Heterocyclic compound, method for preparing same, and pharmaceutical use thereof
By designing heterocyclic compounds to bind with PROTAC chimeric molecules, selective degradation of BCL6 was achieved, solving the problem of the difficulty in effectively degrading BCL6 in existing technologies, and showing potential applications in the treatment of BCL6-related diseases.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-11-21
- Publication Date
- 2026-05-28
AI Technical Summary
Existing technologies are unable to effectively degrade the BCL6 protein, leading to its overexpression and the development of various diseases, such as non-Hodgkin's lymphoma and other malignant tumors.
A class of heterocyclic compounds was designed and synthesized, which selectively degrade BCL6 by binding E3 ligase to the BCL6BTB domain through PROTAC chimeric molecules.
It achieves highly efficient degradation of BCL6, with the potential to treat BCL6-mediated or dependent diseases such as B-cell lymphoma, breast cancer, and non-small cell lung cancer.
Smart Images

Figure CN2025136731_28052026_PF_FP_ABST
Abstract
Description
Heterocyclic compounds, their preparation methods and their applications in medicine Technical Field
[0001] This disclosure pertains to the pharmaceutical field and relates to a heterocyclic compound of general formula (I), a method for its preparation, a pharmaceutical composition containing the heterocyclic compound, and its use as a therapeutic agent, particularly as a BCL6 inhibitor or degrader, and in the preparation of medicaments for the treatment and / or prevention of BCL6-mediated or dependent diseases or conditions. Background Technology
[0002] BCL6 (B-cell lymphoma 6) is a member of the BTB / POZ zinc finger family, containing an N-terminal BTB / POZ domain and a C-terminal zinc finger structure. As a transcription factor for T follicular helper (Tfh) cells, BCL6 is essential for germinal center formation and antibody affinity maturation in naive B cells. Initially identified as an oncogene in diffuse large B-cell lymphomas (DIBCLs), BCL6 is associated with many types of diseases, including B-cell acute lymphoblastic leukemia, chronic myeloid leukemia, breast cancer, and non-small cell lung cancer (NSCLC). The N-terminal BTB / POZ domain binds to and recruits co-inhibitors such as SMRT, NCOR1, and BCOR, forming type I and type II histone deacetylase complexes, while the C-terminal zinc finger binds to specific DNA recognition sequences. By binding to target gene sequences and forming complexes, BCL6 can reduce the expression of target gene RNA, including some key tumor suppressor factors. Overexpression of BCL6 leads to ectopic inhibition of cyclins and DNA repair checkpoint proteins, resulting in uncontrolled cell proliferation and tumorigenesis, a phenomenon commonly seen in malignancies such as non-Hodgkin's lymphoma (NHL). Germinal center reactions (GCs) in some diseases lead to increased production of disease-related autoantibodies, suggesting that inhibiting or degrading BCL6 has potential therapeutic applications. The structural characterization of the co-crystal structure of the BCL6 TB / POZ domain and its co-inhibitor indicates that binding occurs at a side groove formed at the interface between the BCL6 BB / POZ homodimers. Therefore, research is being conducted on specific ligands binding to this groove site, and the discovery of this groove-affinity ligand makes BCL6 a potential drug target.
[0003] Protein degradation is a highly regulated and essential process for maintaining cellular homeostasis. The selective recognition and removal of damaged, misfolded, or redundant proteins is achieved via the ubiquitin-proteasome pathway (UPP). UPP is central to regulating almost all cellular processes. Protein ubiquitination is accomplished by E3 ubiquitin ligases, which bind to proteins and add ubiquitin molecules to them, thereby enabling the proteasome to degrade the ubiquitinated protein. One promising therapy uses chimeric proteolysis, commonly known as PROTACs, to remove unwanted proteins through protein degradation. PROTACs are ligand-directed degraders that bind an E3 ligase to the target protein to be degraded. These bivalent molecules typically consist of an E3 ligase ligand that is linked via a linker portion to a small molecule bound to the target protein. PROTACs position the E3 ligase at the appropriate distance and orientation to the target protein, allowing the latter to ubiquitinate. The ubiquitinated target protein is then recognized by the proteasome and subsequently degraded. In summary, PROTAC chimeric molecules can be used to link ligands targeting the substrate-binding pocket of the BCL6 BTB domain and E3 ligands together via linkers, thereby achieving the goal of degrading BCL6. Summary of the Invention
[0004] The purpose of this disclosure is to provide a compound of general formula (I) or a pharmaceutically acceptable salt thereof.
[0005] in:
[0006] E is
[0007] R 1 Selected from hydrogen atom, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, -alkylene-NR 17 R 18 alkyl, cycloalkylalkyl, heterocyclic, aryl, and heteroaryl; each of the alkyl, alkylene, alkoxy, alkoxyalkyl, cycloalkyl, cycloalkylalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace;
[0008] X 1 For N or CR 2a ;
[0009] X 2 For N or CR 2b ;
[0010] X 3 For N or CR 2c ;
[0011] R 2a R2b R 2c and R 3a The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, hydroxyl, -NR 17 R 18 ,-alkylene-NR 17 R 18 cycloalkyl and heterocyclic groups;
[0012] R 3 -W 1 -(CR 4a R 4b ) t -W 2 Or -CH = CH-W 2 ;
[0013] R 4a and R 4b They may be the same or different, and each is independently selected from hydrogen, halogen, alkyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, cyano, and hydroxyl; or R 4a and R 4b Together with the attached carbon atom, it forms a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R groups. 0 replace;
[0014] t is 1, 2, 3, 4, or 5;
[0015] W 1 Selected from NR Y O and S;
[0016] R Y Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl;
[0017] W 2 Selected from -C(O)NR 4 R 5 -C(O)R 6 -C(O)OR 6 -S(O) v R 6 -P(O)-R 6 R 6 and -C(=NH)NH2;
[0018] R 4 and R 5The same or different, and each independently selected from hydrogen atoms, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, cycloalkyl, heterocyclic, aryl, and heteroaryl, wherein the alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl are each independently optionally selected by one or more R 0 Replace; or, R 4 and R 5 Together with the attached nitrogen atom, it forms an optional structure with one or more R atoms. 0 Substituted heterocyclic groups;
[0019] R 6 The same or different, and each independently selected from hydrogen atoms, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl, wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl is independently optionally selected by one or more R 0 replace;
[0020] Or, R 3 and R 3a Together with their respective attached atoms, they form cycloalkyl or heterocyclic groups, each of which is independently and optionally influenced by one or more R groups. 7 replace;
[0021] Z is selected from O, S, (CR) 8a R 8b ) z and NR 9 ;
[0022] R 8a and R 8b They may be the same or different, and each is independently selected from hydrogen, halogen, alkyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, cyano, and hydroxyl; or R 8a and R 8b Together with the attached carbon atom, it forms a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R groups. 0 replace;
[0023] z is 1, 2, 3, 4 or 5;
[0024] R T and R 9 They may be the same or different, and each is independently selected from hydrogen atom, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxyalkyl, hydroxyl, alkoxy, -alkylene-NR 17 R 18cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl; wherein the alkyl, alkenyl, alkynyl, alkoxyalkyl, alkoxy, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl are each independently and optionally selected by one or more R 0 replace;
[0025] Z 1 Z 2 and Z 3 One of them is a carbon atom bonded to NH, and the other two are the same or different, and each is independently N or CR. 10 ;
[0026] Z 4 For CR 10a Or N;
[0027] R 10 and R 10a The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, hydroxyl, -NR 17 R 18 ,-alkylene-NR 17 R 18 cycloalkyl and heterocyclic groups;
[0028] Or, R T and R 10a Together with their respective attached atoms, they form cycloalkyl or heterocyclic groups, each of which is independently and optionally influenced by one or more R atoms. 11 replace;
[0029] Ring A is a bicyclic aryl or a bicyclic heteroaryl, wherein each of the bicyclic aryl and bicyclic heteroaryl groups is independently and optionally converted by one or more R groups. 12 replace;
[0030] L is -(L) A ) n -;
[0031] n is an integer from 0 to 20;
[0032] Each L A They may be the same or different, and each is independently selected from O and S(O). v NR d C(O), C(O)NR d NR dC(O), C(O)O, OC(O), alkylene, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkylene, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally selected by one or more R L replace;
[0033] R d Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl;
[0034] Q is selected from * The terminal is connected to L;
[0035] Y is selected from C(O), CR 13a R 13b O, S and NR 13c ;
[0036] R 13a and R 13b They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, haloalkyl groups, and hydroxyalkyl groups; or, R 13a and R 13b Together with the adjacent carbon atom, they form cycloalkyl groups;
[0037] R 13c and R 14 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl and cycloalkylalkyl;
[0038] Q 1 For N or CR 15a ;
[0039] Q 2 For N or CR 15b ;
[0040] Q 3 For N or CR 15c ;
[0041] Q 4 For N or CR 15d ;
[0042] A 1 For N or CR A1 ;
[0043] A 2 For N or CR A2 ;
[0044] R 15a R 15b R 15c R 15d RA1 and R A2 The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, cyano, haloalkyl, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalkoxy, cycloalkyl, heterocyclic, aryl, heteroaryl, -OR 16 -NR 17 R 18 ,-alkylene-NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 and -S(O) v R 16 ;
[0045] Or, R A1 and R 15a Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace;
[0046] Or, R A1 and R 15b Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace;
[0047] Or, R A1 and R 15c Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace;
[0048] Or, R A1 and R 15d Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace;
[0049] Each R q The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, -OR 16 -NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18-OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20 )NR 17 R 18 -S(O) v R 16 -S(O) v NR 17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 =O, =S, =CR 21 R 22 cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace;
[0050] Or, R q and R 15a Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace;
[0051] Or, R q and R 15b Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace;
[0052] Or, R q and R 15c Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace;
[0053] Or, R q and R 15d Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace;
[0054] a1 and a2 are each independently 0, 1, 2, 3 or 4;
[0055] k can be 0, 1, 2, 3, 4, 5, or 6;
[0056] L c Selected from key, CR a R b O, S, NR c C(O), C(O)NR c and NR c C(O);
[0057] R a and R b They may be the same or different, and each is independently selected from hydrogen, halogen, alkyl, haloalkyl, alkoxy, hydroxyalkyl, cyano and hydroxyl;
[0058] R c Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl;
[0059] It can be a double bond or a single bond;
[0060] X is N or CR x ;
[0061] R x Selected from hydrogen atom, halogen, hydroxyl, alkyl, hydroxyalkyl, haloalkyl and cyano;
[0062] R 7 R 11 R 12 R 15 and R L Same or different, and each independently selected from halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, -OR 16 -NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 -OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20 )NR17 R 18 -S(O) v R 16 -S(O) v NR 17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 =O, =S, =CR 21 R 22 cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace;
[0063] Or, two Rs 7 Together with the attached atom, they form a cycloalkyl or heterocyclic group, or, two R groups... 11 Together with the attached atom, they form a cycloalkyl or heterocyclic group, or, two R groups... 12 Together with the attached atom, they form a cycloalkyl or heterocyclic group, or, two R groups... 15 Together with the attached atom, they form a cycloalkyl or heterocyclic group, or, two R groups... L Together with the attached atom, it forms a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R groups. 0 replace;
[0064] R 16 R 17 and R 18 The same or different, and each independently selected from hydrogen atoms, alkyl, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein the alkyl, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl are each independently optionally selected by one or more R atoms. 0 Replace; or R 17 and R 18 Together with the connected nitrogen atom, they form an optional structure with one or more R atoms. 0 Substituted heterocyclic groups;
[0065] R 19 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl groups, and cycloalkyl groups;
[0066] R 20 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, alkoxy, hydroxyl and cycloalkyl;
[0067] R 21 and R22 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, haloalkyl groups, hydroxyalkyl groups, and cycloalkyl groups; or, R 21 and R 22 Together with the carbon atoms attached to it, they form cycloalkyl groups;
[0068] R 0 They may be the same or different, and each is independently selected from halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, aminoalkyl, hydroxyl, cyano, nitro, amino, -NHalkyl, -N(alkyl)2, =O, =S, =CH2, =CHF, =CF2, -C(O)Oalkyl, -C(O)OH, -C(O)NH2, -C(O)NH(alkyl), -C(O)N(alkyl)2, -C(O)halogen, -C(O)alkyl, -S(alkyl), cycloalkyl, cycloalkylalkyl, cycloalkyloxy, heterocyclic, heterocyclic alkyl, heterocyclic oxy, aryl, arylalkyl, aryloxy, heteroaryl, heteroarylalkyl and heteroaryloxy;
[0069] v can be 0, 1, or 2.
[0070] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein X 1 For N or CH; in some implementations, X 1 For CR 2a ;R 2a As defined in general formula (I); in some implementations, X 1 For CH.
[0071] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein X 2 For N or CH; in some implementations, X 2 For CR 2b ;R 2b As defined in general formula (I); in some implementations, X 2 For CH.
[0072] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein X 3 For N or CH; in some implementations, X 3 For CR 2c ;R 2c As defined in general formula (I); in some implementations, X 3 For CH; in some implementations, X 3 Let N be the number of elements in the array.
[0073] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein X 1 For CR 2a ;X 2 For CR 2b ;X 3 For CR 2c Or, X 1 For N; X 2 For CR 2b ;X 3 For CR 2c Or, X 1 For CR 2a ;X 2 For N; X 3 For CR 2c Or, X 1 For CR 2a ;X 2 For R 2b ;X 3 For N; R 2a R 2b and R 2c As defined in general formula (I); in some implementations, X 1 For CR 2a ;X 2 For CR 2b ;X 3 For CR 2c ;R 2a R 2b and R 2c As defined in general formula (I); in some implementations, X 1 For CH; X 2 For CH; X 3 For CR 2c ;R 2c It is a hydrogen atom or a methoxy group; in some embodiments, X 1 For CH; X 2 For CH; X 3 For CH.
[0074] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein ring A is optionally surrounded by one or more R 12 Substituted 9- or 10-membered bicyclic heteroaryl groups; R 12 As defined in general formula (I); in some implementations, ring A is optionally bounded by one or more R 12 Substituted 9- or 10-membered bicyclic heteroaryl groups; R 12 Selected from halogens, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6Halogenated alkyl and cyano groups; in some embodiments, ring A is optionally surrounded by one or more R groups. 12 Substituted 9-membered bicyclic heteroaryl group; R 12 As defined in general formula (I); in some implementations, ring A is optionally bounded by one or more R 12 Substituted 9-membered bicyclic heteroaryl group; R 12 Selected from halogens, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkyl and cyano groups; in some embodiments, ring A is... U, G, B, D, M, K, and R are as defined in general formula (II); in some implementations, ring A is G, D, M, K, and R are as defined in general formula (IV); in some implementations, ring A is selected from... The * end is connected to NH.
[0075] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein R 12 Selected from halogens, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkyl and cyano groups; in some embodiments, R 12 It is halogen or cyano; in some embodiments, R 12 It is either Cl or cyano.
[0076] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein Z 1 Z 2 and Z 3 One of them is a carbon atom bonded to NH, and the other two are the same or different, and each is independently a C or D atom. 10 ;R 10 As defined in general formula (I); in some implementations, Z 2 Z is a carbon atom bonded to NH. 1 and Z 3 Whether the same or different, and each independently constitutes a CR 10 Or, Z 3 Z is a carbon atom bonded to NH. 1 and Z 2 Whether the same or different, and each independently constitutes a CR 10 ;R 10 As defined in general formula (I); in some implementations, Z 2 Z is a carbon atom bonded to NH. 1 and Z 3 For CH; or, Z 3Z is a carbon atom bonded to NH. 1 and Z 2 For CH.
[0077] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein Z 4 For CR 10a ;R 10a As defined in general formula (I); in some implementations, Z 4 For N or CH; in some implementations, Z 4 For CH.
[0078] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein X is N; in some embodiments, X is CR x ;R x As defined in general formula (I); in some implementations, X is CH or N; in some implementations, X is CH.
[0079] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein It is a single key; in some implementations, It is a double bond.
[0080] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein X is CH; It can be a double bond or a single bond; in some implementations, X is CH; X is a single bond; in some implementations, X is N; It is a single key.
[0081] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein L c Selected from bonds, NH and NHC(O); in some embodiments, L c For key.
[0082] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof is a compound represented by general formula (II) or a pharmaceutically acceptable salt thereof.
[0083] in:
[0084] U is N or CR 12a ;
[0085] G is N or CR 12b ;
[0086] B is either C or N;
[0087] D is either C or N;
[0088] M, K, and R may be the same or different, and each is independently selected from O, S, and CR. 12c , N and NR 12d ;
[0089] R 12a R 12b and R 12c The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, -OR 16 -NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 -OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20 )NR 17 R 18 -S(O) v R 16 -S(O) v NR 17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace;
[0090] R 12d Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl;
[0091] R 1 R 2a R 2b R 2c R3 R 3a Q, L, R 0 R 16 -R 20 And v is as defined in general formula (I).
[0092] In some embodiments of this disclosure, the compound represented by general formula (I) or general formula (II), or a pharmaceutically acceptable salt thereof, is a compound represented by general formula (II-1) or a pharmaceutically acceptable salt thereof.
[0093] in:
[0094] M 1 and M 2 Each is independently selected from bonds, O, S, C(O), (CR) 7g R 7h ) h NR 7i and C(O)NR 7i ;
[0095] h can be 0, 1, 2, or 3;
[0096] x is 0, 1, 2, or 3;
[0097] R 7a R 7b R 7c R 7d R 7e R 7f R 7g and R 7h The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, -OR 16 -NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 -OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20 )NR 17 R 18 -S(O) vR 16 -S(O) v NR 17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace;
[0098] Or, R 7a and R 7b Together they form = O; or, R 7c and R 7d Together they form = O; or, R 7e and R 7f Together they form = O; or, R 7g and R 7h Together they form = O;
[0099] Or, R 7a and R 7b Together with the attached atoms, they form cycloalkyl or heterocyclic groups, or, R 7c and R 7d Together with the attached atoms, they form cycloalkyl or heterocyclic groups, or, R 7e and R 7f Together with the attached atoms, they form cycloalkyl or heterocyclic groups, or, R 7g and R 7h Together with the attached atoms, they form cycloalkyl or heterocyclic groups, or, R 7a and R 7c Together with the attached atoms, they form cycloalkyl or heterocyclic groups, or, R 7a and R 7e Together with the attached atoms, they form cycloalkyl or heterocyclic groups, or, R 7c and R 7e Together with the attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 0 replace;
[0100] R 7i Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, alkoxyalkyl, cycloalkyl, and cycloalkylalkyl;
[0101] R 1 R 2a R 2b R2c ,U,G,B,D,M,K,R,Q,L,R 0 R 16 -R 20 And v is as defined in general formula (II).
[0102] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof is a compound represented by general formula (III) or a pharmaceutically acceptable salt thereof.
[0103] in:
[0104] m is 0, 1, or 2;
[0105] U is N or CR 12a ;
[0106] G is N or CR 12b ;
[0107] B is either C or N;
[0108] D is either C or N;
[0109] M, K, and R may be the same or different, and each is independently selected from O, S, and CR. 12c , N and NR 12d ;
[0110] R 12a R 12b and R 12c The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, -OR 16 -NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 -OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20 )NR 17 R 18 -S(O) v R 16 -S(O) v NR17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace;
[0111] R 12d Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl;
[0112] Z, R T R 10 R 10a Q, L, R 0 R 16 -R 20 And v is as defined in general formula (I).
[0113] In some embodiments of this disclosure, the compound represented by general formula (I) or general formula (III), or a pharmaceutically acceptable salt thereof, is a compound represented by general formula (III-1) or a pharmaceutically acceptable salt thereof.
[0114] in:
[0115] M 3 Selected from bonds, O, S, C(O), (CR) 11e R 11f ) j NR 11g and C(O)NR 11g ;
[0116] j can be 0, 1, 2, or 3;
[0117] y is 0, 1, 2, 3 or 4;
[0118] R 11a R 11b R 11c R 11d R 11e and R 11f The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, -OR 16 -NR 17 R 18 -C(O)R16 -C(O)OR 16 -C(O)NR 17 R 18 -OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20 )NR 17 R 18 -S(O) v R 16 -S(O) v NR 17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace;
[0119] Or, R 11a and R 11b Together they form = O; or, R 11c and R 11d Together they form = O; or, R 11e and R 11f Together they form = O;
[0120] Or, R 11a and R 11b Together with the attached atoms, they form cycloalkyl or heterocyclic groups, or, R 11c and R 11d Together with the attached atoms, they form cycloalkyl or heterocyclic groups, or, R 11e and R 11f Together with the attached atoms, they form cycloalkyl or heterocyclic groups, or, R 11a and R 11c Together with the attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 0 replace;
[0121] R 11gSelected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, alkoxyalkyl, cycloalkyl, and cycloalkylalkyl;
[0122] Z, R 10 ,m,U,G,B,D,M,K,R,Q,L,R 0 R 16 -R 20 And v is as defined in general formula (III).
[0123] In some embodiments of this disclosure, the compound or its pharmaceutically acceptable salt represented by general formula (I), general formula (II), general formula (II-1), general formula (III) or general formula (III-1) is used, wherein n is 1, 2, 3, 4, 5, 6 or 7; in some embodiments, n is 1, 2, 3, 4, 5 or 6; in some embodiments, n is 1, 2, 3, 4 or 5; in some embodiments, n is 2, 3, 4 or 5; in some embodiments, n is 2 or 3; in some embodiments, n is 2; in some embodiments, n is 3.
[0124] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1), general formula (III) or general formula (III-1) or their pharmaceutically acceptable salts, wherein each L A They may be the same or different, and each is independently selected from O, S, NH, C(O), C 1-6 Alkylene, C 2-6 alkenyl, C 2-6 Alkyne group, 3- to 12-membered cycloalkyl group and 3- to 12-membered heterocyclic group; the C 1-6 The alkylene group, the 3- to 12-membered cycloalkyl group, and the 3- to 12-membered heterocyclic group are each independently and optionally influenced by one or more R groups. L Replace; R L As defined in general formula (I); in some implementations, each L A They may be the same or different, and each is independently selected from O, NH, C(O), C 1-6 Alkylene, C 2-6 Alkyne group, 3- to 8-membered cycloalkyl group, and 3- to 8-membered heterocyclic group; each of the 3- to 8-membered cycloalkyl group and the 3- to 8-membered heterocyclic group is independently optionally divided by one or more R groups. L Replace; R L As defined in general formula (I); in some implementations, each L A They may be the same or different, and each is independently selected from O, C(O), NH, C 1-6 Alkylene, 4- to 8-membered cycloalkyl, and 4- to 8-membered heterocyclic groups; each of the 4- to 8-membered cycloalkyl and 4- to 8-membered heterocyclic groups is independently optionally surrounded by one or more R L Replace; R LAs defined in general formula (I); in some implementations, each L A They may be the same or different, and each is independently selected from O, NH, and C. 1-6 Alkylene, 4- to 8-membered cycloalkyl, and 4- to 8-membered heterocyclic groups; in some embodiments, each L A Same or different, and each independently selected from O and C 1-6 Alkylene, 4- to 6-membered cycloalkyl, and 4- to 6-membered heterocyclic groups; each of the 4- to 6-membered cycloalkyl and 4- to 6-membered heterocyclic groups is independently and optionally composed of one or more R L Replace; R L As defined in general formula (I); in some implementations, each L A Same or different, and each independently selected from O and C 1-6 Alkylene, 4- to 6-membered cycloalkyl, and 4- to 6-membered heterocyclic groups; in some embodiments, each L A They may be the same or different, and each is independently selected from O, 4 to 6-membered cycloalkyl and 4 to 6-membered heterocyclic groups; in some embodiments, each L A They may be the same or different, and each is independently selected from O, NH, C(O), CH2, CH2CH2, CH(CH3)2, ethynyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, aziridine, pyrrolidinyl, piperidinyl and piperazine.
[0125] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1), general formula (III) or general formula (III-1), or their pharmaceutically acceptable salts, wherein L is -(L A ) n -; n is 1, 2, 3, 4 or 5; each L A They may be the same or different, and each is independently selected from O, NH, C(O), C 1-6 Alkylene, C 2-6 Alkyne group, 3- to 8-membered cycloalkyl group, and 3- to 8-membered heterocyclic group; each of the 3- to 8-membered cycloalkyl group and the 3- to 8-membered heterocyclic group is independently optionally divided by one or more R groups. L Replace; R L They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, hydroxy, and =O;
[0126] In some implementations, L is -(L A ) n -; n is 1, 2, 3, 4 or 5; each L A They may be the same or different, and each is independently selected from O, NH, and C. 1-6 Alkylene, 4- to 6-membered cycloalkyl and 4- to 6-membered heterocyclic groups;
[0127] In some implementations, L is A 3 A 4 A 5 A 6 a3, a4, a5, a6, R L1 R L2 k1, k2 and L A1 As defined in general formula (IV);
[0128] In some implementation schemes, L is selected from In some implementation schemes, L is selected from
[0129] In some implementation schemes, L is selected from In some implementation schemes, L is selected from In some implementations, L is * The end is connected to the ring containing ring A or U.
[0130] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1), general formula (III) or general formula (III-1), or their pharmaceutically acceptable salts, wherein L is
[0131] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II), general formula (II-1), general formula (III) or general formula (III-1) or a pharmaceutically acceptable salt thereof, wherein B is C; in some embodiments, B is N.
[0132] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II), general formula (II-1), general formula (III) or general formula (III-1) or a pharmaceutically acceptable salt thereof, wherein U is N; in some embodiments, U is CR 12a ;R 12a Selected from hydrogen atoms, halogens and C 1-6 Alkyl; in some embodiments, U is N or CH.
[0133] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1), general formula (III) or general formula (III-1), or their pharmaceutically acceptable salts, wherein R 12a Selected from hydrogen atoms, halogens and C1-6 Alkyl; in some embodiments, R 12a It is a hydrogen atom.
[0134] In some embodiments of this disclosure, the compound represented by general formula (I) or general formula (II), or a pharmaceutically acceptable salt thereof, is a compound represented by general formula (IV) or a pharmaceutically acceptable salt thereof.
[0135] in:
[0136] A 3 For N or CR A3 ;
[0137] A 4 For N or CR A4 ;
[0138] A 5 For N or CR A5 ;
[0139] A 6 For N or CR A6 ;
[0140] R A3 R A4 R A5 and R A6 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, hydroxyalkyl groups, haloalkyl groups, hydroxyl groups, cyano groups, alkoxy groups, alkoxyalkyl groups, cycloalkyl groups, and cycloalkylalkyl groups;
[0141] a3, a4, a5, and a6 are each independently 0, 1, 2, 3, or 4;
[0142] k1 and k2 are each independently 0, 1, 2, 3, 4, 5 or 6;
[0143] L A1 Selected from bond, O, S(O) v NR d C(O), C(O)NR d NR d C(O), C(O)O, OC(O), alkylene, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkylene, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally selected by one or more R L replace;
[0144] R L1 and R L2 The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, -OR16 -NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 -OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20 )NR 17 R 18 -S(O) v R 16 -S(O) v NR 17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 =O, =S, =CR 21 R 22 cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace;
[0145] Or, two Rs L1 Together with the attached atom, it forms a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R groups. 0 replace;
[0146] Or, two Rs L2 Together with the attached atom, it forms a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R groups. 0 replace;
[0147] R 1 R 2a R 2b R 2c R 3 R 3a G, D, M, K, R, Q, R d R L R0 R 16 -R 22 And v is as defined in general formula (II).
[0148] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II), general formula (II-1) or general formula (IV), or a pharmaceutically acceptable salt thereof, is a compound represented by general formula (IV-1) or a pharmaceutically acceptable salt thereof.
[0149] in:
[0150] R 7a R 7c and R 7d The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, -OR 16 -NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 -OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20 )NR 17 R 18 -S(O) v R 16 -S(O) v NR 17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace;
[0151] Or, R 7c and R 7dTogether they form = O;
[0152] Or, R 7c and R 7d Together with the attached atoms, they form cycloalkyl or heterocyclic groups, or, R 7a and R 7c Together with the attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 0 replace;
[0153] R 1 R 2a R 2b R 2c G, D, M, K, R, Q, A 3 A 4 A 5 A 6 a3, a4, a5, a6, R L1 R L2 k1, k2, L A1 R 0 R 16 -R 22 And v is as defined in general formula (IV).
[0154] In some embodiments of this disclosure, the compound represented by general formula (I) or general formula (III), or a pharmaceutically acceptable salt thereof, is a compound represented by general formula (V) or a pharmaceutically acceptable salt thereof.
[0155] in:
[0156] A 3 For N or CR A3 ;
[0157] A 4 For N or CR A4 ;
[0158] A 5 For N or CR A5 ;
[0159] A 6 For N or CR A6 ;
[0160] R A3 R A4 R A5 and R A6 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, hydroxyalkyl groups, haloalkyl groups, hydroxyl groups, cyano groups, alkoxy groups, alkoxyalkyl groups, cycloalkyl groups, and cycloalkylalkyl groups;
[0161] a3, a4, a5, and a6 are each independently 0, 1, 2, 3, or 4;
[0162] k1 and k2 are each independently 0, 1, 2, 3, 4, 5 or 6;
[0163] L A1 Selected from bond, O, S(O) v NR d C(O), C(O)NR d NR d C(O), C(O)O, OC(O), alkylene, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkylene, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally selected by one or more R L replace;
[0164] R L1 and R L2 The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, -OR 16 -NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 -OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20 )NR 17 R 18 -S(O) v R 16 -S(O) v NR 17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 =O, =S, =CR 21 R 22cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace;
[0165] Or, two Rs L1 Together with the attached atom, it forms a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R groups. 0 replace;
[0166] Or, two Rs L2 Together with the attached atom, it forms a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R groups. 0 replace;
[0167] R 10 m, R 10a Z, R T G, D, M, K, R, Q, R d R L R 0 R 16 -R 22 And v is as defined in general formula (III).
[0168] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1) or general formula (V), or a pharmaceutically acceptable salt thereof, is a compound represented by general formula (V-1) or a pharmaceutically acceptable salt thereof.
[0169] in:
[0170] R 11a Selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, -OR 16 -NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 -OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20)NR 17 R 18 -S(O) v R 16 -S(O) v NR 17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace;
[0171] R 10 ,m,Z,G,D,M,K,R,Q,A 3 A 4 A 5 A 6 a3, a4, a5, a6, R L1 R L2 k1, k2, L A1 R 0 R 16 -R 20 And v as defined in general formula (V). In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1) or their pharmaceutically acceptable salts, wherein Q is selected from... T is selected from bonds, O, S, C(O), CR 15e R 15f NR 15g NR 15g C(O) and C(O)NR 15g ;
[0172] R 15g Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl;
[0173] R 15e and R 15f The same or different, and each independently selected from hydrogen, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, cycloalkyl, and heterocyclic groups; or, R 15e and R 15fTogether with the attached carbon atom, they form cycloalkyl groups;
[0174] p and q are each independently 0, 1, 2 or 3;
[0175] A 1 For N or R A1 ;
[0176] A 2 For N or R A2 ;
[0177] R A1 and R A2 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalkoxy, cyano, hydroxyl, amino, cycloalkyl and heterocyclic groups;
[0178] Y, R 14 R 15a R 15b and R 15d As defined in general formula (I);
[0179] In some implementations, Q is selected from...
[0180] In some implementations, Q is selected from...
[0181] In some implementations, Q is *Terminal with L or A 3 Connected.
[0182] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1) or a pharmaceutically acceptable salt thereof, wherein Y is CH2 or C(O); in some embodiments, Y is CH2.
[0183] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 13a and R 13b They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and alkyl groups; in some embodiments, R 13a and R 13b It is a hydrogen atom.
[0184] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 13c It is a hydrogen atom or a carbon atom. 1-6 alkyl.
[0185] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 14 It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 14 C 1-6 Alkyl; in some embodiments, R 14 It is a methyl group.
[0186] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein Q 1 For CR 15a ;R 15a As defined in general formula (I); in some implementations, Q 1 For CH; in some implementations, Q 2 For CR 15b ;R 15b As defined in general formula (I); in some implementations, Q 2 For CH; in some implementations, Q 3 For CR 15c ;R 15c As defined in general formula (I); in some implementations, Q 3 For CH; in some implementations, Q 4 For CR 15d ;R 15d As defined in general formula (I); in some implementations, Q 4 For CH.
[0187] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R15a R 15b R 15c and R 15d Whether the same or different, and each independently selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkoxy groups and 3- to 6-membered cycloalkyl groups; in some embodiments, R 15a R 15b R 15c and R 15d They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; in some embodiments, R 15a R 15b R 15c and R 15d They may be the same or different, and each is independently a hydrogen atom or a halogen; in some embodiments, R 15a R 15b R 15c and R 15d They may be the same or different, and each is independently a hydrogen atom or F; in some implementations, R 15a For hydrogen atoms; in some implementations, R 15b For hydrogen atoms; in some implementations, R 15c For hydrogen atoms; in some implementations, R 15d It is a hydrogen atom or a halogen; in some implementations, R 15d For hydrogen atoms; in some implementations, R 15d For halogen; in some implementations, R 15d It is F.
[0188] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt of the general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1) is used, wherein k is 0 or 1; in some embodiments, k is 0; in some embodiments, k is 1.
[0189] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts represented by general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1) are used, wherein a1 and a2 are each independently 0 or 1; in some embodiments, a1 and a2 are 1.
[0190] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R q They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; or, R q and R 15a Together with their respective connected atoms, they form 5- to 7-membered heterocyclic groups, or, R q and R 15b Together with their respective connected atoms, they form 5- to 7-membered heterocyclic groups, or, R q and R 15c Together with their respective connected atoms, they form 5- to 7-membered heterocyclic groups, or, R q and R 15d Together with their respective connected atoms, they form 5- to 7-membered heterocyclic groups; in some implementations, R q For hydrogen atoms; or, R q and R 15a Together with their respective connected atoms, they form a 6- or 7-membered heterocyclic group; or, R q and R 15b Together with their respective connected atoms, they form a 6- or 7-membered heterocyclic group, or, R q and R 15c Together with their respective connected atoms, they form a 6- or 7-membered heterocyclic group, or, R q and R 15d Together with their respective connected atoms, they form a 6- or 7-membered heterocyclic group; in some embodiments, R q It is a hydrogen atom.
[0191] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R A1 Selected from hydrogen atoms, halogens and C 1-6 Alkyl; or, R A1 and R 15a Together with their respective connected atoms, they form 5- to 7-membered heterocyclic groups, or, R A1 and R 15b Together with their respective connected atoms, they form 5- to 7-membered heterocyclic groups, or, R A1 and R 15c Together with their respective connected atoms, they form 5- to 7-membered heterocyclic groups, or, R A1 and R 15dTogether with their respective connected atoms, they form 5- to 7-membered heterocyclic groups; in some implementations, R A1 For hydrogen atoms; or, R A1 and R 15a Together with their respective connected atoms, they form a 5-membered heterocyclic group, or, R A1 and R 15b Together with their respective connected atoms, they form a 5-membered heterocyclic group, or, R A1 and R 15c Together with their respective connected atoms, they form a 5-membered heterocyclic group, or, R A1 and R 15d Together with their respective connected atoms, they form a 5-membered heterocyclic group; in some implementations, R A1 It is a hydrogen atom.
[0192] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R A2 Selected from hydrogen atoms, halogens and C 1-6 Alkyl; in some embodiments, R A2 It is a hydrogen atom.
[0193] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein A 1 and A 2 They may be the same or different, and each is independently N or CH; in some implementations, A 1 For N; in some implementations, A 1 For CH; in some implementations, A 2 For N; in some implementations, A 2 For CH.
[0194] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1) or a pharmaceutically acceptable salt thereof, wherein T is CH2 or O; in some embodiments, T is O.
[0195] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 15 They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy and =O; in some embodiments, R 15 They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups.
[0196] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 15e and R 15f They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; in some embodiments, R 15e and R 15f It is a hydrogen atom.
[0197] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 15g It is a hydrogen atom or a carbon atom. 1-6 alkyl.
[0198] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts represented by general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1) are used, wherein p and q are each independently 0 or 1; in some embodiments, p is 1 and q is 0 or 1; in some embodiments, p is 1 and q is 0; in some embodiments, p is 1 and q is 1.
[0199] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1), or their pharmaceutically acceptable salts, wherein Y is CH2 or C(O); R14 C 1-6 Alkyl; Q 1 For CR 15a Q 2 For CR 15b Q 3 For CR 15c Q 4 For CR 15d A 1 For N or CR A1 A 2 For N or CH; R 15a R 15b R 15c and R 15d They may be the same or different, and each is independently a hydrogen atom or a halogen; R A1 For hydrogen atoms; R q For hydrogen atoms; or, R A1 and R 15a Together with their respective connected atoms, they form a 5-membered heterocyclic group, or, R A1 and R 15b Together with their respective connected atoms, they form a 5-membered heterocyclic group, or, R A1 and R 15c Together with their respective connected atoms, they form a 5-membered heterocyclic group, or, R A1 and R 15d Together with their respective connected atoms, they form a 5-membered heterocyclic group; or, R q and R 15a Together with their respective connected atoms, they form a 6- or 7-membered heterocyclic group; or, R q and R 15b Together with their respective connected atoms, they form a 6- or 7-membered heterocyclic group, or, R q and R 15c Together with their respective connected atoms, they form a 6- or 7-membered heterocyclic group, or, R q and R 15d Together with their respective connected atoms, they form a 6- or 7-membered heterocyclic group; k is 0, 1, or 2; a1 and a2 are each independently 0 or 1; in some embodiments, Y is CH2; R 14 Methyl; Q 1 For CR 15a Q 2 For CR 15b Q 3 For CR 15c Q 4 For CR 15d ;R 15a R 15b R 15c and R 15d They may be the same or different, and each is independently a hydrogen atom or a halogen; A1 For N or CR A1 ;R A1 A is a hydrogen atom; 2 For N or CH; R q A is a hydrogen atom; a1 and a2 are both 1.
[0200] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1), or their pharmaceutically acceptable salts, wherein Y is CH2 or C(O); R 14 C 1-6 Alkyl; A 1 For N or CH; A 2 For N or CH; R 15a R 15b and R 15d They may be the same or different, and each is independently a hydrogen atom or a halogen; T is O; p and q are each independently 0 or 1; in some embodiments, Y is CH2; R 14 Methyl; A 1 For N or CH; A 2 For N or CH; R 15a R 15b and R 15d They may be the same or different, and each is independently a hydrogen atom or a halogen; T is O; p is 1; q is 0 or 1; in some embodiments, Y is CH2; R 14 Methyl; A 1 For N or CH; A 2 For N; R 15a and R 15b For hydrogen atoms; R 15d It represents a hydrogen atom or a halogen; T represents O; p represents 1; q represents 0 or 1.
[0201] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1), general formula (IV) or general formula (IV-1), or their pharmaceutically acceptable salts, wherein R 1 Selected from hydrogen atoms, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy C 1-6 Alkyl, 3- to 6-membered cycloalkyl and 3- to 6-membered cycloalkyl C 1-6 Alkyl; in some embodiments, R 1 C 1-6 Alkyl or 3- to 6-membered cycloalkyl; in some embodiments, R 1 C 1-6 Alkyl; in some embodiments, R1 Selected from methyl, isopropyl, and cyclopropyl; in some embodiments, R 1 It is methyl or isopropyl; in some embodiments, R 1 It is isopropyl; in some embodiments, R 1 It is a methyl group.
[0202] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1), general formula (IV) or general formula (IV-1), or their pharmaceutically acceptable salts, wherein R 2a R 2b and R 2c They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl and C 1-6 Alkoxy; in some embodiments, R 2a R 2b and R 2c It is a hydrogen atom or a carbon atom. 1-6 Alkoxy; in some embodiments, R 2a R 2b and R 2c All are hydrogen atoms; in some implementations, R 2a For hydrogen atoms; in some implementations, R 2b For hydrogen atoms; in some implementations, R 2c It is a hydrogen atom or a methoxy group; in some embodiments, R 2c It is a hydrogen atom.
[0203] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II) or general formula (IV) or a pharmaceutically acceptable salt thereof, wherein R 3 -W 1 -CR 4a R 4b -W 2 W 1 W 2 R 4a and R 4b As defined in general formula (I); in some implementations, R 3 for R 4 and R 5 As defined in general formula (I); in some implementations, R 3 for R 4 and R 5 Whether the atoms are the same or different, and each is independently selected from hydrogen atoms, C atoms 1-6 Alkyl and 3- to 6-membered cycloalkyl; in some embodiments, R 3 Selected from In some implementation schemes, R 3 for In some implementation schemes, R 3 for
[0204] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II) or general formula (IV) or a pharmaceutically acceptable salt thereof, wherein R 3a Selected from hydrogen atoms, halogens and C 1-6 Alkyl; in some embodiments, R 3a It is a hydrogen atom.
[0205] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II) or general formula (IV) or a pharmaceutically acceptable salt thereof, wherein R 3 and R 3a Together with their respective connected atoms, they form a 6- or 7-membered heterocyclic group, which is optionally bonded by one or more R atoms. 7 Replace; R 7 As defined in general formula (I);
[0206] In some implementation schemes, R 3 and R 3a Together with their respective connected atoms, they form a 6- or 7-membered heterocyclic group, which is optionally bonded by one or more R atoms. 7 Replace; R 7 They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy and 3- to 6-membered cycloalkyl;
[0207] In some implementation schemes, R 3 and R 3a Together with their respective connected atoms, they form optional groups of one or more R atoms. 7 Substituted 7-membered heterocyclic group; R 7 As defined in general formula (I);
[0208] In some implementation schemes, R 3 and R 3a Together with the atoms they are connected to, they form * The terminal is connected to C(O); x, M 1 M 2 R 7a R 7b R 7c R 7d R 7e and R 7fAs defined in general formula (II-1); in some implementations, R 3 and R 3a Together with the atoms they are connected to, they form * The terminal is connected to C(O); R 7a R 7c and R 7d As defined in general formula (IV-1); in some implementations, R 3 and R 3a Together with the atoms they are connected to, they form The * terminal is connected to C(O).
[0209] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II) or general formula (IV) or a pharmaceutically acceptable salt thereof, wherein R 3a For hydrogen atoms; R 3 for R 4 and R 5 Whether the atoms are the same or different, and each is independently selected from hydrogen atoms, C atoms 1-6 Alkyl groups and 3- to 6-membered cycloalkyl groups;
[0210] Or, R 3 and R 3a Together with their respective connected atoms, they form a 6- or 7-membered heterocyclic group, which is optionally bonded by one or more R atoms. 7 Replace; R 7 They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy and 3- to 6-membered cycloalkyl;
[0211] In some implementation schemes, R 3a For hydrogen atoms; R 3 for Or, R 3 and R 3a Together with the atoms they are connected to, they form * The terminal is connected to C(O);
[0212] In some implementation schemes, R 3a For hydrogen atoms; R 3 for
[0213] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II) or general formula (IV) or a pharmaceutically acceptable salt thereof, wherein R 4 and R 5 Whether the atoms are the same or different, and each is independently selected from hydrogen atoms, C atoms 1-6Alkyl and 3- to 6-membered cycloalkyl; in some embodiments, R 4 and R 5 They may be the same or different, and each is independently a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 4 and R 5 They may be the same or different, and each independently consists of a hydrogen atom, a methyl group, and a cyclopropyl group; in some embodiments, R 4 For hydrogen atoms, R 5 C 1-6 Alkyl or 3- to 6-membered cycloalkyl; in some embodiments, R 4 For hydrogen atoms, R 5 C 1-6 Alkyl; in some embodiments, R 4 For hydrogen atoms, R 5 It is methyl or cyclopropyl; in some embodiments, R 4 For hydrogen atoms, R 5 It is a methyl group.
[0214] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II) or general formula (IV) or a pharmaceutically acceptable salt thereof, wherein t is 1 or 2; in some embodiments, t is 1.
[0215] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II) or general formula (IV) or a pharmaceutically acceptable salt thereof, wherein R Y It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R Y It is a hydrogen atom.
[0216] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II) or general formula (IV) or a pharmaceutically acceptable salt thereof, wherein W 1 Selected from NH, O, and S; in some embodiments, W 1 It is O.
[0217] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II) or general formula (IV) or a pharmaceutically acceptable salt thereof, wherein W 2 -C(O)NR 4 R 5 ;R 4 and R 5 As defined in general formula (I); in some implementations, W 2 Selected from -C(O)NH2, -C(O)NH(CH3), -C(O)N(CH3)2 and -C(O)NH (cyclopropyl); in some embodiments, W 2It is -C(O)NH(CH3) or -C(O)NH (cyclopropyl); in some embodiments, W 2 It is -C(O)NH(CH3).
[0218] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II) or general formula (IV) or a pharmaceutically acceptable salt thereof, wherein R 4a and R 4b They may be the same or different, and each is independently a hydrogen atom or a carbon atom. 1-6 Alkyl group; or, R on the same carbon atom 4a and R 4b Together with the attached carbon atom, it forms a cyclopropyl group; in some embodiments, R 4a and R 4b They may be the same or different, and each is independently a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 4a and R 4b They may be the same or different, and each is independently a hydrogen atom or a methyl group; in some embodiments, R 4a and R 4b It is a hydrogen atom.
[0219] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II) or general formula (IV) or their pharmaceutically acceptable salts, wherein each R 7 They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl, C 1- 6-Hydroalkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkoxy groups, C 1-6 Hydroxyalkyl and 3- to 6-membered cycloalkyl; in some embodiments, each R 7 They may be the same or different, and each is independently halogenated or 3 to 6-membered cycloalkyl; in some embodiments, each R... 7 They may be the same or different, and each is independently F or cyclopropyl.
[0220] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1), general formula (IV) or general formula (IV-1), or their pharmaceutically acceptable salts, wherein R 7a Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1- 6-Hydroalkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkoxy groups, C 1-6 Hydroxyalkyl and 3- to 6-membered cycloalkyl; in some embodiments, R 7a It is a 3- to 6-membered cycloalkyl group; in some embodiments, R7a It is cyclopropyl.
[0221] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1) or general formula (IV), or their pharmaceutically acceptable salts, wherein R 7b Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkoxy groups, C 1-6 Hydroxyalkyl and 3- to 6-membered cycloalkyl; in some embodiments, R 7b It is a hydrogen atom.
[0222] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1), general formula (IV) or general formula (IV-1), or their pharmaceutically acceptable salts, wherein R 7c Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1- 6-Hydroalkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkoxy groups, C 1-6 Hydroxyalkyl and 3- to 6-membered cycloalkyl; in some embodiments, R 7c For halogen; in some implementations, R 7c It is F.
[0223] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1), general formula (IV) or general formula (IV-1), or their pharmaceutically acceptable salts, wherein R 7d Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1- 6-Hydroalkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkoxy groups, C 1-6 Hydroxyalkyl and 3- to 6-membered cycloalkyl; in some embodiments, R 7d For halogen; in some implementations, R 7d It is F.
[0224] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1), general formula (IV) or general formula (IV-1), or their pharmaceutically acceptable salts, wherein R 7c It is a halogen; R 7d For halogen; in some implementations, R 7c For F; R 7d It is F.
[0225] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1) or general formula (IV), or their pharmaceutically acceptable salts, wherein R 7e and R 7f They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkoxy groups, C 1-6 Hydroxyalkyl and 3- to 6-membered cycloalkyl; in some embodiments, R 7e and R 7f For hydrogen atoms; in some implementations, R 7e For hydrogen atoms; in some implementations, R 7f It is a hydrogen atom.
[0226] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II), general formula (II-1) or general formula (IV) or a pharmaceutically acceptable salt thereof, wherein x is 0, 1 or 2; in some embodiments, x is 0 or 1; in some embodiments, x is 1.
[0227] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1) or general formula (IV), or pharmaceutically acceptable salts thereof, wherein M 1 It is O.
[0228] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1) or general formula (IV), or pharmaceutically acceptable salts thereof, wherein M 2 It is NH.
[0229] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (II), general formula (II-1) or general formula (IV) or a pharmaceutically acceptable salt thereof, wherein R 7i It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 7i It is a hydrogen atom.
[0230] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1), general formula (V) or general formula (V-1) or a pharmaceutically acceptable salt thereof, wherein Z is CR 8a R 8b or NR 9 ;R 8a R 8b and R 9 As defined in general formula (I); in some implementations, Z is CR 8aR 8b or NR 9 ;R 8a and R 8b They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; R 9 It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, Z is CH2 or NR. 9 ;R 9 C 1-6 Alkyl; in some embodiments, Z is CR 8a R 8b ;R 8a and R 8b As defined in general formula (I); in some implementations, Z is CH2.
[0231] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1), general formula (V) or general formula (V-1) or its pharmaceutically acceptable salt, wherein z is 1.
[0232] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1), general formula (V) or general formula (V-1) or a pharmaceutically acceptable salt thereof, wherein R 8a and R 8b They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkoxy, hydroxyl, and cyano groups; or, R 8a and R 8b Together with the carbon atom attached to it, they form a 3- to 6-membered cycloalkyl group; in some embodiments, R 8a and R 8b They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; in some embodiments, R 8a and R 8b They may be the same or different, and each is independently a hydrogen atom or a halogen; in some embodiments, R 8a and R 8b It is a hydrogen atom.
[0233] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1), general formula (V) or general formula (V-1), or a pharmaceutically acceptable salt thereof, wherein R 9 It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 9 C1-6 Alkyl; in some embodiments, R 9 For hydrogen atoms; in some implementations, R 9 Selected from hydrogen atoms, methyl and ethyl; in some embodiments, R 9 It is an ethyl group.
[0234] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1), general formula (V) or general formula (V-1), or a pharmaceutically acceptable salt thereof, wherein R 10 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkoxy, hydroxyl, and cyano groups; in some embodiments, R 10 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl and C 1-6 Halogenated alkyl; in some embodiments, R 10 It is a hydrogen atom.
[0235] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1), general formula (V) or general formula (V-1) or a pharmaceutically acceptable salt thereof, wherein m is 0 or 1; in some embodiments, m is 0.
[0236] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III) or general formula (V) or a pharmaceutically acceptable salt thereof, wherein R 10a Selected from hydrogen atoms, halogens, C 1-6 Alkyl and C 1-6 Halogenated alkyl; in some embodiments, R 10a It is a hydrogen atom.
[0237] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III) or general formula (V) or a pharmaceutically acceptable salt thereof, wherein R T Selected from hydrogen atoms, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Hydroxyalkyl, C 1-6 Alkoxy C 1-6 Alkyl, -C 1-6 Alkylene-NHC 1-6 Alkyl, 3- to 6-membered cycloalkyl C 1-6 Alkyl groups and 3 to 6-membered heterocyclic C groups 1-6 Alkyl; in some embodiments, R T C 1-6Alkyl; in some embodiments, R T It is an ethyl group.
[0238] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III) or general formula (V) or a pharmaceutically acceptable salt thereof, wherein R T and R 10a Together with their respective connected atoms, they form an array optionally bounded by one or more R atoms. 11 Substituted 5- to 7-membered heterocyclic groups; R 11 As defined in general formula (I); in some implementations, R T and R 10a Together with their respective connected atoms, they form an array optionally bounded by one or more R atoms. 11 Substituted 5- to 7-membered heterocyclic groups; R 11 Selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl and C 1-6 Hydroxyalkyl; in some embodiments, R T and R 10a Together with their respective connected atoms, they form an array optionally bounded by one or more R atoms. 11 Substituted 6-membered heterocyclic group; R 11 C 1-6 alkyl.
[0239] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1) or general formula (V) or a pharmaceutically acceptable salt thereof, wherein R 11a R 11b R 11c and R 11d They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Halogenated alkyl and C 1-6 alkoxy; or, R 11a and R 11b Together with the adjacent carbon atom, they form a 3- to 6-membered cycloalkyl group; or, R 11c and R 11d Together with the attached atoms, they form a 3- to 6-membered cycloalkyl group; in some embodiments, R 11a R 11b R 11c and R 11d It is a hydrogen atom; or, R on the same carbon atom. 11a and R 11b Together with the adjacent carbon atom, they form a cyclopropyl group; or, the R on the same carbon atom... 11c and R 11d Together with the attached carbon atom, they form a cyclopropyl group.
[0240] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1), general formula (V) or general formula (V-1), or a pharmaceutically acceptable salt thereof, wherein R 11a Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1- 6-Hydroalkyl and C 1-6 Alkoxy; in some embodiments, R 11a It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 11a For hydrogen atoms; in some implementations, R 11a It is a hydrogen atom or a methyl group; in some embodiments, R 11a It is a methyl group.
[0241] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1) or general formula (V) or a pharmaceutically acceptable salt thereof, wherein R 11b Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl and C 1-6 Alkoxy; in some embodiments, R 11b For hydrogen atoms; in some implementations, R 11c Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl and C 1-6 Alkoxy; in some embodiments, R 11c For hydrogen atoms; in some implementations, R 11d Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl and C 1-6 Alkoxy; in some embodiments, R 11d It is a hydrogen atom.
[0242] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III) or general formula (V) or a pharmaceutically acceptable salt thereof, wherein R 11 Selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl and C 1-6 Alkoxy; in some embodiments, R 11 C 1-6 Alkyl; in some embodiments, R 11 It is a methyl group.
[0243] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1) or general formula (V) or a pharmaceutically acceptable salt thereof, wherein y is 1 or 2; in some embodiments, y is 1.
[0244] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1), general formula (V) or general formula (V-1) or its pharmaceutically acceptable salt, wherein j is 1.
[0245] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1) or general formula (V) or a pharmaceutically acceptable salt thereof, wherein M 3 For O or CH2; in some implementations, M 3 It is O.
[0246] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1) or general formula (V) or a pharmaceutically acceptable salt thereof, wherein R 11e and R 11f They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; or, R 11e and R 11f Together with the attached atoms, they form a 3- to 6-membered cycloalkyl group; in some embodiments, R 11e and R 11f It is a hydrogen atom; or, R on the same carbon atom. 11e and R 11f Together with the attached carbon atom, they form a cyclopropyl group; in some embodiments, R 11e and R 11f It is a hydrogen atom.
[0247] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (III), general formula (III-1) or general formula (V) or a pharmaceutically acceptable salt thereof, wherein R 11g It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 11g It is a hydrogen atom.
[0248] In some embodiments disclosed herein, wherein Each independently selected In some implementation schemes, where for
[0249] In some embodiments disclosed herein, wherein Each independently selected
[0250] In some embodiments of this disclosure, the compounds represented by general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1), or pharmaceutically acceptable salts thereof, wherein G is N or CH; in some embodiments, G is N; in some embodiments, G is CH. In some embodiments of this disclosure, the compounds represented by general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1), or pharmaceutically acceptable salts thereof, wherein D is N; in some embodiments, D is C.
[0251] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein M, K, and R are the same or different, and are each independently selected from O, S, and CR. 12c , N and NR 12d ;R 12c Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkyl and cyano groups; R 12d It is a hydrogen atom or a carbon atom. 1-6 alkyl.
[0252] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of the general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein M is selected from N, S, and CR. 12c ;R 12c As defined in general formula (I); in some implementations, M is selected from N, S, and CR. 12c ;R 12c Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkyl and cyano groups; in some embodiments, M is selected from N, S, and CR. 12c ;R 12c It is selected from hydrogen atoms, halogens, and cyano groups.
[0253] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein K is a CR 12c ;R 12c As defined in general formula (I); in some implementations, K is CH.
[0254] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt thereof represented by general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1) is used, wherein R is N.
[0255] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 12b Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkyl and cyano groups; in some embodiments, R 12b Selected from hydrogen atoms, halogens and C 1-6 Alkyl; in some embodiments, R 12b It is a hydrogen atom.
[0256] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 12c Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkyl and cyano groups; in some embodiments, R 12c Selected from hydrogen atoms, halogens, and cyano groups; in some embodiments, R 12c Selected from hydrogen atom, Cl and cyano group; in some embodiments, R 12c It is a hydrogen atom.
[0257] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 12d It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 12d It is a hydrogen atom.
[0258] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V), or general formula (V-1), or their pharmaceutically acceptable salts, wherein G is N or CH; and / or M is selected from N, S, and CR. 12c ;R 12c Selected from hydrogen atoms, halogens, C 1- 6-alkyl, C 1-6 Haloalkyl, C 1-6 Alkyl and cyano groups; and / or K is CH; and / or R is N.
[0259] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein ring A, Each independently selected The * end is connected to NH.
[0260] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R A3 R A4 R A5 and R A6 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1- 6-alkyl; in some embodiments, R A3 R A4 R A5 and R A6 For hydrogen atoms; in some implementations, R A3 For hydrogen atoms; in some implementations, R A4 For hydrogen atoms; in some implementations, R A5 For hydrogen atoms; in some implementations, RA6 It is a hydrogen atom.
[0261] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein A 3 A 4 A 5 and A 6 They may be the same or different, and each is independently N or CH; in some implementations, A 3 For N; in some implementations, A 3 For CH; in some implementations, A 4 For N; in some implementations, A 4 For CH; in some implementations, A 5 For N; in some implementations, A 5 For CH; in some implementations, A 6 For N; in some implementations, A 6 For CH; in some implementations, A 3 For CH; A 4 For CH; A 5 For CH; A 6 Let N be the number of elements in the array.
[0262] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of the general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are each independently 0 or 1; in some embodiments, a3 and a4 are 1; in some embodiments, a3 is 0; a4 is 1; in some embodiments, a3 and a4 are 0; in some embodiments, a5 and a6 are 1; in some embodiments, a5 and a6 are 0.
[0263] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R L1 and R L2 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, haloalkyl, hydroxyl, =O, C 1-6 Alkoxy and C 1-6 Hydroxyalkyl; or, two non-adjacent R groups.L1 Connected to form a bridge C 2-3 Alkylene; or, two non-adjacent R groups. L2 Connected to form a bridge C 2-3 Alkylene; or, two R atoms on the same carbon atom. L1 They connect to form a cyclopropyl group; or, two R atoms on the same carbon atom... L2 Linked to form cyclopropyl groups; in some embodiments, R L1 and R L2 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; in some embodiments, R L1 and R L2 They may be the same or different, and each is independently a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R L1 For hydrogen atoms; in some implementations, R L2 For hydrogen atoms; in some implementations, two non-adjacent R atoms L1 Connected to form a bridge C 2-3 Alkylene; in some embodiments, two non-adjacent Rs L1 Connected to form a bridging ethylene group; in some embodiments, two non-adjacent R groups are connected to form a bridging ethylene group. L2 Connected to form a bridge C 2-3 Alkylene; in some embodiments, two non-adjacent Rs L2 Connected to form a bridging ethylene group; in some embodiments, two R atoms on the same carbon atom L1 Linked to form a cyclopropyl group; in some embodiments, two R groups on the same carbon atom L2 They connect to form cyclopropyl groups.
[0264] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts represented by general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1) are used, wherein k1 and k2 are each independently 0 or 1; in some embodiments, k1 is 0; in some embodiments, k1 is 1; in some embodiments, k2 is 0; in some embodiments, k2 is 1.
[0265] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein L A1 Selected from key, O, C 1-6Alkylene, 3- to 8-membered cycloalkyl, and 3- to 8-membered heterocyclic groups; each of the 3- to 8-membered cycloalkyl and 3- to 8-membered heterocyclic groups is independently optionally coupled with one or more R L Replace; R L As defined in general formula (I); in some implementations, L A1 Selected from bonds, O and C 1-6 Alkylene; in some embodiments, L A1 For O or C 1-6 Alkylene; in some embodiments, L A1 Selected from bonds, O, CH2, CH2CH2, CH(CH3) and C(CH3)2; in some embodiments, L A1 For O or CH2; in some implementations, L A1 For O; in some implementations, L A1 It is CH2.
[0266] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R L They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl, haloalkyl, hydroxyl, =O, C 1-6 Alkoxy and C 1-6 Hydroxyalkyl; or, two non-adjacent R groups. L Connected to form a bridge C 2-3 Alkylene; or, two R atoms on the same carbon atom. L Linked to form cyclopropyl groups; in some embodiments, R L They may be the same or different, and each is independently a halogen or a carbon. 1-6 Alkyl; in some embodiments, R L The same or different, and each independently is C. 1-6 Alkyl; in some embodiments, two non-adjacent Rs L Connected to form a bridge C 2-3 Alkylene; in some embodiments, two non-adjacent Rs L Connected to form a bridging ethylene group; in some embodiments, two R atoms on the same carbon atom L They connect to form cyclopropyl groups.
[0267] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein A3 A 4 A 5 and A 6 Same or different, and each independently is N or CH; and / or a3, a4, a5 and a6 are each independently 0 or 1; and / or R L1 and R L2 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; and / or k1 and k2 are each independently 0 or 1; and / or L A1 It can be O or CH2;
[0268] In some implementation schemes, A 3 For CH; A 4 For CH; A 5 For CH; A 6 N; a3 and a4 are 0; a5 and a6 are 1; R L1 and R L2 For hydrogen atoms; L A1 It is O.
[0269] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts represented by general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1), wherein for In some implementation schemes, for In some implementation schemes, for
[0270] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 6 C 1-6 Alkyl; in some embodiments, R 6 It is a methyl group.
[0271] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 16 It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 16 C 1-6Alkyl; in some embodiments, R 16 It is a hydrogen atom.
[0272] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 17 and R 18 They may be the same or different, and each is independently a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 17 and R 18 It is a hydrogen atom.
[0273] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 19 It is a hydrogen atom.
[0274] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 20 Selected from hydrogen atoms, C 1-6 Alkyl, C 1-6 Alkyl and hydroxyl; in some embodiments, R 20 It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 20 It is a hydrogen atom.
[0275] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R 21 and R 22 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; in some embodiments, R 21 and R 22 They may be the same or different, and each is independently a hydrogen atom or a halogen; in some embodiments, R 21 and R 22 It is F.
[0276] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt thereof represented by general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1) is used, wherein v is 0; in some embodiments, v is 1; and in some embodiments, v is 2.
[0277] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein R a and R b They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; in some embodiments, R a and R b It is a hydrogen atom.
[0278] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein R c It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R c It is a hydrogen atom.
[0279] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), or (V-1) are used, wherein R d It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R d It is a hydrogen atom.
[0280] In some embodiments of this disclosure, the compound represented by general formula (II) or a pharmaceutically acceptable salt thereof, wherein Q is selected from... Y is CH2 or C(O); R 14 C 1-6 Alkyl; A 1 For N or CH; A 2 For N or CH; R 15a R 15b and R 15d They may be the same or different, and each is independently a hydrogen atom or a halogen; T is O; p is 1; q is 0 or 1; L is -(L A ) n -; n is 1, 2, 3, 4 or 5; each L A They may be the same or different, and each is independently selected from O, NH, C(O), C 1-6 Alkylene, C2-6 Alkyne group, 3- to 8-membered cycloalkyl group, and 3- to 8-membered heterocyclic group; each of the 3- to 8-membered cycloalkyl group and the 3- to 8-membered heterocyclic group is independently optionally divided by one or more R groups. L Replace; R L They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, hydroxy, and =O;R 1 C 1-6 Alkyl; R 3 for R 4 and R 5 Whether the atoms are the same or different, and each is independently selected from hydrogen atoms, C atoms 1- 6-alkyl and 3- to 6-membered cycloalkyl; R 3a For hydrogen atoms; R 2a R 2b and R 2c It is a hydrogen atom; U is N; G is N or CH; B is C or N; D is C or N; M, K and R may be the same or different, and each is independently selected from O, S, C, and R. 12c , N and NR 12d ;R 12c Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1- 6-alkoxy and cyano groups; R 12d It is a hydrogen atom or a carbon atom. 1-6 alkyl.
[0281] In some embodiments of this disclosure, the compound represented by general formula (IV) or a pharmaceutically acceptable salt thereof, wherein Q is... R 1 C 1-6 Alkyl; R 3 for R 4 and R 5 Whether the atoms are the same or different, and each is independently selected from hydrogen atoms, C atoms 1-6 Alkyl and 3- to 6-membered cycloalkyl; R 3a For hydrogen atoms; R 2a R 2b and R 2c A is a hydrogen atom; 3 A 4 A 5 and A 6 They are either the same or different, and each is independently N or CH; a3, a4, a5, and a6 are each independently 0 or 1; R L1 and R L2 For hydrogen atoms; L A1O; G is N or CH; D is C or N; M is selected from N, S, and CR. 12c ;R 12c Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkyl and cyano groups; K is CH; R is N.
[0282] In some embodiments of this disclosure, the compound represented by general formula (IV) or a pharmaceutically acceptable salt thereof, wherein Q is selected from... R 1 C 1-6 Alkyl; R 3 for R 3a For hydrogen atoms; R 2a R 2b and R 2c A is a hydrogen atom; 3 A 4 A 5 and A 6 They are either the same or different, and each is independently N or CH; a3, a4, a5, and a6 are each independently 0 or 1; R L1 and R L2 For hydrogen atoms; L A1 O; G is N or CH; D is C or N; M is selected from N, S, and CR. 12c ;R 12c Selected from hydrogen atoms, halogens, and cyano groups; K is CH; R is N.
[0283] Table A lists typical compounds disclosed herein, including but not limited to:
[0284] Furthermore, this disclosure provides a compound of general formula (IIB) or a salt thereof:
[0285] in:
[0286] R LP It is a leaving group;
[0287] R 1 R 2a R 2b R 2c R 3 R 3a U, G, B, D, M, K and R are as defined in general formula (II).
[0288] Furthermore, this disclosure provides a compound of general formula (II-1B) or a salt thereof:
[0289] in:
[0290] R LP It is a leaving group;
[0291] R 1 R 2a R 2b R 2c M 1 M 2 R 7a R 7b R 7c R 7d R 7e R 7f x, U, G, B, D, M, K and R are as defined in general formula (II-1).
[0292] Furthermore, this disclosure provides a compound of general formula (IIIB) or a salt thereof:
[0293] in:
[0294] R LP It is a leaving group;
[0295] Z, R T R 10 m, R 10a U, G, B, D, M, K and R are as defined in general formula (III).
[0296] Furthermore, this disclosure provides a compound of general formula (III-1B) or a salt thereof:
[0297] in:
[0298] R LP It is a leaving group;
[0299] Z, R 10 m, M 3 y, R 11a R 11b R 11c R 11d U, G, B, D, M, K and R are as defined in general formula (III-1).
[0300] Furthermore, this disclosure provides a compound of general formula (IVB) or a salt thereof:
[0301] in:
[0302] R LP It is a leaving group;
[0303] R 1 R 2a R 2b R 2c R 3 R 3a G, D, M, K and R are as defined in general formula (IV).
[0304] Furthermore, this disclosure provides a compound of general formula (IV-1B) or a salt thereof:
[0305] in:
[0306] R LP It is a leaving group;
[0307] R 1 R 2a R 2b R 2c R 7a R 7c R 7d G, D, M, K and R are as defined in general formula (IV-1).
[0308] Furthermore, this disclosure provides a compound of general formula (VB) or a salt thereof:
[0309] in:
[0310] R LP It is a leaving group;
[0311] Z, R 10 m, R 10a R T G, D, M, K and R are as defined in general formula (V).
[0312] Furthermore, this disclosure provides a compound of general formula (V-1B) or a salt thereof:
[0313] in:
[0314] R LP It is a leaving group;
[0315] Z, R 10 m, R 11a R T G, D, M, K and R are as defined in general formula (V-1).
[0316] Furthermore, this disclosure provides a compound of general formula (IVA) or a salt thereof:
[0317] in:
[0318] Q is selected from *Terminal and A 3 Connected;
[0319] R W It is a hydrogen atom or an amino protecting group;
[0320] T, p, q, Y, R 14 R 15a R 15b R 15d A 1 A 2 A 3 A 4 A 5 a3, a4, a5, a6, R L1 R L2 k1, k2 and L A1 As defined in general formula (IV).
[0321] In some embodiments of this disclosure, the compounds or salts thereof represented by general formula (IIB), general formula (II-1B), general formula (IIIB), general formula (III-1B), general formula (IVB), general formula (IV-1B), general formula (VB) or general formula (V-1B), wherein R LP For halogen; in some implementations, R LP For F or Cl; in some implementations, R LP It is Cl.
[0322] In some embodiments of this disclosure, the compound or salt thereof represented by general formula (IIB) or general formula (IVB) is not a
[0323] In some embodiments of this disclosure, the compound represented by the general formula (IVA) or a salt thereof, wherein R W For hydrogen atoms; in some implementations, R W It is an amino protecting group; in some embodiments, R W For Boc.
[0324] Table B lists typical intermediate compounds disclosed herein, including but not limited to:
[0325] Another aspect of this disclosure relates to a method for preparing a compound of general formula (IV) or a pharmaceutically acceptable salt thereof, comprising:
[0326] A compound of general formula (IVA) or a salt thereof undergoes a nucleophilic substitution reaction with a compound of general formula (IVB) or a salt thereof to give a compound of general formula (IV) or a pharmaceutically usable salt thereof;
[0327] in:
[0328] R W It is a hydrogen atom;
[0329] A 6 Let N be the number of people in the group.
[0330] R LP It is a leaving group;
[0331] R 1 R 2a R 2b R 2c R 3 R 3a G, D, M, K, R, Q, A 3 A 4 A 5 a3, a4, a5, a6, R L1 R L2 k1, k2 and L A1 As defined in general formula (IV).
[0332] Another aspect of this disclosure relates to a method for preparing a compound of general formula (IV-1) or a pharmaceutically acceptable salt thereof, comprising:
[0333] The compound represented by general formula (IVA) or its salt undergoes a nucleophilic substitution reaction with the compound represented by general formula (IV-1B) or its salt to give the compound represented by general formula (IV-1) or its pharmaceutically usable salt.
[0334] in:
[0335] R W It is a hydrogen atom;
[0336] A 6 Let N be the number of people in the group.
[0337] R LP It is a leaving group;
[0338] R 1 R 2a R 2b R 2c R 7a R7c R 7d G, D, M, K, R, Q, A 3 A 4 A 5 a3, a4, a5, a6, R L1 R L2 k1, k2 and L A1 As defined in general formula (IV-1).
[0339] Another aspect of this disclosure relates to a method for preparing a compound of general formula (V) or a pharmaceutically acceptable salt thereof, comprising:
[0340] A compound of general formula (IVA) or a salt thereof undergoes a nucleophilic substitution reaction with a compound of general formula (VB) or a salt thereof to give a compound of general formula (V) or a pharmaceutically usable salt thereof;
[0341] in:
[0342] R W It is a hydrogen atom;
[0343] A 6 Let N be the number of people in the group.
[0344] R LP It is a leaving group;
[0345] Z, R T R 10 m, R 10a G, D, M, K, R, Q, A 3 A 4 A 5 a3, a4, a5, a6, R L1 R L2 k1, k2 and L A1 As defined in general formula (V).
[0346] Another aspect of this disclosure relates to a method for preparing a compound of general formula (V-1) or a pharmaceutically acceptable salt thereof, comprising:
[0347] The compound represented by general formula (IVA) or its salt undergoes a nucleophilic substitution reaction with the compound represented by general formula (V-1B) or its salt to give the compound represented by general formula (V-1) or its pharmaceutically usable salt.
[0348] in:
[0349] R W It is a hydrogen atom;
[0350] A 6 Let N be the number of people in the group.
[0351] R LP It is a leaving group;
[0352] Z, R 10 m, R 11a G, D, M, K, R, Q, A 3 A 4 A 5 a3, a4, a5, a6, R L1 R L2 k1, k2 and L A1 As defined in general formula (V-1).
[0353] In some embodiments of this disclosure, the preparation methods of compounds of general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1) or pharmaceutically acceptable salts thereof, wherein R LP For halogen; in some implementations, R LP For F or Cl; in some implementations, R LP It is Cl.
[0354] In some embodiments of this disclosure, the preparation of compounds of general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1) or pharmaceutically acceptable salts thereof, wherein the nucleophilic substitution reaction is carried out under basic conditions.
[0355] In some embodiments of this disclosure, the preparation methods of compounds or pharmaceutically acceptable salts of the compounds represented by general formula (IV), general formula (IV-1), general formula (V), or general formula (V-1) include methods for providing alkaline conditions, wherein the reagents providing alkaline conditions include organic and inorganic bases. The organic bases include, but are not limited to, triethylamine, N,N-diisopropylethylamine, n-butyllithium, diisopropylaminolithium, potassium acetate, sodium tert-butoxide, potassium tert-butoxide, tetrabutylammonium fluoride, tetrahydrofuran solution of tetrabutylammonium fluoride, or 1,8-diazabicycloundec-7-ene. The inorganic bases include, but are not limited to, sodium hydride, potassium phosphate, sodium carbonate, sodium acetate, potassium acetate, potassium carbonate, cesium carbonate, sodium hydroxide, lithium hydroxide, cesium fluoride, and potassium hydroxide. In some embodiments, the reagent providing alkaline conditions is N,N-diisopropylethylamine.
[0356] In some embodiments of this disclosure, the preparation methods of compounds of general formula (IV), general formula (IV-1), general formula (V) or general formula (V-1) or pharmaceutically acceptable salts thereof, wherein the nucleophilic substitution reaction is carried out in a solvent, including but not limited to: ethylene glycol dimethyl ether, acetic acid, methanol, ethanol, acetonitrile, n-butanol, toluene, tetrahydrofuran, dichloromethane, petroleum ether, ethyl acetate, n-hexane, dimethyl sulfoxide, 1,4-dioxane, water, N,N-dimethylformamide, N,N-dimethylacetamide, and mixtures thereof.
[0357] Another aspect of this disclosure relates to a pharmaceutical composition comprising a compound of the above-described formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), (V-1) or Table A, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers, diluents or excipients.
[0358] This disclosure further relates to the use of compounds of the above general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), (V-1) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising them, in the preparation of a medicament for inhibiting or degrading BCL6.
[0359] This disclosure further relates to the use of compounds of general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V), general formula (V-1) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising thereof, in the preparation of a medicament for regulating BCL6 protein ubiquitination and degradation in a subject.
[0360] This disclosure further relates to the use of compounds of general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V), general formula (V-1) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising thereof, in the preparation of medicaments for the treatment and / or prevention of diseases or conditions mediated or dependent on BCL6.
[0361] This disclosure further relates to the use of compounds of general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V), general formula (V-1) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising thereof, in the preparation of medicaments for the treatment and / or prevention of tumors or autoimmune diseases.
[0362] This disclosure also relates to a method for regulating the ubiquitination and degradation of BCL6 protein in a subject, comprising administering to a desired patient a compound of the above general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V), general formula (V-1) or Table A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above.
[0363] This disclosure also relates to a method of inhibiting or degrading BCL6 in a subject, comprising administering to a desired patient a compound of the above general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V), general formula (V-1) or Table A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above.
[0364] This disclosure also relates to a method of treating and / or preventing diseases or conditions mediated or dependent on BCL6, comprising administering to a desired patient a compound of the above general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V), general formula (V-1) or Table A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above.
[0365] This disclosure also relates to a method of treating and / or preventing tumors or autoimmune diseases, comprising administering to a desired patient a compound of the above general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V), general formula (V-1) or Table A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above.
[0366] This disclosure further relates to a compound of the above general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V), general formula (V-1) or Table A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the thereof, which is used as a medicine.
[0367] This disclosure further relates to a compound of the above general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V), general formula (V-1) or Table A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above, which is used as a drug for regulating the ubiquitination and degradation of BCL6 protein in a subject.
[0368] This disclosure further relates to a compound of the above general formula (I), general formula (II), general formula (II-1), general formula (III), general formula (III-1), general formula (IV), general formula (IV-1), general formula (V), general formula (V-1) or Table A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the thereof, which is used as a medicament for treating and / or preventing diseases or conditions mediated or dependent on BCL6.
[0369] This disclosure further relates to compounds of the above general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), (V-1) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising the above, for regulating BCL6 protein ubiquitination and degradation in a subject.
[0370] This disclosure further relates to compounds of the above general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), (V-1) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising the above, for use in inhibiting or degrading BCL6 in a subject.
[0371] This disclosure further relates to compounds of the above general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), (V-1) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising them, for the treatment and / or prevention of diseases or conditions mediated or dependent on BCL6.
[0372] This disclosure further relates to compounds of the above general formulas (I), (II), (II-1), (III), (III-1), (IV), (IV-1), (V), (V-1) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising thereof, for the treatment and / or prevention of tumors or autoimmune diseases.
[0373] In some embodiments, the diseases or conditions mediated or dependent on BCL6 described in this disclosure are tumors or autoimmune diseases; in some embodiments, the diseases or conditions mediated or dependent on BCL6 described in this disclosure are tumors; in some embodiments, the diseases or conditions mediated or dependent on BCL6 described in the disclosure are selected from lymphoma, leukemia, breast cancer, and lung cancer; in some embodiments, the diseases or conditions mediated or dependent on BCL6 described in the disclosure are lymphoma or leukemia; in some embodiments, the diseases or conditions mediated or dependent on BCL6 described in the disclosure are lymphoma.
[0374] In some embodiments, the tumors described in this disclosure are selected from lymphoma, leukemia, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, hepatocellular carcinoma, renal cell carcinoma, bladder cancer, colorectal cancer, breast cancer, cervical cancer, colon cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, gastric cancer, melanoma, sarcoma, Ewing sarcoma, angiosarcoma, Kaposi's sarcoma, liposarcoma, sarcoma, and peripheral neuroepithelial tumor. Neuroepithelial tumor, synovial sarcoma, glioma, astrocytoma, glioblastoma, neuroblastoma, ganglioglioma, medulloblastoma, pineal cell carcinoma, meningioma, meningeal sarcoma, neurofibroma and schwannoma, prostate cancer, endometrial cancer, testicular cancer, thyroid cancer, astrocytoma, carcinosarcoma, Hodgkin's disease, nephroblastoma and teratoma; in some embodiments, the tumors described in this disclosure are selected from leukemia, lymphoma, breast cancer and lung cancer; in some embodiments, the tumors described in this disclosure are leukemia or lymphoma; in some embodiments, the tumors described in this disclosure are lymphoma.
[0375] In some embodiments, the autoimmune diseases described in this disclosure are selected from systemic lupus erythematosus (SLE), ankylosing spondylitis, Chagas disease, chronic obstructive pulmonary disease, dermatomyositis, type 1 diabetes mellitus, endometriosis, Goodpasture's syndrome, Graves' disease, Guillain-Barré syndrome (GBS), Hashimoto's disease, hidradenitis suppurativa, and Kawasaki disease. Diseases, IgA nephropathy, idiopathic thrombocytopenic purpura, interstitial cystitis (IC), mixed connective tissue disease (MCTD), scleroderma, multiple sclerosis, chronic spontaneous urticaria (CSU), neuromuscular rigidity, psoriasis, psoriatic arthritis, psoriasis, polymyositis, primary biliary cirrhosis, relapsing polychondritis, rheumatoid arthritis, sarcoidosis, scleroderma, Sjögren's syndrome, stiffness syndrome, ulcerative colitis, vasculitis, vitiligo, and Wegener's granulomatosis. The autoimmune diseases described herein include granulomatosis, atopic dermatitis, asthma, insulin-dependent diabetes mellitus, Hashimoto's thyroiditis, pernicious anemia, myasthenia gravis, pemphigus vulgaris, and Crohn's disease; in some embodiments, the autoimmune diseases described herein are selected from systemic lupus erythematosus (SLE), rheumatoid arthritis, scleroderma, and Guillain-Barré syndrome (GBS); in some embodiments, the autoimmune diseases described herein are selected from atopic dermatitis, asthma, insulin-dependent diabetes mellitus, Hashimoto's thyroiditis, pernicious anemia, myasthenia gravis, pemphigus vulgaris, and Crohn's disease.
[0376] In some implementations, the tumor described in this disclosure is cancer.
[0377] In some embodiments, the tumors described in this disclosure are hematologic malignancies.
[0378] In some implementations, the lung cancer described in this disclosure is non-small cell lung cancer (NSCLC).
[0379] In some embodiments, the lymphoma described in this disclosure is selected from non-Hodgkin lymphoma (NHL), diffuse large B-cell lymphoma (DIBCLs), Burkitt lymphoma, T-cell lymphoblastic lymphoma (T-LL), peripheral T-cell lymphoma, lymphoblastic lymphoma, Pre-B lymphoma, B-cell lymphoma, B-cell ALL, follicular lymphoma, marginal zone lymphoma (MZL), mantle cell lymphoma (MCL), small lymphocytic lymphoma (SLL), intravascular large B-cell lymphoma, and Waldenström macroglobulinemia (WM); in some embodiments, the lymphoma described in this disclosure is B-cell lymphoma; in some embodiments, the lymphoma described in this disclosure is diffuse large B-cell lymphoma; in some embodiments, the lymphoma described in this disclosure is non-Hodgkin lymphoma (NHL); in some embodiments, the lymphoma described in this disclosure is relapsed / refractory non-Hodgkin lymphoma.
[0380] In some embodiments, the leukemia described in this disclosure is selected from T-cell acute lymphoblastic leukemia (T-ALL), adult T-cell leukemia, precursor B-cell acute lymphoblastic leukemia (Pre-B ALL), B-cell acute lymphoblastic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia (CLL), B-cell leukemia, and chronic myeloid leukemia.
[0381] In addition to the active compound, the pharmaceutical compositions disclosed herein may contain one or more excipients selected from the following: fillers (diluents), binders, wetting agents, disintegrants, or excipients. Depending on the method of administration, the composition may contain 0.1 to 99% by weight of the active compound.
[0382] The active compounds can be formulated into forms suitable for administration via any appropriate route. As a general guideline, the active compounds of this disclosure are, in some embodiments, expressed as unit doses or in a manner that allows the patient to self-administer a single dose. The unit dose of the disclosed compounds or compositions can be expressed as tablets, capsules, sachets, bottled liquids, powders, granules, lozenges, suppositories, regenerated powders, or liquid formulations. In some embodiments, the unit dose of the pharmaceutical composition is 0.001 mg to 1000 mg; in some embodiments, a suitable unit dose may be 0.1 to 1000 mg.
[0383] .
[0384] In some embodiments, the pharmaceutical composition contains 0.01-99.99% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution, based on the total weight of the composition. In some embodiments, the pharmaceutical composition contains 0.1-99.9% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution. In some embodiments, the pharmaceutical composition contains 0.5%-99.5% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution. In some embodiments, the pharmaceutical composition contains 1%-99% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution. In some embodiments, the pharmaceutical composition contains 2%-98% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution.
[0385] In some embodiments, the pharmaceutical composition contains 0.01% to 99.99% pharmaceutically acceptable excipients based on the total weight of the composition. In some embodiments, the pharmaceutical composition contains 0.1% to 99.9% pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical composition contains 0.5% to 99.5% pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical composition contains 1% to 99% pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical composition contains 2% to 98% pharmaceutically acceptable excipients.
[0386] The pharmaceutically acceptable salts of the compounds described in this disclosure may be selected from inorganic or organic salts.
[0387] Pharmaceutical compositions containing active ingredients may be in forms suitable for oral administration, such as tablets, sugar lozenges, tablets, aqueous or oil suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. Oral compositions may be prepared according to any method known in the art for preparing pharmaceutical compositions, and such compositions may contain one or more ingredients selected from sweeteners, flavoring agents, coloring agents, and preservatives to provide an appealing and palatable pharmaceutical formulation.
[0388] Tablets contain an active ingredient and non-toxic, pharmaceutically acceptable excipients suitable for tablet preparation, used for mixing. These excipients may be inert excipients, granulating agents, disintegrants, binders, and lubricants. These tablets may be uncoated or coated using known techniques that mask the taste of the drug or delay disintegration and absorption in the gastrointestinal tract, thus providing sustained release over a longer period.
[0389] Oral formulations can also be provided using soft gelatin capsules in which the active ingredient is mixed with an inert solid diluent or in which the active ingredient is mixed with a water-soluble carrier or an oil solvent.
[0390] Aqueous suspensions contain active substances and excipients suitable for preparing aqueous suspensions for mixing. These excipients are suspending agents, dispersing agents, or wetting agents. Aqueous suspensions may also contain one or more preservatives, one or more coloring agents, one or more flavoring agents, and one or more sweeteners.
[0391] Oil suspensions are formulated by suspending the active ingredient in vegetable or mineral oil. Oil suspensions may contain thickeners. Sweeteners and flavoring agents mentioned above may be added to provide palatable formulations. These compositions may be preserved by adding antioxidants.
[0392] The pharmaceutical compositions disclosed herein may also be in the form of an oil-in-water emulsion. The oil phase may be vegetable oil, mineral oil, or a mixture thereof. Suitable emulsifiers may be naturally occurring phospholipids, and the emulsion may also contain sweeteners, flavoring agents, preservatives, and antioxidants. Such formulations may also contain modifiers, preservatives, colorants, and antioxidants.
[0393] The pharmaceutical compositions disclosed herein may be in the form of sterile injectable aqueous solutions. Acceptable solvents or media that can be used include water, Ringer's solution, and isotonic sodium chloride solution. The sterile injectable formulation may be a sterile injectable oil-in-water microemulsion in which the active ingredient is dissolved in the oil phase, which can be injected into the patient's bloodstream via local large-volume injection. Alternatively, the solution and microemulsion are preferably administered in a manner that maintains a constant circulating concentration of the compounds disclosed herein. To maintain such a constant concentration, a continuous intravenous delivery device may be used. An example of such a device is the Deltec CADD-PLUS™ 5400 intravenous infusion pump.
[0394] The pharmaceutical compositions disclosed herein may be in the form of sterile injectable aqueous or oil suspensions for intramuscular and subcutaneous administration. These suspensions may be formulated using suitable dispersants or wetting agents and suspending agents according to known techniques. The sterile injectable formulations may also be sterile injectable solutions or suspensions prepared in parenteral acceptable non-toxic diluents or solvents. Furthermore, sterile fixative oils can be conveniently used as solvents or suspension media. Any blended fixative oil may be used for this purpose. Additionally, fatty acids may also be used to prepare injectable formulations.
[0395] The disclosed compounds can be administered in suppository form for rectal administration. These pharmaceutical compositions can be prepared by mixing the drug with a suitable, non-irritating excipient that is solid at normal temperatures but liquid in the rectum, and thus dissolves in the rectum to release the drug.
[0396] As is well known to those skilled in the art, the dosage of a drug depends on a variety of factors, including but not limited to: the activity of the specific compound used, the patient's age, the patient's weight, the patient's health status, the patient's behavior, the patient's diet, the timing of administration, the route of administration, the rate of excretion, the combination of drugs, the severity of the disease, etc.; in addition, the optimal treatment mode, such as the treatment pattern, the daily dosage of the compound, or the type of medicinal salt can be validated based on conventional treatment protocols.
[0397] Terminology Explanation
[0398] Unless otherwise stated, the terms used in the specification and claims have the following meanings.
[0399] The term "alkyl" refers to a saturated, straight-chain or branched aliphatic hydrocarbon group having 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) carbon atoms (i.e., C2). 1-20 Alkyl group). In some embodiments, the alkyl group is an alkyl group having 1 to 12 carbon atoms (i.e., C12). 1-12 Alkyl groups, in some embodiments, having 1 to 6 carbon atoms (i.e., C14-C6 ... 1-6Alkyl groups). Non-limiting examples include: methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropyl, 1-ethylpropyl, 2-methylbutyl, 3-methylbutyl, n-hexyl, 1-ethyl-2-methylpropyl, 1,1,2-trimethylpropyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 2,2-dimethylbutyl, 1,3-dimethylbutyl, 2-ethylbutyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 2,3-dimethylbutyl, n-heptyl, 2-methylhexyl, 3-methylhexyl, 4-methylhexyl, 5-methylhexyl, 2 3-Dimethylpentyl, 2,4-Dimethylpentyl, 2,2-Dimethylpentyl, 3,3-Dimethylpentyl, 2-Ethylpentyl, 3-Ethylpentyl, n-Octyl, 2,3-Dimethylhexyl, 2,4-Dimethylhexyl, 2,5-Dimethylhexyl, 2,2-Dimethylhexyl, 3,3-Dimethylhexyl, 4,4-Dimethylhexyl, 2-Ethylhexyl, 3-Ethylhexyl, 4-Ethylhexyl, 2-Methyl-2-Ethylpentyl, 2-Methyl-3-Ethylpentyl, n-Nonyl, 2-Methyl-2-Ethylhexyl, 2-Methyl-3-Ethylhexyl, 2,2-Diethylpentyl, n-Decyl, 3,3-Diethylhexyl, 2,2-Diethylhexyl, and their various branched isomers, etc. Alkyl groups can be substituted or unsubstituted, and when substituted, they can be substituted at any usable connection point. In some embodiments, the substituents are selected from one or more of the following: D atom, halogen, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0400] The term "alkenyl" refers to an alkyl group in which the molecule contains at least one carbon-carbon double bond, wherein the alkyl group is defined as described above and has 2 to 12 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) carbon atoms (i.e., C atoms). 2-12 Alkenyl group). In some embodiments, the alkenyl group has 2 to 6 carbon atoms (i.e., C16). 2-6 Alkenyl). Non-limiting examples include vinyl, propenyl, isopropenyl, butenyl, etc. Alkenyl groups can be substituted or unsubstituted, and when substituted, they can be substituted at any usable connection point; in some embodiments, the substituent is selected from one or more of the following: D atom, alkoxy, halogen, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0401] The term "alkynyl" refers to an alkyl group in a molecule that contains at least one carbon-carbon triple bond, wherein the alkyl group is defined as described above and has 2 to 12 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) carbon atoms (i.e., C64, C74, C84, C9 ... 2-12 (Alynyl group). In some embodiments, the alkynyl group has 2 to 6 carbon atoms (i.e., C12). 2-6 (Alynyl). Non-limiting examples include: ethynyl, propynyl, butynyl, pentyynyl, hexynyl, etc. The alkynyl group can be substituted or unsubstituted, and when substituted, it can be substituted at any usable linker; in some embodiments, the substituent is selected from one or more of the following: D atom, alkoxy, halogen, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0402] The term "alkylene" refers to a divalent alkyl group, wherein the alkyl group, as defined above, has 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) carbon atoms (i.e., C2). 1-20 Alkylene). In some embodiments, the alkylene has 1 to 10 carbon atoms (i.e., C10). 1-10 Alkylenes), in some embodiments, alkylenes having 1 to 8 carbon atoms (i.e., C1646-C ... 1-8 Alkylenes), in some embodiments, are selected to have 2 to 7 carbon atoms (i.e., C164-C ... 2-7 Alkylene; in some embodiments, alkylene having 1, 2, or 3 carbon atoms (i.e., C14) 1-6 Alkylenes. Non-limiting examples include: -CH2-, -CH(CH3)-, -C(CH3)2-, -CH2CH2-, -CH(CH2CH3)-, -CH2CH(CH3)-, -CH2C(CH3)2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, etc. Alkylenes can be substituted or unsubstituted, and when substituted, they can be substituted at any usable link. In some embodiments, the substituent is selected from one or more of the following: D atom, halogen, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0403] The term "bridged alkylene" refers to an alkylene ring formed by the connection of two non-adjacent atoms, as defined above. Non-limiting examples include: bridged ethylene (-CH2CH2-) and bridged methylene (-CH2-).
[0404] The term "alkoxy" refers to -O-(alkyl), where alkyl is defined as described above. Non-limiting examples include methoxy, ethoxy, propoxy, and butoxy, etc. Alkoxy groups can be substituted or unsubstituted, and when substituted, they can be substituted at any usable link. In some embodiments, the substituent is selected from one or more of the following: D atom, halogen, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0405] The term "cycloalkyl" refers to a saturated or partially unsaturated monocyclic all-carbon ring (i.e., monocyclic cycloalkyl) or polycyclic system (i.e., polycyclic cycloalkyl) having 3 to 20 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) ring atoms (i.e., 3 to 20 membered cycloalkyl). In some embodiments, the cycloalkyl group is a cycloalkyl group having 3 to 12 ring atoms (i.e., a 3 to 12-membered cycloalkyl group) or a cycloalkyl group having 4 to 11 ring atoms (i.e., a 4 to 11-membered cycloalkyl group); in some embodiments, a cycloalkyl group having 3 to 8 ring atoms (i.e., a 3 to 8-membered cycloalkyl group); in some embodiments, a cycloalkyl group having 4 to 8 ring atoms (i.e., a 4 to 8-membered cycloalkyl group); in some embodiments, a cycloalkyl group having 4 to 6 ring atoms (i.e., a 4 to 6-membered cycloalkyl group); and in some embodiments, a cycloalkyl group having 3 to 6 ring atoms (i.e., a 3 to 6-membered cycloalkyl group).
[0406] Non-limiting examples of the monocyclic cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cyclohexadienyl, cycloheptyl, cyclohepttrienyl, and cyclooctyl.
[0407] The polycyclic alkyl groups include: spirocyclic alkyl groups, fused cyclic alkyl groups, and bridged cyclic alkyl groups.
[0408] The term "spirocycloalkyl" refers to a polycyclic system in which rings share a single carbon atom (called a spiro atom), and the ring may contain one or more double bonds, or one or more heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized to form nitrogen oxides; the sulfur may optionally be oxidized to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-), provided that it contains at least one full carbon ring with a bonding point on that full carbon ring, having 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., 5 to 20-membered spirocycloalkyl). In some embodiments, the spirocycloalkyl is a spirocycloalkyl having 6 to 14 ring atoms (i.e., 6 to 14-membered spirocycloalkyl), and in some embodiments, it is a spirocycloalkyl having 7 to 10 ring atoms (i.e., 7 to 10-membered spirocycloalkyl). The spirocyclic alkyl group includes monospirocyclic alkyl and polyspirocyclic alkyl (such as bispirocyclic alkyl, etc.). In some embodiments, it is a monospirocyclic alkyl or a bispirocyclic alkyl. In some embodiments, the spirocyclic alkyl group is a 3-membered / 4-membered, 3-membered / 5-membered, 3-membered / 6-membered, 4-membered / 4-membered, 4-membered / 5-membered, 4-membered / 6-membered, 5-membered / 3-membered, 5-membered / 4-membered, 5-membered / 5-membered, 5-membered / 6-membered, 5-membered / 7-membered, 6-membered / 3-membered, 6-membered / 4-membered, 6-membered / 5-membered, 6-membered / 6-membered, 6-membered / 7-membered, 7-membered / 5-membered, or 7-membered / 6-membered monospirocyclic alkyl group. Non-limiting examples include:
[0409] Its connection point can be anywhere;
[0410] wait.
[0411] The term "fused cycloalkyl" refers to a polycyclic system in which two adjacent carbon atoms are shared between rings. This system is a monocyclic cycloalkyl group fused with one or more monocyclic cycloalkyl groups, or a monocyclic cycloalkyl group fused with one or more heterocyclic, aryl, or heteroaryl groups, wherein the bonding point is on the monocyclic cycloalkyl group, which may contain one or more double bonds and has 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., 5 to 20-membered fused cycloalkyl). In some embodiments, the fused cycloalkyl group is a fused cycloalkyl group having 6 to 14 ring atoms (i.e., 6 to 14-membered fused cycloalkyl), and in some embodiments, it is a fused cycloalkyl group having 7 to 10 ring atoms (i.e., 7 to 10-membered fused cycloalkyl). The fused cyclic alkyl group includes bicyclic fused cyclic alkyl groups and polycyclic fused cyclic alkyl groups (such as tricyclic fused cyclic alkyl groups, tetracyclic fused cyclic alkyl groups, etc.). In some embodiments, it is a bicyclic fused cyclic alkyl group or a tricyclic fused cyclic alkyl group. In some embodiments, it is a ternary / quadrivalent, ternary / quinary, ternary / six-membered, quadrivalent / quadrivalent, quadrivalent / five-membered, quadrivalent / six-membered, quadrivalent / quadrivalent, quadrivalent / six-membered, 5-member / tertiary, 5-member / quadrivalent, 5-member / five-membered, 5-member / six-membered, 5-member / seven-membered, 6-member / tertiary, 6-member / quadrivalent, 6-member / four-membered, 6-member / five-membered, 6-member / six-membered, 6-member / seven-membered, 7-member / five-membered, or 7-member / six-member bicyclic fused cyclic alkyl group. Non-limiting examples include:
[0412] Its connection point can be anywhere;
[0413] wait.
[0414] The term "bridged cycloalkyl" refers to a fully carbon polycyclic system in which two non-directly connected carbon atoms are shared between rings, and the ring may contain one or more double bonds and have 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) carbon atoms (i.e., 5 to 20-membered bridged cycloalkyl). In some embodiments, the bridged cycloalkyl is a bridged cycloalkyl with 6 to 14 carbon atoms (i.e., 6 to 14-membered bridged cycloalkyl), and in some embodiments, it is a bridged cycloalkyl with 7 to 10 carbon atoms (i.e., 7 to 10-membered bridged cycloalkyl). The bridged cycloalkyl includes bicyclic bridged cycloalkyl and polycyclic bridged cycloalkyl (e.g., tricyclic bridged cycloalkyl, tetracyclic bridged cycloalkyl, etc.), and in some embodiments, it is a bicyclic bridged cycloalkyl or a tricyclic bridged cycloalkyl. Non-limiting examples include:
[0415] Its connection point can be anywhere.
[0416] The cycloalkyl group can be substituted or unsubstituted. When substituted, it can be substituted at any usable connection point. In some embodiments, the substituent is selected from one or more of the following: D atom, halogen, alkyl, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, alkylthio, haloalkylthio, cycloalkylthio, heterocyclic thio, heterocyclic oxy, hydroxy, hydroxyalkyl, oxo, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0417] The term "heterocyclic group" refers to a saturated or partially unsaturated monocyclic heterocycle (i.e., monocyclic heterocyclic group) or polycyclic heterocyclic system (i.e., polycyclic heterocyclic group) containing at least one (e.g., 1, 2, 3 or 4) heteroatoms selected from nitrogen, oxygen and sulfur (the nitrogen may optionally be oxidized, i.e., to form nitrogen oxides; the sulfur may optionally be oxidized, i.e., to form sulfoxides or sulfones, but excluding -OO-, -OS- or -SS-), and having 3 to 20 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) ring atoms (i.e., 3 to 20 membered heterocyclic groups). In some embodiments, the heterocyclic group is a heterocyclic group having 3 to 12 ring atoms (i.e., a 3 to 12-membered heterocyclic group) or a heterocyclic group having 4 to 11 ring atoms (i.e., a 4 to 11-membered heterocyclic group); in some embodiments, a heterocyclic group having 3 to 8 ring atoms (i.e., a 3 to 8-membered heterocyclic group); in some embodiments, a heterocyclic group having 4 to 8 ring atoms (i.e., a 4 to 8-membered heterocyclic group); in some embodiments, a heterocyclic group having 4 to 6 ring atoms (i.e., a 4 to 6-membered heterocyclic group); in some embodiments, a heterocyclic group having 3 to 6 ring atoms (i.e., a 3 to 6-membered heterocyclic group); in some embodiments, a heterocyclic group having 5 to 7 ring atoms (i.e., a 5 to 7-membered heterocyclic group); in some embodiments, a heterocyclic group having 5 or 6 ring atoms (i.e., a 5 or 6-membered heterocyclic group); in some embodiments, a heterocyclic group having 6 ring atoms (i.e., a 6-membered heterocyclic group).
[0418] Non-limiting examples of the monocyclic heterocyclic group include: pyrrolidinyl, tetrahydropyranyl, 1,2,3,6-tetrahydropyridyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, and homopiperazinyl, etc.
[0419] The polycyclic heterocyclic groups include spirocyclic heterocyclic groups, fused heterocyclic groups, and bridged heterocyclic groups.
[0420] The term "spiroheterocyclic group" refers to a polycyclic heterocyclic system in which rings share a single atom (called a spiro atom), which may contain one or more double bonds and at least one (e.g., 1, 2, 3, or 4) heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized to form nitrogen oxides; the sulfur may optionally be oxidized to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-), provided that at least one monocyclic heterocyclic group is present and the bonding point is on the monocyclic heterocyclic group, which has 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., 5 to 20-membered spiroheterocyclic groups). In some embodiments, the spiroheterocyclic group is a spiroheterocyclic group having 6 to 14 ring atoms (i.e., a 6 to 14-membered spiroheterocyclic group), and in some embodiments, it is a spiroheterocyclic group having 7 to 11 ring atoms (i.e., a 7 to 11-membered spiroheterocyclic group). The spiroheterocyclic group includes monospirocyclic and polyspirocyclic groups (such as bispirocyclic groups). In some embodiments, it is a monospirocyclic or bispirocyclic group. In some embodiments, it is a 3-membered / 4-membered, 3-membered / 5-membered, 3-membered / 6-membered, 4-membered / 4-membered, 4-membered / 5-membered, 4-membered / 6-membered, 5-membered / 3-membered, 5-membered / 4-membered, 5-membered / 5-membered, 5-membered / 6-membered, 5-membered / 7-membered, 6-membered / 3-membered, 6-membered / 4-membered, 6-membered / 5-membered, 6-membered / 6-membered, 6-membered / 7-membered, 7-membered / 5-membered, or 7-membered / 6-membered monospirocyclic group. Non-limiting examples include:
[0421] wait.
[0422] The term "fused heterocyclic group" refers to a polycyclic heterocyclic system in which two adjacent atoms are shared between rings. The ring may contain one or more double bonds and at least one (e.g., 1, 2, 3, or 4) heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized to form nitrogen oxides; the sulfur may optionally be oxidized to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-). It is a monocyclic heterocyclic group fused with one or more monocyclic heterocyclic groups, or a monocyclic heterocyclic group fused with one or more cycloalkyl, aryl, or heteroaryl groups, wherein the bonding point is on the monocyclic heterocyclic group and has 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., 5 to 20 membered fused heterocyclic groups). In some embodiments, the fused heterocyclic group is a fused heterocyclic group having 6 to 14 ring atoms (i.e., a 6 to 14-membered fused heterocyclic group); in some embodiments, it is a fused heterocyclic group having 7 to 11 ring atoms (i.e., a 7 to 11-membered fused heterocyclic group); and in some embodiments, it is a fused heterocyclic group having 9 ring atoms (i.e., a 9-membered fused heterocyclic group). The fused heterocyclic group includes bicyclic and polycyclic fused heterocyclic groups (such as tricyclic fused heterocyclic groups, tetracyclic fused heterocyclic groups, etc.). In some embodiments, it is a bicyclic or tricyclic fused heterocyclic group. In some embodiments, it is a 3-membered / 4-membered, 3-membered / 5-membered, 3-membered / 6-membered, 4-membered / 4-membered, 4-membered / 5-membered, 4-membered / 6-membered, 5-membered / 3-membered, 5-membered / 4-membered, 5-membered / 5-membered, 5-membered / 6-membered, 5-membered / 7-membered, 6-membered / 3-membered, 6-membered / 4-membered, 6-membered / 5-membered, 6-membered / 6-membered, 6-membered / 7-membered, 7-membered / 5-membered, or 7-membered / 6-membered bicyclic fused heterocyclic group. Non-limiting examples include:
[0423] wait.
[0424] The term "bridged heterocyclic group" refers to a polycyclic heterocyclic system in which two non-directly bonded atoms are shared between the rings. The rings may contain one or more double bonds, and the system contains at least one (e.g., 1, 2, 3, or 4) heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized to form nitrogen oxides; the sulfur may optionally be oxidized to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-). The system has 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., a 5- to 20-membered bridged heterocyclic group). In some embodiments, the bridged heterocyclic group has 6 to 14 ring atoms (i.e., a 6- to 14-membered bridged heterocyclic group), and in some embodiments, it has 7 to 10 ring atoms (i.e., a 7- to 10-membered bridged heterocyclic group). Based on the number of constituent rings, heterocyclic groups can be classified into bicyclic bridged heterocyclic groups and multicyclic bridged heterocyclic groups (such as tricyclic bridged heterocyclic groups, tetracyclic bridged heterocyclic groups, etc.). In some embodiments, they are bicyclic bridged heterocyclic groups or tricyclic bridged heterocyclic groups. Non-limiting examples include:
[0425] wait.
[0426] The heterocyclic group can be substituted or unsubstituted. When substituted, it can be substituted at any usable connection point. In some embodiments, the substituent is selected from one or more of the following: D atom, halogen, alkyl, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, alkylthio, haloalkylthio, cycloalkylthio, heterocyclic thio, hydroxy, hydroxyalkyl, oxo, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0427] The term "aryl" refers to a monocyclic all-carbon aromatic ring (i.e., monocyclic aryl) or a polycyclic aromatic ring system (i.e., polycyclic aryl) having a conjugated π-electron system, having 6 to 14 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, or 14) ring atoms (i.e., 6 to 14-membered aryl). In some embodiments, the aryl group has 6 to 10 ring atoms (i.e., 6 to 10-membered aryl). The monocyclic aryl group is, for example, phenyl. Non-limiting examples of the polycyclic aryl group include naphthyl, anthraceneyl, phenanthrene, etc. The polycyclic aryl group further includes fusion of the phenyl group with one or more heterocyclic groups or cycloalkyl groups, or fusion of the naphthyl group with one or more heterocyclic groups or cycloalkyl groups, wherein the bonding point is on the phenyl or naphthyl group, and in this case, the number of ring atoms continues to represent the number of ring atoms in the polycyclic aromatic ring system, non-limiting examples including:
[0428] wait.
[0429] The aryl group can be substituted or unsubstituted. When substituted, it can be substituted at any usable connection point. In some embodiments, the substituent is selected from one or more of the following: D atom, halogen, alkyl, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxyl, alkylthio, haloalkylthio, cycloalkylthio, heterocyclic thio, hydroxyalkyl, oxo, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0430] The term "heteroaryl" refers to a monocyclic heteroaryl ring (i.e., monocyclic heteroaryl) or a polycyclic heteroaryl ring system (i.e., polycyclic heteroaryl) having a conjugated π-electron system, containing at least one (e.g., 1, 2, 3, or 4) heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized, i.e., to form nitrogen oxides; the sulfur may optionally be oxidized, i.e., to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-), having 5 to 14 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14) ring atoms (i.e., 5 to 14-membered heteroaryl). In some embodiments, the heteroaryl has 5 to 10 ring atoms (i.e., 5 to 10-membered heteroaryl), and in some embodiments, it has 5 or 6 ring atoms (i.e., 5 or 6-membered heteroaryl).
[0431] Non-limiting examples of the aforementioned monocyclic heteroaryl groups include: furanyl, thiopheneyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiadiazolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, furazonyl, pyrroleyl, N-alkylpyrroleyl, pyridyl, pyrimidinyl, pyridoneyl, N-alkylpyridone (e.g.) (etc.), pyrazinyl, pyridazinyl, etc.
[0432] Non-limiting examples of the polycyclic heteroaryl groups include: indolyl, indazole, quinolinyl, isoquinolinyl, quinoxalinyl, phthalazinyl, benzimidazolyl, benzothiophene, quinazolinyl, benzothiazolyl, carbazole, etc. The polycyclic heteroaryl groups also include monocyclic heteroaryl groups fused with one or more aryl groups, wherein the connecting point is on the aromatic ring, and in this case, the number of ring atoms continues to represent the number of ring atoms in the polycyclic heteroaryl ring system. The polycyclic heteroaryl groups also include monocyclic heteroaryl groups fused with one or more cycloalkyl or heterocyclic groups, wherein the connecting point is on the monocyclic heteroaryl ring, and in this case, the number of ring atoms continues to represent the number of ring atoms in the polycyclic heteroaryl ring system. Non-limiting examples include:
[0433] wait.
[0434] The heteroaryl group can be substituted or unsubstituted. When substituted, it can be substituted at any usable connection point. In some embodiments, the substituent is selected from one or more of the following: D atom, halogen, alkyl, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxyl, alkylthio, haloalkylthio, cycloalkylthio, heterocyclic thio, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0435] "Bicyclic aryl" refers to the fusion of two monocyclic rings, one of which is phenyl, and the other is selected from cycloalkyl, heterocyclic, and phenyl groups, with the linking site on the phenyl group. Non-limiting examples include:
[0436] "Bicyclic heteroaryl" refers to the fusion of two monocyclic rings, one of which is a heteroaryl group, and the other monocyclic ring is selected from cycloalkyl, heterocyclic, phenyl, and heteroaryl groups, with the linking site located on the phenyl or heteroaryl group. Non-limiting examples include:
[0437] The aforementioned cycloalkyl, heterocyclic, aryl, and heteroaryl groups include residues derived from removing one hydrogen atom from a parent ring atom, or residues derived from removing two hydrogen atoms from the same ring atom or two different ring atoms of the parent ring, i.e., "cycloalkylene", "heterocyclicene", "arylene", and "heteroarylene". Non-limiting examples include:
[0438] wait.
[0439] The term "cycloalkylalkyl" refers to an alkyl group that is substituted by one or more cycloalkyl groups, wherein the cycloalkyl and alkyl groups are as defined above.
[0440] The term "heterocyclic alkyl" refers to an alkyl group that is substituted by one or more heterocyclic groups, wherein the heterocyclic group and the alkyl group are as defined above.
[0441] The term "arylalkyl" refers to an alkyl group that is substituted with one or more aryl groups, wherein the aryl and alkyl groups are as defined above.
[0442] The term "heteroarylalkyl" refers to an alkyl group that is substituted by one or more heteroaryl groups, wherein the heteroaryl and alkyl groups are as defined above.
[0443] The term "cycloalkyloxy" refers to -O-cycloalkyl, where the cycloalkyl is as defined above.
[0444] The term "heterocyclic oxygen group" refers to an -O-heterocyclic group, wherein the heterocyclic group is as defined above.
[0445] The term "aryloxy group" refers to -O-aryl, where the aryl group is as defined above.
[0446] The term "heteroaryloxy" refers to -O-heteroaryl, where the heteroaryl is as defined above.
[0447] The term "aminoalkyl" refers to an alkyl group that is substituted with one or more amino groups, wherein the alkyl group is as defined above.
[0448] The term "alkoxyalkyl" refers to an alkyl group that is substituted with one or more alkoxy groups, wherein the alkoxy groups and alkyl groups are as defined above.
[0449] The term "halogenated alkyl" refers to an alkyl group that has been substituted with one or more halogens, wherein the alkyl group is as defined above.
[0450] The term "haloalkoxy" refers to an alkoxy group that is substituted by one or more halogens, wherein the alkoxy group is as defined above.
[0451] The term "hydroxyalkyl" refers to an alkyl group that is replaced by one or more hydroxyl groups, wherein the alkyl group is as defined above.
[0452] The term "halogen" refers to fluorine, chlorine, bromine, or iodine.
[0453] The term "hydroxyl group" refers to -OH.
[0454] The term "thiol" refers to -SH.
[0455] The term "amino" refers to -NH2.
[0456] The term "cyano" refers to -CN.
[0457] The term "nitro" refers to -NO2.
[0458] The term "oxo" or "oxo group" refers to "=O".
[0459] The term "carbonyl" refers to C=O.
[0460] The term "alkylthio" refers to -S-alkyl, where the alkyl group is as defined above.
[0461] The term "haloalkylthio" refers to an alkylthio group that is replaced by one or more halogens, wherein the alkylthio group is as defined above.
[0462] The term "cycloalkylthio" refers to -S-cycloalkyl, where the cycloalkyl group is as defined above.
[0463] The term "heterocyclic thio" refers to a -S-heterocyclic group, where the heterocyclic group is as defined above.
[0464] “TBS” refers to tert-butyldimethylsilyl substituent.
[0465] “Boc” refers to the tert-butyloxycarbonyl substituent.
[0466] “SEM” refers to (trimethylsilyl)ethoxymethyl substituent.
[0467] A "leaving group," or simply a group, is an atom or functional group that breaks off from a larger molecule in a chemical reaction. It's a term used in nucleophilic substitution and elimination reactions. In a nucleophilic substitution reaction, the reactant attacked by the nucleophile is called the substrate, and the atom or group of atoms that breaks off with a pair of electrons from the substrate molecule is called the leaving group. Groups that readily accept electrons and have a strong ability to accept negative charges are desirable leaving groups. The smaller the pKa of the conjugate acid of the leaving group, the easier it is for the leaving group to break off from other molecules. This is because a smaller pKa means the leaving group doesn't need to bond with other atoms and has a stronger tendency to exist as an anion (or an electrically neutral leaving group). Common leaving groups include, but are not limited to, halogens, -OTs, or -OH.
[0468] The compounds disclosed herein can exist in specific stereoisomer forms. The term "stereoisomer" refers to isomers with the same structure but different spatial arrangements of atoms. These include cis and trans (or Z and E) isomers, (-)- and (+)- isomers, (R)- and (S)- enantiomers, diastereomers, (D)- and (L)- isomers, tautomers, blocked isomers, conformational isomers, and mixtures thereof (such as racemic mixtures and mixtures of diastereomers). Substituents in the compounds disclosed herein may contain additional asymmetric atoms. All such stereoisomers and mixtures thereof are included within the scope of this disclosure. Optically active (-)- and (+)- isomers, (R)- and (S)- enantiomers, and (D)- and (L)- isomers can be prepared by chiral synthesis, chiral reagents, or other conventional techniques. This disclosure discloses an isomer of a compound, which can be prepared by asymmetric synthesis or with chiral auxiliaries, or, when the molecule contains a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group), by forming a salt of the diastereomer with a suitable optically active acid or base, followed by diastereomer resolution using conventional methods known in the art to obtain the pure isomer. Furthermore, the separation of enantiomers and diastereomers is typically performed by chromatography.
[0469] In the chemical structure of the compounds described in this disclosure, the bonds... This indicates that the configuration is not specified; that is, if chiral isomers exist in the chemical structure, the bond... It can be Or simultaneously include Two configurations. For all carbon-carbon double bonds, even if only one configuration is named, both the Z-type and E-type are included.
[0470] The compounds disclosed herein may exist in various tautomer forms, and all such forms are included within the scope of this disclosure. The terms "tautomer" or "tautomer form" refer to a structural isomer that exists in equilibrium and readily transforms from one isomer to another. This includes all possible tautomers, i.e., existing as a single isomer or as a mixture of said tautomers in any proportion. Non-limiting examples include: keto-enols, imine-enamines, lactam-lactamimides, etc. Examples of lactam-lactamimide equilibrium are shown below:
[0471] When referring to the pyrazolyl group, it should be understood to include any one or a mixture of two tautomers of the following two structures:
[0472] All tautomers are within the scope of this disclosure, and the naming of compounds does not exclude any tautomers.
[0473] The compounds disclosed herein may comprise transisomers. The term "transisomer" refers to a conformational stereoisomer resulting from restricted or significantly slowed rotation around a single bond in a molecule (as a result of steric interactions with other parts of the molecule and asymmetric substituents at the ends of the single bond), whose interconversion is slow enough to allow separation and isolation under predetermined conditions. For example, some compounds of this disclosure may exist as mixtures of transisomers (e.g., equal-proportion mixtures, mixtures enriched with one transisomer, etc.) or as a purified transisomer.
[0474] The compounds disclosed herein include all suitable isotopic derivatives thereof. The term "isotopic derivative" refers to a compound in which at least one atom is replaced by an atom having the same atomic number but a different atomic mass. Examples of isotopes that may be introduced into the compounds of this disclosure include stable and radioactive isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, chlorine, bromine, and iodine, for example, […]. 2 H (deuterium, D) 3 H (tritium, T) 11 C 13 C 14 C 15 N、 17 O、 18 O、 32 p、 33 p、 33 S, 34 S, 35 S, 36 S, 18 F, 36 Cl、 82 Br、 123 I,124 I, 125 I, 129 I and 131 In some implementations, I is deuterium.
[0475] Compared to undeuterated drugs, deuterated drugs offer advantages such as reduced toxicity, increased drug stability, enhanced efficacy, and prolonged biological half-life. All isotopic variations of the compounds disclosed herein, regardless of radioactivity, are included within the scope of this disclosure. Each available hydrogen atom bonded to a carbon atom can be independently replaced by a deuterium atom, wherein the deuterium substitution can be partial or complete; partial deuterium substitution refers to the replacement of at least one hydrogen atom with at least one deuterium atom.
[0476] When a site is specifically designated as deuterium D, the site should be understood as having a deuterium abundance of at least 1,000 times greater than the natural abundance of deuterium (which is 0.015%) (i.e., at least 15% deuterium incorporation). The compounds in the examples having a natural abundance greater than deuterium can be at least 1000 times abundant deuterium (i.e., at least 15% deuterium doping), at least 2000 times abundant deuterium (i.e., at least 30% deuterium doping), at least 3000 times abundant deuterium (i.e., at least 45% deuterium doping), at least 3340 times abundant deuterium (i.e., at least 50.1% deuterium doping), at least 3500 times abundant deuterium (i.e., at least 52.5% deuterium doping), at least 4000 times abundant deuterium (i.e., at least 60% deuterium doping), or at least 4500 times abundant deuterium (i.e., at least 67.5% deuterium doping). The abundance of deuterium is at least 5000 times (i.e., at least 75% deuterium doping), at least 5500 times (i.e., at least 82.5% deuterium doping), at least 6000 times (i.e., at least 90% deuterium doping), at least 6333.3 times (i.e., at least 95% deuterium doping), at least 6466.7 times (i.e., at least 97% deuterium doping), at least 6600 times (i.e., at least 99% deuterium doping), at least 6633.3 times (i.e., at least 99.5% deuterium doping), or higher.
[0477] "Optional" or "optional" means that the event or situation described below may but is not necessarily to occur; it includes both the possibility that the event or situation may occur or not occur. For example, "C that is optionally substituted with a halogen or cyano group..." 1-6 "Alkyl" includes cases where the alkyl group is substituted with a halogen or cyano group and cases where the alkyl group is not substituted with a halogen or cyano group.
[0478] "Substitution" or "substituted" refers to one or more hydrogen atoms in a group, in some embodiments 1 to 6, and in some embodiments 1 to 3 hydrogen atoms, which are independently substituted by the corresponding number of substituents. Those skilled in the art can determine possible or impossible substitutions without much effort (through experimentation or theory). For example, an amino or hydroxyl group with free hydrogen may be unstable when combined with a carbon atom having an unsaturated bond (such as an alkene).
[0479] "Pharmaceutical composition" means a mixture containing one or more of the compounds described herein or their pharmaceutically acceptable salts, along with other chemical components, such as pharmaceutically acceptable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration to a living organism, thereby promoting the absorption of the active ingredient and its biological activity.
[0480] "Pharmacologically acceptable salt" refers to the salt of the compounds disclosed herein, which may be selected from inorganic or organic salts. Such salts are safe and effective when used in mammals and possess the expected biological activity. They can be prepared separately during the final isolation and purification of the compound, or by reacting a suitable group with a suitable base or acid. Bases commonly used to form pharmaceutically acceptable salts include inorganic bases, such as sodium hydroxide and potassium hydroxide, and organic bases, such as ammonia. Acids commonly used to form pharmaceutically acceptable salts include both inorganic and organic acids.
[0481] For the purposes of pharmaceuticals or pharmacologically active agents, the term "therapeutic effective amount" refers to the amount of a drug or agent sufficient to achieve or at least partially achieve the intended effect. The determination of the therapeutic effective amount varies from person to person, depending on the recipient's age and general condition, as well as the specific active substance. The appropriate therapeutic effective amount in a given case can be determined by a person skilled in the art based on routine testing.
[0482] As used herein, the term "pharmaceutically acceptable" means that these compounds, materials, compositions, and / or dosage forms are suitable for contact with patient tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, within reasonable medical judgment, have a reasonable benefit / risk ratio, and are effective for their intended use.
[0483] As used herein, the singular forms of “a,” “an,” and “the” include plural references, and vice versa, unless the context clearly indicates otherwise.
[0484] When the term "about" is applied to parameters such as pH, concentration, temperature, etc., it indicates that the parameter can vary by ±10%, and in some embodiments within ±5%. As those skilled in the art will understand, when a parameter is not critical, figures are typically given for illustrative purposes only and not as limitations. Detailed Implementation
[0485] The following embodiments are used to further describe this disclosure, but these embodiments are not intended to limit the scope of this disclosure.
[0486] Example
[0487] The structure of the compound was determined by nuclear magnetic resonance (NMR) and / or mass spectrometry (MS). NMR shifts (δ) were expressed in 10⁻¹⁰. -6 The unit (ppm) is given. NMR determination was performed using a Bruker AVANCE-400 NMR spectrometer or a Bruker AVANCE NEO 500M. The solvents used were deuterated dimethyl sulfoxide (DMSO-d6), deuterated chloroform (CDCl3), and deuterated methanol (CD3OD). The internal standard was tetramethylsilane (TMS).
[0488] MS measurements were performed using an Agilent 1200 / 1290 DAD-6110 / 6120 Quadrupole MS liquid chromatography-mass spectrometry system (manufacturer: Agilent, MS model: 6110 / 6120 Quadrupole MS).
[0489] waters ACQuity UPLC-QD / SQD (Manufacturer: waters, MS model: waters ACQuity Qda Detector / waters SQ Detector)
[0490] THERMO Ultimate 3000-Q Exactive (Manufacturer: THERMO, MS Model: THERMO Q Exactive)
[0491] High-performance liquid chromatography (HPLC) analysis was performed using an Agilent HPLC 1200DAD, an Agilent HPLC 1200VWD, and a Waters HPLC e2695-2489 HPLC system.
[0492] Chiral HPLC analysis was performed using an Agilent 1260DAD high-performance liquid chromatograph.
[0493] High performance liquid chromatography (HPLC) was performed using Waters 2545-2767, Waters 2767-SQ Detecor2, Shimadzu LC-20AP, and Gilson GX-281 preparative chromatographs.
[0494] Chiral preparation was performed using a Shimadzu LC-20AP preparative chromatograph.
[0495] The CombiFlash rapid preparation system uses a CombiFlash Rf200 (TELEDYNE ISCO).
[0496] Thin-layer chromatography silica gel plates are Yantai Huanghai HSGF254 or Qingdao GF254. The silica gel plates used in thin-layer chromatography (TLC) have a diameter of 0.15 mm to 0.2 mm, and the diameter of the silica gel plates used for thin-layer chromatography separation and purification products is 0.4 mm to 0.5 mm.
[0497] Silica gel column chromatography generally uses Yantai Huanghai silica gel with a mesh size of 200-300 as the carrier.
[0498] Mean inhibition rate of kinases and IC 50 The values were determined using a NovoStar microplate reader (BMG GmbH, Germany).
[0499] The known starting materials disclosed herein can be synthesized using or in accordance with methods known in the art, or can be purchased from companies such as ABCR GmbH & Co. KG, Acros Organics, Aldrich Chemical Company, Accela ChemBio Inc, and Darui Chemicals.
[0500] Unless otherwise specified in the examples, all reactions can be carried out under an argon or nitrogen atmosphere.
[0501] Argon or nitrogen atmosphere refers to a reaction flask connected to an argon or nitrogen gas balloon with a volume of approximately 1L.
[0502] A hydrogen atmosphere refers to a reaction flask connected to a hydrogen balloon with a volume of approximately 1L.
[0503] The pressurized hydrogenation reaction was performed using a Parr 3916EKX hydrogenator and a Qinglan QL-500 hydrogen generator or an HC2-SS hydrogenator.
[0504] The hydrogenation reaction is usually carried out under vacuum, filled with hydrogen gas, and repeated 3 times.
[0505] The microwave reaction was performed using a CEM Discover-S 908860 microwave reactor.
[0506] Unless otherwise specified in the examples, "solution" refers to an aqueous solution.
[0507] Unless otherwise specified in the examples, the reaction temperature is room temperature.
[0508] The reaction process in the examples was monitored using thin-layer chromatography (TLC). The developing solvent used in the reaction, the eluent system for column chromatography used to purify the compounds, and the developing solvent system for TLC included: A: dichloromethane / methanol system, B: n-hexane / ethyl acetate system. The volume ratio of the solvent was adjusted according to the polarity of the compounds, and small amounts of basic or acidic reagents such as triethylamine and acetic acid could also be added for adjustment.
[0509] Example 1
[0510] 2-((6-((5-(4-((1r,3r)-3-(4-(2-(2,6-dioxopiperidin-3-yl)-4-fluoro-1-oxoisoindoline-5-yl)piperidin-1-yl)cyclobutoxy)piperidin-1-yl)pyrazolo[1,5-a]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide1
[0511] first step
[0512] 2-((6-((5-chloropyrazolo[1,5-a]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 1c
[0513] 2-((6-amino-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 1a (70 mg, 0.24 mmol, prepared by the method disclosed in step 5 on page 178 of patent application WO2022221673A1) was dissolved in ethanol (5 mL), and 5,7-dichloropyrazolo[1,5-a]pyrimidine 1b (46 mg, 0.24 mmol, Bioderm) and N,N-diisopropylethylamine (63 mg, 0.49 mmol, Sinopharm) were added. The mixture was reacted at 80 °C for 10 hours. After cooling to room temperature, the solid was filtered off, washed with ethanol (5 mL), and dried to give the title compound 1c (52 mg, yield: 48.7%).
[0514] MS m / z(ESI):441.4[M+1].
[0515] Step 2
[0516] 2-((6-((5-(4-((1r,3r)-3-(4-(2-(2,6-dioxopiperidin-3-yl)-4-fluoro-1-oxoisoindoline-5-yl)piperidin-1-yl)cyclobutoxy)piperidin-1-yl)pyrazolo[1,5-a]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide1
[0517] Compound 1c (52 mg, 0.12 mmol) was dissolved in N-methylpyrrolidone (3 mL), and 3-(4-fluoro-1-oxo-5-(1-((1r,3r)-3-(piperidin-4-yloxy)cyclobutyl)piperidin-4-yl)isoindoline-2-yl)piperidin-2,6-dione 1d (59 mg, 0.12 mmol, prepared by the method disclosed in step 4 on page 220 of patent application WO2022221673A1), N,N-diisopropylethylamine (76 mg, 0.59 mmol, from Sinopharm), were added. The mixture was reacted in a microwave at 130 °C for 1 hour. After cooling to room temperature, the mixture was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give title compound 1 (5 mg, yield: 4.7%).
[0518] MS m / z(ESI): 904.1 [M+1].
[0519] 1 H NMR(500MHz,DMSO)δ11.02(s,1H),9.62(s,1H),9.44(s,1H),7.97–7.92(m,2H),7.79(d,1H),7.68(d,1H),7.62(d,1H),7.52 (dd,1H),7.50–7.45(m,1H),7.26(s,1H),6.05(s,1H),5.13(dd,1H),4.59–4.55(m,3H),4.40(d,1H),4.29–4.26(m,1H),3.95 –3.91(m,2H),3.87–3.82(m,1H),3.65–3.57(m,3H),3.26–3.13(m,3H),3.03–2.90(m,3H),2.69(d,3H),2.64–2.54(m,2H),2. 45–2.40(m,2H),2.31–2.26(m,2H),2.09–1.97(m,5H),1.87–1.84(m,2H),1.60(d,6H),1.47–1.41(m,2H),1.31–1.26(m,1H).
[0520] Example 2
[0521] 2-((6-((3-cyano-5-(4-((1r,3r)-3-(4-(2-(2,6-dioxopiperidin-3-yl)-4-fluoro-1-oxoisoindoline-5-yl)piperidin-1-yl)cyclobutoxy)piperidin-1-yl)pyrazolo[1,5-a]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide2
[0522] Following the synthetic route of Example 1, compound 1b was replaced with 5,7-dichloropyrazolo[1,5-a]pyrimidine-3-carboxylonitrile (BYD) to obtain title compound 2 (48 mg, yield: 24.1%).
[0523] MS m / z(ESI): 929.8 [M+1].
[0524] 1 H NMR(500MHz,DMSO)δ11.02(s,1H),9.84(s,1H),9.45(s,1H),8.44(s,1H),7.95–7.92(m,1H),7.80(d,1H),7.68(d,1H),7.62 (d,1H),7.52–7.45(m,2H),7.25(s,1H),5.13(dd,1H),4.59–4.55(m,3H),4.40(d,1H),4.30–4.25(m,1H),4.00–3.97(m,2H), 3.85(q,1H),3.62–3.56(m,3H),3.27–3.22(m,3H),3.04–2.97(m,2H),2.95–2.90(m,1H),2.68(d,3H),2.65–2.57(m,2H),2. 47–2.40(m,2H),2.34–2.27(m,2H),2.07–1.94(m,5H),1.89–1.85(m,2H),1.59(d,6H),1.47–1.40(m,2H),1.32–1.27(m,1H).
[0525] Example 3
[0526] 2-((6-((3-chloro-5-(4-((1r,3r)-3-(4-(2-(2,6-dioxopiperidin-3-yl)-4-fluoro-1-oxoisoindoline-5-yl)piperidin-1-yl)cyclobutoxy)piperidin-1-yl)pyrazolo[1,5-a]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide3
[0527] Using the synthetic route of Example 1, starting compound 1b was replaced with starting compound 3,5,7-trichloropyrazolo[1,5-a]pyrimidine (Shaoyuan) to obtain title compound 3 (11.5 mg, yield: 4.3%).
[0528] MS m / z(ESI): 937.4 [M+1].
[0529] 1 H NMR (500MHz, DMSO-d6): δ11.02(s,1H),9.62(s,1H),9.58-9.47(m,1H),8.06(s,1H),8.00-7.98(m,1H),7.80-7.78(m,1H), 7.68-7.60(m,2H),7.53-7.46(m,2H),7.27-7.25(m,1H),5.83(s,1H),5.14-5.10(m,1H),4.59(s,3H),4.55-4.41(m,1H),4 .38-4.28(m,1H),4.00-3.97(m,2H),3.84-3.76(m,1H),3.59-3.53(m,4H),3.24-3.16(m,3H),3.02-2.88(m,3H),2.69-2.6 6(m,3H),2.56-2.50(m,2H),2.48-2.30(m,3H),2.08-1.97(m,5H),1.88-1.85(m,2H),1.61-1.58(m,6H),1.45-1.41(m,2H).
[0530] Example 4
[0531] 2-((6-((5-(4-((1r,3r)-3-(4-(2-(2,6-dioxopiperidin-3-yl)-4-fluoro-1-oxoisoindoline-5-yl)piperidin-1-yl)cyclobutoxy)piperidin-1-yl)thiazo[5,4-d]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide4
[0532] first step
[0533] 2-((6-((5-chlorothiazo[5,4-d]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 4b
[0534] Using the synthetic route in Example 1, the title compound 4b was prepared by replacing compound 1b in the first step with compound 5,7-dichlorothiazo[5,4-d]pyrimidine 4a (Shaoyuan) (110 mg, yield: 69.3%).
[0535] MS m / z(ESI):459.1[M+1].
[0536] Step 2
[0537] 2-((6-((5-(4-((1r,3r)-3-(4-(2-(2,6-dioxopiperidin-3-yl)-4-fluoro-1-oxoisoindoline-5-yl)piperidin-1-yl)cyclobutoxy)piperidin-1-yl)thiazo[5,4-d]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide4
[0538] Using the synthetic route in Example 1, the title compound 4 (50 mg, yield: 45.3%) was prepared by replacing compound 1c in the second step with compound 4b.
[0539] MS m / z(ESI): 921.5 [M+1].
[0540] 1 H NMR (500MHz, DMSO-d6): δ11.02(s,1H),10.01(s,1H),8.90(s,1H),8.27–8.22(m,1H),8.01–7.97(m,1H),7.86–7.80( m,1H),7.75–7.69(m,1H),7.66–7.60(m,1H),7.51–7.45(m,1H),7.04–6.98(m,1H),5.16–5.09(m,1H),4.61–4.54(m, 2H),4.42–4.24(m,4H),3.92–3.84(m,1H),3.65–3.60(m,1H),3.30–3.21(m,2H),3.07–2.88(m,4H),2.72–2.67(m,2H ),2.66–2.55(m,3H),2.43–2.30(m,3H),2.07–1.90(m,7H),1.61–1.56(m,6H),1.51–1.45(m,2H),1.32–1.20(m,5H).
[0541] Example 5
[0542] 2-((6-((5-(4-((1r,3r)-3-(4-(2-(2,6-dioxopiperidin-3-yl)-4-fluoro-1-oxoisoindoline-5-yl)piperidin-1-yl)cyclobutoxy)piperidin-1-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide5
[0543] first step
[0544] 2-((6-((5-chloro-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 5b
[0545] Using the synthetic route in Example 1, the first step compound 1b was replaced with compound 5,7-dichloro-[1,2,4]triazolo[1,5-a]pyrimidine 5a (Shaoyuan) to obtain the title compound 5b (140 mg, yield: 91.7%).
[0546] MS m / z(ESI):442.1[M+1].
[0547] Step 2
[0548] 2-((6-((5-(4-((1r,3r)-3-(4-(2-(2,6-dioxopiperidin-3-yl)-4-fluoro-1-oxoisoindoline-5-yl)piperidin-1-yl)cyclobutoxy)piperidin-1-yl)-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide5
[0549] Using the synthetic route in Example 1, the title compound 5 (18 mg, yield: 16.1%) was obtained by replacing compound 1c in the second step with compound 5b.
[0550] MS m / z(ESI): 904.6 [M+1].
[0551] 1H NMR (500MHz, DMSO-d6): δ11.02(s,1H),9.94(s,1H),9.63–9.54(m,1H),8.51(s,1H),8.00–7.96(m,1H),7.84–7.78(m,1H),7.69–7.6 5(m,1H),7.65–7.60(m,1H),7.53–7.44(m,2H),7.26(s,1H),5.91(s,1H),5.16–5.09(m,1H),4.60–4.53(m,3H),4.43–4.36(m,1H),4 .30–4.26(m,1H),4.01–3.95(m,2H),3.88–3.80(m,1H),3.30–3.22(m,2H),3.04–2.87(m,3H),2.71–2.66(m,3H),2.65–2.53(m,4H), 2.49–2.38(m,1H),2.33–2.25(m,2H),2.09–1.95(m,5H),1.89–1.84(m,2H),1.62–1.57(m,6H),1.47–1.40(m,2H),1.30–1.24(m,3H).
[0552] Example 6
[0553] 2-((6-((3-cyano-5-(4-((1r,3r)-3-(4-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H-indazol-6-yl)piperidin-1-yl)cyclobutoxy)piperidin-1-yl)pyrazolo[1,5-a]pyrimidin-7-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide6
[0554] first step
[0555] 2-((6-((5-chloro-3-cyanopyrazolo[1,5-a]pyrimidin-7-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 6c
[0556] 2-((6-amino-1-methyl-2-oxo-1,2-dihydroquinolin-3-yl)oxy)-N-methylacetamide 6a (120 mg, 0.46 mmol, prepared by the method disclosed in step 2 on page 388 of patent application WO2021077010A1) was dissolved in ethanol (5 mL), and 5,7-dichloropyrazolo[1,5-a]pyrimidin-3-carboxynitrile 6b (100 mg, 0.47 mmol, Bioderm) and N,N-diisopropylethylamine (120 mg, 0.93 mmol, Sinopharm) were added. The mixture was reacted at 80 °C for 10 min. After cooling to room temperature, the solid was filtered off, washed with ethanol (5 mL), and dried to give the title compound 6c (170 mg, yield: 84.5%).
[0557] MS m / z(ESI):438.3[M+1].
[0558] Step 2
[0559] 4-((1r,3r)-3-(4-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H-indazol-6-yl)piperidin-1-yl)cyclobutoxy)piperidin-1-carboxylic acid tert-butyl ester 6e
[0560] 3-(1-methyl-6-(piperidin-4-yl)-1H-indazol-3-yl)piperidin-2,6-dione 6d (75 mg, 0.14 mmol, prepared by the method disclosed in step 8 on page 200 of patent application WO2021127586A1) was dissolved in acetonitrile (5 mL), and N,N-diisopropylethylamine (60 mg, 0.46 mmol, Sinopharm) and 4-((1s,3s)-3-(((trifluoromethyl)sulfonyl)oxy)cyclobutoxy)piperidin-1-carboxylic acid tert-butyl ester (93 mg, 0.23 mmol, prepared by the method disclosed in step 5 on page 268 of patent application WO202396987 A1) were added. The mixture was reacted at 100 °C for 10 minutes. The mixture was cooled to room temperature and concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 6e (120 mg, yield: 90.1%).
[0561] MS m / z(ESI): 580.6 [M+1].
[0562] Step 3
[0563] 3-(1-Methyl-6-(1-((1r,3r)-3-(piperidin-4-yloxy)cyclobutyl)piperidin-4-yl)-1H-indazol-3-yl)piperidin-2,6-dione 6f
[0564] Compound 6e (120 mg, 0.21 mmol) was dissolved in trifluoroacetic acid (1 mL) and dichloromethane (3 mL) and reacted at room temperature for 1 hour. The mixture was concentrated under reduced pressure, and 5 mL of saturated sodium bicarbonate solution was added. The mixture was extracted with dichloromethane (5 mL × 3). The organic phases were combined, washed with 5 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 6f (95 mg, yield: 95.7%).
[0565] MS m / z(ESI): 480.2 [M+1].
[0566] Step 4
[0567] 2-((6-((3-cyano-5-(4-((1r,3r)-3-(4-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H-indazol-6-yl)piperidin-1-yl)cyclobutoxy)piperidin-1-yl)pyrazolo[1,5-a]pyrimidin-7-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide6
[0568] Compound 6f (95 mg, 0.20 mmol) was dissolved in dimethyl sulfoxide (3 mL), and compound 6c (87 mg, 0.12 mmol) and N,N-diisopropylethylamine (128 mg, 0.99 mmol, Sinopharm) were added. The mixture was reacted at 100 °C for 1 hour. After cooling to room temperature, the mixture was concentrated under reduced pressure and purified by column chromatography using eluent system A to give title compound 6 (5 mg, yield: 2.9%).
[0569] MS m / z(ESI): 881.7 [M+1].
[0570] 1H NMR(500MHz,DMSO)δ10.88(s,1H),9.83(s,1H),8.42(s,1H),8.37(s,1H),7.97(d,1H),7.68(d,1H),7.63–7.56(m, 2H),7.45(s,1H),7.32(s,1H),7.21(s,1H),7.04(d,1H),4.59(s,2H),4.33(dd,1H),4.18–4.14(m,1H),3.97–3.92( m,4H),3.72(s,3H),3.56–3.51(m,1H),3.24–3.20(m,3H),3.04–2.96(m,2H),2.82–2.79(m,1H),2.68–2.60(m,5H) ,2.39–2.31(m,2H),2.20–2.13(m,2H),2.03–1.97(m,5H),1.85–1.72(m,5H),1.49–1.37(m,2H),1.34–1.29(m,1H).
[0571] Example 7
[0572] 2-((6-((3-cyano-5-(4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,6H-spiro[furano[2,3-f]indazole-7,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrazolo[1,5-a]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide7
[0573] first step
[0574] 6-Bromo-3-iodo-5-methoxy-1H-indazole 7b
[0575] 6-Bromo-5-methoxy-1H-indazole 7a (200 mg, 0.88 mmol, BIDE) was dissolved in N,N-dimethylformamide (5 mL), and 1-iodopyrrolidine-2,5-dione (234 mg, 1.04 mmol, BIDE) was added. The mixture was reacted at room temperature for 2 hours. 10 mL of water was added, and the mixture was extracted with ethyl acetate (10 mL × 3). The organic phases were combined, washed with 10 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 7b (310 mg, yield: 99.7%).
[0576] MS m / z(ESI): 353.1 [M+1].
[0577] Step 2
[0578] 6-Bromo-3-iodo-5-methoxy-1-methyl-1H-indazole 7c
[0579] Compound 7b (4.5 g, 12.75 mmol) was dissolved in N,N-dimethylformamide (90 mL), and iodomethane (3.4 g, 24.23 mmol, Shaoyuan) and cesium carbonate (6.3 g, 19.34 mmol, Shaoyuan) were added. The mixture was reacted at room temperature for 3 hours. The solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 7c (4.3 g, yield: 91.9%).
[0580] MS m / z(ESI): 367.2 [M+1].
[0581] Step 3
[0582] 6-Bromo-3-iodo-1-methyl-1H-indazole-5-phenol 7d
[0583] Compound 7c (2.3 g, 6.27 mmol) was dissolved in dichloromethane (30 mL), and boron tribromide (16 g, 63.87 mmol, Sinopharm) was added at 0 °C. The reaction was carried out at 30 °C for 12 hours. After cooling to room temperature, the reaction was quenched with 5 mL of methanol and concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 7d (1.56 g, yield: 70.5%).
[0584] MS m / z(ESI): 353.1 [M+1].
[0585] Step 4
[0586] 4-(((6-bromo-3-iodo-1-methyl-1H-indazol-5-yl)oxy)methyl)-3,6-dihydropyridine-1(2H)-carboxylic acid tert-butyl ester 7e
[0587] Compound 7d (580 mg, 1.64 mmol) was dissolved in tetrahydrofuran (10 mL), and N-Boc-4-(hydroxymethyl)-1,2,3,6-tetrahydropyridine (421 mg, 1.97 mmol, BIDE), triphenylphosphine (1.3 g, 4.96 mmol, BIDE), and bis(4-chlorobenzyl)azodicarbonate (1.9 g, 5.17 mmol, BIDE) were added. The mixture was reacted at 36 °C for 12 h. After cooling to room temperature, the mixture was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give the title compound 7e (522 mg, yield: 57.9%).
[0588] MS m / z(ESI):492.3[M-55].
[0589] Step 5
[0590] 4-(((3-(2,6-bis(benzyloxy)pyridin-3-yl)-6-bromo-1-methyl-1H-indazol-5-yl)oxy)methyl)-3,6-dihydropyridine-1(2H)-carboxylic acid tert-butyl ester 7f
[0591] Compound 7e (100 mg, 0.18 mmol, Bio-Tech Pharmaceuticals) was dissolved in N,N-dimethylformamide (2.5 mL), and 20 mL of water was added. Then, 2,6-bisbenzyloxypyridine-3-boronate pinacol ester (80 mg, 0.19 mmol, Bio-Tech Pharmaceuticals), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (15 mg, 0.02 mmol, Bio-Tech Pharmaceuticals), and potassium carbonate (55 mg, 0.40 mmol, Bio-Tech Pharmaceuticals) were added. The reaction was carried out at 65 °C for 2.5 h under nitrogen protection. After cooling to room temperature, 20 mL of water was added. The mixture was extracted with ethyl acetate (50 mL × 3), the organic phases were combined, washed with 50 mL of saturated brine, dried over anhydrous sodium sulfate, filtered, concentrated, and the residue was purified by column chromatography using eluent system B to give the title compound 7f (62 mg, yield: 47.8%).
[0592] MS m / z(ESI): 711.5 [M+1].
[0593] Step 6
[0594] 7g of 3-(2,6-bis(benzyloxy)pyridin-3-yl)-1-methyl-2',3'-dihydro-1H,1'H,6H-spiro[furano[2,3-f]indazole-7,4'-pyridine]-1'-carboxylic acid tert-butyl ester
[0595] Compound 7f (30 mg, 0.04 mmol) was dissolved in N,N-dimethylformamide (0.8 mL), and sodium formate (5 mg, 0.07 mmol), sodium acetate (9 mg, 0.11 mmol), palladium acetate (1 mg, 0.004 mmol), and tetraethylammonium chloride (11 mg, 0.07 mmol) were added. The mixture was reacted at 75 °C for 12 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 7 g (15 mg, yield: 56.4%).
[0596] MS m / z(ESI): 631.8 [M+1].
[0597] Step 7
[0598] 3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,6Hspiro[furano[2,3-f]indazole-7,4'-piperidin]-1'-carboxylic acid tert-butyl ester 7h
[0599] 7 g (15 mg, 0.02 mmol) of the compound was dissolved in 3 mL of a mixed solvent of tetrahydrofuran and methanol (V / V = 1:2). Palladium on carbon (4 mg, 0.04 mmol, Bio-Tech Pharmaceuticals) and palladium hydroxide (6 mg, 0.04 mmol, Shaoyuan) were added. The system was reacted at 70 °C for 16 hours under a hydrogen atmosphere. After filtration and concentration, the title compound 7h (11 mg, yield: 24.2%) was obtained.
[0600] MS m / z(ESI): 455.6 [M+1].
[0601] Step 8
[0602] 3-(1-Methyl-1H,6H-spiro[furano[2,3-f]indazole-7,4'-piperidine]-3-yl)piperidine-2,6-dione 7i
[0603] Compound 7h (11 mg, 0.02 mmol) was dissolved in trifluoroacetic acid (2 mL) and reacted at room temperature for 1 hour. The solution was concentrated under reduced pressure, and 5 mL of saturated sodium bicarbonate solution was added. The mixture was extracted with ethyl acetate (5 mL × 3). The combined organic phases were washed with 5 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 7i (8 mg, yield: 94.1%). MS m / z (ESI): 355.1 [M+1].
[0604] Step 9
[0605] 2-((6-((3-cyano-5-(4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,6H-spiro[furano[2,3-f]indazole-7,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrazolo[1,5-a]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide7
[0606] Using steps one through four of the synthetic route in Example 6, the first step compound 6a was replaced with compound 1a, and the second step compound 6d was replaced with compound 7i, respectively, to obtain title compound 7 (50 mg, yield: 33.1%).
[0607] MS m / z(ESI): 937.8 [M+1].
[0608] 1H NMR (500MHz, DMSO) δ10.84(s,1H),9.82(s,1H),8.43(s,1H),7.94(d,1H),7.80(d,1H),7.67(d,1H),7. 54–7.48(m,2H),7.25(s,1H),6.90(s,1H),5.84(s,1H),4.55(s,2H),4.38(s,2H),4.25(dd,1H),4.20– 4.14(m,1H),3.94(s,5H),3.55(dd,1H),3.24(t,2H),2.88(d,2H),2.82(s,1H),2.68(d,3H),2.66–2.5 4(m,3H),2.31(ddt,1H),2.14(td,3H),2.04–1.91(m,4H),1.87–1.69(m,6H),1.59(d,6H),1.41(d,2H).
[0609] Example 8
[0610] 2-((6-((3-cyano-5-(4-((1r,3r)-3-(4-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H-indazol-6-yl)piperidin-1-yl)cyclobutoxy)piperidin-1-yl)pyrazolo[1,5-a]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 8
[0611] Using steps one through four of the synthetic route in Example 6, the first step compound 6a was replaced with 1a to obtain title compound 8 (50 mg, yield: 30%).
[0612] MS m / z(ESI): 909.7 [M+1].
[0613] 1H NMR(500MHz,DMSO)δ10.88(s,1H),9.82(s,1H),8.43(s,1H),7.94(q,1H),7.80(d,1H),7.67(d,1H),7.60(d, 1H),7.51(dd,1H),7.45(s,1H),7.25(s,1H),7.07–7.01(m,1H),5.84(s,1H),4.55(s,2H),4.33(dd,1H),4.1 6(td,1H),3.97(s,5H),3.55(tt,1H),3.23(td,2H),3.04–2.98(m,2H),2.85-2.77(m,1H),2.73–2.55(m,7H) ,2.40–2.30(m,1H),2.22–2.12(m,3H),2.03-1.96(m,2H),1.87–1.69(m,8H),1.59(d,6H),1.46–1.36(m,2H).
[0614] Example 9
[0615] 2-((6-((3-cyano-5-(4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrazolo[1,5-a]pyrimidin-7-yl)amino)-1-
[0616] Isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 9
[0617] first step
[0618] 6-Bromo-7-methoxy-1H-indazole 9b
[0619] 4-Bromo-2-fluoro-3-methoxybenzaldehyde 9a (9 g, 38.62 mmol, Bioderm) was dissolved in ethylene glycol dimethyl ether (100 mL), and hydrazine hydrate (16 g, 271.67 mmol, 85%, Sinopharm) was added. The reaction mixture was reacted at 100 °C for 48 hours. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 9b (950 mg, yield: 10.8%).
[0620] MS m / z(ESI):229.1[M+1].
[0621] Step 2
[0622] 6-Bromo-3-iodo-7-methoxy-1H-indazole 9c
[0623] Compound 9b (1.1 g, 4.84 mmol) was dissolved in N,N-dimethylformamide (15 mL), and N-iodosuccinimide (1.42 g, 6.30 mmol, Adamas) was added. The reaction mixture was reacted at room temperature for 3 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 9c (1.41 g, yield: 82.4%).
[0624] MS m / z(ESI):355.0[M+1].
[0625] Step 3
[0626] 6-Bromo-3-iodo-7-methoxy-1-methyl-1H-indazole 9d
[0627] Compound 9c (1.41 g, 4.0 mmol) was dissolved in N,N-dimethylformamide (15 mL), and potassium carbonate (1.10 g, 8.0 mmol, Sinopharm) and methyl iodide (1.13 g, 8.0 mmol, Adamas) were added. The reaction mixture was reacted at room temperature for 3 hours. The reaction solution was filtered, the filtrate was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 9d (900 mg, yield: 61.3%).
[0628] MS m / z(ESI): 369.1 [M+1].
[0629] Step 4
[0630] 6-Bromo-3-iodo-1-methyl-1H-indazole-7-phenol 9e
[0631] Compound 9d (900 mg, 2.45 mmol) was dissolved in N,N-dimethylformamide (10 mL), and sodium ethanethiol (2.06 g, 24.52 mmol, Adamas) was added. The reaction mixture was reacted at 80 °C for 30 min. The reaction solution was cooled to room temperature, 50 mL of water was added, and the mixture was extracted with ethyl acetate (50 mL × 3). The aqueous phases were combined, the pH was adjusted to 6-7 with 1 M hydrochloric acid, and the mixture was extracted with ethyl acetate (50 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 9e (800 mg, yield: 92.4%).
[0632] MS m / z(ESI):355.0[M+1].
[0633] Step 5
[0634] 2-((6-((3-cyano-5-(4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrazolo[1,5-a]pyrimidin-7-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide9
[0635] Using steps four through nine of the synthetic route in Example 7, the compound 7d in step four was replaced with compound 9e to obtain title compound 9 (30 mg, yield: 15.9%).
[0636] MS m / z(ESI): 937.7 [M+1].
[0637] 1 H NMR(500MHz,DMSO)δ10.89(s,1H),9.82(s,1H),8.43(s,1H),7.94(d,1H),7.80(d,1H),7.67(d,1H),7. 51(dd,1H),7.32–7.17(m,2H),6.99(d,1H),5.84(s,1H),4.56(d,4H),4.32(dd,1H),4.19–4.15(m,1H), 4.07(s,3H),3.98–3.95(m,2H),3.57–3.52(m,1H),3.27–3.21(m,3H),2.93–2.77(m,3H),2.68(d,3H), 2.61–2.53(m,2H),2.41–2.27(m,1H),2.19–2.14(m,3H),2.02–1.66(m,10H),1.59(d,6H),1.41(d,2H).
[0638] Biological evaluation
[0639] The following test examples further describe and explain this disclosure, but these test examples are not intended to limit the scope of this disclosure.
[0640] Test Example 1: Degradation activity of the disclosed compound against BCL6 in OCI-LY1 human B-cell lymphoma.
[0641] OCI-LY1 cells (Nanjing Kebai Biotechnology, catalog number: CBP60557) were centrifuged (300g / min, 3min), the supernatant was discarded, and the cell pellet was resuspended in fresh culture medium and counted. A cell suspension with a cell density of 5E5 / ml was prepared and mixed well. 50μL of the suspension was added to each well of a 96-well round-bottom plate, along with 187.5μL of fresh culture medium. The plates were incubated at 37°C. The compound was prepared into a 20mM stock solution using DMSO, and then diluted in the 96-well round-bottom plate to an initial concentration of 2.5μM. This was followed by 4-fold dilutions with DMSO, resulting in 9 concentration points. The DMSO blank wells served as a blank control. The obtained DMSO compound solution was then diluted 50-fold: 3μL of the DMSO compound solution was added to 147μL of fresh culture medium and the plates were shaken for 10min to mix. DMSO was added to each well at a concentration of 12.5 μL, with duplicates, and incubated at 37°C for 24 hours. After 24 hours, cells were lysed: the cell plates were removed from the 37°C incubator and centrifuged at 400 g / min for 5 min. 200 μL of supernatant was discarded from each well, and 12.5 μL of 5X lysis buffer was added to each well of the remaining cells. The cells were shaken for 5 min and then sonicated for 5 min to fully lyse the cells. The lysed cell plates were centrifuged at 800 g / min for 5 min, and the supernatant was transferred to new 96-well round-bottom plates. BCL6 protein levels were measured using the MSD method.
[0642] MSD 96-well plates (Meso Scale Discovery, catalog number: L15XA-3) were coated one day in advance with PBS buffer containing 1 μg / mL BCL6 goat-derived antibody (R&D Systems, catalog number: AF5046) and incubated overnight at 4°C. Before testing, the coating solution was discarded, and 150 μL of 5% BSA phosphate buffer was added to each well for blocking for 1 hour. The plates were washed three times with PBS + 0.05% Tween 20 wash buffer. 25 μL of lysed cell sample or BCL6 standard curve solution was added to each well, and the plates were incubated with shaking at 500 rpm for 1.5 hours. The samples were discarded, and the plates were washed three times. 25 μL of primary antibody solution containing 1 μg / mL rabbit BCL6 antibody (GeneTex, #GTX638196) was added, and the plates were incubated with shaking at 500 rpm for 1 hour. The primary antibody was discarded, and the plates were washed three times. Add 25 μL of a solution containing 1 μg / mL SULFO-TAG-labeled anti-rabbit secondary antibody (Meso Scale Discovery, #R32AB-1), and incubate at 500 rpm in the dark for 1 hour. Discard the secondary antibody, wash the plate 3 times, add 150 μL of 1X MSD detection buffer to each well, and read the signal value using a MESO SECTOR S600.
[0643] The BCL6 content in the samples was calculated based on the BCL6 standard curve. DMSO-treated wells were used as positive control wells, and blank cell lysate wells were used as negative control wells. Degradation rate % = (BCL6 content) 阳性对照孔 -BCL6 content 待测化合物孔 BCL6 content 阳性对照孔 -BCL6 content 阴性对照孔 ×100%. Using Graphpad software, inhibition curves were plotted based on the compound's concentration points and corresponding degradation rates, and the compound concentration (DC) at which the inhibition rate was 50% was calculated. 50 The value, Dmax%, represents the maximum degradation rate of each compound.
[0644] Table 1. Degradation activity of the disclosed compounds against BCL6 in OCI-LY1 human B-cell lymphoma.
[0645] Conclusion: The compound disclosed herein exhibits good degradation activity against intracellular BCL6.
[0646] Test Example 2: Degradation activity of the disclosed compound on BCL6 in SU-DHL-4HiBiT cells.
[0647] The degradation rate of BCL6 in SU-DHL-4HiBiT cells treated with the compound was detected by cryoluminescence, thereby evaluating the degradation activity of the compound on intracellular BCL6.
[0648] SU-DHL-4BCL6-HiBiT cells were constructed using Genewiz: The HiBiT tag sequence was knocked into the BCL6 (gene ID: 604) gene sequence of SU-DHL-4 cells (ATCC, #CRL-2957) at the insertion site before the TGA terminator. The inserted gene sequence was: GTGAGAGGCGGCTGGCGGCTGTTCAAGAAGATTAGC(HiBiTtag).
[0649] SU-DHL-4BCL6-HiBiT cells were suspended in RPMI 1640 medium containing FBS to a cell suspension with a density of 2.8E5 / mL and mixed well. 36 μL of the suspension was added to each well of a 384 cell culture plate, for a total cell count of 10,000. The plates were incubated at 37°C. A 20 mM stock solution of the compound was prepared using DMSO and then diluted with DMSO in 96-well round-bottom plates to an initial concentration of 64 μM. This was followed by 4-fold dilutions with DMSO, resulting in 9 concentration points. The resulting DMSO solution was then diluted 40-fold to obtain a 10× compound solution: 4 μL of the DMSO compound solution was added to 156 μL of medium and mixed by pipetting 10 times. 4 μL of the 10× compound solution was added to each well of the cell culture plate, in duplicate (left and right replicates), with a final DMSO concentration of 0.25%. DMSO blank wells served as a blank control, and ARV-393 160 nM wells served as a positive control. After adding the compound solution, the cell culture plate was shaken at 420 rpm for 10 minutes on a shaker to mix thoroughly. The plate was then incubated at 37°C for 24 hours. Detection was performed using the Promega Nano-Glo HiBiT Lytic Detection System kit (catalog number: N3040). LgBiT protein was diluted 1:100, and Nano-Glo HiBiT Lytic substrate was diluted 1:50 to an appropriate volume of Nano-Glo HiBiT Lytic buffer to prepare the HiBiT Lytic reagent. The mixture was inverted and allowed to stand at room temperature. The cell culture plate was removed from the incubator and equilibrated to room temperature. 40 μL of HiBiT Lytic reagent (equal to the volume of cell culture medium) was added to each well. The plate was shaken at 500 rpm for 10 minutes, then allowed to stand for 10 minutes before luminescence signal values were read using Pherastar. DMSO-treated wells served as blank control wells (Max). Blank cell culture medium wells served as negative control wells, and ARV-393 160 nM-treated wells served as degradation positive control wells (Min). Degradation rate % = (signal value) 空白对照孔 -Signal value 待测化合 物孔 ) / (signal value) 空白对照孔 -Signal value 阴性对照孔 ×100%. Using Graphpad Prism software, curves were plotted based on the compound's concentration points and corresponding degradation rates, and the compound concentration (DC) at a degradation rate of 50% was calculated. 50 Value. Dmax% is the maximum degradation rate of each compound.
[0650] Conclusion: The compound disclosed herein exhibits good degradation activity against BCL6 in SU-DHL-4HiBiT cells.
[0651] Test Example 3: Inhibitory activity of the disclosed compound against the proliferation of OCI-LY1 human B-cell lymphoma.
[0652] OCI-LY1 cells (Nanjing Kebai Biotechnology, #CBP60557) were centrifuged (300g / min, 3min), the supernatant was discarded, and the cell pellet was resuspended in fresh culture medium and counted. A cell suspension with a cell density of 5E4 / mL was prepared and mixed well. 50 μL of the suspension was added to each well of a 96-well plate, along with 187.5 μL of fresh culture medium, for a total cell count of 2500. The plates were incubated at 37℃. The compound was prepared into a 20 mM stock solution using DMSO, and then diluted with DMSO in 96-well plates to an initial concentration of 10 μM (the final maximum concentration was 10 nM). This was followed by 3-fold dilutions with DMSO, resulting in a total of 9 concentration points.
[0653] The obtained DMSO solution was diluted 50-fold to obtain a 20× compound solution: 3 μL of DMSO compound solution was added to 147 μL of fresh culture medium and mixed by pipetting 15 times. The 20× compound solution was added to cell culture plates at 12.5 μL / well, in triplicate, with a final DMSO concentration of 0.1%. DMSO blank wells served as blank controls, and wells treated with the highest concentration of the positive reference compound served as positive controls. The plates were shaken at 350 rpm for 5 minutes to mix. The cell culture plates were incubated at 37°C for 5 days. On the fifth day, cell counts were performed on the DMSO-treated wells, and the dilution factor to 2500 cells per well was calculated. All cell wells were diluted to this factor and transferred to new 96-well black plates. Fresh culture medium was added to bring the total volume to 237.5 μL. The compound solution was prepared as described above and added to new black 96-well plates at the same concentration as on the first day, at 12.5 μL. The plates were incubated at 37°C for 4 days.
[0654] Cell viability was detected using the CellTiter-Glo kit (Promega, #G7573): After centrifuging the 96-well cell culture plate (300 g / min, 5 min), discard 150 μL of supernatant, add 100 μL of CTG reagent, vortex and mix for 5 min, then incubate in the dark for 10 min, and measure the bioluminescent fluorescence signal value using an EnVision microplate reader.
[0655] DMSO-treated wells served as blank control wells, and blank cell culture medium wells served as negative control wells. Inhibition rate % = (signal value) 空白对照孔 -Signal value 待测化合物孔 ) / (signal value) 空白对照孔 -Signal value 阴性对照孔The concentration of the compound was calculated as IC50 (100%). Using Graphpad Prism software, inhibition curves were plotted based on the concentration points of the compound and their corresponding inhibition rates. The concentration of the compound at which the inhibition rate was 50% was then calculated. 50 Value. The maximum inhibition rate for each compound is the Imax% value.
[0656] Conclusion: The compound disclosed herein exhibits good inhibitory activity against the proliferation of OCI-LY1 tumor cells.
[0657] Test Example 4: Pharmacokinetic Evaluation
[0658] I. SD Rat Experiment
[0659] 1. Abstract
[0660] Using SD rats as test animals, the plasma drug concentration of the disclosed compound at different time points after gavage (ig) administration to SD rats was determined by LC / MS / MS. The pharmacokinetic behavior of the disclosed compound in SD rats was investigated to evaluate its pharmacokinetic characteristics.
[0661] 2. Test Plan
[0662] 2.1 Test Drugs
[0663] This compound is disclosed.
[0664] 2.2 Experimental Animals
[0665] SD rats were provided by Viton Lever Laboratories. After fasting overnight, the drugs were administered via gavage.
[0666] 2.3 Drug Preparation
[0667] Weigh out a certain amount of the test compound, add 5% DMSO + 5% Tween 80 + 90% physiological saline, and prepare a colorless and clear solution of 0.2 mg / mL.
[0668] 2.4 Administration
[0669] The dosage is 2.0 mg / kg, and the administration volume is 10.0 mL / kg.
[0670] 3. Operation
[0671] Blood samples of 0.1 mL were collected from the orbital cavity before administration and at 0.25, 0.5, 1.0, 2.0, 4.0, 6.0, 8.0, 11.0, and 24.0 hours after administration. The samples were placed in EDTA-K2 anticoagulant tubes and centrifuged at 10,000 rpm for 1 minute (4°C). Plasma was separated within 1 hour and stored at -20°C for analysis. The entire process, from blood collection to centrifugation, was performed under ice bath conditions. Patients ate 2 hours after administration.
[0672] The levels of the target compound in the plasma of SD rats were determined after administration of different concentrations of the drug.
[0673] Conclusion: The compound disclosed herein has a high exposure level in SD rats and exhibits pharmacokinetic advantages.
[0674] II. C57 Mouse Experiment
[0675] 1. Abstract
[0676] Using C57 mice as test animals, the plasma drug concentrations of the disclosed compound at different time points after administration by gavage (ig) / intravenous injection (iv) in C57 mice were determined by LC / MS / MS. The pharmacokinetic behavior of the disclosed compound in C57 mice was investigated to evaluate its pharmacokinetic characteristics.
[0677] 2. Test Plan
[0678] 2.1 Test Drugs
[0679] This disclosed compound
[0680] 2.2 Experimental Animals
[0681] C57 mice were provided by Viton Lever Laboratories. The drugs were administered via gavage and intravenous injection, respectively.
[0682] 2.3 Drug Preparation
[0683] Weigh out a certain amount of the test compound, add 5% DMSO + 5% Tween 80 + 90% physiological saline, and prepare a 0.1 mg / mL colorless clear solution (gavage administration group) and a 0.1 mg / mL colorless clear solution (intravenous injection group).
[0684] 2.4 Administration
[0685] Gavage administration group: The dosage was 2.0 mg / kg, and the administration volume was 0.2 mL / 10 g.
[0686] Intravenous administration group: The dosage was 1.0 mg / kg, and the administration volume was 0.1 mL / 10 g.
[0687] 3. Operation
[0688] In the gavage administration group: 0.1 mL of blood was collected before administration and at 0.25, 0.5, 1.0, 2.0, 4.0, 6.0, 8.0, 11.0, and 24.0 hours after administration. The blood was placed in an EDTA-K2 anticoagulant tube, centrifuged at 10,000 rpm for 1 minute (4℃), and the plasma was separated within 1 hour and stored at -80℃ for analysis. The blood collection and centrifugation process was performed under ice bath conditions.
[0689] Intravenous injection group: Blood samples were collected before administration and 5 minutes after administration, and at 0.25, 0.5, 1.0, 2.0, 4.0, 8.0, 11.0 and 24 hours after administration. The treatment was the same as that of the gavage group.
[0690] The levels of the target compound in the plasma of C57 mice were determined after administration of different concentrations of the drug.
[0691] Conclusion: The compound disclosed herein exhibits high exposure levels in C57 mice and demonstrates pharmacokinetic advantages.
Claims
1. A compound of general formula (I) or a pharmaceutically acceptable salt thereof, in: E is R 1 Selected from hydrogen atom, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, -alkylene-NR 17 R 18 alkyl, cycloalkylalkyl, heterocyclic, aryl, and heteroaryl; each of the alkyl, alkylene, alkoxy, alkoxyalkyl, cycloalkyl, cycloalkylalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace; X 1 For N or CR 2a ; X 2 For N or CR 2b ; X 3 For N or CR 2c ; R 2a R 2b R 2c and R 3a The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, hydroxyl, -NR 17 R 18 ,-alkylene-NR 17 R 18 cycloalkyl and heterocyclic groups; R 3 -W 1 -(CR 4a R 4b ) t -W 2 Or -CH = CH-W 2 ; R 4a and R 4b They may be the same or different, and each is independently selected from hydrogen, halogen, alkyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, cyano, and hydroxyl; or R 4a and R 4b Together with the attached carbon atom, it forms a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R groups. 0 replace; t is 1, 2, 3, 4, or 5; W 1 Selected from NR Y O and S; R Y Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl; W 2 selected from -C(O)NR 4 R 5 、 -C(O)R 6 、 -C(O)OR 6 、 -S(O) v R 6 、 -P(O)-R 6 R 6 and -C(=NH)NH2; R 4 and R 5 The same or different, and each independently selected from hydrogen atoms, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, cycloalkyl, heterocyclic, aryl, and heteroaryl, wherein the alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl are each independently optionally selected by one or more R 0 Replace; or, R 4 and R 5 Together with the attached nitrogen atom, it forms an optional structure with one or more R atoms. 0 Substituted heterocyclic groups; R 6 The same or different, and each independently selected from hydrogen atoms, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl, wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl is independently optionally selected by one or more R 0 replace; Or, R 3 and R 3a Together with their respective attached atoms, they form cycloalkyl or heterocyclic groups, each of which is independently and optionally influenced by one or more R groups. 7 replace; Z is selected from O, S, (CR) 8a R 8b ) z and NR 9 ; R 8a and R 8b They may be the same or different, and each is independently selected from hydrogen, halogen, alkyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, cyano, and hydroxyl; or R 8a and R 8b Together with the attached carbon atom, it forms a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R groups. 0 replace; z is 1, 2, 3, 4 or 5; R T and R 9 They may be the same or different, and each is independently selected from hydrogen atom, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxyalkyl, hydroxyl, alkoxy, -alkylene-NR 17 R 18 cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl; wherein the alkyl, alkenyl, alkynyl, alkoxyalkyl, alkoxy, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl are each independently and optionally selected by one or more R 0 replace; Z 1 Z 2 and Z 3 One of them is a carbon atom bonded to NH, and the other two are the same or different, and each is independently N or CR. 10 ; Z 4 For CR 10a Or N; R 10 and R 10a The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, hydroxyl, -NR 17 R 18 ,-alkylene-NR 17 R 18 cycloalkyl and heterocyclic groups; Or, R T and R 10a Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 11 replace; Ring A is a bicyclic aryl or a bicyclic heteroaryl, wherein each of the bicyclic aryl and bicyclic heteroaryl groups is independently and optionally converted by one or more R groups. 12 replace; L is -(L) A ) n -; n is an integer from 0 to 20; Each L A They may be the same or different, and each is independently selected from O and S(O). v NR d C(O), C(O)NR d NR d C(O), C(O)O, OC(O), alkylene, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkylene, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally selected by one or more R L replace; R d Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl; Q is selected from * The terminal is connected to L; Y is selected from C(O), CR 13a R 13b O, S and NR 13c ; R 13a and R 13b They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, haloalkyl groups, and hydroxyalkyl groups; or, R 13a and R 13b Together with the adjacent carbon atom, they form cycloalkyl groups; R 13c and R 14 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl and cycloalkylalkyl; Q 1 For N or CR 15a ; Q 2 For N or CR 15b ; Q 3 For N or CR 15c ; Q 4 For N or CR 15d ; A 1 For N or CR A1 ; A 2 For N or CR A2 ; R 15a R 15b R 15c R 15d R A1 and R A2 The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, cyano, haloalkyl, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalkoxy, cycloalkyl, heterocyclic, aryl, heteroaryl, -OR 16 -NR 17 R 18 ,-alkylene-NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 and -S(O) v R 16 ; Or, R A1 and R 15a Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace; Or, R A1 and R 15b Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace; Or, R A1 and R 15c Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace; Or, R A1 and R 15d Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace; Each R q The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, -OR 16 -NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 -OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20 )NR 17 R 18 -S(O) v R 16 -S(O) v NR 17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 =O, =S, =CR 21 R 22 cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace; Or, R q and R 15a Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace; Or, R q and R 15b Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace; Or, R q and R 15c Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace; Or, R q and R 15d Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 15 replace; a1 and a2 are each independently 0, 1, 2, 3 or 4; k can be 0, 1, 2, 3, 4, 5, or 6; L c Selected from key, CR a R b O, S, NR c C(O), C(O)NR c and NR c C(O); R a and R b They may be the same or different, and each is independently selected from hydrogen, halogen, alkyl, haloalkyl, alkoxy, hydroxyalkyl, cyano and hydroxyl; R c Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl; It can be a double bond or a single bond; X is N or CR x ; R x Selected from hydrogen atom, halogen, hydroxyl, alkyl, hydroxyalkyl, haloalkyl and cyano; R 7 R 11 R 12 R 15 and R L Same or different, and each independently selected from halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, -OR 16 -NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 -OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20 )NR 17 R 18 -S(O) v R 16 -S(O) v NR 17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 =O, =S, =CR 21 R 22 cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace; Or, two Rs 7 Together with the attached atom, they form a cycloalkyl or heterocyclic group, or, two R groups... 11 Together with the attached atom, they form a cycloalkyl or heterocyclic group, or, two R groups... 12 Together with the attached atom, they form a cycloalkyl or heterocyclic group, or, two R groups... 15 Together with the attached atom, they form a cycloalkyl or heterocyclic group, or, two R groups... L Together with the attached atom, it forms a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R groups. 0 replace; R 16 R 17 and R 18 The same or different, and each independently selected from hydrogen atoms, alkyl, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein the alkyl, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl are each independently optionally selected by one or more R atoms. 0 Replace; or R 17 and R 18 Together with the connected nitrogen atom, they form an optional structure with one or more R atoms. 0 Substituted heterocyclic groups; R 19 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl groups, and cycloalkyl groups; R 20 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, alkoxy, hydroxyl and cycloalkyl; R 21 and R 22 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, haloalkyl groups, hydroxyalkyl groups, and cycloalkyl groups; or, R 21 and R 22 Together with the carbon atoms attached to it, they form cycloalkyl groups; R 0 They may be the same or different, and each is independently selected from halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, aminoalkyl, hydroxyl, cyano, nitro, amino, -NHalkyl, -N(alkyl)2, =O, =S, =CH2, =CHF, =CF2, -C(O)Oalkyl, -C(O)OH, -C(O)NH2, -C(O)NH(alkyl), -C(O)N(alkyl)2, -C(O)halogen, -C(O)alkyl, -S(alkyl), cycloalkyl, cycloalkylalkyl, cycloalkyloxy, heterocyclic, heterocyclic alkyl, heterocyclic oxy, aryl, arylalkyl, aryloxy, heteroaryl, heteroarylalkyl and heteroaryloxy; v can be 0, 1, or 2.
2. The compound of formula (I) according to claim 1, or a pharmaceutically acceptable salt thereof, wherein ring A is optionally surrounded by one or more R 12 Substituted 9- or 10-membered bicyclic heteroaryl groups; R 12 Selected from halogens, C 1-6 Alkyl, C 1- 6-alkoxy, C 1-6 Halogenated alkyl and cyano groups; preferably, ring A is selected from... The * end is connected to NH.
3. The compound of general formula (I) according to claim 1, or a pharmaceutically acceptable salt thereof, wherein it is the compound of general formula (II) or a pharmaceutically acceptable salt thereof. in: U is N or CR 12a ; G is N or CR 12b ; B is either C or N; D is either C or N; M, K, and R may be the same or different, and each is independently selected from O, S, and CR. 12c , N and NR 12d ; R 12a R 12b and R 12c The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, -OR 16 -NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 -OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20 )NR 17 R 18 -S(O) v R 16 -S(O) v NR 17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace; R 12d Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl; R 1 R 2a R 2b R 2c R 3 R 3a Q, L, R 0 R 16 -R 20 and v as defined in claim 1.
4. The compound of general formula (I) according to any one of claims 1 to 3, or a pharmaceutically acceptable salt thereof, wherein L is -(L A ) n -; n is 1, 2, 3, 4 or 5; each L A They may be the same or different, and each is independently selected from O, NH, C(O), C 1-6 Alkylene, C 2-6 Alkyne group, 3- to 8-membered cycloalkyl group, and 3- to 8-membered heterocyclic group; each of the 3- to 8-membered cycloalkyl group and the 3- to 8-membered heterocyclic group is independently optionally divided by one or more R groups. L Replace; R L They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkyl, hydroxyl, and =O; preferably, L is selected from...
5. The compound of general formula (I) according to claim 1, 3 or 4, or a pharmaceutically acceptable salt thereof, wherein the compound is of general formula (IV) or a pharmaceutically acceptable salt thereof. in: A 3 For N or CR A3 ; A 4 For N or CR A4 ; A 5 For N or CR A5 ; A 6 For N or CR A6 ; R A3 R A4 R A5 and R A6 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, hydroxyalkyl groups, haloalkyl groups, hydroxyl groups, cyano groups, alkoxy groups, alkoxyalkyl groups, cycloalkyl groups, and cycloalkylalkyl groups; a3, a4, a5, and a6 are each independently 0, 1, 2, 3, or 4; k1 and k2 are each independently 0, 1, 2, 3, 4, 5 or 6; L A1 Selected from bond, O, S(O) v NR d C(O), C(O)NR d NR d C(O), C(O)O, OC(O), alkylene, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkylene, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally selected by one or more R L replace; R L1 and R L2 The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, -OR 16 -NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 -OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20 )NR 17 R 18 -S(O) v R 16 -S(O) v NR 17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 =O, =S, =CR 21 R 22 cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace; Or, two Rs L1 Together with the attached atom, it forms a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R groups. 0 replace; Or, two Rs L2 Together with the attached atom, it forms a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R groups. 0 replace; R 1 R 2a R 2b R 2c R 3 R 3a G, D, M, K, R, Q, R d R L R 0 R 16 -R 22 and v as defined in claim 3.
6. The compound of general formula (I) according to any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof, wherein Q is selected from... T is selected from bonds, O, S, C(O), CR 15e R 15f NR 15g NR 15g C(O) and C(O)NR 15g ; R 15g Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl; R 15e and R 15f The same or different, and each independently selected from hydrogen, halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, cyano, amino, hydroxyl, nitro, cycloalkyl, and heterocyclic groups; or, R 15e and R 15f Together with the attached carbon atom, they form cycloalkyl groups; p and q are each independently 0, 1, 2 or 3; A 1 For N or R A1 ; A 2 For N or R A2 ; R A1 and R A2 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalkoxy, cyano, hydroxyl, amino, cycloalkyl and heterocyclic groups; Y, R 14 R 15a R 15b and R 15d As defined in claim 1; Preferably, Q is selected from *Terminal with L or A 3 Connected.
7. The compound of general formula (I) according to any one of claims 1 to 6, or a pharmaceutically acceptable salt thereof, wherein R 1 Selected from hydrogen atoms, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy C 1-6 Alkyl, 3- to 6-membered cycloalkyl and 3- to 6-membered cycloalkyl C 1-6 Alkyl; preferably, R 1 C 1-6 Alkyl; more preferably, R 1 It is methyl or isopropyl.
8. The compound of general formula (I) according to any one of claims 1 to 7, or a pharmaceutically acceptable salt thereof, wherein R 2a R 2b and R 2c They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl and C 1- 6-alkoxy; preferably, R 2a R 2b and R 2c All are hydrogen atoms.
9. The compound of formula (I) according to any one of claims 1 to 8, or a pharmaceutically acceptable salt thereof, wherein R 3a For hydrogen atoms; R 3 for R 4 and R 5 Whether the atoms are the same or different, and each is independently selected from hydrogen atoms, C atoms 1-6 Alkyl groups and 3- to 6-membered cycloalkyl groups; Or, R 3 and R 3a Together with their respective connected atoms, they form a 6- or 7-membered heterocyclic group, which is optionally bonded by one or more R atoms. 7 Replace; R 7 They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy and 3- to 6-membered cycloalkyl; Preferably, R 3a For hydrogen atoms; R 3 for 10. The compound of general formula (I) according to any one of claims 1 to 9, or a pharmaceutically acceptable salt thereof, wherein G is N or CH; And / or M is selected from N, S and CR 12c ;R 12c Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkyl and cyano groups; And / or K is CH; And / or R is N.
11. The compound of formula (I) according to any one of claims 5 to 10, or a pharmaceutically acceptable salt thereof, wherein A 3 A 4 A 5 and A 6 They are the same or different, and each is independently N or CH; And / or a3, a4, a5 and a6 are each independently 0 or 1; and / or R L1 and R L2 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 alkyl; And / or k1 and k2 are each independently 0 or 1; and / or L A1 It can be O or CH2; Preferably, A 3 For CH; A 4 For CH; A 5 For CH; A 6 N; a3 and a4 are 0; a5 and a6 are 1; R L1 and R L2 For hydrogen atoms; L A1 It is O.
12. The compound of general formula (I) according to any one of claims 1 to 11, or a pharmaceutically acceptable salt thereof, selected from the group consisting of:
13. A compound of general formula (IVB) or a salt thereof, in: R LP It is a leaving group; preferably, R LP Halogen; more preferably, R LP For Cl; R 1 R 2a R 2b R 2c R 3 R 3a G, D, M, K and R as defined in claim 5.
14. A compound or a salt thereof, selected from the following compounds:
15. A method for preparing a compound of formula (I) according to claim 5 or a pharmaceutically acceptable salt thereof, comprising: A compound of general formula (IVA) or a salt thereof undergoes a nucleophilic substitution reaction with a compound of general formula (IVB) or a salt thereof to give a compound of general formula (IV) or a pharmaceutically usable salt thereof; in: R W It is a hydrogen atom; A 6 Let N be the number of people in the group. R LP It is a leaving group; preferably, R LP For halogen, more preferably, R LP For Cl; R 1 R 2a R 2b R 2c R 3 R 3a G, D, M, K, R, Q, A 3 A 4 A 5 A 6 a3, a4, a5, a6, R L1 R L2 k1, k2 and L A1 As defined in claim 5.
16. A pharmaceutical composition comprising a compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 12, and one or more pharmaceutically acceptable carriers, diluents or excipients.
17. Use of the compound of any one of claims 1 to 12 or a pharmaceutically acceptable salt thereof or the pharmaceutical composition of claim 16 in the preparation of a medicament for inhibiting or degrading BCL6.
18. Use of the compound of any one of claims 1 to 12 or a pharmaceutically acceptable salt thereof or the pharmaceutical composition of claim 15 in the preparation of a medicament for treating and / or preventing diseases or conditions mediated or dependent on BCL6.
19. Use of the compound of any one of claims 1 to 12 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 16, in the preparation of a medicament for treating and / or preventing tumors or autoimmune diseases; wherein the tumor is preferably selected from lymphoma, leukemia, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, hepatocellular carcinoma, renal cell carcinoma, bladder cancer, intestinal cancer, breast cancer, cervical cancer, colon cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, gastric cancer, melanoma, and other cancers. Sarcoma, Ewing sarcoma, angiosarcoma, Kaposi's sarcoma, liposarcoma, myoma, peripheral neuroepithelial tumor, synovial sarcoma, glioma, astrocytoma, glioblastoma, neuroblastoma, ganglioglioma, medulloblastoma, pineal cell carcinoma, meningioma, meningeal sarcoma, neurofibroma and schwannoma, prostate cancer, endometrial cancer, testicular cancer, thyroid cancer, astrocytoma, carcinosarcoma, Hodgkin's disease, nephroblastoma and teratoma; more preferably selected from lymphoma, leukemia, breast cancer and lung cancer.
Citation Information
Patent Citations
2-quinolone derived inhibitors of BCL6
WO2018215798A1
Bifunctional molecules containing an e3 ubiquitine ligase binding moiety linked to a BCL6 targeting moiety
WO2021077010A1
Modulators of BCL6 proteolysis and associated methods of use
WO2022221673A1
Rapidly accelerated fibrosarcoma (RAF) degrading compounds and associated methods of use
WO2024054591A1
Modulators of BCL6 proteolysis and associated methods of use
WO2024086759A1