Combination treatments using epigenetic inhibition and syngri-mediated frataxin expression
Combining SynTEF with an HDAC inhibitor addresses the challenge of dysregulated FXN expression in FRDA/FA by effectively restoring FXN levels, offering treatment options for these disorders.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- ST JUDE CHILDRENS RES HOSPITAL INC
- Filing Date
- 2025-11-12
- Publication Date
- 2026-05-21
AI Technical Summary
Current treatments for disorders associated with dysregulated frataxin (FXN) expression, such as Friedreich's ataxia (FRDA/FA), are limited, and there is a need to develop methods that restore or partially restore FXN levels to treat and/or prevent these disorders.
The use of synthetic transcription elongation factor (SynTEF) in combination with an epigenetic inhibitor, such as a histone deacetylase (HDAC) inhibitor, to regulate FXN expression and treat disorders like FRDA/FA.
The combination of SynTEF and HDAC inhibitor effectively restores FXN levels, providing therapeutic benefits for FRDA/FA and other GAA-repeat based diseases.
Smart Images

Figure US2025055125_21052026_PF_FP_ABST
Abstract
Description
Attorney Docket No. 19116.0064P1COMBINATION TREATMENTS USING EPIGENETIC INHIBITION AND SYNGR1-MEDIATED FRATAXIN EXPRESSIONCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This Application claims the benefit of U. S. Application No. 63 / 719,550, filed on November 12, 2024, and U. S. Application No. 63 / 772,216, filed on March 14, 2025, the contents of which are incorporated herein by reference in their entireties.REFERENCE TO SEQUENCE LISTING
[0002] This Application includes a Sequence Listing filed electronically as an XML file named “19116.0064Pl.xml,'’ created on November 11, 2025, with a size of 32,378 bytes. The Sequence Listing is incorporated herein by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0003] This invention was made with government support under grant number NS 108376 awarded by the National Institutes of Health and grant number 2017079 awarded by the National Science Foundation. The government has certain rights in the invention.BACKGROUND
[0004] More than half of the human genome is composed of repetitive sequence elements that are ensconced in repressive heterochromatin (Lander, E. S. et al. (2001) Nature 409, 860-921; Gershman, A. et al. (2022) Science 376. eabj5089). A signature mark of repressive heterochromatin at repeat elements is the trimethylated lysine 9 of histone 3 (H3K9me3)(Allis, C. D. & Jenuwein, T. (2016) Nat Rev Genet 17, 487-500; Allshire, R. C. & Madhani, H. D. (2018) Nat Rev Mol Cell Biol 19, 229-244). In addition to constitutive heterochromatin at peri centromeric repeats, H3K9me3 marks are also found at genes that are repressed in specific cell lineages (Nicetto, D. et al. (2019) Science 363, 294-297;Matsumura, Y. et al. (2015) Molecular Cell 60, 584-596). This latter form of facultative heterochromatin occurs at genes that define fate and function of distinct cell types. Consistent with their critical roles, aberrant placement or erasure of heterochromatin marks is linked to multiple human diseases (Allis, C. D. & Jenuwein, T. (2016) Nat Rev Genet 17, 487-500).
[0005] In Friedreich s ataxia (FRDA / FA), a terminal neurodegenerative disease, expressionAttorney Docket No. 19116.0064P1 of frataxin (FXN) is downregulated by expansion of GAA trinucleotide repeats within the first intron of the FXN gene (Campuzano, V. etal. (1996) Science 271, 1423-1427). This expansion is accompanied by increased deposition of H3K9me3 (Saveliev, A., et al. (2003) Nature 422, 909-913; Soragni, E. et al. (2014) Ann Neurol 76, 489-508; Kim, E., et al. (2011) Nucleic Acids Res 39, 8366-8377; Herman, D. et al. (2006) Nature chemical biology 2, 551-558; Punga, T. & Buhler, M. (2010) EMBO Mol Med 2, 120-129; Yandim, C„ Natisvih, T. & Festenstein, R. (2013) Journal of neurochemistry 126 Suppl 1, 21-42). The extent of GAA repeat expansions correlates with H3K9me3 enrichment, suggesting a functional role of this signature repressive mark in silencing FXN expression (Punga, T. & Buhler, M. (2010) EMBO Mol Med 2. 120-129). Placing expanded GAA repeats at different genomic loci (Saveliev, A., et al. (2003) Nature 422, 909-913) or downstream of heterologous gene promoters (Kim, E., et al. (2011) Nucleic Acids Res 39, 8366-8377) suffices to drive a concomitant increase in H3K9me3 marks at the new site. Furthermore, augmenting the levels of active acetyl marks with histone deacetylase (HD AC) inhibitors alleviates the repressive impact of H3K9me3 on FXN in patient-derived cells and in animal models of the disease (Soragni, E. et al. (2014) Ann Neurol 76, 489-508; Natisvili, T. & Festenstein, R. (2013) Journal of neurochemistry 126 Suppl 1, 21-42; Sherzai, M. et al. (2020) Front Genet 11, 584; Rai, M. et al. (2010) PloS one 5, e8825).
[0006] Currently, there are limited treatment methods for disorders associated with dysregulated FXN espression such as FRDA / FA and so expanded options are needed.Therefore, there is a need to develop methods that restore or partially restore FXN levels to treat and / or prevent FXN-mediated disorders.SUMMARY
[0007] In accordance with the purpose(s) of the invention, as embodied and broadly described herein, the invention, in one aspect, relates to relates to pharmaceutical compositions comprising a synthetic transcription elongation factor (SynTEF) and an epigenetic inhibitor (e.g., a histone deacetylase (HD AC) inhibitor). As detailed herein, the disclosed compositions and combinations can be used to regulate target genes including, but not limited to, FXN and FGF14b. In this way, the disclosed compositions and combinations can be used to treat Friedreich’s ataxia (FRDA / FA), SCA27b, and other GAA-repeat based diseases.
[0008] Thus, in one aspect, disclosed are methods of treating a disorder associated withAttorney Docket No. 19116.0064P1 dysregulation of frataxin (FXN) expression in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic transcription elongation factor (SynTEF) and an epigenetic inhibitor.
[0009] Also disclosed are methods of treating a disorder associated with dysregulation of frataxin (FXN) expression in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic transcription elongation factor (SynTEF) and a histone deacetylase (HDAC) inhibitor.
[0010] Also disclosed are pharmaceutical compositions comprising an effective amount of a synthetic transcription elongation factor (SynTEF), an epigenetic inhibitor, and a pharmaceutically acceptable earner.
[0011] Also disclosed are pharmaceutical compositions comprising an effective amount of a synthetic transcription elongation factor (SynTEF), a histone deacetylase (HDAC) inhibitor, and a pharmaceutically acceptable carrier.
[0012] Also disclosed are kits comprising a synthetic transcription elongation factor (SynTEF) and an epigenetic inhibitor, and one or more selected from: (a) at least one agent know n to treat a disorder associated with dysregulation of frataxin (FXN) expression; (b) instructions for administering the SynTEF in connection with treating a disorder associated with dysregulation of frataxin (FXN) expression; (c) instructions for administering the epigenetic inhibitor in connection with treating a disorder associated with dysregulation of FXN expression; and instructions for treating a disorder associated with dysregulation of FXN expression.
[0013] Also disclosed are kits comprising a synthetic transcription elongation factor (SynTEF) and a histone deacetylase (HDAC) inhibitor, and one or more selected from: (a) at least one agent known to treat a disorder associated with dysregulation of frataxin (FXN) expression; (b) instructions for administering the SynTEF in connection with treating a disorder associated with dysregulation of frataxin (FXN) expression; (c) instructions for administering the HDAC inhibitor in connection with treating a disorder associated with dysregulation of FXN expression; and instructions for treating a disorder associated with dysregulation of FXN expression.
[0014] While aspects of the present invention can be described and claimed in a particular statutory class, such as the system statutory class, this is for convenience only and one of skill in the art will understand that each aspect of the present invention can be described and claimed in any statutory class. Unless otherwise expressly stated, it is in no way intendedAttorney Docket No. 19116.0064P1 that any method or aspect set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not specifically state in the claims or descriptions that the steps are to be limited to a specific order, it is no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including matters of logic with respect to arrangement of steps or operational flow, plain meaning derived from grammatical organization or punctuation, or the number or type of aspects described in the specification.BRIEF DESCRIPTION OF THE DRAWINGS
[0015] The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects and together with the description serve to explain the principles of the invention.
[0016] FIG. 1A, FIG. IB, and FIG. 2A-H show representative data illustrating repressive chromatin marks and HP1 paralogs increase in response to FXN gene expression.
[0017] FIG. 3A-G show representative data illustrating FXN stimulation in diseased cells mirrors healthy cells.
[0018] FIG. 4A-G show representative data illustrating that SynGRl (SynTEFl) activates FXN transcription across the cell population.
[0019] FIG. 5A-P show representative data illustrating that BRD4 can access HP1 condensates.
[0020] FIG. 6A-M show representative data illustrating synergy in FXN expression.
[0021] FIG. 7A-C show representative data illustrating synergy of HD AC inhibitors and SynTEF.
[0022] FIG. 8A and FIG.8B show representative schematic and additional data illustrating synergy of HD AC inhibitors and SynTEFs.
[0023] FIG. 9A-J show representative data illustrating epigenetic silencing caused by (GAA)n repeat expansion at FXN remains after SynTEFl mediated transcriptional activation.
[0024] FIG. 10A-G show representative data illustrating velocity' plots are a method to visualize the change in ChlP-seq peak distribution.
[0025] FIG. 11A-D show representative data of labeled H3 modified peptide (SEQ ID NO: 1) and protein generation.
[0026] FIG. 12A-C show representative data illustrating HP1 binding of modified H3 tail peptides by fluorescence polarization.Attorney Docket No. 19116.0064P1
[0027] FIG. 13A-G show representative data illustrating SynTEFl stimulates Frataxin expression in a population of cells.
[0028] FIG. 14A-F show representative data illustrating SynGRl treatment in FRDA and WT lymphocyte cells.
[0029] FIG. 15A-E show representative data illustrating BRD4 and HP la co-occurrence in cells.
[0030] FIG. 16A-E show representative data illustrating BRD4 is recruited to HP la phase separated condensates by SynTEFl.
[0031] FIG. 17A-D show representative data leading to the identification of epigenetic modulators of SynGRl.
[0032] FIG. 18A-C show representative data illustrating the role of PRC2 AND HUSH complexes on FXN gene transcription revealed by siRNA knockdown.
[0033] FIG. 19 show s representative data illustrating repeated FXN induction upon successive SynGRl treatments.
[0034] FIG. 20A-D show representative data illustrating a ChlP-qPCR analysis of H3K9me3 levels in three patient-derived cell lines. Cells were cultured and treated with 1 pM SynGRl for 24 hours, following the same protocol as GM15850 cells, as described in the methods section. H3K9me3 enrichment was quantified using qPCR.
[0035] FIG. 21A-H show representative data illustrating SynTEFl and 109 work synergistically to activate FXN expression.
[0036] While aspects of the present invention can be described and claimed in a particular statutory class, such as the system statutory class, this is for convenience only and one of skill in the art will understand that each aspect of the present invention can be described and claimed in any statutory class. Unless otherwise expressly stated, it is in no way intended that any method or aspect set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not specifically state in the claims or descriptions that the steps are to be limited to a specific order, it is no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including matters of logic with respect to arrangement of steps or operational flow, plain meaning derived from grammatical organization or punctuation, or the number or type of aspects described in the specification.Attorney Docket No. 19116.0064P1DETAILED DESCRIPTION
[0037] The present invention can be understood more readily by reference to the following detailed description of the invention and the Examples included therein.
[0038] Before the present compounds, compositions, articles, systems, devices, and / or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, example methods and materials are now described.
[0039] While aspects of the present invention can be described and claimed in a particular statutory class, such as the system statutory class, this is for convenience only and one of skill in the art will understand that each aspect of the present invention can be described and claimed in any statutory class. Unless otherwise expressly stated, it is in no way intended that any method or aspect set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not specifically state in the claims or descriptions that the steps are to be limited to a specific order, it is no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including matters of logic with respect to arrangement of steps or operational flow, plain meaning derived from grammatical organization or punctuation, or the number or type of aspects described in the specification.
[0040] Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided herein may be different from the actual publication dates, which can require independent confirmation.Attorney Docket No. 19116.0064P1 A. DEFINITIONS
[0041] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a functional group.” “an alkyl.” or “a residue” includes mixtures of two or more such functional groups, alkyls, or residues, and the like.
[0042] As used in the specification and in the claims, the term “comprising” can include the aspects “consisting of” and “consisting essentially of.”
[0043] Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
[0044] As used herein, the terms “about” and “at or about” mean that the amount or value in question can be the value designated some other value approximately or about the same. It is generally understood, as used herein, that it is the nominal value indicated ±10% variation unless otherwise indicated or inferred. The term is intended to convey that similar values promote equivalent results or effects recited in the claims. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but can be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off. measurement error and the like, and other factors know n to those of skill in the art. In general, an amount, size, formulation, parameter or other quantity or characteristic is “about” or “approximate” whether or not expressly stated to be such. It is understood that where “about” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.
[0045] References in the specification and concluding claims to parts by weight of a particular element or component in a composition denotes the weight relationship between the element or component and any other elements or components in the composition or articleAttorney Docket No. 19116.0064P1 for which a part by weight is expressed. Thus, in a compound containing 2 parts by weight of component X and 5 parts by weight component Y, X and Y are present at a weight ratio of 2:5, and are present in such ratio regardless of whether additional components are contained in the compound.
[0046] A weight percent (wt. %) of a component, unless specifically stated to the contrary, is based on the total weight of the formulation or composition in which the component is included.
[0047] As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
[0048] As used herein, the term “subject” can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. Thus, the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig, or rodent. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered. In one aspect, the subject is a mammal. A patient refers to a subject afflicted with a disease or disorder. The term “patient” includes human and veterinary subjects.
[0049] As used herein, the term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder. In various aspects, the term covers any treatment of a subject, including a mammal (e.g, a human), and includes: (i) preventing the disease from occurring in a subject that can be predisposed to the disease but has not yet been diagnosed as having it: (ii) inhibiting the disease, i.e.. arresting its development; or (iii) relieving the disease, i.e., causing regression of the disease. In one aspect, the subject is aAttorney Docket No. 19116.0064P1 mammal such as a primate, and, in a further aspect, the subject is a human. The term “subject” also includes domesticated animals (e.g., cats, dogs, etc.), livestock (e.g, cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e g, mouse, rabbit, rat, guinea pig, fruit fly, etc.).
[0050] As used herein, the term “prevent” or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit or prevent are used herein, unless specifically indicated otherwise, the use of the other tw o words is also expressly disclosed.
[0051] As used herein, the term “diagnosed” means having been subjected to a physical examination by a person of skill, for example, a physician, and found to have a condition that can be diagnosed or treated by the compounds, compositions, or methods disclosed herein.
[0052] As used herein, the terms “administering” and “administration” refer to any method of providing a pharmaceutical preparation to a subject. Such methods are well known to those skilled in the art and include, but are not limited to, oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, intravaginal administration, ophthalmic administration, intraaural administration, intracerebral administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable such as intravenous administration, intra-arterial administration, intramuscular administration, and subcutaneous administration. Administration can be continuous or intermittent. In various aspects, a preparation can be administered therapeutically; that is, administered to treat an existing disease or condition. In further various aspects, a preparation can be administered prophylactically; that is, administered for prevention of a disease or condition.
[0053] As used herein, the terms “effective amount” and “amount effective” refer to an amount that is sufficient to achieve the desired result or to have an effect on an undesired condition. For example, a “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms, but is generally insufficient to cause adverse side effects. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity' of the disorder; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination orAttorney Docket No. 19116.0064P1 coincidental with the specific compound employed and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of a compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, single dose compositions can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. In further various aspects, a preparation can be administered in a “prophylactically effective amount”; that is, an amount effective for prevention of a disease or condition.
[0054] As used herein, “dosage form” means a pharmacologically active material in a medium, carrier, vehicle, or device suitable for administration to a subject. A dosage form can comprise a disclosed compound, a product of a disclosed method of making, or a salt, solvate, or polymorph thereof, in combination with a pharmaceutically acceptable excipient, such as a preservative, buffer, saline, or phosphate buffered saline. Dosage forms can be made using conventional pharmaceutical manufacturing and compounding techniques.Dosage forms can comprise inorganic or organic buffers (e.g., sodium or potassium salts of phosphate, carbonate, acetate, or citrate) and pH adjustment agents (e.g., hydrochloric acid, sodium or potassium hydroxide, salts of citrate or acetate, amino acids and their salts) antioxidants (e.g., ascorbic acid, alpha-tocopherol), surfactants (e.g., polysorbate 20, polysorbate 80, polyoxyethylene9-10 nonyl phenol, sodium desoxycholate), solution and / or cryo / lyo stabilizers (e.g., sucrose, lactose, mannitol, trehalose), osmotic adjustment agents (e.g., salts or sugars), antibacterial agents (e.g., benzoic acid, phenol, gentamicin), antifoaming agents (e.g., polydimethylsilozone), preservatives (e.g., thimerosal, 2-phenoxyethanol, EDTA), polymeric stabilizers and viscosity-adjustment agents (e.g., polyvinylpyrrolidone, poloxamer 488, carboxymethylcellulose) and co-solvents (e.g., glycerol, polyethylene glycol, ethanol). A dosage form formulated for injectable use can have a disclosed compound, a product of a disclosed method of making, or a salt, solvate, or polymorph thereof, suspended in sterile saline solution for injection together with a preservative.
[0055] As used herein, “kit” means a collection of at least two components constituting theAttorney Docket No. 19116.0064P1 kit. Together, the components constitute a functional unit for a given purpose. Individual member components may be physically packaged together or separately. For example, a kit comprising an instruction for using the kit may or may not physically include the instruction with other individual member components. Instead, the instruction can be supplied as a separate member component, either in a paper form or an electronic form which may be supplied on computer readable memory device or downloaded from an internet website, or as recorded presentation.
[0056] As used herein, “instruction(s)” means documents describing relevant materials or methodologies pertaining to a kit. These materials may include any combination of the following: background information, list of components and their availability information (purchase information, etc.), brief or detailed protocols for using the kit, trouble-shooting, references, technical support, and any other related documents. Instructions can be supplied with the kit or as a separate member component, either as a paper form or an electronic form which may be supplied on computer readable memory device or downloaded from an internet website, or as recorded presentation. Instructions can comprise one or multiple documents, and are meant to include future updates.
[0057] As used herein, the terms “therapeutic agent” include any synthetic or naturally occurring biologically active compound or composition of matter which, when administered to an organism (human or nonhuman animal), induces a desired pharmacologic, immunogenic, and / or physiologic effect by local and / or systemic action. The term therefore encompasses those compounds or chemicals traditionally regarded as drugs, vaccines, and biopharmaceuticals including molecules such as proteins, peptides, hormones, nucleic acids, gene constructs and the like. Examples of therapeutic agents are described in well-known literature references such as the Merck Index (14thedition), the Physicians' Desk Reference (64thedition), and The Pharmacological Basis of Therapeutics (12thedition), and they include, without limitation, medicaments; vitamins; mineral supplements; substances used for the treatment, prevention, diagnosis, cure or mitigation of a disease or illness; substances that affect the structure or function of the body, or pro-drugs, which become biologically active or more active after they have been placed in a physiological environment. For example, the term “therapeutic agent” includes compounds or compositions for use in all of the major therapeutic areas including, but not limited to, adjuvants; anti-infectives such as antibiotics and antiviral agents; analgesics and analgesic combinations, anorexics, anti-inflammatory agents, anti-epileptics, local and general anesthetics, hypnotics, sedatives, antipsychoticAttorney Docket No. 19116.0064P1 agents, neuroleptic agents, antidepressants, anxiolytics, antagonists, neuron blocking agents, anticholinergic and cholinomimetic agents, antimuscarinic and muscarinic agents, antiadrenergics, antiarrhythmics, antihypertensive agents, hormones, and nutrients, antiarthritics, antiasthmatic agents, anticonvulsants, antihistamines, antinauseants, antineoplastics, antipruritics, antipyretics; antispasmodics, cardiovascular preparations (including calcium channel blockers, beta-blockers, beta-agonists and antiarrythmics), antihypertensives, diuretics, vasodilators; central nervous system stimulants; cough and cold preparations; decongestants; diagnostics; hormones; bone growth stimulants and bone resorption inhibitors; immunosuppressives; muscle relaxants; psychostimulants; sedatives; tranquilizers; proteins, peptides, and fragments thereof (whether naturally occurring, chemically synthesized or recombinantly produced); and nucleic acid molecules (polymeric forms of two or more nucleotides, either ribonucleotides (RNA) or deoxyribonucleotides (DNA) including both double- and single-stranded molecules, gene constructs, expression vectors, antisense molecules and the like), small molecules (e.g, doxorubicin) and other biologically active macromolecules such as, for example, proteins and enzymes. The agent may be a biologically active agent used in medical, including veterinary, applications and in agriculture, such as with plants, as well as other areas. The term "therapeutic agent" also includes without limitation, medicaments; vitamins; mineral supplements; substances used for the treatment, prevention, diagnosis, cure or mitigation of disease or illness; or substances which affect the structure or function of the body; or pro- drugs, which become biologically active or more active after they have been placed in a predetermined physiological environment.
[0058] The term “pharmaceutically acceptable” describes a material that is not biologically or otherwise undesirable, z.e., without causing an unacceptable level of undesirable biological effects or interacting in a deleterious manner.
[0059] As used herein, the term “derivative” refers to a compound having a structure derived from the structure of a parent compound (e.g. a compound disclosed herein) and whose structure is sufficiently similar to those disclosed herein and based upon that similarity, would be expected by one skilled in the art to exhibit the same or similar activities and utilities as the claimed compounds, or to induce, as a precursor, the same or similar activities and utilities as the claimed compounds. Exemplary derivatives include salts, esters, amides, salts of esters or amides, and N-oxides of a parent compound.
[0060] As used herein, the term “pharmaceutically acceptable carrier” refers to sterileAttorney Docket No. 19116.0064P1aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. These compositions can also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, sorbic acid and the like. It can also be desirable to include isotonic agents such as sugars, sodium chloride and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents, such as aluminum monostearate and gelatin, which delay absorption. Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide-poly glycolide, poly(orthoesters) and poly(anhydrides). Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissues. The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable media just prior to use. Suitable inert carriers can include sugars such as lactose. Desirably, at least 95% by weight of the particles of the active ingredient have an effective particle size in the range of 0.01 to 10 micrometers.
[0061] A residue of a chemical species, as used in the specification and concluding claims, refers to the moiety that is the resulting product of the chemical species in a particular reaction scheme or subsequent formulation or chemical product, regardless of whether the moiety is actually obtained from the chemical species. Thus, an ethylene glycol residue in a polyester refers to one or more -OCH2CH2O- units in the polyester, regardless of whether ethylene glycol was used to prepare the polyester. Similarly, a sebacic acid residue in a polyester refers to one or more -CO(CH2)sCO- moieties in the polyester, regardless of whether the residue is obtained by reacting sebacic acid or an ester thereof to obtain theAttorney Docket No. 19116.0064P1 polyester.
[0062] As used herein, the term '‘substituted” is contemplated to include all permissible substituents of organic compounds. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, and aromatic and nonaromatic substituents of organic compounds. Illustrative substituents include, for example, those described below. The permissible substituents can be one or more and the same or different for appropriate organic compounds. For purposes of this disclosure, the heteroatoms, such as nitrogen, can have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms. This disclosure is not intended to be limited in any manner by the permissible substituents of organic compounds. Also, the terms “substitution” or “substituted with” include the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g, a compound that does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc. It is also contemplated that, in certain aspects, unless expressly indicated to the contrary, individual substituents can be further optionally substituted (i.e., further substituted or unsubstituted).
[0063] In defining various terms, “A1,” “A2,” “A3,” and “A4” are used herein as generic symbols to represent various specific substituents. These symbols can be any substituent, not limited to those disclosed herein, and when they are defined to be certain substituents in one instance, they can, in another instance, be defined as some other substituents.
[0064] The term “aliphatic” or “aliphatic group.” as used herein, denotes a hydrocarbon moiety that may be straight-chain i.e., unbranched), branched, or cyclic (including fused, bridging, and spirofused polycyclic) and may be completely saturated or may contain one or more units of unsaturation, but which is not aromatic. Unless otherwise specified, aliphatic groups contain 1-20 carbon atoms. Aliphatic groups include, but are not limited to, linear or branched, alkyl, alkenyl, and alkynyl groups, and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.
[0065] The term “alkyl” as used herein is a branched or unbranched saturated hydrocarbon group of 1 to 24 carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobuty l, s-butyl, / -butyl, w-pentyl, isopentyl, s-pentyl, neopentyl, hexyl, heptyl, octyl, nonyl, decyl, dodecyl, tetradecyl, hexadecyl, eicosyl, tetracosyl, and the like. The alkyl group can be cyclic or acyclic. The alkyl group can be branched or unbranched. The alkyl group can alsoAttorney Docket No. 19116.0064P1 be substituted or unsubstituted. For example, the alkyl group can be substituted with one or more groups including, but not limited to, cycloalkyl, alkoxy, amino, ether, halide, hydroxy, nitro, silyl, sulfo-oxo, or thiol, as described herein. A “lower alkyl” group is an alkyl group containing from one to six (e.g., from one to four) carbon atoms. The term alky l group can also be a Cl alkyl, C1-C2 alkyl, C1-C3 alkyl, C1-C4 alkyl, C1-C5 alkyl, C1-C6 alkyl, C1-C7 alkyl, C1-C8 alkyl, C1-C9 alkyl, Cl -CIO alkyl, and the like up to and including a C1-C24 alkyl.
[0066] Throughout the specification “alkyl” is generally used to refer to both unsubstituted alkyl groups and substituted alkyl groups; however, substituted alkyl groups are also specifically referred to herein by identifying the specific substituent(s) on the alkyl group. For example, the term “halogenated alkyl” or “haloalkyl” specifically refers to an alkyl group that is substituted with one or more halide, e.g., fluorine, chlorine, bromine, or iodine.Alternatively, the term “monohaloalky 1” specifically refers to an alkyl group that is substituted with a single halide, e.g. fluorine, chlorine, bromine, or iodine. The term “polyhaloalkyl” specifically refers to an alkyl group that is independently substituted with two or more halides, i.e. each halide substituent need not be the same halide as another halide substituent, nor do the multiple instances of a halide substituent need to be on the same carbon. The term “alkoxyalkyl” specifically refers to an alkyl group that is substituted with one or more alkoxy groups, as described below. The term “aminoalkyl” specifically refers to an alkyl group that is substituted with one or more amino groups. The term “hydroxyalkyl” specifically refers to an alkyd group that is substituted with one or more hydroxy groups. When “alkyl” is used in one instance and a specific term such as “hydroxyalkyl” is used in another, it is not meant to imply that the term “alkyl” does not also refer to specific terms such as “hydroxyalkyl” and the like.
[0067] This practice is also used for other groups described herein. That is, while a term such as “cycloalkyl” refers to both unsubstituted and substituted cycloalkyl moieties, the substituted moieties can, in addition, be specifically identified herein; for example, a particular substituted cycloalkyl can be referred to as, e.g., an “alkylcycloalkyl.” Similarly, a substituted alkoxy can be specifically referred to as, e.g., a “halogenated alkoxy,” a particular substituted alkenyl can be, e.g., an “alkenylalcohol,” and the like. Again, the practice of using a general term, such as “cycloalkyl,” and a specific term, such as “alkylcycloalkyl,” is not meant to imply that the general term does not also include the specific term.
[0068] The term “cycloalkyl” as used herein is a non-aromatic carbon-based ring composedAttorney Docket No. 19116.0064P1 of at least three carbon atoms. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, norbomyl, and the like. The term “heterocycloalkyl” is a type of cycloalkyl group as defined above, and is included within the meaning of the term “cycloalkyd,” where at least one of the carbon atoms of the ring is replaced with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkyl group and heterocycloalkyl group can be substituted or unsubstituted. For example, the cycloalkyl group and heterocycloalkyl group can be substituted with 0, 1, 2, 3, or 4 groups independently selected from C1-C4 alkyl, C3-C7 cycloalkyl, C1-C4 alkoxy, -NH2, (C1-C4) alkylamino, (C1-C4)(C1-C4) dialkylamino, ether, halogen, -OH. C1-C4 hydroxyalkyl, -NO2. silyl, sulfo-oxo, -SH, and C1-C4 thioalkyl, as described herein.
[0069] The term “polyalky lene group” as used herein is a group having two or more CH2 groups linked to one another. The polyalkylene group can be represented by the formula — (CH2)a —, where “a” is an integer of from 2 to 500.
[0070] The terms “alkoxy” and “alkoxyl” as used herein to refer to an alkyl or cycloalkyl group bonded through an ether linkage; that is, an “alkoxy” group can be defined as — OA1where A1is alkyl or cycloalky l as defined above. “Alkoxy” also includes polymers of alkoxy groups as just described; that is, an alkoxy can be a poly ether such as — OA1— OA2or — OA1— (OA2)a— OA3, where “a” is an integer of from 1 to 200 and A1, A2, and A3are alkyl and / or cycloalkyl groups.
[0071] The term “alkenyl” as used herein is a hydrocarbon group of from 2 to 24 carbon atoms with a structural formula containing at least one carbon-carbon double bond.Asymmetric structures such as (A1A2)C=C(A3A4) are intended to include both the E and Z isomers. This can be presumed in structural formulae herein wherein an asymmetric alkene is present, or it can be explicitly indicated by the bond symbol C=C. The alkenyl group can be substituted with one or more groups including, but not limited to, alkyl, cycloalkyl, alkoxy, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, azide, nitro, silyl, sulfo-oxo, or thiol, as described herein.
[0072] The term “cycloalkenyl” as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms and containing at least one carbon-carbon double bound, i.e.. C=C. Examples of cycloalkenyl groups include, but are not limited to. cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclopentadienyl, cyclohexenyl,Attorney Docket No. 19116.0064P1 cyclohexadienyl, norbomenyl. and the like. The term “heterocycloalkenyl” is a type of cycloalkenyl group as defined above, and is included within the meaning of the term “cycloalkenyl,” where at least one of the carbon atoms of the ring is replaced with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkenyl group and heterocycloalkenyl group can be substituted or unsubstituted. For example, the cycloalkenyl group and heterocycloalkenyl group can be substituted with 0, 1, 2, 3, or 4 groups independently selected from C1-C4 alkyl, C3-C7 cycloalkyl, C1-C4 alkoxy, C2-C4 alkenyl, C3-C6 cycloalkenyl, C2-C4 alkynyl, and, heteroaryl, aldeyhyde, -NFb, (Cl-C4) alkylamino, (C1-C4)(C1-C4) dialkylamino, carboxylic acid, ester, ether, halogen, -OH, C1-C4 hydroxyalkyl, ketone, azide, -NO2, silyl, sulfo-oxo, -SH, and C1-C4 thioalkyl, as described herein.
[0073] The term “alkynyl” as used herein is a hydrocarbon group of 2 to 24 carbon atoms with a structural formula containing at least one carbon-carbon triple bond. The alkynyl group can be unsubstituted or substituted with one or more groups including, but not limited to, alkyl, cycloalkyd, alkoxy, alkenyl, cycloalkenyl, alky nyl, cycloalkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, azide, nitro, silyl, sulfo-oxo, or thiol, as described herein.
[0074] The term “cycloalkynyl” as used herein is a non-aromatic carbon-based ring composed of at least seven carbon atoms and containing at least one carbon-carbon triple bound. Examples of cycloalkynyl groups include, but are not limited to, cycloheptynyl, cyclooctynyl, cyclononynyl, and the like. The term “heterocycloalkynyl” is a type of cycloalkenyl group as defined above, and is included within the meaning of the term “cycloalkynyl,” where at least one of the carbon atoms of the ring is replaced with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkynyl group and heterocycloalky nyl group can be substituted or unsubstituted. The cycloalkynyl group and heterocycloalkynyl group can be substituted with one or more groups including, but not limited to. alkyl, cycloalkyl, alkoxy, alkenyl, cycloalkenyl, alkynyl, cycloalky nyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, azide, nitro, silyl, sulfo-oxo, or thiol as described herein.
[0075] The term “aromatic group” as used herein refers to a ring structure having cyclic clouds of delocalized 71 electrons above and below the plane of the molecule, where the 7i clouds contain (4n+2) 71 electrons. A further discussion of aromaticity’ is found in Morrison and Boyd, Organic Chemistry, (5th Ed., 1987), Chapter 13, entitled “Aromaticity,” pagesAttorney Docket No. 19116.0064P1 477-497, incorporated herein by reference. The term “aromatic group” is inclusive of both aryl and heteroaryl groups.
[0076] The term “aryl” as used herein is a group that contains any carbon-based aromatic group including, but not limited to, benzene, naphthalene, phenyl, biphenyl, anthracene, and the like. The aryl group can be substituted or unsubstituted. The aryl group can be substituted with one or more groups including, but not limited to, alkyl, cycloalkyl, alkoxy, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, heteroaryl, aldehyde, — NPh. carboxylic acid, ester, ether, halide, hydroxy, ketone, azide, nitro, silyl, sulfo-oxo, or thiol as described herein. The term “biaryl” is a specific type of aryl group and is included in the definition of “aryl.” In addition, the aryl group can be a single ring structure or comprise multiple ring structures that are either fused ring structures or attached via one or more bridging groups such as a carboncarbon bond. For example, biaryl can be two aryl groups that are bound together via a fused ring structure, as in naphthalene, or are attached via one or more carbon-carbon bonds, as in biphenyl.
[0077] The term “aldehyde” as used herein is represented by the formula — C(O)H.Throughout this specification “C(O)” or “CO” is a short hand notation for a carbonyl group, z.e., C=O.
[0078] The terms “amine” or “amino” as used herein are represented by the formula — NAXA2, where A1and A2can be, independently, hydrogen or alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroaryl group as described herein. A specific example of amino is — NH2.
[0079] The term “alkylamino” as used herein is represented by the formula — NH(-alkyl) where alkyl is a described herein. Representative examples include, but are not limited to. methylamino group, ethylamino group, propylamino group, isopropylamino group, butylamino group, isobutylamino group, (sec-butyl)amino group, (lert-butyl)amino group, penty lamino group, isopenty lamino group, (tert-penty l)amino group, hexylamino group, and the like.
[0080] The term “dialkylamino” as used herein is represented by the formula — N(-alkyl)2 where alkyl is a described herein. Representative examples include, but are not limited to, dimethylamino group, diethylamino group, dipropylamino group, diisopropylamino group, dibutylamino group, diisobutylamino group, di(sec-butyl)amino group, di(tert-butyl)amino group, dipentylamino group, diisopentylamino group. di(tert-pentyl)amino group, dihexylamino group, N-ethyl-N-methylamino group, N-methyl-N-propylamino group, N-Attorney Docket No. 19116.0064P1 ethyl-N-propylamino group and the like.
[0081] The term '‘carboxylic acid’’ as used herein is represented by the formula — C(O)OH.
[0082] The term “ester” as used herein is represented by the formula — OC(O)A1or — C(O)OA1, where A1can be alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroaryl group as described herein. The term “polyester” as used herein is represented by the formula — (A1O(O)C-A2-C(O)O)a— or — (A1O(O)C-A2-OC(O))a—, where A1and A2can be, independently, an alkyl, cycloalkyd, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, ary l, or heteroaryl group described herein and “a” is an integer from 1 to 500. “Polyester” is as the term used to describe a group that is produced by the reaction between a compound having at least two carboxylic acid groups with a compound having at least two hydroxyl groups.
[0083] The term “ether” as used herein is represented by the formula AXOA2, where A1and A2can be, independently, an alk l, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroaryl group described herein. The term “polyether” as used herein is represented by the formula — (A1O-A2O)a—, where A1and A2can be, independently, an alkyl, cycloalky 1, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroaryl group described herein and “a” is an integer of from 1 to 500. Examples of polyether groups include polyethylene oxide, polypropylene oxide, and polybutylene oxide.
[0084] The terms “halo,” “halogen,” or "halide” as used herein can be used interchangeably and refer to F, Cl, Br, or I.
[0085] The terms “pseudohalide,” “pseudohalogen,” or “pseudohalo” as used herein can be used interchangeably and refer to functional groups that behave substantially similar to halides. Such functional groups include, by way of example, cyano, thiocyanato, azido, trifluoromethyl, trifluoromethoxy, perfluoroalkyl, and perfluoroalkoxy groups.
[0086] The term “heteroalkyl” as used herein refers to an alkyl group containing at least one heteroatom. Suitable heteroatoms include, but are not limited to, O, N, Si, P and S, wherein the nitrogen, phosphorous and sulfur atoms are optionally oxidized, and the nitrogen heteroatom is optionally quatemized. Heteroalkyls can be substituted as defined above for alkyl groups.
[0087] The term “heteroaryd” as used herein refers to an aromatic group that has at least one heteroatom incorporated within the ring of the aromatic group. Examples of heteroatoms include, but are not limited to. nitrogen, oxygen, sulfur, and phosphorus, where N-oxides, sulfur oxides, and dioxides are permissible heteroatom substitutions. The heteroaryl groupAttorney Docket No. 19116.0064P1 can be substituted or unsubstituted. The heteroaryl group can be substituted with one or more groups including, but not limited to, alkyl, cycloalkyl, alkoxy, amino, ether, halide, hydroxy, nitro, silyl, sulfo-oxo, or thiol as described herein. Heteroaryl groups can be monocyclic, or alternatively fused ring systems. Heteroaryl groups include, but are not limited to, furyl, imidazolyl, pyrimidinyl, tetrazolyl, thienyl, pyridinyl, pyrrolyl, A-methylpyrrol l. quinolinyl, isoquinolinyl, pyrazolyl, triazolyl, thiazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiadiazolyl, isothiazolyl, pyridazinyl, pyrazinyl, benzofuranyl, benzodioxolyl, benzothiophenyl, indolyl, indazolyl, benzimidazolyl, imidazopyridinyl, pyrazolopyridinyl, and pyrazolopyrimidinyl. Further not limiting examples of heteroaryl groups include, but are not limited to, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, thiophenyl, pyrazolyl, imidazolyl, benzo|t / |oxazolyl. benzo|c / |thiazolyl. quinolinyl, quinazolinyl, indazolyl, imidazo[l,2-b]pyridazinyl, imidazo[l,2-a]pyrazinyl, benzo[c][l,2,5]thiadiazolyl, benzo[c][l,2,5]oxadiazolyl, and pyrido[2,3-b]pyrazinyl.
[0088] The terms ■’heterocycle" or ’’heterocyclyl" as used herein can be used interchangeably and refer to single and multi-cyclic aromatic or non-aromatic ring systems in which at least one of the ring members is other than carbon. Thus, the term is inclusive of, but not limited to, “heterocycloalkyl,” “heteroaryl,’' “bicyclic heterocycle,” and “polycyclic heterocycle.” Heterocycle includes pyridine, pyrimidine, furan, thiophene, pyrrole, isoxazole, isothiazole, pyrazole, oxazole, thiazole, imidazole, oxazole, including, 1,2, 3 -oxadiazole, 1,2,5-oxadiazole and 1,3,4-oxadiazole, thiadiazole, including, 1,2,3-thiadiazole, 1,2,5-thiadiazole, and 1,3,4-thiadiazole, triazole, including, 1,2,3-triazole, 1,3,4-triazole, tetrazole, including 1, 2,3,4-tetrazole and 1,2.4.5-tetrazole, pyridazine, pyrazine, triazine, including 1,2,4-triazine and 1,3,5-triazine, tetrazine, including 1.2.4.5-tetrazine, pyrrolidine, piperidine, piperazine, morpholine, azetidine, tetrahydropyran, tetrahydrofuran, dioxane, and the like. The term heterocyclyl group can also be a C2 heterocyclyl, C2-C3 heterocyclyl, C2-C4 heterocyclyl, C2-C5 heterocyclyl, C2-C6 heterocyclyl, C2-C7 heterocyclyl, C2-C8 heterocyclyl, C2-C9 heterocyclyl, C2-C10 heterocyclyl, C2-C11 heterocyclyl, and the like up to and including a C2-C 18 heterocyclyl. For example, a C2 heterocyclyl comprises a group which has two carbon atoms and at least one heteroatom, including, but not limited to, aziridinyl, diazetidinyl, dihydrodiazetyl, oxiranyl, thiiranyl, and the like. Alternatively, for example, a C5 heterocyclyl comprises a group which has five carbon atoms and at least one heteroatom, including, but not limited to. piperidinyl, tetrahydropyranyl, tetrahydrothiopyranyl. diazepanyl, pyridinyl, and the like. It is understood that a heterocyclyl group may be boundAttorney Docket No. 19116.0064P1 either through a heteroatom in the ring, where chemically possible, or one of carbons comprising the heterocyclyl ring.
[0089] The term “bicyclic heterocycle” or “bicyclic heterocyclyl” as used herein refers to a ring system in which at least one of the ring members is other than carbon. Bicyclic heterocyclyl encompasses ring systems wherein an aromatic ring is fused with another aromatic ring, or wherein an aromatic ring is fused with a non-aromatic ring. Bicyclic heterocyclyl encompasses ring systems wherein a benzene ring is fused to a 5- or a 6-membered ring containing 1, 2 or 3 ring heteroatoms or wherein a pyridine ring is fused to a 5- or a 6-membered ring containing 1, 2 or 3 ring heteroatoms. Bicyclic heterocyclic groups include, but are not limited to. indolyl, indazolyl, pyrazolo[l,5-a]pyridinyl. benzofuranyl, quinolinyl, quinoxalinyl, 1,3-benzodioxolyl, 2,3-dihydro-l,4-benzodioxinyl, 3,4-dihydro-2H-chromenyl, lH-pyrazolo[4,3-c]pyridin-3-yl; lH-pyrrolo[3,2-b]pyridin-3-yl; and 1H-pyrazolo[3.2-b]pyridin-3-yl.
[0090] The term “heterocycloalkyl” as used herein refers to an aliphatic, partially unsaturated or fully saturated, 3- to 14-membered ring system, including single rings of 3 to 8 atoms and bi- and tricyclic ring systems. The heterocycloalkyl ring-systems include one to four heteroatoms independently selected from oxygen, nitrogen, and sulfur, wherein a nitrogen and sulfur heteroatom optionally can be oxidized and a nitrogen heteroatom optionally can be substituted. Representative heterocycloalkyl groups include, but are not limited to, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, and tetrahydrofuryl.
[0091] The term “hydroxy” or “hydroxyl” as used herein is represented by the formula — OH.
[0092] The term “ketone” as used herein is represented by the formula A1C(O)A2, where A1and A2can be, independently, an alkyl, cycloalky l, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroaryl group as described herein.
[0093] The term “azide” or “azido” as used herein is represented by the formula — N3.
[0094] The term “nitro” as used herein is represented by the formula — NO2.
[0095] The term “nitrile” or “cyano” as used herein is represented by the formula — CN or — ON.
[0096] The term “silyl” as used herein is represented by the formula — SiA^A3, where A1. A2, and A3can be, independently, hydrogen or an alkyl, cycloalkyl, alkoxy, alkenyl,Attorney Docket No. 19116.0064P1 cycloalkenyl, alkynyl, cycloalkynyl. aryl, or heteroaryl group as described herein.
[0097] The term '‘sulfo-oxo” as used herein is represented by the formulas — S(O)A1, — S(O)2A1, — OS(O)2A', or — OS(O)2OA1, where A1can be hydrogen or an alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, ary l, or heteroaryl group as described herein. Throughout this specification “S(O)” is a short hand notation for S=O. The term 'sulfonyl" is used herein to refer to the sulfo-oxo group represented by the formula — S(O)2A1, where A1can be hydrogen or an alkyl, cycloalkyd, alkenyl, cycloalkenyl, alkynyl, cycloalky nyl, ary 1, or heteroaryl group as described herein. The term “sulfone” as used herein is represented by the formula A'S(O)2A2, where A1and A2can be, independently, an alkyl, cycloalky 1. alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroaryl group as described herein. The term “sulfoxide” as used herein is represented by the formula AXS(O)A2, where A1and A2can be, independently, an alkyd, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroary! group as described herein.
[0098] The term “thiol” as used herein is represented by the formula — SH.
[0099] “R1,” “R2,” “R3,” “Rn,” where n is an integer, as used herein can, independently, possess one or more of the groups listed above. For example, if R1is a straight chain alkyl group, one of the hydrogen atoms of the alkyd group can optionally be substituted with a hydroxyl group, an alkoxy group, an alkyl group, a halide, and the like. Depending upon the groups that are selected, a first group can be incorporated within second group or, alternatively, the first group can be pendant (z.e., attached) to the second group. For example, with the phrase “an alkyl group comprising an amino group,” the amino group can be incorporated within the backbone of the alkyd group. Alternatively, the amino group can be attached to the backbone of the alkyl group. The nature of the group(s) that is (are) selected w ill determine if the first group is embedded or attached to the second group.
[0100] As described herein, compounds of the invention may contain “optionally substituted” moieties. In general, the term “substituted,” whether preceded by the term “optionally” or not, means that one or more hydrogen of the designated moiety are replaced with a suitable substituent. Unless otherwise indicated, an “optionally substituted” group may have a suitable substituent at each substitutable position of the group, and w hen more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position. Combinations of substituents envisioned by this invention are those that result in the formation of stable or chemically feasible compounds. In is also contemplated that, inAttorney Docket No. 19116.0064P1 certain aspects, unless expressly indicated to the contrary, individual substituents can be further optionally substituted (z. e., further substituted or unsubstituted).
[0101] The term “stable,” as used herein, refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain aspects, their recovery, purification, and use for one or more of the purposes disclosed herein.
[0102] Suitable monovalent substituents on a substitutable carbon atom of an “optionally substituted” group are independently halogen; -(CH2)o 4R0; -(CH2)o 4OR0; -0(CH2)O-4R°. -0-(CH2)O4C(0)0RO; -(CH2)O4CH(ORO)2; -(CH2)O4SRO: -(CH2)O4Ph, which may be substituted with R°; -(CH2)O IO(CH2)<) i Ph which may be substituted with R°; -CH=CHPh, which may be substituted with R°; -(CH2)o-40(CH2)o-i-pyridyl which may be substituted with R°; -NO2: -CN; -Ns; -(CH2)o4N(R°)2; -(CH2)o-4N(R°)C(0)R°; -N(R°)C(S)R°; -(CH2)O 4N(RO)C(O)NR°2; -N(RO)C(S)NR°2; -(CH2)O4N(RO)C(O)OR°; -N(R°)N(R°)C(O)R°; -N(RO)N(RO)C(O)NRO2; -N(R°)N(R°)C(O)OR°; -(CH2)o 4C(O)R°; -C(S)R°; -(CH2)O4C(0)0RO; -(CH2)O4C(O)SRO; -(CH2)O4C(0)0SiRo?; -(CH2)o4CJC(O)R°: -OC(0)(CH2)O ISR-. SC(S)SR°; -(CH2)O4SC(O)RO; -(CH2)O 4C(O)NRO2; -C(S)NRO2; -C(S)SR°: -(CH2)O 4OC(O)NRO2; -C(O)N(OR°)R°; -C(O)C(O)R°; -C(O)CH2C(O)R°; -C(NOR°)R°; -(CH2)o 4SSR0; -(CH2)o4S(O)2R°; -(CH2)o4S(O)2OR°; -(CH2)o4OS(O)2R°; -S(O)2NR°2; -(CH2)O-4S(0)R°; -N(RO)S(O)2NRO2; -N(RO)S(O)2R°; -N(0R°)R°; -C(NH)NR°2; -P(O)2RO; -P(O)RO2; -OP(O)R°2; -OP(O)(ORO)2; SiR°3; -(Ci 4 straight or branched alkylene)O-N(R°)2; or-(Ci 4 straight or branched alkylene)C(O)O-N(R°)2, wherein each R° may be substituted as defined below and is independently hydrogen, Ci-6 aliphatic, -CH2Ph, -0(CH2)o iPh, -CH2-(5-6 membered heteroaryl ring), or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R°, taken together with their intervening atom(s), form a 3-12-membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which may be substituted as defined below.
[0103] Suitable monovalent substituents on R° (or the ring formed by taking two independent occurrences of R° together with their intervening atoms), are independently halogen, -(CH2)o2R*, -(haloR*), -(CH2)o-2OH, -(CH2)o2OR*, -(CH2)o-Attorney Docket No. 19116.0064P12CH(OR*)2; -O(haloR’). -CN. -N3, -(CH2)o2C(O)R’, -(CH2)o2C(O)OH, -(CH2)o-2C(O)OR’, -(CH2)O-2SR", -(CH2)O2SH, -(CH2)O2NH2, -(CH2)O-2NHR*, -(CH2)O-2NR*2, -NO2, -SiR*3, -OSiR’s, -C(O)SR*, -(Ci-4 straight or branched alkylene)C(O)OR*, or -SSR* wherein each R* is unsubstituted or where preceded by “halo'’ is substituted only with one or more halogens, and is independently selected from Ci-4 aliphatic. -CH2Ph, -0(CH2)o iPh, or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents on a saturated carbon atom of R° include =0 and =S.
[0104] Suitable divalent substituents on a saturated carbon atom of an “optionally substituted” group include the following: =0, =S, =NNR*2, =NNHC(0)R*, =NNHC(O)OR*, =NNHS(O)2R*, =NR*, =N0R*, -O(C(R*2))2sO-, or -S(C(R*2))2 3S- wherein each independent occurrence of R* is selected from hydrogen, Ci-6 aliphatic which may be substituted as defined below, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents that are bound to vicinal substitutable carbons of an “optionally substituted” group include: -O(CR*2)2-3O-, wherein each independent occurrence of R* is selected from hydrogen, Ci-6 aliphatic which may be substituted as defined below, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0105] Suitable substituents on the aliphatic group of R* include halogen, - R*. -(haloR*), -OH, -OR*. -O(haloR’), -CN. -C(O)OH, -C(O)OR*. -NH2, -NHR’, -NRe2, or -NO2, wherein each R* is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently Ci-4 aliphatic, -CH2Ph, -0(CH2)o iPh, or a 5-6-membered saturated, partially unsaturated, or ar l ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0106] Suitable substituents on a substitutable nitrogen of an “optionally substituted” group include -R:. -NRT2, -C(O)Rt, -C(O)ORt, -C(O)C(O)Rt, -C(O)CH2C(O)Rt, -S(O)2Rf, -S(O)2NR^2, -C(S)NRf2, -C(NH)NRf2, or -N(Rt)S(O)2Rt; wherein each R:is independently hydrogen, C i-6 aliphatic which may be substituted as defined below, unsubstituted -OPh, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R1', taken together withAttorney Docket No. 19116.0064P1 their intervening atom(s) form an unsubstituted 3-12-membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0107] Suitable substituents on the aliphatic group of K are independently halogen, -R*. -(haloR*), -OH, -OR*, -O(haloR*). -CN, -C(O)OH. -C(O)OR*, -NH2, -NHR", -NR*2, or -NO2, wherein each R* is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C1-4 aliphatic, -CH2P 1, -0(CH2)o iPh, or a 5-6-membered saturated, partially unsaturated, or ary l ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0108] The term “leaving group” refers to an atom (or a group of atoms) with electron withdrawing ability that can be displaced as a stable species, taking with it the bonding electrons. Examples of suitable leaving groups include halides and sulfonate esters, including, but not limited to, triflate, mesylate, tosylate, and brosylate.
[0109] The terms “hydrolysable group” and “hydrolysable moiety ” refer to a functional group capable of undergoing hydrolysis, e.g., under basic or acidic conditions. Examples of hydrolysable residues include, without limitation, acid halides, activated carboxylic acids, and various protecting groups known in the art (see, for example, “Protective Groups in Organic Synthesis,” T. W. Greene, P. G. M. Wuts, Wiley-Interscience, 1999).
[0110] The term “organic residue” defines a carbon containing residue, z.e., a residue comprising at least one carbon atom, and includes but is not limited to the carbon-containing groups, residues, or radicals defined hereinabove. Organic residues can contain various heteroatoms, or be bonded to another molecule through a heteroatom, including oxygen, nitrogen, sulfur, phosphorus, or the like. Examples of organic residues include but are not limited alkyl or substituted alkyls, alkoxy or substituted alkoxy, mono or di-substituted amino, amide groups, etc. Organic residues can preferably comprise 1 to 18 carbon atoms, 1 to 15, carbon atoms, 1 to 12 carbon atoms, 1 to 8 carbon atoms. 1 to 6 carbon atoms, or 1 to 4 carbon atoms. In a further aspect, an organic residue can comprise 2 to 18 carbon atoms, 2 to 15, carbon atoms, 2 to 12 carbon atoms, 2 to 8 carbon atoms, 2 to 4 carbon atoms, or 2 to 4 carbon atoms.
[0111] A very close synonym of the term “residue” is the term “radical,” which as used in the specification and concluding claims, refers to a fragment, group, or substructure of a molecule described herein, regardless of how the molecule is prepared. For example, aAttorney Docket No. 19116.0064P1 2,4-thiazolidinedione radical in a particular compound has the structure:Oregardless of whether thiazolidinedione is used to prepare the compound. In some embodiments the radical (for example an alky l) can be further modified (i.e., substituted alkyl) by having bonded thereto one or more ‘‘substituent radicals.’' The number of atoms in a given radical is not critical to the present invention unless it is indicated to the contrary elsewhere herein.
[0112] ’‘Organic radicals,” as the term is defined and used herein, contain one or more carbon atoms. An organic radical can have, for example, 1-26 carbon atoms, 1-18 carbon atoms, 1-12 carbon atoms, 1-8 carbon atoms, 1-6 carbon atoms, or 1-4 carbon atoms. In a further aspect, an organic radical can have 2-26 carbon atoms, 2-18 carbon atoms, 2-12 carbon atoms, 2-8 carbon atoms, 2-6 carbon atoms, or 2-4 carbon atoms. Organic radicals often have hydrogen bound to at least some of the carbon atoms of the organic radical. One example, of an organic radical that comprises no inorganic atoms is a 5, 6, 7, 8-tetrahydro-2-naphthyl radical. In some embodiments, an organic radical can contain 1-10 inorganic heteroatoms bound thereto or therein, including halogens, oxygen, sulfur, nitrogen, phosphorus, and the like. Examples of organic radicals include but are not limited to an alkyl, substituted alky l, cy cloalkyl, substituted cycloalkyd, mono-substituted amino, disubstituted amino, acyloxy, cyano, carboxy, carboalkoxy, alkylcarboxamide, substituted alkylcarboxamide, dialkylcarboxamide, substituted dialkylcarboxamide, alkylsulfonyl, alkylsulfinyl, thioalkyl, thiohaloalky 1, alkoxy, substituted alkoxy, haloalkyl, haloalkoxy, aryl, substituted aryl, heteroaryl, heterocyclic, or substituted heterocyclic radicals, wherein the terms are defined elsewhere herein. A few non-limiting examples of organic radicals that include heteroatoms include alkoxy radicals, trifluoromethoxy radicals, acetoxy radicals, dimethylamino radicals and the like.
[0113] “Inorganic radicals,” as the term is defined and used herein, contain no carbon atoms and therefore comprise only atoms other than carbon. Inorganic radicals comprise bonded combinations of atoms selected from hydrogen, nitrogen, oxygen, silicon, phosphorus, sulfur, selenium, and halogens such as fluorine, chlorine, bromine, and iodine, which can be present individually or bonded together in their chemically stable combinations. Inorganic radicals have 10 or fewer, or preferably one to six or one to four inorganic atoms asAttorney Docket No. 19116.0064P1 listed above bonded together. Examples of inorganic radicals include, but not limited to. amino, hydroxy, halogens, nitro, thiol, sulfate, phosphate, and like commonly known inorganic radicals. The inorganic radicals do not have bonded therein the metallic elements of the periodic table (such as the alkali metals, alkaline earth metals, transition metals, lanthanide metals, or actinide metals), although such metal ions can sometimes serve as a pharmaceutically acceptable cation for anionic inorganic radicals such as a sulfate, phosphate, or like anionic inorganic radical. Inorganic radicals do not comprise metalloids elements such as boron, aluminum, gallium, germanium, arsenic, tin, lead, or tellurium, or the noble gas elements, unless otherwise specifically indicated elsewhere herein.
[0114] Compounds described herein can contain one or more double bonds and, thus, potentially give rise to cis / trans (E / Z) isomers, as well as other conformational isomers. Unless stated to the contrary7, the invention includes all such possible isomers, as well as mixtures of such isomers.
[0115] Unless stated to the contrary, a formula with chemical bonds shown only as solid lines and not as wedges or dashed lines contemplates each possible isomer, e.g, each enantiomer and diastereomer, and a mixture of isomers, such as a racemic or scalemic mixture. Compounds described herein can contain one or more asymmetric centers and, thus, potentially give rise to diastereomers and optical isomers. Unless stated to the contrary7, the present invention includes all such possible diastereomers as well as their racemic mixtures, their substantially pure resolved enantiomers, all possible geometric isomers, and pharmaceutically acceptable salts thereof. Mixtures of stereoisomers, as well as isolated specific stereoisomers, are also included. During the course of the synthetic procedures used to prepare such compounds, or in using racemization or epimerization procedures known to those skilled in the art, the products of such procedures can be a mixture of stereoisomers.
[0116] Many organic compounds exist in optically active forms having the ability to rotate the plane of plane-polarized light. In describing an optically active compound, the prefixes D and L or R and S are used to denote the absolute configuration of the molecule about its chiral center(s). The prefixes d and 1 or (+) and (-) are employed to designate the sign of rotation of plane-polarized light by the compound, with (-) or meaning that the compound is levorotatory7. A compound prefixed with (+) or d is dextrorotatory7. For a given chemical structure, these compounds, called stereoisomers, are identical except that they are non-superimposable mirror images of one another. A specific stereoisomer can also be referred to as an enantiomer, and a mixture of such isomers is often called an enantiomericAttorney Docket No. 19116.0064P1 mixture. A 50:50 mixture of enantiomers is referred to as a racemic mixture. Many of the compounds described herein can have one or more chiral centers and therefore can exist in different enantiomeric forms. If desired, a chiral carbon can be designated with an asterisk (*). When bonds to the chiral carbon are depicted as straight lines in the disclosed formulas, it is understood that both the (R) and (S) configurations of the chiral carbon, and hence both enantiomers and mixtures thereof, are embraced within the formula. As is used in the art, when it is desired to specify the absolute configuration about a chiral carbon, one of the bonds to the chiral carbon can be depicted as a wedge (bonds to atoms above the plane) and the other can be depicted as a series or wedge of short parallel lines is (bonds to atoms below the plane). The Cahn-Ingold-Prelog system can be used to assign the (R) or (S) configuration to a chiral carbon.
[0117] Compounds described herein comprise atoms in both their natural isotopic abundance and in non-natural abundance. The disclosed compounds can be isotopically-labeled or isotopically-substituted compounds identical to those described, but for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number typically found in nature. Examples of isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine and chlorine, such as2H,3H,13C,14C,15N,18O,170,35S,18F and36C1, respectively. Compounds further comprise prodrugs thereof, and pharmaceutically acceptable salts of said compounds or of said prodrugs which contain the aforementioned isotopes and / or other isotopes of other atoms are within the scope of this invention. Certain isotopically-labeled compounds of the present invention, for example those into which radioactive isotopes such as3H and14C are incorporated, are useful in drug and / or substrate tissue distribution assays. Tritiated, z.e.,3H, and carbon-14, i.e.,14C, isotopes are particularly preferred for their ease of preparation and detectability'. Further, substitution with heavier isotopes such as deuterium, i.e.,2H, can afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements and, hence, may be preferred in some circumstances.Isotopically labeled compounds of the present invention and prodrugs thereof can generally be prepared by carry ing out the procedures below, by substituting a readily available isotopically labeled reagent for a non-isotopically labeled reagent.
[0118] The compounds described in the invention can be present as a solvate. In some cases, the solvent used to prepare the solvate is an aqueous solution, and the solvate isAttorney Docket No. 19116.0064P1 then often referred to as a hydrate. The compounds can be present as a hydrate, which can be obtained, for example, by crystallization from a solvent or from aqueous solution. In this connection, one, two, three or any arbitrary number of solvent or water molecules can combine with the compounds according to the invention to form solvates and hydrates. Unless stated to the contrary, the invention includes all such possible solvates.
[0119] The term ”co-crystaT means a physical association of two or more molecules which owe their stability through non-covalent interaction. One or more components of this molecular complex provide a stable framework in the crystalline lattice. In certain instances, the guest molecules are incorporated in the crystalline lattice as anhydrates or solvates, see e.g. '“Crystal Engineering of the Composition of Pharmaceutical Phases. Do Pharmaceutical Co-crystals Represent a New Path to Improved Medicines?” Almarasson, O, et. al., The Royal Society of Chemistry, 1889-1896, 2004. Examples of co-crystals include p-toluenesulfonic acid and benzenesulfonic acid.
[0120] It is also appreciated that certain compounds described herein can be present as an equilibrium of tautomers. For example, ketones with an a-hydrogen can exist in an equilibrium of the keto form and the enol form.keto form enol form amide form imidic acid form Likewise, amides with an N-hydrogen can exist in an equilibrium of the amide form and the imidic acid form. As another example, pyrazoles can exist in two tautomeric forms, Nl-unsubstituted, 3-A3and JV1-unsubstituted, 5-A3as shown below.N-NHUnless stated to the contrary, the invention includes all such possible tautomers.
[0121] It is known that chemical substances form solids which are present in different states of order which are termed polymorphic forms or modifications. The different modifications of a polymorphic substance can differ greatly in their physical properties. The compounds according to the invention can be present in different polymorphic forms, with it being possible for particular modifications to be metastable. Unless stated to the contrary, the invention includes all such possible polymorphic forms.Attorney Docket No. 19116.0064P1
[0122] In some aspects, a structure of a compound can be represented by a formula:Il d“Rn5which is understood to be equivalent to a formula:Rn(a)Rn(d)wherein n is typically an integer. That is, R” is understood to represent five independent substituents, R"(a), R”^’, R”(c), R”(d), R”(e). By ‘"independent substituents,” it is meant that each R substituent can be independently defined. For example, if in one instance R"(a)is halogen, then R"(b)is not necessarily halogen in that instance.
[0123] Certain materials, compounds, compositions, and components disclosed herein can be obtained commercially or readily synthesized using techniques generally known to those of skill in the art. For example, the starting materials and reagents used in preparing the disclosed compounds and compositions are either available from commercial suppliers such as Aldrich Chemical Co., (Milwaukee, Wis.), Acros Organics (Morris Plains. N. J.), Fisher Scientific (Pittsburgh, Pa.), or Sigma (St. Louis, Mo.) or are prepared by methods known to those skilled in the art following procedures set forth in references such as Fieser and Fiesers Reagents for Organic Synthesis, Volumes 1-17 (John Wiley and Sons, 1991); Rodd’s Chemistry of Carbon Compounds. Volumes 1-5 and supplemental volumes (Elsevier Science Publishers, 1989); Organic Reactions, Volumes 1-40 (John Wiley and Sons, 1991); March’s Advanced Organic Chemistry, (John Wiley and Sons, 4th Edition); and Larock’s Comprehensive Organic Transformations (VCH Publishers Inc., 1989).
[0124] Unless otherwise expressly stated, it is in no way intended that any method set forth herein be construed as requiring that its steps be performed in a specific order.Accordingly, where a method claim does not actually recite an order to be followed by its steps or it is not otherw ise specifically stated in the claims or descriptions that the steps are to be limited to a specific order, it is no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including: matters of logic with respect to arrangement of steps or operational flow; plain meaning derived from grammatical organization or punctuation; and the number or type of embodiments described in the specification.Attorney Docket No. 19116.0064P1
[0125] Disclosed are the components to be used to prepare the compositions of the invention as well as the compositions themselves to be used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds cannot be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular compound is disclosed and discussed and a number of modifications that can be made to a number of molecules including the compounds are discussed, specifically contemplated is each and every combination and permutation of the compound and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F. B-D. B-E, B-F, C-D, C-E. and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the compositions of the invention. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the methods of the invention.
[0126] It is understood that the compositions disclosed herein have certain functions. Disclosed herein are certain structural requirements for performing the disclosed functions, and it is understood that there are a variety' of structures that can perform the same function that are related to the disclosed structures, and that these structures will typically achieve the same result.B. COMPOUNDS
[0127] In one aspect, disclosed are sequence selective deoxyribonucleic acid (DNA) binding compounds and epigenetic inhibitors including, but not limited to, histone deacetylase (HD AC) inhibitors. Such compounds, when used in combination, can be useful in regulating target genes including, but not limited to, FXN and FGF14b. In this way, the disclosed combination can be used to treat Friedreich’s ataxia (FRDA / FA). SCA27b. and other GAA-repeat based diseases.Attorney Docket No. 19116.0064P1
[0128] It is contemplated that each disclosed compound can be optionally further substituted. It is also contemplated that one or more compounds can be optionally omitted from the invention. It is understood that a disclosed compound can be provided by the disclosed methods. It is also understood that the disclosed compounds can be employed in the disclosed methods of using.1. SYNTEF
[0129] In various aspects, the sequence selective deoxyribonucleic acid (DNA) binding compound is a synthetic transcription elongation factor (SynTEF). As would be understood by those of skill in the art, SynTEFs are members of the class of Synthetic Gene readers / regulators (SynGRs). SynTEFs and methods of making SynTEFs are known in the art. See, e.g., US 20170281643 Al and US 2023 / 0322853 Al.
[0130] In various aspects, the SynTEF comprises a polyamide moiety configured to bind a deoxyribonucleic acid (DNA) sequence, wherein the polyamide moiety7is tethered to a bromodomain extraterminal domain (BET) binding ligand via a chemical linker.a. POLYAMIDES
[0131] In various aspects, the polyamide moiety is configured to bind a GAA sequence
[0132] In various aspects, the polyamide moiety comprises a monomeric unit having a structure represented by a formula:wherein R1is selected from:andR11wherein R10is selected from hydrogen, -NO2, and -C(O)NH2; and wherein R11is selected from hydrogen and C1-C4 alkyl.
[0133] In various aspects, the polyamide moiety comprises a plurality7of monomeric units having a structure represented by a formula:Attorney Docket No. 19116.0064P1(A)wherein ' — ' is selected from:
[0134] In various aspects, the polyamide moiety comprises a monomeric unit having a structure represented by a formula selected from:wherein each of m, o, and p is independently an integer selected from 1 to 20.
[0135] In a further aspect, the polyamide moiety comprises at least two different monomeric units.
[0136] In a still further aspect, the polyamide moiety comprises each of:
[0137] In various aspects, the polyamide moiety is a linear polyamide moiety.
[0138] In a further aspect, the linear polyamide moiety has a structure represented by a formula:wherein n is an integer selected from 1 to 20; wherein q is 0 or 1; wherein R1is selected from:Attorney Docket No. 19116.0064P1wherein R10is selected from hydrogen, -NO2, and -C(O)NH2; and wherein R11is selected ( )from hydrogen and C1-C4 alkyl; and wherein each occurrence of is independently- selected from:wherein each of R12and R13is independently selected from hydrogen and methyl.
[0139] In a further aspect, the polyamide moiety has a structure represented by a formula selected from:R10
[0140] In a further aspect, the polyamide moiety has a structure represented by a formula selected from:Attorney Docket No. 19116.0064P1
[0141] In a further aspect, the polyamide moiety has a structure represented by a formula selected from:R10R10R10and R10\ O wherein each occurrence of X is independently selected from N and CH.
[0142] In various aspects, the polyamide moiety is selected from:Attorney Docket No. 19116.0064P1H2N, and
[0143] In various aspects, each of m, o, and p is independently an integer selected from 1 to 20. In a further aspect, each of m, o, and p is independently an integer selected from 1 to 15. In a still further aspect, each of m, o, and p is independently an integer selected from 1 to 10. In yet a further aspect, each of m, o, and p is independently an integer selected from 1 to 5. In an even further aspect, each of m, o. and p is independently an integer selected from 5 to 20. In a still further aspect, each of m, o, and p is independently an integer selected from 10 to 20. In yet a further aspect, each of m, o, and p is independently an integer selected from 15 to 20. In an even further aspect, each of m, o, and p is independently an integer selected from 5 to 15.
[0144] In various aspects, each of m, o, and p is independently selected from 1, 2, 3,Attorney Docket No. 19116.0064P1 and 4, and the sum of m. o, and p is equal to t. In a further aspect, each of m. o, and p is independently selected from 1, 2, and 3. In a still further aspect, each of m, o, and p is independently selected from 1 and 2. In yet a further aspect, each of m, o, and p is independently selected from 1 and 3. In an even further aspect, each of m, o, and p is independently selected from 1 and 4. In a still further aspect, each of m, o, and p is independently selected from 2 and 3. In yet a further aspect, each of m, o, and p is independently selected from 2 and 4. In an even further aspect, each of m, o, and p is independently selected from 3 and 4. In a still further aspect, each of m, o, and p is 4. In yet a further aspect, each of m, o, and p is 3. In an even further aspect, each of m, o, and p is 2.
[0145] In various aspects, n is an integer selected from 1 to 20. In a further aspect, n is an integer selected from 1 to 15. In a still further aspect, n is an integer selected from 1 to 10. In yet a further aspect, n is an integer selected from 1 to 5. In an even further aspect, n is an integer selected from 5 to 20. In a still further aspect, n is an integer selected from 10 to 20. In yet a further aspect, n is an integer selected from 15 to 20. In an even further aspect, n is an integer selected from 5 to 15.
[0146] In various aspects, q is 0 or 1. In a further aspect, q is 0. In a still further aspect, q is 1.(■) GROUPS
[0147] In various aspects,
[0148] In various aspects, each occurrence ofis independently selected from”wherein * denotes a bond connected to -C(O)- and ** denotes a bond connected to -NH-.(ii) X GROUPSAttorney Docket No. 19116.0064P1
[0149] In various aspects, X is independently selected from N or CH. In a further aspect, X is N. In a still further aspect, X is CH.(iii) MONOMERIC UNIT GROUPS
[0150] In various aspects, a monomeric unit having a structure represented by a
[0151] In a further aspect, each occurrence of R is independently selected from:
[0152] In a further aspect, each occurrence of R is independently selected from:
[0153] In a further aspect, each occurrence of R is independently selected from:(iv) R1GROUPS
[0154] In various aspects, R1is selected from:
[0155] In various aspects, R1is selected from:Attorney Docket No. 19116.0064P1
[0156] In a father aspect, R1is selected from:
[0157] In various aspects, R1isR10
[0158] In various aspects, R1is(v) R10GROUPS
[0159] In various aspects, R10is selected from hydrogen, -NO2, and -C(O)NH2.
[0160] In various aspects, R10, when present, is hydrogen.(vi) R11GROUPS
[0161] In various aspects, R11is selected from hydrogen and C1-C4 alkyl. In a further aspect, R11is selected from hydrogen, methyl, ethyl, propyl, and isopropyl. In a still further aspect, R11is selected from hydrogen, methyl, and ethyl. In yet a further aspect, R11is selected from hydrogen and methyl.
[0162] In various aspects, R11is hydrogen.b. CHEMICAL LINKERS
[0163] In various aspects, the chemical linker is a polyethylene glycol (PEG) linker.
[0164] In various aspects, the first chemical linker has a structure represented by aAttorney Docket No. 19116.0064P1 formula selected from:u ouwherein * denotes a bond connected to the polyamide moiety and ** denotes a bond connected to the BET binding ligand; and wherein u is an integer selected from 1 to 20.
[0165] In one aspect, u is an integer selected from 1 to 20. In a further aspect, u is an integer selected from 1 to 15. In a still further aspect, each of u and v is independently an integer selected from 1 to 10. In yet a further aspect, u is an integer selected from 1 to 5. In an even further aspect, u is an integer selected from 5 to 20. In a still further aspect, u is an integer selected from 10 to 20. In yet a further aspect, u is an integer selected from 15 to 20. In an even further aspect, u is an integer selected from 5 to 15.c. BROMODOMAIN EXTRATERMINAL DOMAIN (BET) BINDING LIGANDS (BRD GROUPS)
[0166] In various aspects, the BET binding ligand has a structure represented by a formula selected from:wherein r is an integer selected from 1 to 6; wherein R2is selected from hydrogen and C1-C6 alkyl; wherein each of R3, R4, and R5is independently selected from hydrogen, methyl, ethyl, and halomethyl; and wherein R6is selected from halogen, -NH2, -C(O)NH2, C1-C4 aminoalkyl, and Ar1; and wherein Ar1is selected from a 5- to 10-membered heteroaryl and a 6- to 10-membered aryl, and is substituted with 0, 1, 2, or 3 groups independently selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alkyl, C2-C4 alkenyl. C1-C4 haloalkyl, Cl-Attorney Docket No. 19116.0064P1 C4 cyanoalkyl. C1-C4 hydroxyalkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl.
[0167] In various aspects, the BET binding ligand has a structure represented by a formula:
[0168] In various aspects, the BET binding ligand has a structure represented by a formula:
[0169] In various aspects, the BET binding ligand is selected from:
[0170] In various aspects, the BET binding ligand has a structure represented by a formula selected from:Attorney Docket No. 19116.0064P1wherein each of Q1and Q2is independently selected from N and CH; wherein each of R7aand R7bis independently selected from hydrogen, halogen, -NH2. C1-C4 alkyl. C1-C4 alkoxy, and C1-C4 aminoalkyk wherein R8is selected from hydrogen, halogen, -NH2, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, C1-C4 aminoalkyl, and -C(O)NH2; and wherein each of R9aand R9bis independently selected from hydrogen, halogen, -NH2, C1-C4 alkyl, C1-C4 alkoxy, and C1-C4 aminoalkyl.
[0171] In various aspects, the BET binding ligand is: / O O
[0172] In various aspects, the BET binding ligand is a structure selected from:Attorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1
[0173] In various aspects, the BET binding ligand is a structure selected from:Attorney Docket No. 19116.0064P1or a pharmaceutically acceptable salt thereof.
[0174] In various aspects, r is an integer selected from 1 to 6. In a further aspect, 5 is an integer selected from 1 to 5. In a still further aspect, r is an integer selected from 1 to 4. In yet a further aspect, r is an integer selected from 1 to 3. In an even further aspect, r is an integer selected from 1 to 2. In a still further aspect, r is an integer selected from 2 to 6. In yet a further aspect, r is an integer selected from 3 to 6. In an even further aspect, r is an integer selected from 4 to 6. In a still further aspect, r is an integer selected from 5 to 6. In yet a further aspect, r is 1. In an even further aspect, r is 2. In a still further aspect, r is 3. In yet a further aspect, r is 4. In an even further aspect, r is 5. In an even further aspect, r is 6.(i) Q’ AND Q2GROUPS
[0175] In various aspects, each of Q1and Q2is independently selected from N or CH. In a further aspect, each of Q1and Q2is N. In a still further aspect, each of Q1and Q2is CH. In yet a further aspect, Q1is N and Q2is CH. In an even further aspect, Q1is CH and Q2is N.(ii) R2GROUPS
[0176] In various aspects, R2is selected from hydrogen and C1-C6 alkyl. In a further aspect, R2is selected from hydrogen and C1-C4 alkyl. In a still further aspect, R2is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl. In yet a further aspect, R2is selected from hydrogen, methyl, and ethyl. In an even further aspect, R2is selected from hydrogen and methyl.
[0177] In various aspects, R2is hydrogen.(iii) R3, R4, AND R5GROUPS
[0178] In one aspect, each of R3, R4, and R5is independently selected from hydrogen, methyl, ethyl, and halomethyl. In a further aspect, each of R3, R4, and R5is independently selected from hydrogen, methyl, and ethyl. In a still further aspect, each of R3. R4. and R5isAttorney Docket No. 19116.0064P1 independently selected from hydrogen and methyl,
[0179] In various aspects, each of R3, R4, and R5is methyl.
[0180] In various aspects, each of R3, R4, and R5is hydrogen.(iv) R6GROUPS
[0181] In various aspects, R6is selected from halogen, -NH2, -C(O)NH2, C1-C4 aminoalkyl, and Ar1. In a further aspect, R6is selected from -F, -Cl, -Br, -NH2, -C(O)NH2, -CH3NH2, -CH2CH3NH2, -CH2CH2CH3NH2, and Ar1. In a still further aspect, R6is selected from-F, -Cl, -NH2, -C(O)NH2, -CH3NH2, CH2CH3NH2, and Ar1. In a further aspect, R6is selected from -F, -NH2, -C(O)NH2, -CH3NH2, and Ar1.
[0182] In various aspects, R6is selected from -NH2, C1-C4 aminoalkyl, and Ar1. In a further aspect, R6is selected from -NH2, -CH3NH2, -CH2CH3NH2, -CH2CH2CH3NH2, and Ar1. In a still further aspect, R6is selected from -NH2, -CH3NH2, -CH2CH3NH2, and Ar1. In a further aspect, R6is selected from -NH2, -CH3NH2, and Ar1.
[0183] In various aspects, R6is selected from halogen, -C(O)NH2, and Ar1. In a further aspect, R6is selected from -F, -Cl, -Br, -C(O)NH2, and Ar1. In a still further aspect, R6is selected from -F, -Cl, -C(O)NH2, and Ar1. In a further aspect, R6is selected from -F, -C(O)NH2, and Ar1.
[0184] In various aspects, R6is halogen. In a further aspect, R6is selected from -F, -Cl, and-Br. In a still further aspect. R6is selected from -F and -Cl. In a further aspect, R6is -Cl. In a further aspect, R6is -F.(v) R7AAND R7BGROUPS
[0185] In various aspects, each of R7aand R7bis independently selected from hydrogen, halogen, -NH2, C1-C4 alkyl, C1-C4 alkoxy, and C1-C4 aminoalkyl. In a further aspect, each of R7aand R7bis independently selected from hydrogen, -F, -Cl, -Br, -NH2, methyl, ethyl, propyl, and isopropyl, -OCH3, -OCH2CH3, -OCH2CH2CH3, -OCH(CH )2, -NCH3, -NCH2CH3, -NCH2CH2CH3, and -NCH(CHS)2. In a still further aspect, each of R7aand R7bis independently selected from hydrogen, -F. -Cl, -NH2. methyl, ethyl, -OCH3, -OCH2CH3. -NCH3, and -NCH2CH3. In a further aspect, each of R7aand R7bis independently selected from hydrogen, -F, -NH2, methyl, -OCH3, and -NCH3.
[0186] In various aspects, each of R7aand R7bis independently selected from hydrogen and C1-C4 alkoxy. In a further aspect, each of R7aand R7bis independently selected from hydrogen, -OCH3, -OCH2CH3, -OCH2CH2CH3, -OCH(CH3)2. In a stillAttorney Docket No. 19116.0064P1 further aspect, each of R7aand R7bis independently selected from hydrogen, -OCH3. and -OCH2CH3. In a further aspect, each of R7aand R7bis independently selected from hydrogen and -OCH3.
[0187] In various aspects, when R7ais hydrogen, then R71’ is C1-C4 alkoxy. In a further aspect, when R7ais hydrogen, then R7bis selected from -OCH3, -OCH2CH3, -OCH2CH2CH3, -OCH(CH3)2. In a still further aspect, when R7ais hydrogen, then R7bis selected from -OCH3, and -OCH2CH3. In a further aspect, when R7ais hydrogen, then R7bis -OCH3.
[0188] In various aspects, each of R7aand R7bis independently selected from hydrogen, -NH2. C1-C4 alkoxy, and C1-C4 aminoalkyl. In a further aspect, each of R7aand R7bis independently selected from hydrogen, -OCH3, -OCH2CH3, -OCH2CH2CH3, -OCH(CH3)2, -NCHS, -NCH2CH3, -NCH2CH2CH3, and -NCH(CH3)2. In a still further aspect, each of R7aand R7bis independently selected from hydrogen, -NH2, -OCH3, -OCH2CH3. -NCH3, and -NCH2CH3. In a further aspect, each of R7aand R7bis independently selected from hydrogen, -NH2, -OCH3, -NCH3.
[0189] In various aspects, when R7bis hydrogen, then R7ais selected from -NH2, Cl-C4 alkoxy, and C1-C4 aminoalkyl. In a further aspect, when R7bis hydrogen, then R7ais selected from -NH2, -OCH3, -OCH2CH3, -OCH2CH2CH3, -OCH(CH3)2, -NCH3, -NCH2CH3, -NCH2CH2CH3, and -NCH(CH3)2. In a still further aspect, when R7bis hydrogen, then R7ais selected from -NH2, -OCH3, -OCH2CH3, -NCH3, and -NCH2CH3. In a further aspect, when R7bis hydrogen, then R7ais selected from -NH2, -OCH3, and -NCH3.
[0190] In various aspects, each of R7aand R7bis C1-C4 alkoxy. In a further aspect, each of R7aand R7bis independently selected from -OCH3, -OCH2CH3, -OCH2CH2CH3, -OCH(CH3)2. In a still further aspect, each of R7aand R7bis independently selected from -OCH3, and -OCH2CH3. In a further aspect, each of R7aand R7bis methoxy.(vi) R8GROUPS
[0191] In various aspects, R8is selected from hydrogen, halogen, -NH2, C1-C4 alkyl, C2-C4 alkenyl. C2-C4 alkynyl, C1-C4 ammoalkyl, and -C(O)NH2.
[0192] In various aspects, R8is selected from hydrogen, C1-C4 alkyl, C2-C4 alkenyl, and C2-C4 alkynyl. In a further aspect, R8is selected from hydrogen, methyl, ethyl, propyl, isopropyl, C2-C4 alkenyl, C2-C4 alkynyl.
[0193] In various aspects, R8is hydrogen.Attorney Docket No. 19116.0064P1 (vii) R9AAND R9BGROUPS
[0194] In various aspects, each of R9aand R9bis independently selected from hydrogen, halogen, -NH2, C1-C4 alkyl, C1-C4 alkoxy, and C1-C4 aminoalkyl. In a further aspect, each of R9aand R9bis independently selected from hydrogen, -F. -Cl, -Br. -NH2, methyl, ethyl, propyl, and isopropyl, -OCH3, -OCH2CH3, -OCH2CH2CH3, -OCH(CH3)2, -NCH3, -NCH2CH3, -NCH2CH2CH3, and -NCH(CHS)2. In a still further aspect, each of R9aand R9bis independently selected from hydrogen, -F, -Cl, -NH2, methyl, ethyl, -OCH3, -OCH2CH3, -NCH3, and -NCH2CH3. In a further aspect, each of R9aand R9bis independently selected from hydrogen, -F, -NH2, methyl, -OCH3, and -NCH3.
[0195] In various aspects, at least one of R9aand R9bis halogen, -NH2, C1-C4 alkyl, C1-C4 alkoxy, or C1-C4 aminoalkyl. In a further aspect, at least one of R9aand R9bis -F, - Cl, -Br, -NH2, methyl, ethyl, propyl, and isopropyl, -OCH3, -OCH2CH3, -OCH2CH2CH3, -OCH(CH3)2, -NCH3, -NCH2CH3. -NCH2CH2CH3, and -NCH(CH3)2. In a still further aspect, at least one of R9aand R9bis -F, -Ck-NFh, methyl, ethyl, -OCH3, -OCH2CH3, -NCH3, and -NCH2CH3. In yet a further aspect, at least one of R9aand R9bis -F, -NH2, methyl, -OCH3, and -NCH3.
[0196] In various aspects, each of R9aand R9bis independently selected from hydrogen and C1-C4 alkyl. In a further aspect, each of R9aand R9bis independently selected from hydrogen, methyl, ethyl, propyl, and isopropyl. In a still further aspect, each of R9aand R9bis independently selected from hydrogen, methyl, and ethyl. In a further aspect, each of R9aand R9bis independently selected from hydrogen and methyl.
[0197] In various aspects, each of R9aand R9bis CI-C4 alkyl. In a further aspect, each of R9aand R9bis independently selected from methyl, ethyl, propyl, and isopropyl. In a still further aspect, each of R9aand R9bis independently selected from methyl, and ethyl. In a further aspect, each of R9aand R9bis methyl.(viii) AR1GROUPS
[0198] In various aspects, Ar1is selected from a 5- to 10-membered heteroaryl and a 6- to 10-membered aryl, and is substituted with 0, 1, 2, or 3 groups independently selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alkyd, C2-C4 alkenyl, C1-C4 haloalkyl, Cl-C4 cyanoalkyl, C1-C4 hydroxyalkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. In a further aspect, Ar1is selected from a 5- to 10-membered heteroaryl and a 6- to 10-membered aryl, and is substituted with 0,Attorney Docket No. 19116.0064P1 1, or 2 groups independently selected from halogen. -CN, -NH2, -OH. -NO2, C1-C4 alkyl, C2-C4 alkenyl, C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxyalkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. In a still further aspect, Ar1is selected from a 5- to 10-membered heteroaryl and a 6- to 10-membered arylAr1is selected from a 5- to 10-membered heteroaryl and a 6- to 10-membered aryl, and is substituted with 0 or 1 group selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alkyl, C2-C4 alkenyl, C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxyalkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. In yet a further aspect, Ar1is selected from a 5- to 10-membered heteroaryl and a 6- to 10-membered aryl, and is monosubstituted with a group selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alkyl, C2-C4 alkenyl, C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxy alkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. In an even further aspect, Ar1is selected from a 5- to 10-membered heteroaryl and a 6- to 10-membered aryl, and is unsubstituted.
[0199] In various aspects, Ar1is a 6- to 10-membered aryl substituted with 0, 1, 2, or 3 groups independently selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alkyl, C2-C4 alkenyl, C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxyalkyl, C1-C4 haloalkoxy. Cl-C4 alkoxy, C1-C4 alkylamino. (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. In a further aspect, Ar1is a 6- to 10-membered aryl substituted with 0, 1, or 2 groups independently selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alkyd, C2-C4 alkenyl, C1-C4 haloalky l. C1-C4 cyanoalkyl, C1-C4 hydroxyalkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alky lamino. (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalky l. In a still further aspect, Ar1is a 6- to 10-membered aryl substituted with 0 or 1 group selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alkyl, C2-C4 alkeny l, C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxy alkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. In yet a further aspect. Ar1is a 6- to 10-membered ary l monosubstituted with a group selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alkyl, C2-C4 alkenyl, C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxyalky 1, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alky lamino, (C1-C4)(C1-C4) dialky lamino, and C1-C4 aminoalkyl. In an even further aspect. Ar2is an unsubstituted 6- to 10-membered aryl.
[0200] In various aspects, Ar1is a 6-membered aryl substituted with 0, 1. 2, or 3 groups independently selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alky 1, C2-C4Attorney Docket No. 19116.0064P1alkenyl, C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxy alkyl. C1-C4 haloalkoxy. Cl-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. In a further aspect, Ar1is a 6-membered aryl substituted with 0, 1, or 2 groups independently selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alkyl, C2-C4 alkenyl, C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxyalkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. In a still further aspect. Ar1is a 6-membered aryl substituted with 0 or 1 group selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alkyl, C2-C4 alkenyl, C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxy alkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. In yet a further aspect. Ar1is a 6-membered aryl monosubstituted with a group selected from halogen, -CN, -NH2, -OH, -NO2, Cl -C4 alkyl, C2-C4 alkenyl, C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxyalkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. In an even further aspect. Ar2is an unsubstituted 6-membered aryl.
[0201] In various aspects. Ar1is a 5- to 10-membered heteroaryl substituted with 0, 1, 2, or 3 groups independently selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alkyl, C2-C4 alkenyl, C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxyalkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. Examples of 5- to 10-membered heteroaryls include, but are not limited to, oxazole, oxadiazole, indole, indazole, isoindole, pyrazole, triazole, benzothiazole, benzoxazole, quinolone, isoquinoline, pyridine, pyrimidine, and pyrazine. In a further aspect, Ar1is a 5- to 10-membered heteroaryl substituted with 0, 1, or 2 groups independently selected from halogen. -CN. -NH2, -OH, -NO2, C1-C4 alkyl, C2-C4 alkenyl, C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxy alkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. In a still further aspect, Ar1is a 5- to 10-membered heteroaryl substituted with 0 or 1 group selected from halogen, -CN, -NH2, -OH. -NO2, C1-C4 alkyl, C2-C4 alkenyl, C1-C4 haloalkyl. C1-C4 cyanoalkyl, C1-C4 hydroxyalkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. In yet a further aspect, Ar1is a 5- to 10-membered hcteroary I monosubstituted with a group selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alkyl, C2-C4 alkenyl. C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxyalkyl, Cl-C4 haloalkoxy. C1-C4 alkoxy. C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. In an even further aspect, Ar1is an unsubstituted 5- to 10-membered heteroaryl.Attorney Docket No. 19116.0064P1
[0202] In various aspects, Ar1is a 5 -membered heteroaryl substituted with 0, 1, or 2 groups independently selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alkyd, C2-C4 alkenyl, C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxyalkyl, C1-C4 haloalkoxy, Cl-C4 alkoxy, C1-C4 alky lamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl. In a still further aspect, Ar1is a 5-membered heteroaryl substituted with 0 or 1 group selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alky 1, C2-C4 alkenyl, C1-C4 haloalkyl, Cl-C4 cyanoalkyl, C1-C4 hydroxyalkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialky lamino, and C1-C4 aminoalkyl. In yet a further aspect, Ar1is a 5-membered heteroaryl monosubstituted with a group selected from halogen, -CN. -NH2, -OH, -NO2. C1-C4 alkyl. C2-C4 alkenyl, C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxy alkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkydamino, and C1-C4 aminoalkyl. In an even further aspect, Ar1is an unsubstituted 5-membered heteroaryl.d. SYNTEF COMPOUNDS
[0203] In various aspects, the SynTEF has a structure represented by a formula selected from:andn wherein n is an integer selected from 1 to 20; wherein q is 0 or 1; wherein u is an integer selected from 1 to 20; wherein R1is selected from:Attorney Docket No. 19116.0064P1andwherein R10is selected from hydrogen, -NO2, and -C(O)NH2; and wherein R11is selected ( )from hydrogen and C1-C4 alkyl; and wherein each occurrence of is independently selected from:wherein * denotes a bond connected to -C(O)- and ** denotes a bond connected to -NH-; wherein each of R12and R13is independently selected from hydrogen and methyl; and wherein R14is the BET binding ligand, or a pharmaceutically acceptable salt thereof.
[0204] In various aspects, the SynTEF has a structure represented by a formula selected from:Attorney Docket No. 19116.0064P1or a pharmaceutically acceptable salt thereof.
[0205] In various aspects, the SynTEF is selected from:ciAttorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1or a pharmaceutically acceptable salt thereof.
[0206] In various aspects, the SynTEF is selected from:Attorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1andor a pharmaceutically acceptable salt thereof.
[0207] In various apects, the SynTEF is:Attorney Docket No. 19116.0064P1
[0208] In various apects, the SynTEF is:d. EXAMPLE SYNTEF COMPOUNDS
[0209] In one aspect, a SynTEF can be present as one or more of the following structures:Attorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1oCl 0 oxAttorney Docket No.19116.0064P1Attorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1or a pharmaceutically acceptable salt thereof.
[0210] It is contemplated that one or more SynTEF compounds can optionally be omitted from the disclosed invention.
[0211] It is understood that the disclosed SynTEF compounds can be used in connection with the disclosed methods, compositions, kits, and uses.
[0212] It is understood that pharmaceutically acceptable derivatives of the disclosed SynTEF compounds can be used also in connection with the disclosed methods, compositions, kits, and uses. The pharmaceutically acceptable derivatives of the SynTEF compounds can include any suitable derivative, such as pharmaceutically acceptable salts, isomers, radiolabeled analogs, tautomers, and the like.2. EPIGENETIC INHIBITORS
[0213] In one aspect, disclosed are combinations involving an epigenetic inhibitor. In various aspects, the epigenetic inhibitor is selected from an histone deacetylase (HD AC) inhibitor, a non-receptor tyrosine kinase ABL proto-oncogene 1 (ABL1) inhibitor, anon-receptor tyrosine kinase ABL proto-oncogene (ABL) inhibitor, an acetylcholinesterase inhibitor, an adrenoceptor alpha 2A inhibitor, an adrenoceptor alpha 2C inhibitor, an AKT serine / threonine kinase 1 inhibitor, an apolipoprotein Al inhibitor, an aurora kinase inhibitor, a butyrlcholinesterase inhibitor, a BCL2 apoptosis regulator inhibitor, a BCL2 like 1 inhibitor, a bromodomain (BRD) inhibitor, a calcium voltage-gated channel subunit alphal B inhibitor, a cyclin T1 inhibitor, a CD274 molecule inhibitor, a cyclin dependent kinase inhibitor, a cholinergic receptor muscarinic inhibitor, a cAMP responsive element binding protein inhibitor, a CREB binding lysine acety ltransferase inhibitor, a catenin beta inhibitor, a DNA methyltransferase inhibitor, an epidermal growth factor receptor inhibitor, an egl-9 family hypoxia inducible factor inhibitor, an euchromatic histone lysine methyltransferaseAttorney Docket No. 19116.0064P1 inhibitor, an EP300 lysine acetyltransferase inhibitor, an erb-b2 receptor tyrosine kinase inhibitor, a fibroblast growth factor receptor inhibitor, a fms related receptor tyrosine kinase inhibitor, a forkhead box Al inhibitor, a Src family tyrosine kinase FYN proto-oncogene inhibitor, a glycogen synthase kinase beta inhibitor, a hypoxia inducible factor 1 subunit alpha (HIF1A) inhibitor, an interferon alpha 1 inhibitor, an insulin like growth factor 1 receptor inhibitor, an interleukin inhibitor, a Janus kinase inhibitor, a lysine demethylase inhibitor, a lysine acetyltransferase inhibitor, a lysine methyltransferase inhibitor, a Src family tyrosine kinase LCK proto-oncogene inhibitor, a mitogen-activated protein kinase kinase inhibitor, a mitogen-activated protein kinase kinase kinase inhibitor, a microtubule affinity regulating kinase inhibitor, a metallo-beta-lactamase domain containing inhibitor, a menin inhibitor, a mechanistic target of rapamycin kinase inhibitor, a bHLH transcription factor MY C proto-oncogene inhibitor, a nicotinamide phosphoribosyltransferase inhibitor, a nuclear receptor subfamily 4 group A member 2 inhibitor, a nuclear receptor binding SET domain protein inhibitor, a neurotrophic receptor tyrosine kinase inhibitor, a NUAK family kinase inhibitor, a purinergic receptor P2X 7 inhibitor, a prolyl 4-hydroxylase subunit alpha 1 inhibitor, a phosphodiesterase 5 A inhibitor, a platelet derived growth factor receptor beta inhibitor, a serine / threonine Pirn proto-oncogene inhibitor, a proline rich transmembrane protein inhibitor, a polo like kinase inhibitor, a protein kinase AMP-activated catalytic subunit inhibitor, a protein kinase C alpha inhibitor, a platelet activating factor receptor inhibitor, a ret proto-oncogene inhibitor, a salt inducible kinase inhibitor, a SIK family kinase inhibitor, a sirtuin inhibitor, a solute carrier family member inhibitor, a non-receptor tyrosine kinase SRC proto-onocogene inhibitor, a signal transducer and activator of transcription inhibitor, a DNA topoisomerase inhibitor, a DNA topoisomerase alpha inhibitor, and a WD repeat domain inhibitor. In various further aspects, the epigenetic inhibitor is a histone deacety lase (HD AC) inhibitor. In various further aspects, the epigenetic inhibitor is a HIF1 A inhibitor.
[0214] Exemplary epigenetic inhibitors are provided in Table 1 below.TABLE 1.Epigenetic Inhibitor Ratio Target Target Target Symbol Target Name Category ABL proto0.4430530DANUSERTIB ABL1 ABL1 oncogene 1. nonKinases 87 receptor tyrosinekinaseAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category ABL proto0.3291430KW-2449 ABL1 ABL1 oncogene 1, nonKinases 34 receptor tyrosinekinaseABL protoXL-228 | XL228 | XL 0.0276342ABL1 ABL1 oncogene 1. non228 66 receptor tyrosine Kinases kinaseABL protoXL-228 | XL228 | XL 0.0276342 oncogene 2. non228 66 ABL2 ABL2 receptor tyrosine Kinases kinase CHELERYTHRINE 3.0995135 acetylcholinesterase Other ACHE ACHE CHLORIDE 79 (Y t blood group) Enzymes G protein- 1.6721886 ADRA2 ADRA2 adrenoceptor alphaSGC-CBP30 79 A A 2A coupled receptors G protein- 1.6721886 ADRA2 ADRA2 adrenoceptor alphaSGC-CBP3079 coupled C C 2Creceptors AKT2.9818003PARIS SAPONIN VII AKT1 AKT137 serine / threonine Kinases kinase 1Other 0.3839926RVX-297 APOA1 APOA1 apolipoprotein Al protein 46targets 0.4430530DANUSERTIB 87 AURKA AURKA aurora kinase A Kinases 0.0249814U20497 / 6 / 2 AURKA AURKA aurora kinase A Kinases 01SCH-1473759 0.2790806AURKA AURKA(HYDROCHLORIDE) 84 aurora kinase A Kinases 0.0382878AT9283 AURKA AURKA88 aurora kinase A Kinases 0.4696594BI-847325 AURKA AURKA39 aurora kinase A Kinases 0.0757511CENISERTIB AURKA AURKA42 aurora kinase A Kinases AKI603 0.1076192 AURKA AURKA aurora kinase A Kinases 410.4430530DANUSERTIB AURKB AURKB87 aurora kinase B Kinases GSK1070916 0.4991793 AURKB AURKB aurora kinase B KinasesAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category 47SCH-1473759 0.2790806AURKB AURKB(HYDROCHLORIDE) 84 aurora kinase B Kinases 0.1360289HESPERADIN AURKB AURKB aurora kinase B Kinases 430.4430530DANUSERTIB87 AURKC AURKC aurora kinase C Kinases GSK 1070916 0.4991793AURKC AURKC aurora kinase C Kinases 47CHELERYTHRINE 3.0995135 Other BCHE BCHE butyrylcholinesteras CHLORIDE 79 e Enzymes Other 2.9818003 BCL2 apoptosisPARIS SAPONIN VII 37 BCL2 BCL2 regulator protein targets Other CHELERYTHRINE 3.0995135CHLORIDE 79 BCL2L1 BCL2L1 BCL2 like 1 protein targets Bromodom 0.0888570 bromodomain ain- JQ1 75 BRD2 BRD2 containing 2 containing proteins Bromodom 0.1807148 bromodomain ain- I-BET151 BRD2 BRD24 containing 2 containing proteins Bromodom 0.0465716 bromodomain ain- OTX015 BRD2 BRD214 containing 2 containing proteins Bromodom I-BET726 0.0755561 BRD2 BRD2 bromodomain ain- 64 containing 2 containing proteins Bromodom 0.0644868 bromodomain ain- ABBV-744 BRD2 BRD211 containing 2 containing proteins Bromodom 0.0725317 bromodomain ain- INCB054329 BRD2 BRD271 containing 2 containing proteins 0.0685642 bromodomain Bromodom HJB97 BRD2 BRD238 containing 2 ain-containingAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category proteins Bromodom 0.0543767 bromodomain ain- (S)-JQ-35 BRD2 BRD271 containing 2 containing proteins Bromodom 0.1725228 bromodomain ain- ML228 BRD2 BRD262 containing 2 containing proteins Bromodom 0.3839926 bromodomain ain- RVX-297 46 BRD2 BRD2 containing 2 containing proteins Bromodom 0.0888570 bromodomain ain- JQ1 75 BRD3 BRD3 containing 3 containing proteins Bromodom 0.1807148 bromodomain ain- I-BET151 4 BRD3 BRD3 containing 3 containing proteins Bromodom 0.0465716 bromodomain ain- OTX015 BRD3 BRD314 containing 3 containing proteins Bromodom 0.0755561 bromodomain ain- I-BET726 BRD3 BRD364 containing 3 containing proteins Bromodom 0.0644868 bromodomain ain- ABBV-744 BRD3 BRD311 containing 3 containing proteins Bromodom 0.0725317 bromodomain ain- INCB054329 71 BRD3 BRD3 containing 3 containing proteins Bromodom 0.0556112 bromodomain ain- MZP-55 08 BRD3 BRD3 containing 3 containing proteins Bromodom 0.0685642 bromodomain ain- HJB97 BRD3 BRD338 containing 3 containing proteinsAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category Bromodom 0.0543767 bromo ain- (S)-JQ-35 BRD3 BRD3 domain71 containing 3 containing proteins Bromodom 0.1725228 bromodomain ain- ML228 BRD3 BRD362 containing 3 containing proteins Bromodom 0.3839926 bromodomain ain- RVX-297 46 BRD3 BRD3 containing 3 containing proteins Bromodom 0.1194312 bromodomain ain- BI-2536 37 BRD4 BRD4 containing 4 containing proteins Bromodom 0.0888570 bromodomain ain- JQ1 BRD4 BRD475 containing 4 containing proteins Bromodom 0.0894128 bromodomain ain- I-BET-762 BRD4 BRD473 containing 4 containing proteins Bromodom 0.1807148 bromodomain ain- T-BET151 BRD4 BRD44 containing 4 containing proteins Bromodom 0.3198133 bromodomain ain- BROMOSPORINE BRD4 BRD402 containing 4 containing proteins Bromodom 0.0696124 bromodomain ain- CPI-203 BRD4 BRD499 containing 4 containing proteins Bromodom 0.0465716 bromodomain ain- OTX015 14 BRD4 BRD4 containing 4 containing proteins Bromodom I-BET726 0.0755561 BRD4 BRD4 bromodomain ain- 64 containing 4 containing proteins 0.0561671 bromodomainBET-BAY 002 BRD4 BRD4 Bromodom 57 containing 4 ain-Attorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category containing proteins Bromodom 0.0946218 bromodomain ain- CPI7 59 BRD4 BRD4 containing 4 containing proteins Bromodom 0.1789975 bromodomain ain- ARV-825 53 BRD4 BRD4 containing 4 containing proteins Bromodom 0.1247962 bromodomain ain- AZD5153 27 BRD4 BRD4 containing 4 containing proteins Bromodom BI TOOL CMPD 0.0687962 BRD4 BRD4 bromodomain ain- 14 containing 4 containing proteins Bromodom 0.0644868 bromodomain ain- ABBV-744 BRD4 BRD411 containing 4 containing proteins Bromodom 0.0853062 bromodomain ain- INCB-057643 BRD4 BRD456 containing 4 containing proteins Bromodom 0.2047571 bromodomain ain- PLX-51107 27 BRD4 BRD4 containing 4 containing proteins Bromodom 0.0305152 bromodomain ain- DBET6 73 BRD4 BRD4 containing 4 containing proteins Bromodom 0.0725317 bromodomain ain- INCB054329 BRD4 BRD471 containing 4 containing proteins Bromodom 0.2088263 bromodomain ain- BAY 1238097 BRD4 BRD461 containing 4 containing proteins Bromodom 0.0556629 bromodomain ain- TROTABRESIB BRD4 BRD424 containing 4 containing proteinsAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category Bromodom 1.5389361 ain- LT052 BRD4 BRD4 bromodomain06 containing 4 containing proteins Bromodom 0.0556112 bromodomain ain- MZP-55 BRD4 BRD408 containing 4 containing proteins Bromodom PROTAC BET 0.0328298 bromodomain ain- DEGRADER-2 95 BRD4 BRD4 containing 4 containing proteins Bromodom BET BROMODOMAIN 0.0881799 BRD4 BRD4 bromodomain ain- INHIBITOR 02 containing 4 containing proteins Bromodom 0.0792282 bromodomain ain- GS-626510 BRD4 BRD432 containing 4 containing proteins Bromodom 0.0685642 bromodomain ain- HJB97 BRD4 BRD438 containing 4 containing proteins Bromodom 0.1548743 bromodomain ain- NHWD-870 BRD4 BRD418 containing 4 containing proteins Bromodom 0.0543767 bromodomain ain- (S)-JQ-35 BRD4 BRD471 containing 4 containing proteins Bromodom 0.0772652 bromodomain ain- CF53 BRD4 BRD489 containing 4 containing proteins Bromodom PROTAC BET 0.0187876 ain- BRD4 BRD4 bromodomain DEGRADER- 1 76 containing 4 containing proteins Bromodom ML228 0.1725228 BRD4 BRD4 bromodomain ain- 62 containing 4 containing proteins 0.0505180 bromodomainMS645 BRD4 BRD4 Bromodom 6 containing 4 ain-Attorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category containing proteins Bromodom 0.0588542 bromodomain ain- ALOBRESIB 84 BRD4 BRD4 containing 4 containing proteins Bromodom 0.4915641 bromodomain ain- Y06036 83 BRD4 BRD4 containing 4 containing proteins Bromodom PROTAC BET 0.2431121 bromodomain ain- BRD4 BRD4DEGRADER- 10 81 containing 4 containing proteins Bromodom OXFBD04 0.4175900 BRD4 BRD4 bromodomain ain- 03 containing 4 containing proteins Bromodom BET BROMODOMAIN 0.1059134 bromodomain ain- BRD4 BRD486 containing 4 containing INHIBITOR 1proteins Bromodom 0.3839926 bromodomain ain- RVX-297 BRD4 BRD446 containing 4 containing proteins 0.1360289 CACNA CACNA calcium voltageIon HESPERAD1N43 IB IB gated channelsubunit alphal B channels Other 0.4247447ON123300 T1 CCNT1 CCNT1 cyclin T1 protein targets Other WP1066 0.2131596 CD274 CD274 protein 28 CD274 moleculetargets AURORA KINASE / CDK 0.0622903 CDK1 CDK1 cyclin dependent Kinases 4 kinase 1INHIBITOR RGB-286638 (FREE 0.0310578CDK1 CDK1 cyclin dependentKinases BASE) 09 kinase 10.0321143CGP60474 cyclin dependent75 CDK1 CDK1kinase 1 Kinases AURORA 0.0622903 cyclin dependent KINASE / CDK CDK2 CDK2 Kinases 4 kinase 2 INHIBITORAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category 0.0526193 cyclin dependentTG-02 76 CDK2 CDK2kinase 2 Kinases RGB-286638 (FREE 0.0310578 cyclin dependent CDK2 CDK2 Kinases BASE) 09 kinase 20.0321143CGP60474 cyclin dependent75 CDK2 CDK2kinase 2 Kinases RGB-286638 (FREE 0.0310578 cyclin dependent CDK4 CDK4 Kinases BASE) 09 kinase 40.0321143 cyclin dependent CGP60474 CDK4 CDK4 Kinases 75 kinase 40.4247447 cyclin dependent ON123300 CDK4 CDK4 Kinases 27 kinase 4RGB-286638 (FREE 0.0310578 cyclin dependent CDK5 CDK5 Kinases BASE) 09 kinase 50.0321143 cyclin dependent CGP60474 CDK5 CDK5 Kinases 75 kinase 50.4247447 cyclin dependent ON123300 CDK6 CDK6 Kinases 27 kinase 60.0321143 cyclin dependent CGP60474 CDK7 CDK7 Kinases 75 kinase 70.0526193 cyclin dependent TG-02 CDK9 CDK9 Kinases 76 kinase 9RGB-286638 (FREE 0.0310578 cyclin dependent CDK9 CDK9 Kinases BASE) 09 kinase 90.0321143 cyclin dependent CGP60474 CDK9 CDK9 Kinases 75 kinase 90.4247447 cyclin dependent ON123300 CDK9 CDK9 Kinases 27 kinase 9G protein- 0.4276330 cholinergic receptor STAUROSPORINE CHRM1 CHRM1 coupled 12 muscarinic 1receptors cAMP responsive 1.6721886 Transcrip ti SGC-CBP30 CREB1 CREB1 element binding 79 on factors protein 1Bromodom CREB binding2.3754947 CREBB CREBB ain- E-7386 lysine 65 P P containing acetyltransferaseproteins Bromodom CREB binding0.3772924 CREBB CREBB ain- lysine NICUR 2 P P containing acetyltransferaseproteinsAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category Bromodom 0.0315139 CREBB CREBB CREB binding ain- NEO2734 lysine18 P P containing acetyltransferaseproteins Other 2.3754947 CTNNB CTNNBE-7386 catenin beta 1 protein 65 1 1targets 1.7389959 DNA Other 5 -AZACYTIDINE 86 DNMT1 DNMT1metliyltransferase 1 Enzymes 0.0853098 DNA Other CM-272 DNMT1 DNMT166 metliyltransferase 1 Enzymes CM-579TRIHYDROCHLORID 0.0226935 DNMT1 DNMT1 DNA Other 55E metliyltransferase 1 Enzymes 3.5083251CUDC-101 EGFR EGFR epidermal growth63 factor receptor Kinases egl-9 family ROXADUSTAT | FG- 0.2445803 EGLN1 EGLN1 Other 4592 41 hypoxia inducibleEnzymes factor 1 DAPRODUSTAT; 0.1953611 egl-9 family Other EGLN1 EGLN1GSK1278863 15 hypoxia induciblefactor 1 Enzymes ENARODUSTAT | JTZ- 0.2555931 egl-9 family Other EGLN1 EGLN1 hypoxia inducible951 07factor 1 Enzymes 0.1676631 egl-9 family Other IOX4 EGLN1 EGLN14 hypoxia induciblefactor 1 Enzymes egl-9 family ROXADUSTAT | FG- 0.2445803 EGLN2 EGLN2 Other 4592 41 hypoxia inducible Enzymes factor 2egl-9 family DAPRODUSTAT; 0.1953611 Other GSK 1278863 15 EGLN2 EGLN2 hypoxia inducible Enzymes factor 2 MOLIDUSTAT; BAY 0.2624747 egl-9 family Other EGLN2 EGLN2 hypoxia inducible85-3934 89 factor 2 Enzymes ENARODUSTAT | JTZ- 0.2555931 egl-9 family Other EGLN2 EGLN2951 07 hypoxia induciblefactor 2 Enzymes ROXADUSTAT | FG- 0.2445803 egl-9 family Other EGLN3 EGLN34592 41 hypoxia induciblefactor 3 Enzymes DAPRODUSTAT; 0.1953611 EGLN3 EGLN3 egl-9 family OtherAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category GSK 1278863 15 hypoxia inducible Enzymes factor 3 ENARODUSTAT | JTZ- 0.2555931 egl-9 family Other 951 07 EGLN3 EGLN3 hypoxia induciblefactor 3 Enzymes cuchromatic histo Chromatin 0.4384472 ne UNC0642 EHMT1 EHMT17 lysine modifying 4methyltransferase 1 enzymes euchromatic histone Chromatin 0.4384472UNC0642 EHMT2 EHMT2 lysine modifying 74methyltransferase 2 enzymes Chromatin 0.0853098 euchromatic histoneCM-272 EHMT2 EHMT2 modifying 66 lysine methyltransferase 2 enzymes Bromodom 1.6721886 EP300 lysine ain- SGC-CBP30 79 EP300 EP300acetyltransferase containing proteins 3.5083251 erb-b2 receptorCUDC-101 ERBB2 ERBB263 Kinases tyrosine kinase 2 0.4430530 fibroblast growth DANUSERTIB 87 FGFR1 FGFR1 factor receptor 1 Kinases KW-2449 0.3291430 FGFR1 FGFR1 fibroblast growth34 factor receptor 1 Kinases 0.4247447 fibroblast growth ON123300 FGFR1 FGFR127 factor receptor 1 Kinases 0.4247447ON123300 FGFR2 FGFR2 fibroblast growth27 factor receptor 2 Kinases FEDRATINIB 0.1997541 FLT3 FLT3 fms related receptor64 Kinases tyrosine kinase 3 0.3291430KW-2449 FLT3 FLT3 fms related receptor Kinases 34 tyrosine kinase 3 0.4247447ON123300 FLT3 FLT3 fms related receptor27 Kinases tyrosine kinase 3 0.4247447 fms related receptor ON123300 FLT4 FLT427 Kinases tyrosine kinase 4 0.0888570 Transcripti JQ1 FOXA1 FOXA175 forkhead box Alon factors FYN proto0.0526193TG-02 FYN FYN oncogene, SrcKinases 76 family tyrosinekinaseON123300 0.4247447 FYN FYN FYN proto- KinasesAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category 27 oncogene, Srcfamily tyrosinekinaseRGB-286638 (FREE 0.0310578 glycogen synthaseBASE) 09 GSK3B GSK3Bkinase 3 beta Kinases Chromatin 2.7734439 histone deacetylaseSCRIPT AID2 HDAC1 HDAC1 1 modifying enzymes Chromatin 2.2913585VORINOSTAT histone deacetylase43 HDAC1 HDAC1 1 modifying enzymes Chromatin 1.8962993MOCETINOSTAT histone deacetylase45 HDAC1 HDAC1 modifying 1enzymes Chromatin 1.8580430ENTINOSTAT histone deacetylaseHDAC1 HDAC1 modifying 76 1enzymes 1.5171414 Chromatin DACINOSTAT histone deacetylase modifying 52 HDAC1 HDAC1 1enzymes Chromatin 2.0455078BELINOSTAT histone deacety lase73 HDAC1 HDAC1 1 modifying enzymes Chromatin 2.7934889PRACINOSTAT histone deacetylase73 HDAC1 HDAC1 1 modifying enzymes Chromatin 1.7853517QUISINOSTAT histone deacetylaseHDAC1 HDAC1 modifying 58 1enzymes 1.6221672 Chromatin histone deacetylase PYROXAMIDE modifying 13 HDAC1 HDAC1 1enzymes Chromatin 2.1511694RESMINOSTAT histone deacety lase modifying 79 HDAC1 HDAC1 1enzymes Chromatin 1.6425252RG2833 (RGFP109) 13 HDAC1 HDAC1 histone deacety lase modifying 1enzymes Chromatin HDACS / MTOR 2.7694574 histone deacetylase modifying T 47 HDAC1 HDAC1INHIBI OR 1 1enzymes Chromatin 2.3069371JAK / HDAC-IN-1 histone deacetylaseHDAC1 HDAC1 modifying 21 1 enzymesAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category TUCIDINOSTAT | Chromatin 2.5288665 histone deacetylaseCHID AMIDE | HBI- modifying 6 HDAC1 HDAC1 18000 | CS 055 enzymes Chromatin 1.8176501CXD101 histone deacetylase92 HDAC1 HDAC1 modifying 1enzymes Chromatin EDO-S101; 2.0702296 histone deacetylase modifying TINOSTAMUSTINE 93 HDAC1 HDAC1 1enzymes Chromatin 2.2563464 histone deacetylaseFNDR-20123 modifying 49 HDAC1 HDAC1 1enzymes Chromatin CORIN 1.9324121 histone deacety lase6 HDAC1 HDAC1 modifying 1enzymes Chromatin 2.8114531HDAC-IN-3 histone deacetylase59 HDAC1 HDAC1 1 modifying enzymes Chromatin 2.5265110NANATINOSTAT histone deacetylase modifying 44 HDAC1 HDAC1 1enzymes 2.1776676 Chromatin histone deacetylaseSR-4370 modifying 8 HDAC1 HDAC1 1enzymes Chromatin 2.0470475NAMPT-IN-3 histone deacety lase7 HDAC1 HDAC1 modifying 1enzymes Chromatin QUISINOSTAT 1.7853517 HDAC1 HDAC1 histone deacety lase modifying 58 0 0 10enzymes TUCIDINOSTAT | Chromatin 2.5288665CHID AMIDE | HBI- HDAC1 HDAC1 histone deacetylase modifying 6 0 0 108000 | CS 055 enzymes Chromatin 2.0455078BELINOSTAT HDAC1 HDAC1 histone deacetylase modifying 73 1 1 11 enzy mes Chromatin 1.7853517 HDAC1 HDAC1 histone deacetylase QUISINOSTAT modifying 58 1 1 11enzymes TUCIDINOSTAT | Chromatin 2.5288665CHID AMIDE | HBI- HDAC1 HDAC1 histone deacety lase modifying 6 1 1 118000 | CS 055 enzymes 0.2620397 HDAC1 HDAC1 histone deacety laseAES-135 Chromatin 85 1 1 11 modifyingAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category enzymes Chromatin FT895 0.2103716 HDAC1 HDAC1 histone deacetylase42 1 1 11 modifying enzymes Chromatin 2.2913585VORINOSTAT HDAC2 HDAC2 histone deacetylase modifying 43 2enzymes Chromatin 2.0455078BELINOSTAT HDAC2 HDAC2 histone deacetylase modifying 73 2enzymes 1.7853517 Chromatin histone deacetylase QUISINOSTAT HDAC2 HDAC2 modifying 58 2enzymes TUCIDINOSTAT | Chromatin 2.5288665 histone deacetylaseCHID AMIDE | HBI- HDAC2 HDAC2 modifying 6 28000 | CS 055 enzymes Chromatin 1.8176501CXD101 histone deacetylase92 HDAC2 HDAC2 2 modifying enzymes Chromatin EDO-S101; 2.0702296HDAC2 HDAC2 histone deacetylase modifying TINOSTAMUSTINE 93 2enzymes 2.2563464 Chromatin FNDR-20123 HDAC2 HDAC2 histone deacetylase modifying 49 2enzy mes Chromatin 2.5265110NANATINOSTAT HDAC2 HDAC2 histone deacety lase modifying 44 2enzymes Chromatin SANTACRUZAMATE 2.5005357 HDAC2 HDAC2 histone deacety lase modifying A 01 2enzymes Chromatin 2.1776676SR-4370 histone deacetylase8 HDAC2 HDAC2 2 modifying enzymes Chromatin 2.0470475NAMPT-IN-3 HDAC2 HDAC2 histone deacetylase modifying 7 2enzymes 2.2913585 Chromatin histone deacety lase VORINOSTAT HDAC3 HDAC3 modifying 43 3enzymes Chromatin 2.0455078 histone deacety lase BELINOSTAT HDAC3 HDAC3 modifying 73 3enzymes RESMINOSTAT HDAC3 HDAC3 2.1511694 Chromatin histone deacetylaseAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category 79 3 modifying enzymes Chromatin 1.6425252 histone deacetylaseRG2833 (RGFP109) HDAC3 HDAC3 modifying 13 3enzymes Chromatin TUCIDINOSTAT |2.5288665 histone deacety laseCHID AMIDE | HBI- HDAC3 HDAC3 modifying 6 38000 | CS 055 enzymes Chromatin 1.8176501CXD101 histone deacetylase92 HDAC3 HDAC3 3 modifying enzymes Chromatin EDO-S101; 2.0702296 HDAC3 HDAC3 histone deacetylase modifying TINOSTAMUSTINE 93 3enzymes Chromatin 2.2563464 histone deacetylase FNDR-20123 HDAC3 HDAC3 modifying 49 3enzymes Chromatin 2.5265110 histone deacety lase NANATINOSTAT HDAC3 HDAC3 modifying 44 3enzymes Chromatin 2.1776676 histone deacety lase SR-4370 HDAC3 HDAC3 modifying 8 3enzymes Chromatin 2.0455078 histone deacetylase BELINOSTAT HDAC4 HDAC4 modifying 73 4enzymes Chromatin 1.7853517 histone deacetylase QUISINOSTAT HDAC4 HDAC4 modifying 58 4enzymes Chromatin 2.1912226 histone deacetylaseLMK-235 HDAC4 HDAC4 modifying 15 4enzymes Chromatin 2.0455078 histone deacety lase BELINOSTAT HDAC5 HDAC5 modifying 73 5enzymes Chromatin 2.1912226 histone deacety lase HDAC5 HDAC5 modifying LMK-235 15 5enzymes Chromatin 2.2913585 histone deacetylase VORINOSTAT HDAC6 HDAC6 modifying 43 6enzymes Chromatin 2.1511694 histone deacetylase RESMINOSTAT HDAC6 HDAC6 modifying 79 6 enzymesAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category Chromatin 2.6219705 histone deacetylase ROCILINOSTAT HDAC6 HDAC6 modifying 74 6enzymes Chromatin 2.5291099NEXTURASTAT A HDAC6 HDAC6 histone deacetylase modifying 81 6enzymes Chromatin 1.5898679ACY-738 HDAC6 HDAC6 histone deacetylase modifying 48 6enzymes Chromatin HDACS / MTOR 2.7694574 histone deacetylaseHDAC6 HDAC6 modifying INHIBITOR 1 47 6enzymes Chromatin EDO-S101; 2.0702296 HDAC6 HDAC6 histone deacety lase modifying TINOSTAMUSTINE 93 6enzymes Chromatin CITARINOSTAT; 2.1069242 HDAC6 HDAC6 histone deacetylase modifying ACY241 83 6enzymes Chromatin 2.2563464FNDR-20123 HDAC6 HDAC6 histone deacetylase modifying 49 6enzymes 2.1776676 Chromatin histone deacetylaseSR-4370 HDAC6 HDAC6 modifying 8 6enzymes Chromatin 1.5907647MPT0G211 HDAC6 HDAC6 histone deacety lase modifying 22 6enzymes Chromatin QTX125 (TFA) 1.8238733 HDAC6 HDAC6 histone deacety lase modifying 31 6enzymes Chromatin 2.9541065TRICHOSTATIN A HDAC7 HDAC7 histone deacetylase modifying 61 7enzymes Chromatin 2.0455078BELINOSTAT HDAC7 HDAC7 histone deacetylase modifying 73 7 enzymes Chromatin 2.2913585 histone deacetylase VORINOSTAT HDAC8 HDAC8 modifying 43 8enzymes Chromatin TRICHOSTATIN A 2.9541065 HDAC8 HDAC8 histone deacety lase modifying 61 8enzymes 2.0455078 histone deacety lase BELINOSTAT HDAC8 HDAC8 Chromatin 73 8 modifyingAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category enzymes Chromatin RESMINOSTAT 2.1511694 HDAC8 HDAC8 histone deacetylase modifying 79 8enzymes Chromatin 2.2563464 histone deacetylaseFNDR-20123 HDAC8 HDAC8 modifying 49 8enzymes Chromatin 0.2620397AES-135 HDAC8 HDAC8 histone deacetylase modifying 85 8enzymes 0.1960512 Chromatin histone deacetylaseHDAC8-IN-1 HDAC8 HDAC8 modifying 4 8enzymes Chromatin 2.1776676SR-4370 HDAC8 HDAC8 histone deacetylase modifying 8 8enzymes Chromatin 2.0455078BELINOSTAT histone deacetylase73 HDAC9 HDAC9 9 modifying enzymes 0.0606727 hypoxia inducible ACRIFLAVINE HIF1A HIF1A factor 1 subunit Transcripti 5 on factors alpha0.3730874 hypoxia inducibleMK-8617 HIF1A factor 1 subunit Transcripti HIF1A64 on factors alpha0.2735240 hypoxia inducible TP0463518 HIF1A HIF1A factor 1 subunit Transcripti 95 on factors alphahypoxia inducible 0.4152793 Transcripti DMOG 87 HIF1A HIF1A factor 1 subuniton factors alpha0.4650775TILORONE IFNA1 IFNA1 interferon alpha 164 Cytokine XL-228 | XL228 | XL 0.0276342 insulin like growthIGF1R IGF1R228 66 factor 1 receptor Kinases CPI-203 0.0696124 IL6 IL6 interleukin 699 Cytokine 0.3839926RVX-297 IL6 IL6 interleukin 646 Cytokine 0.0490628JAK2-IN-7 31 JAK1 JAK1 Janus kinase 1 Kinases 0.1997541FEDRATINIB JAK2 JAK264 Janus kinase 2 KinasesAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category 0.1345297TG101209 JAK2 JAK243 Janus kinase 2 Kinases 0.4909506CEP-33779 JAK2 JAK2 Janus kinase 2 Kinases 80.1888556FLLL32 JAK2 JAK217 Janus kinase 2 Kinases ILGINATINIB 0.3576275JAK2 JAK2 Janus kinase 2 Kinases HYDROCHLORIDE 19RGB-286638 (FREE 0.0310578JAK2 JAK2 Janus kinase 2 Kinases BASE) 092.3069371JAK / HDAC-IN-1 JAK2 JAK221 Janus kinase 2 Kinases 0.1066639BREVILIN A JAK2 JAK2 Janus kinase 2 Kinases 80.0490628JAK2-IN-7 JAK2 JAK2 Janus kinase 2 Kinases 310.4461612G5-7 JAK2 JAK2 Janus kinase 2 Kinases 48Chromatin 0.1924025 J ARID 1 lysine demethylaseJIB-04 KDM5A modifying 61 A 5Aenzymes Chromatin 0.3950646 lysine demethylaseML324 JMJD2 KDM4A modifying 91 4Aenzymes Chromatin 0.1924025 lysine demethylaseJIB-04 JMJD2A KDM4A modifying 61 4Aenzymes Chromatin 0.1924025 lysine demethylaseJIB-04 JMJD2B KDM4B modifying 61 4Benzymes Chromatin 0.1924025 lysine demethylaseJIB-04 JMJD2C KDM4C modifying 61 4Cenzymes Chromatin 0.1924025 lysine demethylaseJIB-04 JMJD2D KDM4D modifying 61 4Denzymes Chromatin 0.1924025 lysine demethylaseJIB-04 JMJD2E KDM4E modifying 61 4Eenzymes Chromatin 0.1924025 lysine demethylaseJIB-04 JMJD3 KDM6B modifying 61 6Benzymes PF-9363 0.4332913 KAT6A KAT6A lysine ChromatinAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category 87 acetyltransferase 6A modifying enzymes Chromatin 0.4332913 lysinePF-9363 KAT6B KAT6B modilying 87 acetyltransferase 6Benzymes Chromatin 0.2454902 lysine demethylaseSP-2509 KDM1A KDM1A modilying 33 1Aenzymes Chromatin 0.1893982SECLIDEMSTAT 23 KDM1A KDM1A lysine demethylase modifying 1Aenzymes DDP-38003 Chromatin (TRIHYDROCHLORID 0.4729012 KDM1A KDM1A lysine demethylase modilying 91 1AE) enzymes Chromatin 1.9324121CORIN KDM1A KDM1A lysine demethylase modifying 6 1Aenzymes 0.2609670 Chromatin lysine demethylasePFI-90 KDM3B KDM3B modilying 82 3Benzymes Chromatin 0.4053535 lysine demethylase NCGC00247743 78 KDM4A KDM4A 4A modilying enzymes Chromatin 0.3950646ML324 lysine demethylase91 KDM4B KDM4B 4B modilying enzymes Chromatin 0.2860086NCGC00244536 KDM4B KDM4B lysine demethylase modifying 33 4Benzymes 0.1579885 Chromatin lysine demethylaseAS8351 KDM5B KDM5B modilying 66 5Benzymes Chromatin 0.2822507 lysineBVT 948 KMT5A KMT5A modilying 72 methyltransferase5A enzymes LCK proto0.0526193TG-02 LCK LCK oncogene, SrcKinases 76 family tyrosinekinaseLCK proto0.4247447ON123300 LCK LCK oncogene, Src27 Kinases family tyrosinekinaseON123300 0.4247447 LYN LYN LYN proto - Kinasesoncogene. SrcAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category 27 family tyrosinekinaseRGB-286638 (FREE 0.0310578 MAP2K MAP2K mitogen-activatedBASE) 09 1 1 protein kinase Kinases kinase 10.4696594 MAP2K MAP2K mitogen-activatedBI-847325 protein kinase39 1 1 Kinases kinase 1mitogen-activated 0.4247447 MAP3K MAP3KON123300 protein kinase27 20 20 Kinases kinase kinase 20RGB-286638 (FREE 0.0310578 MAP3K MAP3K mitogen-activatedprotein kinase Kinases BASE) 09 7 7kinase kinase 72.9818003 mitogen-activatedPARIS SAPONIN VII MAPK1 MAPK137 Kinases protein kinase 1 0.2240151 microtubule affinityMRT 199665 32 MARK1 MARK1 regulating kinase 1 Kinases 0.2240151MRT 199665 MARK2 MARK2 microtubule affinity32 regulating kinase 2 Kinases 0.2240151MRT 199665 MARK3 MARK3 microtubule affinity32 regulating kinase 3 Kinases 0.2240151MRT 199665 MARK4 MARK4 microtubule affinity32 regulating kinase 4 Kinases 1.8298207 MBLAC MBLA metallo-beta- Other WT-161 Clactamase domain34 2 2containing 2 Enzymes Other MENIN-MLL 0.0488946MEN1 MEN1 menin 1 protein INHIBITOR 20 06targets HDACS / MTOR 2.7694574 mechanistic targetMTOR MTOR Kinases INHIBITOR 1 47 of rapamycin kinase0.07 MYC protoINCB054329 25317MYC MYC oncogene. bHLH Transcrip ti 71transcription factor on factors 2.0470475 nicotinamide Other NAMPT-IN-3 7 NAMPT NAMPT phosphoribosyltrans Enzymes ferase AMODIAQUIN nuclear receptor Nuclear 0.4530413DIHYDROCHLORIDE 64 NR4A2 NR4A2 subfamily 4 group hormone DIHYDRATE A member 2 receptors NSC-663284| 6- 0.1876893 nuclear receptor Chromatin CHLORO-7-(2- NSD2 NSD215 binding SET modifyingMORPHOLIN-4-YL-Attorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category ETHYL AMINO)QUIN domain protein 2 enzymes OLINE-5, 8-DIONE0.4430530 neurotrophic DANUSERTIB NTRK1 NTRK1 receptor tyrosine87 Kinases kinase 10.4247447 NUAK familyON123300 NUAK1 NUAK1 Kinases 27 kinase 1 CHELERYTHRINE 3.0995135 Ion P2RX7 P2RX7 purinergic receptor CHLORIDE 79 P2X 7 channels prolyl 4- 1.4-DPCA ETHYL 0.4243904 P4HA1 P4HA1 Other ESTER 73 hydroxylase subunit Enzymes alpha 11.6721886 Other SGC-CBP30 PDE5A PDE5A phosphodiesterase79 5A Enzymes 0.4247447 PDGFR platelet derived ON123300 PDGFR growth factor27 B B Kinases receptor betaPim-1 proto0.1825963 oncogene,M-110 PIM1 PIM196 Kinases serine / threoninekinasePim-1 protoGDC-0339 0.4022797 PIM1 PIM1 oncogene,91 Kinases serine / threoninekinasePim-2 proto0.1825963M-110 PIM2 PIM2 oncogene,96 Kinases serine / threoninekinasePim-2 proto0.4022797GDC-0339 PIM2 PIM2 oncogene,91 Kinases serine / threoninekinasePim-3 proto0.1825963 oncogene,M-110 96 PIM3 P1M3serine / threonine Kinases kinasePim-3 pro to - 0.4022797 oncogene,GDC-0339 PIM3 PIM391 Kinases serine / threoninekinaseproline rich Other 0.0321143CGP60474 protei 75 PKC PRRT2 transmembrane n protein 2 targetsAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category 0.1194312BI-2536 37 PLK1 PLK1 polo like kinase 1 Kinases protein kinase0.2240151 PRKAA PRKAAMRT 199665 AMP-activated32 1 1 catalytic subunit Kinases alpha 1protein kinase0.4676802 PRKAA PRKAA AMP-activatedRSVA405 59 2 2 catalytic subunit Kinases alpha 2protein kinase0.2240151 PRKAA PRKAA AMP-activatedMRT 199665 32 2 2 catalytic subunit Kinases alpha 20.0321143 protein kinase C CGP60474 75 PRKCA PRKCAalpha Kinases HYPOCRELLIN A 0.0690940 PRKCA PRKCA protein kinase C Kinases 4 alphaG protein- 1.6721886 platelet activatingSGC-CBP30 PTAFR PTAFR79 factor receptor coupled receptors DANUSERTIB 0.4430530 RET RET ret proto-oncogene Kinases 870.4247447ON123300 RET RET27 ret proto-oncogene Kinases 0.2240151MRT 199665 SIK1 SIK1 salt inducible kinase32 1 Kinases 0.2240151MRT 199665 SIK2 SIK2 salt inducible kinase Kinases 32 20.2240151MRT 199665 32 SIK3 SIK3 SIK family kinase 3 Kinases 0.4864064 Chromatin SRT1720 SIRT1 SIRT1 sirtuin 1 modifying 13enzymes 0.0606727 SLC16A SLC16A solute carrier family Transporter ACRIFLAVINE5 4 4 16 member 4 s 0.2822507 SLC25A SLC25A Transporter BVT 948 solute carrier family72 3 3 25 member 3 s SRC protoXL-228 | XL228 | XL 0.0276342 oncogene, non228 66 SRC SRC receptor tyrosine Kinases kinaseWP1066 signal transducer 0.2131596 STAT3 STAT3 Transcripti and activator ofAttorney Docket No. 19116.0064P1Epigenetic Inhibitor Ratio Target Target Target Name Target Symbol Category 28 transcription 3 on factors signal transducerFLLL32 0.1888556 STAT3 STAT3 and activator of Transcripti 17 on factors transcription 3signal transducer0.1066639BREVILIN A STAT3 STAT3 and activator of Transcripti 8 on factors transcription 3signal transducer0.4676802RSVA405 STAT3 STAT3 and activator of Transcripti 59transcription 3 on factors 0.4461612 signal transducer Transcripti G5-7 STAT3 STAT3 and activator of48 transcription 3 on factors 0.2897482 Other CAMPTOTHECIN DNA topoisomerase84 TOPI TOPI I Enzymes 0.0713998MI DNA topoisomerase Other TOXANTHRONE TOP2A TOP2A66 II alpha Enzymes DOXORUBICIN 0.0244389 DNA topoisomerase Other (HYDROCHLORIDE) 57 TOP2A TOP2AII alpha Enzymes Other 0.2146640 WD repeat domainNA WDR5 WDR5 protein 23 5targetsa. HDAC INHIBITORS
[0215] In one aspect, the epigenetic inhibitor is a histone deacetylase (HDAC) inhibitor. HDAC inhibitors are commercially available or can be prepared by methods known in the art.
[0216] In various aspects, the HDAC inhibitor is selected from Dacinostat, ACY-738, MPT0G211, Pyroxamide, RG2833 (RGFP109). Quisinostat, CXDI01, QTX125 (TFA), WT-161, Entinostat, Mocetinostat, Corin, Belinostat, NAMPT-IN-3, EDO-S101 (Tinostamustine), Citarinostat (ACY241), Resminostat, SR-4370, LMK-235, FNDR-20123, Vorinostat, JAK / HDAC-IN-1, Santacruzamate A, Nanatinostat, Tucidinostat (chidamide, HBI-8000, CS 055), Nexturastat A, Rocilinostat, RDACs / mTOR Inhibitor 1, Scriptaid, Pracinostat, HDAC-IN-3, Trichostatin A, CUDC-101, and Givinostat.
[0217] In various aspects, the HDAC inhibitor is selected from Abexinostat (PCI-24781), Alteminostat (CKD581), AR42 (OSU-HDAC42), Belinostat (PDX101), Chidamide (Tucidinostat, CS055). Citarinostat (ACY241), CKD504, CKD506, CXD101, Decitabine,Attorney Docket No. 19116.0064P1 Domatinostat (4SC202), Entinostat (MS-275, SNDX-275), FRM-0334. Givinostat (ITF-2357), HG146, MBF-015, Mocetinostat (MGCD0103), Nicotinamide, Panobinostat (LHB-589), Phenyl butyrate, Pivanex, Pracinostat (SB939), Quisinostat, Remetinostat (SHP141), Resminostat (4SC-201), Ricolinostat (ACY-1215), Romidepsine (depsopeptide, FR901228, FK228, Istodax). Tacedinaline (CI994), Tefinostat (CHR2845). Valproic acid, and Vorinostat (MK-0683, SAHA).
[0218] In various aspects, the HD AC inhibitor is selected from Belinostat and Romidepsin.
[0219] In various aspects, the HD AC inhibitor is HDACi-109, having a structure:
[0220] In various aspects, the structure of the HD AC inhibitors is selected from:Attorney Docket No. 19116.0064P1OHNHHOAttorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1N=NAttorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1OHAttorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1C. METHODS OF TREATING A DISORDER ASSOCIATED WITH DYSREGULATION OF FRATAXIN (FXN) EXPRESSION IN A SUBJECT
[0221] In one aspect, disclosed are methods of treating a disorder associated with dysregulation of frataxin (FXN) expression in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic transcription elongation factor (SynTEF) and an epigenetic inhibitor. In various aspects, the epigenetic inhibitor is selected from an histone deacetylase (HD AC) inhibitor, a non-receptor tyrosine kinase ABL proto-oncogene 1 (ABL1) inhibitor, a non-receptor tyrosine kinase ABL protooncogene (ABL) inhibitor, an acetylcholinesterase inhibitor, an adrenoceptor alpha 2A inhibitor, an adrenoceptor alpha 2C inhibitor, an AKT serine / threonine kinase 1 inhibitor, an apolipoprotein Al inhibitor, an aurora kinase inhibitor, a butyrlcholinesterase inhibitor, a BCL2 apoptosis regulator inhibitor, a BCL2 like 1 inhibitor, a bromodomain (BRD) inhibitor, a calcium voltage-gated channel subunit alphal B inhibitor, a cyclin T1 inhibitor, a CD274 molecule inhibitor, a cyclin dependent kinase inhibitor, a cholinergic receptor muscarinic inhibitor, a cAMP responsive element binding protein inhibitor, a CREB binding lysine acetyltransferase inhibitor, a catenin beta inhibitor, a DNA methyltransferase inhibitor, an epidermal growth factor receptor inhibitor, an egl-9 family hypoxia inducible factor inhibitor,Attorney Docket No. 19116.0064P1 an euchromatic histone lysine methyltransferase inhibitor, an EP300 lysine acetyltransferase inhibitor, an erb-b2 receptor tyrosine kinase inhibitor, a fibroblast growth factor receptor inhibitor, a fms related receptor tyrosine kinase inhibitor, a forkhead box Al inhibitor, a Src family tyrosine kinase FYN proto-oncogene inhibitor, a glycogen synthase kinase beta inhibitor, a hypoxia inducible factor 1 subunit alpha (HIF1A) inhibitor, an interferon alpha 1 inhibitor, an insulin like growth factor 1 receptor inhibitor, an interleukin inhibitor, a Janus kinase inhibitor, a lysine demethylase inhibitor, a lysine acety ltransferase inhibitor, a lysine methyltransferase inhibitor, a Src family tyrosine kinase LCK proto-oncogene inhibitor, a mitogen-activated protein kinase kinase inhibitor, a mitogen-activated protein kinase kinase kinase inhibitor, a microtubule affinity regulating kinase inhibitor, a metallo-beta-lactamase domain containing inhibitor, a menin inhibitor, a mechanistic target of rapamycin kinase inhibitor, abHLH transcription factor MYC proto-oncogene inhibitor, a nicotinamide phosphoribosyltransferase inhibitor, a nuclear receptor subfamily 4 group A member 2 inhibitor, a nuclear receptor binding SET domain protein inhibitor, a neurotrophic receptor tyrosine kinase inhibitor, a NUAK family kinase inhibitor, a purinergic receptor P2X 7 inhibitor, a prolyl 4-hydroxylase subunit alpha 1 inhibitor, a phosphodiesterase 5A inhibitor, a platelet derived growth factor receptor beta inhibitor, a serine / threonine Pirn protooncogene inhibitor, a proline rich transmembrane protein inhibitor, a polo like kinase inhibitor, a protein kinase AMP-activated catalytic subunit inhibitor, a protein kinase C alpha inhibitor, a platelet activating factor receptor inhibitor, a ret proto-oncogene inhibitor, a salt inducible kinase inhibitor, a SIK family kinase inhibitor, a sirtuin inhibitor, a solute carrier family member inhibitor, a non-receptor tyrosine kinase SRC proto-onocogene inhibitor, a signal transducer and activator of transcription inhibitor, a DNA topoisomerase inhibitor, a DNA topoisomerase alpha inhibitor, and a WD repeat domain inhibitor. In various further aspects, the epigenetic inhibitor is a histone deacetylase (HD AC) inhibitor. In various further aspects, the epigenetic inhibitor is a HIF1A inhibitor.
[0222] In one aspect, disclosed are methods of treating a disorder associated with dysregulation of frataxin (FXN) expression in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic transcription elongation factor (SynTEF) and a histone deacetylase (HD AC) inhibitor.
[0223] In various aspects, the disorder is Friedreich’s ataxia or SCA27b. In a further aspect, the disorder is Friedreich’s ataxia. In a still further aspect, the disorder is SCA27b.
[0224] In various aspects, the SynTEF comprises a polyamide moiety’ configured toAttorney Docket No. 19116.0064P1 bind a deoxyribonucleic acid (DNA) sequence, wherein the polyamide moiety is tethered to a bromodomain extraterminal domain (BET) binding ligand via a chemical linker.
[0225] In various aspects, the polyamide moiety is configured to bind a GAA sequence.
[0226] In various aspects, the polyamide moiety comprises a monomeric unit having a structure represented by a formula:wherein R1is selected from:andR11wherein R10is selected from hydrogen, -NO2, and -C(O)NH2; and wherein R11is selected from hydrogen and C1-C4 alkyl.
[0227] In various aspects, the polyamide moiety comprises a plurality of monomeric units having a structure represented by a formula:(A)wherein ■S is selected from:
[0228] In various aspects, the polyamide moiety comprises a monomeric unit having a structure represented by a formula selected from:wherein each of m, 0, and p is independently an integer selected from 1 to 20.Attorney Docket No. 19116.0064P1
[0229] In a further aspect, the polyamide moiety comprises at least two different monomeric units.
[0230] In a still further aspect, the polyamide moiety comprises each of:
[0231] In various aspects, the polyamide moiety is a linear polyamide moiety.
[0232] In a further aspect, the linear polyamide moiety' has a structure represented by a formula:wherein n is an integer selected from 1 to 20; wherein q is 0 or 1; wherein R1is selected from:wherein R10is selected from hydrogen, -NO2, and -C(O)NH2; and wherein R11is selected from hydrogen and C1-C4 alkyl; and wherein each occurrence of CA is independently selected from:wherein each of R12and R13is independently selected from hydrogen and methyl.
[0233] In a further aspect, the polyamide moiety has a structure represented by aAttorney Docket No. 19116.0064P1 formula selected from:R10R10andRi°
[0234] In a further aspect, the polyamide moiety has a structure represented by a formula selected from:
[0235] In a further aspect, the polyamide moiety has a structure represented by a formula selected from:R10Attorney Docket No. 19116.0064P1 R10R10andRw\ o wherein each occurrence of X is independently selected from N and CH.
[0236] In various aspects, the polyamide moiety is selected from:H2NAttorney Docket No. 19116.0064P1, and
[0237] In various aspects, the chemical linker is a polyethylene glycol (PEG) linker.
[0238] In various aspects, the first chemical linker has a structure represented by a formula selected from:wherein * denotes a bond connected to the polyamide moiety and ** denotes a bond connected to the BET binding ligand; and wherein u is an integer selected from 1 to 20.
[0239] In various aspects, the BET binding ligand has a structure represented by a formula selected from:wherein r is an integer selected from 1 to 6; wherein R2is selected from hydrogen and C1-C6 alkyl; wherein each of R3, R4, and R5is independently selected from hydrogen, methyl, ethyl, and halomethyl; and wherein R6is selected from halogen. -NH2, -C(O)NH2. C1-C4 aminoalkyl, and Ar1; and wherein Ar1is selected from a 5- to 10-membered heteroaryl and a 6- to 10-membered ary l, and is substituted with 0, 1, 2, or 3 groups independently selectedAttorney Docket No. 19116.0064P1 from halogen, -CN, -NH2, -OH, -NO2. C1-C4 alky l. C2-C4 alkenyl. C1-C4 haloalkyl, Cl-C4 cyanoalkyl, C1-C4 hydroxyalkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalky l.
[0240] In various aspects, the BET binding ligand has a structure represented by a formula:
[0241] In various aspects, the BET binding ligand has a structure represented by a formula:
[0242] In various aspects, the BET binding ligand is selected from:
[0243] In various aspects, the BET binding ligand has a structure represented by a formula selected from:Attorney Docket No. 19116.0064P1wherein each of Q1and Q2is independently selected from N and CH; wherein each of R7aand R7bis independently selected from hydrogen, halogen, -NH2. C1-C4 alkyl. C1-C4 alkoxy, and C1-C4 aminoalkyk wherein R8is selected from hydrogen, halogen, -NH2, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, C1-C4 aminoalkyl, and -C(O)NH2; and wherein each of R9aand R9bis independently selected from hydrogen, halogen, -NH2, C1-C4 alkyl, C1-C4 alkoxy, and C1-C4 aminoalkyl.
[0244] In various aspects, the BET binding ligand is:
[0245] In various aspects, the BET binding ligand is a structure selected from:Attorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1
[0246] In various aspects, the BET binding ligand is a structure selected from:Attorney Docket No. 19116.0064P1or a pharmaceutically acceptable salt thereof.
[0247] In various aspects, the HD AC inhibitor is selected from Dacinostat, ACY-738, MPT0G211, Pyroxamide, RG2833 (RGFP109). Quisinostat, CXD101, QTX125 (TFA), WT-161, Entinostat, Mocetinostat, Corin, Belinostat, NAMPT-IN-3, EDO-S101 (Tinostamustine), Citannostat (ACY241), Resminostat, SR-4370, LMK-235, FNDR-20123, Vorinostat, JAK / HDAC-IN-1, Santacruzamate A, Nanatinostat, Tucidinostat (chidamide, HBI-8000, CS 055), Nexturastat A, Rocilinostat, RDACs / mTOR Inhibitor 1, Scriptaid, Pracinostat, HDAC-IN-3, Trichostatin A. CUDC-101, and Givinostat.
[0248] In various aspects, the HD AC inhibitor is selected from Abexinostat (PCI-24781), Alteminostat (CKD581), AR42 (OSU-HDAC42), Belinostat (PDX101), Chidamide (Tucidinostat, CS055), Citannostat (ACY241), CKD504, CKD506. CXD101, Decitabine, Domatinostat (4SC202), Entinostat (MS-275, SNDX-275), FRM-0334. Givinostat (ITF-2357), HG146, MBF-015, Mocetinostat (MGCD0103), Nicotinamide, Panobinostat (LHB-589), Phenyl butyrate, Pivanex, Pracinostat (SB939), Quisinostat, Remetinostat (SHP141), Resminostat (4SC-201), Ricolinostat (ACY-1215), Romidepsine (depsopeptide, FR901228, FK228, Istodax). Tacedinaline (CI994), Tefinostat (CHR2845). Valproic acid, and Vorinostat (MK-0683, SAHA).
[0249] In various aspects, the HD AC inhibitor is selected from Belinostat and Romidepsin.
[0250] In various aspects, the HD AC inhibitor is HDACi-109, having a structure:
[0251] In various aspects, the structure of the HD AC inhibitors is selected from:Attorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1OHAttorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1
[0252] In various aspects, the SynTEF is:and wherein the HD AC inhibitor is HDACi-109, having a structure:Attorney Docket No. 19116.0064P1
[0253] In various aspects, the SynTEF is:and wherein the HD AC inhibitor is HDACi-109, having a structure:
[0254] In a further aspect, the subject is a mammal. In a still further aspect, the mammal is a human.
[0255] In various aspects, the subject has been diagnosed with a need for treatment of the disorder prior to the administering step. In a further aspect, the method further comprises the step of identifying a subject in need of treatment of the disorder.
[0256] In various aspects, the effective amount is a therapeutically effective amount.
[0257] In various aspects, the effective amount is a prophylactically effective amount.D. PHARMACEUTICAL COMPOSITIONS
[0258] In one aspect, are pharmaceutical compositions used for methods of treating a disorder associated with dysregulation of frataxin (FXN) expression in a subject in need thereof.
[0259] Thus, in one aspect, disclosed are pharmaceutical compositions comprising an effective amount of a synthetic transcription elongation factor (SynTEF), an epigenetic inhibitor, and a pharmaceutically acceptable carrier. In various aspects, the epigenetic inhibitor is selected from an histone deacetylase (HD AC) inhibitor, a non-receptor tyrosine kinase ABL proto-oncogene 1 (ABL1) inhibitor, a non-receptor tyrosine kinase ABL protooncogene (ABL) inhibitor, an acetylcholinesterase inhibitor, an adrenoceptor alpha 2A inhibitor, an adrenoceptor alpha 2C inhibitor, an AKT serine / threonine kinase 1 inhibitor, an apolipoprotein Al inhibitor, an aurora kinase inhibitor, a butyrlcholinesterase inhibitor, a BCL2 apoptosis regulator inhibitor, a BCL2 like 1 inhibitor, a bromodomain (BRD) inhibitor, a calcium voltage-gated channel subunit alphal B inhibitor, a cyclin T1 inhibitor, a CD274 molecule inhibitor, a cyclin dependent kinase inhibitor, a cholinergic receptor muscarinicAttorney Docket No. 19116.0064P1 inhibitor, a cAMP responsive element binding protein inhibitor, a CREB binding lysine acetyltransferase inhibitor, a catenin beta inhibitor, a DNA methyltransferase inhibitor, an epidermal growth factor receptor inhibitor, an egl-9 family hypoxia inducible factor inhibitor, an euchromatic histone lysine methyltransferase inhibitor, an EP300 lysine acetyltransferase inhibitor, an erb-b2 receptor tyrosine kinase inhibitor, a fibroblast growth factor receptor inhibitor, a fms related receptor tyrosine kinase inhibitor, a forkhead box Al inhibitor, a Src family tyrosine kinase FYN proto-oncogene inhibitor, a glycogen synthase kinase beta inhibitor, a hypoxia inducible factor 1 subunit alpha (HIF1A) inhibitor, an interferon alpha 1 inhibitor, an insulin like growth factor 1 receptor inhibitor, an interleukin inhibitor, a Janus kinase inhibitor, a lysine demethylase inhibitor, a lysine acetyltransferase inhibitor, a lysine methyltransferase inhibitor, a Src family tyrosine kinase LCK proto-oncogene inhibitor, a mitogen-activated protein kinase kinase inhibitor, a mitogen-activated protein kinase kinase kinase inhibitor, a microtubule affinity regulating kinase inhibitor, a metallo-beta-lactamase domain containing inhibitor, a menin inhibitor, a mechanistic target of rapamycin kinase inhibitor, a bHLH transcription factor MYC proto-oncogene inhibitor, a nicotinamide phosphoribosyltransferase inhibitor, a nuclear receptor subfamily 4 group A member 2 inhibitor, a nuclear receptor binding SET domain protein inhibitor, a neurotrophic receptor tyrosine kinase inhibitor, a NUAK family kinase inhibitor, a purinergic receptor P2X 7 inhibitor, a prolyl 4-hydroxylase subunit alpha 1 inhibitor, a phosphodiesterase 5A inhibitor, a platelet derived growth factor receptor beta inhibitor, a serine / threonine Pim protooncogene inhibitor, a proline rich transmembrane protein inhibitor, a polo like kinase inhibitor, a protein kinase AMP-activated catalytic subunit inhibitor, a protein kinase C alpha inhibitor, a platelet activating factor receptor inhibitor, a ret proto-oncogene inhibitor, a salt inducible kinase inhibitor, a SIK family kinase inhibitor, a sirtuin inhibitor, a solute carrier family member inhibitor, a non-receptor tyrosine kinase SRC proto-onocogene inhibitor, a signal transducer and activator of transcription inhibitor, a DNA topoisomerase inhibitor, a DNA topoisomerase alpha inhibitor, and a WD repeat domain inhibitor. In various further aspects, the epigenetic inhibitor is a histone deacetylase (HD AC) inhibitor. In various further aspects, the epigenetic inhibitor is a HIF1A inhibitor.
[0260] In one aspect, disclosed are pharmaceutical compositions comprising an effective amount of a synthetic transcription elongation factor (SynTEF), a histone deacetylase (HD AC) inhibitor, and a pharmaceutically acceptable carrier.
[0261] In various aspects, the compounds and compositions of the invention can beAttorney Docket No. 19116.0064P1 administered in pharmaceutical compositions, which are formulated according to the intended method of administration. The compounds and compositions described herein can be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients. For example, a pharmaceutical composition can be formulated for local or systemic administration, e.g., administration by drops or injection into the ear, insufflation (such as into the ear), intravenous, topical, or oral administration.
[0262] The nature of the pharmaceutical compositions for administration is dependent on the mode of administration and can readily be determined by one of ordinary skill in the art. In various aspects, the pharmaceutical composition is sterile or sterilizable. The therapeutic compositions featured in the invention can contain carriers or excipients, many of which are known to skilled artisans. Excipients that can be used include buffers (for example, citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer), amino acids, urea, alcohols, ascorbic acid, phospholipids, polypeptides (for example, serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, water, and glycerol. The nucleic acids, polypeptides, small molecules, and other modulatory compounds featured in the invention can be administered by any standard route of administration. For example, administration can be parenteral, intravenous, subcutaneous, or oral. A modulatory compound can be formulated in various ways, according to the corresponding route of administration. For example, liquid solutions can be made for administration by drops into the ear, for injection, or for ingestion; gels or powders can be made for ingestion or topical application. Methods for making such formulations are well known and can be found in, for example, Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA 1990.
[0263] In various aspects, the disclosed pharmaceutical compositions comprise the disclosed compounds (including pharmaceutically acceptable salt(s) thereof) as an active ingredient, a pharmaceutically acceptable carrier, and, optionally, other therapeutic ingredients or adjuvants. The instant compositions include those suitable for oral, rectal, topical, and parenteral (including subcutaneous, intramuscular, and intravenous) administration, although the most suitable route in any given case will depend on the particular host, and nature and severity of the conditions for which the active ingredient is being administered. The pharmaceutical compositions can be conveniently presented in unit dosage form and prepared by any of the methods well known in the art of pharmacy.
[0264] In various aspects, the pharmaceutical compositions of this invention canAttorney Docket No. 19116.0064P1 include a pharmaceutically acceptable carrier and a compound or a pharmaceutically acceptable salt of the compounds of the invention. The compounds of the invention, or pharmaceutically acceptable salts thereof, can also be included in pharmaceutical compositions in combination with one or more other therapeutically active compounds.
[0265] The pharmaceutical carrier employed can be, for example, a solid, liquid, or gas. Examples of solid carriers include lactose, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, and stearic acid. Examples of liquid carriers are sugar syrup, peanut oil, olive oil, and water. Examples of gaseous carriers include carbon dioxide and nitrogen.
[0266] In preparing the compositions for oral dosage form, any convenient pharmaceutical media can be employed. For example, water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents and the like can be used to form oral liquid preparations such as suspensions, elixirs and solutions; while carriers such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents, and the like can be used to form oral solid preparations such as powders, capsules and tablets. Because of their ease of administration, tablets and capsules are the preferred oral dosage units whereby solid pharmaceutical carriers are employed. Optionally, tablets can be coated by standard aqueous or nonaqueous techniques
[0267] A tablet containing the composition of this invention can be prepared by compression or molding, optionally with one or more accessory ingredients or adjuvants. Compressed tablets can be prepared by compressing, in a suitable machine, the active ingredient in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Molded tablets can be made by molding in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent.
[0268] The pharmaceutical compositions of the present invention comprise a compound of the invention (or pharmaceutically acceptable salts thereof) as an active ingredient, a pharmaceutically acceptable carrier, and optionally one or more additional therapeutic agents or adjuvants. The instant compositions include compositions suitable for oral, rectal, topical, and parenteral (including subcutaneous, intramuscular, and intravenous) administration, although the most suitable route in any given case will depend on the particular host, and nature and severity of the conditions for which the active ingredient is being administered. The pharmaceutical compositions can be conveniently presented in unitAttorney Docket No. 19116.0064P1 dosage form and prepared by any of the methods well known in the art of pharmacy.
[0269] Pharmaceutical compositions of the present invention suitable for parenteral administration can be prepared as solutions or suspensions of the active compounds in water. A suitable surfactant can be included such as, for example, hydroxypropylcellulose.Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils. Further, a preservative can be included to prevent the detrimental growth of microorganisms.
[0270] Pharmaceutical compositions of the present invention suitable for injectable use include sterile aqueous solutions or dispersions. Furthermore, the compositions can be in the form of sterile powders for the extemporaneous preparation of such sterile injectable solutions or dispersions. In all cases, the final injectable form must be sterile and must be effectively fluid for easy syringability. The pharmaceutical compositions must be stable under the conditions of manufacture and storage; thus, preferably should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol), vegetable oils, and suitable mixtures thereof.
[0271] Pharmaceutical compositions of the present invention can be in a form suitable for topical use such as, for example, an aerosol, cream, ointment, lotion, dusting powder, mouth washes, gargles, and the like. Further, the compositions can be in a form suitable for use in transdermal devices. These formulations can be prepared, utilizing a compound of the invention, or pharmaceutically acceptable salts thereof, via conventional processing methods. As an example, a cream or ointment is prepared by mixing hydrophilic material and water, together with about 5 wt% to about 10 wt% of the compound, to produce a cream or ointment having a desired consistency.
[0272] In addition to the aforementioned carrier ingredients, the pharmaceutical formulations described above can include, as appropriate, one or more additional carrier ingredients such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including anti-oxidants) and the like. Furthermore, other adjuvants can be included to render the formulation isotonic with the blood of the intended recipient. Compositions containing a compound of the invention, and / or pharmaceutically acceptable salts thereof, can also be prepared in powder or liquid concentrate form.Attorney Docket No. 19116.0064P1
[0273] In a further aspect, an effective amount is a therapeutically effective amount. In a still further aspect, an effective amount is a prophylactically effective amount.
[0274] In a further aspect, the pharmaceutical composition is administered to a mammal. In a still further aspect, the mammal is a human. In an even further aspect, the human is a patient.
[0275] It is understood that the disclosed compositions can be prepared from the disclosed compounds. It is also understood that the disclosed compositions can be employed in the disclosed methods of using.E. METHODS OF USING THE COMPOSITIONS
[0276] Provided are methods of using of a disclosed composition or medicament. In one aspect, the method of use is directed to the treatment of a disorder. In a further aspect, the disclosed compounds can be used as single agents or in combination with one or more other drugs in the treatment, prevention, control, amelioration, or reduction of risk of the aforementioned diseases, disorders and conditions for which the compound or the other drugs have utility, where the combination of drugs together are safer or more effective than either drug alone. The other drug(s) can be administered by a route and in an amount commonly used therefore, contemporaneously or sequentially with a disclosed compound. When a disclosed compound is used contemporaneously with one or more other drugs, a pharmaceutical composition in unit dosage form containing such drugs and the disclosed compound is preferred. However, the combination therapy can also be administered on overlapping schedules. It is also envisioned that the combination of one or more active ingredients and a disclosed compound can be more efficacious than either as a single agent.
[0277] The pharmaceutical compositions and methods of the present invention can further comprise other therapeutically active compounds as noted herein which are usually applied in the treatment of the above mentioned pathological conditions.1. MANUFACTURE OF A MEDICAMENT
[0278] In one aspect, the invention relates to a method for the manufacture of a medicament for treating for treating a disorder associated with dysregulation of frataxin (FXN) expression in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic transcription elongation factor (SynTEF) and an epigenetic inhibitor.
[0279] In one aspect, the invention relates to a method for the manufacture of aAttorney Docket No. 19116.0064P1 medicament for treating for treating a disorder associated with dysregulation of frataxin (FXN) expression in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic transcription elongation factor (SynTEF) and a histone deacetylase (HDAC) inhibitor.
[0280] As regards these applications, the present method includes the administration to an animal, particularly a mammal, and more particularly a human, of a therapeutically effective amount of the compound effective in the inhibition of uncontrolled cellular proliferation, such as of treating an autoimmune disease. The dose administered to an animal, particularly a human, in the context of the present invention should be sufficient to affect a therapeutic response in the animal over a reasonable time frame. One skilled in the art will recognize that dosage will depend upon a variety of factors including the condition of the animal, the body weight of the animal, as well as the severity and stage of the disorder.
[0281] Thus, in one aspect, the invention relates to the manufacture of a medicament comprising combining a disclosed sequence selective DNA binding compound or a product of a disclosed method of making, or a pharmaceutically acceptable salt, solvate, or polymorph thereof, with a pharmaceutically acceptable carrier or diluent.2. USE OF COMPOUNDS AND COMPOSITIONS
[0282] Also provided are the uses of the disclosed compounds and compositions. Thus, in one aspect, the invention relates to the uses of sequence selective DNA binding compounds.
[0283] In a further aspect, the invention relates to the use of a disclosed sequence selective DNA binding compound or product of a disclosed method in the manufacture of a medicament for the treating a disorder associated with dysregulation of frataxin (FXN) expression in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic transcription elongation factor (SynTEF) and an epigenetic inhibitor.
[0284] In a further aspect, the invention relates to the use of a disclosed sequence selective DNA binding compound or product of a disclosed method in the manufacture of a medicament for the treating a disorder associated with dysregulation of frataxin (FXN) expression in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic transcription elongation factor (SynTEF) and a histone deacetylase (HDAC) inhibitor.
[0285] In a further aspect, the use relates to a process for preparing a pharmaceuticalAttorney Docket No. 19116.0064P1 composition comprising a therapeutically effective amount of a disclosed sequence selective DNA binding compound or a product of a disclosed method, and a pharmaceutically acceptable carrier, for use as a medicament.
[0286] In a further aspect, the use relates to a process for preparing a pharmaceutical composition comprising a therapeutically effective amount of a disclosed sequence selective DNA binding compound or a product of a disclosed method, wherein a pharmaceutically acceptable carrier is intimately mixed with a therapeutically effective amount of the disclosed compound or the product of a disclosed method.
[0287] In various aspects, the use relates to the treatment of uncontrolled cellular proliferation in a vertebrate animal. In a further aspect, the use relates to the treatment of uncontrolled cellular proliferation in a human subject.
[0288] In a further aspect, the use is the treating a disorder associated with dysregulation of frataxin (FXN) expression in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic transcription elongation factor (SynTEF) and a histone deacetylase (HD AC) inhibitor.
[0289] It is understood that the disclosed uses can be employed in connection with the disclosed compounds, methods, compositions, and kits. In a further aspect, the invention relates to the use of a disclosed sequence selective DNA binding compound or composition of a medicament for the treatment of a disorder associated with uncontrolled cellular proliferation in a mammal.
[0290] In a further aspect, the invention relates to the use of a disclosed sequence selective DNA binding compound or composition in the manufacture of a medicament for treating a disorder associated with dysregulation of frataxin (FXN) expression in a subject in need thereof, the method comprising administering to the subject an effective amount of a synthetic transcription elongation factor (SynTEF) and a histone deacetylase (HD AC) inhibitor.3. SUBJECTS
[0291] In various aspects, the subject of the disclosed methods is a vertebrate, e.g., a mammal. Thus, the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig, or rodent. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered. A patient refers to a subject afflicted with a disease or disorder. The term “patient” includes human and veterinary subjects.Attorney Docket No. 19116.0064P1
[0292] In some aspects of the disclosed methods, the subject has been diagnosed with a need for treatment prior to the administering step. In some aspects of the disclosed method, the subject has been diagnosed with a disorder associated with uncontrolled cellular proliferation prior to the administering step. In some aspects of the disclosed methods, the subject has been identified with a need for treatment prior to the administering step. In one aspect, a subject can be treated prophylactically with a compound or composition disclosed herein, as discussed herein elsewhere.a. DOSAGE
[0293] Toxicity and therapeutic efficacy of the agents and pharmaceutical compositions described herein can be determined by standard pharmaceutical procedures, using either cells in culture or experimental animals to determine the LD50 (the dose lethal to 50% of the population) and the EDso (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD50 / ED50. Polypeptides or other compounds that exhibit large therapeutic indices are preferred.
[0294] Data obtained from cell culture assays and further animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity, and with little or no adverse effect on a human's ability to hear. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any agents used in the methods described herein, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (that is, the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Exemplary dosage amounts of a differentiation agent are at least from about 0.01 to 3000 mg per day, e.g., at least about 0.00001, 0.0001. 0.001, 0.01, 0.1, 1. 2, 5, 10, 25, 50, 100. 200, 500. 1000, 2000, or 3000 mg per kg per day, or more.
[0295] The formulations and routes of administration can be tailored to the disease or disorder being treated, and for the specific human being treated. For example, a subject can receive a dose of the agent once or twice or more daily for one week, one month, six months, one year, or more. The treatment can continue indefinitely, such as throughout the lifetime ofAttorney Docket No. 19116.0064P1 the human. Treatment can be administered at regular or irregular intervals (once every other day or twice per week), and the dosage and timing of the administration can be adjusted throughout the course of the treatment. The dosage can remain constant over the course of the treatment regimen, or it can be decreased or increased over the course of the treatment.
[0296] In various aspects, the dosage facilitates an intended purpose for both prophylaxis and treatment without undesirable side effects, such as toxicity, irritation, or allergic response. Although individual needs may vary, the determination of optimal ranges for effective amounts of formulations is within the skill of the art. Human doses can readily be extrapolated from animal studies (Katocs et al., (1990) Chapter 27 in Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA). In general, the dosage required to provide an effective amount of a formulation, which can be adjusted by one skilled in the art, will vary depending on several factors, including the age, health, physical condition, weight, type and extent of the disease or disorder of the recipient, frequency of treatment, the nature of concurrent therapy, if required, and the nature and scope of the desired effect(s) (Nies et al., (1996) Chapter 3, In: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill, New York, NY).b. ROUTES OF ADMINISTRATION
[0297] Also provided are routes of administering the disclosed sequence selective DNA binding compounds and compositions. The compounds and compositions of the present invention can be administered by direct therapy using systemic administration and / or local administration. In various aspects, the route of administration can be determined by a patient's health care provider or clinician, for example following an evaluation of the patient. In various aspects, an individual patient's therapy may be customized, e.g, the type of agent used, the routes of administration, and the frequency of administration can be personalized. Alternatively, therapy may be performed using a standard course of treatment, e.g., using preselected agents and pre-selected routes of administration and frequency of administration.
[0298] Systemic routes of administration can include, but are not limited to, parenteral routes of administration, e.g., intravenous injection, intramuscular injection, and intraperitoneal injection; enteral routes of administration e.g., administration by the oral route, lozenges, compressed tablets, pills, tablets, capsules, drops (e.g., ear drops), syrups, suspensions and emulsions; rectal administration, e.g., a rectal suppository or enema; a vaginal suppository; a urethral suppository; transdermal routes of administration; andAttorney Docket No. 19116.0064P1 inhalation (e.g., nasal sprays).
[0299] In various aspects, the modes of administration described above may be combined in any order.c. KITS
[0300] In one aspect, disclosed are kits comprising a synthetic transcription elongation factor (SynTEF) and an epigenetic inhibitor, and one or more selected from: (a) at least one agent known to treat a disorder associated with dysregulation of frataxin (FXN) expression; (b) instructions for administering the SynTEF in connection with treating a disorder associated with dysregulation of frataxin (FXN) expression; (c) instructions for administering the epigenetic inhibitor in connection with treating a disorder associated with dysregulation of FXN expression; and instructions for treating a disorder associated with dysregulation of FXN expression. In various aspects, the epigenetic inhibitor is selected from an histone deacetylase (HD AC) inhibitor, a non-receptor tyrosine kinase ABL protooncogene 1 (ABL1) inhibitor, a non-receptor tyrosine kinase ABL proto-oncogene (ABL) inhibitor, an acetylcholinesterase inhibitor, an adrenoceptor alpha 2A inhibitor, an adrenoceptor alpha 2C inhibitor, an AKT serine / threonine kinase 1 inhibitor, an apolipoprotein Al inhibitor, an aurora kinase inhibitor, a butyrlcholinesterase inhibitor, a BCL2 apoptosis regulator inhibitor, a BCL2 like 1 inhibitor, a bromodomain (BRD) inhibitor, a calcium voltage-gated channel subunit alphal B inhibitor, a cyclin T1 inhibitor, a CD274 molecule inhibitor, a cyclin dependent kinase inhibitor, a cholinergic receptor muscarinic inhibitor, a cAMP responsive element binding protein inhibitor, a CREB binding lysine acetyltransferase inhibitor, a catenin beta inhibitor, a DNA methyltransferase inhibitor, an epidermal growth factor receptor inhibitor, an egl-9 family hypoxia inducible factor inhibitor, an euchromatic histone lysine methyltransferase inhibitor, an EP300 lysine acetyltransferase inhibitor, an erb-b2 receptor tyrosine kinase inhibitor, a fibroblast growth factor receptor inhibitor, a fms related receptor tyrosine kinase inhibitor, a forkhead box Al inhibitor, a Src family tyrosine kinase FYN proto-oncogene inhibitor, a glycogen synthase kinase beta inhibitor, a hypoxia inducible factor 1 subunit alpha (HIF 1 A) inhibitor, an interferon alpha 1 inhibitor, an insulin like growth factor 1 receptor inhibitor, an interleukin inhibitor, a Janus kinase inhibitor, a lysine demethylase inhibitor, a lysine acetyltransferase inhibitor, a lysine methyltransferase inhibitor, a Src family tyrosine kinase LCK proto-oncogene inhibitor, a mitogen-activated protein kinase kinase inhibitor, a mitogen-activated protein kinase kinase kinase inhibitor, a microtubule affinity’ regulating kinase inhibitor, a metallo-beta-lactamaseAttorney Docket No. 19116.0064P1 domain containing inhibitor, a menin inhibitor, a mechanistic target of rapamycin kinase inhibitor, a bHLH transcription factor MYC proto-oncogene inhibitor, a nicotinamide phosphoribosyltransferase inhibitor, a nuclear receptor subfamily 4 group A member 2 inhibitor, a nuclear receptor binding SET domain protein inhibitor, a neurotrophic receptor tyrosine kinase inhibitor, a NUAK family kinase inhibitor, a purinergic receptor P2X 7 inhibitor, a prolyl 4-hydroxylase subunit alpha 1 inhibitor, a phosphodiesterase 5 A inhibitor, a platelet derived growth factor receptor beta inhibitor, a serine / threonine Pirn protooncogene inhibitor, a proline rich transmembrane protein inhibitor, a polo like kinase inhibitor, a protein kinase AMP-activated catalytic subunit inhibitor, a protein kinase C alpha inhibitor, a platelet activating factor receptor inhibitor, a ret proto-oncogene inhibitor, a salt inducible kinase inhibitor, a SIK family kinase inhibitor, a sirtuin inhibitor, a solute carrier family member inhibitor, a non-receptor tyrosine kinase SRC proto-onocogene inhibitor, a signal transducer and activator of transcription inhibitor, a DNA topoisomerase inhibitor, a DNA topoisomerase alpha inhibitor, and a WD repeat domain inhibitor. In various further aspects, the epigenetic inhibitor is a histone deacetylase (HD AC) inhibitor. In various further aspects, the epigenetic inhibitor is a HIF1A inhibitor.
[0301] In one aspect, disclosed are kits comprising a synthetic transcription elongation factor (SynTEF) and a histone deacetylase (HD AC) inhibitor, and one or more selected from: (a) at least one agent known to treat a disorder associated with dysregulation of frataxin (FXN) expression; (b) instructions for administering the SynTEF in connection with treating a disorder associated with dysregulation of frataxin (FXN) expression; (c) instructions for administering the HD AC inhibitor in connection with treating a disorder associated with dysregulation of FXN expression; and instructions for treating a disorder associated with dysregulation of FXN expression.
[0302] In various aspects, the SynTEF and the epigenetic inhibitor are co-packaged. In various aspects, the SynTEF and the HD AC inhibitor are co-packaged.
[0303] In various aspects, the SynTEF and the epigenetic inhibitor are co-formulated. In various aspects, the SynTEF and the HD AC inhibitor are co-formulated.F. EXAMPLES
[0304] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and / or methods claimed herein are made and evaluated, and are intended to be purely exemplary of the invention and are not intended to limit the scope of what theAttorney Docket No. 19116.0064P1 inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc ), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric.
[0305] The Examples are provided herein to illustrate the invention, and should not be construed as limiting the invention in any way. Examples are provided herein to illustrate the invention and should not be construed as limiting the invention in any way.1. CHEMISTRY METHODS.a. POLYAMIDE SYNTHESIS
[0306] Polyamide (PAI) was synthesized using solid phase peptide synthesis (Erwin, G. S. et al. (2017) Science 358, 1617-1622) and then conjugated to activated JF646-NHS ester by using DIPEA and DMF. The reaction was carried out at room temperature for 6h. After completion of the reaction, diluted in 15% of acetonitrile in H2O and injected in Prep-HPLC to purify the compound. The pure fractions were collected and lyophilized to obtain pure compound.2. BIOLOGICAL METHODSa. CELL CULTURE AND TREATMENT
[0307] GM15850, GM15851, GM16209, GM04079 and GM16197 cells were obtained from the Coriell Institute and cultured under recommended conditions. Cells were cultured in RPMI (GIBCO) containing 15% FBS (GIBCO) and an antibiotic / antimycotic containing 100 U / mL penicillin, 100 U / mL streptomycin, and 0.25 U / mL Amphotericin B (GIBCO). Small molecules were dissolved in DMSO and were added to fresh culture in media.b. PEPTIDE SYNTHESIS AND PROTEIN PRODUCTION
[0308] The H3 peptide sequence ARTKQTARKSTGGKAPRKQLATKA (SEQ ID NO:1) labeled with a 3’ 5-FAM was produced at the St. Jude Children's Research Hospital Peptide Production Facility using a Symphony X solid phase peptide synthesizer. The lysine and serine modifications were introduced during peptide synthesis using pre-modified amino acids. Peptide purity was validated using 220 nm and 492 nm HPLC and verified using massAttorney Docket No. 19116.0064P1 spectrometry.
[0309] HPla, HPlty and HPly proteins were generated by the St. Jude Children’s Research Hospital Protein Production Facility. Briefly, BL21(DE3) Rosetta E. coli cells were transformed with pBH4-6His-TEV-HPla plasmid and selected using carbenicillin and kanamycin. Single colonies were grown and induced with IPTG. Pellets were lysed in lysis buffer (300 mM NaCl, 1 x PBS, 10% glycerol, 7.5 mM imidazole pH 8) in the presence of PMSF, pepstatin A, aprotinin, and leupeptin. Supernatant from lysate was incubated with cobalt resin for at least 1 hour and then washed in a gravity column. Protein was eluted in 20 mM HEPES pH 7.5, 150 mM KC1, 400 mM imidazole pH 7.5. 50 L TEV protease at 2 mg / mL was used to cleave the tag, and the protein was then dialyzed overnight in 20 mM HEPES pH 7.2, 75 mM KC1, and 1 mM DTT. The protein was then passed through a MonoQ column using standard protocols and eluted with a 200 mM-1 M KC1 gradient and collected. Protein was then passed through a 0.22 pm centrifugal filter and purified further on an S75 size exclusion column. Protein was concentrated using 10 kDa spin column concentrators as needed, and concentrations were verified using UV absorbance at 280 nm (Nanodrop).
[0310] A synthetic gene for BRD4s, codon-optimized for A. coli, was ordered from Genscript in a pET28a vector. A hexa-histidine tag followed by a TEV protease cleavage site was placed at the N-terminus of the open reading frame. The BRD4s plasmid was transformed into BL21-RIPL cells, cultures were grown in LB medium, and expression initiated by addition of IPTG. Cells were lysed in 30 mM imidazole pH 7.8, 1 MNaCl with a sonicator. The clarified lysate was loaded onto a 5 mL Fast Flow Chelating Sepharose gravity column and washed with the resuspension buffer. Protein was eluted in 300 mM imidazole pH 7.8, 300 mMNaCl and subsequently diluted three-fold before loading onto aHiTrap Heparin column for the removal of bound nucleic acid. The protein was eluted with a gradient of NaCl in 20 mM HEPES pH 7.5 and concentrated to 100 pM. Protein was then either dialyzed into 20 mM Tris pH 7.8, 150 mM NaCl, 5 mM DTT and flash frozen and stored at -80 °C.c. FLUORESCENCE POLARIZATION BINDING ASSAYS
[0311] Fluorescence polarization binding assays were performed using 20 pL FP buffer (0.02% NP-40, 150 mM KC1. 20 mM HEPES pH 7.5, 1 mM DTT) in black flat bottom plates (Coming 3821BC). HP1 proteins (20 mM HEPES pH 7.5, 200 mM KC1, 10% glycerol, 2 mM DTT) were serially diluted into the plate. 30 nM final concentration of H3 peptidesAttorney Docket No. 19116.0064P1were added to each well with an Echo Liquid Handler. Plates were agitated on shaker for 5 minutes and incubated at RT for 90 minutes. Fluorescence polarization of all samples was determined using fluorescence excitation at 485nm and emission at 520 nm.d. CHROMATIN IMMUNOPRECIPITATION
[0312] 2.5 x 107cells were used for each ChIP sample. Covaris truChIP Chromatin Shearing Kits were used for fixation and nuclear isolation using the standard protocol.Immunoprecipitation was performed as follows: 35 pL / sample of Protein A / G (Pierce 88803) beads were washed 2x with and resuspended in ChIP Lysis Buffer (50 mM Tris-HCl, 10 mM EDTA, 0.5% Empigen BB, 1% SDS) and used to preclear samples for 1 hr. 8 pL of sample was added to 292pL Elution Buffer (1% SDS, 100 mM NaHCO3) and stored as input at -20°C. 800 pL of sample was added to 2 mL of IP Buffer (2 mM EDTA, 150 mM NaCL, 20 mM Tris-HCL pH 8.0, 1% Triton X-100). 6pg antibody was added to each sample, and they were rotated at 4°C overnight. Antibodies used can be found in Table 2. 100 pL magnetic beads per sample were washed 2* with equal volumes of IP buffer and then added to each sample and samples incubated for 1 hour. Samples were centrifuged at 13k RPM for 1 minute and then placed on magnet. Supernatant was discarded and beads were washed with 1 mL each of Wash Buffer 1 (2 mM EDTA, 20 mM Tns-HCl pH 8.0), 0.1% SDS, 1% Triton X-100, 150 mM NaCl), Wash Buffer 2 (2mM EDTA, 20 mM Tris-HCl pH 8.0, 0.1% SDS, 1% Triton X-100, 500 mM NaCl), Wash Buffer 3 (1 mM EDTA, 10 mM Tris-HCl pH 8.0, 250 mM LiCl, 1% Deoxy cholate, 1% NP-40), and 2* with 1 mL TE Buffer (10 mM Tris-HCl, 1 mM EDTA). Samples were centrifuged at 13k RPM for 30s and residual TE buffer was removed. Magnetic beads were resuspended in 300 pL Elution Buffer. 12 pL 5 M NaCl was added to both samples and inputs and placed at 65°C for 18 hours. Samples were then spun at max speed at RT and supernatant was transferred to new tubes. RNase A (Fisher EN0531) was added at 0.2 pg / pL and samples incubated at 37°C for 1 hour. Proteinase K (Fisher 25530049) was added at 0.2 ug / pL and samples incubated at 55°C for 1 hour. DNA was isolated using Qiagen DNA cleanup buffers PB (19066) and PE (19065). Briefly 1.2 mL buffer PB was added to each sample and samples were added to DNA columns (Fisher NC0066803) and centrifuged for 60 seconds. Columns were washed 2* with 0.75 mL buffer PE and eluted in 50 pL nuclease-free water. Samples were sequenced using Next Generation Sequencing by NovaSeq6000 by the St. Jude Children’s Research Hospital Genome Sequencing Facility.Attorney Docket No. 19116.0064P1TABLE 2.Target AntibodyH3K4me3 Abeam Ab8580H3K9me3 Abeam Ab8898HPla Cell Signaling 2616SHPip Cell Signaling 8676SHPly Millipore 05-690e. CHIP-SEQ DAT ANALYSIS
[0313] All ChIP-seq data were sequenced for this study and deposited under accession number GSE196619 in the GEO database. Collection of all sequencing reads were processed with the Trim Galore tool (available on-line at https: / / www.bioinformatics.babraham.ac.uk / projects / trim_galore / ), removing all potential adapter sequences and quality trimming reads with cutadapt using Q20 quality score cutoff (Martin, M. (2011) EMBnet.journal, 17, 10-12). Next, reads were aligned to the human reference genome GRCh38.p12 using bwa (v0.7.17-r1198)(Li, H. & Durbin, R. (2010) Bioinformatics 26, 589-595) and the output was converted to BAM format with samtools (v1.2)(Li, H. et al. (2009) Bioinformatics 25, 2078-2079), followed by identification of duplicated reads with bamsormadup tool from biobambam2 program (v2.0.87)(Tischler, G. & Leonard, S. (2014) Source Code for Biology and Medicine 9, 13). Subsequently, the SPP tool (v1.11)(Kharchenko. P. V., et al. (2008) Nature biotechnology 26, 1351-1359) was used to estimate fragment size with the relative strand cross-correlation analysis; and uniquely mapped reads were extracted from BAM files with samtools and extended with bedtools (v2.24.0)(Quinlan, A. R. & Hall. I. M. (2010) Bioinformatics 26, 841-842), using the fragment size value precalculated with cross-correlation analysis. Subsequently, the MACS2 program (Zhang, Y. et al. (2007) Genome Biol 9, R137) was used to call peaks in narrow mode, with -nomodel -q 0.05 flags (high confidence peaks). In parallel, peaks were also called with more relaxed criteria, setting the -q flag to 0.5, which are here further referred to as low confidence peaks. The reproducible peaks of biological replicates were identified as those which either in both replicates had overlapping high confidence peaks or those, which in one replicate had a high confidence peak, which was supported by a low-confidence peakAttorney Docket No. 19116.0064P1 in the second replicate. Finally, reproducible peaks were annotated with genes if the peak overlapped the with gene promoter, defined as transcription start site (TSS) ± 2000 bp, and based on the reference annotation from Gencode (Frankish, A. et al. (2019) Nucleic Acids Res 47, D766-D773). For the purposes of visualization, the mapped reads’ densities were converted to BigWig format and normalized to 15 million non-duplicated mapped reads. Next, whenever applicable, the average signal between biological replicates was calculated.
[0314] Differential peak binding analysis included calculation of the fragment counts per reproducible peaks based on bedtools (v2.24.0)(Quinlan, A. R. & Hall, I. M. (2010) Bioinformatics 26, 841-842), combined with in-house scripts, and was followed by limma-voom approach (Ritchie. M. E. et al. (2015) Nucleic Acids Res 43, e47; Law. C. W., et al. (2014) Genome Biol 15, R29) to differentially binding peaks. Different levels of stringency were used to classify the peaks as differentially binding, including p<0.05.f. VELOCITY PLOTS
[0315] To visualize the differences between two conditions, a new approach that utilize the vector (aka. Quiver) plots, was introduced, which for this study, covered region at coordinates chr9:69, 035.000-69.039, 600. These plots, which are here referred to as velocity plots, emphasize the differences of the shape and intensity of the enrichment signal between two conditions. Velocity plots are generated for a predefined genomic region of interest, and step-by-step guidelines on how the velocity plots are generated were depicted in the supplementary (FIG. 10A-G). The signal enrichment from two toy example conditions, both of which were pre-normalized to the same sequencing depth, and which both use the same bin size (in our case genome was separated in 50 bp long bins), are visualized on the FIG. 10A. The input format was bedGraph. Note that the values represented by entries of bedGraph files for each condition, which are 1-dimentional, were then converted to 2-Dimentional matrix, which dimensions depend on the number of bins that span the genomic region of interest, and the user-specified number of desired layers (in our case equal to 5 layers). Next, the algorithm identified the maximum enrichment value from both conditions, which was round up to integer. This max integer value was then divided by the number of layers, which was subsequently used to calculate m - the max enrichment value per layer. Next, for each bin, the algorithm calculated how many m values could be covered by the enrichment value from that bin, which in the final matrix were assigned the value of 1, and what was the ratio of the remaining signal to the m value (FIG. 10B). Finally, the valuesAttorney Docket No. 19116.0064P1 identified were ordered in ascending order, and filled in the values for the layers 1-5 of the corresponding bins. On the example of 12th bin of the condition 1 (FIG. 10B), which enrichment value is equal to 4.3, the m value is equal to 1, so the 4.3 = 4*m + 0.3; and the 0.3 / m = 0.3; therefore, the values placed in layers 1-5 were 0.3, 1, 1, 1, 1, as visualized on the figure 2B. Next, in order to compare the condition 1 to condition 2, the 2-D matrix of the condition 2 has to be subtracted from 2-D matrix of the condition 1 (FIG. 10C), and vice versa, to compare condition 2 to condition 1, 2-D matrix of the latter has to be subtracted from the 2-D matrix of the former. Next, the algorithm calculated the values required to plot regular quiver plot from matplotlib Python package (description available on-line at: https: / / matplotlib.org / stable / api / _as_gen / matplotlib.pyplot.quiver.html), that is X and Y coordinates, which correspond with the Bins and layers from the processed 2-D subtraction matrix. Moreover, the quiver plotting function requires the values of the horizontal and vertical arrow tilt to position the vector on the plot. Both were calculated by traverse through the 2-D subtraction matrix, with calculating the tilts using the weight pattern shown on FIG.10D. i.e. in order to calculate the vertical arrow tilt, the value from current cell, as well as the cell corresponding to the previous layer, wwere taken under consideration (result values for vertical arrow tilt are shown on FIG. 10F); however, to calculate the horizontal arrow tilt, all the adjacent layers’ values wwere taken under consideration, with the weights decreasing the further the distance from the cell of origin (for the example matrix shown in FIG. 10C, the horizontal tilt values are shown in FIG. 10E). Finally, the values for the vertical arrow tilt, which range between -1 and 1, were also used to assign color from the blue-white-red color map. The resulting vector-enrichment plots for the toy example, for both the condition 1 over condition 2, and condition 2 over condition 1, are shown on the FIG. 10G.g. siRNA, RNA ISOLATION, AND QPCR
[0316] On-target plus siRNA was purchased from Dharmacon and Dharmafect I was used for siRNA transfection and knockdown using the recommended protocol. RNA was isolated using Qiagen RNeasy isolation kit (74106) and eluted in 50pL nuclease free water. RNA concentration was determined using nanodrop and diluted to lOOng / uL in nuclease free water. lOOng of RNA was used to generate cDNA using iScript reverse transcription cDNA synthesis kit (Bio-Rad 1708891). The resulting cDNA concentration was determined using nanodrop and diluted to lOOng / uL. Quantitative polymerase chain reaction was performed using SYBR Green SsoAdvanced (Bio-Rad 1725275) with lOOng cDNA per sample. qPCRAttorney Docket No. 19116.0064P1 was performed on ABI7900.h. RNA-SEQ DATA ANALYSIS
[0317] Raw RNA-seq reads were quality fdtered and trimmed with Trim Galore tool (available on-line at https: / / www.bioinformatics.babraham.ac.uk / projects / trim_galore / ). Reads were then aligned to the human reference genome (hg38 / GRCh38.p12) using STAR (Dobin, A. et al. (2013) Bioinformatics 29, 15-21). Subsequently, based on the reference annotation from Gencode (Release 31)(Frankish, A. et al. (2019) Nucleic Acids Res 47, D766-D773), read counts per gene were calculated using RSEM (Li, B. & Dewey, C. N. (2011) BMC Bioinformatics 12, 323), including only level 1 and 2 protein-coding genes, with at least 10 reads per condition. Next, to identify differentially expressed genes (DEGs), the remaining genes were processed using limma-voom approach (Ritchie, M. E. et al. (2015) Nucleic Acids Res 43, e47; Law, C. W., et al. (2014) Genome Biol 15, R29). Based on the values of log2(fold-change), p-value and false discovery rate (FDR), genes were then classified into various categories of differential expression representing different levels of stringency: |log2(FC)| > 1 and FDR < 0.05.i. RNA / DNA FISH
[0318] GM15850 and GM15851 cells were cultured according to CorielFs protocol using RPMI +15% FBS. seeded at 2.5 x 105cells / ml, and treated for 24 hours with either 0.1% DMSO or luM Syn-TEFl in 0.1% DMSO prior to collection. 2.5 x 105cells / sample were used for PCR analysis of FXN and GAPDH expression. 1-5 x 106cells / treated were used for DNA / RNA FISH using an FXN probe from WI2-1857D19 fosmid. This experiment had 3 biological replicates with 2-4 technical replicates? Samples were sequentially stained and imaged for RNA and then DNA FISH using DAPI, FITC, and TRITC channels for both acquisitions. DNA FITC and RNA TRITC channels contain peaks of interest; DNA TRITC and RNA FITC channels contain background / bleed through. DNA and RNA z-stacks were trimmed to the same length using points of interest to determine z-offset and then merged using DAPI stains to align samples in Nikon Elements. Peak picking of RNA (RNA TRITC) and DNA (DNA FITC) spots in merged z-stacks were conducted by generating peak masks by interactively thresholding a Laplacian of Gaussian (sigma: 0.15) and peak positions were defined as the center of gravity of the masked image pixels. At each peak, the intensity value of each image channel was read (following a gaussian blur with sigma 0.15). Additionally.Attorney Docket No. 19116.0064P1the closest neighbors across all image channels were determined using the KDTree algorithm. The thresholds used were: 1200 (DNA FITC), 600 (DNA TRITC and RNA FITC), 1000 (RNA TRITC). Peak intensity values and xyz location were filtered first to see if they were nuclear (DAPI > 200) and far from a bleed through signal (DNA FITC peak further than 0.75um from any DNA TRITC peak and RNA TRITC peak further than 0.75um from any RNA FITC peak). DNA spots were counted for any DNA FITC peak that met the above filters. A RNA spot was counted if the RNA TRITC peak met the above filters and was within 0.75pm of a DNA spot.j. IMAGING
[0319] Cell culture: 18x18 #1.5 microscope coverslips (Fisher brand: 12541013CA) were acid washed and stored in 95% ethanol until use. Coverslips were placed in a 6 well dish and the ethanol allowed to evaporate while sterilized by UV light and washed with PBS. Poly-D-lysine (Gibco: A38904-01) was added to the coverslips according to manufacturer’s directions before the lymphocytes — GM15851 and GM15850 — were added. Lymphocytes were cultured in RPMI amended with 15% FBS and were grown for 24 hours before treatment. Cells were treated with either 1 uM SynGRl or DMSO for an overall 0.1% DMSO. The cells were incubated for 24 hours before the RNAScope+IF procedure. See Table 3 for reagents.
[0320] RNAScope+ Immunofluorescence: RNAScope multiplexed with immunofluorescence was performed largely by the manufacturer’s directions with one exception — the immunofluorescence and DAPI staining occurred after the RNAScope procedure. Opal dyes were diluted 1:2000. POLR2A was chosen as the control to ensure RNAScope w as successful in all conditions imaged since FXN is a low expression target.TABLE 3.Name Company Reference #Advanced CellRNAscope H2O2 and Protease Reagents 322381 DiagnosticsRNAscope Multiplex Fluorescent Detection Advanced Cell 323110 Reagents v2 DiagnosticsAdvanced CellRNAScope Wash Buffer Reagents 310091 DiagnosticsHs-POLR2A Advanced Cell 310451-C2Attorney Docket No. 19116.0064P1Name Company Reference #DiagnosticsAdvanced CellHs-FXN 428961 DiagnosticsOpal 570 Akoya Biosciences FP 1488001 KT Opal 620 Akoya Biosciences FP1495001KT BRD4-alexa647 Abeam Abl97608 HP la -alexa488 Abeam Abl85018 20x SSC buffer Invitrogen AM9763 Nuclease Free Water Ambion AM9932 lx PBS Fisher BioReagents BP24384
[0321] Microscope and image acquisition: Images were captured using a Zeiss 980 Airyscan 2 microscope equipped with a GaAsP-PMT detector. The Plan- Apochromat 63x / 1.40 NA oil DIC M27 objective was used with a 1 AU pinhole. Channels were sequentially imaged with a bidirectional scan and 0.2 um z-step. Image dimensions and depth: 16 bit. 0.0071 um x 0.071 um x 0.200 um. Image acquisitions conditions were optimized from the WT SynTEFl treated condition. Table 4 lists microscope settings for each channel; the excitation and emission of each fluorophore was based off Zeiss’s filter assistant. Images were acquired overnight using the Zeiss multipoint scan and the software’s autofocus set to use the DAPI channel as the reference. A 5 pm window used a total of 2.5 pm above and below the midpoint of the cells in frame was used for the z-range.TABLE 4.POLR2ABRD4 FA7VRNA HPla DNA RNAFluorophore Alexa 647 Opal 620 Opal 570 Alexa 488 DAPI Excitation 639 nm 594 nm 543 nm 488 nm 405 nm Emission 640-693 nm 578-649 nm 543-596 nm 490-543 nm 410-516 nm Laser power 2% 2.2% 1% 1% 0.2%k. AUTOMATED 3D IMAGE ANALYSISAttorney Docket No. 19116.0064P1
[0322] Batch analysis was performed using FIJI (v 1.53m) IJ1 macros. Zeiss archive files were opened using the Bioformats plugin (https: / / bio-formats.readthedocs.io / en / stable / users / index.html#using-bio-formats-with-imagej-and-fiji;The Open Microscopy Environment). 3D segmentation and 3D ROI plugins are from (h ttps: / / mci b3d. frama, i o / d-s uite-i mage; A (Oilion et al. (2013) Bioinformatics 29, 1840-1841). Images and / or cells were excluded from processing if: the image was inadvertently duplicated, a cell was incomplete, or partial image acquisition.i. COUNTING RNA SPOTS IN THE NUCLEUS VERSUS IN THE CYTOPLASM
[0323] MakeMasks SLR zeiss. ijm: Images were sequentially opened in FIJI. For each cell in each image, nuclear masks were created by applying a fixed threshold to a sum intensity projection over the z-dimension on the DAPI channel. The cytoplasm was not specifically stained but was discernable via weak, non-specific background staining.Candidate masks of cells were defined by applying a fixed threshold to a sum intensity projection over all RNA-stained channels and then also over the z-dimension. Cell masks were then “exclusive-or’ed” (XOR) with the corresponding nuclear masks to create cytoplasm masks (i.e. cell with nucleus excluded) with a corresponding ROI ID. Both the nuclear and cytoplasm masks for each image were saved. The cytoplasm mask boundaries were sometimes inaccurate (e.g., when cells touched or overlapped), and a second macro allowed the user to manually edit these masks as needed (EditMasks.ijm).
[0324] EditMasks.ijm: Each image was opened along with its corresponding cytoplasm mask image (output of MakeMasks. ijm) and the user may manually edit the cytoplasm mask via drawing with the pencil tool in either black (to erase) or white (to add). The cytoplasm must be 8-connected around the entire nucleus, and there must be exactly one nucleus per cytoplasm. After manual editing, composite 2D ROIs were generated from the final masks, added to the 2D ROI Manager, and saved.
[0325] CountSpots zeiss. ijm: Each image was opened along with its corresponding 2D composite ROI list (output of EditMasks.ijm). For each ROI in the list (corresponding to one cell), the “3D Maxima Finder” plugin was used to localize and count the spots within the nucleus and within the cytoplasm. Maxima finding was performed according to user-defined, channel-specific parameters and the same parameters were applied across all images in a set. Maxima parameters for RNA used were xy radius 8, z radius 7. and noise 10. 3D spot coordinate lists were saved as Results.csv tables.Attorney Docket No. 19116.0064P1 ii. MEASURING THE CONCENTRATION OF PROTEIN NEAR RNA SPOTS VERSUS IN THE NUCLEUS
[0326] SpotsConcentrationl zeiss.ijm: Each image was opened, along with its corresponding 2D composite ROI list (output of EditMasks.ijm) and spots coordinate lists corresponding to a given RNA channel (output of CountSpots 1.ijm). At the xyz coordinate for each spot, a 7x7-pixel 2D ROI was drawn on the protein channel of interest and the average intensity (concentration) of the protein signal was measured. Within each nucleus, the measurements for each spot were in-tum themselves averaged together and recorded as the average intensity within the spots per nucleus. On the protein channel, the z-slice corresponding to the average z-position of all the spots within a given nucleus was used to measure the average intensity within the entire nucleus. Results were saved into a.csv table.
[0327] Control measures for BRD4 and HP1 a: For each identified FXN ATS, a second 7x72D ROI was randomly chosen by the user to be on the same plane as the ATS. but not the same location of the ATS. BRD4 and HP1 a intensity was measured at the selected location and recorded in excel.iii. 3D ANALYSES OF BRD4 AND HP 1A
[0328] nucROI 2, ijm: An ROI file was created with the nucleus and corresponding cell ID previously generated by the editMasks code.
[0329] 3D coloc SLR6,iim: This code creates multiple 3D masks of BRD4, HP la, and nuclear DAPI signal. Each image is opened individually and the nucROI is used to designate each nucleus. The channels are separated, and the RNA channels are removed. The BRD4 and HP la channels undergo rolling ball background subtraction, radius 30 pixels. BRD4, HP la, and DAPI nuclear ROIs were duplicated for further analysis. A nuclear mask of DAPI channel was created in the 3D Manager 3D Nuclei Segmentation plugin. The HP la puncta (higher concentration regions defined by user threshold) were detected by applying a 3D unsharp mask followed by “3D Simple Segmentation.” This mask was called the punctaMask. The punctaMask was subtracted from the nuclear mask to create the nonpunctaMask. The Coloc2 plugin was used to determine the colocalization coefficients of BRD4 and HPla in either the HPla punctaMask or HPla nonpunctaMask. For each analysis, Costes's regression was used to determine the threshold value. The puncta colocalization values and the nonpuncta colocalization values were saved as a.csv file. Last, the duplicated BRD4, HPla, DAPI, nuclear mask, punctaMask, and nonpunctaMask images were mergedAttorney Docket No. 19116.0064P1 and saved as a. tif.
[0330] 3D puncta SLR4: This code uses the.tif output from 3D_coloc_SLR4 to measure the volume and intensity of BRD4 and HP la in the punctaMask and nonpunctaMask. Briefly, each image is opened and added to the 3D manager. For each channel, quantif was ran to determine the volume and intensity within the different masks. The data were saved as a.csv file. If no HPla puncta were previously detected, the code creates a '‘noData”.csv file.
[0331] Compiling FIJI Data: All FIJI generated.csv sheets were compiled into manageable.xls sheets via python scripts using the St. Jude Center for Bioimage Informatics JupyterHub. A unique 5-7 digit was assigned to each ImageJ cell ID. A Master key file was generated and contained the image batch name, ImageJ cell ID, and unique ID. Compiled excel sheets were manually examined and rearranged to facilitate import into MATLAB.1. MATLAB IMAGE DATA QUANTIFICATION
[0332] All data generated by ImageJ was analyzed in MATLAB. RNA and protein analyses were based off previously established protocol (Robinson-Thiewes (2020) Proc Natl Acad Set USA 117, 26812-26821; Tsanov et al. (2016). Nucleic Acids Res 44, el65; Mueller (2013) Nat Methods 10, 277-278; Raj et al. (2008) Nat Methods 5, 877-879). Statistical analyses and graph generation were performed in MATLAB and Prism. The compiled excel sheets were imported into MATLAB and ran through several codes:
[0333] Protein cell: The BRD4 and HP 1 a protein intensity signal was normalized by subtracting the background of each image. The output was used to normalize BRD4 and HP 1 a intensity at the FXN active transcription site(s) (ATS).
[0334] Process RNA: The datastat function was used to determine the median cytoplasmic RNA intensity. Candidate RNA spots were removed if the spot was outside + / -the standard deviation from the median. All RNAs were normalized to the intensity of the filtered mRNA median. The normalized intensity values were rounded to the nearest integer.
[0335] To determine the active transcription sites, nuclear RNAs that had intensity values greater than the median value of a single mRNA + 1 std (~ 2 RNAs when adjusted for RNA count) were placed into a candidate list to be tested. All nuclear RNAs that were below this threshold were considered mRNAs and added to the mRNA list. All RNAs that rounded to zero were removed.
[0336] Fold: After background subtraction that occurred in the protein cell code,Attorney Docket No. 19116.0064P1 BRD4 and HP 1 a intensity at the ATS were divided by the average intensity’ of each protein in the cell to calculate the fold change of each protein at the ATS.m. PROTEIN LABELING
[0337] Protein was dialyzed into 10 mM HEPES pH 7.5, 150 mM NaCl, 5 mM DTT. HPla was labeled with Oregon Green (Fisher 06147) and BRD4s was labeled with Rhodamine Red (Thermofisher R6160). Briefly the dye was dissolved at 100 mM in DMSO and added to protein in a 20: 1 dye-to-protein molar ratio and incubated on a shaking platform for 5 hours. The reaction was quenched with 2 M excess Tris. Protein was then dialyzed into 20 mM Tris pH 7.8, 150 mM NaCl, and 5 mM DTT.n. PHASE SEPARATION ASSAYS
[0338] DNA oligos were purchased from IDTDNA, resuspended in 50 mM NaCl and annealed at 95 °C for 5 minutes and ramped to 4°C at 0.1 degree / s. DNA was re-annealed before each experiment and incubated with polyamide for at least 3 h at 4 °C. HPla and BRD4s were incubated with DNA / polyamide in dialysis buffer for 1 hour before imaging on a Nikon C2. Time course experiments were performed by pre-forming HPla condensates in PCR tubes for Ihr, transferring the solution to a coverslip affixed to a perforated 35 mm glass plate, and then adding BRD4s at 50 nM. The samples were imaged on the Marianas 2 and images wwere taken every’ 5 seconds. Super-resolution microscopy’ was performed on a Zeiss LSM980 Airyscan microscope on a solution in the 2-phase regime equilibrated for 90 minutes.o. IMAGE ANALYSIS
[0339] FISH images were generated using a merged z-stack with LUTS adjustments made with ImageJ. Distance to nuclear periphery analysis was done using Imaris Image Analysis Software using DAPI to generate a 3D ROI representing the nucleus and measuring the distance of the DNA FISH puncta to the closest edge of the ROI. Cells containing more than 2 DNA FISH signals were excluded. Protein colocalization in phase-separated condensates was performed by image analysis using Nikon Elements. An ROI was generated using the HPla FITC fluorescence channel and average fluorescence intensity measurements were taken from all channels. The kinetics of BRD4s entry into HPla condensates was determined by analysis of movies in ImageJ using a line ROI at default width covering theAttorney Docket No. 19116.0064P1 HP la condensate. BRD4s channel intensity was recorded at each timepoint.p. QUANTITATIVE ANALYSIS OF SYNERGISTIC INTERACTIONS
[0340] Drug combination studies were evaluated using Bliss independence (Bliss (1939) Annals of Applied Biology 26, 585-615). Briefly, all unique pairwise combinations of RGFP109 (DMSO, 6.25, 12.5, 25, 50) and SynGRl (DMSO, 0.125, 0.25, 0.5, and 1 uM) were evaluated in GM 15850 cells using qPCR after 24 hours of drug treatment. Gene expression values from three independent biological replicate experiments were averaged and then normalized to the range 0 (the expression induced by DMSO) to 1 (the expression induced by the combination at the highest concentration of each drug tested) to generate the observed Bliss surface. The expected Bliss surface was calculated from the behavior of each drug as single agent, and then subtracted from the observed Bliss surface to yield the differential Bliss surface. For the differential Bliss surface, values >0 indicate synergy, values = 0 are additive, and values < 0 are antagonistic.q. SEQUENCES
[0341] 601 DNA FWD
[0342] CTGGAGAATCCCGGTCTGCAGGCCGCTCAATTGGTCGTAGACAGCT CTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGG GATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGT (SEQ ID NO:2)
[0343] 601 DNA REV
[0344] ACAGGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATC CCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTA GAGCTGTCTACGACCAATTGAGCGGCCTGCAGACCGGGATTCTCCAG (SEQ ID NO:3)
[0345] GAA DNA FWD
[0346] GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG AAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAA(SEQ ID NO: 4)
[0347] GAA DNA REV
[0348] TTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT CTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTAttorney Docket No. 19116.0064P1TCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC (SEQ ID NO:5)TABLE 5.Target AntibodyH3K4me3 Abeam Ab8540H3K9me3 Abeam Ab8898HPla Cell Signaling 2616SHPip Cell Signaling 8676SHPly Millipore 05-690TABLE 6.Target SequenceFXN Forward CAGAGGAAACGCTGGACTCT (SEQ ID NO: 6) FXN Reverse AGCCAGATTTGCTTGTTTGG (SEQ ID NO: 7) GAPDH Forward CTGAGCTCATTTCCTGGTATGA (SEQ ID NO: 8) GAPDH Reverse CTTCCTCTTGTGCTCTTGCTG (SEQ ID NO: 9) HDAC1 Forward GCTGGCAAAGGCAAGTATTATG (SEQ ID NO: 10) HDAC1 Reverse CTAGGCTGGAACATCTCCATTAC (SEQ ID NO: 11) HDAC2 Forward GGAGAAGGAGGTCGAAGAAATG (SEQ ID NO: 12) HDAC2 Reverse ACCACTGTTGTCCTTGGATTTA (SEQ ID NO: 13) HDAC3 Forward TGATCGATTGGGCTGCTTTA (SEQ ID NO: 14) HDAC3 Reverse CAGCACGAGTAGAGGGATATTG (SEQ ID NO: 15) HPip Forward GGAGAGCTCATGTTCCTGATG (SEQ ID NO: 16) HPip Reverse CGTCAGCCTTTCCTCATAGAAG (SEQ ID NO: 17) HPly Forward GGCCTCCAACAAAACTACATTG (SEQ ID NO: 18) HPly Reverse TCCACTTTCCCATTCACTACAC (SEQ ID NO: 19) HPla Forward TTGCCCTGAGCTAATTTCTGAAT (SEQ ID NO:20) HPla Reverse GATGTCATCGGCACTGTTTGA (SEQ ID NO:21) FXN A Forward CCCCACATACCCAACTGCTG (SEQ ID NO:22) FXN A Reverse GCCCGCCGCTTCTAAAATTC (SEQ ID NO 23)Attorney Docket No. 19116.0064P1 Target SequenceFXN B Forward AAACTGACCCGACCTTTATTCCA (SEQ ID NO:24) FXN B Reverse GGAATCCCCCAAGGTCACA (SEQ ID NO 25) FXN C Forward GAAACCCAAAGAATGGCTGTG (SEQ ID NO:26) FXN C Reverse TTCCCTCCTCGTGAAACACC (SEQ ID NO:27) FXN D Forward CTGGAAAAATAGGCAAGTGTGG (SEQ ID NO:28) FXN D Reverse CAGGGGTGGAAGCCCAATAC (SEQ ID NO:29)r. COMPOUND SCREENING AND GLOBAL SIRNA KNOCKDOWN
[0349] GM04078 fibroblasts were grown in Minimum Essential Medium with Earle’s Salts (Gibco 41200-038) supplemented with 15% FBS (Biowest S1620, Ely clone SH30396.03), Non-Essential Amino Acids (GenClone 25-536), Penicillin / Streptomycin (Gibco 151140-122). and GlutaMAX (Gibco 35050061) at 37° C and 5% CO2. Cell growth and density were monitored by phase microscopy and Trypan Blue exclusion (Gibco 15250061) using a Countess 3 (Thermo Scientific A49862).
[0350] Compound Screening: Compounds were first tested at a final concentration of 10 pM from 10 rnM stocks in 100% DMSO. 25 nl of each tested compound and an additional 25 nl of either DMSO or SynGRl were added to each well of a 384-well CulturPlate (Revity 6007688) using a Beckman Coulter Echo 655 acoustic liquid handler. 2000 GM04078 cells in 25 pl of media were then plated into each well with a final DMSO concentration of 0.2%. Hit compounds were tested in a dose-response format in 1:3-fold dilutions curves from a top screening concentration of 10 pM. 30 nl of each tested compound and an additional 30 nl of either DMSO or SynGRl were added to each well of a 384-well CulturPlate (Revity' 6007688) using a Beckman Coulter Echo 655 acoustic liquid handler. 2000 GM04078 cells in 30 pl of media were then plated into each well using a Multidrop Combi (Thermo Scientific 5840300) with a final DMSO concentration of 0.2%.
[0351] Cells were grown for 24 hours and mRNA extracted using 384-well TurboCapture mRNA plates (Qiagen 72271) per the manufacturer’s protocol. To detect the relative levels of FXN and GAPDH in each sample 4 pl of each eluted mRNA was combined with 6 pl of Luna Universal Probe One-Step RT-qPCR mix (New England Biolabs E3006E) containing the primers and probes below.
[0352] Each sample was reverse transcribed (10 minutes at 55° C and 1 minute at 95°Attorney Docket No. 19116.0064P1 C) and amplified (40 cycles of 5 seconds at 95° C and 40 seconds at 60° C) using a QuantStudio 7 Pro (Thermo Scientific). All curves were analyzed using Design & Analysis (Thermo Scientific Version 2.7.0) and the relative amount of FXN to GAPDH in each sample determined using 2-ΔΔCt. For dose-response calculation all Design & Analysis data points were imported and analyzed for 2-AACtusing GeneData Screener Analyzer with 1 pM SynTEFl alone as a " Neutral Control’7with 0% activity.
[0353] FXN qPCR Primers and Probes:TABLE 7.FXN Forward GAGGAAACGCTGGACTCTTTAG (SEQ ID NO:30) FXN Reverse CACTCCCAAAGGAGACATCATAG (SEQ ID NO 31) FXN_Probe 156- FAM / ACCTTGCAG / ZEN / ACAAGCCATACACGT / 3IABkFQ / (SEQ ID NO:32)GAPDH F orward GGTGTGAACCATGAGAAGTATGA (SEQ ID NO 33) GAPDH Reverse GAGTCCTTCCACGATACCAAAG (SEQ ID NO: 34) GAPDH Probe / 5SUN / AGATCATCA / ZEN / GCAATGCCTCCTGCA / 3IABkFQ / (SEQ ID NO:35)
[0354] siRNA Screening: siRNA pools (Horizon OnTarget Plus) to each gene of interest were tested at a final concentration of 22.5 nM from 5 pM stocks in RNA resuspension buffer (Horizon B-002000-UB-100). 112.5 nl of a tested siRNA was added to one well of a 384-well CulturPlate (Revity 6007688) using a Beckman Coulter Echo 655 acoustic liquid handler. 10 pl of Opti-Mem (Thermo Scientific 51985034) containing 1% Dharmafect 1 (Horizon Discovery T-2006-01) was added to each well for 20 minutes using a Multidrop Combi (Thermo Scientific 5840300). 15 pl of complete media containing 2000 GM04078 cells was then added to each well and incubated overnight. The following day an additional 25 pl of complete media was added to each well and the plates were incubated for an additional 48 hours. A final addition of 10 pl of complete media containing 6 pM SynGRl to a 1 pM final concentration or DMSO was added to each well for 24 hours. mRNA extraction and qPCR were then performed as above.s. HIERARCHICAL NETWORK MODELAttorney Docket No. 19116.0064P1
[0355] The activity- based hierarchical network graph was visualized in Cytoscape (v.3.4.0) using the yFiles circular layout. Node-edge relationships were defined by hierarchically decomposing the reported targets of the epigenetic modulator using annotations from the IUPHAR / BPS Guide to Pharmacology (Harding et al. (2024) Nucleic Acids Res 52, D1438-dl449) or manual annotation when required. Compounds with multiple targets are represented by distinct leaf nodes.
[0356] Chemical space analysis was conducted using KNIME (v.5.3.3) and the RDKit (RDKit: Open-source cheminformatics. https: / / www.rdkit.org) radius 3 morgan fingerprint set to 1024 bits and the following t-SNE (van der Maaten and Hinton (2008) Journal of Machine Learning Research 9. 2579-2605) parameters: dimensions = 2, iterations = 5000, theta = 0.2, perplexity = 30.0, and threads= 20.3. DISCUSSION
[0357] Greater than half of the human genome is composed of repetitive sequence elements that are ensconced in repressive heterochromatin (Lander et al. (2001) Nature 409, 860-921; Gershman et al. (2022) Science 376, eabj5089). A signature mark of repressive heterochromatin at repeat elements is the trimethylated lysine 9 of histone 3 (H3K9me3) (Allis and Jenuwein (2016) Nat Rev Genet 17. 487-500; Allshire and Madhani (2018) Nat Rev Mol Cell Biol 19, 229-244). In addition to constitutive heterochromatin at pericentromeric repeats, H3K9me3 marks are also found at genes that are repressed in specific cell lineages, and even in transcriptionally accessible euchromatin (Nicetto et al. (2019) Science 363, 294-297; Matsumura et al. (2015) Molecular Cell 60, 584-596; Becker et al. (2017) Mol Cell 68. 1023-1037.el015; Vakoc et al. (2005) Mol Cell 19. 381-391; O'Geen et al. (2007) PLoS Genet 3, e89; Riddle et al. (2012) PLoS Genet 8, el 002954; Seczynska et al. (2022) Nature 601, 440-445; Seczynska and Lehner (2023) Trends Genet 39, 251-267). While the role of H3K9me3 in euchromatin is less apparent, the enrichment of this mark in facultative heterochromatin occurs at genes that define fate and function of distinct cell types (Becker et al. (2017) Mol Cell 68, 1023- 1037. el 015; Vakoc et al. (2005) Mol Cell 19, 381-391; O'Geen et al. (2007) PLoS Genet 3, e89). Consistent with key roles in regulating gene expression, aberrant placement or erasure of heterochromatin marks is linked to multiple human diseases (Allis and Jenuwein (2016) Nat Rev Genet 17, 487-500).
[0358] In Friedreich’s ataxia (FRDA / FA), a life-limiting neurodegenerative disease, expression of frataxin (FXN) is downregulated by expansion of GAA trinucleotide repeats within the first intron of the FXN gene (Campuzano et al. (1996) Science 271, 1423-1427;Attorney Docket No. 19116.0064P1 Mirkin (2007) Nature 447. 932-940). This expansion is accompanied by increased deposition of H3K9me3 (Saveliev et al. (2003) Nature 422, 909-913; Soragni et al. (2014) Am Neurol 76, 489-508; Kim et al. (2011) Nucleic Acids Res 39, 8366-8377; Herman et al. (2006) Nat Chem Biol 2, 551-558; Punga and Buhler (2010) EMBO Mol Med 2, 120-129; Yandim et al. (2013) J Neurochem 126 Suppl 1, 21-42). The extent of GAA repeat expansions correlates with the enrichment of H3K9me3 marks and reduced transcription across repeat expansions, thus demonstrating a clear functional role for this signature repressive mark in silencing FXN expression (Punga and Buhler (2010) EMBO Mol Med 2, 120-129). Placing expanded GAA repeats at unrelated genomic loci (Saveliev et al. (2003) Nature 422, 909-913) or downstream of heterologous gene promoters (Kim et al. (2011) Nucleic Acids Res 39. 8366-8377) suffices to increase H3K9me3 marks at the new site. Furthermore, augmenting the levels of active acetyl marks with histone deacetylase (HD AC) inhibitors alleviates the repressive impact of H3K9me3 on FXN in patient-derived cell types and in animal models of the disease (Soragni et al. (2014) Ann Neurol 16, 489-508; Yandim et al. (2013) J Neurochem 126 Suppl 1, 21-42; Sherzai et al. (2020) Front Genet 11, 584; Rai et al. (2010) PLoSOne 5, e8825 (2010)).
[0359] Previously a class of synthetic gene regulators (SynGRs) was developed to restore FXN expression in patient-derived cells (Erwin et al. (2017) Science 358, 1617-1622; Mohammed et al. (2023) J Am Chem Soc: Mohammed et al. (2024) ACS Chem Biol 19, 2268-2276; Chowdhury et al. (2025) Bioorganic Chemistry, 108813). The prototype SynGRl (formerly named SynTEFl) is a hetero-bifunctional molecule composed of a GAA-repeat binding polyamide (PAI) (Burnett et al. (2006) Proc Natl Acad Sci USA 103, 11497-11502; Erwin et al. (2016) Proc Natl Acad Sci USA 113. E7418-e7427) tethered to JQ1 (Filippakopoulos et al. (2010) Nature 468. 1067-1073), a small molecule that binds the Bromodomain and Extra-Terminal domain (BET) family of proteins (FIG.9A). BET proteins, including the well-studied member BRD4, interact with acetylated lysine residues on histone tails and recruit the transcriptional machinery (Filippakopoulos et al. (2010) Nature 468, 1067-1073; Jang et al. (2005) Mol Cell 19, 523-534). SynGRl enriches at the disease-causing GAA repeat expansion, recruits BRD4 / BET to the repressive heterochromatin, and licenses RNA polymerase II (Pol II) transcriptional elongation across the repressive GAA repeats (Erwin et al. (2017) Science 358, 1617-1622).
[0360] Here, SynGRl was used to test prevailing mechanistic models that predict that inducing active transcription of a repressed gene should lead to the erasure of H3K9me3 marks and removal of HP1 proteins from the disease-causing repeats (FIG. 1A). Instead, itAttorney Docket No. 19116.0064P1 was found that FXN expression not only failed to erode the repressive marks, but it led to an increase in H3K9me3 levels and repressive HP1 proteins. Furthermore, contrary to expectations that HP1 and BRD4 form mutually incompatible phase separated condensates, SynGRl readily partitioned BRD4 into HP1-DNA condensates at physiological concentrations. Taken together, these results challenge established paradigms and provide new insights into mechanisms by which transcription is licensed within repressive genomic loci.
[0361] Referring to FIG. 1A, current models of transcription posit that active transcription leads to removal of repressive histone marks and their readers, such as HP1 proteins.a. PARTITIONING OF BRD4 INTO HP1 CONDENSATES OVERRIDES PERSISTENT REPRESSIVE CHROMATIN AT MICROSATELLITE REPEATS IN FRIEDREICH’S ATAXIA
[0362] Frataxin expression was previously restored in a variety of patient-derived cells with SynTEF1, a hetero-bifunctional molecule composed of a GAA-repeat binding polyamide (PAI)(Erwin. G. S. et al. (2017) Science 358, 1617-1622; Burnett, R. et al. (2006) Proceedings of the National Academy of Sciences of the United States of America 103, 11497-11502; Erwin, G. S. et al. (2016) Proceedings of the National Academy of Sciences of the United States of America 113, E7418-e7427) tethered to JQ1, a small molecule that binds BET proteins (FIG. 9A). BET proteins, including BRD4, interact with acetylated histone tails and recruit multiple components of the transcriptional machinery (Filippakopoulos, P. et al. (2010) Nature 468, 1067-1073; Jang, M. K. et al. (2005) Mol Cell 19, 523-534). Within hours of treatment, SynTEF1 traffics to the nucleus, enriches at the disease-causing GAA repeat expansion, localizes BRD4 to the repressive heterochromatin, and licenses RNA polymerase II transcriptional elongation across the repressive GAA repeats (Erwin. G. S. et al. (2017) Science 358, 1617-1622).b. PERSISTENCE OF H3K9ME3 DESPITE / < VVI XPRI SSIOX
[0363] While H3K9me3 marks are predominantly linked to transcriptional repression, these marks can occur in transcribed regions of the genome (Becker et al. (2017) Mol Cell 68, 1023-1037. el015; Vakoc et al. (2005) Mol Cell 19, 381-391; O'Geen et al. (2007) PLoS Genet 3, e89; Riddle et al. (2012) PLoS Genet 8, el002954). To examine if H3K9me3 marksAttorney Docket No. 19116.0064P1 and HP1 paralogs, key readers of this repressive mark, play a role in FXN expression, the expression of each of the three HP1 paralogs and key lysine methyltransferases known to methylate H3K9 was knocked down. Consistent with a repressive function, siRNA-mediated knockdown of HPla and HPlg paralogs increased FXN expression (FIG. IB and FIG. 9B).In further support of H3K9 playing a repressive role, the knockdown of Suv39Hl, a histone methyltransferase that is known to trimethylate H3K9, also alleviated the repression of FXN in SynGRl -treated FRDA cells (FIG. IB).
[0364] To monitor the rewiring of epigenetic marks upon SynTEFl treatment, chromatin-immunoprecipitation (ChlP-seq) of H3K9me3 andH3K4me3 was performed, chromatin marks of transcription repression and activation respectively (FIG. 2A). In patient-derived GM15850 lymphoblastoid cells, the H3K4me3 profile shifted subtly downstream, in agreement with SynTEF1 -licensed transcription elongation at FXN. A computed pseudovelocity plot highlights the 3’ vectorial displacement of H3K4me3 enrichment (FIG.2A right panel and FIG. 10A-G). The levels of repressive H3K9me3, rather than being erased, increased upon SynTEFl -induced transcription of FXN (FIG. 2B). While uncommon, preexisting H3K9me3 marks can persist at some actively transcribed genes (Vakoc, C. R., et al. (2005) Mol Cell 19, 381-391). Rather than the mark itself, heterochromatin proteins (HP1) that read H3K9me3 marks and form phase-separated repressive condensates are the key effectors that present a physical barrier to transcribing polymerases (Larson, A. G. et al. (2017) Nature 547, 236-240; Strom, A. R. et al. (2017) Nature 547, 241-245; Bannister, A. J. et al. (2001) Nature 410, 120-124; Lachner, M., et al. (2001) Nature 410, 116-120;Nakayama, J., et al. (2001) Science 292, 110-113). Consistent with previous reports (Saveliev, A., et al. (2003) Nature 422, 909-913; De Biase, I., et al. (2009) PloS one 4.e7914), enrichment of all three paralogs of HP1 (a, b, g) was observed at FXN. While all three paralogs bind H3K9me3 efficiently (FIG. 2H), they display non-identical enrichment profiles across FXN. HPlg enriched at the transcription start site (TSS), HPla enriched downstream of the TSS and flanking the GAA repeat expansions, while HP lb appeared to bridge the profiles of the other two paralogs (FIG. 2C-F). Consistent with their repressive function, siRNA-mediated knockdown of HPla and HPlg isoforms resulted in significantly increased expression of AW in diseased cells (FIG. 9H).
[0365] Referring to FIG. IB, knockdown of specific genes using siRNA on SynGRl-mediated FXN expression in FRDA cells is shown.C. HP1 ENRICHMENT ACCOMPANIES FXN EXPRESSIONAttorney Docket No. 19116.0064P1
[0366] DNA binding polyamides can displace HP1 from chromatin (Blattes, R. et al. (2006) The EMBO journal 25, 2397-2408). Without wishing to be bound by theory’, it was hypothesized that SynTEFl would overcome the blockade to transcription elongation by displacing HP1 proteins without the need to erase underlying H3K9me3 marks. Contrary to paradigms of HP1 function, SynTEFl -treatment enhanced the enrichment of all three paralogs (FIG. 2C-G). Moreover, the most repressive paralog, HP la, enriched directly along the path of the elongating Pol II (FIG.2C and Erwin, G. S. et al. (2016) Proceedings of the National Academy of Sciences of the United States of America 113, E7418-e7427). HPlg, which can permit transcription elongation when bound within coding regions (Vakoc, C. R., et al. (2005) Mol Cell 19, 381-391; Zaidan, N. Z. & Sridharan, R. (2020) Nucleic Acids Research 48, 12660-12674), displayed increased promoter binding consistent with its well-defined role in repressing transcription initiation (FIG. 2E and FIG. 2G). To enable comparisons, individually scaled profiles were overlaid and observed a coherent increase in repressive chromatin features accompanying active transcription elongation across the GAA repeats (FIG. 2F and FIG. 2G).
[0367] Given the overlap between active (H3K4me3) and repressive (H3K9me3) marks at the FXN transcription start site, the ability of the three HP1 paralogs to bind orthogonally marked histone tails was measured. Binding of 12 modified histone H3 peptides to each of the full-length HP1 paralogs was measured by fluorescence polarization (FIG. 2H and FIG. 12A-C and Table 8). HP1 paralogs displayed high affinity for di- and trimethylated Lysine-9 (H3K9me2 / 3) peptides but not for the unmodified (H3), mono / tri methylated Lysine-4 (H3K4mel / 3), or the phospho-SerinelO (H3S10P) modified peptides that are known to block HP1 binding to nucleosomes (FIG. 2H and FIG. 12A-C). All three HP1 paralogs bind peptides bearing the opposing bivalent K4me3 / K9me3 marks, consistent with the ChlP-seq profiles observed at FXN.TABLE 8.H3K9me2 H3K4mel / K9me2 H3K4mel / K9me3 H3K4me3 / H3K9me2 HPlOt 6.657 9.367 9.725 17.09HP 10 0.1336 0.1079 0.07343 0.1172HP 17 2.984 1.154 0.9241 2.337
[0368] Referring to FIG. 2A-H, repressive chromatin marks and HP1 paralogs increase in response to FXN gene expression is shown. FIG. 2A shows representative dataAttorney Docket No. 19116.0064P1 of ChlP-seq and pseudo-velocity vector analysis of H3K4me3 before and after treatment with SynTEFl (n=2; p=n.s ). Pseudo-velocity vector plot stratifies 50bp bins into 5 layers and compares peak changes after treatment to control peaks. The H3K4me3 vector plot visualizes a 3' movement into the gene body. FIG. 2B-E show representative data of ChlP-seq and pseudo-velocity vector plot for (FIG. 2B) H3K9me3 (n=2; p<1×10-5); (FIG. 2C) HPla (n=2; p<0.01); (FIG.2D) HP1 [3 (n=2; p<lxl0‘9); (FIG. 2E) HP 1 / (n=2; p<0.05). FIG. 2F and FIG. 2G shows peak overlay at FXN for (FIG. 2F ) Control or (FIG. 2G ) SynTEF1 treated cells which shows changes in peak enrichment after treatment. FIG. 2H shows fluorescence polarization assays using synthetic 24 amino-acid H3 tail peptides conjugated with fluorescein at the C-terminus. Plots for H3K9me3, H3K4me3, bivalent H3K4me3+K9me3, and unmodified H3 (l-24aa) are displayed. Paired t-tests were performed and showed significance for HPla (p<0.05) and HPly (PO. OOl). Table 9 shows calculated Kd values using non-linear least squares curve fit.TABLE 9.Peptide HPla HPlp HPlyH3 (1-24) N. D. N. D. N. D.K9me3 3.53 0.12 1.46K4me3 / K9me3 15.09 0.21 1.39K4me3 / K9me2 17.09 0.12 2.34K4mel / K9me3 9.73 0.07 0.92K4mel / K9me2 9.37 0.11 1.15K9me2 6.66 0.13 2.98K4me3 N. D. N D N. D.K4mel N. D. N. D. N. D.K9me3 / S10P N. D. N D. N. D.K9me3 / S10P N. D. N. D. N. D.S10P N. D. N. D. N. D.
[0369] Referring to FIG.9A-J, epigenetic silencing caused by (GAA)n repeat expansion at FXN remains after SynTEFl mediated transcriptional activation is shown. FIG.9A shows chemical structure of SynTEFl. FIG. 9B-E show individual ChlP-seq tracks for H3K4me3 (FIG. 9B), H3K9me3 (FIG. 9C), HPla (FIG.9D), HP1 (FIG. 9E), and HPly (FIG. 9F) treated with DMSO or SynTEFl. FIG.9G shows violin plot of vehicle treated ChlP-seq peaks. Arrows show FXN peaks after SynTEFl treatment. FIG. 9H shows FXN expression for HP1 proteins after siRNA treatment in GM15850 FRDA lymphoblasts.Expression normalized to DMSO. Error bars are SEM, p-values measured by unpaired t-testAttorney Docket No. 19116.0064P1 compared to DMSO. HPla p<0.001, HPly p<0.05. FIG. 91 shows FXN expression after siRNA knockdown and FIG. 9J shows percent remaining mRNA after siRNA treatment compared to untreated cells.
[0370] Refering to FIG. 10A-G, velocity' plots are a method to visualize the change in ChlP-seq peak distribution is shown. FIG. 10A shows signal enrichment from two toy example conditions, both of which were pre-normalized to the same sequencing depth, and which both use the same bin size (in our case genome was separated in 50 bp long bins), are visualized. FIG. 10B shows layering of the max integer peak value. FIG. 10C shows graphical representation of the 2D matrix difference. Positive values are in orange and negative values in purple. FIG. 10D shows horizontal and vertical weight matrix to calculate arrow tilt. FIG. 10E and FIG. 10F show horizontal (FIG. 10E) and vertical (FIG. 10F) weight matrix calculations for example peaks. FIG. 10G shows veloctiy plots generated comparing test condition 1 to 2 or condition 2 to 1.
[0371] Refering to FIG. 11A-D. labeled H3 modified peptide and protein generation is shown. FIG. 11A shows sequence of H3 tail peptide created with C-terminal 5-FAM. FIG. 11B shows HPLC epifluorescence traces and MALDI-TOF spectra of modified H3 tail peptides after purification show ing purity7of histone tail peptide. FIG. 11C show s Coomassie gels of purified recombinant HPla, HP 1(3. and HPly. FIG. 11D shows a Coomassie gel of purified recombinant BRD4.
[0372] Refering to FIG. 12A-C, HP1 binding of modified H3 tail peptides by fluorescence polarization is shown. FIG. 12A-C show fluorescence polarization binding assay of HPla (FIG. 12A), HP 1(3 (FIG. 12B), and HPly (FIG. 12C). Table 2 shows KD values of specified HP1 protein binding to modified H3 tail peptides.d. FXN STIMULATION IN DISEASED CELLS MIRRORS HEALTHY CELLS
[0373] The co-localization of opposing regulatory marks detected in the ChIP studies could result from SynTEFl activity in a limited number of ‘'super-responder” cells that only bear active chromatin marks at the transcribed FXN gene. In this scenario, the seemingly colocalized repressive marks in ChIP studies would be contributed solely by unresponsive cells within the population. To investigate this possibility, fluorescence in situ hybridization (FISH) was performed using sequential probes to visualize the FXN genomic loci (DNA-FISH, in red) and the nascent, chromatin-associated FXN transcripts (via RNA-FISH, in green) (FIG. 3A-D). Visual inspection confirmed that in the absence of SynTEFl, FXNAttorney Docket No. 19116.0064P1 transcripts are rarely observed in untreated diseased FRDA cells (FIG.3A). However, upon treatment with SynTEFl, an increase in nascent FXN transcript was readily evident (FIG. 3B). The pattern and extent of co-localization is indistinguishable from the merged DNA+RNA signals observed in healthy cells (FIG. 3B and FIG.3C). Quantifying the colocalization of RNA at >13,000 FXN DNA loci in nine biological replicates demonstrates that SynTEFl restores FXN expression across the population of diseased cells in a manner that mirrors the expression patterns in the healthy cells (FIG. 3E). Without wishing to be bound by theory', these results from single cells and across the population of cells, unequivocally indicate that SynTEFl overrides persistent repressive chromatin features to restore FXN expression in diseased cells.
[0374] Previous imaging studies of FRDA cells had suggested a causal relationship between the repression of the FXN gene and its position along the nuclear lamina of the nucleus (Silva, A. M., et al. (2015) Hum Mol Genet 24, 3457-3471). To determine how SynTEFl impacts nuclear positioning of FXN, the distance of each allele was measured to the closest point on the nuclear periphery in treated or untreated FRDA cells (FIG. 3F). The distances of 1600 FXN alleles to the nuclear periphery' are displayed as violin plots (FIG. 3G). While the density profiles differed slightly, no significant repositioning of the FXN loci was observed upon SynTEFl -mediated expression of the gene. Consistent with this observation, healthy cells expressed both FXN alleles irrespective of their proximity to the nuclear periphery' (FIG. 3D).
[0375] Refering to FIG.3A-G, FXN stimulation in diseased cells mirrors healthy cells. FIG. 3A-D shows sequential DNA and RNA Fluorescence In situ Hybridization (FISH) performed on (FIG. 3A and FIG. 3B) GM15850 (FRDA) and (FIG. 3C and FIG. 3D) GM15851 (Healthy) cells. The nuclei were visualized with DAPI. White arrows show inactive FXN alleles and pink arrows show genes with active transcription. Cells were untreated (FIG. 3A and FIG. 3C) or treated with SynTEFl (FIG.3B and FIG. 3D). FIG. 3E shows colocalization of RNA FISH with DNA FISH puncta normalized to healthy controls. Error bars are SEM. FIG. 3F shows Graphical representation of 3D DNA puncta localization measurements. FIG. 3G shows 3D distance analysis of over 1400 DNA puncta per sample using Imaris image analysis software. Nuclear lamina determined by periphery' of DAPI stain.
[0376] Refering to FIG. 13A-G, SynTEF1 stimulates Frataxin expression in a population of cells is shown. FIG. 13A shows FXN expression in GM15850 (FRDA) and GM15851 (Healthy) cells treated with DMSO or SynTEF1. Samples are normalized toAttorney Docket No. 19116.0064P1 GM15850 DMSO samples. FIG. 13B shows Total DNA-FISH puncta used for colocalization with RNA-FISH for each treatment. FIG. 13C shows Total DNA-FISH puncta used for nuclear periphery distance analysis for each treatment. FIG. 13D-G show representative full-sized images of merged and individual RNA and DNA FISH signals. GM 15850 cells treated with DMSO (FIG. 13D) or SynTEFl (FIG. 13E), and GM 15851 healthy lymphoblasts treated with DMSO (FIG. 13F) or SynTEFl (FIG. 13G).
[0377] Moreover, even if the entire population of FRDA cells expresses / TVupon SynGRl treatment, it is possible that the actively transcribed allele bears the signature euchromatin marks whereas the silent allele bears the repressive marks. We investigated whether such conflation of signals from individual SynGRl -responsive cells underlies the ChlP-based observation of overlapping orthogonal chromatin marks in a population.
[0378] To map actively transcribed sites (FAA-ATS), we used the single molecule RNAScope approach which utilizes unique probes that hybridize to FXN transcripts and provide means to amplify the fluorescent signal at the transcribed allele (Wang et al. (2012) J Mol Diagn 14, 22-29). Visual inspection revealed that FXN transcripts are rarely observed in untreated diseased FRDA cells (FIG. 4A). SynGRl treatment elicited a pattern of FXN expression across the cell population that was indistinguishable from expression profiles observed in healthy cells (FIG. 4A, lower panel and FIG. 14A-F). To quantitatively analyze our imaging data, a custom ImageJ / FIJl image processing pipeline was developed and MATLAB tools were used to segment the images and quantify single mRNA molecules in each treatment condition (Mueller et al. (2013) Nat Methods 10, 277-278; Raj et al. (2008) Nat Methods 5, 877-879; Bartman et al. (2019)Alo / Cell 73, 519-532.e514; Robinson-Thiewes et al. (2020) Proc Natl Acad Sci USA 117, 26812-26821). In FRDA lymphocytes, SynGRl treatment increased the fraction of cells with a FXN ATS and mRNA approximately 4-fold (FIG.4B and FIG.4C), consistent with the bulk RNA measurements (Erwin et al. (2017) Science 358, 1617-1622; Mohammed et al. (2023) J Am Chem Soc; Mohammed et al. (2024) ACS Chem Biol 19. 2268-2276)
[0379] Referring to FIG. 4A, FXN RNAscope multiplexed with BRD4 and HP la immunofluorescence is shown. White arrow-, FXN active transcription site (ATS); white dashed line, nuclear outline. Scale bar, 5 pm. FIG. 4B show s the percentage of cells with a FXN ATS in FRDA and WT lymphocytes. ****, p < 0.00001. Number of cells per condition: FRDA SynGRl = 1147; FRDA untreated = 657; WT SynGRl = 437; WT untreated = 543.FIG. 5C shows the distribution of / TWmRNA per cell in FRDA and WT cells. Box plot ofAttorney Docket No. 19116.0064P1 95% confidence interval. ****, p<0.00001.e. HP 1A AND BRD4 CO-LOCALIZE IN CELLS
[0380] To determine if the actively transcribed FXN locus co-localizes with BRD4 or HP la, RNAScope was combined with imaging of these two readers of epigenetic marks via immuno-fluorescence (IF). As expected, these functionally orthogonal proteins enrich in nonoverlapping regions of the nucleus, however they do overlap at FXN ATS (FIG. 4A).Quantifying BRD4 and HP la levels at individual FXN ATSs and at equally sized randomly selected locations within the cell (see methods) revealed significantly higher overlap between the two opposing effectors at the FXN ATS (FIG. 4D-G and FIG. 14A-F). In SynGRl -treated FRDA cells, far more FXN ATSs were detected, accompanied by a greater correlation, rs= 0.61, between BRD4 and HPla (FIG. 4F). Moreover, suggestive of a dynamic process, a broad range in the levels of co-localized HPla and BRD4 was observed in all conditions (FIG. 4D-G). These results indicate that not only can BRD4 gain access to regions of modest HPla enrichment, but that it can be recruited into HPla puncta, often assumed to reflect phase separated condensates (FIG.4G, panel i).
[0381] To determine if the observed co-localization of these opposing factors was a unique feature of the FXN locus, the extent of BRD4 and HPla co-occurrence was quantified across the entire nucleus in WT and FRDA cells. Independent of SynGRl treatment, low level of co-localization of BRD4 and HPla was evident under all conditions (FIG. 15A-E).Then, BRD4 levels were quantified within all HP la-enriched puncta and normalized the values to the mean signal across the nucleus (z.e., non-punctate nucleoplasm; see Methods). Even within HPla puncta, these functionally orthogonal proteins were not strictly anticorrelated, as expected based on current models that disfavor mixing of BRD4 and HP 1 a proteins (LeRoy et al. (2012) Genome Biol 13; Shin et al. (2018) Cell 175, 1481-1491,e 1413). In other words, these data reveal a naturally occurring cellular phenomenon where the two functionally opposed effector proteins dynamically sample the orthogonal chromatin regions. In particular, the data provide single cell and single locus evidence for the co-localization of BRD4 and HPla during active transcription of FXN.
[0382] Referring to FIG. 4D-F, the correlation between BRD4 and HPla enrichment at the FXN ATS in FRDA untreated (FIG. 4D), WT untreated (FIG. 4E), and FRDA SynGRl -treated cells (FIG. 4F). Spearman’s correlation test used. Number of FXN ATS measured: FRDA SynGRl = 494; FRDA untreated = 61; WT untreated = 166. WT SynGRlAttorney Docket No. 19116.0064P1 plot (n = 64) is in FIG. 14A-F. FIG. 4G shows HP la and BRD4 immunofluorescence at the FXN ATS (white arrow). Examples i-iii are selected from FRDA SynGRl -treated cells shown in FIG.4F.
[0383] Referring to FIG. 14A, a larger view of cells shown in Figure 2aXXX is shown, z- maximum projection shown; white dashed line-nucleus. Scale, 5 pm. Referring to FIG. 14B-F, BRD4 and HP la enrichment at the FXN ATS (FIG. 14B) and (FIG. 14C-F) control ROTs of the same size as a FXN ATS for all experimental conditions, rs, spearman’s correlation.
[0384] Referring to FIG. 15A. single z-plane images of BRD and HP la in treated and untreated FRDA and WT cells are shown. Arrow, regions of BRD4 and HP la co-occurrence. Referring to FIG. 15B-E, normalized BRD4 fold change in normalized HP1 a puncta are shown. Briefly, a 3D nuclear mask was made for each image. For each nucleus, 3D HP la puncta were detected. The HP la puncta were removed from the 3D masks to get the nuclear, non-HP la puncta region of the nucleus. BRD4 and HP la intensity and volume was measured in the HPla puncta and nuclear non-HPla puncta region. For the HPla and nuclear nonHP la puncta region, HPla and BRD4 concentration was calculated by dividing the intensity by the volume. To normalize the concentration in the HPla puncta, the concentration of either BRD4 or HPla was divided by the nuclear non-HPla puncta concentration for each protein. The concentration was then rescaled so that depletion would be negative and enrichment positive.f. BRD4 PARTITIONS INTO HPla CONDENSATES
[0385] The findings raised a conundrum: how does SynTEFl binding, BRD4 recruitment, and Pol II transcription through GAA repeats occur without reduction in HP1 levels or erasure of H3K9me3 marks? Without wishing to be bound by theory, it is hypothesized that HPla forms repressive condensates at GAA repeat expansions, yet SynTEFl can enter and grant access to BRD4 and Pol II, without dispersing the HPla condensate. Due to its rapid on / off DNA binding kinetics (Keenen, M. M. et al. (2021) Elife 10 e64563), HPla could locally release and re-engage GAA repeats allowing passage to an elongating Pol II. To test this possibility, It was first examined whether HPla forms condensates with a 147 base pair DNA fragment bearing 49 GAA repeats which can adopt unusual conformations (Mirkin, S. M. (2007) Nature 447, 932-940). When compared with the well-characterized 601 DNA sequence of identical length (Keenen, M. M. et al. (2021)Attorney Docket No. 19116.0064P1 Elife 10 e64563). HP la phase-separated with GAA repeats at comparable saturation concentrations and formed condensates of similar dimensions (FIG. 5A-C). Next, to examine if SynTEFl can access cognate DNA binding sites in HP la condensates, a GAA-binding polyamide (PAI) conjugated to JF646 was synthesized, a fluorophore that emits at 646 nm (FIG. 5D, FIG. 16B and FIG. 16C). Consistent with its specificity for GAA repeats (Burnett, R. et al. (2006) Proceedings of the National Academy of Sciences 103, 11497-11502), PA1-JF646 enriches in the HPla condensates bearing 49 contiguous GAA-repeats but not in condensates formed with identically sized 601 DNA, which lack PAI / SynTEFl binding sites (FIG. 5E-G). While other polyamides have been reported to displace HPla (Blattes, R. et al. (2006) The EMBO journal 25, 2397-2408), PAI or PA1-JF646 do not disperse the GAA-HPla condensates even at saturating concentrations (FIG. 5E-G). However, it was unclear if SynTEFl would partition in HPla condensates because JQ1, a key component of SynTEFl, was reported to not enrich in HPla condensates (Klein, I. A. et al. (2020) Science 368, 1386-1392). Moreover, HPla and BRD4 form functionally and physically distinct condensates and their ability to co-condense at physiological concentrations was unexpected (Sabari, B. R. et al. (2018) Science 361 (6400):eaar3958; Gibson, B. A. et al. (2019) Cell 179, 470-484.e421; Shin, Y. et al. (2018) Cell 175, 1481-1491.el413,; Alberti, S., etal. (2019) Cell 176, 419-434). Remarkably, not only does SynTEFl enable JQ1 to enter HPla condensates it also facilitates the partitioning of BRD4 into these repressive condensates at physiological concentrations (FIG. 5H and FIG. 51). Intriguingly, at higher concentrations (>250nM), BRD4 co-condensates with HPla without the assistance of SynTEFl (FIG. 51). When incubated with pre-formed HPla condensates, SynTEFl recruits BRD4 within seconds (FIG. 5 J, FIG. 5C and FIG. 16E). This unexpected result points to a more generally employed mechanism by which genes embedded in repressive heterochromatin might permit transient access to transcriptional machinery
[0386] In addition to HPla, ChlPseq profiles showed that the HP ly paralog also enriched at the GAA repeats (FIG. 5M). Therefore, whether the two HP1 paralogs, either at equimolar (64 pM each) or 2: 1 (128 pM HPly: 64 pM HPla) molar ratio, would form cocondensates with the 147-bp GAA repeat DNA was tested. In both conditions, condensate formation was observed (FIG. 5N). As with HPla-DNA condensates, SynGRl readily partitioned BRD4 into HPla / y co-condensates at lower concentrations but was not required at higher concentrations (FIG. 50 and FIG. 5P). These biophysical studies furtherAttorney Docket No. 19116.0064P1 corroborate the genomic and imaging studies which independently show co-localization of these functionally orthogonal proteins in cells. Initially identified at SynGRl -treated FXN sites, most HP1 puncta are accessed to some degree by BRD4 at non-FATV loci in both healthy and FRDA cells regardless of SynGRl treatment. The innate abi li ty of BRD4 to access HP1 puncta presents a previously undescribed mechanism to permit transcription within repressive chromatin.
[0387] Referring to FIG. 5A-P, BRD4 can access HP1 condensates. FIG.5A shows titration of 601 DNA and GAA-repeat DNA with increasing concentrations of HP la.Samples imaged by DIC microscopy. Fluorescence micrographs of samples at 64 pM HP la show its enrichment in condensates. FIG. 5B shows condensate area over 28,000 total droplets and 4 replicates. FIG. 5C provides schematic showing HP la can form condensates with GAA-repeat DNA followed by PAI -JF 646 and SynTEF into HPla-GAA DNA condensates and subsequently PA1-JF646 and SynTEF into HPla-GAA DNA condensates.FIG. 5D shows chemical structure of PAI -JF 646, a polyamide conjugated to fluorophore JF646. FIG.5E shows PA1-JF646 enters HPla condensates formed with GAA-repeat DNA, but not 601 DNA. FIG. 5F shows PA1-JF646 fluorescence intensity in condensates formed with GAA-repeat DNA or 601 DNA. FIG. 5G shows depletion of PA1-JF646 fluorescence intensity from the dilute phase in presence of HPla-DNA condensates. FIG.5H shows access to BRD4 into HPla-GAA DNA condensates in the presence of SynTEF1, PAI or DMSO. FIG. 51 shows quantification of (i) over 15,000 droplets and 2 replicate samples. Fold change is fluorescence intensity normalized to the average intensity in condensates treated with DMSO. FIG. 5J shows super-resolution micrographs showing SynTEF1-dependent entry of BRD4 into pre-formed HPla-DNA condensates. FIG. 5M shows ChTP-seq profiles of HPla and HPlg across GAA repeats with or without SynGRl treatment. FIG.5N shows a co-condensate formation by 1:1 or 2:1 molar ratio of HPlg and HPla with the 49 GAA repeat-bearing DNA. A fraction of HPlg was fluorescently labeled for imaging. FIG.50 shows that SynGRl helps partition BRD4 into these mixed condensates at 7.5 nM but is not required at higher concentrations of BRD4. FIG. 5P shows the quantification of SynGRl -aided partitioning of BRD4 into mixed HP1 condensates.
[0388] Refering to FIG. 16A-E, BRD4 is recruited to HPla phase separated condensates by SynTEF1. FIG. 16A shows titration of HPla without DNA, with 601 DNA, or with GAA DNA showing increased phase separation with increasing protein concentration. FIG. 16B shows MALDI TOF spectra of PA1-JF646 showing purity7. FIG.Attorney Docket No. 19116.0064P1 16C shows HPLC Chromatogram of PA1-JF646 after purification. FIG. 16D shows Titration of BRD4s with 64pM HPla either in the presence of DMSO vehicle, SynTEFl, or PAI. FIG. 16E shows individual replicates of timed entry of BRD4s into HPla preformed condensates. SEM between droplets in each replicate is shown. Half-time calculated by one-phase association.g. SYNERGISTIC ACTIVATION WITH AN EPIGENETIC INHIBITOR
[0389] Given that HP la and HP 1g repress FXN in patient-derived cells (FIG. IB), it was hypothesized that pharmacological agents that prevent enrichment of these repressive paralogs would enhance SynGRl -mediated FXN expression. Because there are no small molecule inhibitors of HP1, a focused library of 791 epigenetic inhibitors from MedChem Express was screened (see Methods). Members of the library span a diverse chemical space, and a few, target other proteins in addition to those with epigenetic roles (FIG. 17A). 39 molecules increased and 106 reduced SynGRl -mediated T7V expression (FIG. 17B).Validating this approach, BET inhibitors and degraders that prevent SynGRl from engaging BRD4 / BET proteins diminished FXN expression. Amongst the chemically diverse set of molecules that enhance SynGRl -mediated FXN expression, the vast majority are histone deacetylase inhibitors (FIG. 17C). These results were cross-validated with siRNA-mediated knockdown of known protein targets of small molecules that impact SynGRl activity.Knockdow n of BRD4 attenuated SynGRl function, whereas knockdown of Class 1 HDACs enhanced it (FIG. 17D). As many of the HD AC inhibitors were optimized for oncological applications and have unfavorable cytotoxicity profiles, the brain-penetrant histone deacetylase inhibitor RGFP109 / RG2833, which was developed by Repligen to increase FXN expression in FRDA animal models of the disease (Rai et al. (2010) PLoS One 5, e8825), w as focused on. RGFP109 selectively inhibits members of class I histone deacetylases and inhibits the erasure of transcriptionally conducive acetyl-lysine-9 (H3K9ac) chromatin marks (FIG. 6A and FIG. 6B). The retention of H3K9ac marks is also expected to block the placement of the repressive H3K9me3 marks.
[0390] Co-treatment of RGFP109 with SynGRl showed synergistic FXN expression that greatly exceeded the maximal activation achieved by either small molecule on its own (FIG. 6C and FIG. 6D). The BLISS independence model for drug-drug interactions was used to map the synergy landscape of the two effectors of FXN expression (FIG. 6E), and the resulting quantitative measure of synergy7was consistent with the role of repressive chromatinAttorney Docket No. 19116.0064P1 in atenuating FXN expression. Using RNA-seq, whether the synergistic stimulation of FXN by RGFP109 also triggered SynGRl -responsive transcription initiation at other GAA-rich genomic loci was examined. The comprehensive transcriptome-wide profiles identified FXN as the primary7target of SynGRl (FIG. 6F), whereas RGFP109 treatment dramatically remodeled the transcriptome, with 2854 transcripts up-regulated and 1366 transcripts down-regulated (FIG. 6G). The transcriptome-wide perturbation by a freely diffusing HD AC inhibitor is not unexpected, as blocking HD AC activity across the genome is expected to elicit wide-ranging disruptive consequences. In agreement with RT-qPCR results (FIG. 6C and FIG. 6D), the unbiased transcriptomic data showed that co-treatment with SynGRl and RGFP109 non-linearly raised YAmRNA levels (FIG.6H). Importantly, when normalized against RGFP109-treated cells, the residual transcriptome profile closely matched that of cells treated with SynGRl alone (FIG. 61). The results demonstrate that RGFP109 did not adventitiously enable SynGRl to stimulate transcription at other genomic loci.
[0391] To investigate the basis of synergy between SynGRl and RGFP109, the levels of transcriptionally conducive H3K9ac marks were measured across FXN by quantitative ChIP assays (FIG. 6B). In agreement with previous reports (Soragni et al. (2014) Ann Neurol 76, 489-508), RGFP109 treatment led to an increase in H3K9ac marks at the promoter (FIG.6B. amplicon A). However, levels of H3K9ac marks steadily declined upon approach to the GAA repeats. This patern of H3K9Ac enrichment provides a mechanistic explanation for the observed synergy' in the presence of RGFP 109 and SynGRl. In untreated FRDA cells, modest levels of H3K9ac marks at the FXN promoter regulate the extent of transcription initiation (FIG. 6B and FIG. 6 J). This early regulatory step is not altered by SynGRl, which functions instead by enabling transcriptional elongation by Pol II across the roadblock presented by the repressive region. The functional role of SynGRl in licensing this postinitiation step is evident from the increase in phospho-serine2-marked Pol II (S2P), a signature mark of transcription elongation, dow nstream of the GAA repeats (FIG. 6K). In contrast, RGFP 109 treatment increases H3K9ac levels at the promoter, disrupting innate promoter-gating and inducing higher levels of transcription initiation (Chutake et al. (2016) Nucleic Acids Res 44, 5095-5104) (FIG. 6 J and FIG. 6K). However, despite the higher levels of initiation facilitated by RGFP 109, only a small fraction of the promoter-loaded Pol II is able to transcribe across the repressive GAA repeats, resulting in modest gains in FXN mRNA levels (FIG. 6K). In the absence of RGFP 109, innate promoter gating and SynGRl-mediated licensing of stalled Pol II act together to restore FXN expression in FRDA cells toAttorney Docket No. 19116.0064P1 levels observed in healthy cells. However, in the presence of both small molecules, a larger fraction of the RGFP 109-induced Pol II flux through the promoter is further licensed by SynGRl to transcribe past the repressive repeats, yielding dramatically increased levels of FXN transcripts (FIG.6 J and FIG. 6K).
[0392] Referring to FIG. 6A, a schematic of histone deacetylase inhibition by RGFP 109 is shown. FIG. 6B shows a ChlP-qPCR for H3K9ac normalized to percent input at specified amplicons across the / -W gene. FIG.6C shows a qRT-PCR analysis of FXN expression normalized to DMSO control. Error bars are SEM of 3 replicates. FIG. 6D shows comparative plots of observed FXN levels upon single or double agent treatment versus expected additive or multiplicate effects. FIG. 6E shows a BLISS independence model evaluation of synergy with painvise combinations of RGFP109 (DMSO, 6.25, 12.5, 25, 50) and SynGRl (DMSO, 0.125, 0.25, 0.5, and 1 uM) (n=3). FIG. 6F-I show volcano plots comparing RNAseq expression changes in response to SynGRl (FIG. 6F), RGFP 109 (FIG.6G), SynGRl + 109 treatment (FIG. 6H). or corrected for RGFP 109 in co-treated samples (FIG. 61). FIG. 6J-L show a ChlP-seq profile for Pol II (FIG. 6J), phosphor-Ser2 (S2P; FIG. 6K), and H3K9me3 (FIG. 6L) normalized to input. FIG.6M shows a model of SynGRl -mediated progressive transcription through repressive HP 1 -enriched repressive GAA repeat expansions within FXN in vivo.
[0393] Referring to FIG. 17A, a scatterplot of the fold-change in FXN expression induced by combining each member of a library of 791 small molecule epigenetic modulators with SynGRl compared to SynGRl alone is shown. Exemplar molecules enhancing, inhibiting, or not changing gene expression relative to SynGRl alone are colored by compound class in (FIG. 17C). FIG. 17B shows the chemical space representation of the molecules from (FIG. 17A) based on projecting the first and second t-SNE dimensions derived from the Morgan molecular fingerprint distance matrix. Exemplar molecules are colored as in (FIG. 17A). FIG. 17C shows an activity based hierarchical network graph representing 145 compounds from (FIG. 17A). Molecules are represented as leaf nodes and are color coded by the fold-change in FXN expression as reported in (FIG. 17A). FIG. 17D show s a plot of the fold-change in FXN expression resulting from genetic knockdown of gene targets identified from the epigenetic library screen. Genes are color coded according to the mechanistic classes depicted in (FIG. 17D). Values are plotted as the mean and SD.h. OVER-RIDING ACTIVELY PLACED H3K9ME3 MARKSAttorney Docket No. 19116.0064P1
[0394] Given the high levels of FXN expression triggered by the combined action of SynTEFl and HDACi-109, it was examined if H3K9me3 repressive marks were erased under these conditions. Rather than being eroded or erased, as predicted by current paradigms, the levels of H3K9me3 rose substantively over the region spanning the repeats (FIG. 61). The anti-correlated enrichment of H3K9Ac at the promoter and H3K9me3 at the expanded GAA repeats suggests regulated attenuation of transcription across FXN. Rather than a frozen or static epigenetic state, the data reveal that fresh repressive marks are placed in response to active transcription of disease-causing GAA repeats. The hyper-methylation of H3K9 upon co-treatment with HDACi-109 and SynTEFl emerges as a consequence of inhibiting histone deacetylation and perturbation of the dynamic balance between erasure and re-writing of repressive marks.
[0395] Reinforcement of repressive marks at transcribed regions is linked to silencing proteins such as Poly comb Repressive Complex (PRC2) or the Human Silencing Hub (HUSH) complex (Seczynska et al. (2023) Trends Genet 39, 251-267; Laugesen et al. (2019) Mol Cell 74, 8-18; Parreno et al. (2022) Cell Res 32, 231-253; Lehner (2025) Annu Rev Biochem 94, 361-386). To examine if these complexes play a role in repressing FXN in FRDA cells, multiple members of both the HUSH and PRC2 complexes were knocked dow n and modest impact on FXN expression was observed (FIG. 18A-C). In fact, the impact was further mitigated upon SynGRl treatment. These results are consistent with the observation that introns protect against HUSH-mediated transcriptional repression (Seczy nska et al. (2022) Nature 601, 440-445). As the repressive GAA-repeats reside within an intron of FXN, the HUSH complex had minor impact on its expression. Next, if the increase in signature repressive marks led to irreversible silencing of transcription was examined. To test this possibility, FRDA cells were treated with SynGRl for 24 hours, i.e.. conditions under which FXN expression triggers an increase in H3K9me3 and HP1 enrichment. After 24 hours, SynGRl was w ashed out and the decline in FXN mRNA levels to pre-treatment basal levels was monitored over 72 hours (FIG. 19). Once basal levels were attained, cells were re-treated with the same dose and duration of SynGRl and it was observed that FXN expression was fully restored, indicating that FXN transcription had not been irreversibly7silenced by the placement of repressive marks. Identical induction and decay profiles were obtained when the cells were treated for the third time. Taken together, the data demonstrate that SynGRl is able to override active placement of repressive marks in response to FXN expression.
[0396] Referring to FIG. ISA, an experimental design showing siRNA knockdown,Attorney Docket No. 19116.0064P1 SynGRl treatment, and downstream analysis is shown. FIG. 18B and FIG. 18C show representative data illustrating SynGRl mediated FXN expression after HUSH complex (FIG. 18B) or Poly comb Repressor (PRC2) complex (FIG. 18C) knockdown. Left, composition of the respective complexes; right, FXN expression after knockdow n of individual complex members. Gray / Left, untreated control; Red / Right, SynGRl treated.
[0397] Referring to FIG. 19, lymphocyte FRDA cells (GM15850) were treated with 1 pM SynGRl for 24 hrs. Cells were washed to remove SynGRl and replaced with fresh SynGRl free media until induced FXN mRNA levels diminish to basal levels. The cells were retreated with IpM SynGRl for 24 hours. FAjVmRNA was measured by qPCR. Data represent three independent experiments.i. MECHANISTIC AND THERAPEUTIC IMPLICATIONS
[0398] The calibrated restoration of FXN levels upon SynGRl treatment likely leverages the ability of HPla to dynamically associate with DNA (Keenen et al. (2021) Elife 10). These data reveal enrichment of HPla at nuclease inaccessible GAA-repeat regions that bear significantly higher levels of H3K9me3 compared to the genome average. Nonetheless, SynGRl can access GAA repeats and partition BRD4 into these inhospitable HP la-enriched regions. The observation that BRD4 can partition into HPla puncta in cells, and in HPla-DNA condensates in vitro, forces a reconsideration of a widely held assumption that functionally and phy sically orthogonal BRD4 and HPla proteins would not form cocondensates. Moreover, the ability of orthosteric inhibitors, such as iBETs and BET-degraders, to attenuate SynGRl -mediated FXN expression in cells further supports the conclusion that SynGRl -dependent BRD4 recruitment is necessary and sufficient for gene expression within repressive chromatin-w / w / e retaining the repressive character of the transcribed genomic locus.
[0399] Transcription within H3K9me3 -marked regions and recruitment of HP 1g during transcription have been reported in select cases (Vakoc et al. (2005) Mol Cell 19, 381-391; O'Geen et al. (2007) PLoS Genet 3, e89). However, the mechanism by which transcription is elicited while retaining repressive heterochromatin marks, whether in the intermediate or sonication-resistant state, are poorly understood. Using SynGRl. a minimal heterobifunctional molecule, to effectively restore gene expression without loss of the underlying chromatin states provides compelling evidence that simply recruiting BRD4 suffices to elicit transcription w ithin certain state of silenced chromatin. Armed with thisAttorney Docket No. 19116.0064P1 mechanistic insight, the imaging data was evaluated and it was found that, albeit infrequent, BRD4 did co-localize with non-FATVHPla puncta at physiological concentrations. This occurred in both healthy and diseased cells independent of SynGRl treatment. Collectively, these data provide new insights into mechanisms by which heterchromatinized genes can be accessed, transcribed in response to cellular cues, and then re-silenced once the cellular need is met. The ability of SynGRl to achieve this by solely recruiting BRD4 presents a parsimonious mechanism that may well be used by transcription factors that enable transcription of previously silenced genomic loci (Barral et al. (2024) Trends Genet 40, 134- 148).
[0400] How might SynGRl -recruited BRD4 achieve a paradoxical state wherein transcription does not cause the loss of repressive marks or the effectors of repression? It is proposed that the rapid association and dissociation kinetics of HP la for DNA, and the reported viscoelastic properties of the HPla-DNA condensates (Keenen et al. (2021) Elife 10), provide a solution to this conundrum. In essence, HPla-DNA condensates would rebuff high-flux transcription bursts but would permit passage to a slowly elongating Pol II that is assisted by synthetically recruited elongation machinery (Keenen et al. (2021) Elife 10) (FIG.6M). Furthermore, in a negative-feedback loop, the resulting transcripts often recruit repressive epigenetic machinery to silence expression (Allshire and Madhani (2018) Nat Rev Mol Cell Biol 19, 229-244; Eimer et al. (2018) Cell 174, 1095-1105.el011; Yu et al. (2018) Nature 558, 615-619). Similarly, GAA-rich transcripts could help retain HP1 at the transcribed locus and function as a rheostat to moderate the levels of FXN expression in SynGRl -treated cells. By enabling transcription elongation without eroding or erasing the repressive environment imposed at the repeat expansions. SynGRl provides a revealing insight into the fluidify and context-dependence of the histone code. While the signature epigenetic marks function as expected by convention, the ease with which they can be overridden to permit expression of critical genes was entirely unexpected.
[0401] From the therapeutic perspective, these data indicate that "‘epigenetic drugs"’ that inhibit chromatin-modifying enzymes (Gottesfeld (2019) Neurotherapeutics 16, 1032- 1049; Zhang et al. (2019) Trends Pharmacol Sci 40, 229-233; Delafycki and Bidichandani (2019) Neurobiol Dis 132, 104606) will perturb promoter gating more readily than the GAA-dependent gating of elongation that was observed at FXN. In contrast, SynGRl is designed to remove the elongation block placed by the GAA-repeat expansions in FXN. The synergy gained by combining therapeutic agents that act at distinct mechanistic steps in geneAttorney Docket No. 19116.0064P1transcription could expand the therapeutic index and impact for FRDA patients.
[0402] It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.
Claims
Attorney Docket No. 19116.0064P1CLAIMSWhat is claimed is:
1. A method of treating a disorder associated with dysregulation of frataxin (FXN) expression in a subject in need thereof the method comprising administering to the subject an effective amount of a synthetic transcription elongation factor (SynTEF) and an epigenetic inhibitor.
2. The method of claim 1, wherein the disorder is Friedreich’s ataxia or SCA27b.
3. The method of claim 1 or claim 2, wherein the SynTEF comprises a polyamide moiety configured to bind a deoxyribonucleic acid (DNA) sequence, wherein the polyamide moiety is tethered to a bromodomain extraterminal domain (BET) binding ligand via a chemical linker.
4. The method of claim 3, wherein the polyamide moiety’ is configured to bind a GAA sequence.
5. The method of claim 3 or claim 4, wherein the polyamide moiety comprises a monomeric unit having a structure represented by a formula:Owherein R1is selected from:wherein R10is selected from hydrogen, -NO2, and -C(0)NH2; andwherein R11is selected from hydrogen and C1-C4 alky l.
6. The method of any one of claims 3 to 5, wherein the polyamide moiety comprises a monomeric unit having a structure represented by a formula:Attorney Docket No. 19116.0064P1( )wherein is selected from:
7. The method of any one of claims 3 to 5, wherein the polyamide moiety comprises a monomeric unit having a structure represented by a formula selected from:wherein each of m. o, and p is independently an integer selected from 1 to 20.
8. The method of claim 7, wherein the polyamide moiety comprises at least two different monomeric units.
9. The method of claim 7, wherein the polyamide moiety comprises each of:
10. The method of claim 3, wherein the polyamide moiety is a linear polyamide moiety'.
11. The method of claim 10, wherein the linear polyamide moiety is a structure represented by a formula:Attorney Docket No. 19116.0064P1wherein n is an integer selected from 1 to 20;wherein q is 0 or 1;wherein R1is selected from:wherein R10is selected from hydrogen, -NO2, and -C(O)NH2; andwherein R11is selected from hydrogen and C1-C4 alkyl; andwherein each occurrence ofis independently selected from:wherein * denotes a bond connected to -C(O)- and ** denotes a bond connected to -NH-; andwherein each of R12and R13is independently selected from hydrogen and methyl.
12. The method of claim 11, wherein the polyamide moiety has a structure represented by a formula selected from:Attorney Docket No. 19116.0064P1R10andR1°13. The method of claim 11, wherein the polyamide moiety has a structure represented by a formula selected from:
14. The method of claim 11, wherein the polyamide moiety has a structure represented by a formula selected from:Attorney Docket No. 19116.0064P1R10and R10\ O wherein each occurrence of X is independently selected from N and CH.
15. The method of claim 11, wherein the polyamide moiety is selected from:Attorney Docket No. 19116.0064P116. The method of any one of claims 3 to 15, wherein the chemical linker is a polyethylene glycol (PEG) linker.
17. The method of claim 16, wherein the PEG linker has a structure represented by a formula selected from:wherein * denotes a bond connected to the polyamide moiety and ** denotes a bond connected to the BET binding ligand; andwherein u is an integer selected from 1 to 20.Attorney Docket No. 19116.0064P118. The method of claim 17, wherein u is an integer selected from 1 to 15.
19. The method of any one of claims 3 to 18, wherein the BET binding ligand has a structure represented by a formula selected from:wherein r is an integer selected from 1 to 6;wherein R2is selected from hydrogen and C1-C6 alkyl;wherein each of R3, R4, and R5is independently selected from hydrogen, methyl, ethyl, and halomethyl; andwherein R6is selected from halogen, -NH2, -C(O)NH2, C1-C4 aminoalkyl, and Ar1; and wherein Ar1is selected from a 5- to 10-membered heteroaryl and a 6- to 10- membered aryl, and is substituted with 0, 1, 2, or 3 groups independently selected from halogen, -CN, -NH2, -OH, -NO2, C1-C4 alkyl, C2-C4 alkenyl. C1-C4 haloalkyl, C1-C4 cyanoalkyl, C1-C4 hydroxyalkyl, C1-C4 haloalkoxy, C1-C4 alkoxy, C1-C4 alkylamino, (C1-C4)(C1-C4) dialkylamino, and C1-C4 aminoalkyl.
20. The method of claim 19. wherein the BET binding ligand has a structure represented by a formula:Attorney Docket No. 19116.0064P121. The method of claim 19, wherein the BET binding ligand has a structure represented by a formula:R622. The method of any one of claims 19 to 21, wherein r is 1.
23. The method of any one of claims 19 to 22. wherein R2is hydrogen.
24. The method of any one of claims 19 to 23, wherein each of R3, R4, and R5is independently selected from hydrogen and methyl.
25. The method of any one of claims 19 to 23, wherein each of R3, R4, and R5is methyl.
26. The method of any one of claims 19 to 25, wherein R6is halogen.
27. The method of any one of claims 19 to 25, wherein R6is chloro.
28. The method of claim 19, wherein the BET binding ligand is selected from:
29. The method of any one of claims 3 to 18, wherein the BET binding ligand has a structure represented by a formula:Attorney Docket No. 19116.0064P1wherein each of Q1and Q2is independently selected from N and CH;wherein each of R7aand R7bis independently selected from hydrogen, halogen. -NH2, C1-C4 alkyl, C1-C4 alkoxy, and C1-C4 aminoalkyl;wherein R8is selected from hydrogen, halogen, -NH2, C1-C4 alky l, C2-C4 alkenyl, C2-C4 alkynyl, C1-C4 aminoalkyl, and -C(0)NH2; andwherein each of R9aand R9bis independently selected from hydrogen, halogen, -NH2, C1-C4 alkyl, C1-C4 alkoxy, and C1-C4 aminoalkyl.
30. The method of claim 29, provided that when R7ais hydrogen, then R7bis C1-C4 alkoxy.
31. The method of claim 29 or claim 30. provided that when R7bis hydrogen, then R7ais selected from -NH2, C1-C4 alkoxy, and C1-C4 aminoalkyl.
32. The method of any one of claims 29 to 31, provided that at least one of R9aand R9bis halogen, -NH2, C1-C4 alkyl, C1-C4 alkoxy, or C1-C4 aminoalkyl.
33. The method of any one of claims 29 to 32, wherein each of Q1and Q2is CH.
34. The method of any one of claims 29 to 33. wherein each of R7aand R7bis C1-C4 alkoxy.
35. The method of any one of claims 29 to 33, wherein each of R7aand R7bis methoxy.
36. The method of any one of claims 29 to 35, wherein R8is hydrogen.
37. The method of any one of claims 29 to 36, wherein each of R9aand R9bis C1-C4 alkyl.
38. The method of any one of claims 29 to 36, wherein each of R9aand R9bis methyl.Attorney Docket No. 19116.0064P139. The method of claim 29, wherein the BET binding ligand is:
40. The method of any one of claims 3 to 18, wherein the BET binding ligand is a structure selected from:Attorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P141. The method of any one of claims 3 to 18, wherein the BET binding ligand is a structure selected from:
42. The method of claim 3, wherein the SynTEF has a structure represented by a formula selected from:Attorney Docket No. 19116.0064P1nwherein n is an integer selected from 1 to 20;wherein q is 0 or 1;wherein u is an integer selected from 1 to 20;wherein R1is selected from:wherein R10is selected from hydrogen, -NO2, and -C(O)NH2; andwherein R11is selected from hydrogen and C1-C4 alkyl; andwherein each occurrence ofis independently selected from:wherein * denotes a bond connected to -C(O)- and ** denotes a bond connected to -NH-;wherein each of R12and R13is independently selected from hydrogen and methyl; andAttorney Docket No. 19116.0064P1wherein R14is the BET binding ligand,or a pharmaceutically acceptable salt thereof.
43. The method of claim 42. wherein the SynTEF has a structure represented by a formula selected from:Attorney Docket No. 19116.0064P1Clor a pharmaceutically acceptable salt thereof.
44. The method of claim 42, wherein the SynTEF is selected from:ciciAttorney Docket No. 19116.0064P1oAttorney Docket No. 19116.0064P1Attorney Docket No. 19116.0064P1or a pharmaceutically acceptable salt thereof.
45. The method of any one of claims 1 to 44, wherein the epigenetic inhibitor is selected from an histone deacetylase (HD AC) inhibitor, a non-receptor tyrosine kinase ABL protoAttorney Docket No. 19116.0064P1oncogene 1 (ABL 1 ) inhibitor, a non-receptor tyrosine kinase ABL proto-oncogene (ABL) inhibitor, an acetylcholinesterase inhibitor, an adrenoceptor alpha 2A inhibitor, an adrenoceptor alpha 2C inhibitor, an AKT serine / threonine kinase 1 inhibitor, an apolipoprotein Al inhibitor, an aurora kinase inhibitor, a butyrlcholinesterase inhibitor, a BCL2 apoptosis regulator inhibitor, a BCL2 like 1 inhibitor, a bromodomain (BRD) inhibitor, a calcium voltage-gated channel subunit alphal B inhibitor, a cyclin T1 inhibitor, a CD274 molecule inhibitor, a cyclin dependent kinase inhibitor, a cholinergic receptor muscarinic inhibitor, a cAMP responsive element binding protein inhibitor, a CREB binding lysine acetyltransferase inhibitor, a catenin beta inhibitor, a DNA methyltransferase inhibitor, an epidermal growth factor receptor inhibitor, an egl-9 family hypoxia inducible factor inhibitor, an euchromatic histone lysine methyltransferase inhibitor, an EP300 lysine acetyltransferase inhibitor, an erb-b2 receptor tyrosine kinase inhibitor, a fibroblast growth factor receptor inhibitor, a fms related receptor tyrosine kinase inhibitor, a forkhead box Al inhibitor, a Src family tyrosine kinase FYN proto-oncogene inhibitor, a glycogen synthase kinase beta inhibitor, a hypoxia inducible factor 1 subunit alpha (HIF 1 A) inhibitor, an interferon alpha 1 inhibitor, an insulin like growth factor 1 receptor inhibitor, an interleukin inhibitor, a Janus kinase inhibitor, a lysine demethylase inhibitor, a lysine acetyltransferase inhibitor, a lysine methyltransferase inhibitor, a Src family tyrosine kinase LCK proto-oncogene inhibitor, a mitogen-activated protein kinase kinase inhibitor, a mitogen-activated protein kinase kinase kinase inhibitor, a microtubule affinity’ regulating kinase inhibitor, a metallo-beta-lactamase domain containing inhibitor, a menin inhibitor, a mechanistic target of rapamycin kinase inhibitor, a bHLH transcription factor MYC proto-oncogene inhibitor, a nicotinamide phosphoribosyltransferase inhibitor, a nuclear receptor subfamily 4 group A member 2 inhibitor, a nuclear receptor binding SET domain protein inhibitor, a neurotrophic receptor tyrosine kinase inhibitor, a NUAK family kinase inhibitor, a purinergic receptor P2X 7 inhibitor, a prolyl 4-hydroxylase subunit alpha 1 inhibitor, a phosphodiesterase 5A inhibitor, a platelet derived growth factor receptor beta inhibitor, a serine / threonine Pirn protooncogene inhibitor, a proline rich transmembrane protein inhibitor, a polo like kinase inhibitor, a protein kinase AMP-activated catalytic subunit inhibitor, a protein kinase C alpha inhibitor, a platelet activating factor receptor inhibitor, a ret proto-oncogene inhibitor, a salt inducible kinase inhibitor, a SIK family kinase inhibitor, a sirtuin inhibitor, a solute carrier family member inhibitor, a non-receptor tyrosine kinase SRC proto-onocogene inhibitor, aAttorney Docket No. 19116.0064P1signal transducer and activator of transcription inhibitor, a DNA topoisomerase inhibitor, a DNA topoisomerase alpha inhibitor, and a WD repeat domain inhibitor.
46. The method of claim 45, wherein the epigenetic inhibitor is a HIF1 A inhibitor.
47. The method of claim 46, wherein the HIF1 A inhibitor is selected from acriflavine, MK-8617, TP0463518, and DMOG.
48. The method of claim 45. wherein the epigenetic inhibitor is an HD AC inhibitor.
49. The method of claim 48, wherein the HD AC inhibitor is selected from Dacinostat, ACY-738, MPT0G211, Pyroxamide, RG2833 (RGFP109), Quisinostat, CXD101, QTX125 (TFA), WT-161, Entinostat, Mocetinostat, Corin, Belinostat, NAMPT-IN-3, EDO-S101 (Tinostamustine), Citarinostat (ACY241), Resminostat, SR-4370, LMK-235, FNDR-20123, Vorinostat, JAK / HDAC-IN-1, Santacruzamate A, Nanatinostat, Tucidinostat (chidamide, HBI-8000, CS 055), Nexturastat A, Rocilinostat, RDACs / mTOR Inhibitor 1, Scriptaid, Pracinostat, HDAC-IN-3, Trichostatin A, CUDC-101, and Givinostat.
50. The method of claim 48, wherein the HD AC inhibitor is selected from Abexinostat (PCI-24781), Alteminostat (CKD581), AR42 (OSU-HDAC42), Belinostat (PDX101), Chidamide (Tucidinostat, CS055). Citarinostat (ACY241), CKD504, CKD506, CXD101, Decitabine, Domatinostat (4SC202), Entinostat (MS-275, SNDX-275), FRM-0334, Givinostat (ITF-2357), HG146, MBF-015, Mocetinostat (MGCD0103), Nicotinamide, Panobinostat (LHB-589), Phenyl butyrate, Pivanex, Pracinostat (SB939), Quisinostat, Remetinostat (SHP141), Resminostat (4SC-201), Ricolinostat (ACY-1215), Romidepsine (depsopeptide, FR901228. FK228. Istodax). Tacedinaline (CI994), Tefinostat (CHR2845). Valproic acid, and Vorinostat (MK-0683, SAHA).
51. The method of claim 48, wherein the HD AC inhibitor is selected from Belinostat and Romidepsin.
52. The method of claim 48, wherein the HD AC inhibitor is HDACi-109, having a structure:Attorney Docket No. 19116.0064P153. The method of claim 3, wherein the epigenetic inhibitor is an HDAC inhibitor selected from Dacinostat, ACY-738, MPT0G211, Pyroxamide, RG2833 (RGFP109), Quisinostat, CXD101, QTX125 (TFA), WT-161, Entinostat, Mocetinostat, Corin, Belinostat, NAMPT-IN-3, EDO-S101 (Tinostamustine), Citarinostat (ACY241), Resminostat, SR-4370, LMK-235, FNDR-20123, Vorinostat, JAK / HDAC-IN-1, Santacruzamate A, Nanatinostat, Tucidinostat (chidamide, HBI-8000, CS 055), Nexturastat A, Rocilinostat, RDACs / mTOR Inhibitor 1, Scriptaid, Pracinostat, HDAC-IN-3, Trichostatin A, CUDC-101, and Givinostat.
54. The method of claim 3, wherein the epigenetic inhibitor is an HDAC inhibitor selected from Abexinostat (PCI-24781). Altemmostat (CKD581). AR42 (OSU-HDAC42). Belinostat (PDX101), Chidamide (Tucidinostat, CS055), Citarinostat (ACY241), CKD504, CKD506, CXD101, Decitabme, Domatinostat (4SC202), Entinostat (MS-275, SNDX-275), FRM-0334, Givinostat (ITF-2357), HG146, MBF-015, Mocetinostat (MGCD0103), Nicotinamide, Panobinostat (LHB-589). Phenyl butyrate, Pivanex, Pracinostat (SB939), Quisinostat, Remetinostat (SHP141), Resminostat (4SC-201), Ricolinostat (ACY-1215), Romidepsine (depsopeptide, FR901228, FK228, Istodax), Tacedinaline (CI994), Tefinostat (CHR2845), Valproic acid, and Vorinostat (MK-0683, SAHA).
55. The method of claim 3, wherein the epigenetic inhibitor is an HDAC inhibitor selected from Belinostat and Romidepsin.
56. The method of claim 3, wherein epigenetic inhibitor is HDACi-109, having a structure:
57. The method of claim 3, wherein the SynTEF is:andwherein the HDAC inhibitor is HDACi-109, having a structure:Attorney Docket No. 19116.0064P1NH58. The method of any one of claims 1 to 57, wherein the subject is a mammal.
59. The method of claim 58, wherein the mammal is a human.
60. The method of any one of claims 1 to 59, wherein the subject has been diagnosed with a need for treatment of the disorder prior to the administering step.
61. The method of any one of claims 1 to 60, further comprising the step of identifying a subject in need of treatment of the disorder.
62. The method of any one of claims 1 to 61, wherein the effective amount is a therapeutically effective amount.
63. The method of any one of claims 1 to 61, wherein the effective amount is a prophylactically effective amount.
64. A pharmaceutical composition comprising an effective amount of a synthetic transcription elongation factor (SynTEF), an epigenetic inhibitor, and a pharmaceutically acceptable carrier.
65. The pharmaceutical composition of claim 64, wherein the epigenetic inhibitor is an HDAC inhibitor.
66. A kit comprising a synthetic transcription elongation factor (SynTEF) and an epigenetic inhibitor, and one or more selected from:(a) at least one agent known to treat a disorder associated with dysregulation of frataxin (FXN) expression;(b) instructions for administering the SynTEF in connection with treating a disorder associated with dysregulation of frataxin (FXN) expression;(c) instructions for administering the epigenetic inhibitor in connection with treating a disorder associated with dysregulation of FXN expression; andAttorney Docket No. 19116.0064P1(d) instructions for treating a disorder associated with dysregulation of FXN expression.
67. The kit of claim 66, wherein the SynTEF and the epigenetic inhibitor are copackaged.
68. The kit of claim 66, wherein the SynTEF and the epigenetic inhibitor are coformulated.