Oligonucleotide, oligonucleotide conjugate and composition and use thereof
Modified oligonucleotides with specific sequences and nucleotide modifications effectively inhibit APOE4 mRNA, addressing stability and efficacy challenges in siRNA drugs, achieving high inhibition rates in cell models.
Patent Information
- Application Number
- PCT/EP2025/083797
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-11-13
- Filing Date
- 2025-11-21
- Publication Date
- 2026-05-28
Smart Images

Figure IMGF000016_0001 
Figure IMGF000016_0002 
Figure IMGF000017_0001
Abstract
Description
OLIGONUCLEOTIDE, OLIGONUCLEOTIDE CONJUGATE AND COMPOSITION AND USE THEREOF TECHNICAL FIELDThe present disclosure relates to a single-stranded oligonucleotide, a double-stranded oligonucleotide, an oligonucleotide conjugate, a pharmaceutically acceptable salt, a pharmaceutical composition, and uses and preparation methods thereof.BACKGROUND OF THE INVENTION APOE4 (Apolipoprotein E4), a variant allele of the human APOE gene, is closely associated with an increased risk of developing various neurological diseases, especially Alzheimer’s disease (AD). Apolipoprotein E, which is encoded by the APOE gene, is a protein that plays a crucial role in cholesterol and lipid metabolism. APOE gene involves three major alleles:AP0E2, AP0E3, and APOE4, among which APOE4 is considered as the strongest risk factor for Alzheimer’ s disease. Patients with Alzheimer’ s disease who carry APOE4 exhibit symptoms at an earlier age compared those who do not carry the allele APOE4.In siRNA drugs, the antisense strand is the most critical component that determines the performance of a double-stranded oligonucleotide, since it can specifically hybridize with the messenger RNA (mRNA) of a target gene through complementary base pairing, leading to degradation or inactivation of the mRNA, thereby inhibiting or blocking the expression of the target gene. In view of this unique mechanism, siRNA drugs demonstrate great development potential and are expected to serve as an effective means for treating diseases associated with APOE4 gene.SUMMARY OF THE INVENTIONThe present invention provides a single-stranded oligonucleotide. The single- stranded oligonucleotide, the double-stranded oligonucleotide and the oligonucleotide conjugate comprising the single-stranded oligonucleotide of the present disclosure as an antisense strand all exhibit good pharmaceutical activity and stability when having different nucleotide sequences and targeting APOE4 mRNA.In one aspect, the present disclosure provides a single-stranded oligonucleotide, wherein the single-stranded oligonucleotide has a length of 16-30 nucleotides and can inhibit the expression of APOE4 mRNA by the mechanism of RNA interference (RNAi); wherein each nucleotide in the single-stranded oligonucleotide independently of one another is a modified or unmodifiednucleotide; wherein at least one nucleotide in the single-stranded oligonucleotide is a nucleotide X, and at least one nucleotide is a fluoro modified nucleotide; andin a 5’ to 3’ direction, the 13th nucleotide in the single-stranded oligonucleotide is a substituted alkoxy modified nucleotide; the 14th nucleotide in the single-stranded oligonucleotide is a nucleotide X; and each of the 15th nucleotide and all the subsequent nucleotides in the singlestranded oligonucleotide independently of one another is a modified nucleotide; and each nucleotide X is independently a deoxynucleotide or an unmodified nucleotide.In another aspect, the present disclosure provides a double-stranded oligonucleotide comprising a sense strand and an antisense strand, wherein each nucleotide in the sense strand is a modified or unmodified nucleotide, and the sense strand and the antisense strand are at least partially reverse complementary to form a double-stranded region, and wherein the antisense strand is the single-stranded oligonucleotide of the present disclosure.In yet another aspect, the present disclosure further provides an oligonucleotide conjugate comprising an oligonucleotide group and a delivery group conjugated to the oligonucleotide group, wherein the oligonucleotide group is independently a group formed by removing one or more atoms or of atomic groups from the single-stranded oligonucleotide or the double-stranded oligonucleotide of the present disclosure.In yet another aspect, the present disclosure further provides a pharmaceutically acceptable salt of the single-stranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate of the present disclosure.In yet another aspect, the present disclosure further provides a pharmaceutical composition comprising one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, and the pharmaceutically acceptable salt of the present disclosure, and a pharmaceutically acceptable excipient.In yet another aspect, the present disclosure further provides use of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt, or the pharmaceutical composition of the present disclosure in the manufacture of a medicament for treating and / or preventing a disease or symptom associated with the level of APOE4 mRNA.In yet another aspect, the present disclosure further provides a method for treating and / or preventing a disease or symptom associated with the level of APOE4 mRNA, comprising administering to a subject in need thereof an effective amount of one or more of the singlestranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt, and the pharmaceutical composition of the presentdisclosure.In yet another aspect, the present disclosure further provides a method for regulating the expression level of APOE4 mRNAin a cell, comprising contacting the cell with an effective amount of one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt, and the pharmaceutical composition of the present disclosure.In yet another aspect, the present disclosure further provides one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt, and the pharmaceutical composition of the present disclosure for use as a medicament.In yet another aspect, the present disclosure also provides a cell expressing APOE4 mRNA, further comprising one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt, and the pharmaceutical composition of the present disclosure.Furthermore, the present disclosure also provides a kit comprising one or more of the singlestranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt, and the pharmaceutical composition of the present disclosure.BENEFICIAL EFFECTSOne or more of the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt, and the pharmaceutical composition comprising the singlestranded oligonucleotide of the present disclosure as an antisense strand exhibits good activity for regulating APOE4 mRNA, e.g., having good stability and inhibitory activity against APOE4 mRNAin cells and / or in a subject, and therefore has good application prospects.In one aspect, the double-stranded oligonucleotide (such as siRNA), the oligonucleotide conjugate and / or the pharmaceutical composition comprising the single-stranded oligonucleotide of the present disclosure as an antisense strand exhibit excellent inhibitory effect against APOE4 mRNA. For example, in HepG2 human hepatoma cells in vitro, the siRNA conjugate of the present disclosure shows excellent inhibitory effects at a concentration of 50 nM, having an inhibition rate against APOE4 mRNA of more than 85%, or up to 95% or higher, or even up to 98%. For another example, in primary mouse hepatocytes in vitro, the siRNA conjugate of the present disclosure shows excellent inhibitory activity against APOE4 mRNA; at a concentration of 50 nM, the siRNA conjugate of the present disclosure shows an inhibitionrate against APOE4 mRNA of 69% or higher, or up to 97.8%, suggesting that the siRNA conjugate of the present disclosure has superior inhibitory effect against APOE4 mRNA.Therefore, the conjugates of the present disclosure have good activity for regulating APOE4 mRNA, and have excellent development prospects in the preparation of a medicament for treating and / or preventing diseases or symptoms associated with the expression of APOE4 mRNA.INCORPORATION BY REFERENCEAll publications, patents, and patent applications as mentioned in this description are incorporated herein by reference to the extent as if each individual publication, patent or patent application was specifically and separately incorporated herein by reference.DETAILED DESCRIPTION OF THE INVENTIONThe specific embodiments of the present disclosure are described in detail in the following parts. It should be understood that the specific embodiments described herein are only for the purpose of illustration and explanation of the present disclosure and are not intended to limit the present disclosure.In the present disclosure, APOE4 mRNA refers to APOE4 mRNA expressed in mammalian cells. In the present disclosure, APOE4 mRNA or “mRNA expressed by APOE4 gene” specifically refers to the mRNA having a sequence as shown in Genbank Accession No.NM_000041.4. Further, unless otherwise indicated, the term “APOE4 gene” used in the present disclosure refers to the gene transcribed into the above-mentioned APOE4 mRNA.DefinitionsIn the context of the present disclosure, the expressions “complementary” and “reverse complementary” can be interchangeably used, and have a well-known meaning in the art; namely, in a double-stranded nucleic acid molecule, each base in one strand forms a hydrogen bond between base pair with a base in the other strand in a complementary manner to realize base pairing and form a Watson-Crick base pair. A “base pair” refers to two bases that form base pairing. In DNA, a purine base adenine (A) is always paired with a pyrimidine base thymine (T) (or uracil (U) in RNA); and a purine base guanine (G) is always paired with a pyrimidine base cytosine (C). Each base pair comprises a purine and a pyrimidine. When an adenine in one strand is always paired with a thymine (or uracil) in another strand, and a guanine is alwayspaired with a cytosine, these two strands are considered as being complementary each other; and the sequence of a strand can be deduced from the sequence of its complementary strand. When the bases are modified, as long as the above purine-pyrimidine pairing relationship (including but not limited to the number and strength of hydrogen bonds between the bases) is not affected, these modified bases are also considered to be able to form complementary pairing.Correspondingly, a “mismatch” in the art means that in a double-stranded nucleic acid, the bases at corresponding positions are not presented in a manner of complementary pairing; when an abasic nucleotide is present at a corresponding position, it is also considered as forming a mismatch with the base on the other strand.In the context of the present disclosure, “at least partially reverse complementary”, “basically reverse complementary”, “substantially reverse complementary”, and “completely reverse complementary” can be used to refer to the base pairing between the nucleotide sequences of two single nucleic acid strands, namely, between a single- stranded oligonucleotide and APOE4 mRNA, or between a single-stranded oligonucleotide and a nucleotide sequence m, or between the sense strand and the antisense strand of a double-stranded oligonucleotide (e.g., siRNA), or between the antisense strand of a double-stranded oligonucleotide and APOE4 mRNA. Unless otherwise specified, “at least partially reverse complementary” means that there are no more than 50% base mismatches between two nucleotide sequences capable of forming a doublestranded region over the hypothetically or actually formed double-stranded region; “basically reverse complementary” means that there are no more than 3 base mismatches between two nucleotide sequences capable of forming a double-stranded region over the hypothetically or actually formed double-stranded region; “substantially reverse complementary” means that there is no more than 1 base mismatch between two nucleotide sequences capable of forming a double-stranded region over the hypothetically or actually formed double-stranded region; and “completely reverse complementary” means that there is no base mismatch between two nucleotide sequences capable of forming a double-stranded region over the hypothetically or actually formed double-stranded region. When two nucleotide sequences are “at least partially reverse complementary”, “basically reverse complementary”, “substantially reverse complementary”, or “completely reverse complementary”, they can anneal to form a doublestranded hybrid consisting of Watson-Crick base pairs.Unless otherwise specified, when a shorter segment of nucleotide sequence and another longer segment of nucleotide sequence are referred to as being “completely reverse complementary”, it means that the two segments of nucleotide sequences are completely reverse complementary over the entire nucleotide length of the shorter nucleotide sequence. For example, “the single-stranded oligonucleotide of the present disclosure being completely reverse complementary to APOE4 mRNA” means that they are completely reverse complementary over the entire length of the single-stranded oligonucleotide of the present disclosure; in other words, the singlestranded oligonucleotide can form a double-stranded hybrid with APOE4 mRNA by forming a Watson-Crick base pair between each nucleotide in the single-stranded oligonucleotide and a corresponding nucleotide in APOE4 mRNA.In the context of the present disclosure, “double-stranded region” is a double-stranded structure formed between the shortest nucleotide sequences (including all bases that form base pairs) in each single strand of the hypothetically or actually formed double-stranded nucleic acid structure. Thus, the double-stranded region consists of all base pairs and all base mismatches located among the base pairs in the double-stranded nucleic acid structure. In some embodiments, the double-stranded nucleic acid structure comprises a double-stranded region and one or more overhanging terminals consisting of all the nucleotides that are located outside the double-stranded region and do not form base-pairing in one or two single strands of the double-stranded nucleic acid structure. In some embodiments, the double-stranded nucleic acid structure includes only the double-stranded region.The two nucleotide sequences capable of forming a double-stranded region may have identical or different lengths. In some embodiments, the double-stranded nucleic acid structure includes only the double-stranded region. In this case, the two nucleotide sequences forming a doublestranded nucleic acid structure have an equal length; “at least partially reverse complementary” means that there are no more than 50% base mismatches between the two nucleotide sequences; “basically reverse complementary” means that there are no more than 3 base mismatches between the two nucleotide sequences; “substantially reverse complementary” means that there is no more than 1 base mismatch between the two nucleotide sequences; and “completely reverse complementary” means that there is no base mismatch between the two nucleotide sequences. In some embodiments, the two nucleotide sequences forming a double-stranded region have an equal length; the double-stranded nucleic acid structure comprises a doublestranded region and one overhanging terminal of each the nucleotide sequences, and the overhanging terminals of the two nucleotide sequences have an equal length. In some embodiments, the two nucleotide sequences forming a double-stranded region have different lengths; and the double-stranded nucleic acid structure comprises a double-stranded region and one or more overhanging terminals of the longer nucleotide sequence. For example, in some embodiments, the sense strand and the antisense strand of the double-stranded oligonucleotide have different lengths. For instance, when the double-stranded oligonucleotide is an siRNA, thesense strand with a shorter length typically represents the shorter nucleotide sequence, and the antisense strand with a longer length represents the longer nucleotide sequence; and the doublestranded nucleic acid structure comprises a double-stranded region and one overhanging terminal of the antisense strand.In the context of the present disclosure, the expression that “the nucleotide sequence A and the nucleotide sequence B share X contiguous identical nucleotides, and the X contiguous identical nucleotides involve no more than Y base difference(s) or no base difference” means that the nucleotide sequence A comprises a segment of a contiguous nucleotide sequence A’ having a length of X nucleotides, which is contiguously identical with a segment of a contiguous nucleotide sequence B’ also having a length of X nucleotides in the nucleotide sequence B, and the nucleotide sequence A’ and the nucleotide sequence B’ comprise no more than Y base difference(s) or no base difference.In the context of the present disclosure, the expression that “the nucleotide sequence A is basically reverse complementary, substantially reverse complementary or completely reverse complementary to the nucleotide sequence B over a length of X nucleotides” means that the nucleotide sequence A comprises a segment of a contiguous nucleotide sequence A’ having a length of X, which is basically reverse complementary, substantially reverse complementary or completely reverse complementary to a segment of a contiguous nucleotide sequence B’ also having a length of X in the nucleotide sequence B.Unless otherwise specified, in the context of the present disclosure, when the oligonucleotides and / or oligonucleotide conjugates in the uses or methods of the present disclosure (which include, but are not limited to, the oligonucleotides and / or oligonucleotide conjugates represented by any of the structural formulae in the uses or methods of the present disclosure) are separately mentioned, they may also refer to the pharmaceutically acceptable salts of the conjugates depending on the context.In the context of the present disclosure, particularly in the description of the method for preparing the single-stranded oligonucleotide, the double-stranded oligonucleotide, the pharmaceutical composition, or the oligonucleotide conjugate of the present disclosure, unless otherwise specified, the “nucleoside monomer” refers to, according to the kind and sequence of the nucleotides in the single-stranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate to be prepared, “unmodified or modified RNA phosphoramidites used in solid phase phosphoramidite synthesis” (sometimes, RNA phosphoramidites are referred to as Nucleoside phosphoramidites elsewhere). Solid phase phosphoramidite synthesis is a well-known method used in RNA synthesis to those skilled in the art. Nucleoside monomers used inthe present disclosure can all be commercially available.Those skilled in the art would understand, with respect to any group containing one or more substituents, that such groups are not intended to introduce any substitution or substitution pattern that is sterically impractical, synthetically non-feasible and / or inherently unstable.As used herein, “alkyl” refers to a saturated straight-chain and / or branched alkyl group having an indicated number of carbon atoms, usually 1 to 20 carbon atoms, for example, 1 to 10 carbon atoms, such as 1 to 8 or 1 to 6 carbon atoms. For example, C1-C6 alkyl encompasses both straight-chain and branched alkyl of 1 to 6 carbon atoms. When mentioning an alkyl residue having a specific number of carbon atoms, all branched and straight-chain forms having that number of carbon atoms are intended to be encompassed; thus, for example, “butyl” is meant to include n-butyl, sec-butyl, isobutyl, and t-butyl; “propyl” includes n-propyl and isopropyl. Alkylene is a subset of alkyl, referring to a residue which is the same as alkyl, but has two attachment positions.As used herein, “alkoxy” refers to an alkyl group having an indicated number of carbon atoms attached through an oxygen bridge, such as, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentyloxy, 2-pentyloxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy, 3-hexyloxy, 3 -methylpentyloxy, and the like. An alkoxy groups usually have 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms attached through an oxygen bridge.As used herein, “alkoxy-modified alkyl” refers to a group formed by replacing one or more hydrogen atoms in an alkyl group with alkoxy group(s), for example, methoxymethyl (CH₃OCH₂-), ethoxymethyl (CH₃CH₂OCH₂-), methoxyethyl (CH₃OCH₂CH₂-), and the like. As used herein, “alkenyl” refers to an unsaturated branched or straight-chain hydrocarbon group having at least one carbon-carbon double bond which is obtained by respectively removing one hydrogen molecule from two adjacent carbon atoms of the parent alkyl. The group can be in either cis or trans configuration of the double bond. Typical alkenyl groups include, but not limited to, ethenyl; propenyl, such as, prop-l-en-l-yl, prop-l-en-2-yl, prop-2-en-l-yl (allyl), prop-2-en-2-yl; butenyl, such as, but-l-en-l-yl, but-l-en-2-yl, 2-methyl-prop-l-en-l-yl, but-2-en-l-yl, but-2-en-l-yl, but-2-en-2-yl, buta-l,3-dien-l-yl, buta-l,3-dien-2-yl; and the like. In certain embodiments, an alkenyl group has 2 to 20 carbon atoms, and in other embodiments, 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkenylene is a subset of alkenyl, referring to a residue which is the same as alkenyl, but has two attachment positions.As used herein, “alkynyl” refers to an unsaturated branched or straight-chain hydrocarbon group having at least one carbon-carbon triple bond which is obtained by respectively removing two hydrogen molecules from two adjacent carbon atoms of the parent alkyl. Typical alkynyl groupsinclude, but not limited to, ethynyl; propynyl, such as, prop-l-yn-l-yl, prop-2-yn-l-yl; butynyl, such as, but-l-yn-l-yl, but-l-yn-3-yl, but-3-yn-l-yl; and the like. In certain embodiments, an alkynyl group has 2 to 20 carbon atoms, and in other embodiments, 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkynylene is a subset of alkynyl, referring to a residue which is the same as alkynyl, but has two attachment positions.As used herein, “aryl” refers to a group derived from an aromatic monocyclic or multicyclic hydrocarbon ring system by removing a hydrogen atom from a ring carbon atom. The aromatic monocyclic or multicyclic hydrocarbon ring system contains only hydrogen and carbon, including six to eighteen carbon atoms, wherein at least one ring in the ring system is fully unsaturated, i.e., it contains a cyclic, delocalized (4n+2) π–electron system in accordance with the Hückel theory. Aryl groups include, but not limited to, phenyl, fluorenyl, naphthyl, and the like. Arylene is a subset of aryl, referring to a residue which is the same as aryl, but has two attachment positions.As used herein, “heterocyclyl” refers to a group derived from a monocyclic saturated or partially unsaturated, non-aromatic cyclic, or a bicyclic saturated or partially unsaturated heterocyclic hydrocarbon group, wherein the bicyclic ring system is non-aromatic, the monocyclic or bicyclic ring having, for example, 3 to 10 members or 5 to 10 members, where at least one member and up to 5 members, especially 1, 2 or 3 members of the ring are heteroatoms selected from N, O and S, and the remaining ring atoms are carbon atoms, in stable combinations known to those of skill in the art. Therein, heterocyclic ring nitrogen and sulphur atoms are optionally oxidized, and the nitrogen atoms are optionally quatemized. As used herein, the heterocyclic ring can form a bicyclic ring with another ring system, i.e., one or two of the atoms of the heterocyclic ring are shared with another ring system. The heterocyclyl can be linked to the remainder of the molecule through a carbon atom or a heteroatom; and in instances where the heterocylyl is a bicyclic group, the above linkage can be realized via a heteroatom-containing ring or a fused ring. Examples of heterocyclyl groups include, but not limited to, azetidinyl, pyrrolidinyl, piperidinyl, azepanyl, diazepanyl, dihydrofuranyl (e.g. 2,3-dihydrofuranyl, 2,5-dihydrofuranyl), dioxolanyl, morpholinyl, oxazolidinyl, oxazinanyl, indolinyl, isoindolinyl, piperazinyl, tetrahydrofuranyl, thiomorpholinyl, dihydropyranyl (e.g. 3,4-dihydropyranyl, 3,6-dihydropyranyl), homopiperazinyl, dioxanyl, hexahydropyrimidinyl, pyrazolinyl, pyrazolidinyl, 4H-quinolizinyl, quinuclidinyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydropyrimidinyl, tetrahydrothienyl, thiazolidinyl, benzopyranyl, tetrahydroquinolinyl, dihydropyrrolopyridyl, dihydrobenzoxazinyl, pyrrol opyridyl, dihydronaphthyridinyl, dihydroisoquinolinyl, andtetrahydroisoquinolinyl. A heterocyclylene is a subset of heterocyclyl, referring to a residue which is the same as heterocyclyl, but has two attachment positions.As used herein, “heteroaryl” refers to a group derived from a 3- to 18-membered aromatic ring radical, comprising two to seventeen carbon atoms and one to six heteroatoms selected from nitrogen, oxygen and sulfur. As used herein, a heteroaryl group can be a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, wherein at least one ring in the ring system is fully unsaturated, i.e., it contains a cyclic, delocalized (4n+2) π–electron system in accordance with the Hückel theory. Heteroaryl includes fused or bridged ring systems. In some embodiments, the heteroatom in the heteroaryl group is an oxidized heteroatom. In some embodiments, the heteroaryl group comprises one or more nitrogen atoms. In some embodiments, one or more of the nitrogen atoms in the heteroaryl group are quatemized nitrogen atom(s). The heteroaryl is linked to the rest of the molecule through any ring atom. Examples of heteroaryl groups include, but not limited to, azepinyl, acridinyl, benzimidazolyl, benzindolyl, 1,3 -benzodi oxazolyl, benzofuranyl, benzoxazolyl, benzo[d]thiazolyl, benzothiadiazolyl, benzo[Z>][l,4]dioxepinyl, benzo[b][l,4]oxazinyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodi oxolyl, benzodioxinyl, benzopyranyl, benzopyranonyl, benzofuranyl, benzofuranonyl, benzothienyl, benzothieno[3,2-d]pyrimidinyl, benzotri azolyl, benzo[4,6]imidazo[l,2-a]pyridinyl, carbazolyl, cinnolinyl, cyclopenta[d]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-d]pyrimidinyl, 5.6-dihydrobenzo[h]quinazolinyl, 5,6-dihydrobenzo[h]cinnolinyl, 6,7-dihydro-5H-benzo[6,7]cyclohepta[l,2-c]pyridazinyl, dibenzofuranyl, dibenzothienyl, furanyl, furanonyl, furo[3,2-c]pyridinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyrimidinyl,5,6,7,8,9,10-hexahydrocycloocta[d]pyridazinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyridinyl, isothiazolyl, imidazolyl, indazolyl, indolyl, isoindolyl, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, isoxazolyl, 5,8-methano-5,6,7,8-tetrahydroquinazolinyl, naphthyridinyl,1.6-naphthyri dinonyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxiranyl,5,6,6a,7,8,9,10,10a-octahydrobenzo[h]quinazolinyl, 1-phenyl-1H-pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridinyl, pyrido[3,2-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrrolyl, quinazolinyl, quinoxalinyl, quinolinyl, tetrahydroquinolinyl, 5,6,7,8-tetrahydroquinazolinyl,5.6.7.8-tetrahydrobenzo[4,5]thieno[2,3-d]pyrimidinyl,6.7.8.9-tetrahydro-5H-cyclohepta[4,5]thieno[2,3-d]pyrimidinyl,5,6,7,8-tetrahydropyrido[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl,thieno[2,3-d]pyrimidinyl, thieno[3,2-d]pyrimidinyl, thieno[2,3-c]pridinyl, and thiophenyl / thienyl. A heteroarylene is a subset of heteroaryl, referring to a residue which is the same as heteroaryl, but has two attachment positions.In the context of the present disclosure, a “substituted” group, such as substituted amine, substituted alkyl or substituted aryl, unless otherwise specified, refers to a group formed by replacing hydrogen atom(s) in the group with one or more substituents. For example, “substituted alkyl" refers to an alkyl group formed by replacing one or more hydrogen atoms in the alkyl group with substituent(s). Those skilled in the art could understand that the compounds that can be used in the present disclosure could comprise various substituents, as long as the introduction of the substituent(s) does not affect the functions of the present disclosure and can realize the purpose of the present disclosure. In some embodiments, the substituent is selected from the group consisting of the following groups: C1-C10 alkyl, C6-C10aryl, C5-C10 heteroaryl, C1-C10 haloalkyl, -OC1-C10 alkyl, -OC1-C10 alkylphenyl, -C1-C10 alkyl-OH, -OC1-C10 haloalkyl, -SC1-C10 alkyl, -SC1-C10 alkylphenyl, -C1-C10 alkyl-SH, -SC1-C10 haloalkyl, halo substituent, -OH, -SH, -NH2, -C1-C10 alkyl-NH2, -N(C1-C10 alkyl)(C1-C10 alkyl), -NH(C1-C10 alkyl), N(C1-C10 alkyl)( C1-C10 alkylphenyl), NH(Ci-Cio alkylphenyl), -CN, -NO2, -CO2H, -C(O)OCi-C10 alkyl, -CON(Ci-Cio alkyl)(Ci-Cio alkyl), -CONH(Ci-Cio alkyl), -CONH2, -NHC(O)(Ci-C10 alkyl), -NHC(O)(phenyl), -N(Ci-Cio alkyl)C(0)(Ci-Cio alkyl), -N(Ci- C10 alkyl)C(O)(phenyl), -C(0)Ci-Cio alkyl, -C(0)Ci-Cio alkylphenyl, -C(0)Ci-Cio haloalkyl, -OC(0)Ci-Cio alkyl, -S02(Ci-Cio alkyl), -SO2(phenyl), -S02(Ci-Cio haloalkyl), -SO2NH2, -S02NH(CI-CIO alkyl), -SO2NH(phenyl), -NHS02(CI-CIO alkyl), -NHSO2(phenyl), and -NHS02(CI-CIO haloalkyl). In some embodiments, the substituent is one of -C1-C3 alkyl, -C6-C8aryl, -O-C1-C3 alkyl, -O-(Ci-C3 alkyl)phenyl, halogen, -OH, -NH2, -CN, or -NO2. Those skilled in the art would understand, with respect to any group containing one or more substituents, that such groups are not intended to introduce any substitution or substitution pattern that is sterically impractical, synthetically non-feasible and / or inherently unstable.Various protecting groups (such as amino protecting groups or hydroxyl protecting groups) can be used in the present disclosure. In general, protecting groups render chemical functionality inert to specific reaction conditions, and can be added to and removed from such functionality in a molecule without substantially damaging the remainder of the molecule. Representative hydroxyl protecting groups are disclosed in Beaucage, et al., Tetrahedron 1992, 48, 2223-2311, and also in Peter G. M. Wuts, GREEN’S Protective Groups in Organic Synthesis, Chapter 2, 5th edition, John Wiley & Sons Inc., New Jersey, 2014, each of which is hereby incorporated by reference in its entirety. In some embodiments, the protecting group is stable under basicconditions but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxyl protecting groups used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthen-9-yl (Pixyl), and 9-(p-methoxyphenyl)xanthen-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups used herein comprise Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4’-dimethoxytrityl), and TMTr (4,4 ’,4 ” -trimethoxytrityl).The term “subject”, as used herein, refers to any animal, e.g., mammal or marsupial. The subject of the present disclosure includes, but is not limited to, human, non-human primate (e.g., rhesus or other kinds of macaque), mouse, pig, horse, donkey, cow, rabbit, sheep, rat, and any kind of poultry.As used herein, the term “treatment” refers to a method for obtaining advantageous or desired result, including but not limited to, therapeutic benefit. “Therapeutic benefit” means eradication or amelioration of potential disorder to be treated. Also, therapeutic benefit is achieved by eradicating or ameliorating one or more of physiological symptoms associated with a potential disorder such that an amelioration is observed in a subject, although the subject may still be afflicted with the potential disorder.As used herein, the term “prevention” refers to a method for obtaining advantageous or desired result, including but not limited to, prophylactic benefit. For obtaining “prophylactic benefit”, the double-stranded oligonucleotide, the pharmaceutical composition, or the oligonucleotide conjugate of the present disclosure could be administered to a subject at risk of developing a disease associated with APOE4 mRNA, or to a subject reporting one or more physiological symptoms of the disease associated with APOE4 mRNA, even though the diagnosis of the disease may not have been made. In some embodiments, “prevention” involves interfering in the level of APOE4 mRNA or APOE4 protein by administering the double-stranded oligonucleotide, the pharmaceutical composition, or the oligonucleotide conjugate to a subject at risk of developing a particular disease associated with APOE4 mRNA before the risk of the disease develops into a clear disease progress, thereby reducing or eliminating the risk of the disease.Single-stranded oligonucleotide of the present disclosureIn one aspect, the present disclosure provides a single-stranded oligonucleotide, wherein the single-stranded oligonucleotide has a length of 16-30 nucleotides, and the single- stranded oligonucleotide could inhibit the expression of APOE4 mRNA by the mechanism of RNA interference (RNAi); wherein each nucleotide in the single-stranded oligonucleotideindependently of one another is a modified or unmodified nucleotide; and wherein in the single-stranded oligonucleotide, at least one nucleotide is a nucleotide X, and at least one nucleotide is a fluoro modified nucleotide; and in a 5’ to 3’ direction, the 13th nucleotide in the single-stranded oligonucleotide is a substituted alkoxy modified nucleotide; the 14th nucleotide in the single-stranded oligonucleotide is a nucleotide X; and each of the 15th nucleotide and all the subsequent nucleotides in the single-stranded oligonucleotide independently of one another is a modified nucleotide; and each nucleotide X is independently a deoxynucleotide or an unmodified nucleotide.In the present disclosure, by regulating the expression level of APOE4 mRNA and / or changing the APOE4 protein level, the disease associated with the expression level of APOE4 mRNA and / or the APOE4 protein level can be treated or prevented.The inventors have surprisingly found that the single-stranded oligonucleotide of the present disclosure, and the double-stranded oligonucleotide and the oligonucleotide conjugate comprising the single-stranded oligonucleotide of the present disclosure as an antisense strand exhibit good stability and inhibitory activity against APOE4 mRNA in cells and / or in a subject, and therefore have good application prospects.To exert an RNAi effect, the single-stranded oligonucleotide of the present disclosure has a length of 16-30 nucleotides. In some embodiments, the single-stranded oligonucleotide of the present disclosure has a length of 17-28, 19-27, or 20-25 nucleotides. In some embodiments, the single-stranded oligonucleotide of the present disclosure has a length of 19, 21 or 23 nucleotides. In this case, the single-stranded oligonucleotide, and the double-stranded oligonucleotide and the oligonucleotide conjugate comprising the single-stranded oligonucleotide of the present disclosure as an antisense strand have a better synthesis cost, and exhibit a better balance between stability and RNAi activity.In the single-stranded oligonucleotide of the present disclosure, at least one nucleotide is a nucleotide X, and at least one nucleotide is a fluoro modified nucleotide; and in a 5’ to 3’ direction, the 14th nucleotide in the single-stranded oligonucleotide is a nucleotide X; the 13th nucleotide in the single-stranded oligonucleotide is a substituted alkoxy modified nucleotide; and each of the 15th nucleotide and all the subsequent nucleotides in the single-stranded oligonucleotide independently of one another is a modified nucleotide. Particularly, the inventors have found that by including the above-mentioned fluoro modified nucleotide, substituted alkoxy modified nucleotide and nucleotide X, the single- stranded oligonucleotide of the present disclosure can effectively maintain higher inhibitory activity against APOE4 mRNA of the single-stranded oligonucleotide, the double-stranded oligonucleotide and theoligonucleotide conjugate, while retaining their stability.In some embodiments, the number of the nucleotide X in the single-stranded oligonucleotide is 1-3, such as 1, 2 or 3. In some embodiments, in a 5’ to 3’ direction, the 12th and 14th nucleotides in the single-stranded oligonucleotide independently of one another are the nucleotide X. In some embodiments, in a 5’ to 3’ direction, only the 14th nucleotide in the single-stranded oligonucleotide is the nucleotide X.Each nucleotide X is independently selected from a deoxynucleotide or an unmodified nucleotide. In the context of the present disclosure, an “unmodified nucleotide” refers to a ribonucleotide (RNA) in which base and ribose are not modified; that is, the nucleotide base is a natural ribobase (one of A, U, C, G, and T), and the hydroxyl group at the 2’-position of the ribose of the nucleotide is an unprotected hydroxyl group (2’ -OH). Correspondingly, a “modified nucleotide” refers to a nucleotide with base modification, or a nucleotide in which the 2’ -hydroxyl of the ribose of the nucleotide is replaced by another atom or group, or refers to a nucleotide analogue. In some embodiments, in a 5’ to 3’ direction, the 14th nucleotide or the 12th and 14th nucleotides in the single-stranded oligonucleotide are the nucleotide X, and each of other nucleotides independently of one another is a modified nucleotide. In some embodiments, in a 5’ to 3’ direction, the 14th nucleotide in the single-stranded oligonucleotide is the nucleotide X, and each of other nucleotides independently of one another is a modified nucleotide.In some embodiments, the number of the modified nucleotides accounts for 50% or higher, 70% or higher, or 85% or higher of all the nucleotides in the single-stranded oligonucleotide of the present disclosure. In some embodiments, the number of the unmodified nucleotides in the single-stranded oligonucleotide of the present disclosure is no more than 5 or no more than 4. In some embodiments, the number of the unmodified nucleotides in the single-stranded oligonucleotide of the present disclosure is no more than 3, no more than 2, or no more than 1. In some embodiments, the number of the unmodified nucleotides in the single-stranded oligonucleotide is 2 or 1. In some embodiments, each of all nucleotides in the single-stranded oligonucleotide independently of one another is a modified nucleotide.As described above, the single-stranded oligonucleotide of the present disclosure further comprises fluoro modified nucleotides, in addition to nucleotide X and alkoxy modified nucleotides. In some embodiments, the number of fluoro modified nucleotides is 2-7. In some embodiments, in a 5’ to 3’ direction, the fluoro modified nucleotides refer to 2 to 5 nucleotides of the 2nd, 5th, 6th, 7th, 12th, 16th, 18th, and 19th nucleotides in the single-stranded oligonucleotide. In some embodiments, in a 5’ to 3’ direction, the fluoro modified nucleotidesrefer to 1 or 2 nucleotides of the 2nd and 12th nucleotides, 1 or 2 nucleotides of the 5th to 7th nucleotides, and 0-2 nucleotides of the 16th to 19th nucleotides in the single-stranded oligonucleotide. In some embodiments, in a 5’ to 3’ direction, the fluoro modified nucleotides refer to the 2nd and 6th nucleotides in the single-stranded oligonucleotide. In some embodiments, in a 5’ to 3’ direction, the fluoro modified nucleotides refer to the 2nd, 6th and 16th nucleotides in the single-stranded oligonucleotide. In some embodiments, in a 5’ to 3’ direction, the fluoro modified nucleotides refer to the 2nd, 5th, 7th, 12th, and 16th nucleotides in the single-stranded oligonucleotide. In some embodiments, in a 5’ to 3’ direction, the fluoro modified nucleotides refer to the 2nd, 7th, 12th, 16th, and 19th nucleotides in the singlestranded oligonucleotide. In some embodiments, in a 5’ to 3’ direction, the fluoro modified nucleotides refer to the 2nd, 6th, 12th, 16th, and 19th nucleotides in the single-stranded oligonucleotide.In some embodiments, in the single-stranded oligonucleotide, in a 5’ to 3’ direction, except for the 13th and 14th nucleotides and the fluoro modified nucleotides in the single-stranded oligonucleotide, each modified nucleotide is independently one selected from an alkoxy modified nucleotide, a substituted alkoxy modified nucleotide, an alkyl modified nucleotide, a substituted alkyl modified nucleotide, an amine modified nucleotide, a thermally destabilizing nucleotide, and a BNA. In some embodiments, in the single-stranded oligonucleotide, in a 5’ to 3’ direction, except for the 13th and 14th nucleotides and the fluoro modified nucleotides in the single-stranded oligonucleotide, each modified nucleotide is independently one selected from an alkoxy modified nucleotide, a substituted alkoxy modified nucleotide, and a thermally destabilizing nucleotide.In some embodiments, the number of the substituted alkoxy modified nucleotides in the singlestranded oligonucleotide is no more than 3. In some embodiments, the number of the substituted alkoxy modified nucleotides in the single-stranded oligonucleotide is no more than 2. In some embodiments, the number of the substituted alkoxy modified nucleotides in the single- stranded oligonucleotide is 1.In some embodiments, the single-stranded oligonucleotide comprises no thermally destabilizing nucleotide. In some embodiments, the number of the thermally destabilizing nucleotides is no more than 2. In some embodiments, the number of the thermally destabilizing nucleotides is 1 or 2. In some embodiments, except for the substituted alkoxy modified nucleotide, nucleotide X, fluoro modified nucleotide, and thermally destabilizing nucleotide, each of the modified nucleotides is independently an alkoxy modified nucleotide.In the context of the present disclosure, a “thermally destabilizing nucleotide” refers to anucleotide containing thermally destabilizing modification(s). The thermally destabilizing modification refers to a modification that reduces the thermal dissociation temperature of an oligonucleotide duplex having such modification(s) by at least 0.5°C as compared with an oligonucleotide duplex having an unmodified nucleotide at the corresponding position.Exemplary thermally destabilizing modifications can be found in paragraphs
[0236] -
[0251] of the description of PCT publication WO2018 / 098328A1.In some embodiments, the thermally destabilizing nucleotide is one of an acyclic nucleotide or an isonucleotide.An acyclic nucleotide is a nucleotide in which a sugar ring in the nucleotide is opened. In some embodiments, the acyclic nucleotide can be an unlocked nucleic acid (UNA) and a glycerol nucleic acid (GNA), wherein the UNA is as shown by Formula (15), and the GNAis as shown by Formula (16):Formula (15) Formula (16)In the Formula (15) and the Formula (16), R is selected from H, OH or alkoxy (O-alkyl); and “Base” represents a nucleic acid base, such as A, U, G, C, or T.An isonucleotide is a compound which is formed by altering the position of the base on the ribose ring in a nucleotide. In some embodiments, the isonucleotide can be a compound which is formed by transferring a base from 1’ -position to 2’ -position or 3 ’-position on the ribose ring, as shown by Formula (17) or (18).In the above compounds of Formula (17) and Formula (18), “Base” represents a nucleic acid base, such as A, U, G, C, or T; and R is H, OH, F, or a non-fluoro group described above.Formula (17) Formula (18)In some embodiments, the thermally destabilizing nucleotide is one selected from the group consisting of GNA as shown by Formula (27 A), 2’-0Me abasic nucleotide as shown by Formula (27B), 3’-0Me modified nucleotide as shown by Formula (27C), 5’-Me modified nucleotide as shown by Formula (27D), SNA as shown by Formula (27E), hGNA as shown by Formula (27F), hhGNA as shown by Formula (27G), mGNA as shown by Formula (27H), TNA as shown by Formula (27I), and h’GNA as shown by Formula (27J), UNA as shown by Formula (27K), or Hyp-spacer as shown by Formula (27L):Formula (27 A); Formula (27B); Formula (27C); Formula (27D);BaseFormula (27E); Formula (27F); Formula (27G); Formula (27H);Formula (27I); Formula (27 J); Formula (27K);In the above compounds of Formula (27A)-(27L), “Base” represents a nucleic acid base, such as, A, U, G, C, or T; and R27 is selected from H, OH, F, alkoxy, alkyl, or alkoxy substituted alkyl. * indicates that the carbon atom is chiral, and the compound can be in R configuration, or in S configuration, or can be a racemic mixture of R and S configurations. In some embodiments, each thermally destabilizing nucleotide is independently GNA as shown by Formula (27 A).In the context of the present disclosure, a BNA is a nucleotide that is constrained or is not accessible. BNA can contain a 5-membered, 6-membered or 7-membered ring bridged structure with a “fixed” C3’-endo sugar puckering. The bridge is typically incorporated at the 2’ and ’position of the ribose to afford a 2’, 4’ -BNA nucleotide. In some embodiments, the BNA can be LNA, ENA and cET BNA, wherein LNA is as shown by Formula (12), ENA is as shown by Formula (13) and cET BNA is as shown by Formula (14).Formula (12) Formula (13) Formula (14)In some embodiments, for ease of synthesis, each alkoxy modified nucleotide independently of one another is a 2’-methoxy modified nucleotide (2’-OMe) as shown by Formula (8). In some embodiments, the 2’-amino modified nucleotide (2’-NH2) is as shown by Formula (9). In some embodiments, the 2’-deoxy nucleotide (DNA) is as shown by Formula (10).Formula (7) Formula (8) Formula (9) Formula (10)In the above Formulae (7)-(10), “Base” represents a nucleic acid base, such as A, U, G, C, or T. In the context of the present disclosure, a “fluoro modified nucleotide”, a “2’ -fluoro modified nucleotide”, a “nucleotide in which 2’-hydroxyl of the ribose group is substituted with fluoro”, and a “nucleotide with 2’-fluororibosyl” have the same meaning, referring to the compound as shown by Formula (7) formed by substituting the 2’ -hydroxyl of the nucleotide with fluoro. A “methoxy modified nucleotide”, a “2’-methoxy modified nucleotide”, a “nucleotide in which 2’-hydroxyl of the ribose group is substituted with methoxy”, and a “nucleotide with 2’-methoxyribosyl“ have the same meaning, referring to the compound as shown by Formula (8)formed by substituting the 2’ -hydroxyl of the ribose group of the nucleotide with methoxy. In some embodiments, the single-stranded oligonucleotide of the present disclosure has a length of 19-23 nucleotides, and in a 5’ to 3’ direction, the 13th nucleotide is a substituted alkoxy modified nucleotide, the 14th nucleotide is a nucleotide X, one of the 5th to 7th nucleotides is a fluoro modified nucleotide, the 2nd and the 16th nucleotides are fluoro modified nucleotides, the 3rd nucleotide is an alkoxy modified nucleotide or a substituted alkoxy modified nucleotide, the 5th nucleotide is an alkoxy modified nucleotide or a substituted alkoxy modified nucleotide when it is not a fluoro modified nucleotide, and each remaining nucleotide in the single-stranded oligonucleotide independently of one another is an alkoxy modified nucleotide.In some embodiments, the single-stranded oligonucleotide of the present disclosure has a length of 21 nucleotides, and in a 5’ to 3’ direction, the 13th nucleotide is a substituted alkoxy modified nucleotide, the 14th nucleotide is a nucleotide X, the 2nd, 6th and 16th nucleotides are fluoro modified nucleotides, the 3rd or 5th nucleotides are alkoxy modified nucleotides or substituted alkoxy modified nucleotides, and each remaining nucleotide in the single-stranded oligonucleotide independently of one another is an alkoxy modified nucleotide.In some embodiments, each nucleotide X in the single-stranded oligonucleotide of the present disclosure refers to a deoxynucleotide. In some embodiments, each alkoxy modified nucleotide in the single-stranded oligonucleotide of the present disclosure refers to a methoxy modified nucleotide. In some embodiments, each substituted alkoxy modified nucleotide in the singlestranded oligonucleotide of the present disclosure refers to a 2’-O-methoxyethyl modified nucleotide. In some embodiments, each BNA in the single-stranded oligonucleotide of the present disclosure refers to LNA or cET BNA. In some embodiments, each thermally destabilizing nucleotide in the single-stranded oligonucleotide of the present disclosure refers to GNA.In some embodiments, at least 2 of the linking groups linking adjacent nucleotides in the singlestranded oligonucleotide are each independently phosphate ester groups with modification group(s). In some embodiments, 1 to 4 of the linking groups linking adjacent nucleotides of the 1st to 5th nucleotides at 5’ terminal of the single-stranded oligonucleotide of the present disclosure are each independently phosphate ester groups with modification group(s). In some embodiments, 1 to 4 of the linking groups linking adjacent nucleotides of the 1st to 5th nucleotides at 3’ terminal of the single-stranded oligonucleotide of the present disclosure are each independently phosphate ester groups with modification group(s). In some embodiments, 2 of the linking groups linking adjacent nucleotides of the 1st to 3rd nucleotides at 5’ terminal of the single-stranded oligonucleotide of the present disclosure, or 4 of the linking groups linkingadjacent nucleotides of the 1st to 5th nucleotides at 5’ terminal of the single-stranded oligonucleotide of the present disclosure are each independently phosphate ester groups with modification group(s). In some embodiments, 2 of the linking groups linking adjacent nucleotides of the 1st to 3rd nucleotides at 3’ terminal of the single-stranded oligonucleotide of the present disclosure, or 4 of the linking groups linking adjacent nucleotides of the 1st to 5th nucleotides at 3’ terminal of the single-stranded oligonucleotide of the present disclosure are each independently phosphate ester groups with modification group(s). In some embodiments, in the single-stranded oligonucleotide of the present disclosure, if the single-stranded oligonucleotide comprises unmodified nucleotides, then one or both of the two linking groups linking each of the unmodified nucleotides and adjacent nucleotides thereof are each independently phosphate ester groups with modification group(s). The modified phosphate ester groups can render the single-stranded oligonucleotide of the present disclosure to better resist the action of exonucleases, and enhance the stability of the oligonucleotide in a subject.In some embodiments, 2-6 of the linking groups linking adjacent nucleotides in the singlestranded oligonucleotide are each independently phosphate ester groups with modification group(s). In some embodiments, 3 or 4 of the linking groups linking adjacent nucleotides in the single-stranded oligonucleotide are each independently phosphate ester groups with modification group(s). In some embodiments, the linking groups linking adjacent nucleotides of the 1st to 3rd nucleotides at 5’ terminal and the linking groups linking adjacent nucleotides of the 1st to 3rd nucleotides at 3’ terminal of the single- stranded oligonucleotide are each independently phosphate ester groups with modification group(s). In some embodiments, if the single-stranded oligonucleotide comprises unmodified nucleotides, then one or both of the two linking groups linking each of the unmodified nucleotides and adjacent nucleotides thereof are each independently phosphate ester groups with modification group(s). In some embodiments, each of the phosphate ester groups with modification group(s) is independently a phosphorothioate group having the structure as shown by Formula (28):S — P=OFormula (28)In some embodiments, the 5 ’-terminal nucleotide of the single-stranded oligonucleotide is a 5’-hydroxy nucleotide, a 5 ’-phosphate nucleotide or a 5 ’-phosphate analogue modified nucleotide, wherein the 5 ’-hydroxy nucleotide has the structure as shown by Formula (29); the 5 ’-phosphate nucleotide has the structure as shown by Formula (30); and the 5 ’-phosphate analogue modified nucleotide is one selected from the nucleotides as shown by Formulae (31)-(34):Formula (29) Formula (30)Formula (31) Formula (32) Formula (33) Formula (34);wherein R is one selected from H, OH, OCH3, and F; Base represents a nucleic acid base selected from A, U, C, G, or T.In some embodiments, the 5’-phosphate nucleotide is a nucleotide with 5’-phosphate modification as shown by Formula (30); the 5’-phosphate analogue modified nucleotide is a nucleotide with 5’-(E)-vinylphosphonat (E-VP) modification as shown by Formula (31) or a 5’-phosphorothioate modified nucleotide as shown by Formula (33). In some embodiments, the 5’-terminal nucleotide of the single-stranded oligonucleotide is a 5’-hydroxy nucleotide, or a nucleotide with 5’-(E)-vinylphosphonate (E-VP) modification. In some embodiments, the 5’-terminal nucleotide is a 5’-(E)-vinylphosphonate (E-VP) modified nucleotide, which can further increase one or more of the stability, pharmacodynamic activity and long-term effectiveness of the single-stranded oligonucleotide, and the double-stranded oligonucleotide and the oligonucleotide conjugate comprising the single-stranded oligonucleotide of the present disclosure in a subject.In some embodiments, the single-stranded oligonucleotide of the present disclosure has a length of 21 nucleotides, and in a 5’ to 3’ direction, the 13th nucleotide is a 2’-O-methoxyethyl modified nucleotide, the 14th nucleotide is a deoxynucleotide, the 2nd, 6th and 16th nucleotides are fluoro modified nucleotides, and each remaining nucleotide in the single-strandedoligonucleotide independently of one another is a methoxy modified nucleotide; the linking groups linking any two adjacent nucleotides of the 1st to the 3rd nucleotides at 5’ terminal and the linking groups linking any two adjacent nucleotides of the 1st to the 3rd nucleotides at 3’ terminal are phosphorothioate groups; and the 5’ terminal nucleotide is a 5 ’-hydroxy nucleotide as shown by Formula (29) or a 5 ’-vinyl phosphate modified nucleotide as shown by Formula (31).As described above, the composition of the single-stranded oligonucleotide of the present disclosure enables the single-stranded oligonucleotide to inhibit the expression of APOE4 mRNA by the mechanism of RNA interference (RNAi). In some embodiments, the singlestranded oligonucleotide of the present disclosure has sufficient complementarity with APOE4 mRNA to mediate an RNAi effect. In some embodiments, the single-stranded oligonucleotide of the present disclosure is sufficiently complementary to APOE4 mRNA. In the context of the present disclosure, “sufficiently complementary” means that complementarity between the single-stranded oligonucleotide of the present disclosure and APOE4 mRNA is sufficient to enable the single-stranded oligonucleotide to reduce or eliminate the production of the protein encoded by APOE4 mRNA through an RNAi effect. In some embodiments, “sufficiently complementary” means that the single-stranded oligonucleotide of the present disclosure is basically reverse complementary, substantially reverse complementary or completely reverse complementary to APOE4 mRNA over a length of at least 16 nucleotides, such as over a length of 16-25 nucleotides, or over a length of 18-23 nucleotides, or over a length of 19-21 nucleotides. In some embodiments, the single-stranded oligonucleotide of the present disclosure is completely reverse complementary to APOE4 mRNA.In some embodiments, two segments of nucleotide sequences that are “sufficiently complementary” can comprise internal regions that are completely reverse complementary (e.g., being completely reverse complementary over a length of at least 6, 8 or 10 nucleotides). In some embodiments, the single-stranded oligonucleotide of the present disclosure is completely reverse complementary to APOE4 mRNA at least over the seed region, wherein the “seed region” refers to the region of the nucleotides at positions 2 to 8 of the single-stranded oligonucleotide of the present disclosure. In this case, the single-stranded oligonucleotide of the present disclosure can better mediate an RNAi effect and inhibit the level of APOE4 mRNA. In some embodiments, the single-stranded oligonucleotide is substantially reverse complementary or completely reverse complementary to APOE4 mRNA over a length of at least 16 nucleotides. In some embodiments, in the 5’ to 3’ direction, the 2nd to 19th nucleotides in the single-stranded oligonucleotide are completely reverse complementary to APOE4 mRNA. Insome embodiments, in the 5’ to 3’ direction, except for the nucleotide at position 1 at 5’ terminal, the nucleotide sequence of the single-stranded oligonucleotide is completely reverse complementary to APOE4 mRNA. In some embodiments, all the nucleotides of the single-stranded oligonucleotide are completely reverse complementary to APOE4 mRNA.In some embodiments, the single-stranded oligonucleotide is basically reverse complementary, substantially reverse complementary or completely reverse complementary to a segment of a contiguous nucleotide sequence m in APOE4 mRNA, wherein the length of the nucleotide sequence m is not greater than the length of the single-stranded oligonucleotide, and the nucleotide sequence m and the single-stranded oligonucleotide have an equal length, or have a length difference of no more than 8 nucleotides or 1-5 nucleotides.In some embodiments, the nucleotide sequence m has a length of at least 16 nucleotides, or 16-25 nucleotides, or 18-23 nucleotides, or 19-21 nucleotides; or the nucleotide sequence m has a length of 19, 21 or 23 nucleotides.In some embodiments, the single-stranded oligonucleotide and the nucleotide sequence m have an equal length, and at least the nucleotide sequence of the single-stranded oligonucleotide, except for the terminal nucleotides, is completely reverse complementary to the nucleotide sequence m; in this case, the double-stranded oligonucleotide or oligonucleotide conjugate comprising the single-stranded oligonucleotide of the present disclosure as an antisense strand could further improve the inhibitory effect against APOE4 mRNA. In some embodiments, in a 5’ to 3’ direction, the nucleotide sequence of the single-stranded oligonucleotide, except for the nucleotide at position 1, is substantially reverse complementary to the nucleotide sequence m. In some embodiments, in a 5’ to 3’ direction, the nucleotide sequence of the single-stranded oligonucleotide, except for the nucleotide at position 1, is completely reverse complementary to the nucleotide sequence m. In some embodiments, all the nucleotides of the single-stranded oligonucleotide are completely reverse complementary to the nucleotide sequence m.In some embodiments, the single-stranded oligonucleotide of the present disclosure can independently exert pharmacodynamic activity. In some embodiments, the single-stranded oligonucleotide of the present disclosure is an antisense oligonucleotide (ASO). In some embodiments, the single-stranded oligonucleotide of the present disclosure is a single-stranded RNAi (ssRNAi) compound. In some embodiments, the single-stranded oligonucleotide of the present disclosure exerts pharmacodynamic activity as a single strand (e.g., an antisense strand) of a double-stranded oligonucleotide.In some embodiments, the single-stranded oligonucleotide of the present disclosure can be one of the following first to ninth single-stranded oligonucleotide. Each single-strandedoligonucleotide will be described below, respectively.First single-stranded oligonucleotideIn some embodiments, the present disclosure provides a first single-stranded oligonucleotide, wherein the single-stranded oligonucleotide comprises a nucleotide sequence II, and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 2 with no more than 3 base differences:5’- Z2GAAACUUGGUGAAUCUUU-3’ (SEQ ID NO: 2),wherein Z2 is U; the nucleotide sequence II comprises a nucleotide Z’2 at the position corresponding to Z2, wherein Z’2 is the first nucleotide at 5’ terminal of the single-stranded oligonucleotide sequence. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 2 with no more than 3 base differences.In the context of the present disclosure, “position correspondence” refers to the same position in a nucleotide sequence when counting from the same terminal of the nucleotide sequence. For example, the first nucleotide at 5’ terminal of the nucleotide sequence II is a nucleotide at the position corresponding to the first nucleotide of SEQ ID NO: 2.In some embodiments, there is no more than one base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 2 with 1 base difference. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 can include a difference at the position of Z’2 and / or a base difference at any other nucleotide position in the nucleotide sequence II. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 can include a base difference at the position of Z’2 and / or a base difference at a nucleotide position adjacent to Z’2. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 2 with no base difference.In some embodiments, the based difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 includes a difference at the position of Z’2, wherein Z’2 is selected from C, A or G. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 is a difference atthe position of Z’2, wherein Z’2 is selected from C, A or G.Second single-stranded oligonucleotideIn some embodiments, the present disclosure provides a second single-stranded oligonucleotide, wherein the single-stranded oligonucleotide comprises a nucleotide sequence II, and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 4 with no more than 3 base differences:5'- Z4AAACUUGGUGAAUCUUUA -3' (SEQ ID NO: 4),wherein Z4 is G or U; the nucleotide sequence II comprises a nucleotide Z’4 at the position corresponding to Z4, wherein Z’4 is the first nucleotide at 5’ terminal of the single-stranded oligonucleotide sequence. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 4 with no more than 3 base differences.In some embodiments, there is no more than one base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 4. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 4 with 1 base difference. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 4 can include a difference at the position of Z’4 and / or a base difference at any other nucleotide position in the nucleotide sequence II. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 4 may include a base difference at the position of Z’4 and / or a base difference at a nucleotide position adjacent to Z’4. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 4. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 4 with no base difference.In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 4 includes a difference at the position of Z’4, wherein Z’4 is selected from C, U or A. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 4 is a difference at the position of Z’4, wherein Z’4 is selected from C, U or A.Third single-stranded oligonucleotideIn some embodiments, the present disclosure provides a third single-stranded oligonucleotide,wherein the single-stranded oligonucleotide comprises a nucleotide sequence II, and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 6 with no more than 3 base differences:5'-Z6GGCGUUCAGUGAUUGUCG-3' (SEQ ID NO: 6),wherein Ze is C or U; the nucleotide sequence II comprises a nucleotide Z’e at the position corresponding to Ze, wherein Z’e is the first nucleotide at 5’ terminal of the single-stranded oligonucleotide sequence. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 6 with no more than 3 base differences.In some embodiments, there is no more than one base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 6. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 6 with 1 base difference. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 6 can include a difference at the position of Z’e and / or a base difference at any other nucleotide position in the nucleotide sequence II. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 6 can include a base difference at the position of Z’e and / or a base difference at a nucleotide position adjacent to Z’e. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 6. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 6 with no base difference.In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 6 includes a difference at the position of Z’e, wherein Z’e is selected from A, U or G. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 6 is a difference at the position of Z’e, wherein Z’e is selected from A, U or G.Fourth single-stranded oligonucleotideIn some embodiments, the present disclosure provides a fourth single-stranded oligonucleotide, wherein the single-stranded oligonucleotide comprises a nucleotide sequence II, and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 8 with no more than 3 base differences:5’- Z8GAAUCUUUAUUAAACUAG -3’ (SEQ ID NO: 8),wherein Zs is U; the nucleotide sequence II comprises a nucleotide Z’s at the position corresponding to Zs, wherein Z’s is the first nucleotide at 5’ terminal of the single-stranded oligonucleotide sequence. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 8 with no more than 3 base differences.In some embodiments, there is no more than one base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 8. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 8 with 1 base difference. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 8 can include a difference at the position of Z’s and / or a base difference at any other nucleotide position in the nucleotide sequence II. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 8 can include a base difference at the position of Z’s and / or a base difference at a nucleotide position adjacent to Z’s. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 8. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 8 with no base difference.In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 8 includes a difference at the position of Z’s, wherein Z’s is selected from C, A or G. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 8 is a difference at the position of Z’s, wherein Z’s is selected from C, A or G.Fifth single-stranded oligonucleotideIn some embodiments, the present disclosure provides a fifth single-stranded oligonucleotide, wherein the single-stranded oligonucleotide comprises a nucleotide sequence II, and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 32 with no more than 3 base differences:5'- Z10AUUUGUAGGCCUUCAACU-3' (SEQ ID NO: 32),wherein Zio is G or U; the nucleotide sequence II comprises a nucleotide Z’IO at the position corresponding to Zio, wherein Z’io is the first nucleotide at 5’ terminal of the single-stranded oligonucleotide sequence. In one embodiment, the nucleotide sequence II thus comprises orconsists of the nucleotide sequence as shown in SEQ ID NO: 32 with no more than 3 base differences.In some embodiments, there is no more than one base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 32. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 32 with 1 base difference. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 32 can include a difference at the position of Z’ io and / or a base difference at any other nucleotide position in the nucleotide sequence II. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 32 can include a base difference at the position of Z’io and / or a base difference at a nucleotide position adjacent to Z’IO. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 32. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 32 with no base difference.In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 32 includes a difference at the position of Z’io, wherein Z’io is selected from C, A or U. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 32 is a difference at the position of Z’io, wherein Z’io is selected from C, A or U.Sixth single-stranded oligonucleotideIn some embodiments, the present disclosure provides a sixth single-stranded oligonucleotide, wherein the single-stranded oligonucleotide comprises a nucleotide sequence II, and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 34 with no more than 3 base differences:5'- Z12AUUAAACUAGGGUCCACC-3' (SEQ ID NO: 34),wherein Z12 is U; the nucleotide sequence II comprises a nucleotide Z’12 at the position corresponding to Z12, wherein Z’12 is the first nucleotide at 5’ terminal of the single-stranded oligonucleotide sequence. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 34 with no more than 3 base differences.In some embodiments, there is no more than one base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 34. In one embodiment, thenucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 34 with 1 base difference. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 34 can include a difference at the position of Z’ n and / or a base difference at any other nucleotide position in the nucleotide sequence II. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 34 can include a base difference at the position of Z’12 and / or a base difference at a nucleotide position adjacent to Z’12. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 34. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 34 with no base difference.In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 34 includes a difference at the position of Z’12, wherein Z’12 is selected from C, A or G. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 34 is a difference at the position of Z’12, wherein Z’12 is selected from C, A or G.Seventh single-stranded oligonucleotideIn some embodiments, the present disclosure provides a seventh single-stranded oligonucleotide, wherein the single-stranded oligonucleotide comprises a nucleotide sequence II, and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 36 with no more than 3 base differences:5'- Z14GUUCAGUGAUUGUCGCUG-3' (SEQ ID NO: 36),wherein Z14 is C or U; the nucleotide sequence II comprises a nucleotide Z’14 at the position corresponding to Z14, wherein Z’14 is the first nucleotide at 5’ terminal of the single-stranded oligonucleotide sequence. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 36 with no more than 3 base differences.In some embodiments, there is no more than one base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 36. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 36 with 1 base difference. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 36 can include a difference at the position of Z’ 14 and / or a base difference at any other nucleotide position in thenucleotide sequence II. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 36 can include a base difference at the position of Z’14 and / or a base difference at a nucleotide position adjacent to Z’14. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 36. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 36 with no base difference.In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 36 includes a difference at the position of Z’14, wherein Z’14 is selected from U, A or G. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 36 is a difference at the position of Z’14, wherein Z’14 is selected from U, A or G.Eighth single-stranded oligonucleotideIn some embodiments, the present disclosure provides an eighth single-stranded oligonucleotide, wherein the single-stranded oligonucleotide comprises a nucleotide sequence II, and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 38 with no more than 3 base differences:5'- Z16UUCAGUGAUUGUCGCUGG-3' (SEQ ID NO: 38),wherein Zi6 is G or U; the nucleotide sequence II comprises a nucleotide Z’i6 at the position corresponding to Zi6, wherein Z’i6 is the first nucleotide at 5’ terminal of the single-stranded oligonucleotide sequence. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 38 with no more than 3 base differences.In some embodiments, there is no more than one base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 38. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 38 with 1 base difference. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 38 can include a difference at the position of Z’ 16 and / or a base difference at any other nucleotide position in the nucleotide sequence II. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 38 can include a base difference at the position of Z’i6 and / or a base difference at a nucleotide position adjacent to Z’i6. In someembodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 38. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 38 with no base difference.In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 38 includes a difference at the position of Z’i6, wherein Z’i6 is selected from U, A or C. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 38 is a difference at the position of Z’i6, wherein Z’i6 is selected from U, A or C.Ninth single-stranded oligonucleotideIn some embodiments, the present disclosure provides a ninth single-stranded oligonucleotide, wherein the single-stranded oligonucleotide comprises a nucleotide sequence II, and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 40 with no more than 3 base differences:5'- Z18UAUUAAACUAGGGUCCAC-3' (SEQ ID NO: 40),wherein Zis is U; the nucleotide sequence II comprises a nucleotide Z’is at the position corresponding to Zis, wherein Z’is is the first nucleotide at 5’ terminal of the single-stranded oligonucleotide sequence. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 40 with no more than 3 base differences.In some embodiments, there is no more than one base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 40. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 40 with 1 base difference. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 40 can include a difference at the position of Z’ is and / or a base difference at any other nucleotide position in the nucleotide sequence II. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 40 can include a base difference at the position of Z’is and / or a base difference at a nucleotide position adjacent to Z’is. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 40. In one embodiment, the nucleotide sequence II thus comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 40 with no base difference.In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 40 includes a difference at the position of Z’is, wherein Z’is is selected from G, A or C. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 40 is a difference at the position of Z’i8, wherein Z’is is selected from G, A or C.In some embodiments, the single-stranded oligonucleotide further comprises a nucleotide sequence IV, wherein the nucleotide sequence IV is linked to 3’ terminal of the nucleotide sequence II, and has a length of 1, 2, 3 or 4 nucleotides, and each nucleotide in the nucleotide sequence IV is independently one of non-fluoro modified nucleotides; the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to APOE4 mRNA, and each of the non-fluoro modified nucleotides is independently one selected from a 2’-methoxy modified nucleotide, a 2’-CI-3 alkyl modified nucleotide, a 2’-amino modified nucleotide, a 2’-substituted amino modified nucleotide, and a thermally destabilizing nucleotide. In some embodiments, the nucleotide sequence IV has a length of 2 nucleotides.For the first single-stranded oligonucleotide, in some embodiments, the nucleotide sequence IV has a length of 1 nucleotide, and the base is A; or the nucleotide sequence IV has a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition is AU; or the nucleotide sequence IV has a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition is AUU; or the nucleotide sequence IV has a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition is AUUA.For the second single-stranded oligonucleotide, in some embodiments, the nucleotide sequence IV has a length of 1 nucleotide, and the base is U; or the nucleotide sequence IV has a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition is UU; or the nucleotide sequence IV has a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition is UUA; or the nucleotide sequence IV has a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition is UUAA.For the third single-stranded oligonucleotide, in some embodiments, the nucleotide sequence IV has a length of 1 nucleotide, and the base is C; or the nucleotide sequence IV has a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition is CU; or the nucleotide sequence IV has a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition is CUG; or the nucleotide sequence IV has a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition is CUGG.For the fourth single-stranded oligonucleotide, in some embodiments, the nucleotide sequenceIV has a length of 1 nucleotide, and the base is G; or the nucleotide sequence IV has a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition is GG; or the nucleotide sequence IV has a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition is GGU; or the nucleotide sequence IV has a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition is GGUC.For the fifth single-stranded oligonucleotide, in some embodiments, the nucleotide sequence IV has a length of 1 nucleotide, and the base is C; or the nucleotide sequence IV has a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition is CC; or the nucleotide sequence IV has a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition is CCU; or the nucleotide sequence IV has a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition is CCUU.For the sixth single-stranded oligonucleotide, in some embodiments, the nucleotide sequence IV has a length of 1 nucleotide, and the base is C; or the nucleotide sequence IV has a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition is CC; or the nucleotide sequence IV has a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition is CCA; or the nucleotide sequence IV has a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition is CCAG.For the seventh single-stranded oligonucleotide, in some embodiments, the nucleotide sequence IV has a length of 1 nucleotide, and the base is G; or the nucleotide sequence IV has a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition is GG; or the nucleotide sequence IV has a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition is GGC; or the nucleotide sequence IV has a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition is GGCA.For the eighth single-stranded oligonucleotide, in some embodiments, the nucleotide sequence IV has a length of 1 nucleotide, and the base is G; or the nucleotide sequence IV has a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition is GC; or the nucleotide sequence IV has a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition is GCA; or the nucleotide sequence IV has a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition is GCAC.For the ninth single-stranded oligonucleotide, in some embodiments, the nucleotide sequence IV has a length of 1 nucleotide, and the base is C; or the nucleotide sequence IV has a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition is CC; or the nucleotide sequence IV has a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition is CCC; or the nucleotide sequence IV has a length of 4 nucleotides, and in a 5’ to 3’ direction, the basecomposition is CCCA.In some embodiments, the single-stranded oligonucleotide of the present disclosure further comprises a nucleotide sequence V, wherein each nucleotide in the nucleotide sequence V is independently a non-fluoro modified nucleotide, and the nucleotide sequence V has a length of 1 to 3 nucleotides, and is linked to 3’ terminal of the nucleotide sequence IV or the nucleotide sequence II; after the single-stranded oligonucleotide and a sense strand form a double-stranded oligonucleotide, the nucleotide sequence V constitutes a 3’ overhanging terminal of the antisense strand of the double-stranded oligonucleotide.In some embodiments, the nucleotide sequence V of the present disclosure has a length of 2 nucleotides; and in a 5’ to 3’ direction, the nucleotide sequence V comprises 2 contiguous thymine deoxyribonucleotides, 2 contiguous uracil nucleotides, or is completely reverse complementary to APOE4 mRNA.For the first single-stranded oligonucleotide, in some embodiments, the nucleotide sequence V of the present disclosure is linked to 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is UU, AU or AT, wherein the A is a methoxy modified nucleotide or GNA, and the T and U independently of one another are methoxy modified nucleotide. In some embodiments, the single-stranded oligonucleotide comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 2, and the nucleotide sequence V has a base composition of AU.For the second single-stranded oligonucleotide, in some embodiments, the nucleotide sequence V of the present disclosure is linked to 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is UU or TT, wherein the T and U independently of one another are methoxy modified nucleotide or GNA. In some embodiments, the single-stranded oligonucleotide comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 4, and the nucleotide sequence V has a base composition of UU.For the third single-stranded oligonucleotide, in some embodiments, the nucleotide sequence V of the present disclosure is linked to 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is UU, CU or CT, wherein the C is a methoxy modified nucleotide or GNA, and the T and U independently of one another are methoxy modified nucleotide. In some embodiments, the single-stranded oligonucleotide comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 6, and the nucleotide sequence V has a base composition ofCU.For the fourth and the seventh single-stranded oligonucleotides, in some embodiments, the nucleotide sequence V of the present disclosure is linked to 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is UU or GG, wherein the G and U independently of one another are methoxy modified nucleotide or GNA.In some embodiments, the fourth single-stranded oligonucleotide comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 8, and the nucleotide sequence V has a base composition of GG. In some embodiments, the seventh single-stranded oligonucleotide comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 36, and the nucleotide sequence V has a base composition of GG.For the fifth, the sixth and the ninth single-stranded oligonucleotides, in some embodiments, the nucleotide sequence V of the present disclosure is linked to 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is UU or CC, wherein the C and U independently of one another are methoxy modified nucleotide or GNA.In some embodiments, the fifth single-stranded oligonucleotide comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 32, and the nucleotide sequence V has a base composition of CC. In some embodiments, the sixth single-stranded oligonucleotide comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 34, and the nucleotide sequence V has a base composition of CC. In some embodiments, the ninth singlestranded oligonucleotide comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 40, and the nucleotide sequence V has a base composition of CC.For the eighth single-stranded oligonucleotide, in some embodiments, the nucleotide sequence V of the present disclosure is linked to 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is UU or GC, wherein the C and G both are methoxy modified nucleotides or GNA. In some embodiments, the eighth singlestranded oligonucleotide comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 38, and the nucleotide sequence V has a base composition of GC.In some embodiments, the nucleotide sequence II shares at least 16, at least 17, at least 18, atleast 19, at least 20, or at least 21 contiguous identical nucleotides with any one of the nucleotide sequences as shown in SEQ ID NO: 67 to SEQ ID NO: 79 in Table 1 A. In some embodiments, the nucleotide sequence II has no more than 1 base difference or no base difference from the 1st to 19th nucleotides of the nucleotide sequence as shown in any one of SEQ ID NO: 67 to SEQ ID NO: 79 in Table 1 A; alternatively, the nucleotide sequence II is any one of SEQ ID NO: 67 to SEQ ID NO: 79 listed in Table 1 A.Table 1 A Unmodified double-stranded oligonucleotide sequencesDouble-stranded SEQ ID Sequence Direction: 5’ - 3’Oligonucleotide No. NO Sense strand CCGAUGACCUGCAGAAGCG 61 siRNA 10Antisense strand CGCUUCUGCAGGUCAUCGGCA 67 Sense strand AGUUGAAGGCCUACAAAUC 62 siRNA 11Antisense strand UAUUUGUAGGCCUUCAACUCC 68 Sense strand AGUUGAAGGCCUACAAAUC 62 siRNA 12Antisense strand AAUUUGUAGGCCUUCAACUCC 69 Sense strand CGACAAUCACUGAACGCCG 63 siRNA 13Antisense strand UGGCGUUCAGUGAUUGUCGCU 70 Sense strand CGACAAUCACUGAACGCCG 63 siRNA 14Antisense strand AGGCGUUCAGUGAUUGUCGCU 71 Sense strand CAGCGACAAUCACUGAACG 64 siRNA 15Antisense strand UGUUCAGUGAUUGUCGCUGGG 72 Sense strand CAGCGACAAUCACUGAACG 64 siRNA 16Antisense strand AGUUCAGUGAUUGUCGCUGGG 73 Sense strand CCGAUGACCUGCAGAAGCG 61 siRNA 17Antisense strand UGCUUCUGCAGGUCAUCGGCA 74 Sense strand CCGAUGACCUGCAGAAGCG 61 siRNA 18Antisense strand AGCUUCUGCAGGUCAUCGGCA 75 Sense strand CCAGCGACAAUCACUGAAC 65 siRNA 19Antisense strand UUUCAGUGAUUGUCGCUGGGC 76 Sense strand CCAGCGACAAUCACUGAAC 65 siRNA 20Antisense strand AUUCAGUGAUUGUCGCUGGGC 77 Sense strand UAAAGAUUCACCAAGUUUC 66 siRNA 21Antisense strand UAAACUUGGUGAAUCUUUAUU 78 Sense strand UAAAGAUUCACCAAGUUUC 66 siRNA 22Antisense strand AAAACUUGGUGAAUCUUUAUU 79In some embodiments, the single-stranded oligonucleotide is the antisense strand of any one of siAPOE1-M1to siAPOE22-M1 as show in Table 1B. In some embodiments, the single-strandedoligonucleotide is the antisense strand of any one of Conjugates 1 to 25 as show in Table 2.The double-stranded oligonucleotide of the present disclosureIn another aspect, the present disclosure also provides a double-stranded oligonucleotide comprising a sense strand and an antisense strand, wherein each nucleotide in the sense strand is a modified or unmodified nucleotide, and the sense strand and the antisense strand are at least partially reverse complementary to form a double-stranded region, and wherein the antisense strand is the above single-stranded oligonucleotide of the present disclosure.In the double-stranded oligonucleotide of the present disclosure, the sense strand and the antisense strand each have a length of 19-26 nucleotides. In some embodiments, the sense strand has a length of 19-23 nucleotides. As such, the length ratio of the sense strand to the antisense strand in the double-stranded oligonucleotide of the present disclosure can be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 23 / 23, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the sense strand has a length of 15-26 or 17-24 nucleotides. In some embodiments, the sense strand has a length of 19-21 nucleotides. In some embodiments, for ease of synthesis, the sense strand has a length of 19-21 nucleotides, and the antisense strand has a length of 19-23 nucleotides. In some embodiments, the sense strand and the antisense strand have a length difference of 0-5 nucleotides. In some embodiments, the length of the sense strand is not greater than the length of the antisense strand. In some embodiments, the sense strand and the antisense strand have an equal length of 19, 20 or 21 nucleotides. In some embodiments, the sense strand has a length of 19-21 nucleotides, the antisense strand has a length of 20-24 nucleotides, and the length of the antisense strand is greater than the length of the sense strand by 1-3 nucleotides. In some embodiments, the length of the antisense strand is greater than the length of the sense strand by 2 nucleotides. In some embodiments, the sense strand has a length of 19 nucleotides, and the antisense strand has a length of 21 nucleotides; or the sense strand has a length of 21 nucleotides, and the antisense strand has a length of 21 nucleotides; or the sense strand has a length of 21 nucleotides, and the antisense strand has a length of 23 nucleotides. In some embodiments, the sense strand has a length of 19 nucleotides, and the antisense strand has a length of 21 nucleotides. In some embodiments, the sense strand has a length of 21 nucleotides, and the antisense strand has a length of 23 nucleotides.In some embodiments, in the sense strand of the double-stranded oligonucleotide of the present disclosure, in a 3’ to 5’ direction, 2 to 3 nucleotides of the 11th to 13th nucleotides of the sense strand are fluoro modified nucleotides, and the first nucleotide and / or the last nucleotide of thesense strand is an alkoxy modified nucleotide or an inverted abasic deoxyribonucleotide (abbreviated as invab or ia, having the structure as shown by Formula (35)). In some embodiments, in addition to the above-mentioned fluoro modified nucleotides and inverted abasic deoxyribonucleotide, the nucleotides at the remaining positions in the sense strand independently of one another are non-fluoro modified nucleotides, and each of the non-fluoro modified nucleotides is independently one selected from an alkoxy modified nucleotide, an alkyl modified nucleotide, an amine modified nucleotide, and a thermally destabilizing nucleotide.Formula (35)In some embodiments, in a 3’ to 5’ direction, the 11th and 13th nucleotides, or the 11th to 13th nucleotides of the sense strand are fluoro modified nucleotides, the first and / or the last nucleotide is an alkoxy modified nucleotide or an inverted abasic deoxyribonucleotide, and the nucleotides at the remaining positions independently of one another are alkoxy modified nucleotides. In some embodiments, in a 3’ to 5’ direction, the first nucleotide of the sense strand is an alkoxy modified nucleotide or an inverted abasic deoxyribonucleotide.In some embodiments, the oxygen atom directly linked to the ribose ring, as shown in Formula (35) can be linked to the 3’ phosphate group of the penultimate nucleotide at 3’ terminal of the sense strand. In some embodiments, the oxygen atom directly linked to the ribose ring as shown in Formula (35) can be linked to the 3’ phosphate group of the 3’ terminal nucleotide of the sense strand, and the oxygen atom linked to the ribose ring via a methylene group as shown in Formula (35) can be linked to a hydrogen atom, a hydroxyl protecting group, or a delivery group as described below.In some embodiments, the oxygen atom linked to the ribose ring via a methylene group as shown in Formula (35) can be linked to the 5’ phosphate group of the penultimate nucleotide at 5’ terminal of the sense strand. In some embodiments, the oxygen atom linked to the ribose ring via a methylene group as shown in Formula (35) is linked to the 5’ phosphate group of thepenultimate nucleotide at 5’ terminal of the sense strand, and the oxygen atom directly linked to the ribose ring as shown in Formula (35) can be linked to a hydrogen atom, a hydroxyl protecting group, or a delivery group as described below.In some embodiments, the sense strand comprises 19-21 nucleotides, and the antisense strand comprises 21-23 nucleotides; in a 3’ to 5’ direction, the 11th and 13th nucleotides or the 11th to 13th nucleotides of the sense strand are fluoro modified nucleotides, the first and / or last nucleotide of the sense strand is a methoxy modified nucleotide or an inverted abasic deoxyribonucleotide, and the nucleotides at the remaining positions independently of one another are alkoxy modified nucleotides. In this case, through the position coordination of the modified nucleotides in the sense strand and the antisense strand, the double-stranded oligonucleotide of the present disclosure exhibits better stability and / or RISC complex-forming activity, thereby demonstrating stable and efficient inhibitory activity against APOE4 mRNA. In some embodiments, each of the alkoxy modified nucleotides independently of one another is a methoxy modified nucleotide.In some embodiments, in the sense strand, at least one of the linking groups linking two adjacent nucleotides is a phosphate ester group with modification group(s), and the phosphate ester group with modification group(s) is present in at least one position of the positions between two adjacent nucleotides of the 1st to the 5th nucleotides at 5’ terminal of the sense strand and the positions between two adjacent nucleotides of the 1st to the 5th nucleotides at 3’ terminal of the sense strand. In this case, the double-stranded oligonucleotide of the present disclosure achieves a good balance between the ability to resist exonucleases and APOE4 mRNA, thereby showing enhanced stability while maintaining highly efficient inhibitory activity against APOE4 mRNA. In some embodiments, 1 to 4 of the linking groups linking adjacent nucleotides of the 1st to 5th nucleotides at 5’ terminal of the sense strand, and / or 1 to 4 of the linking groups linking adjacent nucleotides of the 1st to 5th nucleotides at 3’ terminal of the sense strand are each independently phosphate ester groups with modification group(s). In some embodiments, all 4 of the linking groups linking adjacent nucleotides of the 1st to 5th nucleotides at 5’ terminal of the sense strand are each independently phosphate ester groups with modification group(s). In some embodiments, all 4 groups of the linking groups linking adjacent nucleotides of the 1st to 5th nucleotides at 3’ terminal of the sense strand are each independently phosphate ester groups with modification group(s). In some embodiments, the linking groups linking two adjacent nucleotides of the 1st to 3rd, 1st to 4th or 1st to 5th nucleotides at 5’ terminal and / or 3’ terminal of the sense strand are phosphate ester groups with modification group(s). In some embodiments, the linking groups linking adjacent nucleotides of the 1st to 3rd nucleotides at 5’terminal of the sense strand are phosphate ester groups with modification group(s). The definition and selection range of the phosphate ester group with modification group(s) are the same as the above phosphate ester group with modification group(s) of the antisense strand of the present disclosure. In some embodiments, each phosphate ester group with modification group(s) is independently a phosphorothioate group having the structure as shown by Formula (28).In some embodiments, the sense strand is the sense strand of any one of siAPOE1-M1 to siAPOE22-M1 as shown in Table 1B. In some embodiments, the sense strand is the sense strand of any one of Conjugates 1 to 25 as shown in Table 2. In some embodiments, the sense strand is any one of SEQ ID NO: 61 to SEQ ID NO: 66 as shown in Table 1A.In some embodiments, the sense strand comprises 19-21 nucleotides and the antisense strand comprises 21-23 nucleotides; in a 3’ to 5’ direction in the sense strand, the 11th and 13th nucleotides, or the 11th to 13th nucleotides are fluoro modified nucleotides, the first nucleotide and / or the last nucleotide of the sense strand are an alkoxy modified nucleotide or an inverted abasic deoxyribonucleotide, and the nucleotides at the remaining positions independently of one another are alkoxy modified nucleotides; 1 to 4 of the linking groups linking adjacent nucleotides of the 1st to 5th nucleotides at 5’ terminal of the sense strand and / or 1 to 4 of the linking groups linking adjacent nucleotides of the 1st to 5th nucleotides at 3’ terminal of the sense strand are each independently phosphate ester groups with modification group(s).In some embodiments, the sense strand comprises 19-21 nucleotides and the antisense strand comprises 21-23 nucleotides; in a 3’ to 5’ direction in the sense strand, the 11th to 13th nucleotides are fluoro modified nucleotides, the first nucleotide is an alkoxy modified nucleotide or an inverted abasic deoxyribonucleotide, and the nucleotides at the remaining positions independently of one another are alkoxy modified nucleotides; 1 to 4 of the linking groups linking adjacent nucleotides of the 1st to 5th nucleotides at 5’ terminal of the sense strand and / or 1 to 4 of the linking groups linking adjacent nucleotides of the 1st to 5th nucleotides at 3’ terminal of the sense strand are each independently phosphate ester groups with modification group(s); in a 5’ to 3’ direction in the antisense strand, the 13th nucleotide is a substituted alkoxy modified nucleotide, the 14th nucleotide is a nucleotide X, the 2nd, 6th and 16th nucleotides are fluoro modified nucleotides, and each remaining nucleotide in the antisense strand independently of one another is an alkoxy modified nucleotide; the linking groups linking any two adjacent nucleotides of the 1st to the 3rd nucleotides at 5’ terminal and the linking groups linking any two adjacent nucleotides of the 1st to the 3rd nucleotides at 3’ terminal of the antisense strand independently of one another are phosphate ester groups with modificationgroup(s); and the 5’ terminal nucleotide of the antisense strand is a 5 ’-hydroxy nucleotides as shown by Formula (29) or 5’-vinyl phosphate modified nucleotides as shown by Formula (31). In some embodiments, the linking groups linking every two adjacent nucleotides of the 1st to 2nd, 1st to 3rd, 1st to 4th, or 1st to 5th nucleotides at 5’ terminal and / or 3’ terminal of the sense strand are phosphate ester groups with modification group(s), and the linking groups linking the remaining adjacent nucleotides of the sense strand are phosphate ester groups. In some embodiments, the linking groups linking every two adjacent nucleotides of the 1st to 3rd, 1st to 4th or 1st to 5th nucleotides at 5’ terminal of the sense strand are phosphate ester groups with modification group(s), and the linking groups linking the remaining adjacent nucleotides of the sense strand are phosphate ester groups. In some embodiments, the linking groups linking two adjacent nucleotides of the 1st to 2rd, 1st to 3rd, 1st to 4th, or 1st to 5th nucleotides at 3’ terminal of the sense strand are phosphate ester groups with modification group(s), and the linking groups linking the remaining adjacent nucleotides of the sense strand are phosphate ester groups. In some embodiments, the phosphate ester group with modification group(s) is a phosphorothioate group having the structure as shown by Formula (28), and the alkoxy modified nucleotide is a 2’ -methoxy modified nucleotide.In some embodiments, in the double-stranded oligonucleotide of the present disclosure, the sense strand comprises 19 nucleotides and the antisense strand comprises 21 nucleotides; in a 3’ to 5’ direction in the sense strand, the 11th to 13th nucleotides are fluoro modified nucleotides, the first nucleotide is an inverted abasic deoxyribonucleotide, and the nucleotides at the remaining positions independently of one another are methoxy modified nucleotides; 1 to 4 of the linking groups linking adjacent nucleotides of the 1st to 5th nucleotides at 5’ terminal of the sense strand is each independently a phosphorothioate group; in a 5’ to 3’ direction in the antisense strand, the 13th nucleotide is a 2’-O-methoxyethyl modified nucleotide, the 14th nucleotide is a deoxynucleotide, the 2nd, 6th and 16th nucleotides are fluoro modified nucleotides, and each remaining nucleotide in the antisense strand independently of one another is a methoxy modified nucleotide; in the antisense strand, the linking groups linking two adjacent nucleotides of the 1st to the 3rd nucleotides at 5’ terminal and the linking groups linking two adjacent nucleotides of the 1st to the 3rd nucleotides at 3’ terminal of the antisense strand are phosphorothioate groups; the 5’ terminal nucleotide in the antisense strand is a 5’-hydroxy nucleotide as shown by Formula (29) or a 5 ’-vinyl phosphate modified nucleotide as shown by Formula (31).By adopting above modification schemes, the single- stranded oligonucleotide, the doublestranded oligonucleotide, the conjugate and / or the pharmaceutical composition of the presentdisclosure could achieve a good balance between APOE4 mRNA regulatory activity and in vivo stability. In the context of the present disclosure, a “modification scheme” refers to a combination of nucleotide ribose modifications, phosphate modifications, 5’ terminal modifications, and / or base modifications which are unrelated or weakly related to specific sequences and are in different numbers, positions, and types. In some embodiments, by adopting the above modification schemes, the double-stranded oligonucleotide of the present disclosure could maintain excellent stability without significantly reducing the original pharmaceutical activity of the double-stranded oligonucleotide, to achieve a good balance between APOE4 mRNA regulatory activity and in vivo stability. In some embodiments, the double-stranded oligonucleotide of the present disclosure is siRNA, and by adopting the above modification schemes, the double-stranded oligonucleotide of the present disclosure could maintain excellent stability without significantly reducing the original RNAi activity of the siRNA, to achieve a good balance between inhibitory activity against APOE4 mRNA and in vivo stability.In some embodiments, the double-stranded oligonucleotide of the present disclosure consists of a double-stranded region that is substantially reverse complementary or completely reverse complementary, and one or two overhanging terminals of the sense strand and / or one or two overhanging terminals of the antisense strand. In some embodiments, the double-stranded oligonucleotide of the present disclosure consists of a double-stranded region that is substantially reverse complementary or completely reverse complementary and one overhanging terminal of the antisense strand.In some embodiments, the double-stranded region formed by the sense strand and the antisense strand comprises at least 16 base pairs. In some embodiments, the double-stranded region formed by the sense strand and the antisense strand comprises 16-23 base pairs. In some embodiments, the double-stranded region formed by the sense strand and the antisense strand comprises 18, 19, 20, or 21 base pairs.In some embodiments, the sense strand and the antisense strand are basically reverse complementary, substantially reverse complementary, or completely reverse complementary. In some embodiments, the sense strand and the antisense strand are substantially reverse complementary or completely reverse complementary within the double-stranded region. In some embodiments, in a 5’ to 3’ direction, at least the nucleotide sequence of the sense strand, except for the first and the last nucleotides, is substantially reverse complementary or completely reverse complementary to the antisense strand. In some embodiments, in a 5’ to 3’ direction, the nucleotide sequence of the sense strand, except for the last nucleotide, is completely reverse complementary to the antisense strand; or all the nucleotides of the sensestrand are completely reverse complementary to the antisense strand.In some embodiments, in the double-stranded oligonucleotide of the present disclosure, the unmodified equivalent sequence of the sense strand comprises a nucleotide sequence having an equal length to the nucleotide sequence m with no more than 3 base differences, no more than 1 base difference, or no base difference, wherein the nucleotide sequence m is defined and selected as described above.In the context, an “unmodified equivalent sequence” refers to an oligonucleotide sequence that does not comprise any ribose ring modification, base modification, and phosphate backbone modification as compared with the original sequence which serves as the alignment reference. For example, the unmodified equivalent sequence of VPAmsCfsdTGmsUmia is ACUGUN, wherein N is A, C, G, or U.In the context, when a nucleotide sequence has a “base difference” from another nucleotide sequence, it means that the bases of the nucleotides at the same position therebetween are changed. For example, if a nucleotide base in the second sequence is A and the nucleotide base at the same position in the first sequence is U, C, G or T, then these two nucleotide sequences are considered as having a base difference at this position. When a base is modified, if the modification does not affect the purine-pyrimidine pairing relationship when the above doublestranded nucleic acid structure is formed, the modified base and the original base are considered as having no base difference therebetween. In some embodiments, it is considered that there is no base difference between U and T. In some embodiments, it is considered that there is no base difference between C and 5-methylcytosine (5mC). In some embodiments, if a nucleotide at a position is replaced with an abasic nucleotide or a nucleotide analogue thereof, it is also considered that there is a base difference at the position. When two nucleotide sequences are aligned to determine the number of base differences, they are aligned in a manner that minimizes the number of base differences among all alignment manners and the base differences are determined according to this alignment manner. In this case, “same position” means the corresponding positions between the two nucleotide sequences in this alignment manner. For example, if when positions 1-5 of a nucleotide sequence A are aligned with positions 2-6 of a nucleotide sequence B in the same direction, the number of base differences is minimum as compared with other alignment manners, then “same position” means that position 1 of the nucleotide sequence A is aligned to position 2 of the nucleotide sequence B, position 2 of the nucleotide sequence A is aligned to position 3 of the nucleotide sequence B, and so on.In some embodiments, the number of base differences between two nucleotide sequences of different lengths refers to the number of base differences calculated within the nucleotidesequence segments spanning from the first nucleotide with no base difference to the last nucleotide with no base difference when the sequences are aligned in the above manner that minimizes the number of base differences. In some embodiments, the number of base differences between two nucleotide sequences of identical length means that the total number of base differences between the first nucleotide to the last nucleotide of any nucleotide sequence and the first nucleotide to the last nucleotide of another nucleotide sequence in the same direction. In some embodiments, no base difference between two nucleotide sequences of different lengths means that there is no base difference between the first nucleotide to the last nucleotide of the shorter nucleotide sequence and the nucleotide at each corresponding position of another nucleotide sequence in the same direction. In some embodiments, no base difference between two nucleotide sequences of identical length means that there is no base difference between the first nucleotide to the last nucleotide of one nucleotide sequence and the first nucleotide to the last nucleotide of another nucleotide sequence in the same direction.The double-stranded oligonucleotides of the present disclosure can be a variety of doublestranded oligonucleotides capable of regulating APOE4 mRNA expression. In some embodiments, they can be double-stranded oligonucleotides that inhibit or down-regulate APOE4 mRNA expression (such as siRNA); in some embodiments, they can be double-stranded oligonucleotides that activate or up-regulate APOE4 mRNA expression (such as saRNA). In some embodiments, the double-stranded oligonucleotide is siRNA.In some embodiments, the double-stranded oligonucleotide of the present disclosure can be the following first to ninth double-stranded oligonucleotide. Each double-stranded oligonucleotide will be described below, respectively.First double-stranded oligonucleotideIn some embodiments, the present disclosure provides a first double-stranded oligonucleotide. The first double-stranded oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence I and the antisense strand comprises the nucleotide sequence II, and the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 1 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 2 with no more than 3 base differences:5’- AAAGAUUCACCAAGUUUCZi-3’ (SEQ ID NO: 1);5’- Z2GAAACUUGGUGAAUCUUU-3’ (SEQ ID NO: 2),wherein Zi is A or ia, and Z2 is U; the nucleotide sequence I comprises a nucleotide Z’ 1 at theposition corresponding to Zi; the nucleotide sequence II comprises a nucleotide Z’2 at the position corresponding to Z2, wherein Z’2 is the first nucleotide at 5’ terminal of the antisense strand. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 1 with no more than 3 base differences and the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 2 with no more than 3 base differences.In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.In some embodiments, there is no more than 1 base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 1, and / or there is no more than 1 base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 1 with 1 base difference and / or the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 2 with 1 base difference. Therein, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 1 can include a difference at the position of Z’i and / or a base difference at any other nucleotide position in the nucleotide sequence I. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 1 can include a base difference at the position of Z’ 1 and / or a base difference at a nucleotide position adjacent to Z’i. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: l is a base difference at the position of Z’ 1, wherein Z’ 1 is preferably an inverted abasic deoxyribonucleotide. In some embodiments, there is no base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 1. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 1 with no base difference.In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 includes a base difference at the position of Z’2, wherein Z’2 is selected from C, A or G. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 is a difference at the position of Z’2, wherein Z’2 is selected from C, A or G. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2. Thus, in one embodiment, the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 2 with no base difference.Second double-stranded oligonucleotideIn some embodiments, the present disclosure provides a second double-stranded oligonucleotide. The second double-stranded oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence I and the antisense strand comprises the nucleotide sequence II, and the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 3 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 4 with no more than 3 base differences:5’- UAAAGAUUCACCAAGUUUZ3-3’ (SEQ ID NO: 3);5’ - Z4AAACUUGGUGAAUCUUUA-3’ (SEQ ID NO: 4),wherein Z3 is C, A or ia, and Z4 is G or U; the nucleotide sequence I comprises a nucleotide Z’3 at the position corresponding to Z3; the nucleotide sequence II comprises a nucleotide Z’4 at the position corresponding to Z4, wherein Z’4 is the first nucleotide at 5’ terminal of the antisense strand. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 3 with no more than 3 base differences and the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 4 with no more than 3 base differences.In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.In some embodiments, there is no more than 1 base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 3, and / or there is no more than 1 base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 4. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 3 with 1 base difference and / or the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 4 with 1 base difference. Therein, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 3 can include a base difference at the position of Z’3, and / or a base difference at any other nucleotide position in the nucleotide sequence I. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 3 can include a base difference at the position of Z’3 and / or a base difference at a nucleotide position adjacent to Z’3. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 3 is a base difference at the position of Z’3, wherein Z’3 is preferably an inverted abasicdeoxyribonucleotide. In some embodiments, there is no base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 3. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 3 with no base difference.In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 4 includes a difference at the position of Z’4, wherein Z’4 is selected from C, U or A. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 4 is a difference at the position of Z’4, wherein Z’4 is selected from C, U or A. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 4. Thus, in one embodiment, the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 4 with no base difference.Third double-stranded oligonucleotideIn some embodiments, the present disclosure provides a third double-stranded oligonucleotide. The third double-stranded oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence I and the antisense strand comprises the nucleotide sequence II, and the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 5 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 6 with no more than 3 base differences:5’- CGACAAUCACUGAACGCCZ5-3’ (SEQ ID NO: 5);5’ - Z6GGCGUUCAGUGAUUGUCG-3’ (SEQ ID NO: 6),wherein Z5 is G, A or ia, and Ze is C or U; the nucleotide sequence I comprises a nucleotide Z’5 at the position corresponding to Z5; the nucleotide sequence II comprises a nucleotide Z’ & at the position corresponding to Ze, wherein Z’e is the first nucleotide at 5’ terminal of the antisense strand. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 5 with no more than 3 base differences and the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 6 with no more than 3 base differences.In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.In some embodiments, there is no more than 1 base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 5, and / or there is no more than 1 basedifference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 6. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 5 with 1 base difference and / or the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 6 with 1 base difference. Therein, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 5 can include a base difference at the position of Z’s, and / or a base difference at any other nucleotide position in the nucleotide sequence I. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 5 can include a base difference at the position of Z’s and / or a base difference at a nucleotide position adjacent to Z’s. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 5 is a base difference at the position of Z’s, wherein Z’s is preferably an inverted abasic deoxyribonucleotide. In some embodiments, there is no base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 5. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 5 with no base difference.In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 6 includes a difference at the position of Z’ 6, wherein Z’e is selected from A, U or G. In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 6 is a difference at the position of Z’e, wherein Z’e is selected from A, U or G. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 6. Thus, in one embodiment, the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 6 with no base difference.Fourth double-stranded oligonucleotideIn some embodiments, the present disclosure provides a fourth double-stranded oligonucleotide. The fourth double-stranded oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence I and the antisense strand comprises the nucleotide sequence II, and the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 7 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 8 with no more than 3 base differences:5’- CUAGUUUAAUAAAGAUUCZ7-3’ (SEQ ID NO: 7);5’ - Z8GAAUCUUUAUUAAACUAG-3’ (SEQ ID NO: 8),wherein Z7 is A or ia and Z8is U; the nucleotide sequence I comprises a nucleotide Z’7 at the position corresponding to Z7; the nucleotide sequence II comprises a nucleotide Z’8at the position corresponding to Z8, wherein Z’8is the first nucleotide at 5’ terminal of the antisense strand. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 7 with no more than 3 base differences and the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 8 with no more than 3 base differences.In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.In some embodiments, there is no more than 1 base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 7, and / or there is no more than 1 base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 8. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 7 with 1 base difference and / or the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 8 with 1 base difference. Therein, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 7 can include a base difference at the position of Z’7, and / or a base difference at any other nucleotide position in the nucleotide sequence I. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 7 can include a base difference at the position of Z’7 and / or a base difference at a nucleotide position adjacent to Z’7. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 7 is a base difference at the position of Z’7, wherein Z’7 is preferably an inverted abasic deoxyribonucleotide. In some embodiments, there is no base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 7. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 7 with no base difference.In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 8 includes a difference at the position of Z’8, wherein Z’8is selected from C, A or G. In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 8 is a difference at the position of Z’8, wherein Z’8is selected from C, A or G. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 8. Thus,in one embodiment, the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 8 with no base difference.Fifth double-stranded oligonucleotideIn some embodiments, the present disclosure provides a fifth double-stranded oligonucleotide. The fifth double-stranded oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence I and the antisense strand comprises the nucleotide sequence II, and the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 31 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 32 with no more than 3 base differences:5’- AGUUGAAGGCCUACAAAUZ9-3’ (SEQ ID NO: 31);5’- ZioAUUUGUAGGCCUUCAACU-3’ (SEQ ID NO: 32),wherein Z9 is C, A or ia, and Z10 is G or U; the nucleotide sequence I comprises a nucleotide Z’9 at the position corresponding to Z9; the nucleotide sequence II comprises a nucleotide Z’10 at the position corresponding to Z10, wherein Z’10 is the first nucleotide at 5’ terminal of the antisense strand. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 31 with no more than 3 base differences and the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 32 with no more than 3 base differences.In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.In some embodiments, there is no more than 1 base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 31, and / or there is no more than 1 base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 32. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 31 with 1 base difference and / or the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 32 with 1 base difference. Therein, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 31 can include a base difference at the position of Z’9, and / or a base difference at any other nucleotide position in the nucleotide sequence I. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 31 can include a base difference at the position of Z’9 and / or a base difference at a nucleotide position adjacent to Z’9. In some embodiments, the basedifference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 31 is a base difference at the position of Z’9, wherein Z’9 is preferably an inverted abasic deoxyribonucleotide. In some embodiments, there is no base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 31. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 31 with no base difference.In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 32 includes a difference at the position of Z’10, wherein Z’10 is selected from C, A or U. In some embodiments, the base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 32 is a difference at the position of Z’ 10, wherein Z’ 10 is selected from C, A or U. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 32. Thus, in one embodiment, the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 32 with no base difference.Sixth double-stranded oligonucleotideIn some embodiments, the present disclosure provides a sixth double-stranded oligonucleotide. The sixth double-stranded oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises the nucleotide sequence II, and the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 33 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 34 with no more than 3 base differences:5’- GGUGGACCCUAGUUUAAUZn-3’ (SEQ ID NO: 33);5’- Z 12 AUUAAACUAGGGUCC ACC-3’ (SEQ ID NO: 34),wherein Z₁₁ is A or ia, and Z₁₂ is U; the nucleotide sequence I comprises a nucleotide Z’n at the position corresponding to Zu; the nucleotide sequence II comprises a nucleotide Z’12 at the position corresponding to Z12, wherein Z’12 is the first nucleotide at 5’ terminal of the antisense strand. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 33 with no more than 3 base differences and the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 34 with no more than 3 base differences.In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.In some embodiments, there is no more than 1 base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 33, and / or there is no more than 1 base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 34. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 33 with 1 base difference and / or the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 34 with 1 base difference. Therein, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 33 can include a base difference at the position of Z’n, and / or a base difference at any other nucleotide position in the nucleotide sequence I. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 33 can include a base difference at the position of Z’ n and / or a base difference at a nucleotide position adjacent to Z’u. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 33 is a base difference at the position of Z’ u, wherein Z’ n is preferably an inverted abasic deoxyribonucleotide. In some embodiments, there is no base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 33. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 33 with no base difference.In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 34 includes a difference at the position of Z’12, wherein Z’12 is selected from C, A or G. In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 34 is a difference at the position of Z’12, wherein Z’12 is selected from C, A or G. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 34. Thus, in one embodiment, the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 34 with no base difference.Seventh double-stranded oligonucleotideIn some embodiments, the present disclosure provides a seventh double-stranded oligonucleotide. The seventh double-stranded oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence I and the antisense strand comprises the nucleotide sequence II, and the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 35 with no more than 3 base differences;and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 36 with no more than 3 base differences:5’- CAGCGACAAUCACUGAACZ13-3’ (SEQ ID NO: 35);5’ - Z14GUUCAGUGAUUGUCGCUG-3’ (SEQ ID NO: 36),wherein Z₁₃ is G, A or ia, and Z₁₄ is C or U; the nucleotide sequence I comprises a nucleotide Z’13 at the position corresponding to Z13; the nucleotide sequence II comprises a nucleotide Z’14 at the position corresponding to Z14, wherein Z’14 is the first nucleotide at 5’ terminal of the antisense strand. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 35 with no more than 3 base differences and the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 36 with no more than 3 base differences.In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.In some embodiments, there is no more than 1 base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 35, and / or there is no more than 1 base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 36. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 35 with 1 base difference and / or the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 36 with 1 base difference. Therein, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 35 may include a base difference at the position of Z’13, and / or a base difference at any other nucleotide position in the nucleotide sequence I. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 35 can include a base difference at the position of Z’13 and / or a base difference at a nucleotide position adjacent to Z’13. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 35 is a base difference at the position of Z’13, wherein Z’13 is preferably an inverted abasic deoxyribonucleotide. In some embodiments, there is no base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 35. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 35 with no base difference.In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 36 includes a difference at the position of Z’14, wherein Z’14 is selected from U, A or G. In some embodiments, the difference between the nucleotide sequenceII and the nucleotide sequence shown in SEQ ID NO: 36 is a difference at the position of Z’14, wherein Z’14 is selected from U, A or G. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 36. Thus, in one embodiment, the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 36 with no base difference.Eighth double-stranded oligonucleotideIn some embodiments, the present disclosure provides an eighth double-stranded oligonucleotide. The eighth double-stranded oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence I and the antisense strand comprises the nucleotide sequence II, and the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 37 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 38 with no more than 3 base differences:5’-CCAGCGACAAUCACUGAAZI5-3’ (SEQ ID NO: 37);5’-ZI6UUCAGUGAUUGUCGCUGG-3’ (SEQ ID NO: 38),wherein Z₁₅ is C, A or ia, and Z₁₆ is G or U; the nucleotide sequence I comprises a nucleotide Z’15 at the position corresponding to Z15; the nucleotide sequence II comprises a nucleotide Z’i6 at the position corresponding to Zi6, wherein Z’i6 is the first nucleotide at 5’ terminal of the antisense strand. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 37 with no more than 3 base differences and the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 38 with no more than 3 base differences.In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.In some embodiments, there is no more than 1 base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 37, and / or there is no more than 1 base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 38. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 37 with 1 base difference and / or the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 38 with 1 base difference. Therein, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 37 can include a base difference at the position of Z’15 and / or a base difference at any other nucleotide position in the nucleotide sequence I. Insome embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 37 can include a base difference at the position of Z’15 and / or a base difference at a nucleotide position adjacent to Z’15. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 37 is a base difference at the position of Z’15, wherein Z’15 is preferably an inverted abasic deoxyribonucleotide. In some embodiments, there is no base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 37. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 37 with no base difference.In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 38 includes a difference at the position of Z’i6, wherein Z’i6 is selected from U, A or C. In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 38 is a difference at the position of Z’i6, wherein Z’i6 is selected from U, A or C. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 38. Thus, in one embodiment, the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 38 with no base difference.Ninth double-stranded oligonucleotideIn some embodiments, the present disclosure provides a ninth double-stranded oligonucleotide. The ninth double-stranded oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence I and the antisense strand comprises the nucleotide sequence II, and the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 39 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 40 with no more than 3 base differences:5’-GUGGACCCUAGUUUAAUAZi7-3’ (SEQ ID NO: 39);5’- Z18UAUUAAACUAGGGUCCAC-3’ (SEQ ID NO: 40),wherein Z₁₇ is A or ia, and Z₁₈ is U; the nucleotide sequence I comprises a nucleotide Z’17 at the position corresponding to Z17; the nucleotide sequence II comprises a nucleotide Z’is at the position corresponding to Zis, wherein Z’is is the first nucleotide at 5’ terminal of the antisense strand. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 39 with no more than 3 base differences and thenucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 40 with no more than 3 base differences.In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.In some embodiments, there is no more than 1 base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 39, and / or there is no more than 1 base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 40. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 39 with 1 base difference and / or the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 40 with 1 base difference. Therein, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 39 can include a base difference at the position of Z’17 and / or a base difference at any other nucleotide position in the nucleotide sequence I. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 39 can include a base difference at the position of Z’17 and / or a base difference at a nucleotide position adjacent to Z’17. In some embodiments, the base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 39 is a base difference at the position of Z’17, wherein Z’17 is preferably an inverted abasic deoxyribonucleotide. In some embodiments, there is no base difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 39. Thus, in one embodiment, the nucleotide sequence I comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 39 with no base difference.In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 40 includes a difference at the position of Z’is, wherein Z’is is selected from G, A or C. In some embodiments, the difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 40 is a difference at the position of Z’is, wherein Z’is is selected from G, A or C. In some embodiments, there is no base difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 40. Thus, in one embodiment, the nucleotide sequence II comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 40 with no base difference.In some embodiments, the nucleotide sequence I has no more than 1 base difference or no base difference from the nucleotide sequence as shown in any one of SEQ ID NO: 61 to SEQ ID NO: 66 in Table 1 A, and the nucleotide sequence II has no more than 1 base difference or no basedifference from the 1st to 19th nucleotides of the nucleotide sequence as shown in any one of SEQ ID NO: 67 to SEQ ID NO: 79 in Table 1 A.In some embodiments, for the above nine double-stranded oligonucleotides, in a 5’ to 3’ direction, the 2nd to 19th nucleotides in the nucleotide sequence II are completely reverse complementary to APOE4 mRNA. In some embodiments, the nucleotide sequence II is completely reverse complementary to the nucleotide sequence I. Alternatively, there is a base mismatch between the second nucleotide in the nucleotide sequence II in a 5’ to 3’ direction and the second nucleotide in the nucleotide sequence I in a 3’ to 5’ direction. By incorporating this base mismatch, the double-stranded oligonucleotides have higher inhibitory activity against the expression of a target gene while maintaining low off-target effect.In some embodiments, for the above nine double-stranded oligonucleotides, the sense strand further comprises a nucleotide sequence III, and the antisense strand further comprises a nucleotide sequence IV, wherein the nucleotide sequence III has a length of 1, 2, 3 or 4 nucleotides, the nucleotide sequence IV and the nucleotide sequence III have an equal length and are substantially reverse complementary or completely reverse complementary to each other, and the nucleotide sequence III is linked to 5’ terminal of the nucleotide sequence I. In some embodiments, in the first double-stranded oligonucleotide, in a 5’ to 3’ direction, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 1 nucleotide, the base of the nucleotide sequence III is U, and the base of the nucleotide sequence IV is A; in this case, the length ratio of the sense strand to the antisense strand is 20 / 20. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is AU, and the base composition of the nucleotide sequence IV is AU; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is AAU, and the base composition of the nucleotide sequence IV is AUU; in this case, the length ratio of the sense strand to the antisense strand is 22 / 22.Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is UAAU, and the base composition of the nucleotide sequence IV is AUUA; in this case, the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III isAU, and the base composition of the nucleotide sequence IV is AU; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21.In some embodiments, in the second double-stranded oligonucleotide, in a 5’ to 3’ direction, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 1 nucleotide, the base of the nucleotide sequence III is A, and the base of the nucleotide sequence IV is U; in this case, the length ratio of the sense strand to the antisense strand is 20 / 20. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is AA, and the base composition of the nucleotide sequence IV is UU; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is UAA, and the base composition of the nucleotide sequence IV is UUA; in this case, the length ratio of the sense strand to the antisense strand is 22 / 22.Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is UUAA, and the base composition of the nucleotide sequence IV is UUAA; in this case, the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is AA, and the base composition of the nucleotide sequence IV is UU; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21.In some embodiments, in the third double-stranded oligonucleotide, in a 5’ to 3’ direction, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 1 nucleotide, the base of the nucleotide sequence III is G, and the base of the nucleotide sequence IV is C; in this case, the length ratio of the sense strand to the antisense strand is 20 / 20. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is AG, and the base composition of the nucleotide sequence IV is CU; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is CAG, and the base composition of the nucleotide sequence IV is CUG; in this case, the length ratio of the sense strand to the antisense strand is 22 / 22.Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is CCAG, and the base composition of the nucleotide sequence IV is CUGG; in this case, the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is AG, and the base composition of the nucleotide sequence IV is CU; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21.In some embodiments, in the fourth double-stranded oligonucleotide, in a 5’ to 3’ direction, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 1 nucleotide, the base of the nucleotide sequence III is C, and the base of the nucleotide sequence IV is G; in this case, the length ratio of the sense strand to the antisense strand is 20 / 20. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is CC, and the base composition of the nucleotide sequence IV is GG; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is ACC, and the base composition of the nucleotide sequence IV is GGU; in this case, the length ratio of the sense strand to the antisense strand is 22 / 22.Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is GACC, and the base composition of the nucleotide sequence IV is GGUC; in this case, the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is CC, and the base composition of the nucleotide sequence IV is GG; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21.In some embodiments, in the fifth double-stranded oligonucleotide, in a 5’ to 3’ direction, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 1 nucleotide, the base of the nucleotide sequence III is G, and the base of the nucleotide sequence IV is C; in this case, the length ratio of the sense strand to the antisense strand is 20 / 20. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 2 nucleotides, and in a 5’ to 3’ direction, the basecomposition of the nucleotide sequence III is GG, and the base composition of the nucleotide sequence IV is CC; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is AGG, and the base composition of the nucleotide sequence IV is CCU; in this case, the length ratio of the sense strand to the antisense strand is 22 / 22.Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is AAGG, and the base composition of the nucleotide sequence IV is CCUU; in this case, the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is GG, and the base composition of the nucleotide sequence IV is CC; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21.In some embodiments, in the sixth double-stranded oligonucleotide, in a 5’ to 3’ direction, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 1 nucleotide, the base of the nucleotide sequence III is G, and the base of the nucleotide sequence IV is C; in this case, the length ratio of the sense strand to the antisense strand is 20 / 20. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is GG, and the base composition of the nucleotide sequence IV is CC; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is UGG, and the base composition of the nucleotide sequence IV is CCA; in this case, the length ratio of the sense strand to the antisense strand is 22 / 22.Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is CUGG, and the base composition of the nucleotide sequence IV is CCAG; in this case, the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is GG, and the base composition of the nucleotide sequence IV is CC; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21.In some embodiments, in the seventh double-stranded oligonucleotide, in a 5’ to 3’ direction, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 1 nucleotide, the base of the nucleotide sequence III is C, and the base of the nucleotide sequence IV is G; in this case, the length ratio of the sense strand to the antisense strand is 20 / 20. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is CC, and the base composition of the nucleotide sequence IV is GG; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is GCC, and the base composition of the nucleotide sequence IV is GGC; in this case, the length ratio of the sense strand to the antisense strand is 22 / 22.Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is UGCC, and the base composition of the nucleotide sequence IV is GGC A; in this case, the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is CC, and the base composition of the nucleotide sequence IV is GG; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21.In some embodiments, in the eighth double-stranded oligonucleotide, in a 5’ to 3’ direction, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 1 nucleotide, the base of the nucleotide sequence III is C, and the base of the nucleotide sequence IV is G; in this case, the length ratio of the sense strand to the antisense strand is 20 / 20. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is GC, and the base composition of the nucleotide sequence IV is GC; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is UGC, and the base composition of the nucleotide sequence IV is GCA; in this case, the length ratio of the sense strand to the antisense strand is 22 / 22.Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition of thenucleotide sequence III is GUGC, and the base composition of the nucleotide sequence IV is GCAC; in this case, the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is GC, and the base composition of the nucleotide sequence IV is GC; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21.In some embodiments, in the ninth double-stranded oligonucleotide, in a 5’ to 3’ direction, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 1 nucleotide, the base of the nucleotide sequence III is G, and the base of the nucleotide sequence IV is C; in this case, the length ratio of the sense strand to the antisense strand is 20 / 20. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is GG, and the base composition of the nucleotide sequence IV is CC; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21. Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 3 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is GGG, and the base composition of the nucleotide sequence IV is CCC; in this case, the length ratio of the sense strand to the antisense strand is 22 / 22.Alternatively, the nucleotide sequence III and the nucleotide sequence IV independently of one another have a length of 4 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is UGGG, and the base composition of the nucleotide sequence IV is CCCA; in this case, the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence III is GG, and the base composition of the nucleotide sequence IV is CC; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21.In some embodiments, the antisense strand further comprises a nucleotide sequence V, wherein each nucleotide in the nucleotide sequence V is independently a non-fluoro modified nucleotide, and the nucleotide sequence V has a length of 1-3 nucleotides and is linked to 3’ terminal of the nucleotide sequence IV or the nucleotide sequence II; after the antisense strand and a sense strand form a double-stranded oligonucleotide, the nucleotide sequence V constitutes a 3’ overhanging terminal of the antisense strand.In some embodiments, the nucleotide sequence V has a length of 2 nucleotides, and in a 5’ to 3’ direction, the nucleotide sequence V comprises 2 contiguous thymine deoxyribonucleotides, 2contiguous uracil nucleotides, or is completely reverse complementary to APOE4 mRNA. In some embodiments, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from UU, AU or AT. In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 2, the nucleotide sequence I consists of SEQ ID NO: 1, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from AU.In some embodiments, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from UU or TT. In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 4, the nucleotide sequence I consists of SEQ ID NO: 3, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the nucleotide sequence V has a base composition of UU.In some embodiments, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from UU, CU or CT. In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 6, the nucleotide sequence I consists of SEQ ID NO: 5, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the nucleotide sequence V has a base composition of CU.In some embodiments, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from UU or GG. In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 8, the nucleotide sequence I consists of SEQ ID NO: 7, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the nucleotide sequence V has a base composition of GG.In some embodiments, the nucleotide sequence V is linked to 3’ terminal of the nucleotidesequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from UU or CC. In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 32, the nucleotide sequence I consists of SEQ ID NO: 31, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from CC.In some embodiments, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from UU or CC. In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 34, the nucleotide sequence I consists of SEQ ID NO: 33, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from CC.In some embodiments, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from UU or GG. In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 36, the nucleotide sequence I consists of SEQ ID NO: 35, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from GG.In some embodiments, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from UU or GC. In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 38, the nucleotide sequence I consists of SEQ ID NO: 37, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from GC.In some embodiments, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from UU or CC. In some embodiments, the sense strand comprises only the nucleotidesequence I, and the antisense strand comprises only the nucleotide sequence II and the nucleotide sequence V, wherein the nucleotide sequence II consists of SEQ ID NO: 40, the nucleotide sequence I consists of SEQ ID NO: 39, the nucleotide sequence V is linked to 3’ terminal of the nucleotide sequence II, and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is selected from CC.In some embodiments, the unmodified equivalent sequence of the double-stranded oligonucleotide of the present disclosure is the siRNA shown in any one of siRNA 10 to siRNA 22 in Table 1A.In some embodiments, the double-stranded oligonucleotide is one of siAPOE1-M1 to siAPOE22-Ml as shown in Table IB below:Table IB The siRNA sequences of the present disclosureSEQ siRNA NO Sequence Direction: 5’ - 3’ID NOSense AoxAoxAoxGoxAoUoUfCfAfCoCoAoAoGoUoUoUo9 siAPOEl- strand xCoxiaMl Antisense P1UosGfsAoAoAoCfUoUoGoGoUoGo(AS)dAUoCfU10 strand oUoUosAosUoSense UoxAoxAoxAoxGoAoUfUfCfAoCoCoAoAoGoUoUo11 siAPOE2- strand xUoxiaMl Antisense P1GosAfsAoAoCoUfUoGoGoUoGoAo(AS)dNCoUfU12 strand oUoAosUosUoSense CoxGoxAoxCoxAoAoUfCfAfCoUoGoAoAoCoGoCo13 siAPOE3- strand xCoxiaM1 Antisense P1CosGfsGoCoGoUfUoCoAoGoUoGo(AS)dNUoGfU14 strand oCoGosCosUoSense CoxUoxAoxGoxUoUoUfAfAfUoAoAoAoGoAoUoUo15 siAPOE4- strand xCoxiaMl Antisense P1UosGfsAoAoUoCfUoUoUoAoUoUo(AS)dAAoCfU16 strand oAoGosGosGoSense AoxGoxUoxUoxGoAoAfGfGfCoCoUoAoCoAoAoAo51 siAPOE5- strand xUoxiaMl Antisense P1GosAfsUoUoUoGfUoAoGoGoCoCo(ZS)dNCoAfA52 strand oCoUosCosCoSense GoxGoxUoxGoxGoAoCfCfCfUoAoGoUoUoUoAoAo53 siAPOE6- strand xUoxiaMl Antisense P1UosAfsUoUoAoAfAoCoUoAoGoGo(GS)dNCoCfA54strand oCoCosCosCoSense CoxAoxGoxCoxGoAoCfAfAfUoCoAoCoUoGoAoAo 55 siAP0E7- strand xCoxiaMl Antisense P1CosGfsUoUoCoAfGoUoGoAoUoUo(GS)dNCoGfC 56 strand oUoGosGosGoSense CoxCoxAoxGoxCoGoAfCfAfAoUoCoAoCoUoGoAo 57 siAP0E8- strand xAoxiaMl Antisense P1GosUfsUoCoAoGfUoGoAoUoUoGo(ZS)dCGoCfU 58 strand oGoGosGosCoSense GoxUoxGoxGoxAoCoCfCfUfAoGoUoUoUoAoAoUo 59 siAP0E9- strand xAoxiaMl Antisense P1UosUfsAoUoUoAfAoAoCoUoAoGo(GS)dGUoCfC 60 strand oAoCosCosCoSense CosCosGosAosUoGoAfCfCfUoGoCoAoGoAoAoGoCoia 95 siAPOElO strand-Ml Antisense P1CosGfsCoUoUoCfUoGoCoAoGoGo(ZS)dCAoUfCoG 96 strand oGosCosAoSense AosGosUosUosGoAoAfGfGfCoCoUoAoCoAoAoAoUoi 97 siAPOEll strand a-Ml Antisense P1UosAfsUoUoUoGfUoAoGoGoCoCo(ZS)dNCoAfAoC 98 strand oUosCosCoSense AosGosUosUosGoAoAfGfGfCoCoUoAoCoAoAoAoUoi 97 siAPOE12 strand a-Ml Antisense P1AosAfsUoUoUoGfUoAoGoGoCoCo(ZS)dNCoAfAoC 99 strand oUosCosCoSense CosGosAosCosAoAoUfCfAfCoUoGoAoAoCoGoCoCoia 100 siAPOE13 strand-Ml Antisense P1UosGfsGoCoGoUfUoCoAoGoUoGo(AS)dNUoGfUoC 101 strand oGosCosUoSense CosGosAosCosAoAoUfCfAfCoUoGoAoAoCoGoCoCoia 100 siAPOE14 strand-Ml Antisense P1AosGfsGoCoGoUfUoCoAoGoUoGo(AS)dNUoGfUoC 102 strand oGosCosUoSense CosAosGosCosGoAoCfAfAfUoCoAoCoUoGoAoAoCoia 103 siAPOE15 strand-Ml Antisense P1UosGfsUoUoCoAfGoUoGoAoUoUo(GS)dNCoGfCoU 104 strand oGosGosGoSense CosAosGosCosGoAoCfAfAfUoCoAoCoUoGoAoAoCoia 103 siAPOE16 strand-Ml Antisense P1AosGfsUoUoCoAfGoUoGoAoUoUo(GS)dNCoGfCoU 105 strand oGosGosGosiAPOE17 Sense CosCosGosAosUoGoAfCfCfUoGoCoAoGoAoAoGoCoia106-Ml strandAntisense P1UosGfsCoUoUoCfUoGoCoAoGoGo(ZS)dCAoUfCoG107 strand oGosCosAoSense CosCosGosAosUoGoAfCfCfUoGoCoAoGoAoAoGoCoia106 siAPOE18 strand-Ml Antisense P1AosGfsCoUoUoCfUoGoCoAoGoGo(ZS)dCAoUfCoG108 strand oGosCosAoSense CosCosAosGosCoGoAfCfAfAoUoCoAoCoUoGoAoAoia109 siAPOE19 strand-Ml Antisense P1UosUfsUoCoAoGfUoGoAoUoUoGo(ZS)dCGoCfUoG110 strand oGosGosCoSense CosCosAosGosCoGoAfCfAfAoUoCoAoCoUoGoAoAoia109 siAPOE20 strand-Ml Antisense P1AosUfsUoCoAoGfUoGoAoUoUoGo(ZS)dCGoCfUoG111 strand oGosGosCoSense UosAosAosAosGoAoUfUfCfAoCoCoAoAoGoUoUoUoi112 siAPOE21 strand a-Ml Antisense P1UosAfsAoAoCoUfUoGoGoUoGoAo(AS)dNCoUfUoU113 strand oAosUosUoSense UosAosAosAosGoAoUfUfCfAoCoCoAoAoGoUoUoUoi112 siAPOE22 strand a-Ml Antisense P1AosAfsAoAoCoUfUoGoGoUoGoAo(AS)dNCoUfUoU114strand oAosUosUoTherein, C, G, U, A and T represent the base composition of the nucleotides; o represents that the nucleotide represented by a capital letter adjacent to the left side of the letter o is an alkoxy modified nucleotide; f represents that the nucleotide represented by a capital letter adjacent to the left side of the letter f is a fluoro modified nucleotide; (AS) represents a substituted alkoxy modified adenine nucleotide; (ZS) represents a substituted alkoxy modified uracil nucleotide or a substituted alkoxy modified thymine nucleotide; (GS) represents a substituted alkoxy modified guanine nucleotide; each N is independently U or T; s represents that the two nucleotides represented by capital letters most adjacent to both sides of the letter s are linked by a phosphorothioate linkage; x represents that the two nucleotides represented by capital letters most adjacent to both sides of the letter x, or the nucleotide represented by a capital letter most adjacent to either side of the letter x and the nucleotide represented by ia are linked by a phosphate ester linkage or a phosphorothioate linkage, and at least two x in the same nucleotide sequence represent phosphorothioate linkages; ia represents an inverted abasic deoxyribonucleotide; d represents that the nucleotide represented by a capital letter adjacent to the right side of the letter d is a deoxyribonucleotide; Pl represents that the nucleotide represented by a capital letter adjacent to the right side of Pl is a 5’-hydroxy nucleotide or a 5’-vinyl phosphate modified nucleotide. In some embodiments, all x in the same sense strand represent phosphorothioate linkages. In some embodiments, each alkoxy modified nucleotide is a 2’ -methoxy modified nucleotide. In some embodiments, each substituted alkoxy modified nucleotide is a 2’-O-methoxyethyl modified nucleotide represented by moe. In some embodiments, each Pl is independently a 5'-hydroxy nucleotide or a 5'-vinyl phosphate (E-VP) modified nucleotide.The single-stranded oligonucleotide and / or double-stranded oligonucleotide provided in the present disclosure can be obtained by conventional methods in the art for preparing oligonucleotides, such as solid phase synthesis method and liquid phase synthesis method. For solid phase synthesis, commercial customization services are already available. A modified nucleotide group can be introduced into the antisense strand and / or double-stranded oligonucleotide of the present disclosure by using a nucleoside monomer having the corresponding modification, wherein the methods for preparing the nucleoside monomer having the corresponding modification and the methods for introducing the modified nucleotide group into the antisense strand and / or double-stranded oligonucleotide are also well-known to those skilled in the art. All modified nucleoside monomers could be either commercially available or prepared by known methods.The single-stranded oligonucleotide or the double-stranded oligonucleotides of the present disclosure can be used alone, or form a pharmaceutical composition with a pharmaceutically acceptable carrier, or form an oligonucleotide conjugate by binding to a delivery group, or be used in other forms. An effective amount of the double-stranded oligonucleotide, pharmaceutical composition or oligonucleotide conjugate is contacted with a cell to regulate the expression of APOE4 mRNA, or an effective amount of the double-stranded oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the present disclosure is administered to a subject to regulate the expression of APOE4 mRNA, thereby achieving the purpose of treating a pathological condition or disease related to the expression level of APOE4 mRNA.The oligonucleotide conjugatesIn another aspect, the present disclosure provides an oligonucleotide conjugate comprising a oligonucleotide group and a delivery group conjugated to the oligonucleotide group, wherein the oligonucleotide group is independently a group formed by removing one or more atoms or atomic groups from the single-stranded oligonucleotide or the double-stranded oligonucleotide provided in the present disclosure. The oligonucleotide group formed by such removal has atleast the same or essentially the same RNAi function as the single-stranded oligonucleotide or the double-stranded oligonucleotide per se. In some embodiments, the oligonucleotide group is a group formed by removing one atom or atomic group, such as a hydrogen atom, a hydroxy group or a phosphate ester group from the single-stranded oligonucleotide or the doublestranded oligonucleotide provided in the present disclosure.In the context of the present disclosure, unless otherwise specified, “conjugation” means that two or more chemical moieties each having specific function are linked to each other via a covalent linkage. Correspondingly, a “conjugate” refers to a compound formed by covalent linkage of individual chemical moieties. Furthermore, an “oligonucleotide conjugate” represents a compound formed by covalently linking one or more chemical moieties each with specific functions to an oligonucleotide. According to the context, an oligonucleotide conjugate should be understood as a general term of multiple oligonucleotide conjugates or as an oligonucleotide conjugate as shown by a chemical formula. In the context of the present disclosure, a “conjugation molecule” should be understood as a specific compound capable of being conjugated to an oligonucleotide via reactions, thereby finally forming the specific compound of the oligonucleotide conjugate of the present disclosure.The delivery group is a group for delivering an oligonucleotide group to a cell that expresses APOE4 mRNA. In some embodiments, the delivery group comprises a linking group and pharmaceutically acceptable targeting group(s), and the oligonucleotide group, the linking group and the targeting group(s) are sequentially linked covalently or non-covalently, and each of the targeting groups is selected from a ligand capable of binding to a cell surface receptor or a group capable of increasing the compatibility with a tissue. In some embodiments, each of the targeting groups independently targets one or more of central nervous system, liver, kidney, lung, muscle, and eye. In some embodiments, each of the targeting groups independently targets the central nervous system. In some embodiments, each of said targeting groups is independently selected from a ligand capable of binding to the surface receptor of a cell in the central nervous system or a group capable of increasing the compatibility with a tissue in the central nervous system.In some embodiments, the number of the targeting groups is 1-6. In one embodiment, the number of the targeting groups is 2-4. The oligonucleotide group could be non-covalently or covalently conjugated to the delivery group; for example, the oligonucleotide group is covalently conjugated to the delivery group. In some embodiments, the oligonucleotide group is a double-stranded oligonucleotide group, and the conjugation site between the double-stranded oligonucleotide group and the delivery group can be at 3’ terminal or 5’ terminal of the sensestrand, or at 5’ terminal of the antisense strand of the double-stranded oligonucleotide, or within the internal sequence of the double-stranded oligonucleotide. In some specific embodiments, the conjugation site between the double-stranded oligonucleotide group and the delivery group is at 3 ’-terminal of the sense strand of the double-stranded oligonucleotide.In some embodiments, the delivery group can be linked to any position of the nucleotide, such as the phosphate group, the 2’-, 3’- or 5’-hydroxyl group of the ribose or the base. When the delivery group is linked to the 3’- or 5’-terminal of the sense strand of the double-stranded oligonucleotide, the delivery group is typically linked to the oxygen atom formed by removing a hydrogen atom from the 3’- or 5’-hydroxyl group of the nucleotide; when the delivery group is linked to an internal sequence of the double-stranded oligonucleotide, the delivery group is typically linked to a phosphate group, a ribose ring or a base. In some embodiments, the delivery group can be linked to the 3 ’-hydroxyl group of a nucleotide in the internal sequence of the double-stranded oligonucleotide when the nucleotides are linked via a 2’-5’-phosphodiester bond. For various linking modes, reference can be made to the following non-patent document: Muthiah Manoharan et.al. siRNA conjugates carrying sequentially assembled trivalentN-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo in hepatocytes. ACS Chemical biology, 2015, 10 (5): 1181-7, which is incorporated herein by reference in its entirety.In some embodiments, the double-stranded oligonucleotide and the delivery group can be linked by an acid-labile or reducible chemical bond which can be degraded under the acidic environment of cell endosomes, such that the double-stranded oligonucleotide group is converted to the double-stranded oligonucleotide in free state. For non-degradable conjugation modes, the delivery group can be linked to the sense strand of the double-stranded oligonucleotide group, thereby minimizing the effect of conjugation on the activity of the double-stranded oligonucleotide group.The targeting group can be linked to the oligonucleotide group via an appropriate linking group, and the appropriate linking group can be selected by those skilled in the art according to the specific type of the targeting group. The types of these linking groups and targeting groups and the linking modes with the double-stranded oligonucleotide can be found in the disclosures of W02015006740A2, which is incorporated herein by reference in its entirety.In some embodiments, the targeting group can be a conventional ligand used in the field of double-stranded oligonucleotide administration, for example, the various ligands as described in W02009082607A2, which is incorporated herein by reference in its entirety.In some embodiments, at least one or each of the targeting groups is selected from ligandscapable of binding to a cell surface receptor of a cell expressing APOE4 mRNA. In some embodiments, at least one or each of the targeting groups is selected from any group capable of targeting the central nervous system, such as a small molecule ligand group or a targeting peptide group capable of binding to a surface receptor of a cell in the central nervous system, or a group capable of increasing the compatibility with a tissue in the central nervous system, such as a lipophilic group. In some embodiments, the double-stranded oligonucleotide group can regulate the expression level of APOE4 mRNA in the central nervous system.In some embodiments, at least one or each of said targeting groups is one selected from lipophilic groups or targeting peptide groups. In some embodiments, each of the targeting groups is one of C5-C18 straight-chain, branched alkyl groups, steroids, or targeting peptides that can be enriched in the central nervous system. The double-stranded oligonucleotide group can regulate the expression level of ApoE4 mRNA in the cells of the central nervous system.The delivery groups in the oligonucleotide conjugates of the present disclosure can be various delivery groups known to the skilled persons in the field of oligonucleotide drugs.In some embodiments, the linking group in the oligonucleotide conjugate of the present disclosure has a structure as shown in Formula (301):A T I C - 1 B - 1LA—L L?k2Formula (301)wherein k is an integer of 1-5, JT / W- represents the site where the group is covalently linked; all LAare linked to the same atom in Lc; alternatively, each LAis independently linked to different atoms in Lc.In some embodiments, Lchas a structure as shown in -NH-C(H)n30i(CH2O-)k, wherein k is an integer of 1-3 and n301=3-k; LBhas a length of 5-20 atoms. In some embodiments, each LAis independently a straight-chain alkylene group of 5-20 carbon atoms in length, in which one or more methylene groups are optionally substituted by any one or more groups selected from the following groups consist of: C(O), NH, O, S, 1,2,3-triazolylene, succinimidylene.In some embodiments, LAhas a structure containing amide bonds as shown in Formula (302) and LBhas a structure as shown in Formula (303):Formula (302)Formula (303)wherein n302, q302, and p302 independently of one another are an integer of 2-6, and optionally, n302, q302, and p302 independently of one another are 2 or 3; n303 is an integer of 4-16, and optionally, n303 is an integer of 8-12, ~~~~ represents the site where the group is covalently linked.In some embodiments, the linking group has a structure as shown in Formula (304) or Formula (305):oFormula (304)Formula (305)In the linking group, each LAis respectively linked to a targeting group by an ether bond, and is linked by forming an ether bond with the Lcpart via the oxygen atom of the hydroxyl group in the Lcpart; LBis linked by forming an amide bond with the nitrogen atom of the amino group in the Lcpart via the carbonyl group in Formula (303), and is linked by forming a phosphate ester bond or phosphorothioate bond with the double-stranded oligonucleotide group via an oxygen atom in Formula (303).In some embodiments, the oligonucleotide conjugates provided in the present disclosure have a structure as shown in Formula (305A):Formula (305 A)wherein Nu represents the double-stranded oligonucleotide group formed by the doublestranded oligonucleotides provided in the present disclosure.In some embodiments, the linking group in the oligonucleotide conjugates of the present disclosure has the structure as shown in Formula (306):Formula (306)wherein n306 is an integer of 0-3, and each p306 is independently an integer of 1-6, represents the site where the group is covalently linked; the linking group is linked by forming an ether bond with the targeting group via the oxygen atom marked by *; the linking group is linked by forming a phosphate ester bond or a phosphorothioate bond with the double-stranded oligonucleotide via at least one of the oxygen atom marked by #, and the remaining oxygen atom marked by # is linked to a hydrogen atom to form a hydroxyl group, or is linked to a C1-C3 alkyl group to form a C1-C3 alkoxy group;In some embodiments, the oligonucleotide conjugate of the present disclosure has the structure as shown in Formula (307):Formula (307)wherein Nu represents the double-stranded oligonucleotide group formed by the doublestranded oligonucleotides provided in the present disclosure.In some embodiments, the oligonucleotide conjugate of the present disclosure has the structure as shown in Formula (308):AQ AOI'1 R308 L'1N— (-C-) - NH' I 'm308 J n308R308Formula (308),wherein n308 is an integer selected from 2-4;Each m308 is independently an integer selected from 2-5;Each R308 is independently a hydrogen atom, methyl or ethyl, or two R308 linked to the same carbon atom form a carbonyl group with the carbon atom;One Ao is a double-stranded oligonucleotide group, which is a group formed by removing an atom or an atomic group from the double-stranded oligonucleotides of the present disclosure; all remaining Ao groups are targeting groups, and each targeting group is identical or different, and has the same definition and selection range as those described above. In some embodiments, each targeting group is independently selected from groups capable of targeting the central nervous system.each Li is independently a divalent linking group of 3-25 atoms in length;represents the site where the group is covalently linked.In some embodiments, each Li is independently a straight-chain alkylene group of 1-20 carbon atoms in length, wherein one or more carbon atoms are optionally replaced with any one or more groups selected from the group consisting of: C(O), NH, O, S, CH=N, S(O)2, OP(O)2, OP(O)(S), C2-C10 alkeylene, C2-C10 alkynylene, C6-C10arylene, C3-C18 heterocyclylene, and C5-C10 heteroarylene; and the straight-chain alkylene group optionally has any one or more substituents selected from the group consisting of: C1-C10 alkyl, C6-C10aryl, C5-C10 heteroaryl, C1-C10 haloalkyl, -OC1-C10 alkyl, -OC1-C10 alkylphenyl, -C1-C10 alkyl-OH, -OC1-C10 haloalkyl, -SC1-C10 alkyl, -SC1-C10 alkylphenyl, -C1-C10 alkyl-SH, -SC1-C10 haloalkyl, halo substituent, -OH, -SH, -NH2, -C1-C10 alkyl-NH2, -N(C1-C10 alkyl)(C1-C10 alkyl), -NH(C1-C10 alkyl), N(C1-C10 alkyl)(C1-C10 alkylphenyl), -NH(C1-C10 alkylphenyl), cyano, nitro, -CO2H, -C(O)O(C1-C10 alkyl), -CON(C1-C10 alkyl)(C1-C10 alkyl), -CONH(C1-C10 alkyl), -CONH2, -NHC(O)(C1-C10 alkyl), -NHC(O)(phenyl), -N(C1-C10 alkyl)C(O)(C1-C10 alkyl), -N(C1-C10 alkyl)C(O)(phenyl), -C(O)C1-C10 alkyl, -C(O)C1-C10 alkylphenyl, -C(O)C1-C10 haloalkyl, -OC(O)C1-C10 alkyl, -SO2(C1-C10 alkyl), -SO2(phenyl), -SO2(C1-C10 haloalkyl), -SO2NH2, -SO2NH(C1-C10 alkyl), -SO2NH(phenyl), -NHSO2(C1-C10 alkyl), -NHSO2(phenyl), and -NHSO2(C1-C10 haloalkyl).Those skilled in the art would understand that, although Li is defined as a linking group formed by substitution or replacement starting from a linear alkylene for convenience, but it may not be a linear group or be named differently, such as an amine or alkenyl produced by the above replacement and / or substitution. Unless otherwise specified, in the chemical structure of the present disclosure, the "length" of any group means that the number of atoms in the longest atomic chain of the group without counting hydrogen atoms; in the calculation of the length of a group, when there are multiple linking modes between two atoms (e.g. if two atoms belong to the same cyclic group, then there are at least 2 atomic chains contain the two atoms), the length is calculated according to the shortest atomic chain between the two atoms. For example, for 1,4-cyclohexanediyl, 1,4-piperidinediyl, 1,4-phenylene, 1,4-piperazinediyl, the length is calculated as 4 atoms, while for 1,2-cyclopentanediyl, the length is calculated as only 2 atoms. The function of Li covalently linked to Ao, which represents the double-stranded oligonucleotide group, is to covalently link the double-stranded oligonucleotide group to the targeting group, so that the oligonucleotide conjugate containing the double-stranded oligonucleotide group enters the cell expressing APOE4 mRNA through the targeting action of the targeting group, and does not affect the double-stranded oligonucleotide group’s ability to regulate the level of APOE4 mRNA after entering the cell expressing APOE4 mRNA. Thus, in some embodiments, Li that is covalently linked to Ao, which represents the double-stranded oligonucleotide group, is 3-20 atoms, or 4-15 atoms, or 5-12 atoms in length. In some embodiments, Li that is covalently linked to Ao, which represents the double-stranded oligonucleotide group, is selected from a linking combination of one or more of Al, A2, A4, A5, A10, A16, A18, and A19 and a phosphate ester group or modified phosphate ester group:wherein j 1 is an integer of 2-10;represents the site where the group is covalently linked.In some embodiments, R2 is selected from a linking combination of at least 2 of Al, A2, A4, A10 and Al 6 and a phosphate ester group or modified phosphate ester group; in some embodiments, R2 is selected from a linking combination of at least 2 of Al, A2, and A10 and a phosphate ester group or modified phosphate ester group.In some embodiments, Li that is covalently linked to Ao, which represents the double-stranded oligonucleotide group, has a structure as shown in Formula (Bl), (B2), (B3), or (B4):(B3) (B4)wherein represents the site where the group is covalently linked. LBI and LB2 areidentical or different and are independently selected from one of the following groups or any linking combinations: -(CH2)q1-, -CH(OH)-, -CH(CH2OH)-, -NH-, -O-, -S-, 1,4-cyclohexanediyl, 1,4-piperidinediyl, 1,4-phenylene, 1,4-piperazinediyl, and pyrrolidinediyl, wherein ql is an integer of 1-6, LBI and LB2independently of one another are 1-20 atoms in length. In some embodiments, LBI and LB2independently of one another have a length of 1-10 atoms. In some embodiments, LBI and LB2independently of one another have a length of 1-6 atoms.LBS is selected from one of a phosphate ester group, a phosphorothioate group and a phosphorodithioate group, and is covalently linked to the remaining oxygen atom after removing a hydrogen atom from the 5’ hydroxyl group of the ribose of the 5’ terminal nucleotide or the 3’ hydroxyl group of the ribose of the 3’ terminal nucleotide in the sense strand or antisense strand of the double-stranded oligonucleotide group. In some embodiments, LB3 is a phosphate ester group and is covalently linked to the remaining oxygen atom after removing a hydrogen atom from the 5’ hydroxyl group of the ribose of the 5’ terminal nucleotide or the 3’ hydroxyl group of the ribose of the 3’ terminal nucleotide in the sense strand of the doublestranded oligonucleotide group.In some embodiments, in the case where the oligonucleotide conjugate of the present disclosure is prepared by a solid phase synthesis process, Li covalently linked to Ao, which represents a double-stranded oligonucleotide group, needs to simultaneously comprise a linking site linked to the N atom on the nitrogenous backbone, a linking site linked to the double-stranded oligonucleotide group, and a functional group that can be linked to the solid phase support. In some embodiments, in Li covalently linked to Ao, which represents the double-stranded oligonucleotide group, the site linked to the N atom on the nitrogenous backbone forms an amide bond with the N atom, and is covalently linked to the double-stranded oligonucleotide group by a phosphate ester bond, and the functional group capable of linking to the solid phase support is a hydroxyl group or an amino group. In some embodiments, R2is B5, B6, B5’ or B6’:wherein represents the site where the group is covalently linked.q2 is an integer of 1-10; in some embodiments, q2 is an integer of 1-5.The function of Li covalently linked to Ao, which represents the targeting group, is to place the targeting group in a suitable spatial position, so as to better bind to the receptor to specifically target relevant tissues. Thus, Li covalently linked to AO, which represents the targeting group, can be used in the present disclosure, as long as it has an appropriate length and its chemical properties do not have a significant effect on delivery. In some embodiments, each Li covalently linked to Ao, which represents the targeting group, is independently a divalent linking group of 3-25 atoms in length. In some embodiments, each Li covalently linked to Ao, which represents the targeting group, is independently has a length of 4-15 atoms. In some embodiments, each Li covalently linked to Ao, which represents the targeting group, has a length of 5-10 atoms. In some embodiments, each Li covalently linked to Ao, which represents the targeting group, has an identical length.In some embodiments, each Li covalently linked to Ao, which represents the targeting group, is the identical or different, and independently selected from a group consisting of the groups shown in Formulae (L3)-(L18) and any linking combination thereof:(L3) (L4) (L5) (L6) (L7)wherein each j 1 is an integer of 2-10; each R’ is independently a hydrogen atom or C1-C3 alkyl group; represents the site where the group is covalently linked.For ease synthesis and / or stable chemical property, in some embodiments, each Li covalently linked to Ao, which represents the targeting group, is independently a linking combination of at least 2 linking units, wherein each linking unit independently has the structure as shown in any of Formulae (L3)-(L7). In some embodiments, each linking unit independently has the structure as shown in any of Formulae (L3), (L4) and (L7). For ease synthesis, in some embodiments, each Li covalently linked to Ao, which represents the targeting group, comprises a carbonyl group linked to the nitrogen atom as shown in Formula (308).In some embodiments, each Li covalently linked to Ao, which represents the targeting group, independently has the structure as shown in Formula (L20) or (L21):o(L21)wherein j2 is an integer of 4 to 9 and j3 is 1 or 2. In some embodiments, j2 is 5, 6, or 7 and j3 is 1. In some embodiments, each Li covalently linked to Ao, which represents the targeting group, is identical.In the conjugates of the present disclosure, the number of targeting groups and the spacing between targeting groups are the number and spacing that can provide an appropriate spatial configuration for multiple targeting groups. For this purpose, n308 and each m308 are independently integers selected from the integer of 2-4. In some embodiments, n308 is 3 or 4, so that the number of targeting groups in the conjugate of the present disclosure is 3 or 4, such that the targeting group could better bind to hepatocyte surface receptors. In some embodiments, n308 is 3, and each m308 is independently 3 or 4.Those skilled in the art would understand that when each R308 is independently a hydrogen atom, methyl or ethyl, it will not affect the delivery effect of the oligonucleotide conjugate and could realize the purpose of the present disclosure. In some embodiments, for ease synthesis, each R308 independently of one another is a hydrogen atom.In the conjugates of the present disclosure, each targeting group is identical or different, and independently selected from ligand groups capable of binding to cell surface receptors or groups capable of increasing the compatibility with tissues. In some embodiments, at least one or each targeting group is a group capable of targeting the liver.In some embodiments, the oligonucleotide conjugate of the present disclosure has the structure as shown in Formula (403):Formula (403)wherein Nu represents an oligonucleotide group, such as a single-stranded oligonucleotide group or a double-stranded oligonucleotide group formed by the single- stranded oligonucleotide or double-stranded oligonucleotide provided in the present disclosure. In some embodiments, the oligonucleotide group is a double-stranded oligonucleotide group, and the P atom shown in the above structural formula is covalently linked to the 3 ’-terminal nucleotide of the sense strand of the double-stranded oligonucleotide group. In some embodiments, the 3 ’-terminal nucleotide of the sense strand of the double-stranded oligonucleotide group is an inverted abasic deoxynucleotide, and the P atom shown in the above structural formula is covalently linked to the double-stranded oligonucleotide group by substituting the hydrogen atom in the hydroxyl group (which is linked to the ribose ring via a methylene group) in the 3 ’-terminal inverted abasic deoxynucleotide of the sense strand of the double-stranded oligonucleotide group represented by Nu. In some embodiments, the P atom shown in Formula (403) is covalently linked to the remaining oxygen atom after removing one hydrogen atom from the ribose 3’-hydroxyl group of the 3 ’-terminal nucleotide in the sense strand of the double-stranded oligonucleotide group represented by Nu. In some embodiments, the P atom shown in Formula (403) is covalently linked to the oxygen atom (which is linked to the ribose ring via a methylene group) in the inverted abasic deoxynucleotide ia represented by formula (35) at the 3 ’-terminal of the sense strand of the siRNA represented by Nu, thereby being covalently linked to the sense strand of the siRNA.In some embodiments, the double-stranded oligonucleotide group comprised in the oligonucleotide conjugate of the present disclosure can be a siRNA group formed by removing an atom or atomic group of a siRNA, in which case the oligonucleotide conjugate of the presentdisclosure is also referred to siRNA conjugate. In some embodiments, the double-stranded oligonucleotide group comprised in the oligonucleotide conjugate of the present disclosure can be, for example, a siRNA group formed by the siAPOE1-M1- siAPOE22-Ml listed in Table IB. The siRNA conjugates comprising these siRNA groups exhibit excellent stability and high inhibitory activity against APOE4 mRNA. In some embodiments, the oligonucleotide conjugate of the present disclosure is one of Conjugate 1 to Conjugate 25 listed in Table 2.Preparation of the oligonucleotide conjugates of the present disclosureThose skilled in the art can prepare the oligonucleotide conjugates of the present disclosure by various suitable methods. For example, in the solid phase synthesis method, when the nucleoside monomers are linked one by one according to the sequences and modification schemes of the sense strand and antisense strand of the double-stranded oligonucleotides of the present disclosure, the oligonucleotide conjugate of the present disclosure can be synthesized and obtained by introducing the delivery group through the methods already described in detail in the prior art. For example, W02015006740A2 describes in detail the preparation methods of various oligonucleotide conjugates. In the case that the double-stranded oligonucleotide is a siRNA, the oligonucleotide conjugate of the present disclosure can also be obtained by the methods well-known to those skilled in the art. For example, W02014025805A1 describes the preparation method of the structure as shown in Formula (305 A); Rajeev et al., ChemBioChem 2015, 16, 903-908 describes the preparation method of the structure as shown in Formula (307); the Chinese patent application CN110959011 A also describes in detail the preparation method of the oligonucleotide conjugate having the structure as shown in Formula (308), all of which are hereby incorporated by reference in their entirety.Pharmaceutically acceptable saltOn the other hand, the present disclosure also provides the pharmaceutically acceptable salts of the single-stranded oligonucleotides, double-stranded oligonucleotides or oligonucleotide conjugates of the present disclosure. Pharmaceutically acceptable salts are known to those skilled in the art. By forming the salt, the pharmaceutically acceptable salts of the singlestranded oligonucleotides, double-stranded oligonucleotides or oligonucleotide conjugates of the present disclosure can exhibit better solubility, bioavailability, or stability than the singlestranded oligonucleotides, double-stranded oligonucleotides or oligonucleotide conjugates themselves. In some embodiments, in the double-stranded oligonucleotide or oligonucleotide conjugate of the present disclosure, adjacent nucleotides are linked via a phosphodiester bond orphosphorothioate diester bond. The non-bridging oxygen or sulfur atom in the phosphodiester bond or phosphorothioate diester bond is negatively charged, and can be present in the form of hydroxyl or sulfhydryl. Moreover, the hydrogen ion in the hydroxyl or sulfhydryl can be partially or completely substituted with a cation. The cation can be any cation, such as a metal cation, an ammonium cation NH4+or an organic ammonium cation. Furthermore, there may also be groups capable of forming salts (such as phosphate group) in the delivery group. For the purpose of improving solubility and / or improving bioavailability, in some embodiments, the pharmaceutically acceptable salts are water-soluble salts of some or all of the single-stranded oligonucleotides, double-stranded oligonucleotides or oligonucleotide conjugates. In some embodiments, the water-soluble salts can be one or more of amine salts, alkali metal salts or alkaline earth metal salts. In some embodiments, the amine salts are selected from one or more of ammonium salts, methylamine salts, tertiary amine salts, and quaternary ammonium salts, the alkali metal salts are selected from potassium salts or sodium salts, and the alkaline earth metal salts are selected from calcium salts or magnesium salts. In some embodiments, the tertiary amine salts are one or more of triethylamine salts, triisopropylamine salts or N, N-diisopropylethylamine salts. In some embodiments, the pharmaceutically acceptable salts of the single-stranded oligonucleotides, double-stranded oligonucleotides or oligonucleotide conjugates are a mixture of methylamine salts and ammonium salts of the single-stranded oligonucleotides, double-stranded oligonucleotides or oligonucleotide conjugates. In some embodiments, the pharmaceutically acceptable salts of the single-stranded oligonucleotides, double-stranded oligonucleotides or oligonucleotide conjugates are sodium salts or partial sodium salts of the single-stranded oligonucleotides, double-stranded oligonucleotides or oligonucleotide conjugates. In some embodiments, the pharmaceutically acceptable salts of the single-stranded oligonucleotides, double-stranded oligonucleotides or oligonucleotide conjugates are salts and partial salts of the single-stranded oligonucleotides, double-stranded oligonucleotides or oligonucleotide conjugates, wherein the salts or partial salts are one or more of sodium salts, calcium salts, and magnesium salts. In some embodiments, the pharmaceutically acceptable salts of the single-stranded oligonucleotide, double-stranded oligonucleotide, or oligonucleotide conjugate are calcium salts or partial calcium salts of the single-stranded oligonucleotides, double-stranded oligonucleotides, or oligonucleotide conjugates. In some embodiments, the pharmaceutically acceptable salts are salts or partial salts of the single-stranded oligonucleotides, double-stranded oligonucleotides, or oligonucleotide conjugates, and the salts are one or more of methylamine salts, triethylamine salts, sodium salts, or calcium salts.Pharmaceutical compositionOn the other hand, the present disclosure also provides a pharmaceutical composition, comprising one or more of the single-stranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate and pharmaceutically acceptable salt provided in the present disclosure, and a pharmaceutically acceptable excipient.Pharmaceutically acceptable excipient is one or more of various conventional ingredients in the art, such as one or more of a solvent, a protectant, an osmotic pressure regulator, and other pharmaceutically acceptable carriers.For example, when the pharmaceutical composition is an injection solution, the pharmaceutically acceptable excipient is a solvent, such as one or more of deionized water, water for injection, physiological saline, ethanol, ethanol aqueous solution, and pH buffer. The pH buffer can be a tris(hydroxymethyl) aminomethane hydrochloride buffer with a pH of 7.5-8.5, and / or a phosphate buffer with a pH of 5.5-8.5, preferably a phosphate buffer with a pH of 5.5-8.5. In some embodiments, the pharmaceutically acceptable excipient is a solvent. In some embodiments, the solvent is an artificial cerebrospinal fluid. In some embodiments, the solvent is an artificial cerebrospinal fluid with increased calcium ion content. In some embodiments, the solvent is a high-calcium and high-magnesium artificial cerebrospinal fluid. The types and amounts of artificial cerebrospinal fluid and high-calcium and high-magnesium artificial cerebrospinal fluid are well known to those skilled in the art. For example, the content of calcium ions and / or magnesium ions in the high-calcium and high-magnesium artificial cerebrospinal fluid is 1.01-100 times, or 1.1-50 times, that in normal artificial cerebrospinal fluid.The dosage of the solvent is adjusted according to the required solution concentration, and the concentration of the oligonucleotide conjugate in the injection solution can be 0.01 mg / mL-20 mg / mL, 0.1 mg / mL-10 mg / mL / or 0.5 mg / mL-5 mg / mL, as calculated based on the oligonucleotide group in the double-stranded oligonucleotide.The protectant can be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose. The content of the protectant can be from 0.01 wt % to 30 wt % on the basis of the total weight of the pharmaceutical composition.The osmotic pressure regulator can be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator allows the osmotic pressure of the pharmaceutical composition to be 200-700 milliosmol / kg (mOsm / kg). Depending on the desired osmotic pressure, thoseskilled in the art can readily determine the content of the osmotic pressure regulator. In some embodiments, the dosage of the formulation prepared by the pharmaceutical composition during administration can be adjusted according to different administration manners.In some embodiments, the pharmaceutical composition can be a liquid formulation, for example, an injection solution; or a lyophilized powder for injection, which is mixed with a liquid excipient to form a liquid formulation upon administration. The liquid formulation can be administered by, but not limited to, intrathecal route, lateral cerebral ventricular route, subcutaneous route, intramuscular route or intravenous injection, and also can be administered to, but not limited to, lung by spray, or other organ tissues (such as liver) through lung by spray, or the pharmaceutical composition can be delivered by oral route or other manners. In some embodiments, the pharmaceutical composition is administered by intrathecal injection.Other pharmaceutically acceptable carrier can be a conventional carrier used in the field of double-stranded oligonucleotide administration, for example, but not limited to, one or more of magnetic nanoparticles (such as Fe3O4and Fe2O3-based nanoparticle), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, l,2-dioleoyl-3 -trimethylammonium -propane (DOTAP), poly(D& L-lactic / glycolic acid) copolymer (PLGA), poly(2-aminoethyl ethylene phosphate) (PPEEA), poly(2-dimethylaminoethyl methacrylate) (PDMAEMA), and derivatives thereof.In some embodiments, in the pharmaceutical composition, there are no special requirements for the contents of the oligonucleotide and the pharmaceutically acceptable carrier. In some embodiments, the ratio of the oligonucleotide, or the oligonucleotide in the oligonucleotide conjugate, to the pharmaceutically acceptable carrier is 1: (1-500) by weight; in some embodiments, the ratio is 1: (1-50) by weight.In some embodiments, the pharmaceutical composition can be in the form of a liposome formulation. In some embodiments, the pharmaceutically acceptable carrier used in the liposome formulation comprises an amine-containing transfection compound (hereinafter also referred to as an organic amine), a helper lipid and / or a PEGylated lipid. Therein, the organic amine, the helper lipid and the PEGylated lipid can be respectively selected from one or more of the amine-containing transfection compounds or the pharmaceutically acceptable salts or derivatives thereof, the helper lipids, and the PEGylated lipids as described in the Chinese patent application CN103380113A, which is incorporated herein by reference in its entirety.In some embodiments, the organic amine can be a compound as shown in Formula (201) as described in the Chinese patent application CN103380113A or a pharmaceutically acceptablesalt thereof:Formula (201)wherein:Xioi and X102 independently of one another are selected from O, S, N-A and C-A, wherein A is hydrogen or a C1-C20 hydrocarbon chain;Y101 and Z101 independently of one another are selected from C=O, C=S, S=O, CH-OH and SO2; R101, R102, R103, R104, Rios, R106 and R107 independently of one another are selected from hydrogen; a cyclic or an acyclic, substituted or unsubstituted, branched or straight-chain aliphatic group; a cyclic or an acyclic, substituted or unsubstituted, branched or straight-chain heteroaliphatic group; a substituted or unsubstituted, branched or straight-chain acyl group; a substituted or unsubstituted, branched or straight-chain aryl group, or a substituted or unsubstituted, branched or straight-chain heteroaryl group;x is an integer of 1 - 10;n is an integer of 1 - 3, m is an integer of 0 - 20, p is 0 or 1; and wherein if m=p=0, then R102 is hydrogen, andif at least one of n or m is 2, then R103 and nitrogen atom in Formula (201) form a structure as shown in Formula (202) or (203):fFormula (202) Formula (203)wherein g, e and f independently of one another are an integer of 1 - 6; “HCC” represents a hydrocarbon chain; and each *N represents a nitrogen atom in Formula (201).In some embodiments, R103 is a polyamine. In other embodiments, R103 is a ketal. In some embodiments, each of Rioi and R102the Formula (201) is independently any of substituted or unsubstituted, branched or straight-chain alkyl or alkenyl groups which have 3 - 20 carbon atoms (such as 8 - 18 carbon atoms) and 0 - 4 double bonds (such as 0 - 2 double bonds).In some embodiments, if each of n and m is independently 1 or 3, then R103 represents any of the following Formulae (204)-(213):Formula (204) Formula (205)HOCFormula (206) Formula (207)Formula (208)Formula (209)Formula (210) Formula (211)Formula (213)wherein in Formula (204) - Formula (213), g, e, and f independently of one another are an integer of 1-6; each “HCC” represents a hydrocarbon chain; and each * represents a potential attachment position of R103 to the nitrogen atom in Formula (201), wherein each H at any * position can be replaced to realize the attachment to the nitrogen atom in Formula (201).Those skilled in the art can obtain the compound as shown in Formula (201) by any reasonable method. In some embodiments, the compound as shown in Formula (201) can be prepared according to the description in the Chinese patent application CN103380113A.In some embodiments, the organic amine is an organic amine as shown in Formula (214) and / or an organic amine as shown in Formula (215):Formula (214)Formula (215)The helper lipid is cholesterol, cholesterol analogue and / or cholesterol derivative.The PEGylated lipid is l,2-dipalmitoyl-sn-glycero-3-phosphatidylethanolamine-N- [methoxy(polyethylene glycol)]-2000.In some embodiments, the molar ratio among the organic amine, the helper lipid, and the PEGylated lipid in the pharmaceutical composition is (19.7-80): (19.7-80): (0.3-50); for example, the molar ratio can be (50-70): (20-40): (3-20).In some embodiments, the pharmaceutical composition particles formed by the double-stranded oligonucleotide of the present disclosure and the above amine-containing transfection agents have an average diameter from about 30 nm to about 200 nm, typically from about 40 nm to about 135 nm; and more typically, the average diameter of the liposome particles is from about 50 nm to about 120 nm, from about 50 nm to about 100 nm, from about 60 nm to about 90 nm, or from about 70 nm to about 90 nm, for example, the average diameter of the liposome particles is about 30, 40, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 140, 150, or 160 nm. In some embodiments, in the pharmaceutical composition formed by the double-strandedoligonucleotide of the present disclosure and the above amine-containing transfection agents, the weight ratio (weight / weight ratio) of the double-stranded oligonucleotide to total lipids (e.g., the organic amines, the helper lipids and / or the PEGylated lipids), ranges from about 1: 1 to about 1:50, from about 1:1 to about 1:30, from about 1:3 to about 1:20, from about 1:4 to about 1:18, from about 1:5 to about 1:17, from about 1:5 to about 1:15, from about 1:5 to about 1:12, from about 1:6 to about 1: 12, or from about 1:6 to about 1:10. For example, the weight ratio of the double-stranded oligonucleotide of the present disclosure to total lipids is about 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, or 1:18.In some embodiments, the pharmaceutical composition can be marketed with each component being separate, and be in the form of a liquid formulation when used. In some embodiments, the pharmaceutical composition formed by the double-stranded oligonucleotide of the present disclosure and the above pharmaceutically acceptable carrier can be prepared by various known methods, except replacing the existing double-stranded oligonucleotide with the double-stranded oligonucleotide of the present disclosure. In some embodiments, the pharmaceutical composition can be prepared according to the following process.The organic amines, helper lipids and PEGylated lipids are suspended in alcohol at a molar ratio as described above and mixed homogeneously to yield a lipid solution; the alcohol is used in an amount such that the resultant lipid solution is present at a total mass concentration of 2 to 25 mg / mL, e.g., 8 to 18 mg / mL. The alcohol is a pharmaceutically acceptable alcohol, such as an alcohol that is liquid at about room temperature, for example, one or more of ethanol, propylene glycol, benzyl alcohol, glycerol, PEG 200, PEG 300, and PEG 400, such as ethanol.The double-stranded oligonucleotide of the present disclosure is dissolved in a buffered salt solution to produce an aqueous solution of the double-stranded oligonucleotide. The buffered salt solution has a concentration of 0.05 to 0.5 M, such as 0.1 to 0.2 M. The pH of the buffered salt solution is adjusted to 4.0 to 5.5, such as 5.0 to 5.2. The buffered salt solution is used in an amount such that the double-stranded oligonucleotide is present at a concentration of less than 0.6 mg / ml, such as 0.2 to 0.4 mg / mL. The buffered salt can be one or more selected from the group consisting of soluble acetate and soluble citrate, such as sodium acetate and / or potassium acetate.The lipid solution and the aqueous solution of the double-stranded oligonucleotide are mixed. The product obtained after mixing is incubated at a temperature of 40 to 60°C for at least 2 minutes (e.g., 5 to 30 minutes) to produce an incubated liposome formulation. The volume ratio of the lipid solution to the aqueous solution of the double-stranded oligonucleotide is 1: (2-5), for example, it can be 1:4.The incubated liposome formulation is concentrated or diluted, purified to remove impurities, and then sterilized to obtain the pharmaceutical composition of the present disclosure, which has the following physicochemical parameters: a pH of 6.5 to 8, an encapsulation efficiency of more than 80%, a particle size of 40 to 200 nm, a polydispersity index of less than 0.30, and an osmotic pressure of 250 to 400 mOsm / kg; for example, the physicochemical parameters can be as follows: a pH of 7.2 to 7.6, an encapsulation efficiency of more than 90%, a particle size of 60 to 100 nm, a polydispersity index of less than 0.20, and an osmotic pressure of 300 to 400 mOsm / kg.Therein, the concentration or dilution step can be performed before, after or simultaneously with the step of removing impurity. The method for removing impurities can be any of various existing methods, for example, ultrafiltration using a 100 kDa hollow fiber column, a PBS at pH 7.4 as an ultrafiltration exchange solution and a tangential flow system. The method for sterilization can be any of various existing methods, such as filtration sterilization with a 0.22 μm filter.Use of the single-stranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt and pharmaceutical composition of the present disclosureThe present disclosure further provides use of one or more of the single-stranded oligonucleotide of the present disclosure, the double-stranded oligonucleotide of the present disclosure, the oligonucleotide conjugate of the present disclosure, pharmaceutically acceptable salt of the present disclosure, and the pharmaceutical composition of the present disclosure in the manufacture of a medicament for treating and / or preventing a disease or symptom associated with the level of APOE4 mRNA.In some embodiments, the disease or symptom associated with the expression level of APOE4 mRNA is a neurodegenerative disease. In some embodiments, the disease or symptom associated with the expression level of APOE4 mRNA is selected from one or more of Alzheimer's disease (AD), Down syndrome, and cerebral amyloid angiopathy. The present disclosure further provides a method for treating and / or preventing a disease or symptom associated with the level of APOE4 mRNA, comprising administering to a subject in need thereof an effective amount of one or more of the single-stranded oligonucleotide, the doublestranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt, and the pharmaceutical composition of the present disclosure.In another aspect, the present disclosure also provides one or more of the single-strandedoligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt, and pharmaceutical composition for use as a medicament.In another aspect, the present disclosure also provides a cell expressing APOE4 mRNA, which further comprises one or more of the single-stranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt, and pharmaceutical composition of the present disclosure.In addition, the present disclosure further provides a method for regulating the expression level of APOE4 mRNA in a cell, comprising contacting the cell with an effective amount of one or more of the single-stranded oligonucleotide, the double-stranded oligonucleotide, the oligonucleotide conjugate, the pharmaceutically acceptable salt, and the pharmaceutical composition of the present disclosure.As used herein, the term “administration / administer” refers to delivering one or more of the single-stranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt, and pharmaceutical composition of the present disclosure into a subject’s body by a method or a route that at least partly locates one or more of the singlestranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt, and pharmaceutical composition of the present disclosure at a desired site to produce a desired effect. The administration routes suitable for the methods of the present disclosure include topical administration and systemic administration. In general, topical administration results in the delivery of a greater amount of one or more of single-stranded oligonucleotides, double-stranded oligonucleotides, oligonucleotide conjugates, pharmaceutically acceptable salts, and pharmaceutical compositions of the present disclosure to a particular site as compared with the whole body of the subject; while systemic administration results in the delivery of one or more of the single-stranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt, and pharmaceutical composition of the present disclosure to substantially the whole body of the subject.The administration to a subject can be achieved by any suitable routes known in the art, including but not limited to, oral or parenteral route, such as, intrathecal administration, lateral cerebral ventricular administration, intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, intratracheal administration (aerosol), pulmonary administration, nasal administration, rectal administration, and topical administration (including buccal administration and sublingual administration). The administration frequency can be once or more times daily, weekly, biweekly, triweekly, monthly, or yearly.The dose of one or more of the single-stranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt and pharmaceutical composition of the present disclosure can be a conventional dose in the art, which can be determined according to various parameters, especially age, weight and gender of a subject. Toxicity and efficacy can be measured in cell cultures or experimental animals by standard pharmaceutical procedures, for example, by determining LD50 (the lethal dose that causes 50% population death) and ED50 (the dose that can cause 50% of the maximum response intensity in a quantitative response, and that causes 50% of the experimental subjects to have a positive response in a qualitative response). The dose range for human use can be derived based on the data obtained from cell culture assays and animal studies.When administering one or more of the single-stranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt, and pharmaceutical composition of the present disclosure, for example, to male or female C57BL / 6J or C3H / HeNCrlVr mice with an age of 6-12 weeks old and a body weight of 18-25 g, the amount of the oligonucleotide can be 0.001-100 mg / kg body weight, in some embodiments 0.01-50 mg / kg body weight, in further embodiments 0.05-20 mg / kg body weight, in still further embodiments 0.1-15 mg / kg body weight, and in still yet further embodiments 0.1-10 mg / kg body weight, as calculated based on the amount of the oligonucleotide in the single-stranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, and / or pharmaceutical composition. When administering one or more of the single-stranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt, and pharmaceutical composition of the present disclosure, the above amounts can be preferred.In the case where the expressions of APOE4 mRNA in cells are inhibited by using the method of the present disclosure, the amount of the oligonucleotide in one or more of the provided singlestranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt, and pharmaceutical composition can be readily determined by those skilled in the art according to the desired effects. For example, in some embodiments, when the oligonucleotide conjugate is a siRNA conjugate, the amount of the siRNA in the siRNA conjugate provided is an amount sufficient to reduce the expression of APOE4 mRNA and result in an extracellular concentration of 1 pM to 1 μM, or 0.01 nM to 100 nM, or 0.05 nM to 50 nM, or 0.05 nM to about 5 nM on the surface of the target cells. The amount required to achieve this local concentration will vary with various factors, including the delivery method, the delivery site, the number of cell layers between the delivery site and the target cells ortissues, the delivery route (topical or systemic), etc. The concentration at the delivery site can be significantly higher than that on the surface of the target cells or tissues.KitsThe present disclosure provides a kit comprising one or more of the single-stranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt and pharmaceutical composition of the present disclosure.In some embodiments, the kit of the present disclosure can provide one or more of the singlestranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt and pharmaceutical composition in one container. In some embodiments, the kit of the present disclosure can comprise a container comprising pharmaceutically acceptable excipients. In some embodiments, the kit of the present disclosure can further comprise additional ingredients, such as stabilizers or preservatives. In some embodiments, the kit of the present disclosure can comprise at least one additional therapeutic agent in other container than the container providing one or more of the single-stranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt and pharmaceutical composition of the present disclosure.In some embodiments, the kit can comprise an instruction for mixing one or more of the singlestranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt, and pharmaceutical composition with pharmaceutically acceptable carriers and / or excipients or other ingredients (if any).In the kit of the present disclosure, one or more of the single-stranded oligonucleotide, doublestranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt, and pharmaceutical composition, and / or the pharmaceutically acceptable excipients can be provided in any form, e.g., in a liquid form, a dry form, or a lyophilized form. In some embodiments, one or more of the single-stranded oligonucleotide, double-stranded oligonucleotide, oligonucleotide conjugate, pharmaceutically acceptable salt, and pharmaceutical composition, and optional pharmaceutically acceptable excipients are substantially pure and / or sterile. In some embodiments, sterile water can be provided in the kit of the present disclosure.Hereinafter, the present disclosure will be further illustrated with reference to the Examples, but is not limited thereto.Without wishing to be limited, the invention is further described in detail in the following embodiments and the Examples regarding the exemplary embodiments where the double-stranded oligonucleotide in the pharmaceutically compositions and / or oligonucleotide conjugates of the present disclosure is a small interfering RNA (siRNA). In this case, the double-stranded oligonucleotides, pharmaceutically compositions, and oligonucleotide conjugates of the present disclosure are siRNA, pharmaceutically compositions comprising siRNA and siRNA conjugates, respectively. In the context of the present disclosure, for ease of description, the siRNA, the pharmaceutically composition comprising the siRNA and the siRNA conjugate in these embodiments are also referred to as the siRNA of the present disclosure, the pharmaceutically composition of the present disclosure and the siRNA conjugate of the present disclosure. It does not mean that the double-stranded oligonucleotide of the present disclosure can only be siRNA, instead, the double-stranded oligonucleotide can be other variants disclosed in the present disclosure or known to those skilled in the art, such as small activating RNA (saRNA). It can be envisaged that, based on the detailed illustration of the siRNA, the pharmaceutically composition comprising the siRNA, and the siRNA conjugate, other doublestranded oligonucleotides would function similarly when being used alone or forming the pharmaceutically compositions and / or oligonucleotide conjugates of the present disclosure.ExamplesUnless otherwise specified, the reagents and culture media used in the following Examples independently of one another are commercially available products, and the operations used (such as nucleic acid electrophoresis and real-time PCR) are carried out according to the methods described in Molecular Cloning (Cold Spring Harbor Laboratory Press (1989)).Preparation Example 1: Synthesis of the siRNA Conjugates 1-22 provided by the present disclosureAccording to the preparation method described in Preparation Example 13 of CN110959011 A, Conjugates 1-22 in Table 2 below are prepared, while the only difference is that the sense strands and antisense strands of the siRNA contained in the siRNA conjugates are as shown in Table 2 respectively; for the nucleic acid sequence having the sense strand and antisense strand sequences of the siRNAs in Conjugates 1-22 in Table 2 below, nucleoside phosphoramidite monomers were linked one by one to synthesize the sense strand and antisense strand of the siRNA conjugates. After the synthesis was completed, the synthesized product were purified by centrifugal ultrafiltration and desalination using 3K (MWCO) ultrafiltration tubes.Conjugates 1-22 are mixtures of methylamine salts and ammonium salts of the compounds having the structure shown in formula (403), wherein the P atom shown in formula (403) iscovalently linked to the oxygen atom (which is linked to the ribose ring via a methylene group) in the inverted abasic deoxynucleotide ia represented by formula (35) at the 3 ’-terminal of the sense strand of the siRNA represented by Nu, thereby being covalently linked to the sense strand of the siRNA. Moreover, the siRNA contained in the siRNA conjugate has the siRNA sequences corresponding to Conjugates 1-22 in Table 2.Formula (403)Each siRNA conjugate was diluted to a concentration of 0.2 mg / mL (calculated based on siRNA) using ultrapure water (Milli-Q ultrapure water instrument, resistivity 18.2 MΩ*cm at 25°C), and then molecular weight detection was performed using a liquid chromatography-mass spectrometer (LC-MS, purchased from Waters, model: LCT Premier). For Conjugate 3, the theoretical value of the sense strand is 7394.462, and the measured value of the sense strand is 7393.50; the theoretical value of the antisense strand is 7010.744, and the measured value of the antisense strand is 7009.92. For Conjugate 6, the theoretical value of the sense strand is 7442.459, the measured value of the sense strand is 7442.92, and the theoretical value of the antisense strand is 6966.782. For Conjugate 21, the theoretical value of the sense strand is 7394.459, and the measured value of the sense strand is 7393.06; the theoretical value of the antisense strand is 6971.703, and the measured value of the antisense strand is 6970.47. For Conjugate 22, the theoretical value of the sense strand is 7394.459, and the measured value of the sense strand is 7393.32; the theoretical value of the antisense strand is 6994.745, and the measured value of the antisense strand is 6993.70.The fact that the measured values are consistent with the theoretical values indicate that the synthesized conjugates contain the designed target double-stranded nucleic acid sequences.Table 2 siRNA sequences in siRNA conjugatesPreparation SEQ ConjugateExample Sequence direction 5 '-3' ID No.No. NO Sense CmsGmsAmsCmsAmAmUfCfAfCmUmG17 Preparation strand mAmAmCmGmCmCmiaConjugate 1Example 1 Antisense CmsGfsGmCmGmUfUmCmAmGmUmGm 18 strand A(moe)dTUmGfUmCmGmsCmsUmSense CmsUmsAmsGmsUmUmUfAfAfUmAmA19 Preparation Conjugate strand mAmGmAmUmUmCmiaExample 2 2 Antisense UmsGfsAmAmUmCfUmUmUmAmUmUm 20 strand A(moe)dAAmCfUmAmGmsGmsGmSense UmsAmsAmsAmsGmAmUfUfCfAmCmC 21 Preparation Conjugate strand mAmAmGmUmUmUmiaExample 3 3 Antisense GmsAfsAmAmCmUfUmGmGmUmGmAm 22 strand A(moe)dTCmUfUmUmAmsUmsUmSense AmsAmsAmsGmsAmUmUfCfAfCmCmA 23 Preparation Conjugate strand mAmGmUmUmUmCmiaExample 4 4 Antisense UmsGfsAmAmAmCfUmUmGmGmUmGm 24 strand A(moe)dAUmCfUmUmUmsAmsUmSense AmsGmsUmsUmsGmAmAfGfGfCmCmU 41 Preparation Conjugate strand mAmCmAmAmAmUmiaExample 5 5 Antisense GmsAfsUmUmUmGfUmAmGmGmCmCm 42 strand T(moe)dTCmAfAmCmUmsCmsCmSense GmsGmsUmsGmsGmAmCfCfCfUmAmG 43 Preparation Conjugate strand mUmUmUmAmAmUmiaExample 6 6 Antisense UmsAfsUmUmAmAfAmCmUmAmGmGm 44 strand G(moe)dTCmCfAmCmCmsCmsCmSense CmsAmsGmsCmsGmAmCfAfAfUmCmA 45 Preparation Conjugate strand mCmUmGmAmAmCmiaExample 7 7 Antisense CmsGfsUmUmCmAfGmUmGmAmUmUm 46 strand G(moe)dTCmGfCmUmGmsGmsGmSense CmsCmsAmsGmsCmGmAfCfAfAmUmC 47 Preparation Conjugate strand mAmCmUmGmAmAmiaExample 8 8 Antisense GmsUfsUmCmAmGfUmGmAmUmUmGm 48 strand T(moe)dCGmCfUmGmGmsGmsCmSense GmsUmsGmsGmsAmCmCfCfUfAmGmU 49 Preparation Conjugate strand mUmUmAmAmUmAmiaExample 9 9 Antisense UmsUfsAmUmUmAfAmAmCmUmAmGm50strand G(moe)dGUmCfCmAmCmsCmsCmSense CmsCmsGmsAmsUmGmAfCfCfUmGmC 80 Preparation Conjugate strand mAmGmAmAmGmCmiaExample 10 10 Antisense CmsGfsCmUmUmCfUmGmCmAmGmGm 81 strand T(moe)dCAmUfCmGmGmsCmsAmSense AmsGmsUmsUmsGmAmAfGfGfCmCmU 41 Preparation Conjugate strand mAmCmAmAmAmUmiaExample 11 11 Antisense UmsAfsUmUmUmGfUmAmGmGmCmCm 82 strand T(moe)dTCmAfAmCmUmsCmsCmSense AmsGmsUmsUmsGmAmAfGfGfCmCmU 41 Preparation Conjugate strand mAmCmAmAmAmUmiaExample 12 12 Antisense AmsAfsUmUmUmGfUmAmGmGmCmCm 83 strand T(moe)dTCmAfAmCmUmsCmsCmSense CmsGmsAmsCmsAmAmUfCfAfCmUmG 17 Preparation Conjugate strand mAmAmCmGmCmCmiaExample 13 13 Antisense UmsGfsGmCmGmUfUmCmAmGmUmGm 84 strand A(moe)dTUmGfUmCmGmsCmsUmSense CmsGmsAmsCmsAmAmUfCfAfCmUmG 17 Preparation Conjugate strand mAmAmCmGmCmCmiaExample 14 14 Antisense AmsGfsGmCmGmUfUmCmAmGmUmGm 85 strand A(moe)dTUmGfUmCmGmsCmsUmSense CmsAmsGmsCmsGmAmCfAfAfUmCmA 45 Preparation Conjugate strand mCmUmGmAmAmCmiaExample 15 15 Antisense UmsGfsUmUmCmAfGmUmGmAmUmUm 86 strand G(moe)dTCmGfCmUmGmsGmsGmSense CmsAmsGmsCmsGmAmCfAfAfUmCmA 45 Preparation Conjugate strand mCmUmGmAmAmCmiaExample 16 16 Antisense AmsGfsUmUmCmAfGmUmGmAmUmUm 87 strand G(moe)dTCmGfCmUmGmsGmsGmSense CmsCmsGmsAmsUmGmAfCfCfUmGmC 80 Preparation Conjugate strand mAmGmAmAmGmCmiaExample 17 17 Antisense UmsGfsCmUmUmCfUmGmCmAmGmGm 88 strand T(moe)dCAmUfCmGmGmsCmsAmSense CmsCmsGmsAmsUmGmAfCfCfUmGmC 80 Preparation Conjugate strand mAmGmAmAmGmCmiaExample 18 18 Antisense AmsGfsCmUmUmCfUmGmCmAmGmGm 89 strand T(moe)dCAmUfCmGmGmsCmsAmSense CmsCmsAmsGmsCmGmAfCfAfAmUmC 47 Preparation Conjugate strand mAmCmUmGmAmAmiaExample 19 19 Antisense UmsUfsUmCmAmGfUmGmAmUmUmGm 90 strand T(moe)dCGmCfUmGmGmsGmsCm Preparation Conjugate Sense CmsCmsAmsGmsCmGmAfCfAfAmUmC47Example 20 20 strand mAmCmUmGmAmAmiaAntisense AmsUfsUmCmAmGfUmGmAmUmUmGm91 strand T(moe)dCGmCfUmGmGmsGmsCmSense UmsAmsAmsAmsGmAmUfUfCfAmCmC21 Preparation Conjugate strand mAmAmGmUmUmUmiaExample 21 21 Antisense UmsAfsAmAmCmUfUmGmGmUmGmAm92 strand A(moe)dTCmUfUmUmAmsUmsUmSense UmsAmsAmsAmsGmAmUfUfCfAmCmC21 Preparation Conjugate strand mAmAmGmUmUmUmiaExample 22 22 Antisense AmsAfsAmAmCmUfUmGmGmUmGmAm93 strand A(moe)dTCmUfUmUmAmsUmsUmSense UmsAmsAmsAmsGmAmUfUfCfAmCmC21 Preparation Conjugate strand mAmAmGmUmUmUmiaExample 23 23 Antisense GmsAfsAmAmCmUfUmGmGmUmGmAm94 strand A(moe)dTCmUfUmUmAmsUmsUmSense CmsUmsAmsGmsUmUmUfAfAfUmAmA19 Preparation Conjugate strand mAmGmAmUmUmCmiaExample 24 24 Antisense UmsGfsAmAmUmCfUmUmUmAmUmUm20 strand A(moe)dAAmCfUmAmGmsGmsGmSense AmsAmsAmsGmsAmUmUfCfAfCmCmA23 Preparation Conjugate strand mAmGmUmUmUmCmiaExample 25 25 Antisense UmsGfsAmAmAmCfUmUmGmGmUmGm24 strand A(moe)dAUmCfUmUmUmsAmsUm Comparativ Sense UmsUmsCmUmCmCmGfAfAfCmGmUm Reference 25 e strand GmUmCmAmCmGmUmConjugatePreparation Antisense AmsCfsGmUmGmAfCmAmCmGmUmUmC NC 26Example strand mGfGmAfGmAmAmsCmsUmTherein, C, G, U, A, and T represent the base composition of the nucleotides; m represents that the nucleotide adjacent to the left side of the letter m is a 2’-methoxy modified nucleotide; f represents that the nucleotide adjacent to the left side of the letter f is a 2’ -fluoro modified nucleotide; (moe) represents that the nucleotide adjacent to the left side of (moe) is a 2'-O-methoxyethyl modified nucleotide; s represents that the linking group between the two nucleotides on the left and right sides of the letter s is a phosphorothioate linkage; d represents that the nucleotide on the right side of the letter d is a deoxyribonucleotide; ia represents an inverted abasic deoxyribonucleotide; VP represents that the nucleotide represented by a capital letter on the right side of this letter combination is a 5'-vinylphosphonate modified nucleotide.Preparation Examples 23-25: Synthesis of siRNA Conjugates 23-25 provided by the present disclosureAccording to the preparation method described in Preparation Example 13 of CN110959011 A,Conjugates 23-25 in Table 2 below are prepared, while the only difference is that the sense strands and antisense strands of the siRNA contained in the siRNA conjugates are as shown in Table 2 respectively; for the nucleic acid sequences having the sense strand and antisense strand sequences of the siRNAs in Conjugates 23-25 in Table 2, nucleoside phosphoramidite monomers were linked one by one to synthesize the sense strands and antisense strands of the siRNA conjugates. After the synthesis was completed, the synthesized products were first purified by a self-packed column with strong anion exchange packing, and then purified byb desalination using a HiPrep 26 / 13 Desalting prepacked column. The resultant Conjugates 23-25 are sodium salts of the compound having the structure shown in Formula (403).Comparative Preparation Example 1: Synthesis of Reference Conjugate NCReference conjugate NC in Table 2 is prepared by solid-phase synthesis method according to the same method as that in Preparation Example 1. Reference conjugate NC is a mixture of methylamine salt and ammonium salt of the compound having the structure shown in Formula (403), wherein the conjugate group is linked to the 3’ position of the ribose of the 3’ terminal nucleotide of the sense strand of the siRNA represented by Nu. Moreover, the siRNA sequence contained in Reference conjugate NC has the siRNA sequence corresponding to Reference conjugate NC in Table 2, wherein the siRNA sequence is a negative control sequence that does not have more than 15 contiguous identical nucleotides with the mRNAs of human, rat, mouse, and non-human primate.Experimental Example 1 In vitro inhibitory activity of Conjugates 1-4This experimental Example investigates the inhibitory activity of Conjugates 1-4, Conjugates 10-22 and Reference conjugate NC against APOE4 mRNA in HepG2 human hepatoma carcinoma cells in vitro.The specific steps are as follows:[1] Cell cultureHepG2 human hepatoma carcinoma cells (purchased from Nanjing Cobioer Bioscieneces Co., Ltd.) were cultured in DMEM medium (M& C GENE) supplemented with 10% fetal bovine serum (FBS, RMBIO) at 37°C in an incubator containing 5% CO2 / 95% air.HepG2 cells were inoculated in 24-well plates at 5×104cells / well (1 mL of cell solution per well), and cultured for 24 hours.[2] TransfectionFor each siRNA conjugate to be tested, each siRNA conjugate to be tested was respectively formulated into a 20 pM siRNA conjugate working solution (calculated based on the amount of the siRNA in the conjugate) using PBS. The siRNA conjugates to be tested were respectively Conjugates 1-4, Conjugates 10-22 and Reference conjugate NC.For each siRNA conjugate to be tested, 1 A Solution was formulated, and each 1 A Solution contained 3 pL of the siRNA conjugate working solution and 97 pL of cell maintenance medium.For each siRNA conjugate to be tested, IB Solution was formulated, and each IB Solution contained 3 pL of Lipofectamine™ RNAiMAX transfection reagent (Invitrogen, catalog number: 13778150) and 97 pL of Opti-MEM medium (GIBCO).For each siRNA conjugate to be tested, one portion of 1 A Solution and one portion of IB Solution were mixed, and incubated at room temperature for 20 minutes to obtain transfection complex X1. Into the culture wells (independently of one another being the above culture wells containing HepG2 cells and 1 mL of Opti-MEM medium, the same applies hereinafter), the transfection complex X1of each siRNA conjugate was respectively added (200 pL / well) and mixed uniformly, to obtain a transfection mixture with a concentration of 50 nM (calculated based on the amount of the siRNA, the same applies hereinafter). The transfection complex X1of each siRNA conjugate was respectively used to transfect 2 culture wells to obtain a transfection mixture containing the siRNA conjugate. Conjugates 1-4 and Conjugates 10-22 were designated as the test groups, and Reference conjugate NC was designated as the negative control group.One portion of IB Solution was mixed with 100 pL of cell maintenance medium to obtain blank transfection mixture B. Into two additional culture wells, blank transfection mixture B was respectively added (200 pL / well) to obtain transfection mixtures without siRNA conjugate, designated as the blank control group.The above test groups, negative control group, and blank control group were placed in an incubator under an air atmosphere containing 5% CO2, and cultured at 37°C for another 24 hours.[3] DetectionTotal RNA was extracted from the cells in each well using MagaBio plus RNA Purification Kit (purchased from Hangzhou Bioer Technology Co., Ltd., catalog number: BSC69L1E-A)according to the method described in the instruction manual.For the cells in each well, 1 pg of total RNA was respectively taken, and was reverse-transcribed into cDNA using a reverse transcription kit (Promega, catalog number: A3500) according to the operation method in the instruction manual. The reverse transcription conditions were as follows: for each reverse transcription reaction system, the reverse transcription reaction system was incubated at 70°C for 10 minutes, then incubated at 42°C for 30 minutes, and finally incubated at 95°C for 5 minutes; after the reaction, 80 pL of DEPC water was added into the reverse transcription reaction system to obtain a solution containing cDNA.For each reverse transcription reaction system, 5 pL of the above solution containing cDNA was respectively used as a template, to prepare a 20 pL of qPCR reaction system by using the reagents provided by SYBR select Master Mix (purchased from Thermo, catalog number:4472920), wherein the PCR primer sequences used to amplify the target gene APOE4 and the internal reference gene GAPDH are shown in Table 3, and the final concentration of each primer is 20 pM. Each qPCR reaction system was placed on an ABI StepOnePlus Real-Time PCR instrument (purchased from Thermo Fisher), and amplified by using a three-step method. The amplification program is as follows: pre-denaturation at 95°C for 10 minutes, then denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. After repeating the above denaturation, annealing, and extension process for 40 times, the product W 1 containing the amplified target gene APOE4 and the internal reference gene GAPDH was obtained. Subsequently, the product W1 was hold at 95°C for 15 seconds, then at 60°C for 1 minute, ramped to 95°C with fluorescence signals collected every 0.3°C, and then hold at 95°C for 15 seconds. The melting curve of the target gene and the internal reference gene GAPDH in the product W 1 were respectively collected by real-time fluorescent quantitative PCR instrument, to obtain the Ct values of the target gene APOE4 and the internal reference gene GAPDH.Table 3 Primer informationGene name Primer type Nucleotide sequence (5’^3’) SEQ ID NO Upstream primer AGCAGACCGAGTGGCAGA 27 \\APOE4Downstream primer TCATGGTCTCGTCCATCAGC 28 Upstream primer GGTCGGAGTCAACGGATTT 29hGAPDHDownstream primer CCAGCATCGCCCCACTTGA 30The comparative Ct (AACt) method was used for relative quantitative calculation of the expression level of the target gene APOE4 mRNAin each test group. The calculation method is as follows:ACt (test group) = Ct (target gene of test group) - Ct (internal reference gene of test group) ACt (control group) = Ct (target gene of control group) - Ct (internal reference gene of control group)AACt (test group) = ACt (test group) - ACt (average of control group)AACt (control group) = ACt (control group) - ACt (average of control group)wherein ACt (average of control group) is the arithmetic mean of the ACt values (control group) of the two culture wells in the control group. Thus, each culture well in the test groups and the control group corresponds to a AACt value.Taking the average value of the control group as the reference, the expression level of APOE4 mRNA in the test group was normalized. The average of the expression level of APOE4 mRNA in the control group is defined as 100%.Relative expression level of APOE4 mRNA in the test group = 2-ΔΔCt (test group)x 100% Inhibition rate of APOE4 mRNA in the test group = (1 - relative expression level of APOE4 mRNA in the test group) x 100%The experimental results are shown in Table 4 below.Table 4 Inhibitory activity of siRNA conjugates in HepG2 cellsConjugate No. Inhibition rate of APOE4 mRNA (%)Conjugate 1 85Conjugate 2 93Conjugate 3 94Conjugate 4 90Conjugate 10 92.6Conjugate 11 92.0Conjugate 12 95.8Conjugate 13 97.6Conjugate 14 93.1Conjugate 15 95.3Conjugate 16 98.3Conjugate 17 91.9Conjugate 18 92.0Conjugate 19 91.3Conjugate No. Inhibition rate of APOE4 mRNA (%)Conjugate 20 90.2Conjugate 21 98.3Conjugate 22 97.3Reference conjugate NC -5.2Table 4 shows the relative inhibition rate of APOE4 mRNA in HepG2 human hepatoma carcinoma cells in vitro after transfection with 50 nM of the siRNA conjugates of the present disclosure. The results indicate that in HepG2 human hepatoma carcinoma cells in vitro, all tested siRNA conjugates exhibit better inhibitory effects at a concentration of 50 nM; the conjugates show an inhibition rate of more than 85% against APOE4 mRNA, and some conjugates exhibit an inhibition rate of 95% or higher against APOE4 mRNA, or even up to 98%. This result demonstrates that the siRNA conjugates of the present disclosure have better inhibitory effects on the expression of APOE4 mRNA.Experimental Example 2 Inhibitory activity of siRNA conjugates in primary mouse hepatocytes This experimental Example investigates the inhibitory activity of Conjugates 1-9 against APOE4 mRNA in primary mouse hepatocytes.Primary mouse hepatocytes were isolated from fresh liver tissues of hAPOE4 transgenic mice (6-8 weeks old, purchased from Biocytogen (Beijing) Co., Ltd.), and the density of primary mouse hepatocytes was adjusted to 1×105cells / mL in DMEM medium (purchased from M& C GENE Company) to prepare a cell suspension. The cell suspension was inoculated in 12-well plates at 1×105cells / well (1 mL per well), with 2 replicate wells set for each sample.For each siRNA conjugate to be tested, a 20 pM conjugate working solution (calculated based on the amount of the siRNA in the conjugate) was prepared using PBS. The siRNA conjugates to be tested used were Conjugates 1-9. The conjugate working solution was then diluted to a 0.6 pM dilution solution with Opti-MEM medium. 300 pL of Opti-MEM medium and 300 pL of the dilution solution were mixed and designated as the test sample.200 pL of the test sample was respectively added into 12 culture wells (all of which were the above-mentioned culture wells containing primary mouse hepatocytes and DMEM), with each test sample added into 2 culture wells, resulting in a mixture with a final concentration of 50 nM. The groups added with the conjugates were designated as the test groups. 200 pL of Opti-MEM medium was added into another 2 culture wells, designated as the blank control group. The above test groups and the blank control group were cultured at 37°C in an incubatorcontaining 5% CO2 / 95% air for 24 hours.Total RNA was extracted from the cells in each well using MagaBio plus RNA Purification Kit (purchased from Hangzhou Bioer Technology Co., Ltd., catalog number: BSC69L1E-A) according to the method described in the instruction manual.For the cells in each well, 1 pg of total RNA was respectively taken, and was reverse-transcribed into cDNA using a reverse transcription kit (Promega, catalog number: A3500) according to the operation method in its instruction manual. The reverse transcription conditions were as follows: for each reverse transcription reaction system, the reverse transcription reaction system was incubated at 70°C for 10 minutes, then incubated at 42°C for 30 minutes, and finally incubated at 95°C for 5 minutes; after the reaction, 80 pL of DEPC water was added into the reverse transcription reaction system to obtain a solution containing cDNA.For each reverse transcription reaction system, 5 pL of the above solution containing cDNA was respectively used as a template, to prepare a 20 pL of qPCR reaction system by using the reagents provided by SYBR select Master Mix (purchased from Thermo, catalog number:4472920), wherein the PCR primer sequences used to amplify the target gene APOE4 and the internal reference gene GAPDH are shown in Table 3, and the final concentration of each primer is 20 pM. Each qPCR reaction system was placed on an ABI StepOnePlus Real-Time PCR instrument (purchased from Thermo Fisher), and amplified by using a three-step method. The amplification program is as follows: pre-denaturation at 95°C for 10 minutes, then denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. After repeating the above denaturation, annealing, and extension process for 40 times, the product W 1 containing the amplified target gene APOE4 and the internal reference gene GAPDH was obtained. Subsequently, the product W1 was hold at 95°C for 15 seconds, then at 60°C for 1 minute, ramped to 95°C with fluorescence signals collected every 0.3°C, and then hold at 95°C for 15 seconds. The melting curve of the target gene and the internal reference gene GAPDH in the product W 1 were respectively collected by real-time fluorescent quantitative PCR instrument, to obtain the Ct values of the target gene APOE4 and the internal reference gene GAPDH.According to the calculation method in Example 1, the relative quantitative calculation of the expression level of the target gene APOE4 mRNA in each test group was performed. The calculation results are shown in Table 5 below.Table 5 Inhibition rates of each conjugate against APOE4 mRNAConjugate No. Inhibition rate / %Conjugate 1 69.0Conjugate 2 97.5Conjugate 3 95.6Conjugate 4 97.8Conjugate 5 81.2Conjugate 6 95.4Conjugate 7 86.9Conjugate 8 83.3Conjugate 9 93.7From the results in Table 5, it can be seen that the conjugates of the present disclosure exhibit better inhibitory activity against APOE4 mRNA; at a concentration of 50 nM, the inhibition rates against APOE4 mRNA of the siRNA conjugates of the present disclosure are all 69% or higher, wherein Conjugate 4 has an inhibition rate against APOE4 mRNA of up to 97.8%, indicating that the conjugates of the present disclosure can effectively inhibit APOE4 mRNA in in vitro cell experiments.Some embodiments of the present disclosure are described in detail above, but the present disclosure is not limited to the specific details of the above embodiments. Various simple variations to the technical solutions of the present disclosure can be made within the scope of the technical concept of the present disclosure, and these simple variations are also within the scope of the present disclosure.In addition, it should be noted that the specific technical features described in some of the above embodiments can be combined in any appropriate manner provided that no contradiction is caused. In order to avoid unnecessary repetition, the present disclosure does not separately describe various possible combination manners.Furthermore, various different embodiments of the present disclosure can also be combined arbitrarily, as long as they do not deviate from the concept of the present disclosure, and such combinations shall also be deemed as content disclosed by the present disclosure.
Claims
CLAIMS1. A single-stranded oligonucleotide, wherein the single-stranded oligonucleotide has a length of 16-30 nucleotides and can inhibit the expression of APOE4 mRNAby the mechanism of RNA interference (RNAi); whereineach nucleotide in the single-stranded oligonucleotide independently of one another is a modified or an unmodified nucleotide; and wherein in the single- stranded oligonucleotide, at least one nucleotide is a nucleotide X,at least one nucleotide is a fluoro modified nucleotide; andin a 5’ to 3’ direction, the 13th nucleotide in the single-stranded oligonucleotide is a substituted alkoxy modified nucleotide; the 14th nucleotide in the single-stranded oligonucleotide is a nucleotide X; and each of the 15th nucleotide and all the subsequent nucleotides in the singlestranded oligonucleotide independently of one another is a modified nucleotide; and each nucleotide X is independently a deoxynucleotide or an unmodified nucleotide.
2. The single-stranded oligonucleotide according to claim 1, wherein the single-stranded oligonucleotide has a length of 17-28, 19-27, or 20-25 nucleotides; or the single-stranded oligonucleotide has a length of 19, 21 or 23 nucleotides.
3. The single-stranded oligonucleotide according to claim 1 or 2, wherein the number of the nucleotide X is 1-3, such as 1-2, such as 1.
4. The single-stranded oligonucleotide according to any one of claims 1-3, wherein in a 5’ to 3’ direction, the 12th and 14th nucleotides in the single-stranded oligonucleotide independently of one another are the nucleotide X; or only the 14th nucleotide is a nucleotide X.
5. The single-stranded oligonucleotide according to any one of claims 1-4, wherein the number of the unmodified nucleotides is no more than 5, no more than 4, no more than 3, no more than 2 or no more than 1; or each of all nucleotides in the single-stranded oligonucleotide independently of one another is a modified nucleotide.
6. The single-stranded oligonucleotide according to any one of claims 1-5, wherein the number of the fluoro modified nucleotides is 2-7, such as 2-5, such as 3.
7. The single-stranded oligonucleotide according to any one of claims 1-6, wherein in a 5’ to 3’ direction, the fluoro modified nucleotides are one or more nucleotides, such as 2-7 nucleotides, such as 2-5 nucleotides, such as 3 nucleotides, selected from the group consisting of the 2nd, 5th, 6th, 7th, 12th, 16th, 18th and 19th nucleotides in the single-stranded oligonucleotide.
8. The single-stranded oligonucleotide according to any one of claims 1-7, wherein in a 5’to 3’ direction, the fluoro modified nucleotides areone or two nucleotides selected from the group consisting of the 2nd and 12th nucleotides, one or two nucleotides selected from the group consisting of the 5th to 7th nucleotides, and 0-2 nucleotides selected from the group consisting of the 16th to 19th nucleotides, in the single-stranded oligonucleotide; and / orin a 5’ to 3’ direction, the fluoro modified nucleotides are one or more nucleotides, or all nucleotides, selected from the group consisting of the 2nd and 6th nucleotides; or the group consisting of the 2nd, 6th and 16th nucleotides; or the group consisting of the 2nd, 5th, 7th, 12th and 16th nucleotides; or the group consisting of the 2nd, 7th, 12th, 16th and 19th nucleotides; or the group consisting of the 2nd, 6th, 12th, 16th and 19th nucleotides, in the single-stranded oligonucleotide.
9. The single-stranded oligonucleotide according to any one of claims 1-8, wherein except for the 13th and 14th nucleotides (in a 5’ to 3’ direction) and the fluoro modified nucleotides, each modified nucleotide in the single-stranded oligonucleotide is independently selected from the group consisting of an alkoxy modified nucleotide, a substituted alkoxy modified nucleotide, an alkyl modified nucleotide, a substituted alkyl modified nucleotide, an amine modified nucleotide, a thermally destabilizing nucleotide, and a BNA, such as the group consisting of an alkoxy modified nucleotide, a substituted alkoxy modified nucleotide and a thermally destabilizing nucleotide.
10. The single-stranded oligonucleotide according to claim 9, wherein the number of substituted alkoxy modified nucleotides is no more than 3; and / or the number of thermally destabilizing nucleotides is no more than 2.
11. The single-stranded oligonucleotide according to any one of claims 1-10, wherein the single-stranded oligonucleotide has a length of 19-23 nucleotides, and / orin a 5’ to 3’ direction in the single-stranded oligonucleotide, the 13th nucleotide is said substituted alkoxy modified nucleotide, the 14th nucleotide is said nucleotide X, one of the 5th to 7th nucleotides is a fluoro modified nucleotide, the 2nd nucleotide and the 16th nucleotide are fluoro modified nucleotides, the 3rd nucleotide is an alkoxy modified nucleotide or a substituted alkoxy modified nucleotide, the 5th nucleotide is an alkoxy modified nucleotide or a substituted alkoxy modified nucleotide when it is not a fluoro modified nucleotide, and each remaining nucleotide in the single-stranded oligonucleotide independently of one another is an alkoxy modified nucleotide.
12. The single-stranded oligonucleotide according to any one of claims 1-11, wherein the single-stranded oligonucleotide has a length of 21 nucleotides, and / orin a 5’ to 3’ direction, the 13th nucleotide is said substituted alkoxy modified nucleotide, the 14th nucleotide is said nucleotide X, the 2nd, 6th and 16th nucleotides are fluoro modified nucleotides, the 3rd or 5th nucleotides are alkoxy modified nucleotides or substituted alkoxy modified nucleotides, and each remaining nucleotide in the single-stranded oligonucleotide independently of one another is an alkoxy modified nucleotide.
13. The single-stranded oligonucleotide according to any one of claims 1-12, wherein each nucleotide X is a deoxynucleotide; and / oreach alkoxy modified nucleotide is a methoxy modified nucleotide; and / oreach substituted alkoxy modified nucleotide is a 2’-O-methoxyethyl modified nucleotide; and / oreach thermally destabilizing nucleotide is GNA.
14. The single-stranded oligonucleotide according to any one of claims 1-13, wherein at least 2 of the linking groups linking adjacent nucleotides in the single-stranded oligonucleotide are each independently phosphate ester groups with modification group(s).
15. The single-stranded oligonucleotide according to any one of claims 1-14, wherein 1 to 4 of the linking groups linking adjacent nucleotides between the 1st and 5th nucleotides at the 5’ terminal of the single-stranded oligonucleotide, and / or 1 to 4 of the linking groups linking adjacent nucleotides between the 1st and 5th nucleotides at the 3’ terminal of the single-stranded oligonucleotide are each independently phosphate ester groups with modification group(s); and / orif the single-stranded oligonucleotide comprises unmodified nucleotides, then one or both of the two linking groups linking each of the unmodified nucleotides and adjacent nucleotides thereof are each independently phosphate ester groups with modification group(s); and / or 2 to 6, or 4 of the linking groups linking adjacent nucleotides in the single-stranded oligonucleotide are each independently phosphate ester groups with modification group(s).
16. The single-stranded oligonucleotide according to any one of claims 1-15, wherein one or more, such as all, of the linking groups linking adjacent nucleotides between the 1st and 3rd nucleotides at the 5’ terminal of the single-stranded oligonucleotide, and / or one or more, such as all, of the linking groups linking adjacent nucleotides between the 1st and 3rd nucleotides at the 3’ terminal of the single-stranded oligonucleotide are each independently phosphate ester groups with modification group(s); and / orif the single-stranded oligonucleotide comprises unmodified nucleotides, then one or both of the two linking groups linking each of the unmodified nucleotides and adjacent nucleotides thereof are each independently phosphate ester groups with modification group(s).Ill17. The single-stranded oligonucleotide according to any one of claims 14-16, wherein each of the phosphate ester groups with modification group(s) is independently a phosphorothioate group having the structure as shown by Formula (28):S — P=OFormula (28).
18. The single-stranded oligonucleotide according to any one of claims 1-17, wherein the 5’-terminal nucleotide of the single-stranded oligonucleotide is a 5’-hydroxy nucleotide, a 5’-phosphate nucleotide or a 5 ’-phosphate analogue modified nucleotide; wherein the 5 ’-hydroxy nucleotide has the structure as shown by Formula (29); the 5 ’-phosphate nucleotide has the structure as shown by Formula (30); and the 5’-phosphate analogue modified nucleotide is one selected from the nucleotides as shown by Formulae (31)-(34):Formula (29); Formula (30);F ormul a (31 ) F ormul a (32) Formula (33) Formula (34);wherein R is one selected from H, OH, OCH3, and F; and the Base is a nucleic acid base selected from A, U, C, G, and T.
19. The single-stranded oligonucleotide according to any one of claims 1-18, wherein the single-stranded oligonucleotide has a length of 21 nucleotides, and / orin a 5’ to 3’ direction in the single-stranded oligonucleotide, the 13th nucleotide is a 2’-O-methoxyethyl modified nucleotide, the 14th nucleotide is a deoxynucleotide, the 2nd, 6th and16th nucleotides are fluoro modified nucleotides, and each remaining nucleotide in the singlestranded oligonucleotide independently of one another is a methoxy modified nucleotide; and / orthe linking groups linking any two adjacent nucleotides between the 1st and the 3rd nucleotides at the 5’ terminal of the single- stranded oligonucleotide and the linking groups linking any two adjacent nucleotides between the 1st and the 3rd nucleotides at the 3’ terminal of the singlestranded oligonucleotide are phosphorothioate groups; and / orthe 5’ terminal nucleotide in the single-stranded oligonucleotide is a 5 ’-hydroxy nucleotide as shown by Formula (29) or a 5 ’-vinyl phosphate modified nucleotide as shown by Formula (31).
20. The single-stranded oligonucleotide according to any one of claims 1-19, wherein the single-stranded oligonucleotide is reverse complementary to a nucleotide sequence m, which is a contiguous nucleotide sequence segment in the APOE4 mRNA, with no more than 3, such as no more than 2, such as 1, base mismatch(es); or the single-stranded oligonucleotide is completely reverse complementary to said contiguous nucleotide sequence m in APOE4 mRNA without any base mismatch;wherein optionally,the length of the nucleotide sequence m is not greater than the length of the single-stranded oligonucleotide, and the nucleotide sequence m and the single-stranded oligonucleotide have an equal length, or have a length difference of 1-5 nucleotides or no more than 8 nucleotides; and / orthe nucleotide sequence m has a length of at least 16 nucleotides, 16-25 nucleotides, 18-23 nucleotides, or 19-21 nucleotides; and / orthe single-stranded oligonucleotide and the nucleotide sequence m have an equal length, and the single-stranded oligonucleotide, except for the terminal nucleotides at position 1, 1-3 or 1-5 at the 5’ terminal (in a 5’ to 3’ direction) and / or the 3’ terminal (in a 3’ to 5’ direction), is completely reverse complementary to the nucleotide sequence m; and / orthe single-stranded oligonucleotide, except for the nucleotide at position 1 (in a 5’ to 3’ direction), is reverse complementary to the nucleotide sequence m with 1 base mismatch, or the single-stranded oligonucleotide, except for the nucleotide at position 1 (in a 5’ to 3’ direction), is completely reverse complementary to the nucleotide sequence m, or the single-stranded oligonucleotide is completely reverse complementary to the nucleotide sequence m.
21. The single-stranded oligonucleotide according to any one of claims 1 to 20, wherein the single-stranded oligonucleotide comprises a nucleotide sequence II, and wherein the nucleotide sequence II is one of the sequences as shown in the following i) to ix):i) the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 2 with no more than 3 base differences:5’ - Z2GAAACUUGGUGAAUCUUU-3’ (SEQ ID NO: 2),wherein Z2 is U; the nucleotide sequence II comprises a nucleotide Z’2 at the position corresponding to Z2; and Z’2 is the first nucleotide at the 5’ terminal of the single-stranded oligonucleotide sequence;ii) the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 4 with no more than 3 base differences:5’ - Z4AAACUUGGUGAAUCUUUA-3’ (SEQ ID NO: 4),wherein Z4 is G or U; the nucleotide sequence II comprises a nucleotide Z’4 at the position corresponding to Z4; and Z’4 is the first nucleotide at the 5’ terminal of the single-stranded oligonucleotide sequence;iii) the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 6 with no more than 3 base differences:5’ - Z6GGCGUUCAGUGAUUGUCG-3’ (SEQ ID NO: 6),wherein Ze is C or U; the nucleotide sequence II comprises a nucleotide Z’ & at the position corresponding to Ze; and Z’e is the first nucleotide at the 5’ terminal of the single-stranded oligonucleotide sequence;iv) the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 8 with no more than 3 base differences:5’ - Z8GAAUCUUUAUUAAACUAG-3’ (SEQ ID NO: 8),wherein Z8is U; the nucleotide sequence II comprises a nucleotide Z’8at the position corresponding to Z8; and Z’8is the first nucleotide at the 5’ terminal of the single-stranded oligonucleotide sequence;v) the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 32 with no more than 3 base differences:5’- ZioAUUUGUAGGCCUUCAACU-3’ (SEQ ID NO: 32),wherein Z10 is G or U; the nucleotide sequence II comprises a nucleotide Z’10 at the position corresponding to Z10; and Z’10 is the first nucleotide at the 5’ terminal of the single-stranded oligonucleotide sequence;vi) the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 34 with no more than 3 base differences:5’- Z 12 AUUAAACUAGGGUCC ACC-3’ (SEQ ID NO: 34),wherein Z12 is U; the nucleotide sequence II comprises a nucleotide Z’12 at the positioncorresponding to Z12; and Z’12 is the first nucleotide at the 5’ terminal of the single-stranded oligonucleotide sequence;vii) the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 36 with no more than 3 base differences:5’ - Z14GUUCAGUGAUUGUCGCUG-3’ (SEQ ID NO: 36),wherein Z14 is C or U; the nucleotide sequence II comprises a nucleotide Z’14 at the position corresponding to Z14; and Z’14 is the first nucleotide at the 5’ terminal of the single-stranded oligonucleotide sequence;viii) the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 38 with no more than 3 base differences:5’ - Z16UUCAGUGAUUGUCGCUGG-3’ (SEQ ID NO: 38),wherein Zi6 is G or U; the nucleotide sequence II comprises a nucleotide Z’i6 at the position corresponding to Zie; and Z’i6 is the first nucleotide at the 5’ terminal of the single-stranded oligonucleotide sequence;ix) the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 40 with no more than 3 base differences:5’- Z18UAUUAAACUAGGGUCCAC-3’ (SEQ ID NO: 40),wherein Zis is U; the nucleotide sequence II comprises a nucleotide Z’is at the position corresponding to Zis; and Z’is is the first nucleotide at the 5’ terminal of the single-stranded oligonucleotide sequence; orthe nucleotide sequence II shares at least 16, at least 17, at least 18, at least 19, at least 20 or at least 21 contiguous identical nucleotides with any one of the nucleotide sequences as shown in SEQ ID NO: 67 to SEQ ID NO: 79 in Table 1A.
22. The single-stranded oligonucleotide according to claim 21, wherein the nucleotide sequence II has no more than 1 base difference from the nucleotide sequence as shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO: 40; orthe nucleotide sequence II has no base difference from the nucleotide sequence as shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO: 40; orthe nucleotide sequence II has no more than 1 base difference or no base difference from the 1st to 19th nucleotides of any one of the nucleotide sequences as shown in SEQ ID NO: 67 to SEQ ID NO: 79 in Table 1 A; orthe nucleotide sequence II is any one of the nucleotide sequences as shown in SEQ ID NO: 67to SEQ ID NO: 79 listed in Table 1 A.
23. The single-stranded oligonucleotide according to claim 21 or 22, wherein the singlestranded oligonucleotide further comprises a nucleotide sequence IV; whereinthe nucleotide sequence IV is linked to the 3’ terminal of the nucleotide sequence II and has a length of 1, 2, 3 or 4 nucleotides, such as 2 nucleotides; each nucleotide in the nucleotide sequence IV is independently a non-fluoro modified nucleotide; the nucleotide sequence IV is reverse complementary to the APOE4 mRNA with 1 base mismatch or is completely reverse complementary to the APOE4 mRNA; each of the non-fluoro modified nucleotides is independently selected from the group consisting of a 2’ -methoxy modified nucleotide, a 2’-Ci-3 alkyl modified nucleotide, a 2’-amino modified nucleotide, a 2’-substituted-amino modified nucleotide, and a thermally destabilizing nucleotide; and / orthe nucleotide sequence IV has a length of 2 nucleotides.
24. The single-stranded oligonucleotide according to any one of claims 21-23, wherein the single-stranded oligonucleotide further comprises a nucleotide sequence V;wherein each nucleotide in the nucleotide sequence V is independently a non-fluoro modified nucleotide; the nucleotide sequence V has a length of 1, 2 or 3 nucleotides, such as 2 nucleotides, and is linked to the 3’ terminal of the nucleotide sequence II or the nucleotide sequence IV; wherein upon formation of a double-stranded oligonucleotide between the singlestranded oligonucleotide and a sense strand, the single- stranded oligonucleotide is the antisense strand and the nucleotide sequence V constitutes a 3’ overhanging terminal of the antisense strand of the double-stranded oligonucleotide; and / orthe nucleotide sequence V has a length of 2 nucleotides; and in a 5’ to 3’ direction, the nucleotide sequence V comprises 2 contiguous thymidine deoxynucleotides or 2 contiguous uridine nucleotides, or is completely reverse complementary to the APOE4 mRNA; or the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 2 with no more than 3 base differences; the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is AU or AT, wherein the A is a methoxy modified nucleotide or GNA, and the T and U independently of one another are methoxy modified nucleotide; orthe nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 4 with no more than 3 base differences; the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is UU or TT, wherein the T and U independently of one another are methoxy modified nucleotide or GNA; orthe nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 6 with no more than 3 base differences; the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is CU or CT, wherein the C is a methoxy modified nucleotide or GNA, and the T and U independently of one another are methoxy modified nucleotide; or the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 8 with no more than 3 base differences; the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is UU or GG, wherein the G and U independently of one another are methoxy modified nucleotides or GNA; orthe nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 32 with no more than 3 base differences; the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is UU or CC, wherein the C and U independently of one another are methoxy modified nucleotides or GNA; orthe nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 34 with no more than 3 base differences; the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is UU or CC, wherein the C and U independently of one another are methoxy modified nucleotides or GNA; orthe nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 36 with no more than 3 base differences; the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is GG, wherein the G is a methoxy modified nucleotide or GNA; or the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 38 with no more than 3 base differences; the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is GC, wherein the C is a methoxy modified nucleotide, and the G is a methoxy modified nucleotide or GNA; orthe nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 40 with no more than 3 base differences; the nucleotide sequence V is linked to the 3’ terminal of the nucleotide sequence II; and in a 5’ to 3’ direction, the base composition of the nucleotide sequence V is CC, wherein the C is a methoxy modified nucleotide or GNA; or wherein the single-stranded oligonucleotide comprises or consists of a nucleotide sequence asdefined by the antisense strand of any one of siAPOE1-M1 to siAPOE22-Ml as listed Table IB; orthe single-stranded oligonucleotide comprises or consists of a nucleotide sequence as defined by the antisense strand of any one of Conjugates 1 to 25 as shown in Table 2.
25. A double-stranded oligonucleotide, comprising a sense strand and an antisense strand, wherein each nucleotide in the sense strand is a modified or an unmodified nucleotide, and the sense strand and the antisense strand are at least partly reverse complementary to form a double-stranded region, and wherein the antisense strand is the single-stranded oligonucleotide according to any one of claims 1 to 24.
26. The double-stranded oligonucleotide according to claim 25, wherein the sense strand has a length of 15-26, 17-24 or 19-23 nucleotides; orthe sense strand has a length of 19-21 nucleotides.
27. The double-stranded oligonucleotide according to claim 26, wherein the sense strand and the antisense strand have a length difference of 0-5 nucleotides; orthe length of the sense strand is not greater than the length of the antisense strand; or the sense strand and the antisense strand have an equal length of 19, 20 or 21 nucleotides; or the sense strand has a length of 19-21 nucleotides, the antisense strand has a length of 20-24 nucleotides, the length of the antisense strand is greater than the length of the sense strand by 1-3 nucleotides; or the length of the antisense strand is greater than the length of the sense strand by 2 nucleotides; orthe sense strand has a length of 19 nucleotides and the antisense strand has a length of 21 nucleotides; or the sense strand has a length of 21 nucleotides and the antisense strand has a length of 21 nucleotides; or the sense strand has a length of 21 nucleotides and the antisense strand has a length of 23 nucleotides.
28. The double-stranded oligonucleotide according to any one of claims 25-27, wherein in a 3’ to 5’ direction, 2 to 3 nucleotides of the 11th to 13th nucleotides in the sense strand are fluoro modified nucleotides, the first nucleotide and / or the last nucleotide is an alkoxy modified nucleotide or an inverted abasic deoxyribonucleotide, and the nucleotides at the remaining positions in the sense strand independently of one another are non-fluoro modified nucleotides, and each of the non-fluoro modified nucleotides is independently selected from the group consisting of an alkoxy modified nucleotide, an alkyl modified nucleotide, an amine modified nucleotide, and a thermally destabilizing nucleotide.
29. The double-stranded oligonucleotide according to claim 28, wherein in a 3’ to 5’ direction, the 11th and the 13th nucleotides or the 11th to 13th nucleotides in the sense strandare fluoro modified nucleotides, the first nucleotide and / or the last nucleotide is an alkoxy modified nucleotide or an inverted abasic deoxyribonucleotide, and the nucleotides at the remaining positions of the sense strand independently of one another are alkoxy modified nucleotides.
30. The double-stranded oligonucleotide according to claim 28 or 29, wherein each of the alkoxy modified nucleotides independently of one another is a methoxy modified nucleotide.
31. The double-stranded oligonucleotide according to any one of claims 25 to 30, wherein in the sense strand, at least one of the linking groups linking two adjacent nucleotides is a phosphate ester group with modification group(s), and the phosphate ester group with modification group(s) is present at at least one position between two adjacent nucleotides within the 1st to the 5th nucleotides at the 5’ terminal of the sense strand and between two adjacent nucleotides within the 1st to the 5th nucleotides at the 3’ terminal of the sense strand.
32. The double-stranded oligonucleotide according to claim 31, wherein 1 to 4, such as all 4, of the linking groups linking any two adjacent nucleotides between the 1st nucleotide and the 5th nucleotide at the 5’ terminal of the sense strand are each independently phosphate ester groups with modification group(s); and / or 1 to 4, such as all 4, of the linking groups linking any two adjacent nucleotides between the 1st nucleotide and the 5th nucleotide at the 3’ terminal of the sense strand are each independently phosphate ester groups with modification group(s); and / orwherein each of the phosphate ester groups with modification group(s) is independently a phosphorothioate group having the structure as shown by Formula (28); and / orwherein the sense strand comprises or consists of a nucleotide sequence as defined by the sense strand of any one of siAPOE1-M1to siAPOE22-Ml as listed in Table IB; and / or wherein the sense strand comprises or consists of a nucleotide sequence as defined by the sense strand of any one of Conjugates 1-25 as listed in Table 2.
33. The double-stranded oligonucleotide according to any one of claims 25-32, wherein the sense strand comprises 19-21 nucleotides and the antisense strand comprises 21-23 nucleotides; and / orin a 3’ to 5’ direction in the sense strand, the 11th and 13th nucleotides, or the 11th to 13th nucleotides are fluoro modified nucleotides, the first and / or the last nucleotide is a methoxy modified nucleotide or an inverted abasic deoxyribonucleotides, and the nucleotides at the remaining positions independently of one another are alkoxy modified nucleotides; and / or 1 to 4, such as all 4, of the linking groups linking adjacent nucleotides between the 1st and the 5th nucleotides at the 5’ terminal of the sense strand and / or 1 to 4, such as all 4, of the linkinggroups linking adjacent nucleotides between the 1st and the 5th nucleotides at the 3’ terminal of the sense strand are each independently phosphate ester groups with modification group(s).
34. The double-stranded oligonucleotide according to claim any one of claims 25-33, wherein the sense strand comprises 19-21 nucleotides and the antisense strand comprises 21-23 nucleotides; and / orin a 3’ to 5’ direction in the sense strand, the 11th and 13th nucleotides, or the 11th to 13th nucleotides are fluoro modified nucleotides, the first and / or the last nucleotide is an alkoxy modified nucleotide or an inverted abasic deoxyribonucleotide, and the nucleotides at the remaining positions independently of one another are alkoxy modified nucleotides; and / or 1 to 4, such as all, of the linking groups linking adjacent nucleotides between the 1st and the 5th nucleotides at the 5’ terminal of the sense strand and / or 1 to 4, such as all, of the linking groups linking adjacent nucleotides between the 1st and the 5th nucleotides at the 3’ terminal of the sense strand are each independently phosphate ester groups with modification group(s); and / orin a 5’ to 3’ direction in the antisense strand, the 13th nucleotide is said substituted alkoxy modified nucleotide; the 14th nucleotide is said nucleotide X; the 2nd, 6th and 16th nucleotides are fluoro modified nucleotides, and each remaining nucleotide in the antisense strand independently of one another is an alkoxy modified nucleotide; and / orone or more, such as all, of the linking groups linking any two adjacent nucleotides between the 1st and the 3rd nucleotides at the 5’ terminal and / or one or more, such as all, of the linking groups linking any two adjacent nucleotides between the 1st and the 3rd nucleotides at the 3’ terminal of the antisense strand independently of one another are phosphate ester groups with modification group(s); and / orthe 5’ terminal nucleotide of the antisense strand is a 5’-hydroxy nucleotide as shown by Formula (29) or a 5’-vinyl phosphate modified nucleotide as shown by Formula (31).
35. The double-stranded oligonucleotide according to any one of claims 25-34, wherein the sense strand comprises 19 nucleotides and the antisense strand comprises 21 nucleotides; and / orin a 3’ to 5’ direction in the sense strand, the 11th to 13th nucleotides are fluoro modified nucleotides, the first nucleotide is an inverted abasic deoxyribonucleotide, and the nucleotides at the remaining positions independently of one another are methoxy modified nucleotides; one or more, such as all, of the linking groups linking adjacent nucleotides between the 1st and the 5th nucleotides at the 5’ terminal of the sense strand are phosphorothioate groups; and / or in a 5’ to 3’ direction in the antisense strand, the 13th nucleotide is a 2’-O-methoxyethylmodified nucleotide, the 14th nucleotide is a deoxynucleotide, the 2nd, 6th and 16th nucleotides are fluoro modified nucleotides, and each remaining nucleotide in the antisense strand independently of one another is a methoxy modified nucleotide; one or more, such as all, of the linking groups linking any two adjacent nucleotides between the 1st and the 3rd nucleotides at the 5’ terminal and the linking groups linking any two adjacent nucleotides between the 1st and the 3rd nucleotides at the 3’ terminal of the antisense strand independently of one another are phosphorothioate groups; and / orthe 5’ terminal nucleotide of the antisense strand is a 5’-hydroxy nucleotide as shown by Formula (29) or a 5’-vinyl phosphate modified nucleotide as shown by Formula (31).
36. The double-stranded oligonucleotide according to any one of claims 25-35, wherein the sense strand is reverse complementary to the antisense strand with no more than 3, such as no more than 2, such as 1, base mismatch(es); or the sense strand is completely reverse complementary to the antisense strand without any base mismatch; orin a 5’ to 3’ direction, at least the nucleotide sequence of the sense strand, except for the first nucleotide and the last nucleotide, is reverse complementary with 1 base mismatch to the antisense strand or is completely reverse complementary to the antisense strand; orin a 5’ to 3’ direction, the nucleotide sequence of the sense strand, except for the last nucleotide, is completely reverse complementary to the antisense strand; or the sense strand is completely reverse complementary to the antisense strand; orthe sense strand comprises a nucleotide sequence having an equal length to the nucleotide sequence m with no more than 3 base differences, no more than 1 base difference, or no base difference; wherein the nucleotide sequence m is said contiguous nucleotide sequence segment in the APOE4 mRNA; and / or the nucleotide sequence m has a length of at least 16 nucleotides, 16-25 nucleotides, 18-23 nucleotides, or 19-21 nucleotides.
37. The double-stranded oligonucleotide according to any one of claims 25-36, wherein the double-stranded oligonucleotide is an siRNA.
38. The double-stranded oligonucleotide according to any one of claims 25-37, wherein the sense strand comprises a nucleotide sequence I; the antisense strand comprises the nucleotide sequence II; and the double-stranded oligonucleotide is one group of the sequences as shown in the following i) to ix):i) the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 1 with no more than 3 base differences, and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 2 with no more than 3 base differences: 5’- AAAGAUUCACCAAGUUUCZi-3’ (SEQ ID NO: 1);5’ - Z2GAAACUUGGUGAAUCUUU-3’ (SEQ ID NO: 2),wherein Zi is A or ia; Z2is U; ia is an inverted abasic deoxyribonucleotide; the nucleotide sequence I comprises a nucleotide Z’i at the position corresponding to Zi; the nucleotide sequence II comprises a nucleotide Z’2at the position corresponding to Z2; and Z’2is the first nucleotide at the 5’ terminal of the antisense strand;ii) the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 3 with no more than 3 base differences, and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 4 with no more than 3 base differences:5’ - UAAAGAUUCACCAAGUUUZ3-3’ (SEQ ID NO: 3);5’ - Z4AAACUUGGUGAAUCUUUA-3’ (SEQ ID NO: 4),wherein Z3 is C, A or ia; Z4 is G or U; the nucleotide sequence I comprises a nucleotide Z’3 at the position corresponding to Z3; the nucleotide sequence II comprises a nucleotide Z’4 at the position corresponding to Z4; and Z’4 is the first nucleotide at the 5’ terminal of the antisense strand;iii) the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 5 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 6 with no more than 3 base differences:5’- CGACAAUCACUGAACGCCZs-3’ (SEQ ID NO: 5);5’ - Z6GGCGUUCAGUGAUUGUCG-3’ (SEQ ID NO: 6),wherein Z5 is G, A or ia; Ze is C or U; the nucleotide sequence I comprises a nucleotide Z’5 at the position corresponding to Z5; the nucleotide sequence II comprises a nucleotide Z’e at the position corresponding to Ze; and Z’e is the first nucleotide at the 5’ terminal of the antisense strand;iv) the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 7 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 8 with no more than 3 base differences:5’- CUAGUUUAAUAAAGAUUCZ7-3’ (SEQ ID NO: 7);5’ - Z8GAAUCUUUAUUAAACUAG-3’ (SEQ ID NO: 8),wherein Z7 is A or ia; Z8is U; the nucleotide sequence I comprises a nucleotide Z’ 7 at the position corresponding to Z7; the nucleotide sequence II comprises a nucleotide Z’8at the position corresponding to Z8; and Z’8is the first nucleotide at the 5’ terminal of the antisensestrand;v) the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 31 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 32 with no more than 3 base differences:5’- AGUUGAAGGCCUACAAAUZ9-3’ (SEQ ID NO: 31)5’- ZioAUUUGUAGGCCUUCAACU-3’ (SEQ ID NO: 32);wherein Z9 is C, A or ia; Z10 is G or U; the nucleotide sequence I comprises a nucleotide Z’9 at the position corresponding to Z9; the nucleotide sequence II comprises a nucleotide Z’10 at the position corresponding to Z10; and Z’10 is the first nucleotide at the 5’ terminal of the antisense strand;vi) the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 33 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 34 with no more than 3 base differences:5’- GGUGGACCCUAGUUUAAUZii-3’ (SEQ ID NO: 33)5’- Z 12 AUUAAACUAGGGUCC ACC-3’ (SEQ ID NO: 34);wherein Zu is A or ia; Z12 is U; the nucleotide sequence I comprises a nucleotide Z’n at the position corresponding to Zu; the nucleotide sequence II comprises a nucleotide Z’12 at the position corresponding to Z12; and Z’12 is the first nucleotide at the 5’ terminal of the antisense strand;vii) the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 35 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 36 with no more than 3 base differences:5’- CAGCGACAAUCACUGAACZ13-3’ (SEQ ID NO: 35)5’ - Z14GUUCAGUGAUUGUCGCUG-3’ (SEQ ID NO: 36);wherein Z13 is G, A or ia; Z14 is C or U; the nucleotide sequence I comprises a nucleotide Z’13 at the position corresponding to Z13; the nucleotide sequence II comprises a nucleotide Z’14 at the position corresponding to Z14; and Z’14 is the first nucleotide at the 5’ terminal of the antisense strand;viii) the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 37 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 38 with no more than 3 basedifferences:5’-CCAGCGACAAUCACUGAAZI5-3’ (SEQ ID NO: 37)5’-ZI6UUCAGUGAUUGUCGCUGG-3’ (SEQ ID NO: 38);wherein Z15 is C, A or ia; Zi6 is G or U; the nucleotide sequence I comprises a nucleotide Z’15 at the position corresponding to Z15; the nucleotide sequence II comprises a nucleotide Z’i6 at the position corresponding to Zie; and Z’i6 is the first nucleotide at the 5’ terminal of the antisense strand;ix) the nucleotide sequence I has an equal length to the nucleotide sequence as shown in SEQ ID NO: 39 with no more than 3 base differences; and the nucleotide sequence II has an equal length to the nucleotide sequence as shown in SEQ ID NO: 40 with no more than 3 base differences:5’-GUGGACCCUAGUUUAAUAZi7-3’ (SEQ ID NO: 39)5’- Z18UAUUAAACUAGGGUCCAC-3’ (SEQ ID NO: 40);wherein Z17 is A or ia; Zis is U; the nucleotide sequence I comprises a nucleotide Z’17 at the position corresponding to Z17; the nucleotide sequence II comprises a nucleotide Z’is at the position corresponding to Zis; and Z’is is the first nucleotide at the 5’ terminal of the antisense strand; orthe unmodified equivalent sequence of the double-stranded oligonucleotide is any one of the siRNAlO to siRNA22 in Table IA.
39. The double-stranded oligonucleotide according to claim 38, wherein the nucleotide sequence I has no more than 1 base difference from the nucleotide sequence as shown in SEQ ID NO: 1, 3, 5, 7, 31, 33, 35, 37 or 39; and the nucleotide sequence II has no more than 1 base difference from the nucleotide sequence as shown in SEQ ID NO: 2, 4, 6, 8, 32, 34, 36, 38 or 40; and / orthe nucleotide sequence I has no more than 1 base difference from the nucleotide sequence as shown in any one of SEQ ID NO: 61 to SEQ ID NO: 66 in Table 1 A, and the nucleotide sequence II has no more than 1 base difference from the 1st to 19th nucleotides of the nucleotide sequence as shown in any one of SEQ ID NO: 67 to SEQ ID NO: 79 in Table 1 A.
40. The double-stranded oligonucleotide according to claim 38 or 39, wherein the doublestranded oligonucleotide is the double-stranded oligonucleotide as shown by siAPOE1-M1, siAPOE2-Ml, siAPOE3-Ml, siAPOE4-Ml, siAPOE5-Ml, siAPOE6-Ml, siAPOE7-Ml, siAPOE8-Ml, siAPOE9-Ml, siAPOElO-Ml, siAPOEll-Ml, siAPOE12-Ml, siAPOE13-Ml, siAPOE14-Ml, siAPOE15-Ml, siAPOE16-Ml, siAPOE17-Ml, siAPOE18-Ml, siAPOE19-Ml, siAPOE20-Ml, siAPOE21-Ml or siAPOE22-Ml in Table IB.
41. An oligonucleotide conjugate, comprising an oligonucleotide group and a delivery group conjugated to the oligonucleotide group, wherein the oligonucleotide group is independently a group formed by removing one or more atoms or atomic groups from the single-stranded oligonucleotide according to any one of claims 1-24 or the double-stranded oligonucleotide according to any one of claims 25-40.
42. The oligonucleotide conjugate according to claim 41, wherein the delivery group comprises a linking group and at least one pharmaceutically acceptable targeting group, and the oligonucleotide group, the linking group and said at least one targeting group are sequentially linked covalently or non-covalently, wherein said at least one targeting group is independently selected from a ligand capable of binding to a cell surface receptor and a group capable of increasing the compatibility with a tissue; and / or wherein said at least one targeting group is independently selected from a ligand capable of binding to a surface receptor of a cell in the central nervous system and a group capable of increasing the compatibility with a tissue in the central nervous system; and / orthe oligonucleotide group in the oligonucleotide conjugate is an siRNA group formed from the siRNAs listed in Table IB; and / orthe oligonucleotide conjugate has the structure as shown in Formula (403):Formula (403),in Formula (403), Nu is an oligonucleotide group; such as the oligonucleotide group formed by removing one or more atoms or atomic groups from the double-stranded oligonucleotide group according to any one of claims 25-40, wherein the P atom is covalently linked to the 3’ terminal nucleotide in the sense strand of the double-stranded oligonucleotide group; or, the 3’ terminal nucleotide in the sense strand of the double-stranded oligonucleotide group is aninverted abasic deoxyribonucleotide, and the P atom is covalently linked to the double-stranded oligonucleotide group by substituting a hydrogen atom in the hydroxyl in the 3’ terminal inverted abasic deoxyribonucleotide of the sense strand of the double-stranded oligonucleotide group, wherein the hydroxyl is linked to the ribose ring via a methylene group; and / or the oligonucleotide conjugate is one of the Conjugates 1-25 as listed in Table 2.
43. A pharmaceutically acceptable salt of the single-stranded oligonucleotide according to any one of claims 1-24, the double-stranded oligonucleotide according to any one of claims 25-40, or the oligonucleotide conjugate according to claim 41 or 42;wherein optionally, the pharmaceutically acceptable salt is a partial or completely water-soluble salt of the single-stranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate;wherein the water-soluble salt is optionally one or more of an amine salt, an alkali metal salt or an alkaline earth metal salt;wherein the amine salt is optionally one or more selected from an ammonium salt, a methylamine salt, a tertiary amine salt and a quaternary ammonium salt; and / or the alkali metal salt is optionally one or more selected from a potassium salt and a sodium salt; and / or the alkaline earth metal salt is optionally one or more selected from a calcium salt and a magnesium salt;wherein the tertiary amine salt is optionally one or more selected from a triethylamine salt, a triisopropylamine salt and an N, N-diisopropylethylamine salt; orwherein optionally, the pharmaceutically acceptable salt is a salt or partial salt of the singlestranded oligonucleotide, the double-stranded oligonucleotide or the oligonucleotide conjugate, wherein the salt is optionally one or more selected from a methylamine salt, a triethylamine salt and a sodium salt.
44. A pharmaceutical composition, comprising one or more of the single-stranded oligonucleotide according to any one of claims 1-24, the double-stranded oligonucleotide according to any one of claims 25-40, the oligonucleotide conjugate according to claim 41 or 42, and the pharmaceutically acceptable salt according to claim 43, and a pharmaceutically acceptable excipient;wherein optionally, the pharmaceutically acceptable excipient is one or more selected from a solvent, a protectant, an osmotic pressure regulator and other pharmaceutically acceptable carriers;wherein the solvent is optionally one or more selected from deionized water, water for injection, a pH buffer, a physiological saline, ethanol and an ethanol aqueous solution.
45. Use of one or more of the single-stranded oligonucleotide of any one of claims 1-24, the double-stranded oligonucleotide of any one of claims 25-40, the oligonucleotide conjugate according to claim 41 or 42, the pharmaceutically acceptable salt according to claim 43, and the pharmaceutical composition of claim 44 in the manufacture of a medicament for treating and / or preventing a disease or a symptom associated with the expression level of APOE4 mRNA.
46. The use according to claim 45, wherein the disease or the symptom associated with the expression level of APOE4 mRNA is a neurodegenerative disease; and / or the disease or the symptom associated with the expression level of APOE4 mRNA is one or more selected from the group consisting of Alzheimer’s disease (AD), Down’s syndrome and cerebral amyloid angiopathy.
47. A method for treating and / or preventing a disease or a symptom associated with the expression level of APOE4 mRNA, comprising administering to a subject in need thereof an effective amount of one or more of the single-stranded oligonucleotide of any one of claims 1-24, the double-stranded oligonucleotide of any one of claims 25-40, the oligonucleotide conjugate according to claim 41 or 42, the pharmaceutically acceptable salt of claim 43, and the pharmaceutical composition of claim 44.
48. The method according to claim 47, wherein the disease or the symptom associated with the expression level of APOE4 mRNA is a neurodegenerative disease; and / or the disease or the symptom associated with the expression level of APOE4 mRNA is one or more selected from the group consisting of Alzheimer’s disease (AD), Down’s syndrome and cerebral amyloid angiopathy.
49. A method for regulating the expression level of APOE4 mRNA in a cell, comprising contacting the cell with an effective amount of one or more of the single- stranded oligonucleotide of any one of claims 1-24, the double-stranded oligonucleotide of any one of claims 25-40, the oligonucleotide conjugate according to claim 41 or 42, the pharmaceutically acceptable salt of claim 43, and the pharmaceutical composition of claim 44.
50. One or more of the single-stranded oligonucleotide according to any one of claims 1-24, the double-stranded oligonucleotide according to any one of claims 25-40, the oligonucleotide conjugate according to claim 41 or 42, the pharmaceutically acceptable salt according to claim 43, and the pharmaceutical composition according to claim 44, for use as a medicament.
51. One or more of the single-stranded oligonucleotide according to any one of claims 1-24, the double-stranded oligonucleotide according to any one of claims 25-40, theoligonucleotide conjugate according to claim 41 or 42, the pharmaceutically acceptable salt according to claim 43, and the pharmaceutical composition according to claim 44, for use in the treatment and / or prevention of a disease or a symptom associated with the expression level of APOE4 mRNA, such as a neurodegenerative disease, such as a neurodegenerative disease selected from the group consisting of Alzheimer’s disease (AD), Down’s syndrome and cerebral amyloid angiopathy.
52. A cell expressing APOE4 mRNA, comprising one or more of the single-stranded oligonucleotide according to any one of claims 1-24, the double-stranded oligonucleotide according to any one of claims 25-40, the oligonucleotide conjugate according to claim 41 or 42, the pharmaceutically acceptable salt according to claim 43, and the pharmaceutical composition according to claim 44.
53. A kit comprising one or more of the single-stranded oligonucleotide according to any one of claims 1-24, the double-stranded oligonucleotide according to any one of claims 25-40, the oligonucleotide conjugate according to claim 41 or 42, the pharmaceutically acceptable salt according to claim 43, and the pharmaceutical composition according to claim 44;and an optional instructions for use.
Citation Information
Patent Citations
5' phosphate mimics
US20120157511A1
Compositions and methods for non-parenteral delivery of oligonucleotides
US20130274309A1
APOLIPOPROTEIN E (APOE) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
US20230193268A1
Compounds and methods for reducing APOE expression
US20230357770A1