Compositions and uses thereof as medicament

Abstract

The invention relates to siRNA-mediated RNAi by using one or more of three types of siRNA molecules, the first type inhibiting the expression of EPHA2, the second type inhibiting the expression of PLK1, and the third type inhibiting expression of FASL, or by using a composition comprising two or more types of said siRNA molecules Further, the present disclosure provides a pharmaceutically acceptable carrier (PAC). Furthermore, a pharmaceutical composition comprising said composition of two or more types of siRNA molecules, and optionally also the PAC, is disclosed. Also, the present disclosure provides expression vectors for production of the siRNA molecules and the PAC. Lastly, a method for screening pharmaceutical targets is disclosed.

Description

[0001] Compositions and uses thereof as medicament

[0002] Technical field

[0003] The disclosure relates to compositions comprising double-stranded nucleic acid molecules, small interfering RNA (siRNA) molecules, which are capable of inducing RNA interference (RNAi) against the expression of target genes. Further, the disclosure relates to pharmaceutical compositions and a method of screening pharmaceutical targets.

[0004] Background

[0005] RNA interference (RNAi) is the process of post-transcriptional silencing of specific gene sequences in cells, mediated by short interfering RNAs (siRNAs). The therapeutic potential of RNAi significantly expands the spectrum of potential anti-cancer targets. However, efficient combination of cytotoxic siRNAs and targeted delivery of siRNAs to cancer cells in vivo remains as a focus of intense research attention. One promising approach for this purpose has been the use of a combination of siRNAs that silence expression of interrelated genes and modulate the underlying signaling pathways. Another thing to consider is the ability of the siRNAs to prevent the targeted cancer cells from bypassing the blocked signaling.

[0006] The superiority of siRNA-based drugs is caused by a number of their properties. First, siRNAs can recognize essentially any target gene with high specificity and minimal off-target effects due to the complementary base pair recognition. Second, siRNAs exert their post-transcriptional gene silencing effect exclusively in the cytoplasm, preventing nuclear penetration and integration into the genome, which minimizes the risk of host gene mutations. Third, the ease of constructing siRNAs based on the mRNA sequence of the target gene allows the creation of siRNAs that can effectively silence any disease-causing gene. Gene silencing by siRNAs is crucial for targets that are not amenable to treatment or not accessible to small molecules, therapeutic antibodies or proteins. Moreover, siRNAs have demonstrated marked potentiation of chemotherapy by sensitizing drug-resistant cancer cells. Recent advances in the identification of molecular pathways involved in cancer initiation and progression offer new opportunities for cancer therapy. The identification of siRNA targets represents a promising new avenue for suppressing carcinogenesis. Potential therapeutic targets for siRNA drugs include: 1) cell cycle-related signaling pathways, 2) cell proliferation-related pathways, 3) molecules related to cancer immune escape, and some other signaling pathways.

[0007] EPHA2 is a receptor tyrosine kinase with a single membrane penetration structure with a molecular weight of 130 kDa. EPHA2 interacts with any of the eight different ephrin A-family ligands, with overt preference to ephrin A1. Ligand-receptor binding activates the kinase domain and induces polyphosphorylation of Eph receptor intracellular domain and signaling. EPHA2 has been reported to be clinically present in many cancers. In patients with colorectal cancer, patients with positive EPHA2 expression have been reported to be susceptible to hepatic metastasis, lymphatic invasion, and lymph node metastasis. Inhibition of EPHA2 expression may inhibit cancer cell invasion, adhesion-independent proliferation, and tumor proliferation in vivo.

[0008] During carcinogenesis, tumors develop multiple mechanisms to evade the host immune response. Up-regulation of Fas ligand (FASL or CD95L or CD178) expression may represent one such mechanism. FASL is a 40 kDa type II transmembrane protein belonging to the tumor necrosis factor (TNF) family. FASL interacts with its receptor, Fas (CD95 or APO-1), and can trigger a cascade of subcellular events including cell death. FASL is expressed by a variety of tumor cells, and it has been suggested that FASL may limit inflammatory responses and maintain relative immunosuppression by inducing apoptosis in infiltrating proinflammatory lymphocytes. Activated T cells express Fas and are sensitive to Fas-mediated apoptosis. Thus, up-regulation of FASL expression by tumor cells may enable the tumor cells to kill infiltrating antitumor lymphocytes. In view of the important role of FASL in so-called “Fas counterattack”, inhibitors and / or modulators of this gene are very desirable.

[0009] Another attractive anti-cancer target is the polo-like kinase 1 (PLK1) gene, which encodes 603 amino acid protein that is a member of a family of serine / threonine protein kinases known as polo-like kinases. Expression of PLK1 has been shown to correlate with mitotic activity of cells and to be high in tumors of several origins including lungs, colon, stomach, smooth muscle, and esophagus. Overexpression or constitutive expression of PLK1 has also been shown to induce malignant transformation of mammalian cells. The pharmacological modulation of PLK1 activity, expression, or function may therefore be an appropriate point of therapeutic intervention in pathological conditions. Currently, there are no known therapeutic agents which effectively inhibit the synthesis of PLK1 in tumors.

[0010] siRNAs have been applied for EPHA2 silencing in human cancer cells as has previously been published in US10385343B2, US20170258871 A1 , and US20220133721 A1, for instance. EPHA2 -specific siRNAs have been shown to suppress EPHA2 expression in pancreatic adenocarcinoma cells, significantly reducing the malignancy of glioma cells, non-small cell lung cancer (NSCLC) and breast cancer cells. However, in contrast to in vitro, in vivo effects of siRNAs targeting EPHA2 have not been unequivocal. For EPHA2-based siRNAs under development, existing challenges include the following: (i) downregulation of EPHA2 levels by siRNAs may lead to compensatory stimulation of other Eph receptors and oncogenic signaling, a kind of bypass pathway; (ii) high conserved kinase domain across different Eph kinases may lead to non-specific inhibition of other members of the Eph family; (iii) significant unresponsiveness and treatment-related toxicity remain a barrier to successful siRNA therapies.

[0011] RNA interference targeting PLK1 is being developed as a major focus of anticancer siRNA therapy as published in US20050107316A1 , W02009082817A1, US20080081791A1 , and WO2014046617A1 , for example. Knockdown of PLK1 expression by RNA interference has been shown to induce decreased cell proliferation and enhanced apoptosis in various cancer cell types. However, the clinical trials of anti-PLK1 siRNAs have not demonstrated improved survival in patients and thus have not provided support for further evaluation as a single target. The challenges accompanying the development of PLK1 -based siRNAs are essentially very similar to those associated with the development of EPHA2-based siRNAs. A combination treatment using PLK1 -based siRNAs and chemotherapeutic drugs, radiation, or immunotherapy has been proposed to overcome these challenges. Reducing FASL expression is a common mechanism for preventing inflammatory diseases, autoimmune diseases, viral infections, graft / allograft rejection, neurological diseases, liver diseases, and any other related disease or condition that is associated with or will respond to FASL levels. siRNAs have been used to silence FASL in cancer as published in US2007254850A1 and US8389708B2, for instance. However, data on FASL-siRNA clinical trials is not available.

[0012] In addition to the above-mentioned challenges, the challenges with any siRNA treatment include inefficient delivery of siRNAs to the tumor site, siRNAs impacting also healthy cells, and reversible / temporary downregulation of the mRNA of interest. Although the therapeutic potential of siRNAs is very high, their application in clinical settings is still limited, mainly due to the lack of effective and tissue or cell-type specific delivery systems. Targeted delivery of siRNAs may not only minimize the likelihood of off-targets and related side effects but may also reduce the dose required to achieve the desired therapeutic effect. A wide range of agents of different nature are being investigated to address in vivo delivery challenges. In targeted siRNA delivery, engineered molecules typically comprise one or more moieties that direct cellular or tissue delivery of a novel molecule linked to one or more of a second moiety that is an active agent useful for the treatment of cancer or other diseases. The moieties can be linked together directly, or they can be linked together indirectly through a linker. The guide / directing moieties can be presented for example by antibodies, fragments of thereof, receptor-binding proteins, peptides, GalNAc conjugates, and aptamers published in US10426842B2, EP2902406B1, W02004007721 A1 , US2022281911A1, and US11208654B2, for instance.

[0013] Thus, there is a need for better cancer treatments. Also, more efficient approaches than using EPHA2-, PLK1- and FASL-based siRNAs alone are needed for effective anti-tumor effect. In addition, there is a need for better delivery of siRNAs, ensuring their delivery to the tumor site and into the tumor cells. Summary

[0014] The invention characterized by the appended claims solves the challenges disclosed above.

[0015] It is an object of the present disclosure to provide double-stranded small interfering nucleic acid (siRNA) molecules that inhibit the expression of target genes EPHA2, PLK1 and / or FASL via RNA interference, and compositions of different combinations thereof. Another objective is to provide a pharmaceutically acceptable carrier (PAC). Another objective is to provide different pharmaceutical compositions comprising said compositions of two or more of the siRNA molecules, with or without the PAC. Another objective is to provide double-stranded small interfering nucleic acid molecules, of which a first type inhibits the expression of target gene EPHA2, a second type inhibits the expression of target gene PLK1 , and a third type inhibits the expression of target gene FASL, via RNA interference. Another objective is to provide expression vectors encoding said siRNA molecules and an expression vector encoding the PAC. Another objective is to provide a method for screening pharmaceutical targets utilizing said compositions, or one or more of the three types of the siRNA molecules, optionally with the PAC.

[0016] The present disclosure provides three types of siRNA molecules, the first type inhibiting the expression of EPHA2, the second type inhibiting the expression of PLK1 , and the third type inhibiting expression of FASL, which all said types of siRNA molecules are comprised of a sense and an antisense strand, i.e. are double-stranded. A composition of two or more types of said siRNA molecules is disclosed. The present disclosure provides a pharmaceutically acceptable carrier (PAC), comprising an siRNA-biding motif, a protease-sensitive site and a fragment recognizing TGF-[3. A pharmaceutical composition comprising said composition of two or more types of siRNA molecules is disclosed. The present disclosure provides an expression vector comprising nucleic acid sequences encoding one or more pair(s) of sense and antisense strands of the three types of siRNA molecules and another expression vector comprising a nucleic acid sequence encoding the PAC. A method for screening pharmaceutical targets utilizing said composition of two or more types of siRNA molecules, or one or more of the three types of siRNA molecules; and optionally said PAC, is disclosed. The method comprises delivering the composition or the siRNA molecule(s) to cells, optionally using the PAC, and as one option (i) adding one or more test agents to the cells after delivery of the composition or the siRNA molecule(s), and measuring the effects of the test agent(s) on the functions of the cells; or as another option ii) treating the cells with one or more test agents prior to the delivery of the composition or the siRNA molecule(s), and measuring the effects of the composition or the siRNA molecule(s) on the functions of the cells.

[0017] The objects of the present disclosure are achieved by the products, methods and uses characterized by what is stated in the independent claims. The preferred embodiments of the disclosure are disclosed in the dependent claims. Other objects, details and advantages of the present disclosure will become apparent from the following detailed description. Brief of the drawings

[0018] The invention will be described in more detail with reference to appended drawings, in which:

[0019] Figure 1 shows the locations of target sequences of the siRNAs in the nucleic acid sequence of Homo sapiens. Fig. 1A: a nucleic acid sequence of Homo sapiens EPHA2 mRNA (access number NM_004431 XM_017000536, 3946 bp) indicating the location of the siRNA target sequences (SEQ ID NO: 13 to SEQ ID NO: 14). Fig. 1B: a nucleic acid sequence of Homo sapiens PLK1 mRNA (access number NM_005030, 2160 bp) indicating the location of the siRNA target sequences (SEQ ID NO: 15 to SEQ ID NO: 16). Fig. 1 C: a nucleic acid sequence of Homo sapiens FASL mRNA (access number NM_000639, 1805 bp) indicating the location of the siRNA target sequences (SEQ ID NO: 17 to SEQ ID NO: 18).

[0020] Figure 2 shows Western blot results demonstrating the silencing effect of the siRNAs. Fig. 2A: Western blot results demonstrating the effect of the siRNAs SEQ ID NO: 1 - SEQ ID NO: 2 (SEQ1-2), SEQ ID NO: 3 - SEQ ID NO: 4 (SEQ3-4), siRNA mixture 1 of SEQ ID NO: 1 - SEQ ID NO: 2 - SEQ ID NO: 5 - SEQ ID NO: 6 - SEQ ID NO: 9 - SEQ ID NO: 10 (MIX1), and siRNA mixture 2 of SEQ ID NO: 3 - SEQ ID NO: 4 - SEQ ID NO: 7 - SEQ ID NO: 8 - SEQ ID NO: 11 - SEQ ID NO: 12 (MIX2) on EPHA2 expression in HOT 116 colorectal carcinoma cell line at 0, 1, 2, 3 days after transfection. Fig. 2B: Western blot results demonstrating the effect of siRNAs SEQ ID NO: 5 - SEQ ID NO: 6 (SEQ5-6), SEQ ID NO: 7 - SEQ ID NO: 8 (SEQ7-8), MIX1 , and MIX2 on PLK1 expression in HOT 116 colorectal carcinoma cell line at 0, 1 , 2, 3, 4 days after transfection. Fig. 2C: Western blot results demonstrating the effect of siRNAs SEQ ID NO: 9 - SEQ ID NO: 10 (SEQ9-10), SEQ ID NO: 11 - SEQ ID NO: 12 (SEQ11-12), MIX1, and MIX2 on FASL expression in the colorectal adenocarcinoma cell line HT-29 at 0, 1 , 2, 3 days after transfection.

[0021] Figure 3 shows the results of an in vitro kinase assay demonstrating the inhibitory effect of the siRNAs. Fig. 3A: demonstrates the effect of siRNAs SEQ1-2 , SEQ3-4, MIX1, and MIX2 on EPHA2 kinase activity in the colorectal carcinoma cell line HOT 116 cells at 1, 3, 5, 7 days after transfection. Fig. 3B: demonstrates the effect of siRNAs SEQ5-6, SEQ7-8, MIX1 , and MIX2 on PLK1 kinase activity in the colorectal carcinoma cell line HCT 116 at 1 , 3, 5, 7 days after transfection. The untransfected HCT 116 cells (C) were taken as 100%.

[0022] Figure 4 shows the results of a cell proliferation assay demonstrating the cytostatic and / or cytotoxic effect of the siRNAs on colorectal carcinoma cells. Fig. 4A: demonstrates the effect of SEQ1-2, SEQ5-6, SEQ9-10, and MIX1 on the in vitro growth of the colorectal carcinoma cell line HCT 116 cells at 1 , 3, 5 days after transfection. Fig. 4B: demonstrates the effect of SEQ3-4, SEQ7-8, SEQ11-12, and MIX2 on the in vitro growth of the colorectal carcinoma cell line HCT 116 at 1, 3, 5 days after transfection. The untransfected HCT 116 cells were used as a control. Time point 0 indicates the day on which the transfection was performed.

[0023] Figure 5 shows the results of a cell proliferation assay demonstrating the cytostatic and / or cytotoxic effect of siRNAs on colorectal adenocarcinoma cells. Fig. 5A: demonstrates the effect of SEQ1-2, SEQ5-6, SEQ9-10, and MIX1 on the in vitro growth of the colorectal adenocarcinoma cell line HT-29 cells at 1, 3, 5 days after transfection. Fig. 5B: demonstrates the effect of SEQ3-4, SEQ7-8, SEQ11-12, and MIX2 on the in vitro growth of the colorectal adenocarcinoma cell line HT-29 at 1, 3, 5 days after transfection. The untransfected HT-29 cells were used as a control. Time point 0 indicates the day on which the transfection was performed.

[0024] Figure 6 shows the cytotoxic effect of different siRNA combinations on monocytic leukemia cells. The cytotoxic effect can be seen as decreased cell survival percentage after transfection of the human monocytic leukemia cell line THP-1 cells, with different siRNA combinations, wherein two or more genes were targeted simultaneously. The following combinations of siRNAs were used: SEQ1-2 and SEQ5-6; SEQ1-2 and SEQ9-10; SEQ5-6 + SEQ9-10; or MIX1. The untransfected THP-1 cells were used as a control, wherein the cell survival was 100%. The cell death was determined at 48 hours after transfection of the cells with the siRNAs.

[0025] Figure 7 shows the antitumor activity of human NK cells against different carcinoma cells transfected with combinations of siRNAs. Fig. 7A: demonstrates the antitumor activity of human NK cells against HCT 116 (a colorectal carcinoma cell line) cells transfected with SEQ1-2 + SEQ5-6, MIX1, SEQ3-4 + SEQ7-8, or MIX2. The untransfected HCT 116 cells were used as a control. Fig. 7B: demonstrates the antitumor activity of human NK cells against HT-29 (a colorectal adenocarcinoma cell line) cells transfected with SEQ1-2 + SEQ5-6, MIX1, SEQ3-4 + SEQ7-8, or MIX2). The untransfected HT-29 cells were used as a control. Fig. 7C: demonstrates the antitumor activity of human NK cells against HeLa (a cervical carcinoma cell line) cells transfected with SEQ1-2 + SEQ5-6, MIX1, SEQ3-4 + SEQ7-8, or MIX2. The untransfected HeLa cells were used as a control.

[0026] Figure 8 is a schematic diagram illustrating the functional motifs of the pharmaceutically acceptable carrier (PAC) and a map of a plasmid vector encoding thereof. Fig. 8A: illustrates the functional motifs of the PAC, the functional motifs being a fragment recognizing TGF-[3 (TGFR1, extracellular part of TGF receptor 1 (1-122 aa)), a protease-sensitive site (MMP9 tag, protease cleavage site (123-128 aa)), and an siRNA-binding motif (PRM1, part of protamine 1 (129-152 aa)). Fig. 8B: depicts a map of pTMP plasmid vector encoding the PAC. The map illustrates the insertion point of certain constructs.

[0027] Figure 9 shows characterization of PAC-siRNA conjugate, or in other words PAC-siRNA complex. Fig. 9A: depicts the ethidium bromide-stained agarose gel (2%), wherein (1) is MIX1 alone, (2) is PAC-siRNA (MIX1) conjugate, (3) is PAC-siRNA (MIX1) conjugate incubated / digested with matrix metalloproteinase MMP9. Fig. 9B: is a histogram illustrating the binding of recombinant TGF-[3 to PAC in enzyme-linked immunosorbent assay (ELISA). Fig. 9C: shows the ethidium bromide-stained real-time polymerase chain reaction (RT-PCR) products on agarose gel (2%), demonstrating EPHA2 mRNA levels in HCT 116 cells transfected with MIX1 using the pharmaceutically acceptable carrier (PAC) or lipofectamine transfection reagent. The untransfected HCT 116 cells were used as a control. Sequence listings

[0028] In the present disclosure, the following sequences are presented:

[0029] SEQ ID NO: 1 to SEQ ID NO: 4 disclose sense and antisense strands of siRNAs targeting EPHA2.

[0030] SEQ ID NO: 5 to SEQ ID NO: 8 disclose sense and antisense strands of siRNAs targeting PLK.

[0031] SEQ ID NO: 9 to SEQ ID NO: 12 disclose sense and antisense strands of siRNAs targeting FASL.

[0032] SEQ ID NO: 13 to SEQ ID NO: 14 disclose target sequence of siRNAs targeting EPHA2.

[0033] SEQ ID NO: 15 to SEQ ID NO: 16 disclose target sequence of siRNAs targeting PLK1.

[0034] SEQ ID NO: 17 to SEQ ID NO: 18 disclose target sequence of siRNAs targeting FASL.

[0035] SEQ ID NO: 19 discloses an amino acid sequence of a pharmaceutically acceptable carrier with functional motifs; a fragment recognizing TGF-[3 (TGFR1, 1-122 aa), a protease-sensitive site (MMP9 tag, 123-128 aa), and an siRNA-binding motif (PRM1, 129-152 aa)

[0036] SEQ ID NO: 20 discloses an exemplary nucleic acid sequence encoding a pharmaceutically acceptable carrier with functional motifs: a fragment recognizing TGF-[3 (TGFR1, 1-369 bp), a protease-sensitive site (MMP9 tag, 370-384 bp), and an siRNA-binding motif (P RM 1 , 385-456 bp).

[0037] SEQ ID NO: 21 discloses an EPHA2 forward (EphF) primer used in RT-PCR.

[0038] SEQ ID NO: 22 discloses an EPHA2 reverse (EphR) primer used in RT-PCR. Detailed

[0039]

[0040] The disclosure is described in more detail in the following description with reference to some embodiments, which shall not be regarded as limiting.

[0041] With the context of this specification, the term “RNA interference” or “RNAi” refers to the biological process of sequence specific inhibition or downregulation or blockage of gene expression in a cell through translational or transcriptional repression, mediated by short interfering nucleic acid molecules, siRNAs.

[0042] With the context of this specification, the term “small interfering RNA”, “short interfering RNA”, “siRNA molecule”, “siRNA”, or “chemically modified short interfering RNA” refer to any nucleic acid molecule capable of inhibiting or downregulating gene expression by mediating RNA interference (RNAi) in a sequence-specific manner. These terms can refer to both individual nucleic acid molecules, a plurality of such nucleic acid molecules, or pools of such nucleic acid molecules. With the context of this specification the siRNA is a double-stranded nucleic acid molecule comprising self-complementary sense and antisense strands, thus the siRNA is a duplex. The antisense strand comprises a nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof, and the sense strand comprises a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.

[0043] With the context of this specification, the term “target” refers to any polynucleotide sequences, such DNA or RNA, or peptide, polypeptide or protein that may be targeted via various means, e.g. with siRNAs. With the context of this specification, the term “target gene” refers to the gene that the siRNA targets and thus inhibits via RNA interference. Similarly, with the context of this specification, the term “target sequence” refers to the sequence within the mRNA, transcribed from the target gene, to which the siRNA binds.

[0044] With the context of this specification, the term “natural killer cell” or “NK cell” refers to a subset of peripheral blood lymphocytes defined by the expression of CD56 or CD16 and the absence of the T cell receptor (CD3). The NK cells may be derived from umbilical cord blood, peripheral blood, bone marrow, CD34 + cells, induced pluripotent stem cells (iPSCs), embryonic stem cells (ESC) or the NK cell infiltrated into tissues.

[0045] With the context of this specification, the term “cytotoxicity” refers to the ability of immune cells, here referring specifically to NK cells, or siRNA molecules via RNAi, to induce cell death in target cells.

[0046] The extent of cell death in connection with NK cell-induced cytotoxicity can be expressed as the percentage of target cell death in excess of the background, with total target cell death taken as 100%. With the context of this specification, the term “target cell” refers to cells targeted by NK cells, i.e. , cytotoxic effector cells, in cytotoxicity assays. In connection to said assay, the ratio effector cells and target cells is referred to as “effectortarget” or “E:T” ratio, wherein the term “effector” refers to effector cells and “target” to target cells.

[0047] With the context of this specification, the term “ephrin type-A receptor 2” or “EPH receptor A2” or “EPHA2” refers to both to a gene and to a protein it encodes, which protein belongs to the ephrin receptor subfamily of the proteintyrosine kinase family.

[0048] With the context of this specification, the term “Fas ligand” or “FASL” or “FasL” or “CD95L” or “CD178” refers to both to a gene and to a protein it encodes, which protein is a type-ll transmembrane protein belonging to the tumor necrosis factor (TNF) family.

[0049] With the context of this specification, the term “polo-like kinase 1” or “PLK1” or “serine / threonine-protein kinase 13” or “STPK13” refers to a gene and to a protein it encodes, which protein is a highly conserved serine / threonine protein kinase.

[0050] With the context of this specification, the term “immunotherapy” refers to the treatment of a disease by a method, including the induction, enhancement, suppression or other beneficial change in the immune response.

[0051] With the context of this specification, the term “expression vector”, “expression construct" or “vector” refers to any nucleic acid-based expression system that is used to deliver one or more nucleic acid molecules to a cell for the one or more nucleic acid molecules to be expressed in the cell. The vector may be for example a plasmid or viral vector that is structurally modified for gene expression in cells.

[0052] A composition of two or more types of siRNA molecules, selected from a first type of siRNA molecule inhibiting expression of EPH receptor A2 (EPHA2), and / or a second type of siRNA molecule inhibiting expression of polo-like kinase 1 (PLK1) and / or a third type of siRNA molecule inhibiting expression of Fas ligand (FASL) via RNA interference, is disclosed (Figures 2 to 7). The inhibition is not limited to said genes only, but the inhibition of said genes results in modulation of underlying signaling pathways as well. With the context of this specification, the first type of siRNA molecule inhibiting expression of EPHA2 is also referred to as “anti-EPHA2 siRNA” or “anti-EPHA2 siRNA duplex”. With the context of this specification, the second type of siRNA molecule inhibiting expression of PLK1 is also referred to as “anti-PLK1 siRNA” or “anti-PLK1 siRNA duplex”. With the context of this specification, the third type of siRNA molecule inhibiting expression of FASL is also referred to as “anti-FASL siRNA” or “anti-FASL siRNA duplex”. The siRNA molecules, i.e. siRNA variants, are double-stranded, comprising a sense strand and an antisense strand. Herein it is understood that the composition comprising two or more types of siRNAs, i.e., two or more types of siRNA molecules, comprises each type of siRNA in multiple copies of siRNA molecules.

[0053] The composition may comprise two types of siRNA molecules, wherein the siRNA molecules comprise the first type of siRNA molecule inhibiting expression of EPHA2 and the second type of siRNA molecule inhibiting expression of PLK1. The composition may comprise two types of siRNA molecules, wherein the siRNA molecules comprise the first type of siRNA molecule inhibiting expression of EPHA2 and the third type of siRNA molecule inhibiting expression of FASL. The composition may comprise two types of siRNA molecules, wherein the siRNA molecules comprise the second type of siRNA molecule inhibiting expression of PLK1 and the third type of siRNA molecule inhibiting expression of FASL. The composition may comprise all three types of siRNAs, namely the first type of siRNA molecule inhibiting expression of EPHA2, the second type of siRNA molecule inhibiting expression of PLK1 and the third type of siRNA molecule inhibiting expression of FASL.

[0054] The composition comprising two or more types of siRNA molecules, thus targeting and inhibiting said two or more different genes, has more profound effect compared to a composition comprising only one type of siRNA molecule. EPHA2 kinase activity is decreased more with the composition comprising all three types of siRNAs, i.e., MIX1 and MIX2, compared to composition comprising only the first type of siRNA targeting EPHA2, as shown in Figure 3A. MIX1 refers to mixture of SEQ ID NO: 1 - SEQ ID NO: 2 - SEQ ID NO: 5 -SEQ ID NO: 6 - SEQ ID NO: 9 - SEQ ID NO: 10, and MIX2 refers to mixture of SEQ ID NO: 3 - SEQ ID NO: 4 - SEQ ID NO: 7 - SEQ ID NO: 8 - SEQ ID NO: 11 - SEQ ID NO: 12. Similarly, PLK1 kinase activity is decreased more with the composition comprising all three types of siRNAs, i.e., MIX1 and MIX2, compared to composition comprising only the second type of siRNA targeting PLK1, as shown in Figure 3B, indicating inhibition of said genes. Also, the cytotoxic effect on cancer cells is more profound with the composition comprising all three types of siRNAs, i.e., MIX1 and MIX2, compared to composition comprising only one type of siRNA, as shown in Figures 4 and Figure 5. Combination of any two of the three types of siRNAs in a composition has cytotoxic effect on cancer cells, as shown in Figure 6. Similarly, the composition comprising all three types of siRNAs has cytotoxic effect in cancer cells as shown in Figure 6. Herein, in Figure 6, quite early timepoint, 48 hours after the treatment of the cancer cells with the composition comprising two or more types of siRNAs, is shown. It is likely that the cytotoxic effect is even stronger at a later timepoint, similar to what is shown in Figures 4 and 5, wherein timepoints up to 5 days are presented. The composition comprising two or more types of siRNA molecules induces cytotoxicity on cancer cells, whereas the composition comprising only one type of siRNA molecule likely induces only cytostatic effect, or possibly also cytotoxicity, but to lesser extent compared to the composition comprising two or more types of siRNA molecules, as shown in Figures 4 and 5. The more profound effects seen with the composition comprising two or more types of siRNA molecules are not only due to inhibition of two or more cancer-related genes, but the combinatorial effect of the simultaneous inhibition of two or more of these genes, being namely EPHA2, PLK1 and FASL, and the downstream effects resulting from their inhibition. The composition comprising two or more types of siRNA molecules also increase the sensitivity of tumor cells to the cytotoxic action of NK cells (Figure 7), which is an additional favorable effect of the composition in addition to the cytotoxicity against cancer cells.

[0055] The first type of siRNA molecule, inhibiting expression of EPHA2, is comprised of a sense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 1 , and an antisense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 2. Alternatively, the first type of siRNA molecule, inhibiting expression of EPHA2, is comprised of a sense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO:3, and an antisense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO:4.

[0056] The second type of siRNA molecule, inhibiting expression of PLK1, is comprised of a sense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 5, and an antisense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 6. Alternatively, the second type of siRNA molecule, inhibiting expression of PLK1 , is comprised of a sense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO:7, and an antisense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO:8.

[0057] The third type of siRNA molecule, inhibiting expression of FASL, is comprised of a sense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 9, and an antisense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 10. Alternatively, the third type of siRNA molecule, inhibiting expression of FASL, is comprised of a sense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO:11, and an antisense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 12.

[0058] The disclosed siRNAs are designed to have sense and antisense strands with asymmetric RNA / deoxythymidine dinucleotide (dTdT) overhangs as this type of overhang may confer nuclease resistance and may improve the strand selection, thereby increasing even considerably the specificity of target gene silencing via RNAi.

[0059] A pharmaceutically acceptable carrier (PAC) is disclosed. The pharmaceutically acceptable carrier is a fusion protein comprising of functional motifs, being an siRNA-binding motif, a protease-sensitive site and a fragment recognizing TGF-[3 (Figure 8A). The pharmaceutically acceptable carrier has an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, preferably at least 80 % identity, to SEQ ID NO: 19.

[0060] The siRNA-binding motif in the disclosed PAC enables the formation of a PAC-siRNA complex (Figure 9A), and may be used with any of the siRNA molecules disclosed herein to form a PAC-siRNA complex with said siRNA molecule(s). The PAC may form a PAC-siRNA complex with the first type of siRNA molecule targeting EPHA2. The PAC may form a PAC-siRNA complex with the second type of siRNA molecule targeting PLK1. The PAC may form a PAC-siRNA complex with the third type of siRNA molecule targeting FASL. The PAC may form a PAC-siRNA complex with a single anti-EPHA2 siRNA, anti-PLK1 siRNA, or anti-FASL siRNA molecule; or multiply of said molecules, wherein the siRNA molecules in the PAC-siRNA complex may be the same of different from each other. As the siRNA-binding motif, part of protamine (PRM1 ) protein is used herein. Protamine is a naturally occurring protein containing more than two-thirds of positively charged amino acid L-arginine. Due to its high content of L-arginine, protamine has the ability to bind nucleic acids and protect them from enzymatic degradation in biological systems. RNA stabilization by protamine demonstrates dual functionality, wherein it not only protects RNA from degradation in biological systems, but also enhances penetration into cells (Figure 9C).

[0061] The fragment recognizing transforming growth factor [3 (TGF-[3) in the disclosed PAC is an extracellular part of TGF-[3 receptor (TGFR1). It directs the PAC-siRNA complex to tumor cells (Figure 9C). Cancer cells secrete TGF-[3, which is responsible for the formation of the immunosuppressive tumor microenvironment and supports cancer growth, invasion, metastasis, recurrence and resistance to therapy. In addition to TGF-p, various malignant tumors, such as colorectal cancer, medullary thyroid cancer, breast cancer, mucinous ovarian cancer, secrete carcinoembryonic antigen (CEA), which also interacts directly with the TGF-p receptor. The use of the extracellular part of TGFR1 in the PAC enables the PAC, and similarly a PAC-siRNA complex, to bind to TGF-p (Figure 9B) and / or interact with CEA. Thus, the PAC helps to direct the PAC-siRNA complex to tumor cells (Figure 9C). Accordingly, the use of the extracellular part of TGFR1 in the PAC may enhance the efficiency and specificity of siRNA delivery as the PAC-siRNA complex to tumor foci, wherein cancer cells express TGF-p and / or CEA.

[0062] The protease-sensitive site (MMP9 tag) in the disclosed PAC fusion protein is an amino acid sequence capable of being digested by Matrix metalloproteinase 9, MMP9. MMP9 is one of the highly expressed and secreted endopeptidases in many human cancers and has been identified as an essential mediator of processes closely related to tumorigenesis, such as reorganization of the extracellular matrix, epithelial-to-mesenchymal transition, cell migration, formation of new blood vessels and immune response. The secretion of large amounts of MMP9 not only promotes the formation of more aggressive cancer phenotypes but also reduces sensitivity to chemotherapy. The MMP9 tag adds an additional positive effect on siRNA delivery. Upon PAC-siRNA complex reaching a tumor site expressing TGF-[3 / CEA and tumor-associated MMP9 protease, the fusion protein of the PAC-siRNA complex may be digested at MMP9 tag leading to release of a protamine-siRNA complex. The protamine-siRNA complex may then be able to penetrate the cancer cell membrane and deliver the silencing siRNA within the cell for RNAi. An exemplary nucleic acid sequence encoding amino acids of PAC (SEQ ID NO: 19) is set forth in SEQ ID NO: 20.

[0063] The PAC-siRNA complex inhibits expression of the target genes at a similar rate as a lipofectamine-siRNA complex, i.e., siRNA transfected with lipofectamine transfection reagent. This is shown in Figure 9C with the composition comprising the three types of siRNAs either with the PAC or lipofectamine, and their ability to inhibit EPHA2 expression. The comparable inhibition rate indicates that the PAC-siRNA complex enters the cells as efficiently as the lipofectamine-siRNA complex. However, the extracellular part of TFGR1 and the MMP9 tag in the PAC advantageously increases the specificity and efficiency of the PAC-siRNA complex delivery to cancer cells compared to lipofectamine-siRNA complex.

[0064] Due to the inherent degeneracy of the genetic code, most amino acids are encoded by more than one codon, a sequence of three consecutive nucleotides. Such nucleic acid variations are “silent variations” or “silent substitutions” or “synonymous substitutions” in a nucleic acid sequence. Another type of variation is “conservative amino acid substitutions” or “homologous replacement” wherein one or more amino acids in an amino acid sequence are substituted with different amino acids with highly similar biochemical properties. Such nucleic acid and amino acid variations are features of each of the disclosed nucleic acid and amino acid sequences herein.

[0065] A pharmaceutical composition that comprises the composition presented above, i.e. the composition of two or more types of siRNA molecules selected from a first type of siRNA molecule inhibiting expression of EPHA2, and / or a second type of siRNA molecule inhibiting expression of PLK1 , and / or a third type of siRNA molecule inhibiting expression of FASL, is disclosed (Figures 2 to 7). The pharmaceutical composition may comprise the first type of siRNA molecule inhibiting expression of EPHA2 and the second type of siRNA molecule inhibiting expression of PLK1. The pharmaceutical composition may comprise the first type of siRNA molecule inhibiting expression of EPHA2 and the third type of siRNA molecule inhibiting expression of FASL. The pharmaceutical composition may comprise the second type of siRNA molecule inhibiting expression of PLK1 and the third type of siRNA molecule inhibiting expression of FASL. The pharmaceutical composition may comprise the first type of siRNA molecule inhibiting expression of EPHA2, the second type of siRNA molecule inhibiting expression of PLK1 and the third type of siRNA molecule inhibiting expression of FASL.

[0066] The pharmaceutical composition may comprise naked nucleic acid, i.e. siRNAs, in the absence of compounds that deliver and protect the nucleic acid from degradation by nucleases of the organism. Alternatively, the pharmaceutical composition may further comprise a carrier, preferably the pharmaceutically acceptable carrier (PAC) presented above. Other suitable carriers and their formulation are described, for example, in Remington: The Science and Practice of Pharmacy (23rd Edition, Adejare A., Ed., Academic Press, 2020). Wherein the siRNA(s) is / are coupled to the PAC to form a PAC-siRNA complex(es), the PAC may facilitate efficient and specific delivery of the siRNA(s) to cancer cells, as indicated in Figure 9C.

[0067] Wherein the pharmaceutical composition comprising two or more types of siRNA molecules, also comprises the PAC, the PAC and the siRNAs form a PAC-siRNA complexes. Herein it is understood that in the pharmaceutical composition there are several copies of each siRNA and the PAC, thus multiple PAC-siRNA complexes are formed comprising a PAC and one or more of the siRNAs. The pharmaceutical composition may comprise the first type of siRNA molecule targeting EPHA2 and the second type of siRNA molecule targeting PLK1, and the PAC, wherein the PAC and the siRNAs form PAC-siRNA complexes. The pharmaceutical composition may comprise the first type of siRNA molecule targeting EPHA2 and the third type of siRNA molecule targeting FASL, and the PAC, wherein the PAC and the siRNAs form PAC-siRNA complexes. The pharmaceutical composition may comprise the second type of siRNA molecule targeting PLK1 and the third type of siRNA molecule targeting FASL, and the PAC, wherein the PAC and the siRNAs form PAC-siRNA complexes. The pharmaceutical composition may comprise the first type of siRNA molecule targeting EPHA2, the second type of siRNA molecule targeting PLK1 and the third type of siRNA molecule targeting FASL, and the PAC, wherein the PAC and the siRNAs form PAC-siRNA complexes. The pharmaceutical composition, with or without the pharmaceutical carrier, may comprise a transfection reagent. The transfection reagent may be selected from lipofectin, lipofectamine, cellfectin, polycations, or liposomes. The pharmaceutical composition may comprise a diluent, an emulsifier, a preservative, an adjuvant, and / or excipient. The diluent may be selected from physiological solution or water, which may additionally contain various types of sugars (like lactose, sorbitol, xylitol, mannitol, microcrystalline cellulose), and other substances. The physiological solution may be selected from phosphate-buffered saline, sterile physiological solution or tissue culture medium. The pharmaceutical compositions should preferably be absent of agents that may inactivate or destroy siRNAs.

[0068] In some embodiments according to the present invention, the pharmaceutical composition presented above may be used as a medicament. In some embodiments according to the present invention, the pharmaceutical composition may be for use in the treatment of cancer in an individual in need thereof. In some embodiments according to the present invention, the pharmaceutical composition may be used in a method of treating a cancer in an individual in need thereof, the method comprising administration of said pharmaceutical composition in a patient in a therapeutically effective amount. The cancer may be selected from colorectal cancer, haematological malignancies or solid tumors. The pharmaceutical composition may be for use in the treatment of cancer, or may be used in the method of treating a cancer, to achieve reduction in tumor size, kill tumor cells, prevent tumor growth, prevent tumor recurrence, prevent tumor metastasis, induce remission in an individual in need of cancer treatment, or any combination thereof. The achieved effect of the pharmaceutical composition when being for use in the treatment of cancer, or when used in the method of treating a cancer, may elicit a complete response or a partial response, wherein the response refers to the presence of signs of a cancer, based on medical scans and tests.

[0069] Combining treatments with different mechanisms of action may lead to enhanced antitumor activity as compared to single treatment administered alone. Thus, the use of different combinations of the three different types of siRNAs disclosed herein, that silence the expression of interconnected genes and modulate the underlying signaling pathways, is considered a promising approach. The use of a combination of said siRNAs may prevent the tumor cells from bypassing the blocked, siRNA-targeted, signaling pathways.

[0070] The present disclosure provides various combinations of siRNA molecules that inhibit the expression of EPHA2, PLK1 and / or FASL genes (Table 1 ) that may improve antitumor immunity and weaken tumor development.

[0071]

[0072] Table 1. The different combinations of the siRNA molecules, indicated with the sequence ID numbers. Further, the pharmaceutical composition may be administered in conjunction with a cancer treatment, including chemotherapy, radiation therapy, immunotherapy and / or gene therapy. Said pharmaceutical composition may be administered simultaneously, separately or sequentially with the anticancer therapy. The pharmaceutical composition may enhance the efficacy of anti-cancer therapies. This may arise from the ability of said siRNA molecules to increase the sensitivity of tumor cells to the cytotoxic action of NK cells (Figure 7). In addition, administration of said pharmaceutical composition may block tumor-produced molecules, such as TGF-[3, CEA, Fas ligand and others, that suppress the immunity. The pharmaceutical composition may be administered in conjunction of a therapeutic agent that may be selected, but is not limited to inhibitors of PD1, PDL1, CTLA4 or LAG-3, such as nivolumab, pembrolizumab, pidilizumab, atezolizumab, avelumab, cemiplimab, dostarlimab, durvalumab, ipilimumab, relatlimab. The therapeutic agent may also be selected from, but is not limited to, immune cells prepared for therapeutic methods, or for use in therapeutic methods, such as T cells, NK cells, dendritic cells, macrophages, the cells being genetically modified or unmodified. The NK cells may be derived from umbilical cord blood, peripheral blood, bone marrow, tissue-infiltrated cells, CD34+ cells, iPSCs, ESCs, or human NK cell lines.

[0073] The pharmaceutical composition may be in the formulation of an aerosol, dispersion, solution, a cream, ointment, tablet, powder, suspension and suppositories, liquid preparations for injections, or including liposome preparations. In addition, the pharmaceutical composition may be administered by an enteral, parenteral, topical or inhalation administration route depending on the formulation of the pharmaceutical composition. The enteral administration route may be selected from the group consisting of oral, sublingual, buccal and rectal route. The parenteral administration route may be selected from injection routes, like subcutaneous, intravenous, intramuscular, intra-articular, intranodal, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional, intracranial, intradermal, intrapulmonal, intraperitoneal, intracardial and intra-arterial route. The topical administration route comprises applying the pharmaceutical composition directly on a surface of skin (transdermal administration), ears, eyes or mucous membranes. The skilled person can readily determine the amount of pharmaceutical composition and optional additives and / or carrier in the pharmaceutical compositions to be administered. For any pharmaceutical composition to be administered to an animal or human, the following can be determined: toxicity by determining the lethal dose (LD) and LD50 in a suitable animal model; the dosage of the pharmaceutical composition(s), the concentration of components therein and the time of administration of the pharmaceutical composition(s) that induce a suitable response.

[0074] A first type of siRNA molecule, inhibiting expression of EPHA2, is disclosed. The first type of siRNA molecule is comprised of a sense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 1, and an antisense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 2. Alternatively, the first type of siRNA molecule is comprised of a sense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 3, and an antisense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO:4.

[0075] A second type of siRNA molecule, inhibiting expression of PLK1 , is disclosed. The second type of siRNA molecule is comprised of a sense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 5, and an antisense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 6. Alternatively, the second type of siRNA molecule is comprised of a sense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO:7, and an antisense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO:8.

[0076] A third type of siRNA molecule, inhibiting expression of FASL, is disclosed. The third type of siRNA molecule is comprised of a sense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 9, and an antisense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 10. Alternatively, the third type of siRNA molecule is comprised of a sense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO:11, and an antisense strand, having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, preferably at least 80 % identity, to SEQ ID NO: 12.

[0077] The above-mentioned siRNA molecules are designed to have sense and antisense strands with asymmetric RNA / deoxythymidine dinucleotide (dTdT) overhangs as this type of overhang may confer nuclease resistance and may improve the strand selection, thereby increasing even considerably the specificity of target silencing.

[0078] A first expression vector comprising one or more pair(s) of sense and antisense strands having at least 80 % identity to sequences set forth in SEQ ID NO: 1 to SEQ ID NO: 12, is provided. The first vector is an expression vector for expressing the encoded sequences, i.e., the siRNA variants. Multiple copies of the first vector with same or different siRNA variants may be used simultaneously in a cell for expressing said sequences.

[0079] A second expression vector comprising a nucleic acid sequence encoding the pharmaceutically acceptable carrier is provided. The nucleic acid sequence of the second expression vector sequence encoding the pharmaceutically acceptable carrier has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, preferably at least 80 % identity, to SEQ ID NO: 20. Multiple copies of the second vector may be used in a cell for expressing said sequences.

[0080] Either of the presented expression vectors may be selected from eukaryotic expression vector or a viral vector, or an RNA molecule used as an expression vector.

[0081] A method for screening pharmaceutical targets utilizing the composition presented above, the composition comprising two or more types of siRNA molecules and optionally said pharmaceutically acceptable carrier, is disclosed. Alternatively, the method for screening pharmaceutical targets may utilize one or more of the three types of siRNA molecules and optionally said pharmaceutically acceptable carrier. The method comprises a delivery of said composition comprising two or more types of siRNA molecules, or one or more of the three types of siRNA molecules, to cells, optionally using the pharmaceutically acceptable carrier, and, as one option, i) adding one or more test agents to the cells after the delivery of the composition or the siRNA molecule(s), and measuring the effects of the test agent(s) on the functions of the cells in which specific genes, depending on the composition or the combination of siRNA molecules used, are silenced via RNAi. Alternatively as another option, ii) the method comprises treating the cells with one or more test agents prior to the delivery of said composition comprising two or more types of siRNA molecules, or one or more of the three types of siRNA molecules, optionally using the pharmaceutically acceptable carrier, and then measuring the effects of the composition or the siRNA molecule(s) on the functions of the cells in which specific genes, depending on the composition or the combination of siRNA molecules used, are silenced via RNAi. In other words, in the firstly presented option the composition or one or more of the three types of siRNA molecules is / are first delivered to cells, optionally using the PAC, wherein the gene expression of the cells is affected, after which one or more test agents are added. In the later presented option, the cells are first treated with one or more test agents, after which the composition or one or more of the three types of siRNA molecules is / are delivered to cells, optionally using the PAC. In both options, also other delivery means, than the pharmaceutically acceptable carrier, may be used for the siRNA delivery to the cells. The test agent may be selected from small organic and / or inorganic molecules, drugs, and nucleic acids. The following examples are given to further illustrate the invention without, however, restricting the invention thereto. EXPERIMENTAL

[0082] Examples 1 to 6 below summarize the results according to the present invention.

[0083] Example 1. Evaluation of siRNA inhibitory activity against EPHA2 and PLK1 protein levels in HCT 116 human colorectal carcinoma cells, and FASL in HT-29 colorectal adenocarcinoma cells.

[0084] The design of anti-EPHA2 siRNA, anti-PLK1 siRNA and anti-FASL siRNA sequences was performed using the following web resources: siRNA Wizard (https: / / www.invivogen.com / sirnawizard / ), siDirect (sidirect2.rnai.jp / ). RNA oligo sequences (SEQ ID NO:1 to SEQ ID NO:12) specific to different target sequences of PLK1, EPHA2 and FASL mRNA (SEQ ID NO:13 to SEQ ID NO:18) were selected. The position of mRNA target sequences is schematically shown in Figure 1. The siRNAs were designed and synthesized with 3'dTdT overhangs on each strand.

[0085] The activity of the designed siRNAs was assessed by their ability to suppress PLK1 and EPHA2 expression in the colorectal carcinoma cell line, HCT 116, cells or FASL expression in the colorectal adenocarcinoma cell line, HT-29, cells. For this purpose, transfection of HCT 116 cells was performed using annealed siRNA duplexes SEQ1-2, SEQ3-4, SEQ5-6, SEQ7-8, siRNA duplex mixture 1 (SEQ ID NO: 1 - SEQ ID NO: 2 - SEQ ID NO: 5 - SEQ ID NO: 6 - SEQ ID NO: 9 - SEQ ID NO: 10), abbreviated as MIX1, or siRNA duplex mixture 2 (SEQ ID NO: 3 - SEQ ID NO: 4- SEQ ID NO: 7 - SEQ ID NO: 8 -SEQ ID NO: 11 - SEQ ID NO: 12), abbreviated as MIX2, and transfection of HT-29 cells with annealed siRNA duplexes SEQ9-10, SEQ11-12, siRNA duplex mixture 1 (MIX1 ) or siRNA duplex mixture 2 (MIX2).

[0086] To anneal the siRNAs, the corresponding pairs of oligonucleotides (final concentration 20 pM) were mixed in a buffer containing 20 mM potassium acetate, 6 mM 4-(2-hydroxyethyl)-1 -piperazineethanesulfonic acid (HEPES) at pH 7.4, 0.4 mM magnesium acetate. The mixture was incubated for 3 min at 90°C, then slowly cooled for 60 min to room temperature.

[0087] HCT 116 or HT-29 cells were seeded at a density of 106cells per well of a 6-well plate in DMEM medium supplemented with 2 mM L-glutamine, 1.5 g / L sodium bicarbonate, and 10% fetal calf serum. Cells were transfected with siRNA duplexes using lipofectamine 3000 (from Thermo Fisher Scientific). A mixture of lipofectamine 3000 and siRNA duplexes (3 pl lipofectamine 3000, 4 pg siRNA, 100 pl Opti-MEM® Medium per well) was incubated for 5 min and added to the wells of the plate. Cells were incubated for 3 to 4 days at 37°C and 5% CO2. Daily samples were collected for analysis by treating the cells with trypsin-EDTA solution.

[0088] The expression level of proteins in clones was assessed by immunoblotting with anti-EPHA2 mouse antibody (from Upstate, clone D7), anti-PLK1 rabbit antibody (from Cell signaling technology), anti-FASL mouse antibody (from BD Biosciences, clone G247). Untransfected cells were used as a positive control. Cells were lysed using a buffer containing 25 mM Tris-HCI, 150 mM NaCI, 1 mM ethylenediaminetetraacetic acid (EDTA), 1% Triton-Xi 00. Cell lysates were centrifuged at 10,000 g for 10 min. The concentration of total protein in the supernatant was determined and aliquots corresponding to 100 pg of protein were separated by electrophoresis under denaturing conditions. Electrotransfer of proteins from the gel to a nitrocellulose membrane was performed. The nitrocellulose membrane with immobilized proteins was then washed with buffer I (20 mM Tris-H C I , pH 7.5; 150 mM NaCI; 0.05% tween-20) and incubated for 1 h in a 2% solution of bovine serum albumin (BSA) in buffer I. The membrane was then incubated for 16 h with the primary antibodies listed above in 2% BSA in buffer I. The membrane was then washed with buffer I and incubated for 1 h with horseradish peroxidase-conjugated secondary antibodies (from Bio-Rad) in 1% milk solution in buffer I. The membrane was washed with buffer I and stained using a commercial ECL chemiluminescent detection kit. Immunoblots are shown in Figure 2.

[0089] As shown in Figure 2A, already on the first day after transfection with SEQ1-2 or SEQ3-4 duplexes, a sharp fall in EPHA2 expression level was detected. The expression of EPHA2 then rose gradually the following days but did not reach the initial level even on day 3. After transfection with MIX1 or MIX2, EPHA2 was undetectable on days 1 and 2 and could only be detected on day 3. Figure 2B shows that PLK1 expression is undetectable or only trace amounts are visible on days 1 and 2 after transfection, either by SEQ5-6 or SEQ7-8 duplexes or by either MIX1 or MIX2. After transfection with SEQ5-6 or SEQ7-8 duplexes, PLK1 levels are restored to initial levels on day 4, while transfection with either MIX1 or MIX2 has a more prolonged effect. As depicted in Figure 2C, FASL expression is detected only on day 3 after transfection with SEQ9-10 or SEQ11-12 duplexes, whereas transfection with either MIX1 or MIX2 has a more pronounced effect. Thus, anti-EPHA2, anti-PLK1 and anti-FASL siRNA duplexes and the mixtures thereof downregulate the expression of target proteins and can be utilized as a tool for reducing the levels of EPHA2, PLK1 and FASL in cancer cells. Also, combining siRNAs targeting different genes leads to enhanced RNA interference compared to single type of siRNAs administered alone.

[0090] Example 2. Evaluation of the inhibitory effect of siRNAs on EPHA2 and PLK1 protein kinase activity in HCT 116 human colorectal carcinoma.

[0091] HCT 116 cells were seeded at a density of 106cells per well on a 6-well plate in DMEM medium supplemented with 2 mM L-glutamine, 1.5 g / L sodium bicarbonate, and 10% fetal calf serum. Cells were transfected with siRNA duplexes using lipofectamine 3000 (from Thermo Fisher Scientific). A mixture of lipofectamine 3000 and siRNA duplexes (3 pl lipofectamine 3000, 4 pg siRNA, 100 pl Opti-MEM® Medium per well) was incubated for 5 min and added to the wells. Cells were incubated for 7 days at 37°C and 5% CO2. On day 1 , 3, 5, 7 samples were collected for analysis by treating the cells with trypsin-EDTA solution. Untransfected cells were used as positive control.

[0092] Cells were lysed using a buffer containing 25 mM Tris-HCI, 150 mM NaCI, 1% TritonX100 pH 7.5. Cell lysates were centrifuged at 10,000 g for 10 min. Cell lysates were incubated with Protein G-sepharose beads and anti-EPHA2 (from Upstate, clone D7) or anti-PLK1 (from Thermo Fisher Scientific) or irrelevant antibodies (from Thermo Fisher Scientific) for 1h at 4°C. The beads were intensively washed with buffer containing 25 mM Tris-HCI, 150 mM NaCI, 1% Triton-X100, pH 7.5 and subjected to kinase activity analysis. In vitro kinase activity was measured using PLK1 Kinase Enzyme System (from Promega) and EPHA1 Kinase Enzyme System (from Promega) in accordance with the manufacturer’s instructions. The luminescent signal of samples precipitated with irrelevant antibodies was used as background. The luminescent signal of samples of non-transfected cells was taken as 100%. The results of in vitro kinase assay are shown in Figure 3.

[0093] Figure 3A shows a marked drop in EPHA2 activity on the first day after transfection with individual duplexes SEQ1 -2 and SEQ3-4 (21 % in both cases) followed by a gradual recovery until the end of the observation period (88% for SEQ1-2 and 78% for SEQ3-4). The SEQ3-4 duplex exerted a slightly greater inhibitory effect on EPHA2 activity than SEQ1-2. Due to the absence of detectable live cells on day 5 after transfection with siRNA duplex mixtures 1 (M 1X1 ) or siRNA duplex mixtures 2 (MIX2), activity measurements were limited to days 1 and 3. In contrast to transfectants with single duplexes, only a decrease in kinase activity was observed for MIX1 and MIX2 on these days (20% and 22% on day 1 , 15% and 12% on day 3, respectively).

[0094] A more pronounced inhibitory effect was achieved by anti-PLK1 siRNA duplexes, as shown in Figure 3B. After transfection with single duplexes, PLK1 kinase activity diminished to 9% and 10% with SEQ5-6 and SEQ7-8, respectively. After a gradual recovery of kinase activity over 7 days, it was restored to only 65% and 66% with SEQ5-6 and SEQ7-8, respectively. Cells transfected with MIX1 and MIX2 showed almost complete inhibition of PLK1 activity (5% and 3% with MIX1; 2% and 4% with MIX2, on days 1 and 2, respectively).

[0095] The sensitivity of this method is much higher than that of immunoblotting. This explains the fact that residual in vitro kinase activity of EPHA2 and PLK1 is observed on days 1 and 2 (Figure 3A and B), whereas immunoblotting is unable to detect the proteins (Figure 2A and B).

[0096] The greater and longer lasting inhibitory effect of MIX1 and MIX2 on EPHA2 and PLK1 kinase activity compared to single duplexes shows a combinatorial mechanism of targeting the three genes, EPH2A, PLK1 and FASL, simultaneously. Thus, single anti-EPHA2 and anti-PLK1 siRNA duplexes exert a reversible inhibitory action on kinase activity, whereas the use of the mixtures of duplexes results in a more prominent and more sustained effect.

[0097] Example 3. Comparative assessment of the proliferation rate of the human colorectal carcinoma cell line HCT 116 transfected with siRNAs.

[0098] Cell proliferation rate was assessed by trypan blue staining and automated cell counter quantification of live cells at different time points. HCT 116 cells were seeded at a density of 106cells per petri dish in quadruplicate, using DMEM medium supplemented with 2 mM L-glutamine, 1.5 g / L sodium bicarbonate, and 10% fetal calf serum. Cells were transfected with siRNA duplexes using lipofectamine 3000 (from Thermo Fisher Scientific). A mixture of lipofectamine 3000 and siRNA duplexes (3 pl lipofectamine 3000, 4 pg siRNA, 100 pl Opti-MEM Medium per well) was incubated for 5 min and added to the wells. Cells were incubated at 37°C and 5% CO2. Daily samples were collected from a different dish for analysis by treating the cells with trypsin-EDTA solution. The cells were then stained with trypan blue stain (from Invitrogene), and the number of viable cells was determined using an automated cell counter (from Invitrogene). All experiments were performed in triplicate, and data is expressed as the mean of three samples with standard deviation. The results of proliferative activity assessment are shown in Figure 4.

[0099] Control group and groups transfected with anti-FASL siRNAs (SEQ9-10 and SEQ11-12) showed a similar increase in cell number, during the overall period of observation. In the groups transfected with anti-EPHA2 siRNAs (SEQ1-2 and SEQ3-4) or anti-PLK1 siRNAs (SEQ5-6 and SEQ7-8) there was a slight decline in the cell number due to cell death on the first day after transfection. In the following days there was an increase in the number of cells, but the proliferation rate was significantly lower than in the control group. At the end of the observation period the fold change of groups transfected with anti-PLK1 siRNAs and anti-EPHA2 siRNAs was approximately 11 -fold lower compared with the control groups. The groups transfected with the siRNA duplex mixture 1 or 2 (MIX1 or MIX2) showed a dramatic decrease in cell counts throughout the observation period. No live cells were detected on the 5th day of cultivation.

[0100] Thus, the inhibition of PLK1 or EPHA2 using the siRNAs disclosed herein has a cytostatic effect, i.e. , inhibition of cell growth and / or proliferation, and / or to lesser extent cytotoxic effect on HCT 116 cells, and simultaneous inhibition of PLK1, EPHA2 and FASL using the composition comprising the three types of siRNAs disclosed herein promotes cell death of transfected HCT 116 cells, i.e., has cytotoxic effect.

[0101] Example 4. Comparative assessment of the proliferation rate of the colorectal adenocarcinoma cell line HT-29 transfected with siRNAs.

[0102] Cell proliferation rate was assessed by trypan blue staining and automated cell counter quantification of live cells at different time points. HT-29 cells were seeded at a density of 106cells per petri dish in quadruplicate, using DMEM medium supplemented with 2 mM L-glutamine, 1.5 g / L sodium bicarbonate, and 10% fetal calf serum. Cells were transfected with siRNA duplexes using lipofectamine 3000 (from Thermo Fisher Scientific). A mixture of lipofectamine 3000 and siRNA duplexes (3 pl lipofectamine 3000, 4 pg siRNA, 100 pl Opti-MEM® Medium per well) was incubated for 5 min and added to the wells. Cells were incubated at 37°C and 5% CO2. Daily samples were collected from a different dish for analysis by treating the cells with trypsin-EDTA solution. The cells were then stained with trypan blue stain (from Invitrogene), and the number of viable cells was determined using an automated cell counter (from Invitrogene). All experiments were performed in triplicate, and data is expressed as the mean of three samples with standard deviation. The results of proliferative activity assessment are shown in Figure 5.

[0103] Control group and groups transfected anti-FASL siRNA (SEQ9-10 and SEQ11-12) showed a similar increase in cell number, during the overall period of observation. In the groups transfected with anti-EPHA2 siRNA (SEQ1 -2 and SEQ3-4) or anti-PLK1 siRNA (SEQ5-6 and SEQ7-8) there was a slight decline in cell number due to cell death on the first day after transfection. In the following days there was an increase in the number of cells, but the proliferation rate was significantly lower than in the control group. At the end of the observation period the fold change of groups transfected with anti-PLK1 siRNA and anti-EPHA2 siRNA was approximately 8-fold lower compared with the control groups. The groups transfected with the siRNA duplex mixtures (MIX1 or MIX2) showed a dramatic decrease in cell counts throughout the observation period. As with HCT 116 cells (Figure 4), no live cells were detected on the 5thday of cultivation (Figure 5).

[0104] Thus, the inhibition of expression of PLK1 or EPHA2 using the siRNAs disclosed herein has a cytostatic effect and / or to lesser extent cytotoxic effect on HT-29 cells, and simultaneous inhibition of PLK1, EPHA2 and FASL using the composition comprising the three types of siRNAs disclosed herein promotes cell death of transfected HT-29 cells, i.e. , has cytotoxic effect.

[0105] Example 5. Comparative assessment of the cytotoxic effect of different combinations of siRNAs on human monocytic leukemia cells THP-1.

[0106] THP-1 cells were transfected with siRNA duplexes using lipofectamine 3000 (from Thermo Fisher Scientific). The following combinations were used:

[0107] anti-EPHA2 siRNA + anti-PLK1 siRNA (SEQ1-2 + SEQ5-6)

[0108] anti-EPHA2 siRNA + anti-FASL siRNA (SEQ1 -2 + SEQ9-10) anti-PLK1 siRNA + anti-FASL siRNA (SEQ5-6 + SEQ9-10)

[0109] anti-EPHA2 siRNA + anti-PLK1 siRNA + anti-FASL siRNA, i.e. MIX1 (SEQ1-2 + SEQ5-6 + SEQ9-10). Untransfected THP-1 cells were used as a control, wherein the cell survival was 100%. All experiments were performed in triplicate, and data is expressed as the mean of the three samples with standard deviation.

[0110] Cell survival was assessed by trypan blue staining and automatic counting of live cells 48 hours after transfection with different siRNA combinations. All siRNA combinations showed cytotoxic effect on cancer cells. The percentage of dead cells, i.e., the cytotoxic effect, in the groups transfected with anti-EPHA2 and anti-PLK1 siRNAs (SEQ1-2 + SEQ5-6) was approximately 2-fold higher compared to cells transfected with anti-EPHA2 siRNA and anti-FASL siRNAs (SEQ1-2 + SEQ9-10), and almost one-third higher than cells transfected with anti-PLK1 siRNA + anti-FASL siRNA (SEQ5-6 + SEQ9-10). Groups transfected with MIX1, i.e., anti-EPHA2 + anti-PLK1 + anti-FASL siRNA, showed a decrease in cell survival similar to that seen with anti-EPHA2 siRNA + anti-PLK1 siRNA transfection, as shown in Figure 6.

[0111] Thus, simultaneous inhibition of two or more of the target genes EPHA2, PLK1 and / or FASL has a cytotoxic effect on cancer cells. The most prominent cytotoxic effect at time point of 48 hours was seen with inhibition of expression of EPHA2 and PLK1, and inhibition of expression of EPHA2, PLK1 and FASL by the siRNAs.

[0112] Example 6. Assessment of cytotoxic activity of NK cells against HCT 116 human colorectal carcinoma, HT-29 colorectal adenocarcinoma, and HeLa human cervical adenocarcinoma target cells transfected with siRNAs.

[0113] To assess the potency of NK cells, cytotoxicity assays were performed using NK cell-sensitive cell lines: HCT 116, HT-29, and HeLa cells. NK cells were expanded using NK MACS medium (from Miltenyi Biotec) according to the manufacturer's instructions. Target cells (HCT 116, HT-29, or HeLa) were transfected with combination of anti-PLK1 and anti-EPHA2 siRNAs (SEQ1-2+SEQ5-6 or SEQ3-4+SEQ7-8) or siRNA duplex mixture 1 (MIX1) or siRNA duplex mixture 2 (MIX2) by electroporation using the Gene Pulser Xcell System (from Bio Rad) according to the manufacturer's instructions. After transfection by electroporation, cells were incubated in DMEM medium supplemented with 2 mM L-glutamine, sodium bicarbonate (1.5 g / L), and 10% fetal calf serum. The control (untransfected) and transfected target cells were seeded into the wells of a 96-well plate. The next day, NK cells were added to the wells of the 96-well plate with the previously seeded target cells and incubated for 2 h at 37°C and 5% CO2 at a ratio of 1 :1 or 5:1 (effector: target, E:T). The wells were then washed with buffered saline, and the number of surviving target cells was estimated by staining with neutral red dye using the method described by Wallach (Wallach D. Preparations of lymphotoxin induce resistance to their own cytotoxic effect. J Immunol. 1984 May;132(5):2464-9). The cytotoxicity of NK cells against transfected target cells at the two E:T ratios are shown in Figure 7 (all experiments were performed in triplicates).

[0114] As depicted in Figure 7, expanded NK cells had a significantly higher cytotoxicity against target cells transfected with siRNAs as compared to the control target cells. As shown in the Figure 7A at the lower E:T ratio of 1 :1 , NK cells killed 32% and 45% of HCT 116 cells transfected with siRNA duplex mixture 1 (MIX1) and mixture 2 (MIX2), respectively. The control HCT 116 cell death was 8% at this ratio. At the higher E:T ratio of 5:1, NK cells killed 86% and 73% of the target cells transfected with MIX1 and MIX2, respectively, which significantly exceeded the cell death rate of the untransfected target cells, that was 21 %. The use of the combination of siRNAs not containing anti-FASL siRNA (SEQ1-2+SEQ5-6 or SEQ3-4+SEQ7-8) resulted in reduced cytotoxic effects compared to MIX1 and MIX2 containing also anti-FASL siRNA (at the E:T ratio of 1:1, 27% and 41%, respectively; at the E:T ratio of 5:1, 81% and 70%, respectively). This shows that blocking the FASL-dependent defense mechanism with anti-FASL siRNAs increases the sensitivity of HCT 116 cells to the action of NK cells.

[0115] Figure 7B shows the death rates of the control and siRNA transfected HT-29 cells when co-cultured with expanded NK cells. At the lower E:T ratio of 1:1, 31% HT-29 cells transfected with MIX1, and 35% of HT-29 cells transfected with siRNA MIX2, were killed by NK cells. Cell death of control target cells was significantly lower than the transfected cells, that was 16%. At the higher E:T ratio of 5:1, NK cells killed 95% and 93% of HT-29 cells transfected with MIX1 and MIX2, respectively. As with HCT 116 cells, the transfected HT-29 cells showed higher susceptibility to NK cells compared to the control target cells, that was 37%. Again, removal of anti-FASL siRNAs from the siRNA mixtures resulted in decreased NK cell-mediated cell death. With the siRNA combinations not containing anti-FASL siRNA (SEQ1-2+SEQ5-6 and SEQ3-4+SEQ7-8), the cell death was reduced at an E:T ratio of 1 :1 to 26% or 28%, respectively, and at an E:T ratio of 5:1 to 89% for both. Similar to HCT 116 cells, with HT-29 the blocking the FASL-dependent defense mechanism with anti-FASL siRNA increased the sensitivity of HT-29 cells to the action of NK cells.

[0116] Figure 7C shows the death rates of the control and siRNA transfected HeLA cells when co-cultured with expanded NK cells. Similar to other tumor cells, the transfected HeLa cells exhibited greater susceptibility to the expanded NK cells compared to the control cells. At the lower E:T ratio of 1 :1 , 45% and 46% of HeLa transfected with MIX1 and MIX2, respectively, were killed by NK cells. The cell death of the control cells was 12% at this ratio. Transfection of HeLa cells with MIX1 and MIX2 resulted in 68% and 80% cell death, respectively, when exposed to NK cells at the E:T ratio of 5:1. The control cell death was 33% at this ratio. Combinations of anti-PLK1 and anti-EPHA2 siRNAs (SEQ1-2+SEQ5-6 or SEQ3-4+SEQ7-8), without anti-FASL siRNAs, had similar effect on NK cell-induced HeLa cell death as MIX1 and MIX2. Thus, the FASL-dependent pathway is likely not utilized by this cell line as a defense mechanism against NK cells.

[0117] As presented here, transfection of cancer cells with siRNAs targeting EPHA2 and PLK1 , or EPHA2, PLK1 and FASL, results in a significant increase in the cells’ sensitivity to NK cell-mediated killing, even at low E:T ratios, compared to non-transfected cells. This suggests that the use of these siRNAs in combination with allo- or autologous NK cells may be an option for combination antitumor therapy.

[0118] Example 7. Production and activity evaluation of the pharmaceutically acceptable carrier.

[0119] The expression vector for production of the pharmaceutically acceptable carrier (PAC) with a length of 5861 bp, the physical map of which is shown in Figure 8B, consists of: 615-818 bp. - CMV promoter; 895-1353 bp - the pharmaceutically acceptable carrier; 1458-1682 bp - bGH poly (A) signal; 1728-2156 bp. - f1 ori; 2170-2500 bp - SV40 promoter; 2567- 3361 bp -NeoR / KanR; 3535-3656 bp - SV40 poly(A) signal; 4107-4695 bp - pUC origin (in Figure 8B indicated as ori); 4866-5726 bp (complementary chain) - AmpR; 5727-5831 bp (complementary chain) - AmpR promoter. The fragment encoding the sequence of the PAC was synthesized by polymerase chain reaction with overlapping oligonucleotides using the method described by Stemmer et al. (Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides, Gene, Volume 164, Issue 1, 1995, Pages 49-53). The fragment was cloned into the pcDNA3.1 (+) vector (from Invitrogen) at the Hindlll and EcoRI restriction sites. DNA sequence of the selected plasmid vector, pTMP, was confirmed by DNA sequencing.

[0120] For production of the PAC, HEK 293T cells were transfected with plasmid vector pTMP using lipofectamine 3000 transfection (from Thermo Fisher Scientific) according to the manufacturer's instructions. Transfected cells at an initial density of 4 x 106cells / ml were incubated in EX-CELL® 293 Serum-Free Medium (SAFC) for 10 days at 37°C and 5% CO2, and the medium was replaced and collected every three days. The PAC was purified from the collected culture medium using affinity chromatography with anti-TGF beta Receptor 1 / TGFR1 Antibody (C-12) conjugated to agarose (from Santa Cruz). The resin column was equilibrated with a working buffer containing 25 mM Tris-HCI, 150 mM NaCI, pH 7.5. The culture medium was passed through the column at a rate of 1 ml / min. After washing the column with a working buffer (10 V column), protein was eluted with 0.1 M glycine solution pH 2.5 into tubes containing 100 mM Tris-HCI solution, pH 9.0. The PAC protein was then dialyzed against a buffer containing 25 mM Tris-HCI, 150 mM NaCI, pH 7.5. Protein concentration was measured spectrometrically using absorbance at 280 nm. Purified recombinant PAC protein was analyzed by Laemmli SDS-PAGE.

[0121] To evaluate the binding of the PAC to siRNA, the PAC was mixed with previously annealed siRNA duplex mixture 1 (MIX1 ) to obtain a ratio of 3:1 (the PAC:siRNA weight / weight) in the buffer containing 20 mM Tris-HCI, pH 7.0 and left for 10 min at room temperature. Then an aliquot was taken and incubated with the 0.4 ng / pL of previously activated recombinant MMP9 metalloprotease (from R&D Systems) according to the manufacturer's instructions (in a molar ratio of 1:1). After an additional hour of incubation, samples were analyzed by electrophoresis in a 3% agarose gel (w / v) as previously described and gels were stained with 0.4 pg / mL ethidium bromide. The binding of the PAC to siRNA(s) to form PAC-siRNA complex(es) is shown in Figure 9A: (1) siRNA duplex mixture 1 alone, (2) PAC-siRNA (MIX1) conjugate, (3) PAC-siRNA (MIX1) conjugate digested with matrix metalloproteinase MMP9.

[0122] To assess the binding of the PAC to TGF-[3, recombinant TGF-[3 (from R&D Systems) was adsorbed in the wells of a 96-well plate at a concentration of 0.1 pg / well. Then 100 pl of purified PAC at a concentration of 1 pg / ml and recombinant TGFR1 inhibitor at a concentration of 0.1, 0.5 and 1 pg / ml were added to the wells of the plate. No inhibitor was added to the wells of the positive control. Incubation buffer contained 25 mM Tris-HCI, 150 mM NaCI, pH 7.5. After incubation for 1 hour at 37°C, the wells were washed with an incubation buffer and horseradish peroxidase-conjugated rabbit anti Protamine 1 antibodies (from MyB ioSource) were added. After incubation for 1 hour at 37°C, the wells were washed with an incubation buffer and the o-phenylenediamine (OPD) substrate solution was added. The stopped colorimetric signal was measured spectrometrically using absorbance at 450 nm. As shown in Figure 9B, the binding of the PAC to TGF-[3 decreased upon increased TGFR1 inhibitor concentration.

[0123] The activity of the PAC as RNA transfection reagent was assessed by the ability of the PAC-siRNA complex to inhibit EPHA2 expression in HCT 116 cells compared with the use of lipofectamine 3000 as a transfection reagent. HCT 116 cells were seeded into the wells of a 96-well plate and incubated for 24 hours. The PAC was mixed with previously annealed siRNA mixture duplex 1 at a ratio of 3:1 (the PAC:siRNA weight / weight) in the buffer containing 20 mM Tris-HCI, pH 7.0 and incubated for 10 min at room temperature. Lipofectamine-siRNA complex was prepared according to the manufacturer's instructions. The HCT 116 cells, previously seeded in the wells of a 96-well plate, were transfected with the PAC-siRNA complex or lipofectamine-siRNA complex and incubated for 48 h at 37°C and 5% CO2. Untransfected HCT 116 cells were used as a control.

[0124] The expression level of EPHA2 was assessed by polymerase chain reaction coupled with reverse transcription (RT-PCR) using the primers EphF 5’gcaaggaagtggtactgctggac3’ (SEQ ID NO: 21) and EphR 5’gtcctggtcgccagacatcac3’ (SEQ ID NO: 22). Two-step RT-PCR reactions were performed using RevertAid M-MuLV reverse transcriptase (from Thermo Scientific, USA) and Taq DNA polymerase (from Thermo Scientific, USA) in accordance with the manufacturer's recommendations. 5 pg of RNA was combined with 0.5 ng of oligo dT 12-18 mer and incubated in water at 65°C for 5 min followed by incubation on ice. First strand synthesis was performed in buffer containing 50 mM Tris-HCI (pH 8.3 at 25 °C), 50 mM KCI, 4 mM MgCI2, 10 mM DTT, 1 mM dNTPs, 10 U / pl RevertAid M-MuLV reverse transcriptase for 60 min at 42°C. The reaction was terminated by heating at 70 °C for 10 min. A fifth of the reaction product was used as a template in a reaction volume of 25 pl containing 10 mM Tris-HCI (pH 8.8 at 25°C), 50 mM KCI, 0.08% (v / v) Nonidet P40, 2 mM MgCI2, 0.2 mM dNTPs (from Thermo Scientific, USA), 0.2 pM of the primers and 0,6 U of Taq DNA polymerase (from Thermo Scientific, USA). The amplification protocol was as follows: an initial denaturation at 95° C for 10 min, followed by 30 cycles at 95°C for 30 s, 59°C for 15 s, 72°C for 30 s, and a final extension at 72°C for 10 min. The size of each amplification product was resolved by electrophoresis in a 2% agarose gel (w I v) prepared in TAE buffer, comprising 40 mM Tris, pH 8.3, 20 mM acetic acid and 25 mM EDTA, with 0.4 pg I ml ethidium bromide. 6X DNA loading dye containing 10 mM Tris-HCI (pH 7.6) 0.03 % bromophenol blue, 0.03 % xylene cyanol FF, 60 % glycerol and 60 mM EDTA, was used for loading DNA markers and samples.

[0125] As shown in Figure 9C, the inhibitory activity of the PAC-siRNA complex is similar to lipofectamine-siRNA complex, thereby validating the activity of the PAC as a potent agent for siRNA delivery.

[0126] Thus, the use of the PAC allows efficient and specific delivery of siRNAs to cancer cells to inhibit expression levels of the target genes.

Claims

Claims:

1. A composition of two or more types of siRNA molecules selected from: i. A first type of siRNA molecule inhibiting expression of EPHA2, which first type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 1 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 2; or a sense strand, having at least 80 % identity to SEQ ID NO: 3, and an antisense strand, having at least 80 % identity to SEQ ID NO:4, and / orii. A second type of siRNA molecule inhibiting expression of PLK1, which second type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 5 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 6; or a sense strand, having at least 80 % identity to SEQ ID NO:7, and an antisense strand, having at least 80 % identity to SEQ ID NO:8, and / oriii. A third type of siRNA molecule inhibiting expression of FASL, which third type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 9 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 10; or a sense strand, having at least 80 % identity to SEQ ID NO: 11 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 12.

2. The composition of claim 1 , comprisingi. The first type of siRNA molecule inhibiting expression of EPHA2, which first type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 1 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 2; or a sense strand, having at least 80 % identity to SEQ ID NO: 3, and an antisense strand, having at least 80 % identity to SEQ ID NO:4, andii. The second type of siRNA molecule inhibiting expression of PLK1, which second type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 5 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 6; or a sense strand, having at least 80 % identity to SEQ ID NO:7, and an antisense strand, having at least 80 % identity to SEQ ID NO:8.

3. The composition of claim 1 , comprisingi. The first type of siRNA molecule inhibiting expression of EPHA2, which first type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 1 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 2; or a sense strand, having at least 80 % identity to SEQ ID NO: 3, and an antisense strand, having at least 80 % identity to SEQ ID NO:4, andii. The third type of siRNA molecule inhibiting expression of FASL, which third type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 9 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 10; or a sense strand, having at least 80 % identity to SEQ ID NO: 11 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 12.

4. The composition of claim 1 , comprisingi. The second type of siRNA molecule inhibiting expression of PLK1, which second type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 5 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 6; or a sense strand, having at least 80 % identity to SEQ ID NO:7, and an antisense strand, having at least 80 % identity to SEQ ID NO:8, andii. The third type of siRNA molecule inhibiting expression of FASL, which third type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 9 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 10; or a sense strand, having at least 80 % identity to SEQ ID NO: 11 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 12.

5. The composition of claim 1 , comprisingi. The first type of siRNA molecule inhibiting expression of EPHA2, which first type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 1 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 2; or a sense strand, having at least 80 % identity to SEQ ID NO: 3, and an antisense strand, having at least 80 % identity to SEQ ID NO:4, andii. The second type of siRNA molecule inhibiting expression of PLK1, which second type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 5 , and an antisense strand,having at least 80 % identity to SEQ ID NO: 6; or a sense strand, having at least 80 % identity to SEQ ID NO:7, and an antisense strand, having at least 80 % identity to SEQ ID NO:8, andiii. The third type of siRNA molecule inhibiting expression of FASL, which third type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 9 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 10; or a sense strand, having at least 80 % identity to SEQ ID NO: 11 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 12.

6. A pharmaceutically acceptable carrier, comprising an siRNA-binding motif, a protease-sensitive site and a fragment recognizing TGF-[3, wherein the pharmaceutically acceptable carrier has an amino acid sequence having at least 80 % identity to SEQ ID NO: 19.

7. A pharmaceutical composition comprising the composition of any of claim 1 to 5.

8. The pharmaceutical composition of claim 7, comprising a carrier, preferably the pharmaceutically acceptable carrier of claim 6.

9. The pharmaceutical composition of claim 7 or 8, comprising a transfection reagent.

10. The pharmaceutical composition of any of claims 7 to 9, comprising diluent, emulsifier, preservative, adjuvant, and / or excipient.

11. The pharmaceutical composition of any of claims 7 to 10 for use as a medicament.

12. The pharmaceutical composition of any of claims 7 to 10 for use in the treatment of cancer.

13. The pharmaceutical composition for use according to claim 11 or 12, wherein the pharmaceutical composition is administered in conjunction with a cancer treatment.

14. The pharmaceutical composition for use according to any of claim 11 or 12, wherein the pharmaceutical composition is in the form of an aerosol, dispersion, solution, a cream, ointment, tablet, powder, suspension and suppositories, liquid preparations for injections, or including liposome preparations.

15. The pharmaceutical composition for use according to claim 11 or 12, wherein the pharmaceutical composition is administered by an enteral, parenteral, topical or inhalation administration route.

16. A first type of siRNA molecule inhibiting expression of EPHA2, which first type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 1 , and an antisense strand, having at least 80 % identity to SEQ ID NO: 2; or a sense strand, having at least 80 % identity to SEQ ID NO:3, and an antisense strand, having at least 80 % identity to SEQ ID NO:4.

17. A second type of siRNA molecule inhibiting expression of PLK1, which second type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 5, and an antisense strand, having at least 80 % identity to SEQ ID NO: 6; or a sense strand, having at least 80 % identity to SEQ ID NO:7; and an antisense strand, having at least 80 % identity to SEQ ID NO:8.

18. A third type of siRNA molecule inhibiting expression of FASL, which third type of siRNA molecule is comprised of a sense strand, having at least 80 % identity to SEQ ID NO: 9, and an antisense strand, having at least 80 % identity to SEQ ID NO: 10; or a sense strand, having at least 80 % identity to SEQ ID NO: 9 or SEQ ID NO: 11 ; and an antisense strand, having at least 80 % identity to SEQ ID NO: 10 or SEQ ID NO:12.

19. An expression vector comprising one or more pair(s) of sense and antisense strands having at least 80 % identity to sequences set forth in SEQ ID NO: 1 to SEQ ID NO:12.

20. An expression vector comprising a nucleic acid sequence encoding the pharmaceutically acceptable carrier of claim 6, wherein the nucleic acid sequence has at least 80 % identity to SEQ ID NO: 20.

21. A method for screening pharmaceutical targets utilizing the composition of any of claim 1 to 5, or one or more type of siRNA molecules of any of claim 16 to 18, and optionally the pharmaceutically acceptable carrier of claim 6, comprising delivering the composition or the siRNA molecule(s) to cells, optionally using the pharmaceutically acceptable carrier, andi) adding one or more test agents to the cells after delivery of the composition or the siRNA molecule(s), and measuring the effects of the test agent(s) on the functions of the cells, orii) treating the cells with one or more test agents prior to the delivery of the composition or the siRNA molecule(s), and measuring the effects of the composition or the siRNA molecule(s) on the functions of the cells.

22. The method of claim 21, comprising delivering the composition of any of claim 1 to 5 to cells, optionally using the pharmaceutically acceptable carrier, andi) adding one or more test agents to the cells after delivery of the composition, and measuring the effects of the test agent(s) on the functions of the cells, orii) treating the cells with one or more test agents prior to the delivery of the composition, and measuring the effects of the composition on the functions of the cells.

23. The method of claim 21, comprising delivering one or more type of siRNA molecule(s) of any of claim 16 to 18 to cells, optionally using the pharmaceutically acceptable carrier, andi) adding one or more test agents to the cells after delivery of the siRNA molecule(s), and measuring the effects of the test agent(s) on the functions of the cells, orii) treating the cells with one or more test agents prior to the delivery of the siRNA molecule(s), and measuring the effects of the siRNA molecule(s) on the functions of the cells.

Images