Biomarker for predicting immune related adverse events in cancer immunotherapy
PD-1 SNP rs10204525, modulated by miR-4717-3p, addresses the unpredictability of severe irAEs in cancer patients, allowing personalized immunotherapy through precise prediction and reduced adverse events.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-11-05
- Publication Date
- 2026-05-21
AI Technical Summary
Current biomarkers are unreliable in predicting severe immune-related adverse events (irAEs) in cancer patients undergoing immune checkpoint inhibitor therapy, limiting the personalized and safe administration of immunotherapy.
The use of PD-1 SNP rs10204525, modulated by miR-4717-3p, as a predictive biomarker to identify patients at higher risk for irAEs, allowing for personalized treatment plans and reducing severe irAEs through an in vitro method and kit for genotyping.
The method provides precise prediction of irAEs onset, enabling tailored immunotherapy to improve safety and management by minimizing severe adverse events.
Smart Images

Figure IMGF000016_0001 
Figure IMGF000021_0001_TABLE 
Figure IMGF000022_0001_TABLE
Abstract
Description
[0001] BIOMARKER FOR PREDICTING IMMUNE RELATED ADVERSE EVENTS IN CANCER IMMUNOTHERAPY
[0002] Field of the invention
[0003] The present invention relates to a predictive biomarker, specifically a single nucleotide polymorphism (SNP) in programmed death cell 1 (PD-1), designed to predict the development of immune-related adverse events (irAEs) in cancer patients, particularly those undergoing treatment with immune checkpoint inhibitors (ICIs) and at higher risk of irAEs.
[0004] Background of the Invention
[0005] The advent of ICI-based immunotherapy, using monoclonal antibodies (mAbs) that target PD-1 and its ligand PD-L1, has transformed the treatment of several solid tumors, including head and neck squamous cell carcinoma (HNSCC), melanoma, non-small cell lung cancer (NSCLC), and renal cell carcinoma (RCC) [1-15], This innovative immunotherapy approach has significantly improved the survival rates and safety profiles of patients with advanced solid tumors compared to traditional therapies [1-15], However, the efficacy of ICI-based therapy remains limited to a subset of patients, with only around 40% experiencing sustained clinical benefit. Among these, approximately 40% achieve long-term benefits, while 10-15% experience severe irAEs [1-15], These irAEs manifest as autoimmune conditions that may affect almost any organ and often resemble newly developed autoimmune diseases [16,17], The presentation of irAEs can vary widely in terms of the number of organs involved, time of onset, severity, and clinical course [16,17], Most irAEs affect a limited number of organs, typically emerging within the first three months after ICI treatment begins, and many cases resolve completely without the need to discontinue therapy [16,17], Unfortunately, a subset of patients (10-15%) experience severe irAEs, which can lead to prolonged complications or even fatal outcomes [1-15], Several biomarkers have been investigated to predict irAEs risk, including tumor mutational burden (TMB), cytokines (e.g., interleukin- la, -2, -6, -13, -17), C-reactive protein (CRP), eosinophil count, soluble cytotoxic T-lymphocyte antigen 4 (sCTLA-4), tumor microenvironment (TME), and gut microbiome composition. However, none of these biomarkers has been shown to reliably and consistently predict severe irAEs development [18-26], Over the last two decades, research has highlighted the impact of genetic variants, especially single nucleotide polymorphisms (SNPs), on disease aspects including cancer. Evidence increasingly links certain SNPs with cancer predisposition, treatment response, survival outcomes, and drug-related toxicity. Several PD-1 SNPs have been identified and associated with autoimmune diseases, such as Crohn's disease, systemic lupus erythematosus, type I diabetes, rheumatoid arthritis, and multiple sclerosis
[0027] . Some studies have linked certain PD-1 SNPs to an increased cancer risk, while others indicate a protective effect [28-33], Additionally, specific PD-1 SNPs have been associated with improved viral control in chronic infections
[0034] .
[0006] Has been disclosed the statistical association between the G allele of rs 10204525 and the occurrence of irAE in a limited cohort of Japanese patients (number of 106) treated with nivolumab and affected by metastatic renal cell carcinoma (mRCC)
[0048] ,
[0007] WO 2018 / 084706 discloses a method for genotyping a patient suffering from cancer for having a predisposition to a deviant biological response associated with immune checkpoint inhibitor therapy which therapy comprises the administration of an immune checkpoint inhibitor that inhibits PD-1- mediated and / or CTLA-4-mediated signaling in T-cells of said patient, said method for genotyping comprising comparing the germline sequence of a PD-1 axis protein gene or the sequence of its RNA in a sample from said patient with the germline sequence of the wild-type gene or the sequence of its RNA, wherein an alteration in the germline sequence of the PD-1 axis protein gene or the sequence of its RNA of the patient indicates a genotype having said predisposition to a deviant biological response, wherein the said alteration in the germline sequence is indicated by the presence of a polymorphic site, including also s Rs 10204525.
[0008] WO 2022 / 086852 discloses method for selecting a subject having cancer for treatment with an anti-cancer therapy other than the immune checkpoint therapy, by measuring the amount germline biomarker SNP rs7816685 in the subject sample, comparing said amount to a control; and c) selecting the subject for treatment with an anti-cancer therapy other than the immune checkpoint therapy if SNP rs7816685 is present or has a significantly increased amount in the subject sample relative to the control.
[0009] Technical Problem
[0010] There is an urgent need for new methods that can reliably predict which patients are likely to develop severe irAEs. Recently, PD-1 SNPs have been explored for their potential as predictive biomarkers for irAEs, but findings have been inconsistent [43-47], While the PD-1 / PD-L1 pathway is known to play a critical role in regulating anti -tumor immune responses, data on how specific PD-1 SNPs affect responses to anti-PD-l / PD-Ll blockade therapy remain limited. The present inventors have investigated PD-1 SNPs to identify advanced cancer patients treated with ICIs who are at higher risk for irAEs, aiming also to elucidate the molecular mechanisms underlying this predictive potential.
[0011] The results indicated:
[0012] • not all PD-1 SNPs are clinically relevant for predicting irAEs;
[0013] • has proved that the specific SNP, rsl0204525correlates with irAEs occurrence, since the available scientific literature does not provide studies clearly demonstrating the predictive role of these PD-1 SNPs as well as the molecular mechanisms underlying its potential predictive value;
[0014] Thus , the inventors of the present invention, underlying cellular mechanism, based on modulation of PD-1 expression by differential binding of specific miRNAs and allele specificity, demonstrated for the first time its role to predict the occurrence of irAEs.
[0015] The novel method, by using said biomarker, allows to precisely predict the onset of irAEs in patients treated with ICIs, to personalize and optimize the anti-cancer treatment plans, considering their predisposition to develop irAEs and contemporarily reducing the onset of severe irAEs by improving safety and management of immunotherapy.
[0016] The present invention, in respect to the prior art, presents the following improvements:
[0017] • The role of specific miRNAs (particularly miR-4717-3p) and the post- transcriptional regulatory mechanism that modulates the immune response to ICI, have been investigated and clarified;
[0018] • The role of miR-4717-3p has been identified by means of in silico analysis and functional verification (mimic, inhibitor, TSB);
[0019] • rs 10204525 has been selected among various SNPs since it shows predictive clinical significance of irAEs, in contrast to contradictory results from the prior art.
[0020] The distinguishing features of the present invention are:
[0021] • »It is based on the modulation of PD-1 expression by miR-4717-3p in an allelespecific manner, which occurs only in the presence of the C / C genotype of rs 10204525;
[0022] • The specific set of patients is; patients with solid tumors undergoing to anti-PD-1 and anti-PD-Ll treatment; • The kit has been specifically designed to identify the immune-related toxicity by genotyping rs 10204525,
[0023] Therefore, the novel method offers several advantages in comparison to existing products already known in the art, such as, improved diagnostic accuracy, allowing customization of immunotherapy treatments, integration with other different diagnostic methods and / or tests, ameliorate patient management by timely adjusting therapy in view of individual risks of irAEs onset.
[0024] Object of the Invention
[0025] This technical problem is addressed by providing PD-1 SNP rs 10204525 for use as predictive biomarker of immune-related adverse events (irAEs) in cancer patients undergoing anti-cancer therapy with immune checkpoint inhibitors (ICIs), in
[0026] an in vitro method for predicting the presence and / or the risk of developing and / or onset of immune-related adverse events (irAEs) in cancer patients undergoing immune checkpoint inhibitors (ICI)-based anti-cancer therapy and includes a corresponding kit to carry out said method.
[0027] The present invention will be further clarified by the following detailed description, experimental data, claims, and attached drawings.
[0028] Brief description of the drawings
[0029] Figure 1 PFS and OS of advanced cancer patients treated with anti-PD-l / PD-Ll mAbs, atezolizumab, nivolumab and pembrolizumab: at a median follow-up of 21.93 months (5.53-46.67 months) median PFS and OS were 4.15 months (A) and 7.86 months (B), respectively. PFS and OS analysis was performed using Kaplan-Meier method.
[0030] Figure 2 Modulation of PD-1 expression by miR-4717-3p based on rsl0204525 allelespecificity in human PBMCs under basal conditions or following IFN-y treatment: both PBMCsc / cand PBMCsc / Twere transfected with specific miR-4717-3p mimic, inhibitor, TSB and a combination of miR-4717-3p mimic with TSB for 48h. Both transfected PBMCsc / cand PBMCsc / Twere seeded into 24-well plates at a density of 2x105 cells per well and incubated with IFN-y (lOOng / ml). Following a 24h incubation at 37°C in a 5% CO2 atmosphere, expression levels of (A) miR-4717-3p normalized to miR-103-3p and (B) PD-1 mRNA normalized to GAPDH were evaluated by RT-PCR. The performances of each miR-4717-3p mimic, inhibitor or TSB were compared to their respective negative controls and expressed as mean ± SD of the results obtained in three independent experiments (***P < 0.001). (C) Following a 48h incubation at 37°C in a 5% CO2 atmosphere, PBMCs were harvested, lysed and analyzed by western blot with PD-1 -specific Ab. GAPDH was used as a loading control. The performances of each miR-4717-3p mimic, inhibitor or TSB were compared to their respective negative controls and plotted below their representative images as mean ± SD of the results obtained in three independent experiments (***P < 0.001). (D) Following a 48h incubation at 37°C in a 5% CO2 atmosphere, PBMCs were harvested and cell surface stained with Phycoerythrin (PE) anti-PD-1 IgGl,k Ab. PE anti-mouse IgG21 was used as a specificity control. Data, expressed as mean fluorescence intensity (MFI), are representative of the results obtained in three independent experiments.
[0031] Figure 3 Modulation by rs 10204525 allele-specificity of in vitro activity of anti-PD-1 nivolumab on transfected PBMCs co-cultured with HaCat cells: HaCat cells were seeded into 24-well plates at a density of 2*105cells per well. Following a 48h incubation at 37°C in a 5% CO2 atmosphere, cells were co-cultured with PBMCsc / cand PBMCsc / Tnontransfected or transfected with miRNA specific constructs (miR-4717-3p mimic, inhibitor, TSB and a combination of the mimic and TSB) in a 1:5 ratio and treated with 10 pg / ml of nivolumab and its human isotype IgG4 for 24h. Non-transfected PBMCsc / cand PBMCsc / Twere used as controls. (A) Following a 48h incubation after transfection, PBMCs were harvested and cell surface stained with Phycoerythrin (PE) anti-PD-1 IgGl,k Ab. PE antimouse IgG21 was used as a specificity control. Data, expressed as mean fluorescence intensity (MFI), are representative of the results obtained in three independent experiments. (B) HaCat cell viability was determined by cell counting kit-8 (CCK-8) assay. Data are expressed as mean percentages of the viability of co-cultured HaCat cells ± SD as compared to HaCat cells alone. The mean percentage of cell viability and SD were calculated from three independent experiments; each of them was performed in triplicate. (C) IFN-y levels in the medium harvested from co-cultured HaCat cells with non-transfected or transfected PBMCs were measured by an ELISA Max Deluxe Set Human IFN-y kit. Data are expressed as means of IFN-y levels ± SD of the results obtained in three independent experiments; each of them performed in triplicate. (D) The induction of apoptosis HaCat cells co-cultured with non-transfected or transfected PBMCs cells was determined by flow cytometry analysis of annexin V and propidium iodide (PI) staining. The levels of apoptosis are plotted and expressed as a mean fraction of annexin V+ cells ± SD of the results obtained in three independent experiments. * Indicates P <0.05. **Indicates P < 0.01. ***Indicates P < 0.001. ns indicates not statistically significant. Figure 4. Differential immune response by rsl0204525 genotype in PBMCs fromNSCLC patients co-cultured with non-cancer epithelial cells upon anti-PD-1 treatment. HaCaT and BEAS-2B cells were seeded into 24-well plates at a density of 2x105 cells per well. Following a 24h incubation at 37°C in a 5% CO2 atmosphere, cells were co-cultured with HLA-matched PBMCsC / C and PBMCsC / T isolated from Patients #1-4 in a 1:5 ratio and treated with 10 pg / ml of anti-PD-1 nivolumab and its human isotype IgG4 for 48h. Monocultured HaCaT and BEAS-2B cells were used as controls. (A) Following a 48h incubation, non-cancer cell growth inhibition was determined by CCK-8 assay. Data are expressed as mean percentages of the viability of co-cultured HaCaT and BEAS-2B cells ± SD as compared to HaCaT or BEAS-2B cells alone. The mean percentage of cell growth inhibition and SD were calculated from three independent experiments; each of them was performed in triplicate. (B) IFN-y levels in the medium harvested from co-cultured cells were measured by an ELISA Max Deluxe Set Human IFN-y kit. Data are expressed as a means of IFN-y levels ± SD of the results obtained in three independent experiments; each of them performed in triplicate. (C) The induction of apoptosis of HaCaT and BEAS-2B cells was determined by flow cytometry analysis of annexin V and propidium iodide (PI) staining. The levels of apoptosis are plotted and expressed as a mean fraction of annexin V+ cells ± SD of the results obtained in three independent experiments. * Indicates P <0.05. **Indicates P < 0.01. ***Indicates P < 0.001. ns indicates not statistically significant.
[0032] Figure 5. Enhanced immune response in rsl0204525 C / C PBMCs isolated from NSCLC patients upon anti-PD-1 and combined anti-PD-1 / CTLA-4 treatment in co-culture with non-cancer epithelial cells. HaCaT and BEAS-2B cells were seeded into 24-well plates at a density of 2x105 cells per well. Following a 24h incubation at 37°C in a 5% CO2 atmosphere, cells were co-cultured with HLA-matched PBMCsC / C and PBMCsC / T isolated from Patients #5 and #6 in a 1:5 ratio and treated with 10 pg / ml of anti-PD-1 nivolumab alone or in combination with 3.3 pg / ml of anti-CTLA-4 ipilimumab and their human isotype IgG4 for 48h. Monocultured HaCaT and BEAS-2B cells were used as controls. (A) Following a 48h incubation, non-cancer cell growth inhibition was determined by CCK-8 assay. Data are expressed as mean percentages of the viability of co-cultured HaCaT and BEAS-2B cells ± SD as compared to HaCaT or BEAS-2B cells alone. The mean percentage of cell growth inhibition and SD were calculated from three independent experiments; each of them was performed in triplicate. (B) IFN-y levels in the medium harvested from co-cultured cells were measured by an ELISA Max Deluxe Set Human IFN-y kit. Data are expressed as a means of IFN-y levels ± SD of the results obtained in three independent experiments; each of them performed in triplicate. (C) The induction of apoptosis of HaCaT and BEAS-2B cells was determined by flow cytometry analysis of annexin V and propidium iodide (PI) staining. The levels of apoptosis are plotted and expressed as a mean fraction of annexin V+ cells ± SD of the results obtained in three independent experiments. * Indicates P <0.05. **Indicates P < 0.01. ***Indicates P < 0.001. ns indicates not statistically significant.
[0033] Figure 6. Graphical representation of the influence of rsl0204525 genotype on PD-1 expression and increased sensitivity of HaCaT cells to anti -PD-1 therapy.
[0034] Detailed description of the invention
[0035] Within the meaning of the present invention, PD-1 SNP rs 10204525 allele variations (accession n. NC_000002.12) are disclosed in https: / / www.ncbi.nlm.iiih.gOv / siip / rsl0204525 / #variaiit details.
[0036] Within the meaning of the present invention, miR-4717-3p is disclosed in https: / / mirbase.org / results / ? query =miR-4717-3p accession n. MIMAT0019830.
[0037] Within the meaning of the present invention, ICIs are a class of immunotherapy drugs working by blocking intrinsic down-regulators of the immune system, as PD-1, leading to empowerment of immune systems.
[0038] Within the meaning of the present invention, irAEs are the autoimmune conditions that can affect any organ in the body after ICIs administration and lead to discontinuation of treatment with ICIs preferably irAEs are selected from the group consisting of: adrenal insufficiency, amylase increase, arthritis, asthenia, alanine aminotransferase increase, aspartate aminotransferase increase, colitis, creatinine increase, decreased appetite, diarrhea, fever, gynecomastia, hypophysitis, lipase increase, nausea, oral mucositis, pancreatitis, pneumonitis, pruritus, rash, thyroiditis, vitiligo, vomiting.
[0039] Within the meaning of the present invention, PD-1 is a protein encoded in humans by the PDCD1 gene, and it is a cell surface receptor on T cells and B cells regulating the immune system. PD-1 is an immune checkpoint and guards against autoimmunity through two mechanisms: promoting apoptosis of antigen-specific T-cells in lymph nodes and reducing S apoptosis in regulatory T cells.
[0040] Object of the invention is PD-1 SNP rs 10204525 for use as predictive biomarker for predicting the presence and / or the risk of developing and / or the onset of irAEs in PBMCs isolated from blood samples of cancer patients undergoing anti-cancer therapy with ICIs. An additional object of the invention is an in vitro method to predict the presence, risk of developing, and / or onset of irAEs in cancer patients undergoing ICI-based anti-cancer therapy.
[0041] Preferably, said method comprises the step of genotyping the C / C and C / T alleles of the SNP rs 10204525 in PBMCs isolated from blood samples of cancer patients undergoing anticancer therapy with ICIs.
[0042] Preferably cancer patients are affected by solid tumor, preferably selected from the group consisting of: non-small cell lung cancer, renal cell carcinoma, head and neck squamous cell carcinoma, melanoma.
[0043] Specifically, the presence of rs 10204525 C / T genotype reveals reduced number of irAEs than patients carrying C / C genotype.
[0044] It also an object of the present invention a kit for performing the in vitro method for predicting the presence and / or the risk of developing and / or the onset of immune related adverse effects in cancer patient undergoing to anti-cancer therapy with ICIs comprising at least means for genotyping the C / C and C / T allele of SNP rs!0204525 from PBMCs isolated from isolated blood samples or DNA extracted from saliva from said cancer patient.
[0045] Examples
[0046] Materials and Methods
[0047] Study population
[0048] Two cohorts of patients were included. In the first, Caucasian patients with confirmed advanced tumors were recruited from July 2017 and June 2022 at “San Giovanni di Dio e Ruggi D’Aragona” University Hospital. The study was performed without interfering with clinical practice. Selection of patients to be included in the study was performed based on: i) signed informed consent for clinical-pathological data acquisition; ii) age >18 years; iii) treatment with single agent anti-PD-l / PD-Ll as first or later lines of treatment in the specific disease; iv) no previous treatment with anti-PD-l / PD-Ll mAbs; v) treatment with baseline prednisone equivalent dose <10 mg / day; vi) absence of symptomatic brain metastases; vii) absence of active autoimmune disease; and viii) signed informed consent for blood sample collection and analysis. Based on patient availability, the study included patients with advanced HNSCC, melanoma, NSCLC and RCC. NSCLC patients with epidermal growth factor receptor (EGFR), anaplastic lymphoma kinase (ALK), c-ros oncogene 1 (ROS1), V- Raf Murine Sarcoma Viral Oncogene Homolog B (BRAF), Mesenchymal-epithelial transition factor (MET), REarranged during Transfection (RET) and Neurotrophic Tropomyosin Receptor Kinases (NTRK) tumor alterations were excluded from the study. Evaluation of ALK, BRAF, EGFR, MET, NTRK, RET and ROS1 alterations was performed on tumor samples (when available) or liquid biopsy according to national pathology guidelines. Clinical-pathological characteristics including age, sex, Eastern Cooperative Oncology Group (ECOG) performance status (PS), smoking status, comorbidities, presence / absence of asymptomatic brain metastases, previous chemotherapy and / or targeted therapy were collected. Then, response rate, median progression-free survival (PFS), median overall survival (OS) and rates of irAEs were calculated. Patient privacy and personal data were preserved by assigning a progressive anonymous identification number. Patients received anti-PD-1 (nivolumab or pembrolizumab) or anti-PD-Ll (atezolizumab) mAbs until progressive disease (PD) or unacceptable toxicity according to European Society for Medical Oncology (ESMO) guidelines. irAEs were defined as adverse events displaying a certain, likely or possible correlation with ICIs according to Common Terminology Criteria for Adverse Events (CTCAE) v 4.0
[0035] , irAEs were graded according to CTCAE v4.0
[0035] and prospectively collected. Safety assessments were made continuously during the ICI treatment. For patients who discontinued ICI, safety assessments were continued up to 100 days after the last dose of ICI. Radiographic imaging was performed every 8 weeks. Response rate was determined according to Response Evaluation Criteria in Solid Tumours version 1.1 (RECIST vl.l)
[0036] and reported as complete response (CR), partial response (PR), stable disease (SD) and PD. Objective response rate (ORR) was defined as the proportion of patients with a CR or PR. PFS was defined as the time from the start of treatment to the first documented PD or death by any cause. OS was defined as the time from the start of treatment to death by any cause or last follow-up date. Patients dead from COVID-19 were excluded from the study. In the second cohort, Caucasian patients with confirmed diagnosis of advanced NSCLC, were recruited from April 2021 to May 2024 at the same Institution. All patients were treated as first line with platinum-based chemotherapy (PBCT) and pembrolizumab (anti-PD-1) or PBCT and nivolumab (anti-PD-1) plus ipilimumab (anti-CTLA-4), according to clinical practice. Patients with EGFR, ALK, ROS1, BRAFV600, neurotrophic tyrosine receptor kinase 1 and 2 (NTRKl and 2), rearranged during transfection (RET), mesenchymal epithelial transition factor (MET) and human epidermal growth factor receptor 2 (HER2) tumor alterations were excluded from the study. The study was approved by the local ethics committee (prot. / SCCE n.85275), in accordance with the Declaration of Helsinki and its amendments.
[0049]
[0050] Six previous reported PD-1 SNPs (rsl0204525, rs2227981, rs7421861, rsl 1568821, rs36084323 and rs2227982) related to autoimmunity, cancer predisposition and cancer prognosis were selected to be genotyped [28-33], Peripheral blood mononuclear cells (PBMCs) were obtained from recruited patients before starting treatment with anti-PD- 1 / PD-L1 therapy and isolated as described
[0037] , Isolated PBMCs were stored at -80°C. PD- 1 SNPs were genotyped from DNA extracted from isolated PBMCs utilizing the Maxwell® 16 blood DNA purification kit (Promega, Madison, WI, USA) according to the manufacturer’s protocol. Quantity and quality of purified DNA were assessed in every sample using a NanoDrop spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Genotyping of PD-1 SNPs was performed using TaqMan genotyping assay (PD-1 gene: C_172862_10 for rsl0204525, C_57931286_20 for rs2227981, C_26891639_10 for rs7421861, C_57931290_10 for 11568821, C_57931321_10 for rs36084323 and C_57931287_10 for rs2227982 as described
[0038] ,
[0051] In silico analysis
[0052] PD-1 SNPs were mapped using NCBI dbSNP (http: / / www.ncbi.nlm.nih.gov / SNP) and ENSEMBL v58 (http: / / www.ensembl.org / ) databases. Identification of putative microRNAs (miRNAs) targeting the binding sites within the 3 ' UTR of PD-1 encompassing rsl0204525, was based on microSNiPer (http: / / vm24141.virt.gwdg.de / services / microsniper / ) and miRNASNP-v3 (http: / / bioinfo.life.hust.edu.cn / miRNASNP / ). Minimum free energy (MFE) score based on the binding affinity of identified miRNAs was evaluated using miRTarbase web server (https: / / awi.cuhk.edu.cn / ~miRTarBase / miRTarBase_2025 / php / index.php).
[0053] Cell cultures
[0054] PBMCs were isolated from blood sample collection of patients included in the study. PBMCs were cultured in RPMI medium (Euroclone, Milan, Italy) supplemented with 10% fetal bovin serum (FBS) (Euroclone) and 1% penicillin-streptomycin (Euroclone), at 37 °C in a humidified incubator containing 5% CO2. Human epidermal keratinocyte (HaCaT) and bronchial epithelial (BEAS-2B) cell lines were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). HaCaT cells were cultured in DMEM medium (Euroclone) supplemented with 10% FBS (Euroclone) and 1% penicillin-streptomycin (Euroclone), while BEAS-2B cells were cultured in airway epithelial cell basal medium (Lonza; Basel, Switzerland) supplemented with the bronchial epithelial cell growth kit (Lonza) according to the manufacturer’s recommendations (ATCC). All cells were regularly tested for mycoplasma contamination with the use of a MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland) following the manufacturer’s protocol.
[0055] Cell transfection experiments
[0056] PBMCs were seeded into 6-well plates at a density of 2*106cells per well. All transfection experiments were carried out by reverse transfection with HiPerFect reagent (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The following oligos at the indicated concentration were used: 5 nM of miR-4717-3p mimic (catalog, on. 339173, QUIAGEN); 60 nM of hairpin inhibitors (catalog, on. 232724697, IDT); 7.5 nM of PD-1-specific miR-4717-3p target site blocker (TSB) (catalog, on. 339194, SEQ. ID NO. 1 sequence: AGGGTGGGCACATGGGG, QIAGEN) or recommended negative miRNA mimic, hairpin inhibitor or TSB negative controls (catalog, on. 339173, QIAGEN; NCI, IDT; catalog, on. 339194, SEQ. ID NO. 2 sequence: ACGTCTATACGCCCA, QIAGEN, respectively). Following a 48h transfection period, PBMCs were incubated with 100 ng / ml of interferon gamma (IFN-y), purchased from PeproTech EC (London, UK) for 48h. Functional assays relative to RNA and protein analyses were performed at 24h and 48h posttransfection, respectively.
[0057] RNA isolation and quantitative Real-Time q(RT)-PCR
[0058] Following a 24h post-transfection period, miRNAs were extracted from PBMCs using the miRNeasy Mini Kit (catalog, on. 217004, QIAGEN) according to the manufacturer’s instructions. The quantity and quality of RNA samples were assessed using NanoDrop spectrophotometer (Thermo Scientific). For miRNA detection, 10 ng of RNA were reverse transcribed using the miRNA LNA PCR starter kit (catalog, on. 3616517, QIAGEN) including U6 as endogenous control. Reverse transcription was followed by qRT-PCR performed in duplicate using SensiFAST SYBRNo-ROX Kit (Bioline, Memphis, TN, USA) according to the manufacturer’s protocol. Expression levels of miR-4717-3p were normalized to miR103a-3p and relative expression levels were calculated within each independent experiment using the formula 2-AACT. Total RNA was extracted using TRIzol (Thermo Fisher) according to the manufacturer's protocol. The quantity and quality of RNA samples were assessed using NanoDrop spectrophotometer (Thermo Scientific). cDNA was transcribed using the SensiFAST cDNA Synthesis Kit (Bioline) according to the manufacturer’s protocol. Reverse transcription reactions were performed in a T100 Termal Cycler (Bio-Rad Laboratories Inc., Hercules, CA, USA) according to the manufacturer’s protocol. mRNA expression levels of PD-1 were evaluated by qRT-PCR. GAPDH was used as an internal reference gene. qRT-PCR was performed in duplicate using SensiFAST SYBR No-ROX Kit (Bioline) according to the manufacturer’s protocol. PCR reactions were carried out in LightCycler 480 II (Roche, Basel, Switzerland). Primer sets were:
[0059] SEQ. ID NO.3
[0060] PD-1 fw: CGTGGCCTATCCACTCCTCA;
[0061] SEQ. ID NO.4
[0062] PD-1 rv: ATCCCTTGTCCCAGCCACTC;
[0063] SEQ. ID NO.5
[0064] GAPDH fw: CTGACTTCAACAGCGACACC,
[0065] SEQ. ID NO.6
[0066] GAPDH rv: TAGCCAAATTCGTTGTCATACC.
[0067] Gene expression profile analysis was performed using 2-AACq method
[0039] , Data are representative of the results obtained in three independent experiments.
[0068] Western Blot Analysis
[0069] Following a 48h post-transfection period, PBMCs were harvested and lysed as described
[0040] , Cell lysates were analyzed by western blot with following antibodies: PD-1- (catalog on. 86163), GAPDH- (catalog on. 5174) specific Abs, horseradish peroxidase (HRP) antirabbit Ab (catalog on. 7074), were purchased from Cell Signaling (Danvers, MA, USA). GAPDH was used as a loading control. Data are representative of the results obtained in three independent experiments.
[0070] Flow cytometry analysis
[0071] PBMCs were seeded into 6-well plates at a density of 2x106 cells per well and incubated with interferon gamma (IFN-y) (lOOng / ml). Untreated cells were used as a control. Following a 48h incubation, PBMCs were harvested, and cell surface were stained with PE anti-PD-1 IgGlk Ab (catalog on. 329905, BioLegend, San Diego, CA, USA). PE anti-mouse IgGlk (catalog on. 406607, BioLegend) was used as a specificity control for PD-1 staining. Staining was performed as described
[0037] , Stained cells were analyzed using a FACS Verse flow cytometer (BD Biosciences, Swindon, UK). Data expressed as mean fluorescence intensity (MFI) are representative of the results obtained in three independent experiments.
[0072] Human leucocyte antigen (HLA) class I genotyping
[0073] HLA class I genotyping on HaCaT, BEAS-2B and PBMCs was performed at the Transplant Hematological Unit of “San Giovanni di Dio e Ruggi D’Aragona” University Hospital. HLA class I genotypes were characterized on non-cancer cells and PBMCs as described
[0039] , HLA class I genotyping of non-cancer cells was validated using TRON Cell Line Portal (https: / / www.cellosaurus.org / CVCL_0038).
[0074] Co-colture of HaCat cells with transfected PBMCs isolated from two NSCLC patients
[0075] Following a 48h post-transfection period, PBMCs isolated from two NSCLC patients carrying C / C or C / T genotypes in rs 10204525, were added to HaCat cells seeded into 24-well plates at a density of 2x105 cells per well (5:1 ratio) and incubated with 10 pg / ml of anti-PD-1 nivolumab, purchased from Thermo Fisher (Waltham, MA, USA) for 24h. The dose of nivolumab was selected based on antitumor activity tested in vitro on NSCLC cell lines
[0041] , Purified human IgG4 isotype control (catalog on. 403,402), purchased from BioLegend (San Diego, CA, USA), was used as a control for nivolumab. Monocultured nontransfected HaCat cells were used as a control for the following assays.
[0076] Co-colture of HaCaT cells with transfected and non-transfected HLA-matched PBMCs incubated with anti-PD-1 nivolumab and combination treatment
[0077] PBMCs isolated from six recruited patients were selected and cultured based on i) tumor type, ii) achievement of long-term clinical benefit from anti-PD-1 / PD-L1 + / - anti-CTLA-4 therapy, iii) presence of different rs 10204525 genotype (C / C or C / T), and iv) HLA class I antigen matching with the HaCaT or BEAS-2B cell lines. Following a 48h post-transfection period as previously described, PBMCs were added to HaCaT cells seeded into 24-well plates at a density of 2x105 cells per well (5:1 ratio) and incubated with 10 pg / ml of anti-PD-1 nivolumab (Thermo Fisher) for 24h.. In addition, PBMCs isolated from different rs!0204525 genotype patients were also added to HaCaT or BEAS-2B cells seeded into 24-well plates at a density of 2x105 cells per well (5:1 ratio) and incubated with 10 pg / ml of anti-PD-1 nivolumab (Thermo Fisher) + / - 3.3 pg / ml of anti-CTLA-4 ipilimimab (Thermo Fisher) for 48h. In our in vitro assays, we adopted a nivolumab to ipilimumab mass ratio of approximately 3:1 to emulate early-phase clinical regimens such as CheckMate 012 and CheckMate 9LA, where patients received nivolumab at 3 mg / kg combined with ipilimumab at 1 mg / kg (~3:1 by mass) [Nivolumab plus ipilimumab as first-line treatment for advanced non-small-cell lung cancer (CheckMate 012): results of an open-label, phase 1, multicohort study]. Purified human IgG4 isotype control (catalog on. 403,402, BioLegend), was used as a control for nivolumab or ipilimumab. Monocultured HaCaT and BEAS-2B cells were used as controls in all co-culture experiments.
[0078] Cell growth inhibition assay
[0079] Following a 24h or 48h of co-culture, HaCaT or BEAS-2B cells were washed with phosphate-buffered saline (PBS) and their viability was determined by cell counting kit-8 (CCK-8) assay (Dojindo Laboratories, Rockville, MD, USA) according to manufacturers’ protocol. The absorbance at 450 nm was determined using the Sunrise microplate reader (TECAN, Mannedorf, Switzerland). All experiments were performed in triplicates and repeated three times.
[0080] Cytotoxicity Assay
[0081] Following a 24h co-culture, HaCat cells were isolated with phosphate-buffered saline (PBS) washing and their viability was determined by cell counting kit-8 (CCK-8) assay (Dojindo Laboratories, Rockville, MD, USA) according to manufacturers’ protocol. The absorbance at 450 nm was determined by the Sunrise microplate reader (TECAN, Mannedorf, Switzerland). All experiments were performed in triplicates and repeated three times.
[0082] IFN-Y ELISA
[0083] Following a 24h co-culture, the medium was harvested and IFN-y levels were analyzed using ELISA Max Deluxe Set Human IFN-y (BioLegend) assay according to the manufacturers’ protocol. The absorbance at 450 nm was determined by the Sunrise microplate reader (TECAN). All experiments were performed in triplicates and repeated three times.
[0084] Annexin V-FITC / PI Assay
[0085] Following a 48h co-culture, HaCat cells were isolated with PBS washing. The Annexin V-FITC / PI assay was carried out using an Annexin V-FITC Early apoptosis detection kit (Cell Signaling technology, Danvers, MA, USA) to differentiate between viable, necrotic and apoptotic cells according to the manufacturer’s protocol. Stained cells were analyzed using a FACSVerse flow cytometer (BD Biosciences). Data are representative of the results obtained in three independent experiments.
[0086] Statistical analysis
[0087] All data was collected using Microsoft Excel. Statistical analyses were performed using STATA v!3 software released by StataCorp LP (College Station, TX, USA) or GraphPad Prism v6.0 released by GraphPad Software (La Jolla, CA, USA). Continuous data were expressed as medians and ranges, whereas categorical data were expressed as frequencies and percentages. PFS and OS were calculated using the Kaplan-Meier method. Correlations between clinical-pathological characteristics and ORR or PD-1 SNPs were performed using the Fisher's exact test, Mann- Whitney U test and the Kruskal-Wallis method, as appropriate. Correlations between clinical-pathological characteristics or PD-1 SNPs and survival outcomes (PFS and OS) were performed using log-rank test. The difference between groups was calculated using the two-sided, unpaired t test or one-way ANOVA. The difference between groups were considered significant when the P value was < 0.05.
[0088] Results
[0089] Clinical-pathological characteristics of cancer patients treated with anti-PD-l / PD-Ll therapyA total of 72 Caucasian patients with a confirmed diagnosis of advanced cancer from “San Giovanni di Dio e Ruggi D’ Aragona University Hospital” were included in the study. Forty-nine (68.06%), 9 (12.50%), 8 (11.11%) and 6 (8.33%) patients were affected by advanced NSCLC, RCC, HNSCC and melanoma, respectively. Baseline medical record information including clinical-pathological characteristics of patients are summarized in Table 1.
[0090] Table 1
[0091]
[0092]
[0093]
[0094] The median age was 66 years (range, 43-84 years). Fifty-nine patients (81.94%) were male. Fifty-four (75.00%) and 18 (25.00%) had ECOG PS of 0-1 and 2, respectively. Thirteen patients (18.06%) were never smokers, while 44 (61.11%) and 15 (20.83%) were previous and current smokers, respectively. Relevant comorbidities included hypertension (59.72%), dyslipidemia (26.39%), diabetes (19.44%), chronic obstructive pulmonary disease (COPD) (11.11%) and hearth failure (8.33%). Asymptomatic brain metastases were present in 14 (19.44%) patients. Most of the patients (84.72%) were treated with anti-PD-l / PD-Ll therapy as second line of treatment. Fifty-one (70.83%) and 10 (13.89%) patients had previously received chemotherapy and targeted therapy, respectively. Anti-PD-1 and anti-PD-Ll mAbs were administered in 88.89% and 11.11% of patients, respectively. Fifty-five (76.39%) and 9 (12.50%) patients were treated with anti-PD-1 nivolumab and pembrolizumab, respectively; 8 (11.11%) patients were treated with anti-PD-Ll atezolizumab. ORR was 27.78%. CRs, PRs, SDs and PDs were reported in 4 (5.56%), 16 (22.21%), 12 (16.67%) and 40 (55.56%) patients, respectively. At a median follow up of 21.93 months (5.53-46.67 months) 21 out of 72 patients (29.17%) were still alive. Median PFS and OS were 4.15 (0.46- 46.67 months) and 10.70 months (0.46-46.67 months), respectively (Figure 1).
[0095] Grade 1-2 and grade 3-4 irAEs were reported in 45 (62.50%) and 6 (8.33%) of treated patients, respectively (Table 2).
[0096] Table 2
[0097]
[0098]
[0099] The most frequently reported irAEs of grade 1-2 and grade 3-4 were asthenia (31.94%) and nausea (4.17 %), respectively. Three (4.17%) patients discontinued anti-PD-l / PD-Ll therapy because of development of irAEs. No treatment-related death was reported. Genotyping and mapping of PD-1 SNPs in cancer patients treated with anti-PD-1 / PD-L1 therapy rs2227982, rs36084323, rsl 1568821, rs7421861, rs2227981 and rsl0204525 PD-1 SNPs were selected and genotyped in the study population. The frequencies of analyzed PD-1 SNPs are described in Table 3. Table 3
[0100]
[0101] Mapping of SNPs on PD-1 has shown that rs2227982 and rs2227981 were localized on its exonic region (chr2:241851281 and chr2:241851121, respectively); rsll568821 and rs7421861 on its intronic region (chr2:241851760 and chr2:241853198, respectively); rs36084323 on its promoter region (chr2: 241859444) and rsl0204525 on its 3'-UTR region (chr2:241850169).
[0102] Association between clinical-pathological characteristics, clinical outcomes. irAEs and PD-1 SNPs in cancer patients treated with anti-PD-l / PD-Ll therapy
[0103] No significant associations between clinical-pathological characteristics, clinical outcomes and development of irAEs were found. In addition, no significant associations between clinical-pathological characteristics, clinical outcomes and PD-1 SNPs were detected. Lastly, no significant associations between PD-1 SNPs including rs2227981, rs7421861, rsl 1568821, rs36084323, rs2227982 and development of irAEs were found. However, presence of different genotypes in rsl 0204525 significantly correlated with development of irAEs. Specifically, patients carrying C / C genotype in rsl 0204525 developed more grade 1-2 and 3-4 irAE (P = 0.0053 and P < 0.0001, respectively) as compared to patients carrying C / T genotype. Worth of note, in patients carrying a C / T genotype in rsl0204525 no grade3-4 irAEs were reported as well as no grade 1-2 irAEs of special interest including arthritis, alanine / aspartate aminotransferase increase, pancreatitis, nausea, and adrenal insufficiency.
[0104] To further validate these results, the predictive role of rsl0204525 was investigated in a validation cohort of advanced non-oncogene addicted NSCLC patients who were treated in first line therapy with the combination of PBCT and pembrolizumab or the combination of PBCT and nivolumab plus ipilimumab. Twenty-seven patients were enrolled from April 2021 to May 2024. Baseline medical record information including clinical-pathological characteristics of patients are summarized in online supplementary table 1. Grade 1-2 and grade 3-4 irAEs were reported in 18 (66.67%) and 9 (33.33%) of treated patients, respectively (online supplementary table 2). The most frequently reported irAEs of grade 1-2 and grade 3-4 were asthenia (33.33%) and pneumonitis (14.81%), respectively. Five (18.52%) patients discontinued combination therapy because of development of irAEs. No treatment-related death was reported. In addition, no significant difference in irAE rates based on ICI-regimen (PBCT and pembrolizumab vs PBCT and nivolumab plus ipilimumab) was found. rsl0204525 PD-1 SNP was genotyped as C / C, C / T, and T / T in 18 (66.67%), 9 (33.33%) and 0 (0.00%) patients, respectively. Even in this cohort, patients carrying C / C genotype inrsl0204525 developed more grade 1-2 and 3-4 irAE (P = 0.0012 andP = 0.0116, respectively) as compared to patients carrying C / T genotype. No grade 3-4 irAEs in patients carrying a C / T genotype in rsl 0204525 were detected.
[0105] Identification of putative miRNAs binding to rsl 0204525 in 3'-UTR of PD-1 gene based on its allele-specificity
[0106] rs!0204525 mapped to the 3'-UTR region of the PD-1 gene. SNPs localized in the 3’-UTR region can affect the binding affinity of specific miRNAs that in turn modify target gene expression. As a result, we investigated whether specific miRNAs might affect PD-1 gene expression changes by rsl 0204525 allele-specificity. To identify the putative miRNAs binding to rsl 0204525 by its allele-specificity, miRNASNiPer and miRNASNP-v3 databases were used. As reported in Table 4, three putative miRNAs (miR-3945-3p, miR-4717-3p and miR-3115) were identified to bind rsl 0204525 based on its allele-specificity. Table 4 reports Table 4 Identification of miRNAs targeting rsl0204525 in the 3' UTR of PD-1 by difference of minimum free energy of hybridization (AMFE) between allele C and T.
[0107] Table 4
[0108]
[0109] All three identified miRNAs recognized a seed region of 8-10 nucleotides encompassing the critical locus rs 10204525. Among them, miR-4717-3p demonstrated the most favorable thermodynamic profile indicated by the lowest minimum free energy value (AMFE) of -1.33, suggesting the strongest miRNA:mRNA affinity. As a result, we selected miR-4717-3p as the best candidate to further investigate its potential role in the modulation of PD-1 gene expression by rs 10204525 allele-specificity.
[0110] Modulation of PD-1 expression and induction by allele-specificity binding of miR-4717-3p to rs 10204525 in human PBMCs
[0111] PBMCs carrying C / C (PBMCsC / C) and C / T (PBMCsC / T) in rsl0204525 were isolated from blood sample collection, cultured, and transfected with i) specific miR-4717-3p mimic, ii) specific miR-4717-3p inhibitor, and iii) TSB. Evaluation of miR-4717-3p in PBMCs transfected with negative miRNA mimic, negative miRNA mimic plus negative TSB and negative inhibitor did not change the levels of miR-4717-3p (online supplemental figure 1). As a result, negative miRNA mimic was selected as a negative control for further experiments. The validity of miRNA transfection was verified by quantifying miR-4717-3p levels under basal conditions and following IFN-y incubation (Figure 2A). Specifically, miR-4717-3p levels were increased by miR-4717-3p mimic with or without TSB, while they were decreased by specific miR-4717-3p inhibitor, regardless of rs 10204525 genotype. IFN-y incubation, utilized to mimic PBMC activation and to induce PD-1 up-regulation
[0043] , did not affect miR-4717-3p levels in any of the transfected experimental conditions in both PBMCsC / C and PBMCsC / T. On the other hand, analysis of PD-1 expression, under basal conditions and following IFN-y incubation, demonstrated that miR-4717-3p modulation differentially affected PD-1 mRNA and protein levels in PBMCsC / C and PBMCsC / T (Figure 2B-D, online supplemental figure 2). Specifically, under basal conditions, PD-1 expression was significantly higher in PBMCsC / T transfected with negative miRNA mimic as compared to those of PBMCsC / C. In addition, modulation of mir-4717-3p by miR-4717-3p mimic and inhibitor significantly reduced and increased, respectively, PD-1 levels in PBMCsC / C, but not in PBMCsC / T. Similarly, transfection with the TSB alone increased PD-1 expression in PBMCsC / C, but not in PBMCsC / T. Lastly, as expected, IFN-y incubation increased PD-1 levels, regardless of rsl0204525 genotype and / or miR-4717-3p modulation. However, even in this case, IFN-y-mediated PD-1 up-regulation was increased to a greater extent in PBMCsC / T as compared to that of PBMCsC / C. These results validated the cause effect relationship between the allele-specificity of rsl0204525 with miR-4717-3p binding. The latter in turn negatively regulated expression and induction of PD-1 in immune cells only in presence of C / C rs 10204525 genotype, but not in C / T.
[0112] Modulation by allele specificity binding of miR-4717-3p-mediated PD-1 expression and induction on the in vitro reactivity of HL A-matched PBMCs to recognize and destroy noncancer cells incubated with anti -PD-1 nivolumab
[0113] To assess the clinical relevance of the association between the development of irAEs and the modulation of expression / induction of PD-1 on immune cells mediated by allele-specificity binding of miR-4717-3p to rs 10204525, we first co-cultured non-cancer cells (HaCaT cells) with miR-4717-3p modulated HLA class I-matched PBMCsC / C and PBMCsC / T, under basal conditions and following incubation with the anti-PD-1 nivolumab (Figure 3). Analysis of HLA class I profile revealed that HaCaT cells were homozygous for HLA-A*31:01 and heterozygous for HLA-B*40:01:02, 51:01:01 as well as for HLA-C*03:04:01, 15:02:01. PBMCs were isolated from blood sample collection of two out of six of the recruited patients and were selected based on their similar clinical-pathological characteristics, differential rsl0204525 genotype, and HLA class I antigen matching to HaCaT cells (HLA-A*31:01 and HLA-C*03:04:01 for PBMCC / C; and HLA-A*31:01 and HLA-C*03:04:01 for PBMCC / C). Noteworthy, all patients were affected by advanced NSCLC, four were long responder to second line anti-PD-1 therapy, while patients #5 and #6 received the combination of PBCT and nivolumab plus ipilimumab. All patients developed grade 1-2 irAEs in presence of C / C genotype for rsl0204525 while the others, in presence of C / T genotype, did not. On the other hand, no patient carrying C / T in rs 10204525 developed grade 3-4 irAEs while among those carrying C / C in rsl0204525, both patient #3 and patient #5 developed grade 3-4 irAEs. Noteworthy, grade 3-4 irAEs led to discontinuation of ICI therapy in patient #5 as shown in table 5, reporting the clinical-pathological characteristics of NSCLC patients selected for PBMC-co-culturing experiments.
[0114] Table 5
[0115]
[0116] i
[0117]
[0118] Quantification of PD-1 surface protein expression on PBMCs across all experimental conditions was used to validate the efficiency of miR-4717-3p modulation by transfection (Figure 3A). Consistently with previous findings, modulation of miR-4717-3p affected PD- 5 1 expression on PBMCsC / C. Indeed, a significant decrease and increase was detected in PD- 1 surface expression upon transfection with miR-4717-3p mimic and miR-4717-3p inhibitor / TSB, respectively. In contrast, in PBMCsC / T, transfection with miR-4717-3p mimic, miR-4717-3p inhibitor or the combination of miR-4717-3p mimic and TSB did not affect PD-1 expression. Cell growth inhibition and apoptosis induction of HaCaT cells as well as IFN-y release by PBMCs were increased in a greater extent when HaCaT cells were co-cultured with PBMCsC / C as compared to HaCaT cells co-cultured with PBMCsC / T (Figure 3B-3D). In addition, cell growth inhibition and apoptosis induction of HaCaT cells as well as IFN-y release by PBMCsC / C were dramatically decreased and not significantly affected, respectively, by miR-4717-3p mimic and miR-4717-3p inhibitor transfection of 5 PBMCsC / C co-cultured with HaCaT cells as compared to those by negative miRNA mimic transfected PBMCsC / C (Figure 3B-3D). Similar results to miR-4717-3p inhibitor transfection were obtained when PBMCsC / C were transfected with miR-4717-3p mimic and TSB. In contrast, cell growth inhibition and apoptosis induction of HaCaT cells as well as IFN-y release by PBMCsC / T were not changed when HaCaT cells were co-cultured with 0 modulated miR-4717-3p PBMCsC / T as compared to that of HaCaT cells co-cultured with negative miRNA mimic transfected PBMCsC / T (Figure 3B-D). Finally, treatment with anti- PD-1 nivolumab significantly and differentially affected PBMC-mediated recognition and destruction of HaCaT cells based on rs 10204525 genotype. Specifically, nivolumab treatment significantly increased cell growth inhibition and apoptosis induction of HaCaT cells as well as IFN-y release by negative miRNA mimic transfected PBMCC / C as compared to cells incubated with isotype control. Additionally, nivolumab treatment synergistically increased the significant increase of cell growth inhibition and apoptosis induction of HaCaT cells as well as IFN-y release by miR-4717-3p mimic transfected PBMCC / C as compared to control groups (Figure 3B-D). In contrast, in all experimental conditions involving the 0 modulated transfection of miR-4717-3p in PBMCsC / T co-cultured with HaCaT cells, no significant changes, even following nivolumab incubation, were detected. Nivolumab treatment slightly decreased the viability of HaCaT cells (Figure 3B) as well as slightly increased PBMC-mediated IFN-y release (Figure 3C) and apoptosis induction of HaCaT cells (Figure 3D) as compared to HaCaT cells treated with IgG4 isotype control, co-cultured with all types of transfected PBMCsC / T. Second, in order to confirm the obtained clinical results as well as the in vitro results, an additional cell line (BEAS-2B) as well as HaCat cell were co-coltured with PBMC isolated from additional patients carrying different rs 10204525 genotypes differential rs 10204525 genotypes following incubation with nivolumab (Fig. 5a) or with nivolumab in combination with anti-CTLA-4 ipilimumab. Specifically, the results demonstrated that the presence of C / C genotype is associated with an increase susceptibility of non-cancer cell to the anti-PD-1 or anti-PD-1 and anti-CTLA-4 mediated enhanced activity of PBMC as compared to C / T genotype.
[0119] PBMCs were transfected with miR-4717-3p mimic, inhibitor, or TSB to modulate miR-4717-3p activity. Following transfection, PBMCs were co-cultured with HaCaT cells, both at baseline and after treatment with the anti-PD-1 antibody nivolumab. HaCaT cells were confirmed to be homozygous for HLA-A31:01 and heterozygous for HLA-B40:01:02, 51:01:01 and HLA-C*03:04:01, 15:02:01, ensuring appropriate HLA class I compatibility with PBMCs. PBMC donors were selected based on matched HLA alleles and differential rs 10204525 genotype. Quantification of PD-1 surface protein expression on PBMCs across all experimental conditions was used to validate the efficiency of miR-4717-3p modulation by transfection (Figure 3 A). Consistently with previous findings, modulation of miR-4717-3p affected PD-1 expression on PBMCsC / C. Indeed, a significant decrease and increase was detected in PD-1 surface expression upon transfection with miR-4717-3p mimic and miR-4717-3p inhibitor / TSB, respectively. In contrast, in PBMCsC / T, transfection with miR-4717-3p mimic, miR-4717-3p inhibitor or the combination of miR-4717-3p mimic and TSB did not affect PD-1 expression. Cell growth inhibition and apoptosis induction of HaCaT cells as well as IFN-y release by PBMCs were increased in a greater extent when HaCaT cells were co-cultured with PBMCsC / C as compared to HaCaT cells co-cultured with PBMCsC / T (Figure 3B-3D). In addition, cell growth inhibition and apoptosis induction of HaCaT cells as well as IFN-y release by PBMCsC / C were dramatically decreased and not significantly affected, respectively, by miR-4717-3p mimic and miR-4717-3p inhibitor transfection of PBMCsC / C co-cultured with HaCaT cells as compared to those by negative miRNA mimic transfected PBMCsC / C (Figure 3B-3D). Similar results to miR-4717-3p inhibitor transfection were obtained when PBMCsC / C were transfected with miR-4717-3p mimic and TSB. In contrast, cell growth inhibition and apoptosis induction of HaCaT cells as well as IFN-y release by PBMCsC / T were not changed when HaCaT cells were co-cultured with modulated miR-4717-3p PBMCsC / T as compared to that of HaCaT cells co-cultured with negative miRNA mimic transfected PBMCsC / T (Figure 3B-D). Finally, treatment with anti-PD-1 nivolumab significantly and differentially affected PBMC-mediated recognition and destruction of HaCaT cells based on rs 10204525 genotype. Specifically, nivolumab treatment significantly increased cell growth inhibition and apoptosis induction of HaCaT cells as well as IFN-y release by negative miRNA mimic transfected PBMCC / C as compared to cells incubated with isotype control. Additionally, nivolumab treatment synergistically increased the significant increase of cell growth inhibition and apoptosis induction of HaCaT cells as well as IFN-y release by miR-4717-3p mimic transfected PBMCC / C as compared to control groups (Figure 3B-D). In contrast, in all experimental conditions involving the modulated transfection of miR-4717-3p in PBMCsC / T co-cultured with HaCaT cells, no significant changes, even following nivolumab incubation, were detected. Nivolumab treatment slightly decreased the viability of HaCaT cells (Figure 3B) as well as slightly increased PBMC -mediated IFN-y release (Figure 3C) and apoptosis induction of HaCaT cells (Figure 3D) as compared to HaCaT cells treated with IgG4 isotype control, co-cultured with all types of transfected PBMCsC / T. To validate and extend these findings, were conducted additional co-culture experiments involving PBMCs isolated from other two NSCLC patients from the first patient cohort (Patient #3 and #4, Table 5) carrying C / C and C / T genotypes, respectively (Figure 4). PBMCs, without miRNA modulation, were co-cultured with both HaCaT and BEAS-2B cells, confirming consistent genotype-dependent differences in immune activation and cytotoxicity. HL A class I typing confirmed compatibility with both cell lines (BEAS-2B: homozygous HLA-A02: 01 and HLA-C07: 01, heterozygous HLA-B*07: 02, 15:01). Finally, to further corroborate the genotype-dependent immune response and its modulation by immune checkpoint blockade, PBMCs isolated from two additional NSCLC patients (Patient #5 and Patient #6, Table 5) carrying C / C and C / T genotypes, respectively from a second cohort were co-cultured with HaCaT and BEAS-2B cells (Figure 5). PBMCs were treated with nivolumab alone or in combination with the anti-CTLA-4 antibody ipilimumab. Results demonstrated that PBMCsC / C exhibited significantly enhanced cytotoxicity and IFN-y secretion in response to both anti-PD-1 monotherapy and combined checkpoint blockade compared to PBMCsC / T. These genotype-dependent differences in immune activation were also reflected in the clinical setting. Noteworthy, all patients included in the analysis were affected by advanced NSCLC. Patient #1-4 were long responders to second-line anti-PD-1 therapy, while patients #5 and #6 received platinum-based chemotherapy (PBCT) in combination with nivolumab plus ipilimumab. All patients developed grade 1-2 irAEs, Importantly, only two patients carrying C / C genotypes (Patients #3 and #5) experienced grade 3-4 irAEs, while no C / T patients developed grade 3-4 irAEs. These severe irAEs led to discontinuation of ICI therapy in patient #5. These clinical observations support the hypothesis that the C / C genotype at rs 10204525 predisposes to heightened immune activation and a greater risk of immune-related toxicities, in line with in vitro findings.
[0120] In summary, the above experimental results demonstrate that:
[0121] • not all PD-1 SNPs have clinical significance for predicting irAEs, the role of rs 10204525 to predict the occurrence of irAEs and only rs 10204525 significantly correlated with the occurrence of irAEs;
[0122] • both grade 1-2 and grade 3-4 irAE rates were significantly higher in patients carrying C / C genotype in rsl0204525 as compared to those carrying C / T genotype in rs 10204525;
[0123] • the underlying mechanism is the modulation of PD-1 expression of PBMCs based on the differential binding of miR-4717-3p to rsl0204525;
[0124] • PD-1 gene expression was increased in PBMCsc / Tas compared to PBMCsc / cand it is differentially modulated by miR-4717-3p based on rs 10204525 allele specificity;
[0125] • miR-4717-3p mimic transfected PBMCsc / cshowed a decreased PD-1 expression;
[0126] • no difference of PD-1 expression was detected in miR-4717-3p mimic transfected PBMCSC / T;
[0127] • rs 10204525 genotype modulates the immune response to anti-PD-1 therapy by the differential binding of miR-4717-3p. References
[0128] 1. Bhatia A, Burtness B. Treating Head and Neck Cancer in the Age of Immunotherapy: A 2023 Update. Drugs. 2023;83:217-48.
[0129] 2. Borghaei H, Paz-Ares L, Hom L, Spigel DR, Steins M, Ready NE, et al. Nivolumab versus Docetaxel in Advanced Nonsquamous Non-Small-Cell Lung Cancer. N Engl J Med.
[0130] 2015;373:1627-39.
[0131] 3. Brahmer J, Reckamp KL, Baas P, Crind L, Eberhardt WEE, Poddubskaya E, et al. Nivolumab versus Docetaxel in Advanced Squamous-Cell Non-Small-Cell Lung Cancer. N Engl J Med. 2015;373:123-35.
[0132] 4. F S, L L, S P, S F. Immune checkpoint inhibitors for the treatment of melanoma. Expert opinion on biological therapy [Internet]. 2022 [cited 2023 May 20];22. Available from: https : / / pubmed.ncbi .nlm.nih. gov / 35130816 /
[0133] 5. Ferris RL, Blumenschein G, Fayette J, Guigay J, Colevas AD, Licitra L, et al. Nivolumab for Recurrent Squamous-Cell Carcinoma of the Head and Neck. N Engl J Med.
[0134] 2016;375:1856-67.
[0135] 6. Lahiri A, Maji A, Potdar PD, Singh N, Parikh P, Bisht B, et al. Lung cancer immunotherapy: progress, pitfalls, and promises. Mol Cancer. 2023;22:40.
[0136] 7. Ma P, Mk C, Jd W. Immune Checkpoint Blockade in Cancer Therapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology [Internet], 2015 [cited 2023 May 20];33. Available from: https: / / pubmed.ncbi.nlm.nih.gov / 25605845 /
[0137] 8. Motzer RJ, Escudier B, McDermott DF, George S, Hammers HJ, Srinivas S, et al. Nivolumab versus Everolimus in Advanced Renal-Cell Carcinoma. N Engl J Med.
[0138] 2015;373:1803-13.
[0139] 9. P L, M F, R F, R DB, R I, C C, et al. New first-line immunotherapy-based combinations for metastatic renal cell carcinoma: A systematic review and network meta-analysis. Cancer treatment reviews [Internet]. 2022 [cited 2023 May 20]; 106. Available from: https: / / pubmed.ncbi.nlm.nih.gov / 35313232 / 10. P S, Ba S, S A, Ss Y, Sk S, J G, et al. The Next Decade of Immune Checkpoint Therapy. Cancer discovery [Internet]. 2021 [cited 2023 May 20];ll. Available from: https : / / pubmed.ncbi .nlm.nih. gov / 33811120 /
[0140] 11. Postow MA, Chesney J, Pavlick AC, Robert C, Grossmann K, McDermott D, et al. Nivolumab and ipilimumab versus ipilimumab in untreated melanoma. N Engl J Med.
[0141] 2015;372:2006-17.
[0142] 12. Reck M, Rodriguez-Abreu D, Robinson AG, Hui R, Csoszi T, Fiilop A, et al. Pembrolizumab versus Chemotherapy for PD-L1 -Positive Non-Small-Cell Lung Cancer. N Engl J Med. 2016;375:1823-33.
[0143] 13. Robert C, Long GV, Brady B, Dutriaux C, Maio M, Mortier L, et al. Nivolumab in previously untreated melanoma without BRAF mutation. N Engl J Med. 2015;372:320-30.
[0144] 14. Robert C, Schachter J, Long GV, Arance A, Grob JJ, Mortier L, et al. Pembrolizumab versus Ipilimumab in Advanced Melanoma. N Engl J Med. 2015;372:2521-32.
[0145] 15. Robert C, Thomas L, Bondarenko I, O’Day S, Weber J, Garbe C, et al. Ipilimumab plus dacarbazine for previously untreated metastatic melanoma. N Engl J Med. 2011;364:2517-26.
[0146] 16. Conroy M, Naidoo J. Immune-related adverse events and the balancing act of immunotherapy. Nat Commun. 2022;13:392.
[0147] 17. Williams KC, Gault A, Anderson AE, Stewart CJ, Lamb CA, Speight RA, et al. Immune-related adverse events in checkpoint blockade: Observations from human tissue and therapeutic considerations. Front Immunol. 2023;14: 1122430.
[0148] 18. Jia X-H, Geng L-Y, Jiang P-P, Xu H, Nan K-J, Yao Y, et al. The biomarkers related to immune related adverse events caused by immune checkpoint inhibitors. J Exp Clin Cancer Res. 2020;39:284.
[0149] 19. Valpione S, Pasquali S, Campana LG, Piccin L, Mocellin S, Pigozzo J, et al. Sex and interleukin-6 are prognostic factors for autoimmune toxicity following treatment with anti-CTLA4 blockade. J Transl Med. 2018;16:94. 20. Fujisawa Y, Yoshino K, Otsuka A, Funakoshi T, Fujimura T, Yamamoto Y, et al. Fluctuations in routine blood count might signal severe immune-related adverse events in melanoma patients treated with nivolumab. J Dermatol Sci. 2017;88:225-31.
[0150] 21. Diehl A, Yarchoan M, Hopkins A, Jaffee E, Grossman SA. Relationships between lymphocyte counts and treatment-related toxicities and clinical responses in patients with solid tumors treated with PD-1 checkpoint inhibitors. Oncotarget. 2017;8:114268-80.
[0151] 22. Khan S, Khan SA, Luo X, Fattah FJ, Saltarski J, Gloria-McCutchen Y, et al. Immune dysregulation in cancer patients developing immune-related adverse events. Br J Cancer.
[0152] 2019;120:63-8.
[0153] 23. Lim SY, Lee JH, Gide TN, Menzies AM, Guminski A, Carlino MS, et al. Circulating Cytokines Predict Immune-Related Toxicity in Melanoma Patients Receiving Anti-PD-1-Based Immunotherapy. Clin Cancer Res. 2019;25:1557-63.
[0154] 24. Pistillo MP, Fontana V, Morabito A, Dozin B, Laurent S, Carosio R, et al. Soluble CTLA-4 as a favorable predictive biomarker in metastatic melanoma patients treated with ipilimumab: an Italian melanoma intergroup study. Cancer Immunol Immunother.
[0155] 2019;68:97-107.
[0156] 25. Bomze D, Hasan Ah O, Bate A, Flatz L. Association Between Immune-Related Adverse Events During Anti-PD-1 Therapy and Tumor Mutational Burden. JAMA Oncol.
[0157] 2019;5:1633-5.
[0158] 26. Chaput N, Lepage P, Coutzac C, Soularue E, Le Roux K, Monot C, Boselli L, Routier E, Cassard L, Collins M, Vaysse T, Marthey L, Eggermont A, Asvatourian V, Lanoy E, Mateus C, Robert C, Carbonnel F. et al. Baseline gut microbiota predicts clinical response and colitis in metastatic melanoma patients treated with ipilimumab. Annals of oncology : official journal of the European Society for Medical Oncology [Internet], 2017 [cited 2023 May 21];28. Available from: https: / / pubmed.ncbi.nlm.nih.gov / 28368458 / ?dopt=Abstract
[0159] 27. Gianchecchi E, Delfino DV, Fierabracci A. Recent insights into the role of the PD-l / PD-L1 pathway in immunological tolerance and autoimmunity. Autoimmun Rev.
[0160] 2013;12:1091-100.
[0161] 28. Nielsen C, Laustrup H, Voss A, Junker P, Husby S, Lillevang ST. A putative regulatory polymorphism in PD-1 is associated with nephropathy in a population-based cohort of systemic lupus erythematosus patients. Lupus. 2004;13:510-6. 29. Kong EK-P, Prokunina-Olsson L, Wong WH-S, Lau C-S, Chan T-M, Alarcon-Riquelme M, et al. A new haplotype of PDCD1 is associated with rheumatoid arthritis in Hong Kong Chinese. Arthritis Rheum. 2005;52:1058-62.
[0162] 30. Prokunina L, Castillejo-Lopez C, Oberg F, Gunnarsson I, Berg L, Magnusson V, et al. A regulatory polymorphism in PDCD1 is associated with susceptibility to systemic lupus erythematosus in humans. Nat Genet. 2002;32:666-9.
[0163] 31. Hashemi M, Karami S, Sarabandi S, Moazeni-Roodi A, Malecki A, Ghavami S, et al. Association between PD-1 and PD-L1 Polymorphisms and the Risk of Cancer: A MetaAnalysis of Case-Control Studies. Cancers (Basel). 2019;l 1 : 1150.
[0164] 32. Lee SY, Jung DK, Choi JE, Jin CC, Hong MJ, Do SK, et al. Functional polymorphisms in PD-L1 gene are associated with the prognosis of patients with early stage non-small cell lung cancer. Gene. 2017;599:28-35.
[0165] 33. Dong W, Gong M, Shi Z, Xiao J, Zhang J, Peng J. Programmed Cell Death- 1 Polymorphisms Decrease the Cancer Risk: A Meta-Analysis Involving Twelve Case-Control Studies. PLoS One. 2016;ll:e0152448.
[0166] 34. Zheng L, Li D, Wang F, Wu H, Li X, Fu J, et al. Association between hepatitis B viral burden in chronic infection and a functional single nucleotide polymorphism of the PDCD1 gene. J Clin Immunol. 2010;30:855-60.
[0167] 35. Common Terminology Criteria for Adverse Events (CTCAE) | Protocol Development | CTEP [Internet]. [cited 2023 Oct 11]. Available from: https: / / ctep.cancer.gov / protocoldevelopment / electronic_applications / ctc.htm
[0168] 36. Eisenhauer EA, Therasse P, Bogaerts J, Schwartz LH, Sargent D, Ford R, et al. New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur J Cancer. 2009;45:228-47.
[0169] 37. Puca AA, Lopardo V, MontellaF, Di Pietro P, Cesselli D, Rolle IG, et al. The Longevity-Associated Variant of BPIFB4 Reduces Senescence in Glioma Cells and in Patients’ Lymphocytes Favoring Chemotherapy Efficacy. Cells. 2022; 11:294.
[0170] 38. Nomizo T, OzasaH, Tsuji T, Funazo T, Yasuda Y, Yoshida H, et al. Clinical Impact of Single Nucleotide Polymorphism in PD-L1 on Response to Nivolumab for Advanced Non-Small-Cell Lung Cancer Patients. Sci Rep. 2017;7:45124. 39. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45.
[0171] 40. Colangelo T, Carbone A, Mazzarelli F, Cuttano R, Dama E, Nittoli T, et al. Loss of circadian gene Timeless induces EMT and tumor progression in colorectal cancer via Zebl-dependent mechanism. Cell Death Differ. 2022;29:1552-68.
[0172] 41. Polcaro G, Liguori L, Manzo V, Chianese A, Donadio G, Caputo A, et al. rs822336 binding to C / EBPP and NFIC modulates induction of PD-L1 expression and predicts anti-PD-1 / PD-L1 therapy in advanced NSCLC. Mol Cancer. 2024;23:63.
[0173] 42. Sri-Ngem-Ngam K, Keawvilai P, Pisitkun T, Palaga T. Upregulation of programmed cell death 1 by interferon gamma and its biological functions in human monocytes. Biochem Biophys Rep. 2022;32: 101369.
[0174] 43. M K, KN, S H, Y M, Y S, H S, et al. Severe Immune-Related Adverse Events in Patients Treated with Nivolumab for Metastatic Renal Cell Carcinoma Are Associated with PDCD1 Polymorphism. Genes [Internet]. 2022 [cited 2023 May 21]; 13. Available from: https : / / pubmed.ncbi.nlm.nih. gov / 35885987 /
[0175] 44. Bins S, Basak EA, El Bouazzaoui S, Koolen SLW, Oomen-de Hoop E, van der Leest CH, et al. Association between single-nucleotide polymorphisms and adverse events in nivolumab-treated non-small cell lung cancer patients. Br J Cancer. 2018;118:1296-301.
[0176] 45. Abdel-Wahab N, Diab A, Yu RK, Futreal A, Criswell LA, Tayar JH, et al. Genetic determinants of immune-related adverse events in patients with melanoma receiving immune checkpoint inhibitors. Cancer Immunol Immunother. 2021;70:1939-49.
[0177] 46. Refae S, Gal J, Ebran N, Otto J, Borchiellini D, Peyrade F, et al. Germinal Immunogenetics predict treatment outcome for PD-1 / PD-L1 checkpoint inhibitors. Invest New Drugs. 2020;38:160-71.
[0178] 47. Boutros A, Carosio R, Campanella D, Spagnolo F, Banelli B, Morabito A, et al. The predictive and prognostic role of single nucleotide gene variants of PD-1 and PD-L1 in patients with advanced melanoma treated with PD-1 inhibitors. Immunooncol Technol.
[0179] 2023;20: 100408. 48. Kobayashi Mizuki et al: "Severe Immune-Related Adverse Events in Patients Treated with Nivolumab for Metastatic Renal Cell Carcinoma Are Associated with PDCD1 Polymorphism", GENES, vol. 13, no. 7, 5 July 2022 (2022-07-05), page 1204,
Claims
CLAIMS1. An in vitro method for predicting the presence and / or the risk of developing and / or the onset of immune-related adverse events, comprising the step of genotyping the C / C and C / T alleles of PD-1 SNP rs 10204525 in peripheral blood mononuclear cells isolated from blood samples of cancer patients undergoing anti-cancer therapy with immune checkpoint inhibitors.
2. The method according to claim 2, wherein the presence of the C / C genotype of rs 10204525 is associated with immune-related adverse events, while the presence of the C / T genotype of rs 10204525 indicates the absence of immune-related adverse events or the presence of at least one immune-related adverse events selected from the group consisting of amylase increase, asthenia, colitis, creatinine increase, decreased appetite, diarrhea, fever, gynecomastia, hypophysitis, lipase increase, oral mucositis, pneumonitis, pruritus, rash, thyroiditis, vitiligo, and vomiting.
3. The method of claim 2 or 3, wherein immune-related adverse event is selected from the group consisting of adrenal insufficiency, amylase increase, arthritis, asthenia, alanine aminotransferase increase, aspartate aminotransferase increase, colitis, creatinine increase, decreased appetite, diarrhea, fever, gynecomastia, hypophysitis, lipase increase, nausea, oral mucositis, pancreatitis, pneumonitis, pruritus, rash, thyroiditis, vitiligo, and vomiting.
4. The method of anyone of the preceding claims wherein cancer is a solid tumor.
5. The method according to claim 4 wherein the solid tumor is selected from the group consisting of: non-small cell lung cancer, renal cell carcinoma, head and neck squamous cell carcinoma, melanoma.
6. A kit for the in vitro diagnosis of the presence and / or the risk of developing and / or the onset of immune-related adverse events in cancer patients undergoing anti-cancer therapy with immune checkpoint inhibitors by performing the method of claims 1- 5, comprising at least means for genotyping the C / C and C / T alleles of SNP rs 10204525 from isolated peripheral blood mononuclear in isolated blood samples or DNA extracted from saliva from cancer patients undergoing anti-cancer therapy with immune checkpoint inhibitors.35
Citation Information
Patent Citations
Kit for detecting esophagus cancer susceptivity and SNP (single nucleotide polymorphism) marker of kit
CN106434980A
Markers for identifying patient classes and use thereof
WO2018084706A1
Germline biomarkers of clinical response and benefit to immune checkpoint inhibitor therapy
WO2022086852A2