic nucleotide by Sp configuration phosphorothioate linking introduced at the 5′-end of the guide strand.
[0100] In some embodiments, the dsRNA agent includes at least one modified nucleotide and further includes one or more targeting groups or linking groups. In some embodiments, the one or more targeting groups or linking groups are conjugated to the sense strand. In some embodiments, the targeting group or linking group includes N-acetyl-galactosamine (GalNAc) . In certain embodiments, the dsRNA agent includes a targeting group that is conjugated to the 5’ -terminal end of the sense strand. In some embodiments, the dsRNA agent includes a targeting group that is conjugated to the 3'-terminal end of the sense strand.
[0101] In some embodiments, the targeting group has a structure:
[0102] n”are independently selected from 1 or 2.
[0103] In some embodiments, the targeting group has a structure:
[0104] In some embodiments, the antisense strand includes one inverted abasic residue at 3’ -terminal end. In certain embodiments, the sense strand includes one or two inverted abasic residues and / or one or two imann residues at 3’ or / and 5’ terminal end. In certain embodiments, each 3’ and 5’ terminal end of the sense strand independently includes an inverted abasic residue. In certain embodiments, each 3’ and 5’ terminal end of the sense strand independently includes an imann residue. In some embodiments, the sense strand includes one inverted abasic residue at 3’ -terminal end. In certain embodiments, each end of the sense strand includes one inverted abasic residue. In certain embodiments, each end of the sense strand includes one imann residue. In some embodiments, one or more inverted abasic residues or one or more imann residues conjugate to either end or both ends of the sense strand via phosphorothioate linkages. In some embodiments, the targeting group further conjugates to either end of the sense strand via a phosphorothioate linkage. In some embodiments, the targeting group further conjugates to 5’ -end of the sense strand via a phosphorothioate linkage. In certain embodiments, the sense strand includes one inverted abasic residue or imann residues at the 5' terminal end of the sense strand, wherein inverted abasic residue or imann residues is linked to an adjacent nucleotide via a phosphorothioate linkage to the 5' terminal end of the nucleotide sequence of the sense strand. In certain embodiments, the sense strand further includes targeting group linked to an inverted abasic residue or an imann residue at the 5' terminal end of the sense strand, wherein targeting group is linked to an adjacent inverted abasic residue or imann via a phosphorothioate linkage, and optionally targeting group is N-acetyl-galactosamine (GalNAc) .
[0105] In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand includes a 3’ overhang of at least 1 nucleotide. In some embodiments, at least one strand includes a 3’ overhang of at least 2 nucleotides.
[0106] In some embodiments, any one of the sense strands in Table 1 may be modified in a pattern shown in Formula (II) or (III) , and wherein the linkages of the sense strand are in a pattern as described above. In some embodiments, any one of the antisense strands in Table 1 may be modified in a pattern shown in Formula (I) , (III) or (IV) , and wherein the linkage of the antisense strand is in a pattern as described above. In some embodiments, any one of the duplexes in Table 1 may be modified in a pattern shown in Formula (I) - (IV) , wherein the linkage of each strand is in a pattern as described above. In some embodiments, the modified sense strand has a modification pattern set forth in any one of Tables 2-3. In some embodiments, the modified antisense strand has a modification pattern set forth in any one of Tables 2-3.
[0107] In certain embodiments, the dsRNA comprises a duplex selected from the group consisting of AV01124. um, AV01126. um, AV01138. um, AV01141. um, AV01152. um, AV01180. um, AV01204. um, AV01124 -19-1. um, AV01126 -19-1. um, AV01138-19-1. um, AV01141-19-1. um, AV01152-19-1. um, AV01180-19-1. um, AV01204-19-1. um. In certain embodiments, the dsRNA comprises a duplex selected from the group consisting of AV01124, AV01126, AV01138, AV01141, AV01152, AV01180, AV01204. In certain embodiments, the dsRNA comprises a duplex selected from the group consisting of AD00990, AD00991, AD00997, AD00768, AD00999, AD01002, AD00773, AD00998, AD00776, AD01018, AD00990-1, AD00991-1, AD00991-2, AD00991-3, AD00991-4, AD00991-5, AD00991-6, AD00997-1, AD00997-2, AD00997-3, AD00997-4, AD00997-5, AD00998-1, AD00999-1, AD01002-1, AD01016-1, AD00990-1, AD00990-2, AD00990-3, AD00990-4, AD00990-12, AD00990-13, AD00997-2, AD02352, AD02362, AD02375-1, AD02399, AD02444, AD02445, AD02446, AD02447.
[0108] According to an aspect of the invention, a composition is provided that includes any embodiment of the aforementioned dsRNA agent aspect of the invention. In certain embodiments, the composition also includes a pharmaceutically acceptable carrier. In some embodiments, the composition also includes one or more additional therapeutic agents. In certain embodiments, the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial. In some embodiments, the composition is formulated for subcutaneous administration or is formulated for intravenous (IV) administration.
[0109] According to another aspect of the invention a cell is provided that includes any embodiment of an aforementioned dsRNA agent aspect of the invention. In some embodiments, the cell is a mammalian cell, optionally a human cell.
[0110] According to another aspect of the invention, a method of inhibiting the expression of a FXI gene in a cell, is provided, the method including: (i) preparing a cell including an effective amount of any embodiment of the aforementioned dsRNA agent aspect of the invention or any embodiment of an aforementioned composition of the invention. In certain embodiments, the method also includes: (ii) maintaining the prepared cell for a time sufficient to obtain degradation of the mRNA transcript of a FXI gene, thereby inhibiting expression of the FXI gene in the cell. In some embodiments, the cell is in a subject and the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the cell is in a subject and the dsRNA agent is administered to the subject by IV administration. In certain embodiments, the method also includes assessing inhibition of the FXI gene, following the administration of the dsRNA agent to the subject, wherein a means for the assessing comprises: (i) determining one or more physiological characteristics of a FXI-associated disease or condition in the subject and (ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the FXI-associated disease or condition and / or to a control physiological characteristic of the FXI-associated disease or condition, wherein the comparison indicates one or more of a presence or absence of inhibition of expression of the FXI gene in the subject. In some embodiments, the physiological characteristic is one or more of: the FXI mRNA level and the FXI protein level. A reduction in the expression of FXI may also be assessed indirectly by measuring a decrease in biological activity of FXI, e.g., In some embodiments, the FXI protein may be an active form (FXIa) . The active form of FXI may promote converting FIX from its inactive form (FIX) to its active form (FIXa) . FXI activity may be assessed with a blood test that characterizes coagulation of blood. Non-limiting examples of such blood tests are a partial thromboplastin time (PTT) test or activated partial thromboplastin time test (aPTT or APTT) . FXI activity in a test plasma sample may be assayed by adding the test plasma sample to a plasma sample that is immunodepleted of FXI and comparing clotting of the resulting combined sample to a reference sample with a reference amount of FXI.
[0111] According to another aspect of the invention, a method of treating a disease or condition associated with the presence of FXI protein is provided, the method including: administering to a subject an effective amount of an embodiment of any aforementioned dsRNA agent aspect of the invention or an embodiment of any aforementioned composition of the invention, to inhibit FXI gene expression. In some embodiments, the disease, disorder or condition associated with FXI is thromboembolic condition. In certain embodiments, the thromboembolic condition is deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD) , including thrombosis associated with dialysis, or other procoagulant condition. Also provided are methods useful treating, preventing, or ameliorating a thromboembolic condition without increasing bleeding risk in an individual. In certain embodiments, the individual is at risk for a thromboembolic condition, including, but not limited to infarct, thrombosis, embolism, thromboembolism such as deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. Such diseases, disorders, and conditions can have one or more risk factors, causes, or outcomes in common. Certain risk factors and causes for development of a thromboembolic condition include immobility, surgery (particularly orthopedic surgery) , dialysis, malignancy, pregnancy, older age, use of oral contraceptives, atrial fibrillation, previous thromboembolic condition, chronic inflammatory disease, inherited or acquired prothrombotic clotting disorders and thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD) . Certain outcomes associated with development of a thromboembolic condition include decreased blood flow through an affected vessel, death of tissue, and death.
[0112] In some embodiments, the method also includes: administering an additional therapeutic regimen to the subject. In some embodiments, the additional therapeutic regimen includes a treatment for the FXI-associated disease or condition. In certain embodiments, methods comprise co-administering one or more pharmaceutical compositions described herein with one or more other pharmaceutical agents at the same time. In certain embodiments, methods comprise co-administering one or more pharmaceutical compositions described herein with one or more other pharmaceutical agents at different times. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are prepared separately. In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include anticoagulant or antiplatelet agents. In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include NSAID / Cyclooxygenase inhibitors, such as, aspirin. In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include adenosine diphosphate (ADP) receptor inhibitors, such as, clopidogrel (PLAVIX) and ticlopidine (TICLID) . In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include phosphodiesterase inhibitors, such as, cilostazol (PLETAL) . In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include, glycoprotein IIB / IIIA inhibitors, such as, abciximab (REOPRO) , eptifibatide (INTEGRILIN) , tirofiban (AGGRASTAT) , and defibrotide. In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include, adenosine reuptake inhibitors, such as, dipyridamole (PERSANTINE) . In certain embodiments, pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include, but are not limited to, warfarin (and related coumarins) , heparin, direct thrombin inhibitors (such as lepirudin, bivalirudin) , apixaban, LOVENOX (enoxaparin) , and small molecular compounds that interfere directly with the enzymatic action of particular coagulation factors (e.g. rivaroxaban, which interferes with Factor Xa) . In certain embodiments, the anticoagulant or antiplatelet agent is administered prior to administration of a pharmaceutical composition described herein. In certain embodiments, the anticoagulant or antiplatelet agent is administered following administration of a pharmaceutical composition described herein. In certain embodiments the anticoagulant or antiplatelet agent is administered at the same time as a pharmaceutical composition described herein. In certain embodiments, the dosage unit of a co-administered anticoagulant or antiplatelet agent is the same as the dosage unit that would be administered if the anticoagulant or antiplateletagent was administered alone. In certain embodiments the dosage unit of a co-administered anticoagulant or antiplatelet agent is lower than the dosage unit that would be administered if the anticoagulant or antiplatelet agent was administered alone. In certain embodiments the dosage unit of a co-administered anticoagulant or antiplatelet agent is greater than the dosage unit that would be administered if the anticoagulant or antiplatelet agent was administered alone. In certain embodiments, methods may comprise co-administering a pharmaceutical composition described herein with an anti-inflammatory agent. In certain embodiments, the anti-inflammatory agent modifies a symptom of the inflammatory disease or condition. In certain embodiments, the anti-inflammatory agent modifies progression of the inflammatory disease or condition. Non-limiting examples of inflammatory disesases and conditions are autoimmune diseases (e.g. arthritis, colitis or diabetes) , trauma, surgery, sepsis, allergic inflammation, and asthma. Non-limiting examples of anti-inflammatory agents include, but are not limited to, methotrexate, abatacept, infliximab, cyclophosphamide, azathioprine, corticosteroids, cyclosporin A, aminosalicylates, sulfasalazine, hydroxychloroquine, leflunomide, etanercept, efalizumab, 6-mercapto-purine (6-MP) , and tumor necrosis factor-alpha (TNFalpha) , and other cytokine blockers or antagonists. In certain embodiments, the anti-inflammatory agent comprises a non-steroidal anti-inflammatory drug (NSAID) . In certain embodiments, NSAIDs reduce inflammatory reactions in an animal. NSAIDS include, but are not limited to, acetyl salicylic acid, choline magnesium salicylate, diflunisal, magnesium salicylate, salsalate, sodium salicylate, diclofenac, etodolac, fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketorolac, meclofenamate, naproxen, nabumetone, phenylbutazone, piroxicam, sulindac, tolmetin, acetaminophen, ibuprofen, Cox-2 inhibitors, meloxicam and tramadol. In certain embodiments, methods comprise administering a pharmaceutical composition disclosed herein and an anti-inflammatory agent concomitantly or sequentially. In certain embodiments, methods comprise administering the anti inflammatory agent prior to administering the pharmaceutical composition described herein. In certain embodiments, methods comprise administering the anti-inflammatory agent after administering a pharmaceutical composition described herein. In certain embodiments, methods comprise administering the anti-inflammatory agent and a pharmaceutical composition described herein at the same time. In certain embodiments, the dosage unit of a co-administered anti-inflammatory agent is the same as the dosage unit that would be administered if the anti-inflammatory agent was administered alone. In certain embodiments the dosage unit of a co-administered anti-inflammatory agent is lower than the dosage unit that would be administered if the anti-inflammatory agent was administered alone. In certain embodiments the dosage unit of a co-administered anti-inflammatory agent is greater than the dosage unit that would be administered if the anticoagulant or antiplatelet agent was administered alone. In certain embodiments, the co-administration of a second pharmaceutical agent enhances the anticoagulant or anti-inflammatory effect of a pharmaceutical composition described herein, such that co administration of the two results in an anticoagulant or anti-inflammatory effect that is greater than the effect of administering the pharmaceutical composition described herein. In certain embodiments, the co-administration results in anticoagulant or anti-inflammatory effects that are additive of the effects of the two when administered alone. In certain embodiments, the co-administration results in anticoagulant or anti inflammatory effects that are supra-additive of the effects of the two when administered alone. In certain embodiments, co-administration of a second pharmaceutical agent increases an antithrombotic activity or anti-inflammatory activity of the pharmaceutical composition relative to that provided by the pharmaceutical composition alone, without increased bleeding risk. In certain embodiments, methods comprise co-administering a pharmaceutical composition described herein and an antiplatelet therapy to an animal in need thereof. In certain embodiments, the animal in need thereof may be an animal having a condition selected from thromboembolism, atrial fibrillation, a heart valve disorder, valvular heart disease, stroke, coronary artery disease (CAD) , and a mechanical heart valve, and a combination thereof. In certain embodiments, administering a pharmaceutical composition described herein in combination with an antiplatelet therapy results in little to no detectable increase in risk of bleeding as compared to antiplatelet therapy alone. In certain embodiments, the risk profile or risk indications are unchanged over antiplatelet therapy alone. In certain embodiments, methods comprise administering a pharmaceutical composition described herein to a dialysis patient, including but not limited to an animal with end stage renal disease (ESRD) or chronic kidney disease (CKD) , wherein the animal is co-administered at least one pharmaceutical agent selected from heparin, erythropoietin, darbopoetin, iron, Vitamin D or analogues thereof, phosphate binders, and a combination thereof. In certain embodimenst, the animal receives dialysis. In certain embodiments, the pharmaceutical agent is administered at a dose that does not differ from a comparative dose that would be prescribed in the absence of administering the pharmaceutical composition.
[0113] In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In certain embodiments, the dsRNA agent is administered to the subject by IV administration. In some embodiments, the method also includes determining an efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject. In some embodiments, a means of determining an efficacy of the treatment in the subject comprises: (i) determining one or more physiological characteristics of the FXI-associated disease or condition in the subject and (ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the FXI-associated disease or condition wherein the comparison indicates one or more of a presence, absence, and level of efficacy of the administration of the double-stranded ribonucleic acid (dsRNA) agent to the subject. In some embodiments, expression of the FXI gene can be assessed based on the level or change in level of any variable associated with FXI gene expression, such as FXI mRNA level, FXI protein level in the subject, or. the FXI protein may be an active form (FXIa) . FXI activity may be assessed with a blood test that characterizes coagulation of blood. blood tests are a partial thromboplastin time (PTT) test or activated partial thromboplastin time test (aPTT or APTT) .
[0114] According to another aspect of the invention, a method of decreasing a level of FXI protein in a subject compared to a baseline pre-treatment level of FXI protein in the subject, is provided, the method including administering to the subject an effective amount of an embodiment of any aforementioned dsRNA agent of the invention or an embodiment of any aforementioned composition of the invention, to decrease the level of FXI gene expression. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or is administered to the subject by IV administration.
[0115] According to another aspect of the invention, a method of altering a physiological characteristic of a FXI-associated disease or condition in a subject compared to a baseline pre-treatment physiological characteristic of the FXI-associated disease or condition in the subject is provided, the method including administering to the subject an effective amount of an embodiment of any aforementioned dsRNA agent of the invention or an embodiment of any aforementioned composition of the invention, to alter the physiological characteristic of the FXI-associated disease or condition in the subject. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or is administered to the subject by IV administration. In certain embodiments, the physiological characteristic is one or more of: FXI mRNA level, FXI protein level in the subject, or FXI activity. The FXI activity may cause a reduction in blood clotting activity in the animal. Blood clotting may be measured by a standard test, for example, but not limited to, activated partial thromboplastin time (aPTT) test, prothrombin time (PT) test, thrombin time (TCT) , bleeding time, or presence of D-dimer in a blood sample of the animal.
[0116] According to another aspect of the invention, an antisense polynucleotide agent for inhibiting expression of FXI protein is provided, the agent including from 10 to 30 contiguous nucleotides, wherein at least one of the contiguous nucleotides is a modified nucleotide, and wherein the nucleotide sequence of the agent is about 80%complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the equivalent region is any one of the target regions of SEQ ID NO: 1 and the complementary sequence is one provided in one of Tables 1-3. In certain embodiments, the antisense polynucleotide agent includes one of the antisense sequences provided in one of Tables 1-3.
[0117] According to another aspect of the invention, a composition including an embodiment of any aforementioned antisense polynucleotide agents is provided. In some embodiments, the composition also includes a pharmaceutically acceptable carrier. In some embodiments, the composition also includes one or more additional therapeutic agents for treatment of a FXI-associated disease or condition. In certain embodiments, the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial. In certain embodiments, the composition is formulated for subcutaneous or IV administration.
[0118] According to another aspect of the invention a cell that includes an embodiment of any of the aforementioned antisense polynucleotide agents is provided. In some embodiments, the cell is a mammalian cell, optionally a human cell.
[0119] According to another aspect of the invention, a method of inhibiting the expression of a FXI gene in a cell is provided, the method including: (i) preparing a cell including an effective amount of an embodiment of any aforementioned antisense polynucleotide agents. In some embodiments, the method also includes (ii) maintaining the cell prepared in (i) for a time sufficient to obtain degradation of the mRNA transcript of a FXI gene, thereby inhibiting expression of the FXI gene in the cell.
[0120] According to another aspect of the invention, a method of inhibiting expression of a FXI gene in a subject is provided, the method including administering to the subject an effective amount of an embodiment of any of the aforementioned antisense polynucleotide agent.
[0121] According to another aspect of the invention, a method of treating a disease or condition associated with the presence of FXI protein, the method including administering to a subject an effective amount of an embodiment of any of the aforementioned antisense polynucleotide agents or an embodiment of any aforementioned composition of the invention, to inhibit FXI gene expression. In certain embodiments, the disease or condition is thromboembolic condition. In certain embodiments, the thromboembolic condition is deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD) , including thrombosis associated with dialysis, or other procoagulant condition. Also provided are methods useful treating, preventing, or ameliorating a thromboembolic condition without increasing bleeding risk in an individual. In certain embodiments, the individual is at risk for a thromboembolic condition, including, but not limited to infarct, thrombosis, embolism, thromboembolism such as deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. Such diseases, disorders, and conditions can have one or more risk factors, causes, or outcomes in common. Certain risk factors and causes for development of a thromboembolic condition include immobility, surgery (particularly orthopedic surgery) , dialysis, malignancy, pregnancy, older age, use of oral contraceptives, atrial fibrillation, previous thromboembolic condition, chronic inflammatory disease, inherited or acquired prothrombotic clotting disorders and thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD) . Certain outcomes associated with development of a thromboembolic condition include decreased blood flow through an affected vessel, death of tissue, and death.
[0122] According to another aspect of the invention, a method of decreasing a level of FXI protein in a subject compared to a baseline pre-treatment level of FXI protein in the subject is provided, the method including administering to the subject an effective amount of an embodiment of any of the aforementioned antisense polynucleotide agents or an embodiment of any aforementioned composition of the invention, to decrease the level of FXI gene expression. In certain embodiments, the antisense polynucleotide agent is administered to the subject subcutaneously or by IV administration.Brief Description of the Drawings
[0123] Figure 1 is a graph showing FXI siRNA (AD00990-3, AD00991-2, AD00997-4, AD01003-1, AD02352-1, AD02375-2, AD02375-2, AD02375-3, AD02399-1) FXI activity after a single subcutaneous dose of siRNA compounds at 5 mg / kg.
[0124] Figure 2 is a graph showing FXI siRNA (AD00990-3, AD00991-2, AD00997-4, AD01003-1, AD02352-1, AD02375-2, AD02375-2, AD02375-3, AD02399-1) in monkey serum protein silencing effect after a single subcutaneous dose of siRNA compounds at 5 mg / kg.
[0125] Figure 3 is a graph showing the resullt of APTT remaining after a single subcutaneous dose of FXI siRNA (AD00990-3, AD00991-2, AD00997-4, AD01003-1, AD02352-1, AD02375-2, AD02375-2, AD02375-3, AD02399-1) at 5 mg / kg.
[0126] Brief Description of the Sequences
[0127] SEQ ID NO: 1 and SEQ ID NO: 2 (reverse complement) are Homo sapiens coagulation factor XI mRNA [NCBI Reference Sequence: NM_000128.4] .
[0128] SEQ ID NO: 3 and SEQ ID NO: 4 (reverse complement) are Mus musculus (house mouse) coagulation factor XI mRNA [NCBI Reference Sequence: NM_001411665.1] .
[0129] SEQ ID NOs: 5-487 are shown in Table 1 and are sense strand sequences.
[0130] SEQ ID NOs: 488-970 are shown in Table 1 and are antisense strand sequences.
[0131] SEQ ID NOs: 971-1446 are shown in Table 2 with chemical modifications.
[0132] SEQ ID NOs: 1447-1800 are shown in Table 3. A delivery molecule is indicated as “GLX-__” at the 3’ end or 5’ end of each sense strand.Detailed Description
[0133] The invention in part, includes RNAi agents, for example, though not limited to double stranded (ds) RNAi agents, which are capable of inhibiting coagulation factor XI (FXI) gene expression. The invention, in part also includes compositions comprising FXI RNAi agents and methods of use of the compositions. FXI RNAi agents disclosed herein may be attached to delivery compounds for delivery to cells, including to hepatocytes. Pharmaceutical compositions of the invention may include at least one dsRNA FXI agent and a delivery compound. In some embodiments of compositions and methods of the invention, the delivery compound is a GalNAc-containing delivery compound. FXI RNAi agents delivered to cells are capable of inhibiting FXI gene expression, thereby reducing activity in the cell of the FXI protein product of the gene. dsRNAi agents of the invention can be used to treat FXI -associated diseases and conditions.
[0134] In some embodiments of the invention reducing FXI expression in a cell or subject treats a disease or condition associated with FXI expression in the cell or subject, respectively. Non-limiting examples of diseases and conditions that may be treated by reducing FXI activity are: thromboembolic condition, such as deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD) , including thrombosis associated with dialysis, or other procoagulant condition, or other diseases for which reducing a level and activity of FXI protein is medically beneficial.
[0135] As used herein, "G, " "C, " "A" and "U" each generally stand for a nucleotide that contains guanine, cytosine, adenine, and uracil as a base, respectively. However, it will be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person understands that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of the invention by a nucleotide containing, for example, inosine. Sequences comprising such replacement moieties are embodiments of the invention.
[0136] As used herein, "coagulation factor XI gene expression " used interchangeably with the term "FXI" refers to the naturally occurring gene that encodes a cell inducing coagulation factor XI protein from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and guinea pig, unless specified otherwise. The term also refers to fragments and variants of native FXI that maintain at least one in vivo or in vitro activity of a native FXI. As used herein, the term "inhibiting coagulation factor XI gene expression " includes inhibiting the expression of the FXI gene as well as variants (e.g., naturally occurring variants) or mutants of the factor XI gene, inhibiting the expression of FXI mRNA, inhibiting the expression of FXI RNA transcript, and / or inhibiting the expression of FXI protein. The FXI gene may be a wild-type human FXI gene, a mutant human FXI gene, or a transgenic human FXI gene in the case of genetically manipulated cells, cell groups, or organisms. The amino acid and complete coding sequences of the reference sequence of the human FXI gene may be found in, for example, GenBank Ref Seq Accession No. NM_000128.4 (SEQ ID NO: 1 and SEQ ID NO: 2) . Mus musculus (house mouse) coagulation FXI mRNA GenBank Ref Seq Accession No.NM_001411665.1 (SEQ ID NO: 3 and SEQ ID NO: 4) ; . Additional examples of FXI mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, Ensembl and OMIM, for example, NM_001354804.2 (coagulation factor XI isoform 3 precursor) .
[0137] "Factor XI" , "FXI" , "Factor 11" and "F11" is used interchangeably herein. "Factor XI nucleic acid" or "Factor XI nucleic acid" means any nucleic acid encoding FXI. For example, in certain embodiments, a Factor XI nucleic acid includes a DNA sequence encoding Factor XI, an RNA sequence transcribed from DNA encoding Factor XI (including genomic DNA comprising introns and exons) , and an mRNA sequence encoding Factor XI. "Factor XI mRNA" means an mRNA encoding a Factor XI protein.
[0138] "FXI specific inhibitor" refers to any agent capable of specifically inhibiting the expression of FXI mRNA and / or FXI protein at the molecular level. For example, FXI specific inhibitors include nucleic acids (including antisense compounds) , peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of FXI mRNA and / or FXI protein. In certain embodiments, by specifically modulating FXI mRNA level and / or FXI protein expression, FXI specific inhibitors may affect components of the inflammatory pathway. Similarly, in certain embodiments, FXI specific inhibitors may affect other molecular processes in an animal.
[0139] The following describes how to make and use compositions comprising FXI single-stranded (ssRNA) and dsRNA agents to inhibit FXI gene expression, as well as compositions and methods for treating diseases and conditions caused by or modulated by FXI gene expression. The term “RNAi” is also known in the art, and may be referred to as “siRNA” .
[0140] As used herein, the term “RNAi” refers to an agent that comprises RNA and mediates targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. As is known in the art, an RNAi a target region refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a gene, including messenger RNA (mRNA) that is a product of RNA processing of a primary transcription product. The target portion of the sequence will be at least long enough to serve as a substrate for RNAi-directed cleavage at or near that portion. A target sequence may be from 8-30 nucleotides long (inclusive) , from 10 -30 nucleotides long (inclusive) , from 12 -25 nucleotides long (inclusive) , from 15 -23 nucleotides long (inclusive) , from 16 -23 nucleotides long (inclusive) , or from 18 –23 nucleotides long (inclusive) , including all shorter lengths within each stated range. In some embodiments of the invention, a target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides long. In certain embodiment a target sequence is between 9 and 26 nucleotides long (inclusive) , including all sub-ranges and integers there between. For example, though not intended to be limiting, in certain embodiments of the invention a target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long, with the sequence fully or at least substantially complementary to at least part of an RNA transcript of a FXI gene. Some aspects of the invention include pharmaceutical compositions comprising one or more FXI dsRNA agents and a pharmaceutically acceptable carrier. In certain embodiments of the invention, a FXI RNAi as described herein inhibits expression of FXI protein.
[0141] As used herein, a “dsRNA agent” means a composition that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting translation of messenger RNA (mRNA) transcripts of a target mRNA in a sequence specific manner. Although not wishing to be limited to a particular theory, dsRNA agents of the invention may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells) , or by any alternative mechanism (s) or pathway (s) . Methods for silencing genes in plant, invertebrate, and vertebrate cells are well known in the art [see, for example, (Sharp et al., Genes Dev. 2001, 15: 485; Bernstein, et al., (2001) Nature 409: 363; Nykanen, et al., (2001) Cell 107: 309; and Elbashir, et al., (2001) Genes Dev. 15: 188) ] , the disclosure of each of which is incorporated herein by reference in its entirety. ] . Art-known gene silencing procedures can be used in conjunction with the disclosure provided herein to inhibit expression of FXI.
[0142] DsRNA agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to short interfering RNAs (siRNAs) , RNAi agents, micro RNAs (miRNAs) , short hairpin RNAs (shRNA) , and dicer substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the mRNA being targeted. It is understood in the art that different lengths of dsRNA duplex structure can be used to inhibit target gene expression. For example, dsRNAs having a duplex structure of 19, 20, 21, 22, and 23 base pairs are known to be effective to induce RNA interference (Elbashir et al., EMBO 2001, 20: 6877-6888) . It is also known in the art that shorter or longer RNA duplex structures are also effective to induce RNA interference. FXI dsRNAs in certain embodiments of the invention can include at least one strand of a length of minimally 21 nt or may have shorter duplexes based on one of the sequences set forth in any one of Tables 1-3, but minus 1, 2, 3, or 4 nucleotides on one or both ends may also be effective as compared to the dsRNAs set forth in Tables 1-3, respectively. In some embodiments of the invention, FXI dsRNA agents may have a partial sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from one or more sequences of Tables 1-3, and differ in their ability to inhibit the expression of a FXI gene by not more than 5%, 10%, 15%, 20%, 25%, or 30%from the level of inhibition resulting from a dsRNA comprising the full sequence. A sense sequence, an antisense sequence and a duplex disclosed in Tables 1-3 may be referred to herein as a “parent” sequence, meaning that the sequences disclosed in Tables 1-3 may be modified, shorten, lengthened, include substitutions, etc. as set forth herein, with the resulting sequences retaining all or at least a portion of the efficacy of their parent sequences in methods and compositions of the invention. Sense and antisense strands included in a dsRNA of the invention are independently selected. As used herein the term “independently selected” means each of two or more like elements can be selected independent of the selection of the other elements. For example, though not intended to be limiting, in preparing a dsRNA of the invention, one may select the “elements” of the two strands to include in the duplex. One selected element, the sense sequence may be SEQ ID NO: 971 (shown in Table 2) and the other selected element, the antisense sequence, may be SEQ ID NO: 1209, or may be SEQ ID NO: 1209 that is modified, shortened, lengthened, and / or includes 1, 2, or 3 substitutions as compared to its parent sequence SEQ ID NO: 491. It will be understood that a duplex of the invention need not include both sense and antisense sequences shown as paired in duplexes in Tables 1-3. Each sense and antisense strand sequence in the tables is immediately followed by its SEQ ID NO.
[0143] Certain embodiments of compositions and methods of the invention comprise a single-strand RNA in a composition and / or administered to a subject. For example, an antisense strand such as one listed in any one of Tables 1-3 may be a composition or in a composition administered to a subject to reduce FXI polypeptide activity and / or expression of FXI gene in the subject. Tables 1-3 show certain FXI dsRNA agent antisense strand and sense strand core stretch base sequences. A single-strand antisense molecule that may be included in certain compositions and / or administered in certain methods of the invention are referred to herein as a “single-strand antisense agent” or an “antisense polynucleotide agent” . A single-strand sense molecule that may be included in certain compositions and / or administered in certain methods of the invention are referred to herein as a “single-strand sense agent” or a “sense polynucleotide agent” . The term “base sequence” is used herein in reference to a polynucleotide sequence without chemical modifications or delivery compounds. For example, the sense strand GCAAGGUCUUUUCAGGAUGAA (SEQ ID NO: 6) shown in Table 1 is the base sequence for SEQ ID NO: 972 in Table 2 and for SEQ ID NO: 1447 in Table 3, with SEQ ID NO: 972 and SEQ ID NO: 1447 shown with their chemical modifications and a delivery compound. Sequences disclosed herein may be assigned identifiers. For example, a single-stranded sense sequence may be identified with a “Sense strand SS#” ; a single stranded antisense sequence may be identified with an “Antisense strand AS#” and a duplex that includes a sense strand and an antisense strand may be identified with a “Duplex AD# / AV#” .
[0144] Table 1 includes sense and antisense strands and provides the identification number of duplexes formed from the sense and antisense strand on the same line in Table 1. In certain embodiments of the invention an antisense sequence includes nucleobase u or nucleobase a in position 1 of the antisense sequence. In certain embodiments of the invention an antisense sequence includes nucleobase u in position 1 of the antisense sequence. As used herein, the term “matching position” in a sense and an antisense strand are the positions in each strand that “pair” when the two strands are duplexed strands. For example, in a 21 nucleobases sense strand and a 21 nucleobases antisense strand, nucleobase in position 1 of the sense strand and position 21 in the antisense strand are in “matching positions” . In yet another non-limiting example in a 23 nucleobases sense strand and a 23 nucleobases antisense strand, nucleobase 2 of the sense strand and position 22 of the antisense strand are in matching positions. In another non-limiting example, in an 18 nucleobases sense strand and an 18 nucleobases antisense strand, nucleobase in position 1 of the sense strand and nucleobase 18 in the antisense strand are in matching positions, and nucleobase 4 in the sense strand and nucleobase 15 in the antisense strand are in matching positions. A skilled artisan will understand how to identify matching positions in sense and antisense strands that are or will be duplexed strands and paired strands.
[0145] The first column in Table 1 indicates a Duplex AV#for a duplex that includes the sense and antisense sequences in the same table row. For example, Table 1 discloses the duplex assigned Duplex AV#AV01118. um, which includes sense strand SEQ ID NO: 6 and antisense strand SEQ ID NO: 489. Thus, each row in Table 1 identifies a duplex of the invention, each comprising the sense and antisense sequences shown in the same row, with the assigned identifier for each duplex shown in the first column in the row.
[0146] In some embodiments of methods of the invention, an RNAi agent comprising a polynucleotide sequence shown in any one of Tables 1-3 is administered to a subject. In some embodiments of the invention an RNAi agent administered to a subject comprises is a duplex comprising at least one of the base sequences set forth in Table 1, including 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 sequence modifications. In some embodiments of methods of the invention an RNAi agent comprising a polynucleotide sequence shown in any one of Tables 1-3 is attached to a delivery molecule, a non-limiting example of which is a delivery compound comprising a GalNAc compound, or a GLS-15*compound.
[0147] In certain embodiments of the invention a dsRNA (also referred to herein as a “duplex” ) is one disclosed in one of Tables 1-3. Each row in Tables 1-3 discloses a duplex comprising the sequence of the sense strand and the sequence of the antisense strand in that table row. In addition to the duplexes disclosed in Tables 1-3, it will be understood that in some embodiments, a duplex of the invention may include sense and antisense sequences shown in Tables 1-3, that differ by zero, one, two, or three nucleotides shown in a sequence shown in Tables 1-3. It will be understood that the sequence of the sense strand and the sequence of the antisense strand in a duplex of the invention may be independently selected. Thus, a dsRNA of the invention may comprise a sense strand and an antisense strand of a duplex disclosed in a row in Tables 1-3. Alternatively, in a dsRNA of the invention, one or both of the selected sense and antisense strand in the dsRNA may include sequences shown in Tables 1-3 but with one or both of the sense and antisense sequences including 1, 2, 3, or more nucleobase substitutions from the parent sequence. The selected sequences may in some embodiments be longer or shorter than their parent sequence. As non-limiting examples, in some embodiments, a sense strand in a duplex of the invention may be SEQ ID NO: 6, 7, 9 longer than SEQ ID NO: 489, 490, 492, respectively. Thus, dsRNA agents included in the invention can but need not include exact sequences of the sense and antisense pairs disclosed as duplexes in Tables 1-3.
[0148] In some embodiments, a dsRNA agent comprises a sense strand and an antisense strand, nucleotide positions 2 to 18 in the antisense strand comprising a region of complementarity to a FXI RNA transcript, wherein the region of complementarity comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally comprising a targeting ligand. In some instances, the region of complementarity to the FXI RNA transcript comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by no more than 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3. In some embodiments of a dsRNA agent of the invention, the antisense strand of the dsRNA is at least substantially complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments, an antisense strand of a dsRNA agent of the invention is fully complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments a dsRNA agent includes a sense strand sequence set forth in any one of Tables 1-3, and the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In other embodiments, a dsRNA agent of the invention comprises a sense strand sequence set forth in any one of Tables 1-3, and the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some instances, a dsRNA agent of the invention comprises an antisense strand sequence set forth in any one of Tables 1-3. Some embodiments of a dsRNA agent of the invention comprises the sense and antisense sequences disclosed as duplex in any of Tables 1-3. As described herein, it will be understood that the sense and antisense strands in a duplex of the invention may be independently selected.
[0149] Mismatches
[0150] It is known to skilled in art, mismatches are tolerated for efficacy in dsRNA, especially the mismatches are within terminal region of dsRNA. Certain mismatches tolerate better, for example mismatches with wobble base pairs G: U and A: C are tolerated better for efficacy (Du et el., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21; 33 (5) : 1671-7. Doi: 10.1093 / nar / gki312. Nucleic Acids Res. 2005; 33 (11) : 3698) . Some embodiments of methods and compounds of the invention a FXI dsRNA agent may contain one or more mismatches to the FXI target sequence. In some embodiments, FXI dsRNA agent of the invention includes no mismatches. In certain embodiments, FXI dsRNA agent of the invention includes no more than 1 mismatch. In some embodiments, FXI dsRNA agent of the invention includes no more than 2 mismatches. In certain embodiments, FXI dsRNA agent of the invention includes no more than 3 mismatches. In some embodiments of the invention, an antisense strand of a FXI dsRNA agent contains mismatches to a FXI target sequence that are not located in the center of the region of complementarity. In some embodiments, the antisense strand of the FXI dsRNA agent includes 1, 2, 3, 4, or more mismatches that are within the last 5, 4, 3, 2, or 1 nucleotide from one or both of the 5' or 3' end of the region of complementarity. Methods described herein and / or methods known in the art can be used to determine whether a FXI dsRNA agent containing a mismatch to a FXI target sequence is effective in inhibiting the expression of the FXI gene.
[0151] Complementarity
[0152] As used herein, unless otherwise indicated, the term “complementary, ” when used to describe a first nucleotide sequence (e.g., FXI dsRNA agent sense strand or targeted FXI mRNA) in relation to a second nucleotide sequence (e.g., FXI dsRNA agent antisense strand or a single-stranded antisense polynucleotide) , means the ability of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize [form base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro) ] and form a duplex or double helical structure under certain conditions with an oligonucleotide or polynucleotide including the second nucleotide sequence. Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. A skilled artisan will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification.
[0153] Complementary sequences, for example, within a FXI dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. It will be understood that in embodiments when two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs are not regarded herein as mismatches with regard to the determination of complementarity. For example, a FXI dsRNA agent comprising one oligonucleotide 19 nucleotides in length and another oligonucleotide 20 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 19 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein. Thus, as used herein, “fully complementary” means that all (100%) of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.
[0154] The term “substantially complementary” as used herein means that in a hybridized pair of nucleobase sequences, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, but not all, of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The term “substantially complementary” can be used in reference to a first sequence with respect to a second sequence if the two sequences include one or more, for example at least 1, 2, 3, 4, or 5 mismatched base pairs upon hybridization for a duplex up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs (bp) , while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of FXI gene expression via a RISC pathway.
[0155] The term, “partially complementary” may be used herein in reference to a hybridized pair of nucleobase sequences, in which at least 75%, but not all, of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. In some embodiments, “partially complementary” means at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide.
[0156] The terms “complementary, ” “fully complementary, ” “substantially complementary, ” and “partially complimentary” are used herein in reference to the base matching between the sense strand and the antisense strand of a FXI dsRNA agent, between the antisense strand of a FXI dsRNA agent and a sequence of a target FXI mRNA, or between a single-stranded antisense oligonucleotide and a sequence of a target FXI mRNA. It will be understood that the term “antisense strand of a FXI dsRNA agent” may refer to the same sequence of an “FXI antisense polynucleotide agent” .
[0157] As used herein, the term “substantially identical” or “substantial identity” used in reference to a nucleic acid sequence means a nucleic acid sequence comprising a sequence with at least about 85%sequence identity or more, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, compared to a reference sequence. Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The inventions disclosed herein encompasses nucleotide sequences substantially identical to those disclosed herein. e.g., in Tables 1-3. In some embodiments, the sequences disclosed herein are exactly identical, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%percent identical to those disclosed herein, e.g., in Tables 1-3.
[0158] As used herein, the term “strand comprising a sequence” means an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature. The term “double-stranded RNA” or “dsRNA, ” as used herein, refers to an RNAi that includes an RNA molecule or complex of molecules having a hybridized duplex region comprising two anti-parallel and substantially or fully complementary nucleic acid strands, which are referred to as having “sense” and “antisense” orientations with respect to a target FXI RNA. The duplex region can be of any length that permits specific degradation of a desired target FXI RNA through a RISC pathway but will typically range from 9 to 30 base pairs in length, e.g., 15-30 base pairs in length. Considering a duplex between 9 and 30 base pairs, the duplex can be any length in this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and any sub-range therein between, including, but not limited to 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. FXI dsRNA agents generated in the cell by processing with Dicer and similar enzymes are generally in the range of 19-22 base pairs in length. One strand of the duplex region of a FXI dsDNA agent comprises a sequence that is substantially complementary to a region of a target FXI RNA. The two strands forming the duplex structure can be from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. Where the duplex region is formed from two strands of a single molecule, the molecule can have a duplex region separated by a single stranded chain of nucleotides (herein referred to as a “hairpin loop” ) between the 3'-end of one strand and the 5'-end of the respective other strand forming the duplex structure. In some embodiments of the invention, a hairpin look comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more unpaired nucleotides. Where the two substantially complementary strands of a FXI dsRNA agent are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than a hairpin loop, the connecting structure is referred to as a “linker. ” The term “siRNA” is also used herein to refer to a dsRNA agent as described herein.
[0159] In some embodiments of the invention a FXI dsRNA agent may include a sense and antisense sequence that have no-unpaired nucleotides or nucleotide analogs at one or both terminal ends of the dsRNA agent. An end with no unpaired nucleotides is referred to as a “blunt end” and as having no nucleotide overhang. If both ends of a dsRNA agent are blunt, the dsRNA is referred to as “blunt ended. ” In some embodiments of the invention, a first end of a dsRNA agent is blunt, in some embodiments a second end of a dsRNA agent is blunt, and in certain embodiments of the invention, both ends of a FXI dsRNA agent are blunt.
[0160] In some embodiments of dsRNA agents of the invention, the dsRNA does not have one or two blunt ends. In such instances there is at least one unpaired nucleotide at the end of a strand of a dsRNA agent. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least 1, 2, 3, 4, 5, 6, or more nucleotides. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. It will be understood that in some embodiments a nucleotide overhang is on a sense strand of a dsRNA agent, on an antisense strand of a dsRNA agent, or on both ends of a dsRNA agent and nucleotide (s) of an overhang can be present on the 5' end, 3' end or both ends of either an antisense or sense strand of a dsRNA. In certain embodiments of the invention, one or more of the nucleotides in an overhang is replaced with a nucleoside thiophosphate.
[0161] As used herein, the term “antisense strand” or “guide strand” refers to the strand of a FXI dsRNA agent that includes a region that is substantially complementary to a FXI target sequence. As used herein the term “sense strand, ” or “passenger strand” refers to the strand of a FXI dsRNA agent that includes a region that is substantially complementary to a region of the antisense strand of the FXI dsRNA agent.
[0162] Modifications
[0163] In some embodiments of the invention the RNA of a FXI RNAi agent is chemically modified to enhance stability and / or one or more other beneficial characteristics. Nucleic acids in certain embodiments of the invention may be synthesized and / or modified by methods well established in the art, for example, those described in “Current protocols in Nucleic Acid Chemistry, "Beaucage, S.L. et al. (Eds. ) , John Wiley &Sons, Inc., New York, N. Y., USA, which is incorporated herein by reference. Modifications that can be present in certain embodiments of FXI dsRNA agents of the invention include, for example, (a) end modifications, e.g., 5' end modifications (phosphorylation, conjugation, inverted linkages, etc. ) 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc. ) , (b) base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides) , or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar, as well as (d) backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of RNA compounds useful in certain embodiments of FXI dsRNA agents, FXI antisense polynucleotides, and FXI sense polynucleotides of the invention include, but are not limited to RNAs comprising modified backbones or no natural internucleoside linkages. As a non-limiting example, an RNA having a modified backbone may not have a phosphorus atom in the backbone. RNAs that do not have a phosphorus atom in their internucleoside backbone may be referred to as oligonucleosides. In certain embodiments of the invention, a modified RNA has a phosphorus atom in its internucleoside backbone.
[0164] It will be understood that the term “RNA molecule” or “RNA” or “ribonucleic acid molecule” encompasses not only RNA molecules as expressed or found in nature, but also analogs and derivatives of RNA comprising one or more ribonucleotide / ribonucleoside analogs or derivatives as described herein or as known in the art. The terms “ribonucleoside” and “ribonucleotide” may be used interchangeably herein. An RNA molecule can be modified in the nucleobase structure or in the ribose-phosphate backbone structure, e.g., as described herein below, and molecules comprising ribonucleoside analogs or derivatives must retain the ability to form a duplex. As non-limiting examples, an RNA molecule can also include at least one modified ribonucleoside including but not limited to a 2'-O-methyl modified nucleoside, a nucleoside comprising a 5' phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, a 2'-deoxy-2'-fluoro modified nucleoside, a 2'-amino-modified nucleoside, 2'-alkyl-modified nucleoside, morpholino nucleoside, a phosphoramidate or a non-natural base comprising nucleoside, or any combination thereof. In some embodiments of the invention, an RNA molecule comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or up to the full length of the FXI dsRNA agent molecule’s ribonucleosides that are modified ribonucleosides. The modifications need not be the same for each of such a plurality of modified ribonucleosides in an RNA molecule.
[0165] DsRNA agents, FXI antisense polynucleotides, and / or FXI sense polynucleotides of the invention may, in some embodiments comprise one or more independently selected modified nucleotide and / or one or more independently selected non-phosphodiester linkage. As used herein the term “independently selected” used in reference to a selected element, such as a modified nucleotide, non-phosphodiester linkage, etc., means that two or more selected elements can but need not be the same as each other.
[0166] As used herein, a “nucleotide base, ” “nucleotide, ” or “nucleobase” is a heterocyclic pyrimidine or purine compound, which is a standard constituent of all nucleic acids, and includes the bases that form the nucleotides adenine, guanine, cytosine, thymine, and uracil. A nucleobase may further be modified to include, though not intended to be limiting: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. The term “ribonucleotide” or “nucleotide” may be used herein to refer to an unmodified nucleotide, a modified nucleotide, or a surrogate replacement moiety. Those in the art will recognize that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety.
[0167] As used herein, "optionally" or "optionally" means that the event or environment described later may, but need not, occur, including where the event or environment occurred or did not occur. For example, "C1-6 alkyl optionally substituted by halogen or cyano" means that halogen or cyano may, but not necessarily, be present, including the case where alkyl is substituted by halogen or cyano and the case where alkyl is not substituted by halogen and cyano.
[0168] As used herein, in the chemical structures of the compounds of the present disclosure, the bond represents an unspecified configuration, i.e., if a chiral isomer is present in the chemical structure, the bond can be or both two configurations. Although some of the above structural formulas are depicted as some isomeric forms for simplicity, the present disclosure may include all isomers, such as tautomers, rotamers, and mixtures thereof. Suitable chiral compounds include: geometric isomers, diastereomers, racemates and enantiomers.
[0169] As used herein as a non-limiting example, one way of characterizing the chiral (asymmetric) phosphorothioates linkage phosphorus atom (s) using the traditional IUPAC R-Ssystem nomenclature. In the present disclosure, regulating an absolute configuration of phosphorus to the R-configuration may be called regulating to "Rp" , and regulating an absolute configuration to the S-configuration may be called regulating to "Sp" . In the chirally-modified dsRNA agent, the (Rp) and / or (Sp) phosphorothioates connects two nucleotides to form a dinucleotide, each nucleotide of a dinucleotide connected by the site specific (e.g., terminal) , dinucleotide comprise one or more of (Rp) and / or (Sp) phosphorothioates the following formulas, respectively, wherein "B" indicates a nucleobase, the labels "R" and "S" in all the strand denote Rp and Sp configuration of the linkage phosphorus atom:
[0170] Unless otherwise indicated, the internucleotide linkages of modified oligonucleotides (e.g., a chirally-modified dsRNA agent) described herein can be stereorandom or in a particular stereochemical configuration or racemic or achiral. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003) , Wan et al. Nuc. Acid. Res. 42, 13456 (2014) , Nucleic Acids Research, 2022, Vol. 50, No. 3 1221–1240, and WO 2017 / 015555. In some embodiments, internucleotide linkages of modified oligonucleotides (e.g., a chirally-modified dsRNA agent) described herein can be achiral (e.g., a phosphodiester linkage (PO) is achiral) .
[0171] The chiral purity with respect to the chiral linkage phosphorus atom for each terminal, chirally modified internucleotide linkage is at least 50%, for instance, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or virtually 100%. At least some of the nucleosides in at least one region selected from the group consisting of the terminal regions and the middle region being bonded together by bonds including asymmetric phosphorus atoms, and absolute configurations of the asymmetric phosphorus atoms being regulated, wherein at least some of the nucleosides in the middle region are bonded by bonds including asymmetric phosphorus atoms, and an absolute configuration of each asymmetric phosphorus atom is regulated to an Sp-configuration or an Rp-configuration, or bonds including asymmetric phosphorus atoms in which an absolute configuration of each asymmetric phosphorus atom is not regulated.
[0172] Non-limiting examples of internucleotide linkages including asymmetric phosphorus atoms are also described in WO2014 / 012081, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO2019 / 126651, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, WO 2019 / 032612, WO2020257194, WO2021237223, WO2021 / 092371, and / or WO202349218 etc.
[0173] In some embodiments, a non-limiting example of a internucleotide linkage including asymmetric phosphorus atom may have a structure shown in Formula I-6 or Formula I-7,
[0174] wherein RL is independently -LL, -R' or -N=C (-LL-R') , LL is independently -L, is a covalent bond or an optionally substituted, linear or branched group selected from C1-C30 aliphatic group, and C1-C30 hetetroaliphatic group having 1-10 heteroatoms, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C (R') 2, -Cy-, -O-, -S-, -S-S-, -N (R') -, --C (O) -, -C (S) -, -C (NR') -, -C (O) N (R') -, -N (R') C (O) N (R') -, -N (R') C (O) -, -N (R') C (O) O-, -OC (O) N (R') -, -S (O) -, -S (O) 2-, -S (O) 2N (R') -, -N (R') S (O)2-, -SC (O) -, -C (O) S-, -OC (O) -, or -C (O) O-;
[0175] each R′is independently -R, -C (O) R, -CO2R, or -SO2R;
[0176] each R is independently hydrogen, or an optionally substituted group selected from C1-C30 aliphatic, C1-C30 heteroaliphatic having 1-10 heteroatoms, C6-C30 aryl, C6-C30 aryl aliphatic, C6-C30 aryl heteroaliphatic having 1-10 heteroatoms, 5-30 membered heteroaryl having 1-10 heteroatoms, or 5-30 membered heterocyclyl having 1-10 heteroatoms; or two R groups are optionally and independently taken together to form a covalent bond, or: two or more R groups on the same atom are optionally and independently taken together with the atom to form an optionally substituted, 3-30 membered, monocyclic, bicyclic or polycyclic ring having, in addition to the atom, 0-10 heteroatoms; or two or more R groups on two or more atoms are optionally and independently taken together with their intervening atoms to form an optionally substituted, 3-30 membered, monocyclic, bicyclic or polycyclic ring having, in addition to the intervening atoms, 0-10 heteroatoms.
[0177] each independently represents a connection to a nucleoside.
[0178] In some embodiments, each independently represents a connection between 3'-carbon of the first nucleoside and 5'-carbon of the second nucleoside and vice versa.
[0179] In some embodiments, another non-limiting example of a internucleotide linkage including asymmetric phosphorus atom is illustrated as u (01*) .
[0180] As used herein, used in the chemical formulas of the present disclosure may be attached to any one or more groups according to the scope of the invention described herein.
[0181] In one embodiment, modified RNAs contemplated for use in methods and compositions described herein are peptide nucleic acids (PNAs) that have the ability to form the required duplex structure and that permit or mediate the specific degradation of a target RNA via a RISC pathway. In certain embodiments of the invention, a FXI RNA interference agent includes a single stranded RNA that interacts with a target FXI RNA sequence to direct the cleavage of the target FXI RNA.
[0182] Modified RNA backbones can include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. Means of preparing phosphorus-containing linkages are routinely practiced in the art and such methods can be used to prepare certain modified FXI dsRNA agents, certain modified FXI antisense polynucleotides, and / or certain modified FXI sense polynucleotides of the invention.
[0183] Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside) ; siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. Means of preparing modified RNA backbones that do not include a phosphorus atom are routinely practiced in the art and such methods can be used to prepare certain modified FXI dsRNA agents, certain modified FXI antisense polynucleotides, and / or certain modified FXI sense polynucleotides of the invention.
[0184] In certain embodiments of the invention, RNA mimetics are included in FXI dsRNAs, FXI antisense polynucleotides, and / or FXI sense polynucleotides, such as, but not limited to: replacement of the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units with novel groups. In such embodiments, base units are maintained for hybridization with an appropriate FXI nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA) . In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Means of preparing RNA mimetics are routinely practiced in the art and such methods can be used to prepare certain modified FXI dsRNA agents of the invention.
[0185] Some embodiments of the invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular -CH2-NH-CH2-, -CH2-N (CH3) -O-CH2- [known as a methylene (methylimino) or MMI backbone] , -CH2-O-N (CH3) -CH2-, -CH2-N (CH3) -N (CH3) -CH2-and -N (CH3) -CH2- [wherein the native phosphodiester backbone is represented as -O-P-O-CH2-] . Means of preparing RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones are routinely practiced in the art and such methods can be used to prepare certain modified FXI dsRNA agents, certain FXI antisense polynucleotides, and / or certain FXI sense polynucleotides of the invention.
[0186] Modified RNAs can also contain one or more substituted sugar moieties. FXI dsRNAs, FXI antisense polynucleotides, and / or FXI sense polynucleotides of the invention may comprise one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Exemplary suitable modifications include O [ (CH2) nO] mCH3, O (CH2) nOCH3, O (CH2) nNH2, O (CH2) nCH3, O (CH2) nONH2, and O (CH2) nON [ (CH2) nCH3) ] 2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2' position: C1 to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of a FXI dsRNA agent, or a group for improving the pharmacodynamic properties of a FXI dsRNA agent, FXI antisense polynucleotide, and / or FXI sense polynucleotide, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O- (2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78: 486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a O (CH2) 2ON (CH3) 2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE) , i.e., 2'-O-CH2-O-CH2-N (CH3) 2. Means of preparing modified RNAs such as those described are routinely practiced in the art and such methods can be used to prepare certain modified FXI dsRNA agents of the invention.
[0187] Other modifications include 2'-methoxy (2'-OCH3) , 2'-aminopropoxy (2'-OCH2CH2CH2NH2) and 2'-fluoro (2'-F) . Similar modifications can also be made at other positions on the RNA of a FXI dsRNA agent, FXI antisense polynucleotide, and / or FXI sense polynucleotide of the invention, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked FXI dsRNAs, FXI antisense polynucleotides, or FXI sense polynucleotides, and the 5' position of 5' terminal nucleotide. FXI dsRNA agents, FXI antisense polynucleotides, and / or FXI sense polynucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Means of preparing modified RNAs such as those described are routinely practiced in the art and such methods can be used to prepare certain modified FXI dsRNA agents, FXI antisense polynucleotides, and / or FXI sense polynucleotides of the invention.
[0188] A FXI dsRNA agent, FXI antisense polynucleotide, and / or FXI sense polynucleotide may, in some embodiments, include nucleobase (often referred to in the art simply as "base" ) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine and uracil. Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C) , 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil) , 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Additional nucleobases that may be included in certain embodiments of FXI dsRNA agents of the invention are known in the art, see for example: Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, Ed. John Wiley &Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Means of preparing dsRNAs, FXI antisense strand polynucleotides and / or FXI sense strand polynucleotides that comprise nucleobase modifications and / or substitutions such as those described herein are routinely practiced in the art and such methods can be used to prepare certain modified FXI dsRNA agents, FXI sense polynucleotides, and / or FXI antisense polynucleotides of the invention.
[0189] Certain embodiments of FXI dsRNA agents, FXI antisense polynucleotides, and / or FXI sense polynucleotides of the invention include RNA modified to include one or more locked nucleic acids (LNA) . A locked nucleic acid is a nucleotide with a modified ribose moiety comprising an extra bridge connecting the 2' and 4' carbons. This structure effectively “locks” the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids in a FXI dsRNA agent, FXI antisense polynucleotides, and / or FXI sense polynucleotides of the invention may increase stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33 (1) : 439-447; Mook, O R. et al., (2007) Mol Canc Ther 6 (3) : 833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31 (12) : 3185-3193) . Means of preparing dsRNA agents, FXI antisense polynucleotides, and / or FXI sense polynucleotides that comprise locked nucleic acid (s) are routinely practiced in the art and such methods can be used to prepare certain modified FXI dsRNA agents of the invention.
[0190] Certain embodiments of FXI dsRNA compounds, sense polynucleotides, and / or antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: a 2’ -O-methyl nucleotide, 2’ -Fluoro nucleotide, 2’ -deoxy nucleotide, 2’3’ -seco nucleotide mimic, locked nucleotide, 2’ -F-Arabino nucleotide, 2’ -methoyxyethyl nucleotide, 2’-amino-modified nucleotide, 2’ -alkyl-modified nucleotide, mopholino nucleotide, and 3’ -Ome nucleotide, a nucleotide comprising a 5’ -phosphorothioate group, or a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2’ -amino-modified nucleotide, a phosphoramidate, or a non-natural base comprising nucleotide. In some embodiments, a FXI dsRNA compound includes an E-vinylphosphonate nucleotide at the 5′ end of the antisense strand, also referred to herein as the guide strand.
[0191] Certain embodiments of FXI dsRNA compounds, 3’ and 5’ end of sense polynucleotides, and / or 3’ end of antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: abasic nucleotide, ribitol, inverted nucleotide, inverted abasic nucleotide, inverted 2’ -OMe nucleotide, inverted 2’ -deoxy nucleotide. It is known to skilled in art, including an abasic or inverted abasic nucleotide at the end of oligonucleotide enhances stability (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003; 31 (11) : 2705-2716. doi: 10.1093 / nar / gkg393) . In some embodiments, a FXI dsRNA compound includes one or more inverted abasic residues (invab) at either 3’-end or 5’ -end, or both 3’ -end and 5’ -end. Exemplified inverted abasic residues (invab) include, but are not limited to the following:
[0192] Certain embodiments of FXI dsRNA compounds, 3’ and 5’ end of sense polynucleotides, and / or 3’ end of antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: isomannide nucleotide or stereoisomer of said isomannide nucleotide. Specific examples of isomannide nucleotides or stereoisomers of said isomannide nucleotides include, but are not limited to: wherein the phrase “Olig” each independently represents a polynucleotide moiety. Exemplified isomannide residues (imann) include, but are not limited to, the following:
[0193] In certain embodiments, the isomannide nucleotides may further conjugate to one or more targeting groups or delivery molecules, such as GalNAc moieties.
[0194] Certain embodiments of FXI dsRNA compounds, antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises unlocked nucleic acid nucleotide (UNA) or / and glycol nucleic acid nucleotide (GNA) . It is known to skilled in art, UNA and GNA are thermally destabilizing chemical modifications, can significantly improves the off-target profile of a siRNA compound (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018; 9 (1) : 723. doi: 10.1038 / s41467-018-02989-4; Laursen et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010; 6: 862–70) .
[0195] In some embodiments, the phosphate mimic is a 5’ -vinyl phosphonate (VP) . In exemplary embodiments, a vinyl phosphonate of the disclosure has the following structure:
[0196] A vinyl phosphonate of the instant disclosure may be attached to either the antisense or the sense strand of a dsRNA of the disclosure. In certain preferred embodiments, a vinyl phosphonate of the instant disclosure is attached to the antisense strand of a dsRNA, optionally at the 5’ end of the antisense strand of the dsRNA.
[0197] In certain embodiments, a vinyl phosphonate modified nucleotide of the disclosure has the structure of formula (V) :
[0198] wherein X is O or S;
[0199] R is hydrogen, hydroxy, fluoro, or C1-20 alkoxy (e.g., methoxy or n-hexadecyloxy) ;
[0200] R5'is =C (H) -P (O) (OH) 2 and the double bond between the C5' carbon and R5' is in the E or Z orientation (e.g., E orientation) ; and
[0201] B is a nucleobase or a modified nucleobase, optionally where B is adenine, guanine, cytosine, thymine, or uracil.
[0202] In certain embodiments, R5' is =C (H) -P (O) (OH) 2 and the double bond between the C5’ carbon and R5’ is in the E orientation. In certain embodiments, R is methoxy and R5'is =C (H) -P (O) (OH) 2 and the double bond between the C5’ carbon and R5’ is in the E orientation. In certain embodiments, X is S, R is methoxy, and R5'is =C (H) -P (O) (OH) 2 and the double bond between the C5’ carbon and R5’ is in the E orientation.
[0203] Vinyl phosphonate modifications are also contemplated for the dsRNAs, the compositions and methods of the instant disclosure. An exemplary vinyl phosphonate structure is:
[0204] In certain embodiments, a vinyl phosphonate modified nucleotide is VPu*which has the structure of as follows:
[0205] Examples of certain the phosphate mimic of the 5'-terminal nucleotid of the invention are disclosed in PCT Application: WO2024 / 208249 (incorporated herein in its entirety) .
[0206] In many cases, protecting groups are used during the preparation of the compounds of the invention. As used herein, the term "protected" means that the indicated moiety has a protecting group appended thereon. In some embodiments of the invention, compounds contain one or more protecting groups. A wide variety of protecting groups can be employed in the methods of the invention. In general, protecting groups render chemical functionalities inert to specific reaction conditions, and can be appended to and removed from such functionalities in a molecule without substantially damaging the remainder of the molecule. Protecting groups in general and hydroxyl protecting groups in particular are well known in the art (Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed., John Wiley &Sons, New York, 1991) .
[0207] As used herein, examples of protecting groups (e.g., hydroxyl protecting groups) include, but are not limited to, methyl, ethyl, benzyl (Bn) , phenyl, isopropyl, tert-butyl, acetyl, chloroacetyl, trichloro acetyl, trifluoroacetyl, pivaloyl, tert-butoxymethyl, methoxymethyl, 1-ethoxyethyl, 1- (2-chloroethoxy) ethyl, allyl, cyclohexyl, 9-fluorenylmethoxycarbonyl (Fmoc) , methanesulfonate, toluenesulfonate, triflate, benzoyl, benzoylformate , p-phenylbenzoyl, 4-methoxybenzyl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, 4-chlorobenzyl, 4-nitrobenzyl, 2, 4-dinitrophenyl, 4-acyloxybenzyl, 2-methylphenyl, 2, 6-dimethylphenyl, 2-chlorophenyl, 2, 6-dichlorobenzyl, diphenylmethyl, triphenylmethyl, 4-methylthio-1-butyl, S-acetylthioacetate (SATA) , 2-cyanoethyl, 2-cyano-l, 1-dimethylethyl (CDM) , 4-cyano-2-butenyl, 2- (trimethylsilyl) ethyl (TSE) , 2-(phenylthio) ethyl, 2- (triphenylsilyl) ethyl, 2- (benzylsulfonyl) ethyl, 2, 2, 2-trichloroethyl, 2, 2, 2-tribromoethyl, 2, 3-dibromopropyl, 2, 2, 2-trifluoroethyl, phenylthio, 2-chloro-4-tritylphenyl, 2-bromophenyl, 2- [N-isopropyl-N- (4-methoxybenzoyl) amino] ethyl, 4- (N-trifluoroacetylamino) butyl, 4-oxopentyl, 4-tritylaminophenyl, 4-benzyl aminophenyl, tetrahydropyranyl, morpholino, trimethylsilyl, triethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triphenyl Silyl, triisopropylsilyl, pivaloyloxymethyl (POM) and 9-phenylxanthine-9-yl.
[0208] As used herein, examples of amino protecting groups include, but are not limited to, carbamate protecting groups, such as 2-trimethylsilylethoxycarbonyl (Teoc) , 1-methyl-1- (4-biphenyl) ethoxycarbonyl (Bpoc) , tert-butyloxycarbonyl (BOC) , allyloxycarbonyl (Alloc) , 9-fluorenyl-methoxycarbonyl (Fmoc) , benzyloxycarbonyl (Cbz) ; amide protecting groups, such as formyl, acetyl, pivaloyl, trihaloacetyl, benzoyl, 2-nitrobenzenesulfonyl; and imine and cyclic imide protecting groups, such as phthalimido and dithiasuccinoyl. Equivalents of these amino-protecting groups are also encompassed by the compounds and methods of the invention.
[0209] Another modification that may be included in the RNA of certain embodiments of FXI dsRNA agents, FXI antisense polynucleotides, and / or FXI sense polynucleotides of the invention, comprises chemically linking to the RNA one or more ligands, moieties or conjugates that enhance one or more characteristics of the FXI dsRNA agent, FXI antisense polynucleotide, and / or FXI sense polynucleotide, respectively. Non-limiting examples of characteristics that may be enhanced are: FXI dsRNA agent, FXI antisense polynucleotide, and / or FXI sense polynucleotide activity, cellular distribution, delivery of a FXI dsRNA agent, pharmacokinetic properties of a FXI dsRNA agent, and cellular uptake of the FXI dsRNA agent. In some embodiments of the invention, a FXI dsRNA agent comprises one or more targeting groups or linking groups, which in certain embodiments of FXI dsRNA agents of the invention are conjugated to the sense strand. A non-limiting example of a targeting group is a compound comprising N-acetyl-galactosamine (GalNAc) . The terms “targeting group” , “targeting agent” , “linking agent” , “targeting compound” , “delivery molecule” , “delivery compound” and “targeting ligand” may be used interchangeably herein. In certain embodiments of the invention a FXI dsRNA agent comprises a targeting compound that is conjugated to the 5'-terminal end of the sense strand. In certain embodiments of the invention a FXI dsRNA agent comprises a targeting compound that is conjugated to the 3'-terminal end of the sense strand. In some embodiments of the invention, a FXI dsRNA agent comprises a targeting group that comprises GalNAc. In certain embodiments of the invention a FXI dsRNA agent does not include a targeting compound conjugated to one or both of the 3'-terminal end and the 5'-terminal end of the sense strand. In certain embodiments of the invention a FXI dsRNA agent does not include a GalNAc containing targeting compound conjugated to one or both of the 5'-terminal end and the 3'-terminal end of the sense strand.
[0210] Additional targeting and linking agents are well known in the art, for example, targeting and linking agents that may be used in certain embodiments of the invention include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556) , cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4: 1053-1060) , a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N. Y. Acad. Sci., 1992, 660: 306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3: 2765-2770) , a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20: 533-538) , an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10: 1111-1118; Kabanov et al., FEBS Lett., 1990, 259: 327-330; Svinarchuk et al., Biochimie, 1993, 75: 49-54) , a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18: 3777-3783) , a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides &Nucleotides, 1995, 14: 969-973) , or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654) , a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264: 229-237) , or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277: 923-937) .
[0211] Certain embodiments of a composition comprising a FXI dsRNA agent, FXI antisense polynucleotide, and / or FXI sense polynucleotide may comprise a ligand that alters distribution, targeting, or etc. of the FXI dsRNA agent. In some embodiments of a composition comprising a FXI dsRNA agent of the invention, the ligand increases affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. A ligand useful in a composition and / or method of the invention may be a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA) , low-density lipoprotein (LDL) , or globulin) ; a carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid) ; or a lipid. A ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid or polyamine. Examples of polyamino acids are a polylysine (PLL) , poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly (L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N- (2-hydroxypropyl) methacrylamide copolymer (HMPA) , polyethylene glycol (PEG) , polyvinyl alcohol (PVA) , polyurethane, poly (2-ethylacryllic acid) , N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL) , spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.
[0212] A ligand included in a composition and / or method of the invention may comprise a targeting group, non-limiting examples of which are a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody that binds to a specified cell type such as a kidney cell or a liver cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.
[0213] Other examples of ligands include dyes, intercalating agents (e.g. acridines) , cross-linkers (e.g. psoralene, mitomycin C) , porphyrins (TPPC4, texaphyrin, Sapphyrin) , polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine) , artificial endonucleases (e.g. EDTA) , lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1, 3-Bis-O (hexadecyl) glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1, 3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide) , alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K) , MPEG, [MPEG] 2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin) , transport / absorption facilitators (e.g., aspirin, vitamin E, folic acid) , synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles) , dinitrophenyl, HRP, or AP.
[0214] A ligand included in a composition and / or method of the invention may be a protein, e.g., glycoprotein, or peptide, for example a molecule with a specific affinity for a co-ligand, or an antibody, for example an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, cardiac cell, or bone cell. A ligand useful in an embodiment of a composition and / or method of the invention can be a hormone or hormone receptor. A ligand useful in an embodiment of a composition and / or method of the invention can be a lipid, lectin, carbohydrates, vitamin, cofactos, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose. A ligand useful in an embodiment of a composition and / or method of the invention can be a substance that can increase uptake of the FXI dsRNA agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and / or intermediate filaments. Non-limiting examples of this type of agent are: taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, and myoservin.
[0215] In some embodiments, a ligand attached to a FXI dsRNA agent of the invention functions as a pharmacokinetic (PK) modulator. An example of a PK modulator that may be used in compositions and methods of the invention includes but is not limited to: a lipophiles, a bile acid, a steroid, a phospholipid analogue, a peptide, a protein binding agent, PEG, a vitamin, cholesterol, a fatty acid, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, a phospholipid, a sphingolipid, naproxen, ibuprofen, vitamin E, biotin, an aptamer that binds a serum protein, etc. Oligonucleotides comprising a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone may also be used in compositions and / or methods of the invention as ligands.
[0216] FXI dsRNA agent compositions
[0217] In some embodiments of the invention, a FXI dsRNA agent is in a composition. A composition of the invention may include one or more FXI dsRNA agent and optionally one or more of a pharmaceutically acceptable carrier, a delivery agent, a targeting agent, detectable label, etc. A non-limiting example of a targeting agent that may be useful according to some embodiments of methods of the invention is an agent that directs a FXI dsRNA agent of the invention to and / or into a cell to be treated. A targeting agent of choice will depend upon such elements as: the nature of the FXI-associated disease or condition, and on the cell type being targeted. In a non-limiting example, in some embodiments of the invention it may be desirable to target a FXI dsRNA agent to and / or into a liver cell. It will be understood that in some embodiments of methods of the invention, a therapeutic agent comprises a FXI dsRNA agent with only a delivery agent, such as a delivery agent comprising N-Acetylgalactosamine (GalNAc) , without any additional attached elements. For example, in some aspects of the invention a FXI dsRNA agent may be attached to a delivery compound comprising GalNAc and included in a composition comprising a pharmaceutically acceptable carrier and administered to a cell or subject without any detectable labels, or targeting agents, etc. attached to the FXI dsRNA agent.
[0218] In cases where a FXI dsRNA agent of the invention is administered with and / or attached to one or more delivery agents, targeting agents, labeling agents, etc. a skilled artisan will be aware of and able to select and use suitable agents for use in methods of the invention. Labeling agents may be used in certain methods of the invention to determine the location of a FXI dsRNA agent in cells and tissues and may be used to determine a cell, tissue, or organ location of a treatment composition comprising a FXI dsRNA agent that has been administered in methods of the invention. Procedures for attaching and utilizing labeling agents such as enzymatic labels, dyes, radiolabels, etc. are well known in the art. It will be understood that in some embodiments of compositions and methods of the invention, a labeling agent is attached to one or both of a sense polynucleotide and an antisense polynucleotide included in a FXI dsRNA agent.
[0219] Delivery of FXI dsRNA agents and FXI antisense polynucleotide agents
[0220] Certain embodiments of methods of the invention, includes delivery of a FXI dsRNA agent into a cell. As used herein the term, “delivery” means facilitating or effecting uptake or absorption into the cell. Absorption or uptake of a FXI dsRNA agent can occur through unaided diffusive or active cellular processes, or by use of delivery agents, targeting agents, etc. that may be associated with a FXI dsRNA agent of the invention. Delivery means that are suitable for use in methods of the invention include, but are not limited to: in vivo delivery, in which a FXI dsRNA agent is in injected into a tissue site or administered systemically. In some embodiments of the invention, a FXI dsRNA agent is attached to a delivery agent.
[0221] Non-limiting examples of methods that can be used to deliver FXI dsRNA agents to cells, tissues and / or subjects include: FXI dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have been used successfully in the art to deliver therapeutic RNAi agents for treatment of various diseases and conditions, such as but not limited to: liver diseases, acute intermittent porphyria (AIP) , hemophilia, pulmonary fibrosis, etc. Details of various delivery means are found in publications such as: Nikam, R.R. &K.R. Gore (2018) Nucleic Acid Ther, 28 (4) , 209-224 Aug 2018; Springer A. D. &S.F. Dowdy (2018) Nucleic Acid Ther. Jun 1; 28 (3) : 109–118; Lee, K. et al., (2018) Arch Pharm Res, 41 (9) , 867-874; and Nair, J.K. et al., (2014) J. Am. Chem. Soc. 136: 16958-16961, the content each of which is incorporated by reference herein.
[0222] Some embodiments of the invention comprise use of lipid nanoparticles (LNPs) to deliver a FXI dsRNA agent of the invention to a cell, tissue, and / or subject. LNPs are routinely used for in vivo delivery of FXI dsRNA agents, including therapeutic FXI dsRNA agents. One benefit of using an LNP or other delivery agent is an increased stability of the FXI RNA agent when it is delivered to a subject using the LNP or other delivery agent. In some embodiments of the invention an LNP comprises a cationic LNP that is loaded with one or more FXI RNAi molecules of the invention. The LNP comprising the FXI RNAi molecule (s) is administered to a subject, the LNPs and their attached FXI RNAi molecules are taken up by cells via endocytosis, their presence results in release of RNAi trigger molecules, which mediate RNAi.
[0223] Another non-limiting example of a delivery agent that may be used in embodiments of the invention to delivery a FXI dsRNA agent of the invention to a cell, tissue and / or subject is an agent comprising GalNAc that is attached to a FXI dsRNA agent of the invention and delivers the FXI dsRNA agent to a cell, tissue, and / or subject. Examples of certain additional delivery agents comprising GalNAc that can be used in certain embodiments of methods and composition of the invention are disclosed in PCT Application: WO2020191183A1, WO2023 / 045995A1 (incorporated herein in its entirety) . A non-limiting example of a GalNAc targeting ligand that can be used in compositions and methods of the invention to deliver a FXI dsRNA agent to a cell is a targeting ligand cluster. Examples of targeting ligand clusters that are presented herein are referred to as: GalNAc Ligand with phosphodiester link (GLO) and GalNAc Ligand with phosphorothioate link (GLS *) . The term “GLX-n” may be used herein to indicate the attached GalNAc-containing compound is any one of compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of each of which is shown below, with the below with location of attachment of the GalNAc-targeting ligand to an RNAi agent of the invention at far right of each (shown with ) . It will be understood that any RNAi and dsRNA molecule of the invention can be attached to the GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structures of GLO-1 through GLO-16 and GLS-1*through GLS-16*are shown below.
[0224] In certain embodiments, the aforesaid isomannide nucleotides may further conjugate to one or more GalNAc targeting ligands. Specific examples of isomannide nucleotides conjugated to a GalNAc targeting ligand include, but are not limited to:
[0225] In some embodiments of the invention, in vivo delivery can also be by a beta-glucan delivery system, such as those described in U.S. Pat. Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005 / 0281781, which are hereby incorporated by reference in their entirety. In vitro introduction of a FXI RNAi agent into a cell may also be done using art-known methods such as electroporation and lipofection. In certain embodiments of methods of the invention, a FXI dsRNA is delivered without a targeting agent. These RNAs may be delivered as “naked” RNA molecules. As a non-limiting example, a FXI dsRNA of the invention may be administered to a subject to treat a FXI-associated disease or condition in the subject, such as a liver disease, in a pharmaceutical composition comprising the RNAi agent, but not including a targeting agent such as a GalNAc targeting compound.
[0226] In addition to certain delivery means described herein, it will be understood that RNAi delivery means, such as but not limited to those described herein and those used in the art, can be used in conjunction with embodiments of FXI RNAi agents and treatment methods described herein.
[0227] FXI dsRNA agents of the invention may be administered to a subject in an amount and manner effective to reduce a level and activity of FXI polypeptide in a cell and / or subject. In some embodiments of methods of the invention one or more FXI dsRNA agents are administered to a cell and / or subject to treat a disease or condition associated with FXI expression and activity. Methods of the invention, in some embodiments, include administering one or more FXI dsRNA agents to a subject in need of such treatment to reduce a disease or condition associated with FXI expression in the subject. FXI dsRNA agents or FXI antisense polynucleotide agents of the invention can be administered to reduce FXI expression and / or activity in one more of in vitro, ex vivo, and in vivo cells.
[0228] In some embodiments of the invention, a level, and thus an activity, of FXI polypeptide in a cell is reduced by delivering (e.g. introducing) a FXI dsRNA agent or FXI antisense polynucleotide agent into a cell. Targeting agents and methods may be used to aid in delivery of a FXI dsRNA agent or FXI antisense polynucleotide agent to a specific cell type, cell subtype, organ, spatial region within a subject, and / or to a sub-cellular region within a cell. A FXI dsRNA agent can be administered in certain methods of the invention singly or in combination with one or more additional FXI dsRNA agents. In some embodiments, 2, 3, 4, or more independently selected FXI dsRNA agents are administered to a subject.
[0229] In certain embodiments of the invention, a FXI dsRNA agent is administered to a subject to treat a FXI-associated disease or condition in conjunction with one or more additional therapeutic regimens for treating the FXI-associate disease or condition. Non-limiting examples of additional therapeutic regimens are: administering one or more FXI antisense polynucleotides of the invention, administering a non-FXI dsRNA therapeutic agent, and a behavioral modification. An additional therapeutic regimen may be administered at a time that is one or more of: prior to, simultaneous with, and following administration of a FXI dsRNA agent of the invention. It will be understood that simultaneous with as used herein, within five minutes of time zero, within 10 minutes of time zero, within 30 minutes of time zero, within 45 minutes of time zero, and within 60 minutes of time zero, with “time zero” the time of administration of the FXI dsRNA agent of the invention to the subject. Non-limiting examples of non-FXI dsRNA therapeutic agents are: NSAID / Cyclooxygenase inhibitors, such as, aspirin; adenosine diphosphate (ADP) receptor inhibitors, such as, clopidogrel (PLAVIX) and ticlopidine (TICLID) . ; phosphodiesterase inhibitors, such as, cilostazol (PLETAL) ; glycoprotein IIB / IIIA inhibitors, such as, abciximab (REOPRO) , eptifibatide (INTEGRILIN) , tirofiban (AGGRASTAT) , and defibrotide; adenosine reuptake inhibitors, such as, dipyridamole (PERSANTINE) ; warfarin (and related coumarins) , heparin; direct thrombin inhibitors. such as lepirudin, bivalirudin, apixaban, LOVENOX (enoxaparin) ; and small molecular compounds that interfere directly with the enzymatic action of particular coagulation factors (e.g. rivaroxaban, which interferes with Factor Xa) . These and other therapeutic agents and behavior modifications are known in the art and used to treat a FXI disease or condition in a subject and may be administered to a subject in combination with the administration of one or more FXI dsRNA agents of the invention to treat the FXI disease or condition. A FXI dsRNA agent of the invention administered to a cell or subject to treat a FXI-associated disease or condition may act in a synergistic manner with one or more other therapeutic agents or activities and increase the effectiveness of the one or more therapeutic agents or activities and / or to increase the effectiveness of the FXI dsRNA agent at treating the FXI-associated disease or condition.
[0230] Treatment methods of the invention that include administration of a FXI dsRNA agent can be used prior to the onset of a FXI-associated disease or condition and / or when a FXI-associated disease or condition is present, including at an early stage, mid-stage, and late stage of the disease or condition and all times before and after any of these stages. Methods of the invention may also be to treat subjects who have previously been treated for a FXI-associated disease or condition with one or more other therapeutic agents and / or therapeutic activities that were not successful, were minimally successful, and / or are no longer successful at treating the FXI-associated disease or condition in the subject.
[0231] Vector Encoded dsRNAs
[0232] In certain embodiments of the invention, a FXI dsRNA agent can be delivered into a cell using a vector. FXI dsRNA agent transcription units can be included in a DNA or RNA vector. Prepare and use of such vectors encoding transgenes for delivering sequences into a cell and or subject are well known in the art. Vectors can be used in methods of the invention that result in transient expression of FXI dsRNA, for example for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks. The length of the transient expression can be determined using routine methods based on elements such as, but not limited to the specific vector construct selected and the target cell and / or tissue. Such transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92: 1292) .
[0233] An individual strand or strands of a FXI dsRNA agent can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced to a cell using means such as transfection or infection. In certain embodiments each individual strand of a FXI dsRNA agent of the invention can be transcribed by promoters that are both included on the same expression vector. In certain embodiments of the invention a FXI dsRNA agent is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the FXI dsRNA agent has a stem and loop structure.
[0234] Non-limiting examples of RNA expression vectors are DNA plasmids or viral vectors. Expression vectors useful in embodiments of the invention can be compatible with eukaryotic cells. Eukaryotic cell expression vectors are routinely used in the art and are available from a number of commercial sources. Delivery of FXI dsRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from a subject followed by reintroduction into the subject, or by any other means that allows for introduction into a desired target cell.
[0235] Viral vector systems that may be included in an embodiment of a method of the include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc. ; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Constructs for the recombinant expression of a FXI dsRNA agent may include regulatory elements, such as promoters, enhancers, etc., which may be selected to provide constitutive or regulated / inducible expression. Viral vector systems, and the use of promoters and enhancers, etc. are routine in the art and can be used in conjunction with methods and compositions described herein.
[0236] Certain embodiments of the invention include use of viral vectors for delivery of FXI dsRNA agents into cells. Numerous adenovirus-based delivery systems are routinely used in the art for deliver to, for example, lung, liver, the central nervous system, endothelial cells, and muscle. Non-limiting examples of viral vectors that may be used in methods of the invention are: AAV vectors, a pox virus such as a vaccinia virus, a Modified Virus Ankara (MVA) , NYVAC, an avipox such as fowl pox or canary pox.
[0237] Certain embodiments of the invention include methods of delivering FXI dsRNA agents into cells using a vector and such vectors may be in a pharmaceutically acceptable carrier that may, but need not, include a slow release matrix in which the gene delivery vehicle is imbedded. In some embodiments, a vector for delivering a FXI dsRNA can be produced from a recombinant cell, and a pharmaceutical composition of the invention may include one or more cells that produced the FXI dsRNA delivery system.
[0238] Pharmaceutical Compositions Containing FXI dsRNA or ssRNA agents
[0239] Certain embodiments of the invention include use of pharmaceutical compositions containing a FXI dsRNA agent or FXI antisense polynucleotide agent and a pharmaceutically acceptable carrier. The pharmaceutical composition containing the FXI dsRNA agent or FXI antisense polynucleotide agent can be used in methods of the invention to reduce FXI gene expression and FXI activity in a cell and is useful to treat a FXI-associated disease or condition. Such pharmaceutical compositions can be formulated based on the mode of delivery. Non-limiting examples of formulations for modes of delivery are: a composition formulated for subcutaneous delivery, a composition formulated for systemic administration via parenteral delivery, a composition formulated for intravenous (IV) delivery, a composition formulated for intrathecal delivery, a composition formulated for direct delivery into brain, etc. Administration of a pharmaceutic composition of the invention to deliver a FXI dsRNA agent or FXI antisense polynucleotide agent into a cell may be done using one or more means such as: topical (e.g., by a transdermal patch) , pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration. A FXI dsRNA agent or FXI antisense polynucleotide agent can also be delivered directly to a target tissue, for example directly into the liver, directly into a kidney, etc. It will be understood that “delivering a FXI dsRNA agent” or “delivering a FXI antisense polynucleotide agent” into a cell encompasses delivering a FXI dsRNA agent or FXI antisense polynucleotide agent, respectively, directly as well as expressing a FXI dsRNA agent in a cell from an encoding vector that is delivered into a cell, or by any suitable means with which the FXI dsRNA or FXI antisense polynucleotide agent becomes present in a cell. Preparation and use of formulations and means for delivering inhibitory RNAs are well known and routinely used in the art.
[0240] As used herein, a “pharmaceutical composition” comprises a pharmacologically effective amount of a FXI dsRNA agent or FXI antisense polynucleotide agent of the invention and a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” refers to a carrier for administration of a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture medium. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract. Agents included in drug formulations are described further herein below.
[0241] As used herein terms such as: “pharmacologically effective amount, ” “therapeutically effective amount” and “effective amount” refers to that amount of a FXI dsRNA agent or FXI antisense polynucleotide agent of the invention to produce the intended pharmacological, therapeutic or preventive result. For example, if a given clinical treatment is considered effective when there is at least a 10%reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to effect at least a 10%reduction in that parameter. For example, a therapeutically effective amount of a FXI dsRNA agent or FXI antisense polynucleotide agent can reduce FXI polypeptide levels by at least 10%.
[0242] Effective amounts
[0243] Methods of the invention, in some aspects comprise contacting a cell with a FXI dsRNA agent or FXI antisense polynucleotide agent in an effective amount to reduce FXI gene expression in the contacted cell. Certain embodiments of methods of the invention comprise administering a FXI dsRNA agent or a FXI antisense polynucleotide agent to a subject in an amount effective to reduce FXI gene expression and treat a FXI-associated disease or condition in the subject. An “effective amount” used in terms of reducing expression of FXI and / or for treating a FXI-associated disease or condition, is an amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of a FXI dsRNA agent or FXI antisense polynucleotide agent to treat a FXI-associated disease or condition could be that amount necessary to (i) slow or halt progression of the disease or condition; or (ii) reverse, reduce, or eliminate one or more symptoms of the disease or condition. In some aspects of the invention, an effective amount is that amount of a FXI dsRNA agent or FXI antisense polynucleotide agent that when administered to a subject in need of a treatment of a FXI-associated disease or condition, results in a therapeutic response that prevents and / or treats the disease or condition. According to some aspects of the invention, an effective amount is that amount of a FXI dsRNA agent or FXI antisense polynucleotide agent of the invention that when combined or co-administered with another therapeutic treatment for a FXI-associated disease or condition, results in a therapeutic response that prevents and / or treats the disease or condition. In some embodiments of the invention, a biologic effect of treating a subject with a FXI dsRNA agent or FXI antisense polynucleotide agent of the invention may be the amelioration and or absolute elimination of symptoms resulting from the FXI-associated disease or condition. In some embodiments of the invention, a biologic effect is the complete abrogation of the FXI-associated disease or condition, as evidenced for example, by a diagnostic test that indicates the subject is free of the FXI-associated disease or condition. A non-limiting example of a physiological symptom that may be detected includes a reduction in FXI level in liver of a subject following administration of an agent of the invention. Additional art-known means of assessing the status of a FXI-associated disease or condition can be used to determine an effect of an agent and / or methods of the invention on a FXI-associated disease or condition.
[0244] Typically an effective amount of a FXI dsRNA agent or FXI antisense polynucleotide agent to decrease FXI polypeptide activity to a level to treat a FXI-associated disease or condition will be determined in clinical trials, establishing an effective dose for a test population versus a control population in a blind study. In some embodiments, an effective amount will be that results in a desired response, e.g., an amount that diminishes a FXI-associated disease or condition in cells, tissues, and / or subjects with the disease or condition. Thus, an effective amount of a FXI dsRNA agent or FXI antisense polynucleotide agent to treat a FXI-associated disease or condition that can be treated by reducing FXI polypeptide activity may be the amount that when administered decreases the amount of FXI polypeptide activity in the subject to an amount that is less than the amount that would be present in the cell, tissue, and / or subject without the administration of the FXI dsRNA agent or FXI antisense polynucleotide agent. In certain aspects of the invention the level of FXI polypeptide activity, and / or FXI gene expression present in a cell, tissue, and / or subject that has not been contacted with or administered a FXI dsRNA agent or FXI antisense polynucleotide agent of the invention is referred to as a “control” amount. In some embodiments of methods of the invention a control amount for a subject is a pre-treatment amount for the subject, in other words, a level in a subject before administration of a FXI agent can be a control level for that subject and compared to a level of FXI polypeptide activity and / or FXI gene expression in the subject following siRNA administered to the subject. In the case of treating a FXI-associated disease or condition the desired response may be reducing or eliminating one or more symptoms of the disease or condition in the cell, tissue, and / or subject. The reduction or elimination may be temporary or may be permanent. It will be understood that the status of a FXI-associated disease or condition can be monitored using methods of determining FXI polypeptide activity, FXI gene expression, symptom evaluation, clinical testing, etc. In some aspects of the invention, a desired response to treatment of a FXI-associated disease or condition is delaying the onset or even preventing the onset of the disease or condition.
[0245] An effective amount of a compound that decreases FXI polypeptide activity may also be determined by assessing physiological effects of administration of a FXI dsRNA agent or FXI antisense polynucleotide agent on a cell or subject, such as a decrease of a FXI-associated disease or condition following administration. Assays and / or symptomatic monitoring of a subject can be used to determine efficacy of a FXI dsRNA agent or FXI antisense polynucleotide agent of the invention, which may be administered in a pharmaceutical compound of the invention, and to determine the presence or absence of a response to the treatment. A non-limiting example, is that one or more art-known tests of activated partial thromboplastin time (aPTT) , prothrombin time (PT) test, thrombin time (TCT) , bleeding time, or presence of D-dimer in a blood sample of the animal. Another non-limiting example, is that one or more art-known tests of liver function can be used to determine the status of the FXI-associated liver disease or condition in a subject before and after treatment of the subject with a FXI dsRNA agent of the invention.
[0246] Some embodiments of the invention include methods of determining an efficacy of an dsRNA agent or FXI antisense polynucleotide agent of the invention administered to a subject, to treat a FXI-associated disease or condition by assessing and / or monitoring one or more “physiological characteristics” of the FXI-associated disease or condition in the subject. Non-limiting examples of physiological characteristics of a FXI-associated disease or condition are the FXI mRNA level, the FXI protein level, or activated partial thromboplastin time (aPTT) , prothrombin time (PT) test, thrombin time (TCT) , bleeding time, or presence of D-dimer in a plasma, or a tissue sample, and / or accumulation of fat and / or expansion of lipid droplets in the liver, etc. Standard means of determining such physiological characteristic are known in the art and include, but are not limited to, blood tests, imaging studies, physical examination, etc.
[0247] It will be understood that the amount of a FXI dsRNA agent or FXI antisense polynucleotide agent administered to a subject can be modified based, at least in part, on such determinations of disease and / or condition status and / or physiological characteristics determined for a subject. The amount of a treatment may be varied for example by increasing or decreasing the amount of a FXI-dsRNA agent or FXI antisense polynucleotide agent, by changing the composition in which the FXI dsRNA agent or FXI antisense polynucleotide agent, respectively, is administered, by changing the route of administration, by changing the dosage timing and so on. The effective amount of a FXI dsRNA agent or FXI antisense polynucleotide agent will vary with the particular condition being treated, the age and physical condition of the subject being treated; the severity of the condition, the duration of the treatment, the nature of the concurrent therapy (if any) , the specific route of administration, and additional factors within the knowledge and expertise of the health practitioner. For example, an effective amount may depend upon the desired level of FXI polypeptide activity and or FXI gene expression that is effective to treat the FXI-associated disease or condition. A skilled artisan can empirically determine an effective amount of a particular FXI dsRNA agent or FXI antisense polynucleotide agent of the invention for use in methods of the invention without necessitating undue experimentation. Combined with the teachings provided herein, by selecting from among various FXI dsRNA agents or FXI antisense polynucleotide agents of the invention, and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned that is effective to treat the particular subject. As used in embodiments of the invention, an effective amount of a FXI dsRNA agent or FXI antisense polynucleotide agent of the invention can be that amount that when contacted with a cell results in a desired biological effect in the cell.
[0248] It will be recognized that FXI gene silencing may be determined in any cell expressing FXI, either constitutively or by genomic engineering, and by any appropriate assay. In some embodiments of the invention, FXI gene expression is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%by administration of a FXI dsRNA agent of the invention. In some embodiments of the invention, FXI gene expression is reduced by at between 5%and 10%, 5%and 25%, 10%and 50%, 10%and 75%, 25%and 75%, 25%and 100%, or 50%and 100%by administration of a FXI dsRNA agent of the invention.
[0249] Dosing
[0250] FXI dsRNA agents and FXI antisense polynucleotide agents are delivered in pharmaceutical compositions in dosages sufficient to inhibit expression of FXI genes. In certain embodiments of the invention, a dose of FXI dsRNA agent or FXI antisense polynucleotide agent is in a range of 0.01 to 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of 1 to 50 mg per kilogram body weight, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, 4 to 15 mg / kg body weight per day, inclusive. For example, the FXI dsRNA agent or FXI antisense polynucleotide agent can be administered in an amount that is from about 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3.0 mg / kg, 3.1 mg / kg, 3.2 mg / kg, 3.3 mg / kg, 3.4 mg / kg, 3.5 mg / kg, 3.6 mg / kg, 3.7 mg / kg, 3.8 mg / kg, 3.9 mg / kg, 4 mg / kg, 4.1 mg / kg, 4.2 mg / kg, 4.3 mg / kg, 4.4 mg / kg, 4.5 mg / kg, 4.6 mg / kg, 4.7 mg / kg, 4.8 mg / kg, 4.9 mg / kg, 5 mg / kg, 5.1 mg / kg, 5.2 mg / kg, 5.3 mg / kg, 5.4 mg / kg, 5.5 mg / kg, 5.6 mg / kg, 5.7 mg / kg, 5.8 mg / kg, 5.9 mg / kg, 6 mg / kg, 6.1 mg / kg, 6.2 mg / kg, 6.3 mg / kg, 6.4 mg / kg, 6.5 mg / kg, 6.6 mg / kg, 6.7 mg / kg, 6.8 mg / kg, 6.9 mg / kg, 7 mg / kg, 7.1 mg / kg, 7.2 mg / kg, 7.3 mg / kg, 7.4 mg / kg, 7.5 mg / kg, 7.6 mg / kg, 7.7 mg / kg, 7.8 mg / kg, 7.9 mg / kg, 8 mg / kg, 8.1 mg / kg, 8.2 mg / kg, 8.3 mg / kg, 8.4 mg / kg, 8.5 mg / kg, 8.6 mg / kg, 8.7 mg / kg, 8.8 mg / kg, 8.9 mg / kg, 9 mg / kg, 9.1 mg / kg, 9.2 mg / kg, 9.3 mg / kg, 9.4 mg / kg, 9.5 mg / kg, 9.6 mg / kg, 9.7 mg / kg, 9.8 mg / kg, 9.9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, through 50 mg / kg body per single dose.
[0251] Various factors may be considered in the determination of dosage and timing of delivery of a FXI dsRNA agent of the invention. The absolute amount of a FXI dsRNA agent or FXI antisense polynucleotide agent delivered will depend upon a variety of factors including a concurrent treatment, the number of doses and the individual subject parameters including age, physical condition, size and weight. These are factors well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. In some embodiments, a maximum dose can be used, that is, the highest safe dose according to sound medical judgment.
[0252] Methods of the invention may in some embodiments include administering to a subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses of a FXI dsRNA agent or FXI antisense polynucleotide agent. In some instances, a pharmaceutical compound, (e.g., comprising a FXI dsRNA agent or comprising a FXI antisense polynucleotide agent) can be administered to a subject at least daily, every other day, weekly, every other week, monthly, etc. Doses may be administered once per day or more than once per day, for example, 2, 3, 4, 5, or more times in one 24 hour period. A pharmaceutical composition of the invention may be administered once daily, or the FXI dsRNA agent or FXI antisense polynucleotide agent may be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In some embodiments of methods of the invention, a pharmaceutical composition of the invention is administered to a subject one or more times per day, one or more times per week, one or more times per month, or one or more times per year.
[0253] Methods of the invention, in some aspects, include administration of a pharmaceutical compound alone, in combination with one or more other FXI dsRNA agents or FXI antisense polynucleotide agents, and / or in combination with other drug therapies or treatment activities or regimens that are administered to subjects with a FXI-associated disease or condition. Pharmaceutical compounds may be administered in pharmaceutical compositions. Pharmaceutical compositions used in methods of the invention may be sterile and contain an amount of a FXI dsRNA agent or FXI antisense polynucleotide agent that will reduce activity of a FXI polypeptide to a level sufficient to produce the desired response in a unit of weight or volume suitable for administration to a subject. A dose administered to a subject of a pharmaceutical composition that includes a FXI dsRNA agent or FXI antisense polynucleotide agent to reduce FXI protein activity can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits.
[0254] Treatment
[0255] FXI-associated diseases and conditions in which a decrease in a level and / or activity of FXI polypeptide is effective to treat the disease or condition, can be treated using methods and FXI dsRNA agents of the invention to inhibit FXI expression. Examples of diseases and conditions that may be treated with a FXI dsRNA agent or FXI antisense polynucleotide agent of the invention and a treatment method of the invention, include, but are not limited to thromboembolic condition, the thromboembolic condition is deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD) , including thrombosis associated with dialysis, or other procoagulant condition. Also provided are methods useful treating, preventing, or ameliorating a thromboembolic condition without increasing bleeding risk in an individual. In certain embodiments, the individual is at risk for a thromboembolic condition, including, but not limited to infarct, thrombosis, embolism, thromboembolism such as deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. Such diseases, disorders, and conditions can have one or more risk factors, causes, or outcomes in common. Certain risk factors and causes for development of a thromboembolic condition include immobility, surgery (particularly orthopedic surgery) , dialysis, malignancy, pregnancy, older age, use of oral contraceptives, atrial fibrillation, previous thromboembolic condition, chronic inflammatory disease, inherited or acquired prothrombotic clotting disorders and thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD) . Certain outcomes associated with development of a thromboembolic condition include decreased blood flow through an affected vessel, death of tissue, and death. Such diseases and conditions may be referred to herein as “FXI-associated diseases and conditions” and “diseases and conditions caused and / or modulated by FXI. ”
[0256] In certain aspects of the invention, a subject may be administered a FXI dsRNA agent or FXI antisense polynucleotide agent of the invention at a time that is one or more of before or after diagnosis of a FXI-associated disease or condition. In some aspects of the invention, a subject is at risk of having or developing a FXI-associated disease or condition. A subject at risk of developing a FXI-associated disease or condition is one who has an increased probability of developing the FXI-associated disease or condition, compared to a control risk of developing the FXI-associated disease or condition. In some embodiments of the invention, a level of risk may be statistically significant compared to a control level of risk. A subject at risk may include, for instance, a subject who is, or will be, a subject who has a preexisting disease and / or a genetic abnormality that makes the subject more susceptible to a FXI-associated disease or condition than a control subject without the preexisting disease or genetic abnormality; a subject having a family and / or personal medical history of the FXI-associated disease or condition; and a subject who has previously been treated for a FXI-associated disease or condition. It will be understood that a preexisting disease and / or a genetic abnormality that makes the subject more susceptible to a FXI-associated disease or condition, may be a disease or genetic abnormality that when present has been previously identified as having a correlative relation to a higher likelihood of developing a FXI-associated disease or condition.
[0257] It will be understood that a FXI dsRNA agent or FXI antisense polynucleotide agent may be administered to a subject based on a medical status of the individual subject. For example, a health-care provided for a subject may assess a FXI level measured in a sample obtained from a subject and determine it is desirable to reduce the subject’s FXI level, by administration of a FXI dsRNA agent or FXI antisense polynucleotide agent of the invention. In this example, the FXI level may be considered to be a physiological characteristic of a FXI-associated condition, even if the subject is not diagnosed as having a FXI-assoicated disease such as one disclosed herein. A healthcare provider may monitor changes in the subject’s FXI level, as a measure of efficacy of the administered FXI dsRNA agent or FXI antisense polynucleotide agent of the invention. In a non-limiting example, a biological sample, such as a blood or serum sample may be obtained from a subject and a FXI level for the subject determined in the sample. A FXI dsRNA agent or FXI antisense polynucleotide agent is administered to the subject and a blood or liver sample is obtained from the subject following the administration and the FXI level determined using the sample and the results compared to the results determined in the subject’s pre-administration (prior) sample. A reduction in the subject’s FXI level in the later sample compared to the pre-administration level indicates the administered FXI dsRNA agent or FXI antisense polynucleotide agent efficacy in reducing the lipid level in the subject.
[0258] Certain embodiments of methods of the invention include adjusting a treatment that includes administering a dsRNA agent or a FXI antisense polynucleotide agent of the invention to a subject based at least in part on assessment of a change in one or more of the subject’s physiological characteristics of a FXI-associated disease or condition resulting from the treatment. For example, in some embodiments of the invention, an effect of an administered dsRNA agent or FXI antisense polynucleotide agent of the invention may be determined for a subject and used to assist in adjusting an amount of a dsRNA agent or FXI antisense polynucleotide agent of the invention subsequently administered to the subject. In a non-limiting example, a subject is administered a dsRNA agent or FXI antisense polynucleotide agent of the invention, the subject’s FXI level is determined after the administration, and based at least in part on the determined level, a greater amount of the dsRNA agent or FXI antisense polynucleotide agent is determined to be desirable in order to increase the physiological effect of the administered agent, for example to reduce or further reduce the subject’s FXI level. In another non-limiting example, a subject is administered a dsRNA agent or FXI antisense polynucleotide agent of the invention, the subject’s FXI level is determined after the administration and based at least in part on the determined level, a lower amount of the dsRNA agent or FXI antisense polynucleotide agent is desirable to administer to the subject.
[0259] Thus, some embodiments of the invention include assessing a change in one or more physiological characteristics of resulting from a subject’s previous treatment to adjust an amount of a dsRNA agent or FXI antisense polynucleotide agent of the invention subsequently administered to the subject. Some embodiments of methods of the invention include 1, 2, 3, 4, 5, 6, or more determinations of a physiological characteristic of a FXI-associated disease or condition to assess and / or monitor the efficacy of an administered FXI dsRNA agent or FXI antisense polynucleotide agent of the invention, and optionally using the determinations to adjust one or more of: a dose, administration regimen, and or administration frequency of a dsRNA agent or FXI antisense polynucleotide agent of the invention to treat a FXI-associated disease or condition in a subject. In some embodiments of methods of the invention, a desired result of administering an effective amount of a dsRNA agent or FXI antisense polynucleotide agent of the invention to a subject is a reduction of the subject’s the FXI mRNA level, the FXI protein level in the subject, or activated partial thromboplastin time (aPTT) , prothrombin time (PT) test, thrombin time (TCT) , bleeding time, or presence of D-dimer in a plasma, or a tissue sample, and / or accumulation of fat and / or expansion of lipid droplets in the liver, etc., as compared to a prior level determined for the subject, or to a control level.
[0260] As used herein, the terms “treat” , “treated” , or “treating” when used with respect to a FXI-associated disease or condition may refer to a prophylactic treatment that decreases the likelihood of a subject developing the FXI-associated disease or condition, and also may refer to a treatment after the subject has developed a FXI-associated disease or condition in order to eliminate or reduce the level of the FXI-associated disease or condition, prevent the FXI-associated disease or condition from becoming more advanced (e.g., more severe) , and / or slow the progression of the FXI-associated disease or condition in a subject compared to the subject in the absence of the therapy to reduce activity in the subject of FXI polypeptide.
[0261] Certain embodiments of agents, compositions, and methods of the invention can be used to inhibit FXI gene expression. As used herein in reference to expression of a FXI gene, the terms “inhibit, ” “silence, ” “reduce, ” “down-regulate, ” and “knockdown” mean the expression of the FXI gene, as measured by one or more of: a level of RNA transcribed from the gene, a level of activity of FXI expressed, and a level of FXI polypeptide, protein or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the FXI gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is contacted with (e.g., treated with) a FXI dsRNA agent or FXI antisense polynucleotide agent of the invention, compared to a control level of RNA transcribed from the FXI gene, a level of activity of expressed FXI, or a level of FXI translated from the MRNA, respectively. In some embodiments, a control level is a level in a cell, tissue, organ or subject that has not been contacted with (e.g. treated with) the FXI dsRNA agent or FXI antisense polynucleotide agent.
[0262] Administration methods
[0263] A variety of administration routes for a FXI dsRNA agent or FXI antisense polynucleotide agent are available for use in methods of the invention. The particular delivery mode selected will depend at least in part, upon the particular condition being treated and the dosage required for therapeutic efficacy. Methods of this invention, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of treatment of a FXI-associated disease or condition without causing clinically unacceptable adverse effects. In some embodiments of the invention, a FXI dsRNA agent or FXI antisense polynucleotide agent may be administered via an oral, enteral, mucosal, subcutaneous, and / or parenteral route. The term “parenteral” includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal, and intrasternal injection, or infusion techniques. Other routes include but are not limited to nasal (e.g., via a gastro-nasal tube) , dermal, vaginal, rectal, sublingual, and inhalation. Delivery routes of the invention may include intrathecal, intraventricular, or intracranial. In some embodiments of the invention, a FXI dsRNA agent or FXI antisense polynucleotide agent may be placed within a slow release matrix and administered by placement of the matrix in the subject. In some aspects of the invention, a FXI dsRNA agent or FXI antisense polynucleotide agent may be delivered to a subject cell using nanoparticles coated with a delivery agent that targets a specific cell or organelle. Various delivery means, methods, agents are known in the art. Non-limiting examples of delivery methods and delivery agents are additionally provided elsewhere herein. In some aspects of the invention, the term “delivering” in reference to a FXI dsRNA agent or FXI antisense polynucleotide agent may mean administration to a cell or subject of one or more “naked” FXI dsRNA agent or FXI antisense polynucleotide agent sequences and in certain aspects of the invention “delivering” means administration to a cell or subject via transfection means, delivering a cell comprising a FXI dsRNA agent or FXI antisense polynucleotide agent to a subject, delivering a vector encoding a FXI dsRNA agent or FXI antisense polynucleotide agent into a cell and / or subject, etc. Delivery of a FXI dsRNA agent or FXI antisense polynucleotide agent using a transfection means may include administration of a vector to a cell and / or subject.
[0264] In some methods of the invention one or more FXI dsRNA agents or FXI antisense polynucleotide agents may be administered in formulations, which may be administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients. In some embodiments of the invention a FXI dsRNA agent or FXI antisense polynucleotide agent may be formulated with another therapeutic agent for simultaneous administration. According to methods of the invention, a FXI dsRNA agent or FXI antisense polynucleotide agent may be administered in a pharmaceutical composition. In general, a pharmaceutical composition comprises a FXI dsRNA agent or FXI antisense polynucleotide agent and optionally, a pharmaceutically-acceptable carrier. Pharmaceutically-acceptable carriers are well-known to those of ordinary skill in the art. As used herein, a pharmaceutically-acceptable carrier means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients, e.g., the ability of the FXI dsRNA agent or FXI antisense polynucleotide agent to inhibit FXI gene expression in a cell or subject. Numerous methods to administer and deliver dsRNA agents or FXI antisense polynucleotide agents for therapeutic use are known in the art and may be utilized in methods of the invention.
[0265] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers and other materials that are well-known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Pat. No. 5,211,657 and others are known by those skilled in the art. Such preparations may routinely contain salt, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically-acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.
[0266] Some embodiments of methods of the invention include administering one or more FXI dsRNA agents or FXI antisense polynucleotide agents directly to a tissue. In some embodiments, the tissue to which the compound is administered is a tissue in which the FXI-associated disease or condition is present or is likely to arise, non-limiting examples of which are the liver or kidney. Direct tissue administration may be achieved by direct injection or other means. Many orally delivered compounds naturally travel to and through the liver and kidneys and some embodiments of treatment methods of the invention include oral administration of one or more FXI dsRNA agents to a subject. FXI dsRNA agents or FXI antisense polynucleotide agents, either alone or in conjunction with other therapeutic agents, may be administered once, or alternatively they may be administered in a plurality of administrations. If administered multiple times, the FXI dsRNA agent or FXI antisense polynucleotide agent may be administered via different routes. For example, though not intended to be limiting, a first (or first several) administrations may be made via subcutaneous means and one or more additional administrations may be oral and / or systemic administrations.
[0267] For embodiments of the invention in which it is desirable to administer a FXI dsRNA agent or FXI antisense polynucleotide agent systemically, the FXI dsRNA agent or FXI antisense polynucleotide agent may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with or without an added preservative. FXI dsRNA agent formulations (also referred to as pharmaceutical compositions) may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents.
[0268] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's , or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose) , and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Lower doses will result from other forms of administration, such as intravenous administration. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. Multiple doses per day may be used as needed to achieve appropriate systemic or local levels of one or more FXI dsRNA agents or FXI antisense polynucleotide agents and to achieve appropriate reduction in FXI protein activity.
[0269] In yet other embodiments, methods of the invention include use of a delivery vehicle such as biocompatible microparticle, nanoparticle, or implant suitable for implantation into a recipient, e.g., a subject. Exemplary bioerodible implants that may be useful in accordance with this method are described in PCT Publication No. WO 95 / 24929 (incorporated by reference herein) , which describes a biocompatible, biodegradable polymeric matrix for containing a biological macromolecule.
[0270] Both non-biodegradable and biodegradable polymeric matrices can be used in methods of the invention to deliver one or more FXI dsRNA agents or FXI antisense polynucleotide agents to a subject. In some embodiments, a matrix may be biodegradable. Matrix polymers may be natural or synthetic polymers. A polymer can be selected based on the period of time over which release is desired, generally in the order of a few hours to a year or longer. Typically, release over a period ranging from between a few hours and three to twelve months can be used. The polymer optionally is in the form of a hydrogel that can absorb up to about 90%of its weight in water and further, optionally is cross-linked with multivalent ions or other polymers.
[0271] In general, FXI dsRNA agents or FXI antisense polynucleotide agents may be delivered in some embodiments of the invention using the bioerodible implant by way of diffusion, or by degradation of the polymeric matrix. Exemplary synthetic polymers for such use are well known in the art. Biodegradable polymers and non-biodegradable polymers can be used for delivery of FXI dsRNA agents or FXI antisense polynucleotide agents using art-known methods. Bioadhesive polymers such as bioerodible hydrogels (see H. S. Sawhney, C. P. Pathak and J. A. Hubell in Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated by reference herein) may also be used to deliver FXI dsRNA agents or FXI antisense polynucleotide agents for treatment of a FXI-associated disease or condition. Additional suitable delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of a FXI dsRNA agent or FXI antisense polynucleotide agent, increasing convenience to the subject and the medical care professional. Many types of release delivery systems are available and known to those of ordinary skill in the art. (See for example: U.S. Pat. Nos. 5,075,109; 4,452,775; 4,675,189; 5,736,152; 3,854,480; 5,133,974; and 5,407,686 (the teaching of each of which is incorporated herein by reference) . In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.
[0272] Use of a long-term sustained release implant may be suitable for prophylactic treatment of subjects and for subjects at risk of developing a recurrent FXI-associated disease or condition. Long-term release, as used herein, means that the implant is constructed and arranged to deliver a therapeutic level of a FXI dsRNA agent or FXI antisense polynucleotide agent for at least up to 10 days, 20 days, 30 days, 60 days, 90 days, six months, a year, or longer. Long-term sustained release implants are well-known to those of ordinary skill in the art and include some of the release systems described above.
[0273] Therapeutic formulations of FXI dsRNA agents or FXI antisense polynucleotide agents may be prepared for storage by mixing the molecule or compound having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers [Remington's Pharmaceutical Sciences 21st edition, (2006) ] , in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol) ; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes) ; and / or non-ionic surfactants such as or polyethylene glycol (PEG) .
[0274] Cells, Subjects, and Controls
[0275] Methods of the invention may be used in conjunction with cells, tissues, organs and / or subjects. In some aspects of the invention a subject is a human or vertebrate mammal including but not limited to a dog, cat, horse, cow, goat, mouse, rat, and primate, e.g., monkey. Thus, the invention can be used to treat FXI-associated diseases or conditions in human and non-human subjects. In some aspects of the invention a subject may be a farm animal, a zoo animal, a domesticated animal or non-domesticated animal and methods of the invention can be used in veterinary prevention and treatment regimens. In some embodiments of the invention, the subject is a human and methods of the invention can be used in human prevention and treatment regimens.
[0276] Non-limiting examples of subjects to which the present invention can be applied are subjects who are diagnosed with, suspected of having, or at risk of having a disease or condition associated with a higher than desirable FXI expression and / or activity, also referred to as “elevated levels of FXI expression” . Non-limiting examples of diseases and conditions associated with a higher than desirable levels of FXI expression and / or activity are described elsewhere herein. Methods of the invention may be applied to a subject who, at the time of treatment, has been diagnosed as having the disease or condition associated with a higher than desirable FXI expression and / or activity, or a subject who is considered to be at risk for having or developing a disease or condition associated with a higher than desirable FXI expression and / or activity. In some aspects of the invention a disease or condition associated with a higher than desirable FXI level of expression and / or activity is an acute disease or condition, and in certain aspects of the invention a disease or condition associated with a higher than desirable FXI level of expression and / or activity is a chronic disease or condition.
[0277] In a non-limiting example, a FXI dsRNA agent of the invention is administered to a subject diagnosed with, suspected of having, or at risk of having, statin resistant hypercholesterolemia, which is a disease in which it is desirable to reduce FXI expression. Methods of the invention may be applied to the subject who, at the time of treatment, has been diagnosed as having the disease or condition, or a subject who is considered to be at risk for having or developing the disease or condition.
[0278] In another non-limiting example, a FXI dsRNA agent of the invention is administered to a subject diagnosed with, suspected of having, or at risk of having, hyperlipidemia, which is a disease in which it is desirable to reduce FXI expression. Methods of the invention may be applied to the subject who, at the time of treatment, has been diagnosed as having the disease or condition, or a subject who is considered to be at risk for having or developing the disease or condition.
[0279] A cell to which methods of the invention may be applied include cells that are in vitro, in vivo, ex vivo cells. Cells may be in a subject, in culture, and / or in suspension, or in any other suitable state or condition. A cell to which a method of the invention may be applied can be a liver cell, a hepatocyte, a cardiac cell, a pancreatic cell, a cardiovascular cell, kidney cell or other type of vertebrate cell, including human and non-human mammalian cells. In certain aspects of the invention, a cell to which methods of the invention may be applied is a healthy, normal cell that is not known to be a disease cell. In certain embodiments of the invention a cell to which methods and compositions of the invention are applied to a liver cell, a hepatocyte, a cardiac cell, a pancreatic cell, a cardiovascular cell, and / or a kidney cell. In certain aspects of the invention, a control cell is a normal cell, but it will be understood that a cell having a disease or condition may also serve as a control cell in particular circumstances for example to compare results in a treated cell having a disease or condition versus an untreated cell having the disease or condition, etc.
[0280] A level of FXI polypeptide activity can be determined and compared to control level of FXI polypeptide activity, according to methods of the invention. A control may be a predetermined value, which can take a variety of forms. It can be a single cut-off value, such as a median or mean. It can be established based upon comparative groups, such as in groups having normal levels of FXI polypeptide and / or FXI polypeptide activity and groups having increased levels of FXI polypeptide and / or FXI polypeptide activity. Another non-limiting example of comparative groups may be groups having one or more symptoms of or a diagnosis of a FXI-associated disease or condition; groups without having one or more symptoms of or a diagnosis of the disease or condition; groups of subjects to whom an siRNA treatment of the invention has been administered; groups of subjects to whom an siRNA treatment of the invention has not been administered. Typically, a control may be based on apparently healthy normal individuals in an appropriate age bracket or apparently healthy cells. It will be understood that controls according to the invention may be, in addition to predetermined values, samples of materials tested in parallel with the experimental materials. Examples include samples from control populations or control samples generated through manufacture to be tested in parallel with the experimental samples. In some embodiments of the invention, a control may include a cell or subject not contacted or treated with a FXI dsRNA agent of the invention and in such instances, a control level of FXI polypeptide and / or FXI polypeptide activity can be compared to a level of FXI polypeptide and / or FXI polypeptide activity in a cell or subject contacted with a FXI dsRNA agent or FXI antisense polynucleotide agent of the invention.
[0281] In some embodiments of the invention a level of FXI polypeptide determined for a subject can be a control level against which a level of FXI polypeptide determined for the same subject at a different time is compared. In a non-limiting example, a level of FXI is determined in a biological sample obtained from a subject who has not been administered a FXI treatment of the invention. In some embodiments, the biological sample is a serum sample. In some embodiments, the biological sample is a liver sample. The level of FXI polypeptide determined in the sample obtained from the subject can serve as a baseline or control value for the subject. After one or more administrations of a FXI dsRNA agent to the subject in a treatment method of the invention, one or more additional serum samples can be obtained from the subject and the level of FXI polypeptide in the subsequent sample or samples can be compared to the control / baseline level for the subject. Such comparisons can be used to assess onset, progression, or recession of a FXI associated disease or condition in the subject. For example, a level of FXI polypeptide in the baseline sample obtained from the subject that is higher than a level obtained from the same subject after the subject has been administered a FXI dsRNA agent or FXI antisense polynucleotide agent of the invention indicates regression of the FXI-associated disease or condition and indicates efficacy of the administered FXI dsRNA agent of the invention for treatment of the FXI-associated disease or condition.
[0282] In some aspects of the invention, values of one or more of a level of FXI polypeptide and / or FXI polypeptide activity determined for a subject may serve as control values for later comparison of levels of FXI polypeptide and / or FXI activity, in that same subject, thus permitting assessment of changes from a “baseline” FXI polypeptide activity in a subject. Thus, an initial FXI polypeptide level and / or initial FXI polypeptide activity level may be present and / or determined in a subject and methods and compounds of the invention may be used to decrease the level of FXI polypeptide and / or FXI polypeptide activity in the subject, with the initial level serving as a control level for that subject.
[0283] Using methods of the invention, FXI dsRNA agents and / or FXI antisense polynucleotide agents of the invention may be administered to a subject. Efficacy of the administration and treatment of the invention can be assessed when a level of FXI polypeptide in a serum sample obtained from a subject is decreased by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a pre-administration level of FXI polypeptide in a serum sample obtained from the subject at a prior time point, or compared to a non-contacted control level, for example a level of FXI polypeptide in a control serum sample. It will be understood that a level of FXI polypeptide and a level of FXI polypeptide activity both correlate with a level of FXI gene expression. Certain embodiments of methods of the invention comprise administering a FXI dsRNA and / or FXI antisense agent of the invention to a subject in an amount effective to inhibit FXI gene expression and thereby reduce a level of FXI polypeptide and reduce a level of FXI polypeptide activity in the subject.
[0284] Some embodiments of the invention, include determining presence, absence, and / or an amount (also referred to herein as a level) of FXI polypeptide in one or more biological samples obtained from one or more subjects. The determination can be used to assess efficacy of a treatment method of the invention. For example, methods and compositions of the invention can be used to determine a level of FXI polypeptide in a biological sample obtained from a subject previously treated with administration of a FXI dsRNA agent and / or a FXI antisense agent of the invention. A level of FXI polypeptide determined in a serum sample obtained from the treated subject that is lower by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a pretreatment level of FXI polypeptide determined for the subject, or compared to a non-contacted control biological sample level, indicates a level of efficacy of the treatment administered to the subject.
[0285] In some embodiments of the invention a physiological characteristic of a FXI-associated disease or condition determined for a subject can be a control determination against which a determination of the physiological characteristic in the same subject at a different time is compared. In a non-limiting example, a physiological characteristic such as the FXI mRNA level, the FXI protein level in the subject, or activated partial thromboplastin time (aPTT) , prothrombin time (PT) test, thrombin time (TCT) , bleeding time, or presence of D-dimer in a blood sample of the animal. The FXI mRNA level (and / or other physiological characteristic of a FXI disease or condition) determined in the sample obtained from the subject can serve as a baseline or control value for the subject. After one or more administrations of a FXI dsRNA agent to the subject in a treatment method of the invention, one or more additional liver or serum samples can be obtained from the subject and FXI mRNA level and / or FXI protein level in the subsequent sample or samples are compared to the control / baseline level and / or ratio, respectively, for the subject. Such comparisons can be used to assess onset, progression, or recession of a FXI associated disease or condition in the subject. For example, FXI mRNA level in the baseline sample obtained from the subject that is higher than FXI mRNA level determined in a sample obtained from the same subject after the subject has been administered a FXI dsRNA agent or FXI antisense polynucleotide agent of the invention indicates regression of the FXI-associated disease or condition and indicates efficacy of the administered FXI dsRNA agent of the invention for treatment of the FXI-associated disease or condition.
[0286] In some aspects of the invention, values of one or more of a physiological characteristic of a FXI-associcated disease or condition determined for a subject may serve as control values for later comparison of the physiological characteristics in that same subject, thus permitting assessment of changes from a “baseline” physiological characteristic in a subject. Thus, an initial physiological characteristic may be present and / or determined in a subject and methods and compounds of the invention may be used to decrease the level of FXI polypeptide and / or FXI polypeptide activity in the subject, with the initial physiological characteristic determination serving as a control for that subject.
[0287] Using methods of the invention, FXI dsRNA agents and / or FXI antisense polynucleotide agents of the invention may be administered to a subject in an effective amount to treat a FXI disease or condition. Efficacy of the administration and treatment of the invention can be assessed by determining a change in one or more physiological characteristics of the FXI disease or condition. In a non-limiting example, a FXI mRNA level in a serum sample obtained from a subject is decreased by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a pre-administration lipid in a serum sample obtained from the subject at a prior time point, or compared to a non-contacted control level, for example FXI mRNA level in a control serum sample. It will be understood that the FXI mRNA level, the FXI protein level in the subject, or activated partial thromboplastin time (aPTT) , prothrombin time (PT) test, thrombin time (TCT) , bleeding time, or presence of D-dimer in a blood each correlates with a level of FXI gene expression. Certain embodiments of methods of the invention comprise administering a FXI dsRNA and / or FXI antisense agent of the invention to a subject in an amount effective to inhibit FXI gene expression and thereby reduce the FXI mRNA level, the FXI protein level in the subject, or otherwise positively impact a physiological characteristic of a FXI-assocaited disease or condition in the subject.
[0288] Some embodiments of the invention, include determining presence, absence, and / or a change in a physiological characteristic of a FXI-associated disease or condition using methods such as but not limited to: (1) assessing one or more biological samples obtained from one or more subjects for the physiological characteristic; (2) imaging a subject (for example but not limited to obtaining a liver image) ; and (3) or physical examination of the subject. The determination can be used to assess efficacy of a treatment method of the invention.
[0289] Kits
[0290] Also within the scope of the invention are kits that comprise one or more FXI dsRNA agents and / or FXI antisense polynucleotide agents and instructions for its use in methods of the invention. Kits of the invention may include one or more of a FXI dsRNA agent, FXI sense polynucleotide, and FXI antisense polynucleotide agent that may be used to treat a FXI-associated disease or condition. Kits containing one or more FXI dsRNA agents, FXI sense polynucleotides, and FXI antisense polynucleotide agents can be prepared for use in treatment methods of the invention. Components of kits of the invention may be packaged either in aqueous medium or in lyophilized form. A kit of the invention may comprise a carrier being compartmentalized to receive in close confinement therein one or more container means or series of container means such as test tubes, vials, flasks, bottles, syringes, or the like. A first container means or series of container means may contain one or more compounds such as a FXI dsRNA agent and / or FXI sense or antisense polynucleotide agent. A second container means or series of container means may contain a targeting agent, a labelling agent, a delivery agent, etc. that may be included as a portion of a FXI dsRNA agent and / or FXI antisense polynucleotide to be administered in an embodiment of a treatment method of the invention.
[0291] A kit of the invention may also include instructions. Instructions typically will be in written form and will provide guidance for carrying-out a treatment embodied by the kit and for making a determination based upon that treatment.
[0292] The following examples are provided to illustrate specific instances of the practice of the present invention and are not intended to limit the scope of the invention. As will be apparent to one of ordinary skill in the art, the present invention will find application in a variety of compositions and methods.
[0293] Examples
[0294] Example 1. Synthesis of FXI RNAi Agents.
[0295] FXI RNAi agent duplexes shown in Table 2-3, above, were synthesized in accordance with the following general procedures:
[0296] Sense and antisense strand sequences of siRNA were synthesized on oligonucleotide synthesizers using a well-established solid phase synthesis method based on phosphonamidite chemistry. Oligonucleotide chain propagation is achieved through 4-step cycles: a deprotection, a condensation, a capping and an oxidation or a sulfurization step for addition of each nucleotide. Syntheses were performed on a solid support made of controlled pore glass (CPG, ) . Monomer phosphoramidites may be purchased from commercial sources or may be the from in WO2016028649, WO2023 / 045995, WO2024 / 208249, WO 2024 / 114776 (incorporated herein in its entirety) . The phosphoramidites compounds herein may be attached to the 3'-end as a monomeric phosphoramidites, and further be attached to the CPG solid support. In the case of attachment at the 5'-end, the phosphoramidites compounds may be used for the final coupling reaction, and can be further conjugated to target ligands if necessary.
[0297] The nucleotides in the chirally-modified dsRNA agent may be made using the general methods for preparing an oligoribonucleotide with solid phase synthesis. The chirally-modified dsRNA agent in a single diastereomeric form can be prepared on the oligonucleotide level or by coupling the diastereomeric form of dinucleotide building blocks.
[0298] When preparing the single diastereomeric form of the chirally-modified dsRNA agent on the dinucleotide building block level, the dsRNA agent may be synthesized according to the general oligonucleotide synthesis method as discussed above. Each of the desirable site specific (e.g., terminal) , chirally-modified internucleotide linkages (e.g., phosphorothioate internucleotide linkages) may be introduced to the dsRNA agent by coupling the corresponding dinucleotide building block containing a chirally-modified internucleotide linkage. Each of the dinucleotide building blocks may be synthesized with incorporating the chirally modified internucleotide linkage (e.g., phosphorothioate internucleotide linkage) between the dinucleotide, e.g., based on the phosphate group synthesis method as discussed above. The resulting epimeric mixture may be separated into individual diastereomers by methods known to one skilled in the art. A chirally pure (or substantially chirally pure) diastereoisomeric form of the chirally-modified RNA agent may then then be prepared by coupling a single diastereoisomeric form of each of the dinucleotide building blocks to the desired locations of the dsRNA agent. The single diastereomeric form of dinucleotide building blocks obtain see, e.g., "Chirality matters: stereo-defined phosphorothioate linkages at the termini of small interfering RNAs improve pharmacology in vivo" , Nucleic Acids Research, 2022, Vol. 50, No. 3, 1221–1240. Oligonucleotides containing chirally pure phosphorothioate linkages were prepared using the method discribed above.
[0299] The phosphoramidites with GalNAc ligand cluster were published in WO2023 / 045995A1 (incorporated herein in its entirety) . The imann residues can be added to the 5' end and / or 3' end of the oligonucleotide chain using imann phosphoramidites by a method well known to those skilled in the art, such as use the inverted abasic residues (invab) method, and / or further added to the target to the GalNAc targeting group. Imann phosphoramidites used herein were published in WO 2024 / 114776 A1 (incorporated herein in its entirety) . 5'-phosphate mimic nucleotide can be added to the 5' end of the oligonucleotide chain using 5'-phosphate mimic nucleotide phosphoramidites by a method well known to those skilled in the art, the5'-phosphate mimic nucleotide phosphoramidites used herein were published in WO2024 / 208249 (incorporated herein in its entirety) .
[0300] For siRNAs used for in vitro screening (Table 2) , syntheses were carried out at 2 μmol scale, and for siRNAs used for in vivo testing (Table 3) , syntheses were carried out at scale of 5 μmol or larger. In the case where the GalNAc ligand (GLO-0 as a non-limiting example) is attached at 3’ -end of sense strand, GalNAc ligand attached CPG solid support was used. In the case where the GalNAc ligand (GLS-5*or GLS-15*as non-limiting example, GLS-5*or GLS-15*Phosphoramidites with GalNAc ligand cluster were public in WO2023 / 045995A1 (incorporated herein in its entirety) ) is attached at 5’-end of sense strand, a GalNAc phosphoramidite was used for the last coupling reaction. Trichloroacetic acid (TCA) 3%in dichloromethane was used for deprotection of 4, 4′-dimethoxytrityl protecting group (DMT) . 5-Ethylthio-1H-tetrazole was used as an activator. I2 in THF / Py / H2O and phenylacetyl disulfide (PADS) in pyridine / MeCN was used for oxidation and sulfurization reactions, respectively. After the final solid phase synthesis step, solid support bound oligomer was cleaved and protecting groups were removed by treating with a 1: 1 volume solution of 40 wt. %methylamine in water and 28%ammonium hydroxide solution. For the synthesis of siRNAs used for in vitro screening, crude mixture was concentrated. The remaining solid was dissolved in 1.0 M NaOAc, and ice cold EtOH was added to precipitate out the single strand product as the sodium salt, which was used for annealing without further purification. For the synthesis of siRNAs used for in vivo testing, crude single strand product was further purified by ion pairing reversed phase HPLC (IP-RP-HPLC) . Purified single strand oligonucleotide product from IP-RP-HPLC was converted to sodium salt by dissolving in 1.0 M NaOAc and precipitation by addition of ice cold EtOH. Annealing of equimolar complementary sense stand and antisense strand oligonucleotide in water was performed to form the double strand siRNA product, which was lyophilized to afford a fluffy white solid.
[0301] Example 2. In Vitro Screening of FXI siRNA Duplexes
[0302] Huh7 cells were trypsinized and adjusted to appropriate density, mixed with the complexes of psiCHECK (TM) -2 Vector plasmid and Lipofectamine 2000 (Invitrogen-11668-019) and seeded into 96-well plates. Cells were transfected with test siRNAs or a control siRNA using Lipofectamine RNAiMax (Invitrogen -13778-150) at the same time of seeding following the protocol according to manufacturer’s recommendation. The siRNAs were tested at two concentrations (1 nM and 0.1 nM) in triplicate.
[0303] Day 1, psiCHECK (TM) -2 Vector transfection (one plate)
[0304] (1) Transfer 2.5μg psiCHECK (TM) -2 Vector plasmid into an RNASE free Eppendorf tube (solution mix#1)
[0305] (2) Add trypsin to disassociate Huh7 cells in one flask, and count cells using Vi-Cell counting machine, adjust the cell density to 1*10^5 / ml
[0306] (3) Transfer 7.5μL Lipofectamine 2000 (Invitrogen-11668-019) into solution mix#1 tube, mix.
[0307] (4) Add solution in Step 3 into cell suspension, mix, and dispense suspension into the 96 well plate (100 μl / well)
[0308] Day 2, siRNAs transfection
[0309] (1) Dilute RNAiMAX Reagent with Medium.
[0310] (2) Dilute the siRNA with RNA-free water to make 12× stock.
[0311] (3) Mix equal volume of diluted RNAiMax and siRNA. Incubate the mixture at RT for 15 min to allow complex formation.
[0312] (4) Add 45μl / well compound RNAiMAX (Opti-MEM) mix into 225μl / well DMEM fresh medium, and discard the supernatants in assay plate, add 120μl / well compound mix into 96 well plates.
[0313] (5) No compound control well was defined as cells transfected with psiCHECK (TM) -2 Vector and without siRNA treatment; blank control was cell only wells.
[0314] Day 3, Luciferase Assay
[0315] (1) Add Reagent to assay plate, wait 10 minutes to allow for cell lysis to occur.
[0316] (2) Transfer 100 μl cell lysates into a plate, then measure the firefly luminescence.
[0317] (3) Add 50μl of Stop & Reagent to the assay plates and mix, wait 10 minutes, then measure Renilla luminescence.
[0318] (4) Calculate the relative expression
[0319] Data analysis
[0320] Ratio of sample well= (sample Renilla luminescence-background blank) / (sample Fireflyluminescence-background blank)
[0321] Ratio of no compound control well= (control Renilla luminescence-background blank) / (control sample Fireflyluminescence-background blank)
[0322] %inhibition= 100- (Ratio of sample well / the average Ratio of no compound control) ×100%. Table 5 provides experimental results of in vitro studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 2.
[0323] Example 3. In Vitro Screening of FXI siRNA Duplexes
[0324] Huh7 cells were trypsinized and adjusted to appropriate density, mixed with the complexes of psiCHECK (TM) -2 Vector plasmid and Lipofectamine 2000 and seeded into 96-well plates. Cells were transfected with test siRNAs or a control siRNA using Lipofectamine RNAiMax at the same time of seeding following the protocol according to manufacturer’s recommendation. The siRNAs were tested at five concentrations (10nM, 3nM, 1 nM 0.1 nM and 0.03 nM) in triplicate. Luciferase analysis. The results are shown in Tables 6.
[0325] Table 6 provides experimental results of in vitro studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 2.
[0326] Example 4. In Vitro Screening of FXI siRNA Duplexes
[0327] Huh7 cells were trypsinized and adjusted to appropriate density, mixed with the complexes of psiCHECK (TM) -2 Vector plasmid and Lipofectamine 2000 and seeded into 96-well plates. Cells were transfected with test siRNAs or a control siRNA using Lipofectamine RNAiMax (Invitrogen -13778-150) at the same time of seeding following the protocol according to manufacturer’s recommendation. The siRNAs were tested at two concentrations (1 nM and 0.1 nM) in triplicate.
[0328] Day 1, psiCHECK (TM) -2 Vector transfection (one plate)
[0329] (1) Transfer 2.5μg psiCHECK (TM) -2 Vector plasmid into an RNASE free Eppendorf tube (solution mix#1)
[0330] (2) Add trypsin to disassociate Huh7 cells in one flask, and count cells using Vi-Cell counting machine, adjust the cell density to 1*10^5 / ml
[0331] (3) Transfer 7.5μL Lipofectamine 2000 into solution mix#1 tube, mix.
[0332] (4) Add solution in Step 3 into cell suspension, mix, and dispense suspension into the 96 well plate (100 μl / well)
[0333] Day 2, siRNAs transfection
[0334] (1) Dilute RNAiMAX Reagent with Medium.
[0335] (2) Dilute the siRNA with RNA-free water to make 12× stock.
[0336] (3) Mix equal volume of diluted RNAiMax and siRNA. Incubate the mixture at RT for 15 min to allow complex formation.
[0337] (4) Add 45μl / well compound RNAiMAX (Opti-MEM) mix into 225μl / well DMEM fresh medium, and discard the supernatants in assay plate, add 120μl / well compound mix into 96 well plates.
[0338] (5) No compound control well was defined as cells transfected with psiCHECK (TM) -2 Vector and without siRNA treatment; blank control was cell only wells.
[0339] Day 3, Luciferase Assay
[0340] (1) Add Reagent to assay plate, wait 10 minutes to allow for cell lysis to occur.
[0341] (2) Transfer 100 μl cell lysates into a plate, then measure the firefly luminescence.
[0342] (3) Add 50μl of Stop & Reagent to the assay plates and mix, wait 10 minutes, then measure Renilla luminescence.
[0343] (4) Calculate the relative expression
[0344] Data analysis, The results are shown in Tables 7, and table 8.
[0345] Table7 provides experimental results of in vitro studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 2.
[0346] Table 8 provides experimental results of in vitro studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 2.
[0347] Example 5. In Vitro Screening of FXI siRNA Duplexes
[0348] Huh7 cells were trypsinized and adjusted to appropriate density, mixed with the complexes of psiCHECK (TM) -2 Vector plasmid and Lipofectamine 2000 and seeded into 96-well plates. Cells were transfected with test siRNAs or a control siRNA using Lipofectamine RNAiMax (Invitrogen -13778-150) at the same time of seeding following the protocol according to manufacturer’s recommendation. The siRNAs were tested at two concentrations (1 nM and 0.1 nM) in triplicate by Luciferase Assay. The results are shown in Tables 9.
[0349] Table 9 provides experimental results of in vitro studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 2.
[0350] Example 6 In Vivo testing of FXI siRNA Duplexes
[0351] At day 1, female C57BL / 6J mice (4-6weeks, 4 in each group) were infected by intravenous administration of a solution of adeno-associated virus (AAV-GFP) vector encoding Human Factor XI and luciferase gene. At day 8, mice were subcutaneously administered a single 3 mg / kg of FXI siRNA agents or PBS. Blood samples were collected at day 8, before dosing of siRNA, at day 15, and day 22. Plasma samples were isolated and were collected for quantification protein level through ELISA protocol. The results are shown in Tables 10-12.
[0352] Table 10 provides experimental results of in vivo studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 3.
[0353] Table 11 provides experimental results of in vivo studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 3.
[0354] Table 12 provides experimental results of in vivo studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 3.
[0355] Example 7 In Vivo testing of FXI siRNA Duplexes
[0356] At day 1, female C57BL / 6J mice (4-6weeks, 4 in each group) were infected by intravenous administration of a solution of adeno-associated virus (AAV-GFP) vector encoding Human Factor XI gene. At day 8, mice were subcutaneously administered a single 3 mg / kg of FXI siRNA agents or PBS. Blood samples were collected at day 8, before dosing of siRNA, at day 15, and / or day 22. Plasma samples were isolated and were collected for quantification protein level through ELISA protocol. The results are shown in Tables 13-15.
[0357] Table 13 provides experimental results of in vivo studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 3.
[0358] Table 14 provides experimental results of in vivo studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 3.
[0359] Table 15 provides experimental results of in vivo studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 3.
[0360] Example 8 In Vivo testing of FXI siRNA Duplexes
[0361] At day 1, female C57BL / 6J mice (4-6weeks, 4 in each group) were infected by intravenous administration of a solution of adeno-associated virus (AAV-GFP) vector encoding Human Factor XI gene. At day 8, mice were subcutaneously administered a single 2 mg / kg of FXI siRNA agents or PBS. Blood samples were collected at day 8, before dosing of siRNA, at day 21, and day 28. Plasma samples were isolated and were collected for quantification protein level through ELISA protocol. The results are shown in Tables 16.
[0362] Table 16 provides experimental results of in vivo studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 3.
[0363] Example 9 In Vivo testing of FXI siRNA Duplexes
[0364] At day 1, female C57BL / 6J mice (4-6weeks, 4 in each group) were infected by intravenous administration of a solution of adeno-associated virus (AAV-GFP) vector encoding Human Factor XI gene. At day 8, mice were subcutaneously administered a single 0.5, 1 or 2 mg / kg of FXI siRNA agents or PBS. Blood samples were collected at day 8, before dosing of siRNA, at day 15, and day 22. Plasma samples were isolated and collected for quantification protein level through ELISA protocol. The results are shown in Tables 17.
[0365] Table 17 provides experimental results of in vivo studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 3.
[0366] Example 10 In Vivo testing of FXI siRNA Duplexes
[0367] At day 1, female C57BL / 6J mice (4-6weeks, 4 in each group) were infected by intravenous administration of a solution of adeno-associated virus (AAV-GFP) vector encoding Human Factor XI gene. At day 8, mice were subcutaneously administered a single 0.5 or 1 mg / kg of FXI siRNA agents or PBS. Blood samples were collected at day 8 (before dosing of siRNA) , at day 17, and day 25. Plasma samples were isolated and collected for quantification protein level through ELISA protocol. The results are shown in Tables 18
[0368] Table 18 provides experimental results of in vivo studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 3.
[0369] Example 11 In Vivo testing of FXI siRNA Duplexes
[0370] At day 1, female C57BL / 6J mice (4-6weeks, 4 in each group) were infected by intravenous administration of a solution of adeno-associated virus (AAV-GFP) vector encoding Human Factor XI gene. At day 8, mice were subcutaneously administered a single 0.5 or 1 mg / kg of FXI siRNA agents or PBS. Blood samples were collected at day 8 (before dosing of siRNA) , at day 15 and 22. Plasma samples were isolated and collected for quantification protein level through ELISA protocol. The results are shown in Tables 19
[0371] Table 19 provides experimental results of in vivo studies using various FXI RNAi agents to inhibit FXI expression. The duplex sequences used correspond to those shown in Table 3.
[0372] Example 12. In Vivo testing of FXI siRNA Duplexes in NHP PD model
[0373] Cynomolgus monkeys (3-5 years old, 3~6 kg of weights, 3 monkeys in each group) were enrolled in the study. Each monkey was subcutaneously administered a single 4 mg / kg of FXI siRNA agents or PBS at day 1 (pre-dosing of siRNA) . After overnight fast, Plasma were drawn at day -14 (pre-dose) , day -7 (pre-dose) , 1 (pre-dose) , 8, 15, 22, 29, 43, 50 and 57; liver biopsy were drawn at dat-7(pre-dose) , 29 and 57. FXI protein concentration in serum were measured by ELISA method (FXI ELISA kit, Abcam, 1002579-4) , the result is shown in table 20. FXI mRNA level in liver were measured by QPCR method, the result is shown in table 21. FXI activity were also measured by automatic blood clotting analyzer (siemens) the result are shown in table 22.
[0374] Table 20 The results of FXI protein concentration in serum were measured by ELISA method
[0375] Table 21 The results of FXI mRNA level in liver were measured by QPCR method.
[0376] Table 22 The results of FXI activity
[0377] Example 13. In Vivo testing of FXI siRNA Duplexes in NHP PD model
[0378] Cynomolgus monkeys (3-5 years old, 3~6 kg of weights, 3 monkeys in each group) were enrolled in the study. Each monkey was subcutaneously administered a single 6 mg / kg of FXI siRNA agents or PBS at day 1 (pre-dosing of siRNA) . After overnight fast, Plasma was drawn at day -19 (pre-dose) , day -7 (pre-dose) , 1 (pre-dose) , 8, 15, 22, and 29. FXI activity were also measured by automatic blood clotting analyzer (siemens) . the result is shown in table 23.
[0379] Table 23. The results of FXI activity
[0380] Example 14. In Vivo testing of FXI siRNA Duplexes in NHP PD model
[0381] Cynomolgus monkeys (3-5 years old, 3~6 kg of weights, 3 monkeys in each group) were enrolled in the study. Each monkey was subcutaneously administered a single 5 mg / kg of FXI siRNA agents (AD00990-3, AD00991-2, AD00997-4, AD01003-1, AD02352-1, AD02375-2 , AD02375-3, AD02399-1) or PBS at day 1 (pre-dosing of siRNA) . After overnight fast, Plasma was drawn at day -28(pre-dose) , -21 (pre-dose) , -14 (pre-dose) , day -7 (pre-dose) , 1 (pre-dose) , 8, 15, 22, 29, 36, 43, 50, and / or 57; FXI activity were also measured by automatic blood clotting analyzer (siemens) , the result is shown Figure 1. FXI protein concentration in serum were measured by ELISA method (FXI ELISA kit, Abcam ab108834) , the result is shown in Figure 2, the result of the APTT remaining is shown in Figure 3 (APTT kit: siemens) .
[0382] Equivalents
[0383] Although several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the functions and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the teachings of the present invention is / are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto; the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, and / or methods, if such features, systems, articles, materials, and / or methods are not mutually inconsistent, is included within the scope of the present invention.
[0384] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.
[0385] The indefinite articles “a” and “an, ” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one. ”
[0386] The phrase “and / or, ” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified, unless clearly indicated to the contrary.
[0387] All references, patents and patent applications and publications that are cited or referred to in this application are incorporated herein in their entirety herein by reference.
Claims
1.A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of coagulation factor XI (FXI) , wherein the dsRNA agent includes a sense strand and an antisense strand, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from sequence of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from sequence of SEQ ID NO: 2, wherein the sense strand and the antisense strand can be partially, substantially, or fully complementary to each other.2.The dsRNA agent of claims 1, wherein the dsRNA agent includes a sense strand and an antisense strand, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences of nucleotides 143-173, 150-180, 380-410, 384-414, 389-419, 402-432, 419-449, 428-458, 536-566, 1141-1171, 1488-1518, 1561-1591, 2111-2141, 2112-2142, 2113-2143, 2115-2145, 2111-2145 of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2, wherein the sense strand and the antisense strand can be partially, substantially, or fully complementary to each other.3.The dsRNA agent of claim 2, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences of nucleotides 148-168, 155-175, 385-405, 389-409, 394-414, 407-427, 424-444, 433-453, 541-561, 1146-1166, 1493-1513, 1566-1586, 2116-2136, 2117-2137, 2118-2138, 2120-2140, 2116-2140 of SEQ ID NO: 1, and the antisense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2.4.The dsRNA agent of any one of claims 1-3, wherein the antisense strand of dsRNA is substantially or fully complementary to any one of a target region of SEQ ID NO: 1, and preferably the dsRNA agent comprises an antisense strand sequence set forth in any one of Tables 1-3.5.The dsRNA agent of any one of claims 1-4, wherein the sense strand sequence is at least substantially complementary to or fully complementary to the antisense strand sequence in the dsRNA agent, preferably, wherein the dsRNA agent comprises a sense strand sequence set forth in any one of Tables 1-3.6.The dsRNA agent of any one of claims 1-5, wherein the dsRNA agent comprises the sequences set forth as a duplex sequence in any of Tables 1-3.7.The dsRNA of any one of claims 1-6, wherein the dsRNA agent comprises at least one modified nucleotide.8.The dsRNA agent of any one of claims 1-7, wherein all or substantially all of the nucleotides of the sense strand and / or the antisense strand are modified nucleotides.9.The dsRNA agent of any one of claims 1-8, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a FXI RNA transcript, wherein each strand is about 15 to about 30 nucleotides in length, wherein the sense strand sequence may be represented by formula (II) :5′- (N′L) n′N′L N′L N′L N′L N′F N′L N′F N′L N′N1 N′N2 N′L N′L N′L N′L N′L (N′L) m′-3′ formula (II)wherein:each N′F represents a 2'-fluoro-modified nucleotide; each N′N1 and N′N2 independently represents a modified or unmodified nucleotide, N′N1 and N′N2 include only one 2'-fluorine modified nucleotides; each N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and m′and n′are each independently an integer of 0 to 7.10.The dsRNA agent of any one of claims 1-8, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a FXI RNA transcript, wherein each strand is about 18 to about 30 nucleotides in length, wherein the antisense strand sequence may be represented by formula (III) :3′- (NL) n NM1 NL NM2 NL NF NL NM3 NL NL NL NL NM4 NL NM5 NL NL NF NZ-5′formula (III)wherein:each NF represents a 2'-fluoro-modified nucleotide; each NM1, NM2, NM3, NM4, and NM5 independently represents a modified or unmodified nucleotide; NM1, NM2, NM3, NM4, and NM5 have only three 2'-fluoro-modified nucleotides; each NL and / or Nz independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and n is an integer of 0 to 7.11.he dsRNA agent of any one of claims 1-10, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein said sense strand is complementary to the antisense strand, wherein said antisense strand comprises a region of complementarity to an mRNA encoding FXI, wherein the region of complementarity comprises at least 15 contiguous nucleotides, wherein the dsRNA duplex represented by formula (IV) :sense: 5′- (N′L) n′N′L N′L N′L N′L N′F N′L N′F N′L N′N1 N′N2 N′L N′L N′L N′L N′L (N′L) m′-3′antisense: 3′- (NL) n NM1 NL NM2 NL NF NL NM3 NL NL NL NL NM4 NL NM5 NL NL NF NZ-5′formula (IV)wherein:each strand is about 18 to about 30 nucleotides in length;each NF and N′F independently represents a 2'-fluoro-modified nucleotide; NM1, NM2, NM3, NM4, NM5, N′N1, and N′N2 each independently represents a modified or unmodified nucleotide; NM1, NM2, NM3, NM4, and NM5 have only three 2'-fluoro-modified nucleotides; N′N1 and N′N2 include only one 2'-fluorine modified nucleotides; each Nz, NL nd / or N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and m′, n′and n are each independently an integer of 0 to 7.12.The dsRNA agent of any one of claims 7-11, wherein the one or more modified nucleotides are independently selected from the group consisting of: a 2’ -O-methyl nucleotide, a 2’ -Fluoro nucleotide, a 2’ -deoxy nucleotide, a 2’ 3’ -seco nucleotide mimic, a locked nucleotide, an unlocked nucleic acid nucleotide (UNA) , a glycol nucleic acid nucleotide (GNA) , a 2’ -F-Arabino nucleotide, a 2’ -methoyxyethyl nucleotide, an abasic nucleotide, an ribitol, inverted nucleotide, an inverted abasic nucleotide, an isomannide nucleotide, an inverted 2’ -Ome nucleotide, an inverted 2’ -deoxy nucleotide, a 2’ -amino-modified nucleotide, a 2’ -alkyl-modified nucleotide, a mopholino nucleotide, a 3’ -OMe nucleotide, a nucleotide comprising a 5’ -phosphorothioate group, a 5'-phosphonate modified nucleotide or a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2’ -amino-modified nucleotide, a phosphoramidate, or a non-natural base comprising nucleotide.13.The dsRNA agent of any one of claims 1-12, comprises an E-vinylphosphonate nucleotide at the 5′end of the guide strand.14.The dsRNA agent of any one of claims 1-12, wherein the dsRNA agent comprises further comprises a phosphate or phosphate mimic, wherein 5’ -phosphate or 5’ -phosphate mimic is introduced at the 5'-terminal nucleotide of the antisense strand.15.The dsRNA agent of claims 14, wherein the phosphate mimic of the 5'-terminal nucleotide has a fragment represented by the following formula: Wherein: Q8 is O, S, SO, SO2, PR16R17 or NR11; R16 and R17 are independently (=O) , (=S) , OH, SH, C1-C6 alkyl, NR18R19; R16 and R17 are independently (=O) , (=S) , OH, SH, C1-C6 alkyl, NR18;Ra and Rc are each independently selected from hydroxyl or protected hydroxyl, sulfhydryl or protected sulfhydryl, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, protected or optional substituted amino, natural or modified nucleosides; and Rb is O or S or NR12, R12 is hydrogen, C1-C6 alkyl, amino protecting group;the substituents in the substituted amino group are selected from: optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, sulfinyl, sulfonyl, acetyl;R11, R18 and R19 are independently H, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, methanesulfonyl, sulfonic acid group;each substituted group comprises one or more optional substituent groups independently selected from: halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylsulfhydryl, CN;indicates the linkage to the remainder of the 5'-terminal nucleotide. In certain embodiments, wherein Q8 is bonded to the 4'-carbon or 5'-carbon of the sugar or sugar surrogate moiety of the 5'-terminal nucleotide.16.The dsRNA agent of any one of claims 1-15, wherein the dsRNA agent comprises at least one phosphorothioate internucleoside linkage.17.The dsRNA agent of any one of claims 1-15, wherein the sense strand comprises at least one phosphorothioate internucleoside linkage.18.The dsRNA agent of any one of claims 1-15, wherein the antisense strand comprises at least one phosphorothioate internucleoside linkage.19.The dsRNA agent of any one of claims 1-15, wherein the sense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages.20.The dsRNA agent of any one of claims 1-15, wherein the antisense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages.21.The dsRNA agent of any one of claims 1-20, wherein the at least one phosphorothioate (PS) linkage is a chirally modified phosphorothioate (PS) linkage.22.The dsRNA agent of any one of claims 1-21, wherein the first linkage counting from the 5'-end of antisense strand is a chirally modified phosphorothioate linkage, and the phosphorus of the phosphorothioate internucleotide linkage is in Rp configuration, or optionally, the first linkage counting from the 5'-end of antisense strand is a chirally modified phosphorothioate linkage, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Rp configuration, and the first linkage counting from the 3'-end of antisense strand is achiral or racemic, or optionally, chirally modified internucleotide linkages is a phosphorothioate linkage only occur at the first internucleotide linkage at the 5'end of antisense strand, wherein the phosphorus of the phosphorothioate internucleotide linkage is in Rp configuration, and the rest internucleotide linkages of antisense strand are achiral or racemic.23.The dsRNA agent of any one of claims 1-22, wherein the modified sense strand is a modified sense strand sequence set forth in one of Tables 2-3.24.The dsRNA agent of any one of claims 1-22, wherein the modified antisense strand is a modified antisense strand sequence set forth in one of Tables 2-3.25.The dsRNA agent of any one of claims 1-24, wherein the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity is between 16 and 23 nucleotides in length.26.The dsRNA agent of any one of claims 1-25, wherein the region of complementarity is 19-21 nucleotides in length.27.The dsRNA agent of any one of claims 1-26, wherein each strand is no more than 30 nucleotides in length.28.The dsRNA agent of any one of claims 1-27, wherein each strand is no more than 25 nucleotides in length.29.The dsRNA agent of any one of claims 1-28, wherein each strand is no more than 23 nucleotides in length.30.The dsRNA agent of any one of claims 1-29, wherein the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting groups or linking groups.31.The dsRNA agent of claim 30, wherein the one or more targeting groups or linking groups are conjugated to the sense strand.32.The dsRNA agent of claim 30 or 31, wherein the targeting group or linking group comprises N-acetyl-galactosamine (GalNAc) .33.The dsRNA agent of claim 32, wherein the targeting group has a structure: 34.The dsRNA agent of any one of claims 1-33, wherein the dsRNA agent comprises a targeting group that is conjugated to the 5’ -terminal end of the sense strand.35.The dsRNA agent of any one of claims 1-33, wherein the dsRNA agent comprises a targeting group that is conjugated to the 3'-terminal end of the sense strand.36.The dsRNA agent of any one of claims 1-35, wherein the antisense strand comprises one inverted abasic residue at 3’ -terminal end.37.The dsRNA agent of any one of claims 1-35, wherein the sense strand comprises one or two inverted abasic residues or imann residues at 3’ or / and 5’ terminal end.38.The dsRNA agent of any one of claims 1-37, wherein the dsRNA agent has two blunt ends.39.The dsRNA agent of any one of claims 1-37, wherein at least one strand comprises a 3’ overhang of at least 1 nucleotide.40.The dsRNA agent of any one of claims 1-37, wherein at least one strand comprises a 3’ overhang of at least 2 nucleotides.41.The dsRNA agent of any one of claims 1-40 wherein the FXI RNA transcript is SEQ ID NO: 1.42.The dsRNA agent of any one of claims 1-41, wherein the modified sense strand is a modified sense strand sequence set forth in one of Tables 2-3.43.The dsRNA agent of any one of claims 1-41, wherein the modified antisense strand is a modified antisense strand sequence set forth in one of Tables 2-3.44.A composition comprising one, two, three, or more dsRNA agents of any one of claims 1-43.45.The composition of claim 44, further comprising a pharmaceutically acceptable carrier.46.The composition of claim 45, further comprising one or more additional therapeutic agents.47.The composition of claim 46, wherein the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial.48.The composition of claim 44, wherein the composition is formulated for subcutaneous administration or is formulated for intravenous (IV) administration.49.A cell comprising a dsRNA agent of any one of claims 1-43.50.The cell of claim 49, wherein the cell is a mammalian cell, optionally a human cell.51.A method of inhibiting the expression of a FXI gene in a cell, the method comprising:(i) preparing a cell or plurality of cells comprising an effective amount of one or more double-stranded ribonucleic acid (dsRNA) agents of any one of claims 1-43 or a composition of any one of claims 44-48.52.The method of claim 51, further comprising:(ii) maintaining the cell or plurality of cells prepared in claim 51 (i) for a time sufficient to obtain degradation of the mRNA transcript of a FXI gene, thereby inhibiting expression of the FXI gene in the cell or plurality of cells and reducing a level of the FXI polypeptide in the cell or plurality of cells.53.The method of claim 51 or 52, wherein the cell or plurality of cells is in a subject and the dsRNA agent is administered to the subject subcutaneously or by IV administration, or the cell or plurality of cells is outside a subject and is contacted with the dsRNA agent.54.The method of any one of claims 51-53, wherein 2, 3, 4, or more dsRNA agents are administered to the subject or contacted with the cell or plurality of cells.55.The method of any one of claims 51-54, further comprising assessing inhibition of the FXI gene in the subject, following the administration of the dsRNA agent (s) to the subject, wherein a means for the assessing comprises:(i) determining one or more physiological characteristics of a FXI -associated disease or condition in the subject and(ii) comparing the determined physiological characteristic (s) to a baseline pre-administration physiological characteristic of the FXI -associated disease or condition and / or to a control physiological characteristic of the FXI -associated disease or condition, wherein the comparison indicates one or more of a presence or absence of inhibition of expression of the FXI gene in the subject.56.The method of any one of claims 51-54, further comprising assessing inhibition of the FXI gene in the cell or plurality of cells, following contacting the dsRNA agent (s) to the cell or plurality of cells, wherein a means for the assessing comprises:(i) determining one or more physiological characteristics of a FXI -associated disease or condition in the cell or plurality of cells and(ii) comparing the determined physiological characteristic (s) to a baseline pre-contact physiological characteristic of the FXI -associated disease or condition and / or to a control physiological characteristic of the FXI -associated disease or condition, wherein the comparison indicates one or more of a presence or absence of inhibition of expression of the FXI gene in the cell or plurality of cells.57.The method of claim 55 or 56, wherein the control physiological characteristic is the physiological characteristic in a subject with a FXI -associated disease or condition and not administered the dsRNA agent (s) or is the physiological characteristic in a cell with a FXI -associated disease or condition and not contacted with the dsRNA agent (s) .58.The method of any one of claims 55-57, wherein the determined physiological characteristic in the subject is one or more of: plasma FXI mRNA level, the FXI protein level, or active form (FXIa) level, partial thromboplastin time (PTT) test, activated partial thromboplastin time test (aPTT or APTT) .59.The method of claim 55, wherein the physiological characteristic is determined in a biological sample obtained from the subject.60.The method of claim 59, wherein the biological sample comprises one or more of: a blood sample, a serum sample, a tissue sample, a cell sample, and a liver sample.61.The method of claim 55, wherein the determined physiological characteristic in the subject is abnormal compared to a control level of the physiological characteristic.62.The method of claim 55 or 56, wherein the control physiological characteristic in the subject is the physiological characteristic in a subject with the FXI-associated disease or condition and not administered the anti-FXI dsRNA agent (s) and the control physiological characteristic in the cell or plurality of cells is the physiological characteristic in a cell with the FXI -associated disease or condition and not contacted with the anti-FXI dsRNA agent (s) .63.A method of inhibiting expression of a FXI gene in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-43 or a composition of any one of claims 44-48.64.The method of claim 63, wherein the dsRNA agent is administered to the subject subcutaneously or by IV administration.65.The method of any one of claims 63 or 64, further comprising assessing inhibition of the FXI gene, following the administration of the dsRNA agent, wherein a means for the assessing comprises:(i) determining one or more physiological characteristics of a FXI -associated disease or condition in the subject and(ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the FXI -associated disease or condition and / or to a control physiological characteristic of the FXI -associated disease or condition, wherein the comparison indicates one or more of a presence or absence of inhibition of expression of the FXI gene in the subject.66.The method of claim 65, wherein the determined physiological characteristic is one or more of:the FXI mRNA level, the FXI protein level in the subject, or active form (FXIa) level, partial thromboplastin time (PTT) test, activated partial thromboplastin time test (aPTT or APTT) .67.A method of treating a disease or condition associated with the presence of FXI protein, the method comprising administering to a subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-43, or a composition of any one of claims 44-48, to inhibit FXI gene expression.68.The method of claim 67, wherein the disease or condition is one or more of: Atrial fibrillation (AFib) , thromboembolic condition, such as deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD) , and stroke.69.The method of claim 68, further comprising administering an additional therapeutic regimen to the subject.70.The method of claim 69, wherein the additional therapeutic regimen comprises: administering to the subject one or more FXI antisense polynucleotides of the invention, administering to the subject a non-FXI dsRNA therapeutic agent, and a behavioral modification in the subject.71.The method of claim 70, wherein the non-FXI dsRNA therapeutic agent is one of more of:NSAID / Cyclooxygenase inhibitors, such as, aspirin; adenosine diphosphate (ADP) receptor inhibitors, such as, clopidogrel (PLAVIX) and ticlopidine (TICLID) ; phosphodiesterase inhibitors, such as, cilostazol (PLETAL) ; glycoprotein IIB / IIIA inhibitors, such as, abciximab (REOPRO) , eptifibatide (INTEGRILIN) , tirofiban (AGGRASTAT) , and defibrotide; adenosine reuptake inhibitors, such as, dipyridamole (PERSANTINE) ; anticoagulants, such as warfarin (and related coumarins) , rivaroxaban, apixaban, dabigatan; heparin; direct thrombin inhibitors , such as, lepirudin, bivalirudin; , LOVENOX (enoxaparin) ; small molecular compounds that interfere directly with the enzymatic action of particular coagulation factors (e.g. rivaroxaban, which interferes with Factor Xa) , tPA (tiaaue plasminogen activator) ; antiplatelet drug , such as, clopidogrel; Beta-blockers, such bisoprolol; Calcium channel blockers, such as, diltiazem, verapamil; Digoxin.72.The method of any one of claims 67-71, wherein the dsRNA agent is administered to the subject subcutaneously or IV administration.73.The method of any one of claims 67-72, further comprising determining an efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject.74.A method of decreasing a level of FXI protein in a subject compared to a baseline pre-treatment level of FXI protein in the subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of claims 1-43, or a composition of any one of claims 44-48, to decrease the level of FXI gene expression.75.The method of claim 74, wherein the dsRNA agent is administered to the subject subcutaneously or is administered to the subject by IV administration.76.A method of altering a physiological characteristic of a FXI-associated disease or condition in a subject compared to a baseline pre-treatment physiological characteristic of the FXI-associated disease or condition in the subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-43, or a composition of any one of claims 44-48, to alter the physiological characteristic of the FXI-associated disease or condition in the subject.77.The method of claim 76, wherein the dsRNA agent is administered to the subject subcutaneously or is administered to the subject by IV administration.78.The method of any one of claims 76-77, wherein the physiological characteristic is one or more of: the FXI mRNA level, the FXI protein level in the subject, or active form (FXIa) level, partial thromboplastin time (PTT) test, activated partial thromboplastin time test (aPTT or APTT) .