Viral vector-based gene therapy for OPA1 gene mutation-induced dominant optic atrophy

Abstract

Dominant optic atrophy (DOA) is the most commonly inherited optic neuropathy. We have designed vectors to express OPA1 cDNA in order to compensate for the reduced OPA1 protein. These OPA1-expressing viral vectors can be used to transduce OPA1 mutant neurons in individuals suffering from DOA.

Description

[0001] VIRAL VECTOR-BASED GENE THERAPY FOR OPA1 GENE MUTATION- INDUCED DOMINANT OPTIC ATROPHY

[0002] CROSS REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit under 35 U.S.C. Section 119(e) of copending and commonly-assigned U.S. Provisional Patent Application No. 63 / 720,886, filed November 15, 2024, entitled “VIRAL VECTOR-BASED GENE THERAPY FOR OP Al GENE MUTATION-INDUCED DOMINANT OPTIC ATROPHY”, the contents of which is incorporated by reference herein.

[0004] TECHNICAL FIELD

[0005] Embodiments of the disclosure concern at least the fields of medicine and molecular biology.

[0006] BACKGROUND OF THE INVENTION

[0007] Dominant optic atrophy (DOA) is the most common inherited optic neuropathy worldwide1 2The disease prevalence is 1:25,000-1:35,000 in most populations, but it can be as high as 1:10.000 in areas with an established founder effect3,4The visual impairment of DOA usually begins in the first two decades of life due to the loss of retinal ganglion cells (RGCs)3f RGCs are the essential projection neurons that extend axons through the optic nerve to transmit visual signals from the retina to the brain. The majority of DOA is caused by mutations in the gene optic atrophy 1 (OPA1; OMIM:*605290), which encodes a dynamin-related GTPase located to the mitochondrion6'8. Although OPA1 is broadly expressed by somatic tissues, most cases of DOA are non-syndromic and patients only exhibit symptoms related to RGC degeneration — namely progressive, bilateral vision loss, including reduced visual acuity, color vision defects, and central visual field defects3’9-11. A hallmark of DOA aiding in its diagnosis is temporal optic nerve head pallor, which is attributed to the preferential loss of RGCs in the papillomacular bundlel2 3. Although inherited in an autosomal dominant manner, OPA1 mutations are only -43-88% penetrant, leading to a high degree of heterogeneity in symptoms11,14. Patients vary widely in their disease presentations from asymptomatic to legally blind, even among family members harboring the same mutation15’17.

[0008] The human OPA1 gene encodes 31 exons and can potentially express eight mRNA isoforms resulting from alternate splicing of exons 4, 4b, and 5b18,19. All OPA1 precursor proteins contain an N-terminal mitochondrial targeting sequence (MTS) that allows the entry into mitochondria where they are further processed into OPA1 protein isoforms20’23. The cleavage of the MTS generates long isoforms (L-OPA1) that are anchored to the inner mitochondrial membrane (IMM)24’26. L-OPA1 can be further processed by mitochondrial peptidases at several downstream cleavage sites to generate short isoforms (S-OPA1) that are attached to the IMM or distributed in the intermembrane space (IMS). The ratio of OPA1 long and short isoforms are dynamically regulated by the mitochondrial inner membrane peptidases 0MA1 and YME1T23, which can respond to stress signals, such as decreased mitochondrial membrane potential and nutrient deprivation2l227;2;t

[0009] OPA1 plays critical roles in regulating mitochondrial dynamics, structure, and cellular bioenergetics. Deletion of the Opal gene results in early lethality at embryonic day 9.5 in mouse29. In contrast, genetically engineered mice with splicing site or missense Opal mutations have been shown to mimic human DOA symptoms30’35. Using Opal null mouse embryonic fibroblasts, it was demonstrated that neither long nor short isoforms of OPA1 can function alone21. Together with the dynamin-related GTPase mitofusin proteins MFN1 and MFN2, OPA1 promotes mitochondrial fusion22>36. Cells containing OPA1 mutations or reduced levels of OPA1 protein show a fragmented mitochondrial network37. In addition, OPA1 is required to maintain cristae complexity and structural integrity, thus stabilizing the respiratory chain complexes and controlling cytochrome C release24’38-41. Defects in OPA1 have been associated with decreases in mitochondrial ATP synthesis and the bioenergetic efficiency of the respiratory complexes42-44 To date, over 500 pathogenic mutations distributed throughout the OPA1 gene have been reported. Depending on the type and location of the mutation, DOA may occur via dominant negative or haploinsufficiency mechanisms18’41’45. Despite the ubiquitous expression of OPA1, human cell types other than RGCs are not affected in -80% of individuals with OPA1 mutations46. Due to the scarcity of human retinal tissues and the rarity of RGCs, which only comprise -2% of the total human retinal cells47'49, OPA1-DOA has not been studied in-depth using human RGCs. The high susceptibility of human RGCs to degenerate when OPA1 function is compromised remains not fully understood. Furthermore, recent single cell transcriptome profiling data has revealed that RGC subtype distribution in primates differs significantly from rodents505f It is thus necessary' to examine human RGCs in order to elucidate the pathological mechanisms responsible for OPA1 mutation-induced optic nerve degeneration.

[0010] Currently there is no treatment available for dominant optic atrophy (DOA) caused by OPA1 gene mutations, which predominantly affect the rare but essential projection neurons in the human retina. There is a need in the art for materials and methods useful to treat DOA.

[0011] SUMMARY OF THE INVENTION

[0012] As disclosed herein, we have generated human pluripotent stem cell (PSC) lines carrying OPA1 mutations by CRISPR gene editing and by reprogramming DOA patients’ blood cells (see, e.g., Pohl et al. (2023). Front. Genet. 14:1251216 and Pohl et al. (2025) Cells 14:137). Using these OPA1 mutant PSC lines, we have established DOA disease models using PSC-derived human RGCs. In these disease models, we have detected neuronal deficiencies, which can serve to evaluate the disclosed invention as treatments for OPA1-DOA. The disease symptoms in vitro include abnormalities in OPA1 protein expression, mitochondrial morphology, energy production by oxidative phosphorylation, reactive oxygen species (ROS), and neuronal activities. We have detected reduced 0PA1 expression in OPA1 mutant PSCs and neurons, which provides evidence that at least some of DOA disease are due to haploinsufficiency. Building upon these discoveries, we have designed both lentivirus and AAV vectors to express human OP Al cDNA in order to compensate for the reduced OPA1 protein. Specific types of promoters can be used to drive OPA1 expression, for example a generic strong promoter such as the CAG promotor, or a neuronal specific promoter such as the human synapsin (hSyn) promoter. These OPA1 -expressing viral vectors can be used to transduce OPA1 mutant neurons in DOA disease models in vitro to confirm phenotype rescues. In this context, one or more viral vectors can be selected for use in an optimized gene therapy, for example where vectors of the invention are used in intravitreal delivery7to the eyes of DOA patients for treatment of this condition.

[0013] The invention disclosed herein has a number of embodiments. Embodiments of the invention include compositions of matter comprising a mammalian expression vector, wherein a polynucleotide disposed in the vector encodes a OPA1 isoforml polypeptide (SEQ ID NO: 1) or encodes a OPA1 isoform 7 polypeptide (SEQ ID NO: 2). In such embodiments of the invention, the vector can comprise an adeno associated viral (AAV) vector or a lentiviral vector or the like.

[0014] In one illustrative embodiment of the invention, a lentivirus encoding the ubiquitous EFla promoter to express OPA1 cDNA effectively transduces OPA1 mutant PSCs, and increased OPA1 protein expression. Consequently, the lentivirus transduced mutant PSCs show restoration of mitochondrial respiration and ATP production while reducing oxidative stress caused by OPA1 mutations. In another illustrative embodiment of the invention, an adeno associated viral vector comprises a AAV2 serotype viral vector. Typically, the vector comprises a promoter upstream of the polynucleotide, for example, a EFla promoter, a CAG promoter, a neuronal specific human synapsin promoter (hSyn) or the like. We provide evidence that an AAV vector with 7m8 capsid encoding the hSyn promoter can effectively transduce PSC-derived neurons. In certain embodiments of the invention, such as intravitreal delivery to the eye, an AAV vector encoding the hSyn promoter will transduce only retinal ganglion cells (RGCs); whereas in the case of an AAV vector encoding the CAG promoter driven OPA1 expression, most retinal cell types including RGCs can be transduced. In either case, AAV vector- mediated OPA1 gene supplement therapy is expected to rescue DOA symptoms due to OPA1 mutation-caused haploinsufficiency.

[0015] Embodiments of the invention also include methods of transducing mammalian cells with a vector disclosed herein. Embodiments of these methods include combining a vector disclosed herein with a retinal ganglion cell under conditions selected to allow the vector to deliver the polynucleotide into the retinal ganglion cell such that the retinal ganglion cell is transduced with the vector. In some methods of the invention, the retinal ganglion cell is transduced in vitro. In other embodiments of the invention, the retinal ganglion cell is transduced in vivo. In certain embodiments of these methods, the retinal ganglion cell is selected to exhibit a OPA1 mutation found in an individual suffering from a dominant optic atrophy.

[0016] Other objects, features and advantages of the present invention will become apparent to those skilled in the art from the following detailed description. It is to be understood, however, that the detailed description and specific examples, while indicating some embodiments of the present invention, are given by way of illustration and not limitation. Many changes and modifications within the scope of the present invention may be made without departing from the spirit thereof, and the invention includes all such modifications.

[0017] FIGURES

[0018] Figure 1. Generation of OPA1 heterozygous and homozygous mutants isogenic to the WT ESC line UCLA1. A. Schematic drawing of the human OPA1 gene, which contains 31 exons (exon 1-29, 4b, and 5b). The exons are represented as boxes with protein coding regions shaded in black. Partial sequence of exon 1 is enlarged to show the ATG translation initiation codon (green), the guide RNA (magenta box), the PAM site (red underline), and the potential CAS9 cleavage site (black arrowhead). B. Alignments of the genomic DNA and predicted protein sequences of the control UCLA1 and the two CRISPR-Cas9 edited OPA1 mutant ESC lines. The control UCLA1 (OPA1+ / +) ESC line shows identical DNA sequences for both alleles. The UCLA1-D9 ESC (OPAE ") contains a single base C insertion (boxed) in both alleles, resulting in a frame shift and early stop after 11 amino acids. The UCLA1-E10 ESC (OPA1+ / ) has a G>A missense mutation (boxed), resulting in Arg-to-His change (grey shaded box) in allele 1; whereas the allele 2 has a 16-base deletion, which is replaced by a 3 base pair insertion (3 Cs between the two asterisks), disrupting the ATG start codon. C. Brightfield images show that E10 and D9 display normal pluripotent stem cell morphology comparable to the control UCLA1 ESC line from which they were derived. Scale bar, 500 pm. D. Immunofluorescent labeling of UCLA1, E10, and D9 ESC lines for pluripotent stem cell markers SOX2, OCT3 / 4, NANOG, and nuclear dye DAPI. Scale bar, 50 pm.

[0019] Figure 2. CRISPR-Cas9 mediated correction of the OPA1 mutation in a DOA iPSC line liDOA. A. Schematic drawing depicting the region of the liDOA genome carrying a G insertion (yellow highlight) in OPA1 exonl9, the sgRNA_exonl9 (underlined in magenta), and the PAM site (underlined in red) absent in the wild type allele. The 124-nucleotide single-stranded HDR donor template (green) removes the G insertion and introduces a silent T>C mutation (blue highlight), which creates a BstBI restriction site (blue overline) on the edited allele. Uppercase letters in the liDOA genome (black text) indicate the sequence of OPA1 exonl9 whereas lowercase letters represent intronic sequences. B. Alignments of partial OPA1 exonl9 genomic DNA and predicted protein sequences of the wild type control, the mutant liDOA, and the CRISPR-HDR corrected liDOA-CR. DNA sequences for both OPA1 alleles are shown above of Sanger sequencing profiles. The allele 2 of liDOA contains a G insertion (boxed), which leads to a premature stop codon. DNA sequencing confirmed the T>C replacement (boxed) and the BstBI site (blue underline) in liDOA-CR. Both alleles of liDOA-CR encode the wild type OP Al protein sequence. Amino acids that differ from the WT protein are shaded in grey. C.

[0020] Gel image shows the presence of the BstBI restriction site in the liDOA-CR iPSC line. A 704 bp PCR fragments spanning the area of CRISPR HDR targeting were incubated with or without BstBI and resolved by electrophoresis. Only liDOA-CR iPSCs show both the expected 704 bp and two additional bands at 436 and 268 bp, indicating the presence of the novel BstBI restriction site. Kb, kilobase pair(s). D.

[0021] The liDOA-CR iPSCs displays a normal male karyotype after undergoing CRISPR-Cas9 gene editing. E. Immunofluorescent labeling of liDOA-CR iPSCs with pluripotent stem cell markers SOX2, OCT3 / 4, NANOG, and nuclei dye DAPI. Scale bar. 30 pm.

[0022] Figure 3. Characterization of OPA1 protein expression in control and mutant PSC lines. A. Western blots showing OPA1 protein expression. The left panel shows the WT control ESC lines H9 and UCLA1, the OPA1 heterozygous mutant ESC line E10, and the OPA1 homozygous mutant ESC line D9. The right panel shows the WT control ESC lines H9 and UCLA1, the DOA patients’ iPSC lines liDOA and 2iDOA, and the CRISPR corrected iPSC line liDOA-CR. All PSC lines except OPA1 homozy gous mutant D9 express OPA1 protein isoforms (~80-100kDa). GAPDH was used as a loading control. Numbers indicate molecular weight marker in kDa. B. C.

[0023] Immunofluorescent detection shows OPA1 protein in control and mutant PSC lines. Anti-TOM20 was used to visualize mitochondria and DAPI for nuclei. B. Confocal images of co-labeled parental control ESC UCLA1, and isogenic OPA1 mutant ESCs E10 and D9. Scale bar, 20 pm. C. Confocal images of co-labeled control H9 ESCs, DOA patients-derived liDOA and isogenic liDOA-CR iPSCs. Scale bar, 10 pm.

[0024] Figure 4. Super resolution imaging of mitochondria in WT and OPA1 mutant PSCs. A. Merged SIM images of ESC lines UCLA1, E10, and D9 co-labeled for the mitochondrial marker TOM20, OPA1, and nuclear dye DAPI. The insets are 3x in scale. Scale bars, 5 pm. B. The top panels show merged SIM images of iPSC lines liDOA-CR, liDOA. and 2iDOA co-labeled for the mitochondrial marker TOM20, OPA1, and nuclear dye DAPI. Scale bars, 5 pm. The lower panels show TOM20 labeling of mitochondria alone. Scale bars, 10 pm. Figure 5. Cellular bioenergetics of normal control and OPA1 mutant ESCs. The control ESC line H9, the parental ESC UCLA1, and UCLA1 -derived OPA1 mutant ESC lines E10 and D9 were subjected to Seahorse cellular respiration analysis. A. Tracings of OCRs under normal cellular respiration and respiratory chain perturbation conditions are shown. Vertical lines indicate the times of inhibitor applications. B. Bar graphs show quantifications of basal and maximal OCRs, mitochondrial reserve capacities, as well as OCR-linked to ATP production. C.

[0025] Tracings of ECAR under normal cellular respiration, inhibiting ATP synthase (oligomycin), and uncoupling conditions (FCCP) are shown. D. Bar graphs present quantifications of basal ECAR and ECAR under ATP synthase-inhibition. The ratios of OCR / ECAR reflect relative participation of mitochondrial respiration versus cellular glycolysis. E. ATP production rates due to mitochondrial respiration, glycolysis, and total cellular ATP production are presented. N=5 replicates per ESC line. Bar graphs show each N as a separate data point, and are presented as mean values + / - SEM. Adjusted P values were obtained from one-way ANOVA and Tukey all-pairs test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.000E

[0026] Figure 6. Bioenergetic characterization of control ESC, DOA patients’ iPSC lines and CRISPR-HDR corrected iPSC line. The control ESC line H9, DOA mutant iPSC lines liDOA and 2iD0A, and the CRISPR HDR-corrected iPSC line liDOA-CR were subjected to Seahorse cellular respiration analysis. A. Tracings of OCRs under normal cellular respiration and perturbation conditions are shown. Vertical lines indicate times of inhibitor applications. B. Bar graphs present quantifications of basal and maximal OCRs, mitochondrial reserve capacities, as well as OCR linked to ATP production. C. Tracings of ECAR under normal cellular respiration, inhibiting ATP synthase (oligomycin). or uncoupling (FCCP) conditions are shown. D. Bar graphs present quantifications of basal ECAR and ECAR under ATP synthase-inhibited condition. The ratios of OCR / ECAR reflect relative participation of mitochondria respiration versus cellular glycolysis. E. ATP production rates due to mitochondrial respiration, glycolysis, and total cellular ATP production are presented. N=5 replicates per cell line. Bar graphs show each N as a separate data point, and are presented as mean values + / - SEM. Adjusted P values were obtained from one-way ANOVA and Tukey all-pairs test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0027] Figure 7. Derivation of human RGCs from control and OPA1 mutant pluripotent stem cells. A. Schematics show experimental timeline of 3D retinal organoid generation from human PSCs and RGC derivation from retinal organoids. B.

[0028] Examples of retinal organoids generated from OPA1+ +control PSC lines and OPA I " mutant PSC lines. Dxx indicate culture days in vitro. C. Confocal images of retinal organoid cross-sections at culture day36 labeled with RGC markers. Note that RGCs reside in the inner layer of the retinal organoids. D. Immunofluorescent labeling for RGC markers ISLET1 and NF145 and mitochondrial marker TOM20 in day54 monolayer cultures dissociated from retinal organoids at day 47.

[0029] Figure 8. Mitochondria in OPA1 mutant human RGCs display aberrant morphology. Transmission electron microscopy was performed for DOA patients’ iPSC-derived RGCs residing in the inner layer of the retinal organoids at day43. TEM images reveal disrupted mitochondrial morphology with poorly formed cristae structures. Scale bar for all panels, 0.5 pm.

[0030] Figure 9. OPA1 mutations cause mitochondrial respiration and energy production deficiency in PSC-derived 3D retinal organoids. A. Cell respiration assays of retinal organoids detects reduced basal and maximum oxygen consumption rates (OCR) and mitochondrial ATP production rates at day47 in OPA1+mutants E10 and liDOA compared to OPA1+ / +controls H9 and UCLA1. Bar graphs show each N as a separate data point, and are presented as mean values + / - SEM. Adjusted p values were obtained from one-way ANOVA and Tukey all-pairs test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. B. Cell respiration assays of isogenic iPSC-derived retinal organoids detect reduced OCR and mitochondrial ATP production rates at day57 in OPA1 " mutant liDOA compared to the isogenic control liDOA-CR. Bar graphs show each N as a separate data point, and are presented as mean values + / -SEM. P values were obtained from student t-test. *p<0.05, **p<0.01. Figure 10. OPA1 mutant neurons show elevated reactive oxygen species (ROS) production. A. Timeline to generate neurogenic factor Ngn2-induced neurons (iN) from PSCs. An inducible lenti virus LV-TetO-Ngn2-GFP is used to promote iN from PSCs. B. Images show ROS signals (white) at day5 in iN cells derived from isogenic iPSC pair liDOA (OPA1+) and liDOA-CR (OPA1 / +) with mitochondria co-labeled with MitoTarcker (red) and nuclear Hoechst dye (blue). C. An image shows Ngn2-induced iN neurons expressing GFP at day7. D. Images of ROS signals (white) in day7 live iNs are shown for the isogenic iPSC pair liDOA (OPA1+) and

[0031]

[0032] Lower panels show iN cultures treated with menadione (MD), which induces ROS as a control. E. Quantification of ROS signals in iN cell soma and dendrites shows elevated ROS production in liDOA (OPA1+ / ) compared to isogenic control liDOA-CR (OPA1+ +). F. Quantification of neuronal death based on pyknotic nuclei shows increased cell death in liDOA (OPA1+) compared to isogenic control liDOA-CR (OPA1+ / +). Bar graphs show each N as a separate data point, and are presented as mean values + / - SEM. P values were obtained from student t-test. *p<0.05, **p<0.01, ***p<0.001.

[0033] Figure 11. OPA1 mutant neurons exhibit altered physiological properties and neuronal activities. Whole cell patch clamp recording analyses were performed for human RGCs produced from PSC-derived 3D retinal organoid between culture day47-50. A. OPA1 mutant liDOA (OPAl+ / ‘) iPSC-derived RGCs exhibit lower resting membrane potential compared to control neurons. When the resting potential is corrected by current injections, the rate of spiking returns to normal. B. OPA1 mutant RGCs show reduced spontaneous firing of action potentials compared to control RGCs derived from H9 and liDOA-CR (OPA1+ / +). C. OPA1 mutant RGCs require higher levels of current inputs to increase the spike rates compared to control human RGCs derived from H9 and liDOA-CR.

[0034] Figure 12. Lentivirus-mediated OPA1 expression rescues mitochondrial dysfunction. A. Schematic designs of lentiviral vectors encoding the EFla promoter. LV- EFla-OEP expresses both OPA1 and GFP to facilitate monitoring of lentivirus transduction; whereas LV-EFla -GFP is a corresponding control. B. Western blot shows LV-EFla -OEP expressing 0PA1 cDNA can increase OPA1 protein levels in mutant PSC lines D9 (OPAL’), 11D0A (OPAU ), 21D0A (OPA1+ / ). Nonetransduced H9 and liDOA-CR lines serve as OPA1+ / +controls. C. Quantification of OPA1 protein levels detected in the western blot shown in B. The

[0035]

[0036] signs indicate OPA1 mutant PSC lines transduced with the LV-EFla-OEP. D. Cell respiration quantification of LV-EFla-OEP transduced mutant iPSC liDOA (OPA1+ / ) show restoration of basal OCR and maximum OCR, and mitochondrial ATP production to the levels of the isogenic control liDOA-CR (OPA1+ / +). E. ROS quantification of LV-EFla-OEP transduced mutant iPSC liDOA (OPAl+ / ‘) show significantly reduced ROS production. Bar graphs show each N as a separate data point, and are presented as mean values + / - SEM. Adjusted p values were obtained from one-way ANOVA and Tukey all-pairs test. **p<0.01, ***p<0.001, ****p<0.0001.

[0037] Figure 13. AAV vector designs and efficient transduction of human ESC-derived RGCs. A. Schematic drawings of AAV vectors encoding either the CAG or hSyn promoter to drive OPA1 cDNA expression. The control AAV vectors express the reporter mCherry from the CAG or hSyn promoter. B. Confocal images show AAV-hSyn-mCherry vector packaged with the 7m8 capsid efficiently transduces human iRGCs derived from ESC H9.

[0038] DETAILED DESCRIPTION OF THE INVENTION

[0039] In the description of embodiments, reference may be made to the accompanying figures which form a part hereof, and in which is shown by way of illustration a specific embodiment in which the invention may be practiced. It is to be understood that other embodiments may be utilized, and structural changes may be made without departing from the scope of the present invention. Many of the techniques and procedures described or referenced herein are well understood and commonly employed by those skilled in the art. Unless otherwise defined, all terms of art, notations and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this invention pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.

[0040] Dominant optic atrophy (DOA) is the most commonly inherited optic neuropathy. The disease prevalence is 1:25,000-1:35,000 in most populations, but it can be as high as 1 : 10,000 in areas with an established founder effect. The disease can be of teen age onset, but is heterogenous. The majority of DOA (60-70%) is caused by mutations in the OP Al gene that encodes a dynamin-related GTPase located to the mitochondrion. Although OPA1 is broadly expressed in various tissue and cell types, OPA1 mutations predominantly affect retinal ganglion cells (RGCs), the essential projection neurons responsible for transmitting vision information from the retina to the brain. OP Al protein enters the mitochondrion and is process into long and short forms, which form complexes in contact with the mitochondrial inner membrane. OPA1 plays important role in mitochondrial dynamics, membrane integrity, respiratory chain complex stability, and cellular energetics.

[0041] As discussed below, we have detected reduced OPA1 expression in OPA1 mutant PSCs, suggesting that a large portion of DOA disease are due to haploinsufficiency. Building upon these discoveries, we have designed AAV and lentivirus vectors to express OPA1 cDNA in order to compensate for the reduced OPA1 protein. Different types of promoters can be used to drive OPA1 expression, for example a generic strong promoter such as a CAG promoter and / or a neuronal specific promoter such as a hSyn promoter.

[0042] The invention disclosed herein has a number of embodiments. Embodiments of the invention include compositions of matter comprising a mammalian expression vector, wherein a polynucleotide disposed in the vector encodes a OPA1 isoforml polypeptide (SEQ ID NO: 1) or encodes a OPA1 isoform 7 polypeptide (SEQ ID NO: 2). In certain embodiments, the vector comprises an adeno associated viral (AAV) vector such as a AAV2, AAV7m8, or AAV5 viral vector. In some embodiments of the invention, the vector comprises a lentiviral vector. In typical embodiments of the invention, the vector comprises a CAG promoter and / or a neuronal specific human synapsin hSyn promoter. In certain embodiments of the invention, the vector is disposed in a human retinal ganglion cell.

[0043] Embodiments of the invention include methods of transducing a human retinal ganglion cell, the methods comprising combining a vector disclosed above with the retinal ganglion cell under conditions selected to allow the vector to deliver the polynucleotide into the retinal ganglion cell such that the retinal ganglion cell is transduced with the vector. In some embodiments of the invention, the vector comprises an adeno associated viral (AAV) vector. In some embodiments of the invention, the vector comprises a lentiviral vector. In typical embodiments of the invention, the vector comprises a CAG promoter and / or a neuronal specific human synapsin promoter. In certain embodiments, the retinal ganglion cell is transduced in vitro. In other embodiments of the invention, the retinal ganglion cell is transduced in vivo. Typically the retinal ganglion cell in these embodiments of the invention is selected to exhibit a mutation found in an individual suffering from a dominant optic atrophy.

[0044] In certain embodiments of the invention, the compositions of the invention include additional constituents. Certain embodiments of the compositions of the invention include, for example a pharmaceutical excipient such as one selected from the group consisting of a preservative, a tonicity adjusting agent, a detergent, a viscosity adjusting agent, a sugar and a pH adjusting agent. For compositions suitable for administration to humans, the term "excipient" is meant to include, but is not limited to, those ingredients described in Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins, 21st ed. (2006) the contents of which are incorporated by reference herein.

[0045] Further aspects and embodiments of the invention are discussed in the examples below.

[0046] EXAMPLES EXAMPLE 1: DERIVATION AND CHARACTERIZATION OF ISOGENIC HUMAN PLURIPOTENT STEM CELL LINES FOR STUDYING OPA1 MUTATION-INDUCED DOMINANT OPTIC ATROPHY

[0047] Below we describe the generation of human O7M7-mutant pluripotent stem cell (PSC) lines for the purpose of creating in vitro disease models of DOA. To reduce genetic background-introduced heterogeneities, we generated homozygous and heterozygous OPA1 mutant ESC lines isogenic to the parental wild type control line using CRISPR-Cas9 gene editing. We also corrected the existing OPA1 mutation in a DOA patient-derived induced pluripotent stem cell (iPSC) line using CRISPR-Cas9-mediated homology directed repair (HDR) to establish an isogenic iPSC pair. Furthermore, we characterized these PSC lines for OPA1 protein expression, mitochondrial morphology, and cellular respiration and energy output. These isogenic PSC lines will be useful tools to investigate impacts of OPA1 mutations on PSC-derived human RGCs and facilitate studies of DOA disease mechanisms in vitro.

[0048] RESULTS

[0049] Generation of isogenic OPA / -mutant ESC lines using CRISPR / Cas9 gene editing To study the effects of OPA1 mutations on human RGCs in vitro, we first generated OPA1 heterozygous and homozygous mutant ESC lines using CRISPR-Cas9 gene editing. The UCLA1 human ESC line that carries the wild-type (WT) OPA1 gene was electroporated with ribonucleotide- protein (RNP) complexes consisting of the Cas9 protein and a small guide RNA (sgRNA) targeting exon 1 of the OPA1 gene (sgRNA_exonl), which was designed to utilize a PAM site near the OPA1 translation initiation codon to maximize the disruption of protein production from one or both alleles (Figure 1A). After electroporation, the genomic DNA sequence tracing from the edited population were compared to the parental UCLA1 ESCs using the Inference of CRISPR Edits (ICE) tool, which calculates the percentage of insertion or deletion (INDEL) mutations generated by the nonhomolog ous end joining (NHEJ) pathway after Cas9 creates a double-stranded break (1). The ICE analysis indicated that editing by Cas9 RNP containing sgRNA_exonl was 97% efficient, and 82% of the edits generated were predicted to disrupt 0PA1 protein function (not shown).

[0050] To identify edited ESC clones that carry either heterozygous or homozygous OPA1 mutations, the edited UCLA1 cell population was plated as single cells at clonal density. The genomic DNAs of expanded ESC clones were extracted, amplified by PCR, and analyzed by DNA sequencing of both strands using primers flanking the sgRNA_exonl. The analysis showed that the majority of the ESC clones contained same INDEL mutations on both OPA1 alleles in the vicinity of the guide RNA targeting site resulting in homozygous OPA1 mutants. As an example, the ESC clone UCLA1-D9, hereby referred to as D9, contained a single base C insertion on both alleles (Figure IB). This mutation caused a frame shift resulting in a premature termination codon after eleven ammo acid residuals from the translation start codon (Figure IB). Since this short peptide abolishes the normal function of OPA1, the ESC clone D9 is predicted as an OPA1 null mutant.

[0051] Due to the high efficiency of Cas9-sgRNA_exonl editing, the resulting OPA1 heterozygous loss of function clones were rare. We identified an ESC clone UCLA1-E10, here by referred to as E10, harboring compound heterozy gous OPA1 mutations (Figure IB). Genomic DNA sequencing analysis showed that one allele of E10 carries a G>A missense mutation changing the fifth amino acid from arginine to histidine (Arg5His); whereas the other allele contains an ATG start codon-disrupting deletion resulting in the loss of the normal translation initiation. Because protein function prediction software scored the Arg5FIis switch as having a very low likelihood of being pathogenic (2), the ESC clone E10 is thus considered an OPA1 heterozygous mutant and can be used to model DOA disease caused by true haploinsufficiency.

[0052] The OP Al homozygous D9 and heterozygous E10 mutant ESC lines can be grown and passaged under standard pluripotent stem cell (PSC) culture conditions and showed typical ESC morphology compared to UCLA1 and other ESC lines (Figure 1C). Cells of both D9 and E10 ESC lines also expressed pluripotent stem cell markers SOX2, OCT3 / 4, and NANOG as their isogenic parental UCLA1 ESCs (Figure ID).

[0053] Generation of isogenic iPSC lines using CRISPR / Cas9-mediated homology directed repair

[0054] To establish patients’ iPSC-based DOA disease models, we have previously generated DOA patients’ iPSC lines earning OPA1 heterozygous mutations (3). To reduce impacts of genetic backgrounds on disease phenotypes in DOA disease models, we used CRISPR-Cas9-mediated homology directed repair (HDR) to correct the OPA1 gene mutation carried in the iPSC line liDOA, generated from a patient with classic DOA symptoms.

[0055] The iPSC line liDOA carried a heterozygous single base pair G insertion in exonl9 of the OPA1 gene (Figure 2A). To carry out CRISPR HDR correction, liDOA iPSCs were nucleofected with RNPs consisting of sgRNA_exonl9 and Cas9 protein, along with a single-stranded oligodeoxynucleotide (ssODN) repair template. The sgRNA_exonl9 was designed to take advantage of the liDOA iPSCs’ OPA1 mutation, which creates a PAM site unique to the mutant allele (Figure 2A). thus allowing specific targeting by the RNP complex. The ssODN / HDR donor template was complementary to the target strand with 60 base pair homology arms (Figure 2A) and Alt-R HDR modifications by Integrated DNA Technologies (IDT) to increase oligo stability and rate of repair (4). In addition to eliminating the G insertion, the HDR donor template also introduced a T>C silent mutation (Figure 2A). The silent mutation introduced a novel BstBI restriction site on the corrected allele (Figure 2A, 2B), which facilitates the identification of correctly edited clones and allows the corrected liDOA line to be distinguished from other OPA1 WT lines. The removal of the G insertion corrected liDOA’ s OP Al mutation and eliminated the PAM site, thus preventing further editing of the corrected allele after successful recombination.

[0056] Through CRISPR-HDR, we identified a correctly edited clone, liDOA-CR (for liDOA CRISPR Corrected). Genomic DNA sequencing confirmed that liDOA- CR carried the corrected OP Al allele eliminating the G insertion and the premature translation stop codon (Figure 2B). In addition, liDOA-CR contained the newly created BstBI restriction site not existing in liDOA mutant iPSC and the control wild type ESC lines (Figure 2C). The HDR corrected liDOA-CR iPSCs showed normal karyotypes (Figure 2D) and expressed the pluripotency markers OCT3 / 4, SOX2, and NANOG (Figure 2E).

[0057] OPA1 protein expression and localization in isogenic PSC lines

[0058] We next investigated the OPA1 protein expression levels and cellular locations in the established PSC lines. Western blot analysis detected five OPA1 isoforms expressed by HEK 293t cells and by the wild type H9 ESCs (Figure 3A). Compared to the isogenic parental ESC line UCLA1. the heterozygous OPA1 mutant E10 show ed reduced OPA1 protein levels, whereas the homozygous OPA1 mutant D9 showed a loss of OPA1 protein expression (Figure 3A). Similarly, Western blot analysis also revealed decreased levels of OPA1 protein expression from DOA patients’ iPSC lines liDOA and 2iD0A, which carrying distinct heterozygous OPA1 gene mutations resulting in premature terminations (3). compared to the control PSC lines H9 and UCLA1 (Figure 3A). Noticeably, compared with the liDOA mutant line the isogenic liDOA-CR iPSC line showed increased OPA1 protein levels comparable to WT controls, indicating the restoration of OPA1 protein expression after correction of the mutation (Figure 3A).

[0059] We next examined the influence of OP Al mutations on mitochondria in various PSC lines. Immunofluorescent labeling and confocal imaging of mitochondrial outer membrane protein TOM20 showed similar mitochondria presence regardless of OPA1 genotypes in the PSCs (Figure 3B, 3C). However, co-labeling for TOM20 and OPA1 revealed that mitochondria of the heterozygous E10 mutant contained lower levels of OPA1, whereas the homozygous D9 mutant showed minimal OPA1 signals compared to the isogenic control ESC line UCLA1 (Figure 3B). Consistent with the result of Western blot analysis, the corrected iPSC liDOA- CR showed restored 0PA1 labeling in mitochondria compared to the isogenic heterozygous mutant liDOA (Figure 3C).

[0060] To assess the impact of OPA1 mutations on mitochondrial morphology in PSCs, we performed high resolution imaging using structured illumination microscopy (SIM). Tn the isogenic control ESC line UCLA1, most OPA1 signals were colocalized to mitochondria labeled by TOM20 (Figure 4A). In comparison, SIM imaging revealed reduced TOM20 and OPA1 co-localization in the heterozygous E10 cells and fragmental mitochondria in the homozygous mutant D9 cells (Figure 4A). SIM imaging also showed a reduced colocalization of TOM20 and OPA1 signals in the heterozygous iPSC liDOA compared with its isogenic control iPSC liDOA-CR (Figure 4B).

[0061] Impact of OPA1 mutations on cellular respiration and ATP production in isogenic PSC lines

[0062] To determine if OPA1 mutations affect mitochondrial function in various PSC lines, we performed cellular respiration analysis by measuring the oxygen consumption rates (OCR) and the extracellular acidification rates (ECAR) using the Agilent Seahorse analyzer. We first examined bioenergetics of the isogenic ESC lines UCLA1, E10, and D9 with glucose as a fuel (Figure 5A, 5C). Compared with the isogenic control UCLA1, the heterozygous E10 and homozygous D9 mutants showed reduced basal respiration rates (Figure 5B). After treatments with the ATP synthase inhibitor oligomycin followed by the uncoupler FCCP, E10 and D9 showed deficits in maximal respiration rates, as well as corresponding reduction in mitochondrial reserve capaci and ATP linked respiration proportional to copies of OPA1 mutant alleles (Figure 5B). The extracellular acidification rates (ECAR), which were simultaneously measured as an indicator of cellular glycolytic activities, were not significantly affected by OPA1 mutations (Figure 5D). In accordance with the observed effects of OPA1 heterozy gous and homozygous mutations on respiration rates, the mitochondrial ATP production rates showed significant and corresponding decreases in E10 and D9 cells in comparison to the isogenic UCLA1 ESCs (Figure 5E). Consistent with the observed ECARs, the ATP production rates associated with glycolysis did not change among the isogenic lines, and as a consequence the rates of total ATP production in UCLA1, E10, and D9 ESCs did not show statistically significant differences (Figure 5E). Interestingly, the WT ESC line H9 showed lower OCR-associated parameters, including a lower mitochondrial ATP production rate compared to UCLA1. However, H9 showed higher ECAR and glycolytic ATP production, which led to the similar total ATP production as UCLA1.

[0063] We also examined cellular respiration of DOA patients-derived iPSC lines. Monolayer cultures of control H9 ESCs, OPA1 mutant liDOA and 2iD0A iPSCs, and liDOA CRISPR corrected liDOA-CR cells were analyzed using glucose as a fuel. Both OP Al heterozygous mutants liDOA and 2iD0A showed reduced levels of basal, maximal, and ATP-linked respiration, as well as a decreased reserve capacity, compared to the WT PSC lines H9 and liDOA-CR (Figure 6A, 6B). In addition, liDOA and 2iD0A mutant iPSCs also showed significantly lower levels of ECAR compared to WT PSCs H9 and liDOA-CR (Figure 6C, 6D). In concordance with mutant iPSCs’ reduced OCAR and ECAR, rates of ATP production by mitochondria and glycolysis, as well as the total ATP production rates were significantly reduced in OPA1 mutant iPSCs compared to WT H9 and liDOA-CR (Figure 6E).

[0064] MATERIALS AND METHODS

[0065] Human pluripotent stem cell cultures

[0066] Human ESCs and iPSCs were maintained in mTeSR plus medium (Stemcell Technologies) supplemented with 1% Antibiotic Antimycotic (Gibco / ThermoFisher Scientific) on Matrigel (Coming) coated plates at 37°C with 5% CO2 as the standard culture condition. PSCs were passaged by dissociating monolayer cells into a singlecell suspension with Accutase (Stemcell Technologies) and plated in the standard medium containing 10 pM Y-27632 (Stemcell Technologies) for 24 hours. Afterwards, PSCs were returned to the standard medium which were changed every other day.

[0067] CRISPR / Cas9 gene editing to generate isogenic OPA / -mutant ESC lines Human UCLA1 ESCs (NTH-0058) with wild type 0PA1 gene were grown till 80% confluence under the standard condition, and dissociated to a single-cell suspension using Accutase (Stemcell Technologies). RNPs composed of 300 pmol of the synthetic guide RNA, “sgRNA_exonl” (Synthego) and 40 pmol of Cas9 protein (Synthego) were mixed with 5xl03UCLA1 ESCs in P3 Primary Cell Nucleofector solution (Lonza) and nucleofected in a Lonza Nucleofector S cuvette using a Lonza 4D-nucleofector X-unit with the CA-137 electroporation program. Nucleofected cells were cultured as in mTeSR plus, 1% Antibiotic-Antimycotic, and 10% Clone R (Stemcell Technologies) for 24 hours before returning to the standard medium. To assess the efficiency of CRISPR / Cas9 editing, genomic DNA was extracted using the Purelink genomic DNA mini kit (Invitrogen) and amplified using Hot Star Taq DNA Polymerase (Qiagen) and primers flanking the double-stranded DNA break site (XJY1349 and XJYI350. The resulting PCR products were sequenced using primer XJY1350. The rate of editing in the nucleofected population was assessed using the Inference of CRISPR Edits (ICE) tool (1). PCR fragments amplified from UCLA1 ESCs electroporated without any CRISPR reagents was sequenced to generate a control file.

[0068] To enable clonal selection, a portion of the nucleofected cells was plated at a density of 1 cell / well in 96-well plates and cultured in mTeSR plus, 1% Antibiotic-Antimycotic, and 10% Clone R. Once the colonies reached ~20 cells, Clone R was removed. Individual colonies were expanded and their genomic DNAs were isolated and amplified by PCR using primers XJY1361 and XJY1362 as described above. The PCR products were sequenced using primer XJY1361 to identify the specific insertion and deletion mutations. Both strands of the genomic DNA around the sgRNA_exonl of OPA1 heterozygous (E10) and homozygous-mutant (D9) ESC lines were sequences. In addition, all OPA1 coding exons of ESC E10 and D9 were sequenced to rule out any unintended OPA1 mutations.

[0069] CRISPR-HDR correction of the OPA1 mutation in liDOA iPSC

[0070] Prior to nucleofection, liDOA iPSCs (3) were dissociated to a single cell suspension using Accutase (Stemcell Technologies), and resuspended at a concentration of 25,000 cells / uL in P3 Primary Cell Nucleofector solution (Lonza). An RNP solution composed of 200 pmol of the synthetic sgRNA, “sgRNA_exonl9” (Synthego), and 120 pmol of Cas9 protein (Macrolabs) was constituted and incubated at room temperature for 15 min. The single-stranded Alt-R modified donor template (Integrated DNA Technologies) was added to the RNP mix to a final concentration of 3 pM along with 5x105liDOA iPSCs in P3 Primary Cell Nucleofector solution (Lonza). The single-cell suspension was then nucleofected in a Lonza Nucleofector cuvette S using a Lonza 4D-nucleofector X-unit with electroporation program CA-137. Afterwards, cells were cultured as a population in mTeSR plus, 1% Antibiotic-Antimycotic. and 10% Clone R for 24 hours before returning to the standard medium.

[0071] To facilitate clonal selection, the population of electroporated cells was subsequently plated in Matrigel-coated 96 well plates at a density of 1 cell / well in standard medium containing 10% Clone R. Clone R was removed once colonies reached ~20 cells. Genomic DNAs were isolated from expanded colonies using the Purelink genomic DNA mini kit (Invitrogen). The region surrounding the G insertion mutation in exon 19 of OP Al was amplified via PCR using primers XJY1366 and XJY1367. PCR products were incubated with or without BstBI (New England Biolabs Inc.) and resolved by agarose gel electrophoresis. One iPSC clone (liDOA-CR) was identified to carry one allele with BstBI site and was further verified by DNA sequencing with primers XJY1424-2 and XJY1367. Standard G-band karyotyping was performed by Cedars Sinai Medical Center iPSC core as previously described (5) to verify that liDOA-CR iPSCs displayed a 46, XY normal male karyotype. Immunofluoi escent labeling, confocal and super resolution imaging

[0072] PSCs grown on Matrigel-coated plastic coverslips (ThermoFisher Scientific) were fixed in 4% paraformaldehyde in PBS for 2 minutes and then incubated in blocking solution (0.1% TritonX-100, 2% donkey serum, 10% FBS in DMEM). Coverslips were sequentially incubated with primary antibodies, followed by secondary' antibodies and lOpg / ml 4’, 6-diamidino-2-phenylindole (DAPI) diluted in blocking solution. All incubations were for one hour at room temperature, and followed by three, 5-minute washes in PBS with 0.1% Tween 20. Coverslips were mounted on glass slides and imaged using the Olympus BX61 scanning laser confocal microscope with Plan- APO objectives.

[0073] For structured illumination microscopy (SIM) imaging, PSCs were grown on #1.5 coverslips (Warner Instruments) coated with Matrigel (Coming). Fixation and immunofluorescent labeling were as described above. Coverslips were mounted on glass slides using Vectashield mounting medium (Vectorlabs) and sealed with CoverGrip (Biotium). SIM images were captured using General Electric DeltaVision OMX microscope with a PlanApoN 60x / 1.42 NA oil objective (Olympus). Immersion oil with a refractive index of 1.516 was used. Images were acquired in 3D-SIM mode using a Z-spacing of 0.125 pm and reconstructed using Softw'orx software (GE Healthcare).

[0074] Western blot

[0075] PSCs were washed twice in cold PBS and then incubated with lysis buffer (10 pM HEPES, 10 pM KCL, 0.1% NP40, 1.3 mM MgCh) supplemented with IX protease and phosphatase inhibitor (Cell Signaling) for 2 minutes at room temperature. Cells were manually dissociated and agitated at 4°C in lysis buffer with inhibitors for 15 minutes on ice. Cell extracts were centrifuged at 13,000 rpm at 4°C for 10 minutes, after which supernatants were collected. Protein concentration was quantified using the micro BCA protein assay kit (ThermoFisher Scientific). 20 pg of protein lysate per sample was loaded on a 4-12% NuPAGE gel (Invitrogen). Following electrophoresis, the gel was transferred to a PVDF membrane (Millipore) under reducing conditions. The membrane was incubated with primary' and secondary' antibodies sequentially according to the Near Infrared Western Blot Detection technical guide (LI-COR Biosciences). The Western blots were imaged using the Odyssey® CLx Imaging System (LI-COR Biosciences).

[0076] Cell respiration assays

[0077] Human PSCs were dissociated using Accutase and seeded at a density of 10,000 cells / well in a Matrigel coated-Seahorse XF 96- well plate (Agilent) in 60 pL of standard PSC medium and 10 pM Y-27632. The following day when cells were approximately 80% confluent, the oxygen consumption rate (OCR) and the extracellular acidification rate (ECAR) were measured in parallel in a Seahorse XF96 Extracellular Flux Analyzer (Agilent). Approximately 1 hour prior to analysis, PSC medium was changed to XF assay media (unbuffered DMEM supplemented with 10 mM glucose, 2 mM glutamine, 1 mM pyruvate, and 5 mM HEPES) and the plate was incubated at 37DC, without CO2. Compounds were injected sequentially throughout the assay via injection ports A-D. Final concentrations of injected compounds included: 2 pM oligomycin (Port A), 0.5 pM (Port B) and 0.9 pM (Port C) FCCP, and 2 pM antimycin A and 2 pM rotenone (Port D). Upon assay completion, the plate was washed with PBS and fixed with 4% PFA. Nuclei were stained with 10 ng / mL of Hoescht 33342 (ThermoFisher) and counted with an Operetta High-Content Imaging System (PerkinElmer). Rate measurements were normalized to the number of Hoechst-positive nuclei stained before analysis. Data was analyzed using the Seahorse Wave Desktop software (Agilent) and exported to Microsoft Excel and GraphPad Prism #9.4.1 for analysis. ATP production rates were calculated as previously described (6, 7).

[0078] Statistical Analysis Seahorse cell respiration data was analyzed using GraphPad Prism #9.4.1 software. Ordinary' one-way ANOVA and Tukey’s multiple comparisons tests were used. All error bars are presented as mean value ± SEM. P < 0.05 was considered statistically different.

[0079] DISCUSSION

[0080] Although OPA1 has been extensively studied in readily accessible cell types, these studies do not address the main conundrum in the field of DOA research: why are RGCs particularly sensitive to OPA1 mutations? To better address this question and to model OP Al -DOA disease using pluripotent stem cell-derived human RGCs, we generated OP Al heterozygous and homozygous mutant ESC lines from a normal control ESC line and corrected the OPA1 mutation in a DOA patient iPSC line (3) using CRISPR / CAS9 gene editing technology. Because OPA1 mutation-caused DOA show high degree of heterogeneity and incomplete penetrance, the OPA1 mutant PSC lines with their isogenic control can serve as useful research tools for reducing variabilities in DOA disease models in vitro and provide opportunities to investigate OPA1 deficiency driven DOA pathogenesis.

[0081] Using both OPA1 ESC and iPSC lines for disease modeling is beneficial, as each confers their own specific advantages. Since the advent of gene editing technology, we are no longer restricted to studying OPA1 mutations that occur naturally in human patients. The OPA1 mutant ESC lines we obtained using CRISPR-Cas9 editing represent the loss of either one or both functional alleles. These ESC lines can serve to better understand the requirement for OP Al gene dosage in development and disease. The OPA1 homozy gous ESC line is useful for evaluating the requirement of OPA1 for the differentiation of specific tissue types or cell lineages. Editing a WT PSC line is also advantageous in that all derivative lines will be isogenic, or have the same genetic background as one another. Comparing isogenic hPSC lines with or without OPA1 mutations can increase the reliability in attributing phenotypic differences observed in vitro to a given OPA1 mutation and avoid issues of incomplete penetrance observed in patient pedigrees.

[0082] Conversely, iPSC lines derived from DOA patients with OPA1 mutations can be corrected in vitro using gene editing to generate an isogenic control iPSC line. The iPSC lines are useful in that in vitro phenotypes of DOA patients iPSC-derived RGCs can be correlated to patients’ ophthalmological data. Observations from a patient's cells in vitro and his / her clinical manifestations of disease can provide insights that will aid in validating how closely the PSC-based model recapitulates the DOA disease symptoms and informing what mechanisms underlie these symptoms. Given the heterogeneity of DOA patient population, examining a range of PSC lines with different OPA1 mutations will be necessary7to fully understand OPA 1 -driven DOA pathogenesis.

[0083] Since OPA1 proteins form complexes within mitochondria, OPA1 mutation-triggered DOA disease can occur via dominant negative or haploinsufficiency mechanisms (8, 9). Currently, it remains challenging to correlate the location and type of OPA1 mutations to the pathogenicity of disease and to predict the mechanism of action for OPA1 mutant variants (10-12). We have determined the expression levels of OPA1 protein in the CRISPR / CAS9 editing-generated OPA1 mutant ESCs. As expected, the heterozygous and homozygous mutant ESC lines showed reduced and none-detectable OPA1 proteins compared to the parental ESC line, respectively. The heterozygous OPA1 ESC line provides a true loss-of-function scenario model, which can represent the haploinsufficiency. The two heterozygous DOA patient iPSC lines also showed reduction of OPA1 protein compared to wild type control PSCs, while the CRISPR-HDR corrected iPSC restored OPA1 protein expression levels. In OPA1 mutant PSC lines, we observed the same pattern of OPA1 isoforms (13, 14) as their WT counterparts, at relatively equal ratios. Interestingly, mouse embryonic fibroblasts (MEFs) and human embryonic kidney (HEK) 293T cells also express the same OPA1 protein isoforms (13). These data indicate that these OPA1 mutations do not alter OPA1 splicing or post-translational processing in PSCs. Therefore, functional differences detected between WT and OP Al heterozygous mutant PSCs likely result from differences in total 0PA1 protein expression levels.

[0084] Previous studies have demonstrated that cells lacking OPA1 expression have highly fragmental mitochondrial networks and reduced cristae complexity (12, 15, 16). Using the super resolution STM imaging, we also detected differences of mitochondrial morphology between the wild type control and the homozygous loss of function ESC line UCLA1-D9. However, differences of mitochondrial morphology between WT and OPA1 heterozygous mutant PSC lines appears subtle by SIM imaging. Unexpectedly, we also observed cytoplasmic distribution of punctate OP Al labeling signals with SIM imaging, even in the OPA1 null ESC lines UCLA1-D9. One possibility is that the OPA1 antibody recognizing C-terminal portion of OPA1 also binds to other cellular proteins. Alternative, this could potentially be attributed to the cryptic translation initiation within exon 3 or exon 4 as reported in NCB1 protein database (NP_001341592.1 and NP_001341593.1). These predicted OPA1 proteins lack the mitochondrial targeting sequence encoded by exon 1 and exon2, but may still be in CRISPR / CAS9 edited ESCs as the guide RNA we used targeted exon 1. However, it is unclear whether the low levels of OPA1 proteins located in the cytoplasm have any biological function.

[0085] It is known that PSCs have high anabolic activities and predominately use glycolysis to provide metabolites for cell proliferation and maintenance of pluripotency (16). The mTeSR medium used to culture PSCs contains high glucose (13 mM), which support the continued growth and proliferation. Our cellular respiration analysis using glucose as a fuel show that comparing to the parental ESC line UCLA1, the isogenic OPA1 mutant ESCs had significant reduction in their basal, maximal, and ATP-linked respiration. Moreover, these deficits are proportional to the loss of one or both functional OP Al alleles (E10 and D9, respectively). However, OPA1 mutant ESCs retained similar extracellular acidification rate (ECAR) and glycolytic ATP productions as the parental UCLA1 line. Interestingly, DOA patients’ heterozygous mutant iPSC lines not only had reduced basal, maximal, and ATP-linked respiration rates compared to WT PSCs, they also had reduced basal and oligomycin-induced ECAR, indicating that both oxidative phosphorylation and glycolysis were impaired in DOA patients’ iPSCs. Consequently, in OPA1 mutant iPSC lines both mitochondrial and glycolytic ATP productions were significantly reduced, causing a decline in total ATP production. It is worth noting that although the DOA patient from whom 2iD0A iPSCs were derived has very mild clinical symptoms (3), the 2iD0A iPSC line displayed similar cellular respiration defects in vitro as liDOA, which was derived from a patient with classic DOA symptoms. This suggests that OPA1 mutant phenotypes may more readily manifest under in vitro conditions. It would be interesting to assess whether ECAR is consistently reduced in other OPA1 mutant iPSC, as published reports do not describe ECARs (17, 18). Despite the observed differences in ECARs between ESCs and iPSCs, and the reduced cellular respiration capacities in all OP Al mutant PSC lines, we did not detect any obvious differences in PSC morphology7and grow th rates, suggesting that under the high glucose culture condition, the cellular metabolic status including the level of ATP they are able to produce is sufficient for PSC maintenance.

[0086] Our results demonstrate that cells’ individual genetic backgrounds, in addition to their OPA1 mutation status, influence their OCR, ECAR, and ATP production in vitro. Among the three OPA1 wild type PSC lines, H9 ESCs are significantly more glycolytic than UCLA1 ESCs, while liDOA-CR iPSCs were more glycolytic than H9 ESCs. Interestingly, UCLA1 ESCs had a significantly higher ratio of basal OCR:ECAR than H9 ESCs, indicating they are relatively more reliant on oxidative phosphorylation than glycolysis. These differences in basal bioenergetics may contribute to the varied severity of DOA symptoms among individuals with the same OP Al mutation.

[0087] In summary, we have established OPA1 mutant ESC and iPSC lines with corresponding isogenic controls as tools to model DOA and investigate disease mechanisms. Our findings have revealed impact of different mutations on OPA1 protein expression and cell bioenergetics, and highlighted the importance of using isogenic controls when evaluating the effects of OPA1 mutations in vitro.

[0088] EXAMPLE 2: REFINEMENT AND TRANSLATION OF OPA1 GENE THERAPY FOR AUTOSOMAL DOMINANT OPTIC ATROPHY (DOA), A MITOCHONDRIAL DISEASE OP Al gene is central to a ubiquitous cellular function and is implicated in multiple neurodegenerative diseases, but monogenetic mutations lead a catastrophic loss of vision as a severe optic neuropathy. OPA1 protein is involved in mitochondrial fusion, the maintenance of the inner membrane integrity and the respiratory' chain complexity. Since RGCs constitute only 2% of the human retina, dominant optic atrophy (DOA) was not studied using patients’ RGCs. We have established DOA disease models using human PSC-derived RGCs, and developed both lentiviral and AAV vectors for OPA1 gene therapy. Our data show that viral vector-mediated OPA1 gene supplemental therapy can rescue mitochondrial dysfunction in mutant cells due to OPA1 haploinsufficiency.

[0089] Establishing human PSC-based DOA disease models:

[0090] By reprogramming DOA patients' somatic cells into iPSCs and by CRISPR-Cas9 editing of ESCs, we have developed and characterized multiple PSC lines with OPA1 mutations (see, e.g., Pohl et al. (2023). Front. Genet. 14:1251216 and Pohl et al. (2025) Cells 14:137)(see, e.g., Table 1 below). Using these tools, we have shown that human PSCs with OPA1 heterozygous mutations can develop into 3D retinal organoids, which spontaneously generate RGCs (Figure 7). However, transmission electron microscopy (TEM) analysis has revealed that mitochondria in OPA1 mutant human RGCs have morphological defects, especially in the poorly formed inner membrane cristae structures (Figure 8). Since mitochondrial respiratory' chain complexes reside on the mitochondrial inner membrane, we predict that OPA1 mutant PSC-derived 3D retinal organoids have defective mitochondria despite the ability to produce RGCs. Indeed, Seahorse cellular respiration assays detected significantly decreased oxygen consumption rates and reduction of ATP production by mitochondrial oxidative phosphorylation in OPA1 mutant retinal organoids (Figure 9). In contrast, the isogenic control iPSC line liDOA-CR (OPA1+ +), in which the DOA patient’s OPA1 mutation has be corrected, showed normal cell respiration rate and ATP production.

[0091] Mitochondrial respiratory chain damage is known to result in increased reactive oxygen species (ROS), which is a major cause of neuronal damage and cell death. To test whether OPA1 mutant neurons have elevated ROS production, we used the neurogenic transcription factor Ngn2 to promote PSC to differentiate into induced neurons (iN). We then measured ROS levels in live iNs. Quantification of ROS signals showed that OPA1 mutant iNs produced significantly higher levels of ROS in neuron soma and in dendrites (Figure 10). Furthermore, OPA1 mutant iN cultures showed increased neuronal death.

[0092] To examine whether OPA1 mutations affect RGC physiological functions, we performed whole cell patch clamp recording assays using retinal organoid-derived RGCs. These function analyses discovered that OPA1 mutant RGCs have altered resting membrane potential, which are lower than normal control human RGCs (Figure 11). In addition, mutant RGCs showed reduced firing rates of action potentials and required higher input currents to elicit spikes (Figure 11). Therefore, OPA1 mutations also affect the physiological function and neuronal activity of human RGCs.

[0093] In summary', we have established PSC-based DOA disease models in vitro. The in vitro disease models have shown a) a reduction of OPA1 protein expression in mutant PSCs; b) altered mitochondrial morphology in RGCs; c) mitochondrial dysfunction with decreased cellular respiration and ATP production; d) elevated oxidative stress as indicated by ROS production and neuronal death; e) RGCs with aberrant resting membrane potential and neuronal activity. These human PSC-based DOA disease models can therefore serve as a platform to develop gene therapy vectors and evaluate the efficacy of OPA1 gene therapy.

[0094] Lentivirus-mediated OPA1 expression rescues DOA mitochondrial deficiencies:

[0095] Most DOA is due to OPA1 haploinsifficiency. To demonstrate that OPA1 supplemental gene therapy can rescue DOA disease symptoms, we have produced lenti viral vectors with the constitutive EFla promoter to express human OPA1 cDNA (Figure 12A). Transduction of heterozygous (liDOA, 2iD0A) and homozygous (D9) OPA1 mutant PSCs with LV-EFla-OEP led to elevation of OPA1 protein expression (Figure 12B, 12C). Using FACS purified LV-EFla-OEP transduced OPA1 mutant iPSCs, we have demonstrated that LV-mediated OPA1 supplemental gene therapy improved basal and maximum mitochondrial respiration and restored ATP production (Figure 12D). Furthermore, LV-EFla-OEP transduction of PSC-derived neurons led to a reduction of ROS, which is a leading cause for RGC damage (Figure 12E).

[0096] Together, these results provide evidence that OPA1 supplemental therapy can correct DOA disease symptoms and LV-EFla-OPAl is an efficacious candidate for 0PA1-D0A gene therapy.

[0097] AAV vector with neuronal specific promoter for OPA1 expression:

[0098] The FDA- approved ocular gene therapy (include Luxtuma for RPE65 deficiency ) has used AAV2 vectors with the strong constitutive CAG promoter, as did a therapy currently in clinical trial for the inherited optic neuropathy LHON. We have designed and produced AAV vectors expressing OPA1 cDNA from either the CAG promoter or the neuronal specific human synapsin promoter (hSyn)(Figure 13A). We are currently testing transduction efficiencies of the AAV vectors packaged with different capsids. Here, we demonstrate that that AAV encoding the hSyn promoter packaged with the 7m8 capsid is highly efficient in transducing PSC-derived human RGCs as indicated by the expression of the mCherry reporter (Figure 13B). Thus, AAV7m8-hSyn-OPAl is a strong candidate gene therapy vehicle for DO A.

[0099] Illustrative OPA isoforms useful in embodiments of the invention are shown immediately below.

[0100] OPA ISOFORM POLYNUCLEOTIDES OPA1 Isoform 1 AGGCTCTTGCGGAAGTCCATGCGCCATTGGGAGGGCCTCGGCCGCGGCTC TGTGCCCTTGCTGCTGAGGGCCACTTCCTGGGTCATTCCTGGACCGGGAGC CGGGCTGGGGCTCACACGGGGGCTCCCGCGTGGCCGTCTCGGCGCCTGCG TGACCTCCCCGCCGGCGGGATGTGGCGACTACGTCGGGCCGCTGTGGCCT GTGAGGTCTGCCAGTCTTTAGTGAAACACAGCTCTGGAATAAAAGGAAGT TTACCACTACAAAAACTACATCTGGTTTCACGAAGCATTTATCATTCACAT CATCCTACCTTAAAGCTTCAACGACCCCAATTAAGGACATCCTTTCAGCAG TTCTCTTCTCTGACAAACCTTCCTTTACGTAAACTGAAATTCTCTCCAATTA AATATGGCTACCAGCCTCGCAGGAATTTTTGGCCAGCAAGATTAGCTACG AGACTCTTAAAACTTCGCTATCTCATACTAGGATCGGCTGTTGGGGGTGGC TACACAGCCAAAAAGACTTTTGATCAGTGGAAAGATATGATACCGGACCT TAGTGAATATAAATGGATTGTGCCTGACATTGTGTGGGAAATTGATGAGT ATATCGATTTTGAGAAAATTAGAAAAGCCCTTCCTAGTTCAGAAGACCTT GTAAAGTTAGCACCAGACTTTGACAAGATTGTTGAAAGCCTTAGCTTATTG AAGGACTTTTTTACCTCAGGTTCTCCGGAAGAAACGGCGTTTAGAGCAAC AGATCGTGGATCTGAAAGTGACAAGCATTTTAGAAAGGTGTCAGACAAAG AGAAAATTGACCAACTTCAGGAAGAACTTCTGCACACTCAGTTGAAGTAT CAGAGAATCTTGGAACGATTAGAAAAGGAGAACAAAGAATTGAGAAAAT TAGTATTGCAGAAAGATGACAAAGGCATTCATCATAGAAAGCTTAAGAAA TCTTTGATTGACATGTATTCTGAAGTTCTTGATGTTCTCTCTGATTATGATG CCAGTTATAATACGCAAGATCATCTGCCACGGGTTGTTGTGGTTGGAGATC AGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGCCCAAGCTCGAATA TTCCCAAGAGGATCTGGGGAGATGATGACACGTTCTCCAGTTAAGGTGAC TCTGAGTGAAGGTCCTCACCATGTGGCCCTATTTAAAGATAGTTCTCGGGA GTTTGATCTTACCAAAGAAGAAGATCTTGCAGCATTAAGACATGAAATAG AACTTCGAATGAGGAAAAATGTGAAAGAAGGCTGTACCGTTAGCCCTGAG ACCATATCCTTAAATGTAAAAGGCCCTGGACTACAGAGGATGGTGCTTGT TGACTTACCAGGTGTGATTAATACTGTGACATCAGGCATGGCTCCTGACAC AAAGGAAACTATTTTCAGTATCAGCAAAGCTTACATGCAGAATCCTAATG CCATCATACTGTGTATTCAAGATGGATCTGTGGATGCTGAACGCAGTATTG TTACAGACTTGGTCAGTCAAATGGACCCTCATGGAAGGAGAACCATATTC GTTTTGACCAAAGTAGACCTGGCAGAGAAAAATGTAGCCAGTCCAAGCAG GATTCAGCAGATAATTGAAGGAAAGCTCTTCCCAATGAAAGCTTTAGGTT ATTTTGCTGTTGTAACAGGAAAAGGGAACAGCTCTGAAAGCATTGAAGCT ATAAGAGAATATGAAGAAGAGTTTTTTCAGAATTCAAAGCTCCTAAAGAC AAGCATGCTAAAGGCACACCAAGTGACTACAAGAAATTTAAGCCTTGCAG TATCAGACTGCTTTTGGAAAATGGTACGAGAGTCTGTTGAACAACAGGCT GATAGTTTCAAAGCAACACGTTTTAACCTTGAAACTGAATGGAAGAATAA CTATCCTCGCCTGCGGGAACTTGACCGGAATGAACTATTTGAAAAAGCTA AAAATGAAATCCTTGATGAAGTTATCAGTCTGAGCCAGGTTACACCAAAA CATTGGGAGGAAATCCTTCAACAATCTTTGTGGGAAAGAGTATCAACTCA TGTGATTGAAAACATCTACCTTCCAGCTGCGCAGACCATGAATTCAGGAA CTTTTAACACCACAGTGGATATCAAGCTTAAACAGTGGACTGATAAACAA CTTCCTAATAAAGCAGTAGAGGTTGCTTGGGAGACCCTACAAGAAGAATT TTCCCGCTTTATGACAGAACCGAAAGGGAAAGAGCATGATGACATATTTG ATAAACTTAAAGAGGCTGTTAAGGAAGAAAGTATTAAACGACACAAGTG GAATGACTTTGCGGAGGACAGCTTGAGGGTTATTCAACACAATGCTTTGG AAGACCGATCCATATCTGATAAACAGCAATGGGATGCAGCTATTTATTTT ATGGAAGAGGCTCTGCAGGCTCGTCTCAAGGATACTGAAAATGCAATTGA AAACATGGTGGGTCCAGACTGGAAAAAGAGGTGGTTATACTGGAAGAAT CGGACCCAAGAACAGTGTGTTCACAATGAAACCAAGAATGAATTGGAGA AGATGTTGAAATGTAATGAGGAGCACCCAGCTTATCTTGCAAGTGATGAA ATAACCACAGTCCGGAAGAACCTTGAATCCCGAGGAGTAGAAGTAGATCC AAGCTTGATTAAGGATACTTGGCATCAAGTTTATAGAAGACATTTTTTAAA AACAGCTCTAAACCATTGTAACCTTTGTCGAAGAGGTTTTTATTACTACCA AAGGCATTTTGTAGATTCTGAGTTGGAATGCAATGATGTGGTCTTGTTTTG GCGTATACAGCGCATGCTTGCTATCACCGCAAATACTTTAAGGCAACAAC TTACAAATACTGAAGTTAGGCGATTAGAGAAAAATGTTAAAGAGGTATTG GAAGATTTTGCTGAAGATGGTGAGAAGAAGATTAAATTGCTTACTGGTAA ACGCGTTCAACTGGCGGAAGACCTCAAGAAAGTTAGAGAAATTCAAGAA AAACTTGATGCTTTCATTGAAGCTCTTCATCAGGAGAAATAAATTAAAATC GTACTCATAATCAGCTCTGCATACATCTGAAGAACAAAAACATCAACGTC TTTTGTCCAGCCTCTTTTTCTTCTGCTGTTCCACCTTTCTAAACATACAATA AAGTCATGGGATAAAAATAATCGATGTATGTTACGGGCGCTTTAACCATC AGCTGCCTCTCGAATGGAAGAACAGTGGTAATGGATTAACATCCTATTTT GTTGTACTAAAGTGACAAATCGGAATAATATAATTGGTATGGCCATTAGG TTCAGTCCTTGAAGATAAGAAACTTGTTCTCTGTTTGTTGTCTTATTTGTGG TGGCACTCGTTTAATGGATTAACTGAGGTTGCTCAATGTTCAGTTTCTTTTC CAGAAATACAATGCTAGGTGTTTTGAAATAAAACTTATATAGCAATTGTTT AAAGTTATCAATTGTATATAAAATCACAGTAGCCTGCTAAATCATTGTATG TGTCTGTAGTATTCTATTCCCAGAAACTATTTGACCATGATAATTCAGTTT ATATTCACCACATGAAAGAAAAATGGGTAACAGAAGAACCCTTAAAACA GGTTAATTTGGATTGTAACGTTCAGTGAAAGAAATTTCAACCCTTCATAGC CAGCGAAGAAATTTGCCTTGGAAGCCAAGTCAGTACCAGCTTACCTATTT GATTCAGTTGCTGTTTTCTCACTCTCTATATCCATTTGAAATTGATTTATTT TAGATGTTGTATACTTACGTTAGGCTTTCTGTTAATAGTGGTTTTTCTCCTG TTGACAGAGCCACCGGATTATGACACAGGATGAGGAAGATTAAGGATAAT CAATTGACTAATTTCATTTAGAATATTATCAAACATTTCAACTAGGTATCA GAAAAAGGCTTTCTTTCATAAGACTATTTTAAATAGAAATTATTTCAACAA TTAAAGTAATGTTGACCATCCCCCTCTCAGCTGAATAAAGAAAAATTTAGT TCAATTTATTGCAATTTAATTACAATACTACCTTCACAACATTTTCATGTGT TTTAAATAAATATTTTTTAATTGGCTAAAGGACATTCAAGCAAAGAAATG CTTTCTTTACTTAAAATGTCTATCTCATTTGCTGCCTTTTCACTAAGCCTTT ACTTTGTTAATAAAAGTGTCCATTGTGTGATGTTTTTGATTTTACAGTTTGC TAAATCTTATTTTCTTGGAGTTGCTTTTTGGTAACAGCCCCATTGCTACTCC CCATTTTATTGTTTTACATCAATGCATGCTTCGTTGTGATCCCTCAAGATGT AACACTTGGTATGCTCGGTTGAGGATATGAAAAAATACTTCCGAAACCAG GAATTCAATGTATGTTTGTTTTATACTGTTTGATAAGAAAAGTAGGTCCAG CCTTAAGCAGCACAGATGCGCTGGTAGATGCATAGTCAGGAACTTTTTTTA TTTCTTTTAGGTCTAGGGACAGGAGTGAATAGAAAGGGAGGAGAGCTCTA TTATGTTCTATACACAGATTAGGAGATGACCTTACTGGGTACACCCCTCTA ACCAGTGCTTACAGGTTAATGCATGTTAATGAATATTTTTGCAGTTGTAAA GCATAACAATTACAACTACACATCTATTTCTAAAGAATAAAACAGGACCA TATTTATTTACTTCTGTCAACTATAGAAAGAAAGACCTTCAGCTGTATTTC CACAGATTTCTCCCAAGGAAAAGGCTAATATTAGTCACTACTGTTATCACA TCCCTTTGTATAAGTTTTAAAAAGAGATGGAGGGAGATCTTCATTTCTTTG AGGAGATCAGTATTGTAACGTATGTGAATAGATGATAACAATTAATATTA CTAAAAGTCCCACATGAGAGTCCTGACGCCCTCTCCATGCCCCACAGTAA TGTGGCTTCTTTCATGGGTTTTTTTTTCTTCTTTTTAGCTGATCTCATCCTAA GCATGCTTTATTTTTCCTTGAAAGCTAGGTATTTATCAACTGCAGATGTTA TTGAAAGAAAATAAAATTCAGTCTCAAGAGTAAACCCTGTGTCTTGTGTCT GTAGTTCAAAAGTCAGAAATGATTCTAATTTAAACAAAAAGATACTAAAT ATACAGAAGTTAAATTCGAACTAGCCACAGAATCATTTGTTTTTATGTCAG AATTTGCAAAGAGTGGAGTGGACAAAGCTCTGTATGGAAGACTGAACAAC TGTAAATAGATGATATCCAAACTTAATTTGGCTAGGACTTCAATTTTAAAA ATCAGTGTACCTAGGCAGTGCACAGCACGAAATAAGTGGCCCTTGCAGCT TCCCCGTTTAACCCACTGTGCTATAGTTGCGGGTGGAACAGTCAACCTTTC TAGTAGTTTATGATATTGCCCTCTTTGTATTCCCATTTTCTACAGTTTTTTC CGCAGACTTCTTTCTGCAAATTATTCAGCCTCCAAATGCAAATGAATGATA TAAAAATAAGTAGGGAACATGGCAGAGAGTGGTGCTTCCCAGCCTCACAA TGTGGGAATTTGACATAGGATGAGAGTCAGAGTATAGGTTTAAAAGATAA AATCTTTAGTTAATAATTTTGTATTTATTTATTCTAGATGTATGTATCTGAG GAAAGAAATCTGGTATTTTTGCTTTCCAATAAAGGGGATCAAAGTAATGG TTTTTCTCTCAGTTCTCTAAGCTGGTCTATGTTATAGCTCTAGCAGTATGGA AATGTGCTTTAAAATATGCTTACCTTTTGAATGATCATGGCTATATGTTGT TGAGATATTTGAAACTTACCTTGTTTTCACTTGTGCACTGTGAATGAACTT TGTATTATTTTTTTAAAACCTTCACATTACGTGTAGATATTATTGCAACTTA TATTTTGCCTGAGCTTGATCAAAGGTCATTTGTGTAGATGAGTAATTAAAA AATATTTAAATCACATTATAATTCTATTATTGGAGAGCATCTTTTAAATTTT TTTCTGTTTTAACGAGGGAAAGAGAAACCTGTATACCTAGGGTCATTATTT GACCCCATAGTATAACCAGATTCATGGTCTAACAAGCTCTCAGTGTGGCTT TTCTCTGAATGCTTGAATTTCACATGCCTTGCATTTCACAGTTGTACTCCAT GGTCAACCGGTGCTTTTTTTCACATCGTGGTACTTGTCAAAACATTTTGTT ATTTTCCTTGGTAAAATATATAAAAAAGGTTTTCTAATTTCA (SEQ ID NO: 1)

[0101] In OPA1 Isoform 1 embodiments of the invention, underlined portions can be cloned into viral vectors.

[0102] OPA1 Isoform 7 AGGCTCTTGCGGAAGTCCATGCGCCATTGGGAGGGCCTCGGCCGCGGCTC TGTGCCCTTGCTGCTGAGGGCCACTTCCTGGGTCATTCCTGGACCGGGAGC CGGGCTGGGGCTCACACGGGGGCTCCCGCGTGGCCGTCTCGGCGCCTGCG TGACCTCCCCGCCGGCGGGATGTGGCGACTACGTCGGGCCGCTGTGGCCT GTGAGGTCTGCCAGTCTTTAGTGAAACACAGCTCTGGAATAAAAGGAAGT TTACCACTACAAAAACTACATCTGGTTTCACGAAGCATTTATCATTCACAT CATCCTACCTTAAAGCTTCAACGACCCCAATTAAGGACATCCTTTCAGCAG TTCTCTTCTCTGACAAACCTTCCTTTACGTAAACTGAAATTCTCTCCAATTA AATATGGCTACCAGCCTCGCAGGAATTTTTGGCCAGCAAGATTAGCTACG AGACTCTTAAAACTTCGCTATCTCATACTAGGATCGGCTGTTGGGGGTGGC TACACAGCCAAAAAGACTTTTGATCAGTGGAAAGATATGATACCGGACCT TAGTGAATATAAATGGATTGTGCCTGACATTGTGTGGGAAATTGATGAGT ATATCGATTTTGAGAAAATTAGAAAAGCCCTTCCTAGTTCAGAAGACCTT GTAAAGTTAGCACCAGACTTTGACAAGATTGTTGAAAGCCTTAGCTTATTG AAGGACTTTTTTACCTCAGGTTCTCCGGAAGAAACGGCGTTTAGAGCAAC AGATCGTGGATCTGAAAGTGACAAGCATTTTAGAAAGGGTCTGCTTGGTG AGCTCATTCTCTTACAACAACAAATTCAAGAGCATGAAGAGGAAGCGCGC AGAGCCGCTGGCCAATATAGCACGAGCTATGCCCAACAGAAGCGCAAGG TGTCAGACAAAGAGAAAATTGACCAACTTCAGGAAGAACTTCTGCACACT CAGTTGAAGTATCAGAGAATCTTGGAACGATTAGAAAAGGAGAACAAAG AATTGAGAAAATTAGTATTGCAGAAAGATGACAAAGGCATTCATCATAGA AAGCTTAAGAAATCTTTGATTGACATGTATTCTGAAGTTCTTGATGTTCTC TCTGATTATGATGCCAGTTATAATACGCAAGATCATCTGCCACGGGTTGTT GTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGC CCAAGCTCGAATATTCCCAAGAGGATCTGGGGAGATGATGACACGTTCTC CAGTTAAGGTGACTCTGAGTGAAGGTCCTCACCATGTGGCCCTATTTAAA GATAGTTCTCGGGAGTTTGATCTTACCAAAGAAGAAGATCTTGCAGCATT AAGACATGAAATAGAACTTCGAATGAGGAAAAATGTGAAAGAAGGCTGT ACCGTTAGCCCTGAGACCATATCCTTAAATGTAAAAGGCCCTGGACTACA GAGGATGGTGCTTGTTGACTTACCAGGTGTGATTAATACTGTGACATCAG GCATGGCTCCTGACACAAAGGAAACTATTTTCAGTATCAGCAAAGCTTAC ATGCAGAATCCTAATGCCATCATACTGTGTATTCAAGATGGATCTGTGGAT GCTGAACGCAGTATTGTTACAGACTTGGTCAGTCAAATGGACCCTCATGG AAGGAGAACCATATTCGTTTTGACCAAAGTAGACCTGGCAGAGAAAAATG TAGCCAGTCCAAGCAGGATTCAGCAGATAATTGAAGGAAAGCTCTTCCCA ATGAAAGCTTTAGGTTATTTTGCTGTTGTAACAGGAAAAGGGAACAGCTC TGAAAGCATTGAAGCTATAAGAGAATATGAAGAAGAGTTTTTTCAGAATT CAAAGCTCCTAAAGACAAGCATGCTAAAGGCACACCAAGTGACTACAAG AAATTTAAGCCTTGCAGTATCAGACTGCTTTTGGAAAATGGTACGAGAGT CTGTTGAACAACAGGCTGATAGTTTCAAAGCAACACGTTTTAACCTTGAA ACTGAATGGAAGAATAACTATCCTCGCCTGCGGGAACTTGACCGGAATGA ACTATTTGAAAAAGCTAAAAATGAAATCCTTGATGAAGTTATCAGTCTGA GCCAGGTTACACCAAAACATTGGGAGGAAATCCTTCAACAATCTTTGTGG GAAAGAGTATCAACTCATGTGATTGAAAACATCTACCTTCCAGCTGCGCA GACCATGAATTCAGGAACTTTTAACACCACAGTGGATATCAAGCTTAAAC AGTGGACTGATAAACAACTTCCTAATAAAGCAGTAGAGGTTGCTTGGGAG ACCCTACAAGAAGAATTTTCCCGCTTTATGACAGAACCGAAAGGGAAAGA GCATGATGACATATTTGATAAACTTAAAGAGGCTGTTAAGGAAGAAAGTA TTAAACGACACAAGTGGAATGACTTTGCGGAGGACAGCTTGAGGGTTATT CAACACAATGCTTTGGAAGACCGATCCATATCTGATAAACAGCAATGGGA TGCAGCTATTTATTTTATGGAAGAGGCTCTGCAGGCTCGTCTCAAGGATAC TGAAAATGCAATTGAAAACATGGTGGGTCCAGACTGGAAAAAGAGGTGG TTATACTGGAAGAATCGGACCCAAGAACAGTGTGTTCACAATGAAACCAA GAATGAATTGGAGAAGATGTTGAAATGTAATGAGGAGCACCCAGCTTATC TTGCAAGTGATGAAATAACCACAGTCCGGAAGAACCTTGAATCCCGAGGA GTAGAAGTAGATCCAAGCTTGATTAAGGATACTTGGCATCAAGTTTATAG AGTATGTATCTAATTTTTATCTTTAACACAAAAAACGAGGCCATTCTTTATAGATCACGAATTTTGCTTAGAACGCTTTTGTGGATACTGGACAAGAATGGATGTGGTCTTGTTTTGGCGTATACAGCGCATGCTTGCTATCACCGCAAATA CTTTAAGGCAACAACTTACAAATACTGAAGTTAGGCGATTAGAGAAAAAT GTTAAAGAGGTATTGGAAGATTTTGCTGAAGATGGTGAGAAGAAGATTAA ATTGCTTACTGGTAAACGCGTTCAACTGGCGGAAGACCTCAAGAAAGTTA GAGAAATTCAAGAAAAACTTGATGCTTTCATTGAAGCTCTTCATCAGGAG AAATAAATTAAAATCGTACTCATAATCAGCTCTGCATACATCTGAAGAAC AAAAACATCAACGTCTTTTGTCCAGCCTCTTTTTCTTCTGCTGTTCCACCTT TCTAAACATACAATAAAGTCATGGGATAAAAATAATCGATGTATGTTACG GGCGCTTTAACCATCAGCTGCCTCTCGAATGGAAGAACAGTGGTAATGGA TTAACATCCTATTTTGTTGTACTAAAGTGACAAATCGGAATAATATAATTG GTATGGCCATTAGGTTCAGTCCTTGAAGATAAGAAACTTGTTCTCTGTTTG TTGTCTTATTTGTGGTGGCACTCGTTTAATGGATTAACTGAGGTTGCTCAA TGTTCAGTTTCTTTTCCAGAAATACAATGCTAGGTGTTTTGAAATAAAACT TATATAGCAATTGTTTAAAGTTATCAATTGTATATAAAATCACAGTAGCCT GCTAAATCATTGTATGTGTCTGTAGTATTCTATTCCCAGAAACTATTTGAC CATGATAATTCAGTTTATATTCACCACATGAAAGAAAAATGGGTAACAGA AGAACCCTTAAAACAGGTTAATTTGGATTGTAACGTTCAGTGAAAGAAAT TTCAACCCTTCATAGCCAGCGAAGAAATTTGCCTTGGAAGCCAAGTCAGT ACCAGCTTACCTATTTGATTCAGTTGCTGTTTTCTCACTCTCTATATCCATT TGAAATTGATTTATTTTAGATGTTGTATACTTACGTTAGGCTTTCTGTTAAT AGTGGTTTTTCTCCTGTTGACAGAGCCACCGGATTATGACACAGGATGAG GAAGATTAAGGATAATCAATTGACTAATTTCATTTAGAATATTATCAAAC ATTTCAACTAGGTATCAGAAAAAGGCTTTCTTTCATAAGACTATTTTAAAT AGAAATTATTTCAACAATTAAAGTAATGTTGACCATCCCCCTCTCAGCTGA ATAAAGAAAAATTTAGTTCAATTTATTGCAATTTAATTACAATACTACCTT CACAACATTTTCATGTGTTTTAAATAAATATTTTTTAATTGGCTAAAGGAC ATTCAAGCAAAGAAATGCTTTCTTTACTTAAAATGTCTATCTCATTTGCTG CCTTTTCACTAAGCCTTTACTTTGTTAATAAAAGTGTCCATTGTGTGATGTT TTTGATTTTACAGTTTGCTAAATCTTATTTTCTTGGAGTTGCTTTTTGGTAA CAGCCCCATTGCTACTCCCCATTTTATTGTTTTACATCAATGCATGCTTCGT TGTGATCCCTCAAGATGTAACACTTGGTATGCTCGGTTGAGGATATGAAA AAATACTTCCGAAACCAGGAATTCAATGTATGTTTGTTTTATACTGTTTGA TAAGAAAAGTAGGTCCAGCCTTAAGCAGCACAGATGCGCTGGTAGATGCA TAGTCAGGAACTTTTTTTATTTCTTTTAGGTCTAGGGACAGGAGTGAATAG AAAGGGAGGAGAGCTCTATTATGTTCTATACACAGATTAGGAGATGACCT TACTGGGTACACCCCTCTAACCAGTGCTTACAGGTTAATGCATGTTAATGA ATATTTTTGCAGTTGTAAAGCATAACAATTACAACTACACATCTATTTCTA AAGAATAAAACAGGACCATATTTATTTACTTCTGTCAACTATAGAAAGAA AGACCTTCAGCTGTATTTCCACAGATTTCTCCCAAGGAAAAGGCTAATATT AGTCACTACTGTTATCACATCCCTTTGTATAAGTTTTAAAAAGAGATGGAG GGAGATCTTCATTTCTTTGAGGAGATCAGTATTGTAACGTATGTGAATAGA TGATAACAATTAATATTACTAAAAGTCCCACATGAGAGTCCTGACGCCCT CTCCATGCCCCACAGTAATGTGGCTTCTTTCATGGGTTTTTTTTTCTTCTTT TTAGCTGATCTCATCCTAAGCATGCTTTATTTTTCCTTGAAAGCTAGGTATT TATCAACTGCAGATGTTATTGAAAGAAAATAAAATTCAGTCTCAAGAGTA AACCCTGTGTCTTGTGTCTGTAGTTCAAAAGTCAGAAATGATTCTAATTTA AACAAAAAGATACTAAATATACAGAAGTTAAATTCGAACTAGCCACAGA ATCATTTGTTTTTATGTCAGAATTTGCAAAGAGTGGAGTGGACAAAGCTCT GTATGGAAGACTGAACAACTGTAAATAGATGATATCCAAACTTAATTTGG CTAGGACTTCAATTTTAAAAATCAGTGTACCTAGGCAGTGCACAGCACGA AATAAGTGGCCCTTGCAGCTTCCCCGTTTAACCCACTGTGCTATAGTTGCG GGTGGAACAGTCAACCTTTCTAGTAGTTTATGATATTGCCCTCTTTGTATT CCCATTTTCTACAGTTTTTTCCGCAGACTTCTTTCTGCAAATTATTCAGCCT CCAAATGCAAATGAATGATATAAAAATAAGTAGGGAACATGGCAGAGAG TGGTGCTTCCCAGCCTCACAATGTGGGAATTTGACATAGGATGAGAGTCA GAGTATAGGTTTAAAAGATAAAATCTTTAGTTAATAATTTTGTATTTATTT ATTCTAGATGTATGTATCTGAGGAAAGAAATCTGGTATTTTTGCTTTCCAA TAAAGGGGATCAAAGTAATGGTTTTTCTCTCAGTTCTCTAAGCTGGTCTAT GTTATAGCTCTAGCAGTATGGAAATGTGCTTTAAAATATGCTTACCTTTTG AATGATCATGGCTATATGTTGTTGAGATATTTGAAACTTACCTTGTTTTCA CTTGTGCACTGTGAATGAACTTTGTATTATTTTTTTAAAACCTTCACATTAC GTGTAGATATTATTGCAACTTATATTTTGCCTGAGCTTGATCAAAGGTCAT TTGTGTAGATGAGTAATTAAAAAATATTTAAATCACATTATAATTCTATTA TTGGAGAGCATCTTTTAAATTTTTTTCTGTTTTAACGAGGGAAAGAGAAAC CTGTATACCTAGGGTCATTATTTGACCCCATAGTATAACCAGATTCATGGT CTAACAAGCTCTCAGTGTGGCTTTTCTCTGAATGCTTGAATTTCACATGCC TTGCATTTCACAGTTGTACTCCATGGTCAACCGGTGCTTTTTTTCACATCGT GGTACTTGTCAAAACATTTTGTTATTTTCCTTGGTAAAATATATAAAAAAG GTTTTCTAATTTCA (SEQ ID NO: 2)

[0103] In illustrative OPA1 Isoform 7 embodiments of the invention, the underlined portions of the above sequences can be cloned into viral vectors.

[0104] Table 1. Summary of pluripotent stem cell lines with OPA1 mutations

[0105] >>

[0106] > "

[0107] >

[0108]

[0109]

[0110] The base positions and amino acid positions refer to reference transcript

[0111] NM 130837.3 and protein sequence NP 570850.2, respectively. + / +: OPA1 WT; + / -: OP Al heterozygous mutant; OPA1 homozygous mutant.

[0112] #ESC lines derived from UCLA1 also contain its polymorphic OPA1 gene changes at positions 473 and 2274 in exons 4 and 21, respectively. REFERENCES

[0113] 1. D. Conant et al., Inference of CRISPR Edits from Sanger Trace Data. CRISPR J 5, 123-130 (2022).

[0114] 2. N. M. loannidis et al., REVEL: An Ensemble Method for Predicting the Pathogenicity of Rare Missense Variants. The American Journal of Human Genetics 99, 877-885 (2016).

[0115] 3. K A. Pohl et al., Establishing induced pluripotent stem cell lines from two dominant optic atrophy patients with distinct OP Al mutations and clinical pathologies. Front Genet 14, 1251216 (2023).

[0116] 4. W. C. Skames, E. Pellegrino, J. A. McDonough, Improving homology- directed repair efficiency in human stem cells. Methods 164-165, 18-28 (2019).

[0117] 5. J. Toombs et al., Generation of twenty four induced pluripotent stem cell lines from twenty four members of the Lothian Birth Cohort 1936. Stem Cell Res 46, 101851 (2020).

[0118] 6. A. S. Divakaruni, A. Paradyse, D. A. Ferrick, A. N. Murphy, M. Jastroch, "Chapter Sixteen - Analysis and Interpretation of Microplate-Based Oxygen Consumption and pH Data" in Methods in Enzymology. A. N. Murphy, D. C. Chan, Eds. (Academic Press, 2014), vol. 547, pp. 309-354.

[0119] 7. A. S. Divakaruni et al., Inhibition of the mitochondrial pyruvate carrier protects from excitotoxic neuronal death. Journal of Cell Biology 216, 1091- 1105 (2017).

[0120] 8. C. Delettre et al., Mutation spectrum and splicing variants in the OPA1 gene.

[0121] Hum Genet 109, 584-591 (2001).

[0122] 9. P. Yu-Wai-Man el al., Multi-system neurological disease is common in patients with OPA1 mutations. Brain 133, 771-786 (2010).

[0123] 10. D. L. Thiselton et al., A comprehensive survey of mutations in the OP Al gene in patients with autosomal dominant optic atrophy. Invest Ophthalmol Vis Sci 43, 1715-1724 (2002). 11. P. Yu-Wai-Man et al., The prevalence and natural history of dominant optic atrophy due to 0PA1 mutations. Ophthalmology 117, 1538-1546, 1546 el531 (2010).

[0124] 12. B. Cartes-Saavedra et al., OPA1 disease-causing mutants have domainspecific effects on mitochondrial ultrastructure and fusion. Proc Natl Acad Sci USA 120, e2207471120 (2023).

[0125] 13. V. R. Akepati et al., Characterization of OPA1 isoforms isolated from mouse tissues. J Neurochem 106, 372-383 (2008).

[0126] 14. Z. Song, H. Chen, M. Fiket, C. Alexander, D. C. Chan, OPA1 processing controls mitochondrial fusion and is regulated by mRNA splicing, membrane potential, and YmelL. J Cell Biol 178, 749-755 (2007).

[0127] 15. A. Olichon et al., Loss of OPA1 perturbates the mitochondrial inner membrane structure and integrity, leading to cytochrome c release and apoptosis. J Biol Chem 278, 7743-7746 (2003).

[0128] 16. W. Gu et al., Glycolytic Metabolism Plays a Functional Role in Regulating Human Pluripotent Stem Cell State. Cell Stem Cell 19, 476-490 (2016).

[0129] 17. P. E. Sladen et al.. CRISPR-Cas9 correction of OPA1 c,1334G>A: p.R445H restores mitochondrial homeostasis in dominant optic atrophy patient-derived iPSCs. Mol Ther Nucleic Acids 26, 432-443 (2021).

[0130] 18. J. Chen, H. Riazifar, M. X. Guan, T. Huang, Modeling autosomal dominant optic atrophy using induced pluripotent stem cells and identifying potential therapeutic targets. Stem Cell Res Ther 7, 2 (2016).

[0131] PUBLICATIONS

[0132] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. Publications cited herein are cited for their disclosure prior to the filing date of the present application. Nothing here is to be construed as an admission that the inventors are not entitled to antedate the publications by virtue of an earlier priority date or prior date of invention. Further, the actual publication dates may be different from those shown and require independent verification. The following references include descriptions of methods and materials in this field of technology.

[0133] CONCLUSION

[0134] This concludes the description of the illustrative embodiments of the present invention. The foregoing description of one or more embodiments of the invention has been presented for the purposes of illustration and description. It is not intended to be exhaustive or to limit the invention to the precise form disclosed. Many modifications and variations are possible in light of the above teaching.

Claims

CLAIMS:

1. A composition of mater comprising a mammalian expression vector, wherein a polynucleotide disposed in the vector encodes a OPA1 isoforml polypeptide (SEQ ID NO: 1) and / or encodes a OPA1 isoform 7 polypeptide (SEQ ID NO: 2).

2. The composition of claim 1, wherein the vector comprises an adeno associated viral (AAV) vector.

3. The composition of claim 2, wherein the adeno associated viral vector comprises a AAV2. AAV7m8, AAV8 or AAV5 viral vector.

4. The composition of claim 1, wherein the vector comprises a lentiviral vector.

5. The composition of claim 3, wherein the vector comprises a CAG promoter and / or a neuronal specific human synapsin promoter.

6. The composition of claim 1, wherein the vector is disposed in a human retinal ganglion cell.

7. The composition of claim 5, wherein the vector is disposed in a human retinal ganglion cell.

8. A method of transducing a human retinal ganglion cell, the method comprising combining the vector of claim 1 with the retinal ganglion cell under conditions selected to allow the vector to deliver the polynucleotide into the retinal ganglion cell such that the retinal ganglion cell is transduced with the vector.

9. The method of claim 8, wherein the vector comprises an adeno associated viral (AAV) vector.

10. The method of claim 9. wherein the vector comprises a CAG promoter and / or a neuronal specific human synapsin promoter.

11. The method of claim 8, wherein the vector comprises a lentiviral vector.

12. The method of claim 11, wherein the vector comprises a CAG promoter and / or a neuronal specific human synapsin promoter.

13. The method of claim 8. wherein the retinal ganglion cell is transduced in vitro.

14. The method of claim 8, wherein the retinal ganglion cell is transduced in vivo.

15. The method of claim 8, wherein the retinal ganglion cell is selected to exhibit a mutation found in an individual suffering from a dominant optic atrophy.

Images