Novel carboxylic acid reductase variant and method for producing 1,4-butanediol using same

Abstract

The present invention relates to a novel carboxylic acid reductase variant and a method for producing 1,4-butanediol using same, wherein the carboxylic acid reductase variant has altered protein activity resulting from substitution of one or more amino acids in the amino acid sequence constituting carboxylic acid reductase, so that a transformant or recombinant microorganism comprising same can efficiently produce the carboxylic acid reductase.

Description

Novel carboxylic acid reductase variant and method for producing 1,4-butanediol using the same

[0001] The present invention relates to a novel variant of carboxylic acid reductase and a method for producing 1,4-butanediol using the same.

[0002] 1,4-butanediol (1,4-BDO) is used throughout the chemical industry as a solvent, polymer intermediate, and fine chemical intermediate. 1,4-butanediol is primarily produced through a process of reacting acetylene with formaldehyde followed by the addition of hydrogen. It can also be produced from maleic anhydride and propylene oxide. However, there are problems such as disruptions in raw material supply and increased production costs due to unstable international oil prices, as well as greenhouse gases and waste generation resulting from the use of fossil fuels.

[0003] To complement these chemical production processes, low-cost and eco-friendly biological processes for producing 1,4-butanediol using biomass as a raw material are currently being developed. Microorganisms primarily produce 1,4-butanediol using α-ketoglutarate or succinyl-CoA as precursors, and recently, a glutamic acid-based metabolic pathway for 1,4-butanediol production in E. coli has been developed. However, microbial 1,4-butanediol production processes face limitations, such as relatively low production yields, due to the generation of unnecessary byproducts like acetate and lactate during metabolic processes and the self-degradation of the produced 1,4-butanediol. Therefore, continuous efforts are required to develop microorganisms capable of producing 1,4-butanediol at high yields using genetic engineering techniques to overcome these limitations.

[0004] [Prior Art Literature]

[0005] [Patent Literature]

[0006] European Registered Patent No. 3050970

[0007] European Registered Patent No. 2782893

[0008] The present invention aims to provide a novel carboxylic acid reductase variant.

[0009] In addition, the present invention aims to provide a polynucleotide encoding the said variant.

[0010] In addition, the present invention aims to provide a human-excluding transgenic organism comprising the above variant or polynucleotide.

[0011] In addition, the present invention aims to provide a method for producing 1,4-butanediol using the above-mentioned transformant.

[0012] One aspect of the present invention provides a carboxylic acid reductase variant, specifically, (1) a variant composed of the amino acid sequence of SEQ ID NO. 4 in which the 377th methionine in the amino acid sequence of SEQ ID NO. 2 is substituted with phenylalanine; (2) a variant composed of the amino acid sequence of SEQ ID NO. 6 in which the 402nd glycine in the amino acid sequence of SEQ ID NO. 2 is substituted with threonine; (3) a variant composed of the amino acid sequence of SEQ ID NO. 10 in which the 387th methionine in the amino acid sequence of SEQ ID NO. 4 is substituted with phenylalanine; and (4) a variant composed of the amino acid sequence of SEQ ID NO. 12 in which the 412th glycine in the amino acid sequence of SEQ ID NO. 4 is substituted with threonine.

[0013] The conventionally known 1,4-butanediol production pathway in microorganisms involves pyruvate, produced from glucose in glycolysis, being oxidized to acetyl-CoA and synthesized into α-ketoglutarate and succinyl-CoA within the TCA cycle, where 4-hydroxybutyric acid is produced through the decarboxylation of α-ketoglutarate or the reduction of succinyl-CoA, and finally, 1,4-butanediol is produced from 4-hydroxybutyric acid by carboxylic acid reductase.

[0014] The “carboxylic acid reductase (CAR)” used in the present invention is an enzyme that catalyzes the reaction of reducing the carboxyl group of 4-hydroxybutyric acid, which is a precursor of 1,4-butanediol, and may be a polypeptide encoded by the CAR gene that has carboxylic acid reductase activity, but is not limited thereto.

[0015] Nucleic acid and protein sequence information for the above-mentioned carboxylic acid reductase can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0016] According to one embodiment of the present invention, the carboxylic acid reductase may be encoded by the car gene (Sequence No. 1) inherent in Mycobacterium canariasense and may consist of the amino acid sequence of Sequence No. 2.

[0017] In addition, the above carboxylic acid reductase may be encoded by the car gene (Sequence No. 7) inherent in Mycobacterium conceptionense and may consist of the amino acid sequence of Sequence No. 8.

[0018] The nucleotide sequence or amino acid sequence of the carboxylic acid reductase according to the present invention may consist of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity compared to the nucleotide sequence of SEQ ID NO. 1 or 7 or the amino acid sequence of SEQ ID NO. 2 or 8, and may have an original function. Here, “homology” or “identity” refers to the percentage of agreement between two sequences when a reference nucleotide sequence or amino acid sequence and any other nucleotide sequence or amino acid sequence are aligned to correspond as much as possible and analyzed.

[0019] General carboxylic acid reductases are known to have high substrate specificity for aromatic compounds, but low activity for substrates with short chains such as 4-hydroxybutyric acid (C4). In the present invention, carboxylic acid reductases derived from Mycobacterium canariasensae and Mycobacterium conceptionense, which have been found to have high activity for short chain substrates, were used to develop carboxylic acid reductase variants by substituting one or more amino acids in the amino acid sequence constituting the carboxylic acid reductases to improve enzyme activity.

[0020] The term "variant" as used in the present invention refers to a protein that differs from its original amino acid sequence due to a variation in the base sequence of a gene encoding a protein. More specifically, a gene sequence variation involves a change in one or more bases or nucleotides in the sequence constituting the gene through substitution, insertion, deletion, etc. Consequently, the translated polypeptide or protein is a protein variant in which one or more amino acids are conservatively substituted and / or modified at the N-terminus, C-terminus, and / or internally, differing from the amino acid sequence prior to the variation, while maintaining functions or properties. Here, "conservative substitution" means replacing one amino acid with another amino acid that has similar structural and / or chemical properties, and may have little to no effect on the activity of the protein or polypeptide. The above amino acids are selected from alanine (Ala), isoleucine (Ile), valine (Val), leucine (Leu), methionine (Met), asparagine (Asn), cysteine ​​(Cys), glutamine (Gln), serine (Ser), threonine (Thr), phenylalanine (Phe), tryptophan (Trp), tyrosine (Tyr), aspartic acid (Asp), glutamic acid (Glu), arginine (Arg), histidine (His), lysine (Lys), glycine (Gly), and proline (Pro).

[0021] Additionally, variants include those in which one or more parts, such as an N-terminal leader sequence or a transmembrane domain, are removed, or in which a portion of the N- and / or C-terminus of a mature protein is removed.

[0022] The ability of such variants may be increased (enhanced), unchanged, or decreased (weakened) compared to the pre-mutation protein. Here, "increase or enhancement" includes cases where the activity of the protein itself is increased compared to the pre-mutation protein, cases where the overall degree of protein activity (expression level) within the cell is higher than that of the wild-type strain or the strain expressing the pre-mutation protein due to increased expression or translation of the gene encoding the protein, and combinations thereof. Additionally, "decrease or weakening" includes cases where the activity of the protein itself is decreased compared to the pre-mutation protein, cases where the overall degree of protein activity (expression level) within the cell is lower than that of the wild-type strain or the strain expressing the pre-mutation protein due to inhibition of gene expression or translation of the gene encoding the protein, cases where there is no protein activity even if the gene encoding the protein is expressed, and combinations thereof. In the present invention, the terms variant may be used interchangeably with variant, modification, variant polypeptide, mutated protein, mutation, etc.

[0023] A carboxylic acid reductase variant according to the present invention may include an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity with respect to the amino acid sequence of SEQ ID NO. 2 for the carboxylic acid reductase of Mycobacterium canariasensae, excluding the variant position (the 377th and / or 402nd amino acid residue), and may include any amino acid sequence that maintains the function or characteristics of the variant without limitation.

[0024] In addition, the carboxylic acid reductase variant according to the present invention may include an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity with respect to the amino acid sequence of SEQ ID NO. 8 for the carboxylic acid reductase of Mycobacterium conceptionense, excluding the variant position (the amino acid residue at the 387th and / or 412th position), and may include any amino acid sequence that maintains the function or characteristics of the variant without limitation.

[0025]

[0026] Another aspect of the present invention provides a polynucleotide encoding the carboxylic acid reductase variant.

[0027] The term "polynucleotide" used in the present invention refers to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, and is a DNA or RNA strand of a certain length or longer, more specifically, a polynucleotide fragment encoding the carboxylic acid reductase variant.

[0028] According to one embodiment of the present invention, the polynucleotide may comprise a base sequence encoding one of the amino acid sequences of SEQ ID NOs. 4, 6, 10 and 12.

[0029] Specifically, the polynucleotide may include the base sequence of SEQ ID NO. 3 encoding the amino acid sequence of SEQ ID NO. 4, the base sequence of SEQ ID NO. 5 encoding the amino acid sequence of SEQ ID NO. 6, the base sequence of SEQ ID NO. 9 encoding the amino acid sequence of SEQ ID NO. 10, and the base sequence of SEQ ID NO. 11 encoding the amino acid sequence of SEQ ID NO. 12, but is not limited thereto.

[0030]

[0031] Another aspect of the present invention provides a vector comprising a polynucleotide encoding the carboxylic acid reductase variant.

[0032] Additionally, another aspect of the present invention provides a transformant comprising the carboxylic acid reductase variant or polynucleotide.

[0033] As used in the present invention, the term "vector" refers to any type of nucleic acid sequence carrier structure used as a means to deliver and express a target gene to a mutation target (host cell). Unless otherwise specified, the vector may mean a structure in which a carried nucleic acid sequence is inserted into the host cell genome to be expressed and / or expressed independently. Such a vector comprises an essential regulatory element operably linked to enable the expression of the gene insertion, where "operably linked" means that the target gene and its regulatory sequence are linked in a manner in which they are functionally coupled to enable gene expression, and the "regulatory element" comprises a promoter for performing transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0034] The vector used in the present invention is not particularly limited as long as it is capable of replicating within a host cell, and any vector known in the art may be used. Examples of such vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors, but are not limited thereto.

[0035] The above vector can typically be constructed as a vector for cloning or as a vector for expression. The vector for expression may be a conventional one used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and may be constructed through various methods known in the art.

[0036] The “recombinant vector” used in the present invention may be constructed using a prokaryotic or eukaryotic cell as a host, and may be capable of replication independently of the host cell’s genome or may be sealed to the genome itself. The host cell is capable of replication by the vector and may include a replication origin, which is a specific nucleotide sequence at which replication is initiated. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it generally includes a potent promoter capable of proceeding transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. When the host is a eukaryotic cell, the replication origins included in the vector that operate in eukaryotic cells include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adeno replication origins, AAV replication origins, and BBV replication origins. In addition, promoters derived from the genome of mammalian cells (e.g., metallothionine promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV tk promoter) may be used and generally have a polyadenylation sequence as a transcription termination sequence.

[0037] The above-mentioned recombinant vector may include a selection marker, which is intended to select transformants (host cells) transformed by the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, the selection of transformed cells is possible. Representative examples of the selection marker include ampicillin, kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.

[0038] A transformant can be produced by inserting the above-mentioned recombinant vector into a host cell, and the transformant may be obtained by introducing the recombinant vector into a suitable host cell. Any host cell known in the art may be used as a cell capable of stably and continuously cloning or expressing the above-mentioned expression vector.

[0039] When transforming a prokaryotic cell to produce a recombinant microorganism, various intestinal bacteria such as Escherichia coli (E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, E. coli XL1-Blue), Corynebacterium, Bacillus (Bacillus subtilis, Bacillus thuringiensis), Salmonella typhimurium, Serratia marcescens, and Pseudomonas (Pseudomonas) may be used as host cells, but are not limited thereto.

[0040] When transforming into a eukaryotic cell to produce a recombinant microorganism, host cells such as yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., may be used, but are not limited thereto.

[0041] As used in this invention, “transformation” refers to a phenomenon in which external DNA is introduced into a host cell to artificially induce a genetic change, and “transformant” refers to a host cell into which external DNA is introduced to stably maintain the expression of a target gene.

[0042] The above transformation may be performed by selecting a vector introduction technique suitable for the host cell to express the target gene or a recombinant vector containing it within the host cell. For example, vector introduction may be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene may be included without limitation, whether inserted into the chromosomes of the host cell or located extrachromosomally, as long as it can be expressed within the host cell.

[0043] The above transformant comprises cells that have been transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used interchangeably with recombinant host cells, recombinant cells, or recombinant microorganisms.

[0044] The transgenic body of the present invention may be one other than a human.

[0045] The genes inserted into the recombinant vector for transformation of the present invention can be introduced into a host cell, such as a microorganism of the genus Corynebacterium, through homologous recombination crossing.

[0046] According to one embodiment of the present invention, the host cell may be a microorganism of the genus Corynebacterium.

[0047] The above-mentioned microorganisms of the genus Corynebacterium are Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, and Corynebacterium parkensae pacaense), Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollitisoli pollutisoli), Corynebacterium imitans,It may be, but is not limited to, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium pseudopelargi, Corynebacterium flavescens, etc.

[0048] For example, the above-mentioned microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0049] The transformant in the present invention may be a strain comprising the aforementioned carboxylic acid reductase variant or a polynucleotide encoding the same, or a vector comprising the same, a strain expressing the carboxylic acid reductase variant or polynucleotide, or a strain having activity against the carboxylic acid reductase variant, but is not limited thereto.

[0050] The transformant in the present invention may include other protein variants or gene variants in addition to the carboxylic acid reductase variant.

[0051] According to one embodiment of the present invention, the transformant may have the ability to produce carboxylic acid reductase.

[0052] The above-mentioned transformant may have the ability to produce 1,4-butanediol naturally, or may be artificially endowed with the ability to produce 1,4-butanediol.

[0053] According to one embodiment of the present invention, the transformant may have a modified carboxylic acid reductase activity and an improved 1,4-butanediol production capacity.

[0054] The term “improved 1,4-butanediol production capacity” as used in the present invention means that the productivity of 1,4-butanediol is increased compared to the microorganism (parent strain) prior to mutation. The parent strain refers to a wild-type or mutant microorganism that is the subject of mutation, and includes the subject that is directly subjected to mutation or transformed into a recombinant vector, etc.

[0055] In the present invention, the parent strain refers to a microorganism before its traits are altered by genetic mutation due to natural or artificial factors, and, for example, may be a microorganism that does not produce 1,4-butanediol because it lacks an enzyme acting on the 1,4-butanediol production pathway, or may be a 1,4-butanediol-producing microorganism that expresses an enzyme involved in the 1,4-butanediol production pathway or a gene encoding it. The above-mentioned 1,4-butanediol-producing microorganism may be modified with respect to genes encoding related enzymes through modifications of the endogenous gene sequence (nucleic acid deletion, addition, substitution, etc.), insertion of foreign genes into the genome, or introduction of plasmids (vectors) containing foreign genes, for example, having a 1,4-butanediol biosynthetic pathway from glutamic acid, including enzymatic reactions converting glutamic acid to 4-aminobutyric acid (glutamic acid decarboxylase, gadB gene), enzymatic reactions converting 4-aminobutyric acid to succinate semialdehyde (4-aminobutyrate aminotransferase, gabT gene), enzymatic reactions converting succinate semialdehyde to 4-hydroxybutyrate (aldehyde reductase, yqhD gene), and It may include, but is not limited to, an enzymatic reaction that converts 4-hydroxybutyrate to 1,4-butanediol (carboxylic acid reductase, car gene / aldehyde reductase, yqhD gene).

[0056] The transformant according to the present invention exhibits increased 1,4-butanediol production capacity compared to the parent strain, as the activity of carboxylic acid reductase changes due to the introduction of a carboxylic acid reductase variant. Specifically, the transformant has a 1,4-butanediol production of at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% increased compared to the parent strain, or 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times, 20 times, 30 times, 40 times, It may be increased by 50, 60, 70, 80, 90, or 100 times, but is not limited thereto. For example, a transformant containing a carboxylic acid reductase variant may have a 1,4-butanediol production of 0.5 times or more compared to the parent strain, specifically 0.5 to 20 times (preferably 1 to 10 times).

[0057] A composition comprising a transformant according to the present invention can be used as a composition for producing 1,4-butanediol.

[0058]

[0059] Another aspect of the present invention provides a method for producing 1,4-butanediol, comprising the steps of: culturing the transformant in a medium; and recovering 1,4-butanediol from the transformant or the medium in which the transformant is cultured.

[0060] The above culture may be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust and use the media and culture conditions. Specifically, the media may be liquid media, but is not limited thereto. The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.

[0061] According to one embodiment of the present invention, the medium must satisfy the requirements of a specific strain in an appropriate manner and may be appropriately modified by a person skilled in the art. For culture media for microorganisms of the genus Corynebacterium, reference may be made to the known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but is not limited thereto.

[0062] According to one embodiment of the present invention, the culture medium may contain various carbon sources, nitrogen sources, and trace element components. Carbon sources that may be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that may be used include peptone, yeast extract, meat broth, malt extract, corn steep liquid, soybean meal, and urea or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that may be used may include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but are not limited thereto. Furthermore, essential growth substances such as amino acids and vitamins may be included. In addition, suitable precursors may be used in the culture medium. The medium or individual components may be added to the culture solution in a batch or continuous manner in a manner suitable for the culture process, but are not limited thereto.

[0063] According to one embodiment of the present invention, the medium may contain 1,4-butanediol.

[0064] According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. Additionally, bubble formation can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester during cultivation. Furthermore, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium can typically be 20 to 45°C, for example, 25 to 40°C. The cultivation period can continue until a desired amount of useful material is obtained, for example, 10 to 160 hours.

[0065] According to one embodiment of the present invention, the step of recovering 1,4-butanediol from the cultured transformant or a culture medium containing the same may involve collecting or recovering 1,4-butanediol produced from the medium using a suitable method known in the art according to the culture method. For example, methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but are not limited thereto.

[0066] According to one embodiment of the present invention, the step of recovering the 1,4-butanediol may involve removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0067] According to one embodiment of the present invention, the step of recovering the 1,4-butanediol may include a process of purifying the 1,4-butanediol.

[0068] The carboxylic acid reductase variant according to the present invention has its protein activity altered by substituting one or more amino acids in the amino acid sequence constituting the carboxylic acid reductase, so that a transformant or recombinant microorganism containing the same can efficiently produce carboxylic acid reductase.

[0069] The present invention will be described in more detail below. However, this description is provided merely as an example to aid in understanding the invention, and the scope of the invention is not limited by this exemplary description.

[0070]

[0071] Example 1. Overexpression of Carboxylic Acid Reductase (CAR) and Evaluation of Enzyme Activity

[0072] 1-1. Fabrication of a Vector for Wild-Type CAR Overexpression

[0073] We constructed vectors that overexpress Mycobacterium canariasense-derived carboxylic acid reductase (McaCAR) and Mycobacterium conceptionense-derived carboxylic acid reductase (McoCAR).

[0074] Chromosomal DNA of Mycobacterium canariasensi was amplified by PCR using primers 1 and 2. The resulting PCR product was inserted into the restriction enzyme NdeI and HindIII sites of the pET30a vector (Merck Millipore, Novagen 69909). This vector was named pET30a-McaCAR.

[0075] Chromosomal DNA of Mycobacterium conceptionense was amplified by PCR using primers 3 and 4 as a template. The resulting PCR product was inserted into the restriction enzyme NdeI and HindIII sites of the pET30a vector. This vector was named pET30a-McoCAR.

[0076] To overexpress phosphopantetheinyl transferase (PPTase), which is required to activate the enzymatic activity of carboxylic acid reductase encoded by the car gene, chromosomal DNA of Bacillus subtilis, which inherently contains the sfp gene, was amplified by PCR using primers 5 and 6, using Bacillus subtilis as a template. The resulting PCR product was inserted into the restriction enzyme NdeI and XhoI sites of the pET21b vector (Merck Millipore, Novagen 69741). This vector was named pET21b-BsPPTase.

[0077] Here, the Wizard Genomic DNA Purification Kit (Promega) was used to extract chromosomal DNA from each bacterium. The nucleotide sequences of the amplified car and sfp genes are shown in Table 1 below, and the primers used for PCR are shown in Table 2 below. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc.) in the presence of 1 unit of PrimeSTAR Max DNA Polymerase (Takara) by adding 1 pM of oligonucleotide and 10 ng of template DNA to a reaction mixture containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP).

[0078] pET30a-McaCAR, pET30a-McoCAR, and pET21b-BsPPTase vectors were constructed using PrimeSTAR MAX Polymerase (Takara), NEBuilder HiFi DNA Assembly Master Mix (NEB), and restriction enzymes NdeI (NEB), HindIII (NEB), and XhoI (NEB). Each vector was transformed into E. coli DH5a (HIT Competent cells™, Cat No. RH618) and plated onto LB-agar plates containing 50 µg / ml kanamycin and 100 µg / ml ampicillin, and incubated at 37°C for 24 hours. The final colonies formed were isolated to confirm that the insert was accurately present in the vector, after which the vector was isolated using the DokDo-Prep Plasmid Mini-Prep Kit (ELPIS-biotech).

[0079] 서열번호유전자 및 염기서열 (5'-3')1Mycobacterium canariasense유래, car 유전자GGGCTGCCGGTGGAGTTCATCGCGGAGGCGATCTCGACGCTCGGTGAGCACGTGGCACTCGAATCGGGAGGAGCCTTCGAGACCTACCACGTGATGAACCCGTACGACGATGGCATCGGCATGGACACCTTCGTCGACTGGCTGATCGACGCCGGCTACAAGATCGAACGCGTCGGTGAGTACGGGAAGTGGCTGGCGCGGTTCGAGACCGCACTGCGGTCGTTGCCGGACAAGCAGCGGCAGGCGTCGCTGCTACCGCTGCTGCACAACTACCAGCGTCCGGAGACACCGGTGCAGGGTTCGATCGCGCCGACCGATGTCTTCCGCGTTGCCGTGCAAGAAGCGAAAATCGGCCCGGACAAAGACATTCCGCATGTCAGTGCCCCGGTGATCGTCAAGTACATCACCGATCTGCAACTGCTCGGCCTGCTCTAG7Mycobacterium conceptionense유래, car 유전자GGTCTGCCCGTCGAGTTCATCGCCGAGTCGATCTCGACGCTGGGCGGGCAATCGGTGGAGAGCTTCGAGACCTACCACGTGATGAACCCGTACGACGACGGCCTCGGCATGGACGAGTTCGTCGACTGGCTCATCGAGGCCGGCTACCCGATCGAGCGCATCGAGGATTACGGGCAGTGGGTCCAGCGCTTCGAGAGCACCCTGCGCGCCCTGCCGGACAAGCAGCGTCAGGCGTCGCTGCTGCCGCTGCTGCACAACTACCAGAAGCCCGAGCGGCCGATGCTGGGTGCCCTGGCGCCCACGGACCACTTCCGTGCGGCAGTGCAGGAAGCCAAGATCGGGCCCGACAAGGACGTCCCCCATGTCAGCCCGGCGGTGATCGTCAAGTACATCACCGACCTGCAGCAGCTCGGCCTGCTCTAG13Bacillus subtilis유래,sfp 유전자ATGAAGATTTACGGAATTTATATGGACCGCCCGCTTTCACAGGAAGAAAATGAACGGTTCATGTCTTTCATATCACCTGAAAAACGGGAGAAATGCCGGAGATTTTATCATAAAGAAGATGCTCACCGCACCCTGCTGGGAGATGTGCTCGTTCGCTCAGTCATAAGCAGGCAGTATCAGTTGGACAAATCCGATATCCGCTTTAGCACGCAGGAATACGGGAAGCCGTGCATCCCTGATCTTCCCGACGCTCATTTCAACATTTCTCACTCCGGACGCTGGGTCATTTGCGCGTTTGATTCACAGCCGATCGGCATAGATATCGAAAAAACGAAACCGATCAGCCTTGAGATCGCCAAGCGCTTCTTTTCAAAAACAGAGTACAGCGACCTTTTAGCAAAAGACAAGGACGAGCAGACAGACTATTTTTATCATCTATGGTCAATGAAAGAAAGCTTTATCAAACAGGAAGGCAAAGGCTTATCGCTTCCGCTTGATTCCTTTTCAGTGCGCCTGCACCAGGACGGACAAGTATCCATTGAGCTTCCGGACAGCCATTCCCCATGCTATATCAAAACGTATGAGGTCGATCCCGGCTACAAAATGGCTGTATGCGCCGCACACCCTGATTTCCCCGAGGATATCACAATGGTCTCGTACGAAGAGCTTTTATAA,

[0080] Sequence Number Primer Name Primer Sequence (5'-3') 14 Primer 1 GC GC CAT AT G ACC ACC GA AA TC CG CC CG GA TG TC 15 Primer 2 AT ATA AG CT TG AG CA CG CC CA GC CG GG TC AG G TC 16 Primer 3 GC GC CAT AT G TC GA TT G T ACT CG TG AT GA GC AA 17 Primer 4 ATA TG CG GC CG AG CA GG CC GA GC TG CT GC 18 Primer 5 CG CG CAT GA AG AT TT AC G GA AT TT ATA TG GA C 19 Primer 6 T ACT CG AG TT ATA AA AG CT CT TC G TA CG AG AC 20 Primer 7 CG CT AC G TC GA CG TT TA CG GG TT CG GC CC CG 21 Primer 8 C GG GG CC GA ACC CG TA AA CG CG TC GA CG TA GC G 22 Primer 9 ATC CAT CT GC GC GA G ACC TA C GG CT CC ACC GA G 23 Primer 10CTCGGTGGAGCCGTAGGTCTCGCGCAGATGGAT24 Primer 11CGGTTCGTCGCCGCGTTTACCGGCTCGGCGCCC25 Primer 12GGGCGCCGAGCCGGTAAACGCGGCGACGAACCG26 Primer 13ATCCACCTGCTCGAGACCTACGGGTCCACCGAG27 Primer 14CTCGGTGGACCCGTAGGTCTCGAGCAGGTGGAT

[0081]

[0082] 1-2. Fabrication of a Vector for CAR Variant Overexpression

[0083] A vector was constructed to express a CAR variant (Sequence No. 4) in which the 377th amino acid, methionine (M), in the amino acid sequence of Mycobacterium canariasensae-derived carboxylic acid reductase (McaCAR) is substituted with phenylalanine (F), or a CAR variant (Sequence No. 6) in which the 402nd amino acid, glycine (G), is substituted with threonine (T).

[0084] The pET30a-McaCAR vector was amplified by PCR using primers 7 and 8 as a template. The template vector was destroyed by adding DpnI restriction enzyme to the PCR product obtained. This vector was named pET30a-McaCAR (M377F).

[0085] The pET30a-McaCAR vector was amplified by PCR using primers 9 and 10 as a template. The template vector was destroyed by adding DpnI restriction enzyme to the PCR product obtained. This vector was named pET30a-McaCAR (G402T).

[0086] A vector was constructed to express a CAR variant (Sequence No. 10) in which the 387th amino acid, methionine (M), in the amino acid sequence of Mycobacterium conceptionensei carboxylic acid reductase (McoCAR) is substituted with phenylalanine (F), or a CAR variant (Sequence No. 12) in which the 412th amino acid, glycine (G), is substituted with threonine (T).

[0087] The pET30a-McoCAR vector was amplified by PCR using primers 11 and 12 as a template. The DpnI restriction enzyme was added to the PCR product obtained to destroy the template vector. This vector was named pET30a-McoCAR (M387F).

[0088] The pET30a-McoCAR vector was amplified by PCR using primers 13 and 14 as a template. The template vector was destroyed by adding DpnI restriction enzyme to the PCR product obtained. This vector was named pET30a-McoCAR (G412T).

[0089] Here, the primers listed in Table 2 above were used for PCR from each vector. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc.) in the presence of 1 unit of PrimeSTAR Max DNA Polymerase (Takara) by adding 1 pM of oligonucleotide and 10 ng of template DNA to a reaction mixture containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP). Subsequently, the PCR products were treated with DpnI (NEB) and reacted at 37°C for 1 hour.

[0090] The prepared pET30a-McaCAR (M377F), pET30a-McaCAR (G402T), pET30a-McoCAR (M387F), and pET30a-McoCAR (G412T) vectors were each transformed into E. coliDH5a (HIT Competent cells™, Cat No. RH618), plated on LB-agar plates containing 50 μg / ml kanamycin, and cultured at 37°C for 24 hours. The final colonies formed were isolated to confirm that the insert was accurately present in the vector, and then the vector was isolated using the DokDo-Prep Plasmid Mini-Prep Kit (ELPIS-biotech).

[0091]

[0092] 1-3. Evaluation of CAR Overexpression and Enzyme Activity

[0093] The fabricated pET30a-McaCAR vector and pET21b-BsPPTase vector, pET30a-McaCAR(M377F) vector and pET21b-BsPPTase vector, pET30a-McaCAR(G402T) vector and pET21b-BsPPTase vector, pET30a-McoCAR vector and pET21b-BsPPTase vector, pET30a-McoCAR(M387F) vector and pET21b-BsPPTase vector, and pET30a-McoCAR(G412T) vector and pET21b-BsPPTase vector are each E. The cells were transformed into coliBL21(DE3) (HIT Competent cells™, Cat No. RH217) and plated onto LB-agar plates containing 50 µg / ml kanamycin and 100 µg / ml ampicillin, then incubated at 37°C for 24 hours. Each final strain was inoculated into 10 ml of LB medium for the seed culture and cultured primaryly at 37°C for 18 hours; subsequently, 10 ml of the seed culture was inoculated into 1 L of LB medium for main culture. Main culture was performed at 37°C and 120 rpm for 2 to 2.5 hours to obtain an OD level. 600 When the value reached 0.5–0.6, 0.5 mM IPTG was added, and the culture was then incubated at 18°C ​​and 120 rpm for 18 hours. The culture medium was centrifuged at 4°C and 4,000 rpm for 10 minutes, the supernatant was discarded, and the precipitated strain was suspended in 30 mL of 40 mM Tris-HCl buffer. The suspension was then lysed using a sonicator and centrifuged at 4°C and 13,500 rpm for 30 minutes. Proteins were isolated and purified from the supernatant via affinity chromatography, and overexpression was confirmed by SDS-PAGE.

[0094] Carboxylic acid reductase derived from Mycobacterium canariasensae (McaCAR) and carboxylic acid reductase derived from Mycobacterium conceptionenseae (McoCAR) were used as controls for CAR mutant enzymes (McaCAR(M377F), McaCAR(G402T), McoCAR(M387F), and McoCAR(G412T)), and enzyme activity was analyzed using a UV / Vis spectrophotometer (Shimadzu, UV-1800). CAR activity was measured by the decrease in NADPH when the reaction occurred using succinic acid as a substrate. The reaction solution was 500 μL, and the composition of the reaction solution was 100 mM phosphate buffer (phosphate, pH 7.0), 10 mM magnesium chloride (MgCl2), 2.5 mM ATP, 0.2 mM NADPH, and 200 mM succinic acid, to which 1 μM of each CAR was added. The enzymatic reaction was carried out at room temperature (25°C), and the absorbance was measured at a wavelength of 340 nm. The results are shown in Table 3 below.

[0095] Enzyme Activity (μM / min) McaCAR 1 12.6 McaCAR (M377F) 201.5 McaCAR (G402T) 222.9 McoCAR 9 5.7 McoCAR (M387F) 164.6 McoCAR (G412T) 180.9

[0096] As shown in Table 3 above, compared to the carboxylic acid reductase derived from Mycobacterium canariasensae (McaCAR), the enzyme activity of the carboxylic acid reductase variants (McaCAR(M377F) and McaCAR(G402T)) in which the 377th or 402nd amino acid in the amino acid sequence was substituted increased by approximately 1.8 times and 2.0 times, respectively.

[0097] Compared to carboxylic acid reductase derived from Mycobacterium conceptionense (McoCAR), the enzymatic activity of carboxylic acid reductases (McoCAR(M387F) and McoCAR(G412T)) with the 387th or 412th amino acid in the amino acid sequence substituted was increased by approximately 1.7 times and 1.9 times, respectively.

[0098]

[0099] Example 2. Production of Corynebacterium glutamicum with an established 1,4-BDO production pathway

[0100] 2-1. Construction of Vectors for gadB, gabT, yqhD, car, and sfp Gene Introduction

[0101] A pathway for the biosynthesis of 1,4-butanediol from glutamic acid was constructed by introducing the gadB, gabT, yqhD, car, and sfp genes into Corynebacterium glutamicum ATCC13032.

[0102] Chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 1 and 2, 3 and 4, 7 and 8, 35 and 36, 37 and 38, and 39 and 8, respectively, to obtain fragments containing the gabT gene. DNA of pCES208H36EcGADmut (ACS Omega. 2022 Aug 23; 7(33): 29106-29115.) containing the gadB gene (derived from Escherichia coli) was amplified by PCR using primers 5 and 6, respectively, using a template. The PCR products obtained therefrom were amplified by crossover PCR and then inserted into the restriction enzyme HindIII and XbaI sites of the pK19mobSacB vector (ATCC, 87098). This vector was named pk19mobsacB-gadB(E89Q,△452-466)gabT.

[0103] Chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 9 and 10, primers 11 and 12, and primers 15 and 16, respectively, using the ATCC13032 template. Chromosomal DNA of Escherichia coli K-12 MG1655, which inherently contains the yqhD gene, was amplified by PCR using primers 13 and 14, respectively, using the chromosomal DNA of Escherichia coli K-12 MG1655 as a template. The resulting PCR products were amplified by crossover PCR and then inserted into the restriction enzyme HindIII and XbaI sites of the pK19mobSacB vector. This vector was named pk19mobsacB-yqhD.

[0104] Chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 17 and 18, primers 19 and 20, and primers 23 and 24, respectively. The E. coli expression vector pKE112CAR3pptase (Polymers (Basel). 2019 11(7):1184), containing the car gene (derived from Mycobacterium abscessus), was amplified by PCR using primers 21 and 22, respectively, using the car gene as a template. The PCR products obtained were amplified by crossover PCR and then inserted into the restriction enzyme HindIII and XbaI sites of the pK19mobSacB vector. This vector was named pk19mobsacB-car.

[0105] To insert the sfp gene required to activate the enzymatic activity of the CAR gene, the chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 25 and 26, 27 and 28, and 31 and 32, respectively. The E. coli expression vector pKE112CAR3pptase (Polymers (Basel). 2019 11(7):1184), containing the sfp gene (derived from Bacillus subtilis, SEQ No. 13), was amplified by PCR using primers 29 and 30, respectively, using a template. The PCR products obtained therefrom were amplified by crossover PCR and then inserted into the restriction enzyme HindIII and XbaI sites of the pK19mobSacB vector. This vector was named pk19mobsacB-sfp.

[0106] Here, the Wizard Genomic DNA Purification Kit (Promega) was used to extract chromosomal DNA from each bacterium. The nucleotide sequences of the amplified gadB, gabT, yqhD, and car genes are shown in Table 4 below, and the primers used for PCR are shown in Table 5 below. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc.) in the presence of 1 unit of PrimeSTAR Max DNA Polymerase (Takara) by adding 1 pM of oligonucleotide and 10 ng of template DNA to a reaction mixture containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP).

[0107] The pk19mobsacB-gadB(E89Q,△452-466)gabT, pk19mobsacB-yqhD, pk19mobsacB-car, and pk19mobsacB-sfp vectors, constructed using NEBuilder HiFi DNA Assembly Master Mix (NEB) and restriction enzymes HindIII (NEB) and XbaI (NEB), were each transformed into E. coliDH5a (HIT Competent cells™, Cat No. RH618) and plated on LB-agar plates containing 50 μg / ml kanamycin, and incubated at 37°C for 24 hours. The final colonies formed were isolated to confirm that the insert was present in the vector, and the vector was isolated and used to prepare a mutant strain of Corynebacterium glutamicum with the glutamic acid-1,4-butanediol pathway introduced.

[0108] 서열번호유전자 및 염기서열 (5'-3')28Escherichia coli유래, gadB 유전자AAGTACAGAACGCCTCTTACCAGGTTGCCGCTTATCTGGCGGATGAAATCGCCAAACTGGGGCCGTATGAGTTCATCTGTACGGGTCGCCCGGACGAAGGCATCCCGGCGGTTTGCTTCAAACTGAAAGATGGTGAAGATCCGGGATACACCCTGTATGACCTCTCTGAACGTCTGCGTCTGCGCGGCTGGCAGGTTCCGGCCTTCACTCTCGGCGGTGAAGCCACCGACATCGTGGTGATGCGCATTATGTGTCGTCGCGGCTTCGAAATGGACTTTGCTGAACTGTTGCTGGAAGACTACAAAGCCTCCCTGAAATATCTCAGCGATCACTGA29Corynebacterium glutamicum유래, gabT 유전자AGACCCGCGCGCAAGAAATCGAGACCATCATCCGCGATGAATTCGCGCAGCTGAGTGCCTTCCCGGAGGTCGCCGAAATCCGCGGCCGCGGAGCAATGATGGCCATTGAGCTTATCGACGCTACCGGCCGCCCGAACGCAGCTTTAACCGCCGCAGTGGCTGCGCGCGCAAAAGCTGAAGGTGTGCTGCTGCTGACTTGCGGCACCGATGGCAACGTCATCCGCCTGCTGCCACCACTGGTCATTGCAGAGGACACTCTCCGTGATGGTCTTCAGGTGTTAGTCGCAGCCCTAGAGCGCGAAACCGCGCACCAGAAGGTGGGCTAA30Escherichia coli유래, yqhD 유전자CCCACCTCTCCGACTACGGTCTGGACGGCAGCTCCATCCCGGCTTTGCTGAAAAAACTGGAAGAGCACGGCATGACCCAACTGGGCGAAAATCATGACATTACGTTGGATGTCAGCCGCCGTATATACGAAGCCGCCCGCtaa31Mycobacterium abscessus유래,car 유전자ttctatgaattggatgccgacggcaatcggcagcgcgctcactatgacggtgtgcccggcgatttcaccgccgcatcgatcaccgccatcggcggtgtgaacgtggtagacggttaccgcagcttcgacgtgttcaacccgcaccatgacggtgtctcgatggataccttcgtcgactggctgatcgacgcaggctacaagatcgcgcggatcgacgattacgaccagtggctcgcccggttcgagctggccctcaagggattgcccgagcagcagcggcaacagtcggtgttgccacttctcaagatgtacgagaagccgcaaccggcgatcgacggaagtgcacttccgaccgcagaattcagtcgcgccgtgcacgaggcgaaggtcggagacagcggtgagataccgcacgtcaccaaggagctgatcctcaagtacgccagcgatattcagctgttgggcctggtgtag,

[0109] Sequence Number Primer Name Primer Sequence (5'-3')32 Primer 1aacagctatgaccatgattacgccaCAAGGATTACGAGCTCGTTGGTGAG33 Primer 2CTTCGGATCTAAACGATCTGGGCTTTTACCTTCGTTTCGC34 Primer 3CGAAGGTAAAAGCCCAGATCGTTTAGATCCGAAGGAAAAC35 Primer 4ACTTGCTTCTTATCCATTGTATGTCCTCCTGGACTTCGTG36 Primer 5AGTCCAGGAGGACATACAATGGATAAGAAGCAAGTAACGG37 Primer 6GGGTCCGGCTTTTTGTCAGTGATCGCTGAGATATTTCAGG38 Primer 7CTCAGCGATCACTGACAAAAAGCCGGACCCTTGCTTTAAG39 Primer 8ggtacccggggatcctctagTGCTCATGCAGTACCTGC40 Primer 9TGATTACGCCAAGCTGGGCGATGGCGGCGAATCCG41 Primer 10CCTTCGGATCTAAACGATCTTTCCTTAAGTGCTGATTCGC42 Primer 11GCGAATCAGCACTTAAGGAAAGATCGTTTAGATCCGAAGG43 Primer 12CAGATTAAAGTTGTTcatTGTATGTCCTCCTGGACTTCG44 Primer 13GTCCAGGAGGACATACAatgAACAACTTTAATCTGCACAC45 Primer 14TCAGAACCTGTAGGTCttaGCGGGCGGCTTCGTATATACG46 Primer 15CGAAGCCGCCCGCtaaGACCTACAGGTTCTGACAATTTAAATCTC47 Primer 16CCGGGGATCCTCTAGCTGGGACTTCAGCAACATCG48 Primer 17aacagctatgaccatgattacgccaTCCGACCTGGCCGGTGATGG49 Primer 18agctaagtagggtGAGCCAAGATTAGCGCTGAAAAGTAGC50 Primer 19GCGCTAATCTTGGCTCaccctacttagctgccaattattc51 PrimerPrimer 20ggagatcgtttcagtcatgggtaaaaaatcctttcgtagg52 Primer 21aaggattttttacccatgactgaaacgatctccacagcgg53 Primer 22GTCTGTAATCAGCGTCCTActacaccaggcccaacagctg54 Primer 23ttgggcctggtgtagTAGGACGCTGATTACAGACGTGTCC55 Primer 24ggtacccggggatcctctagTCTGCTCTAAAGAGCGGCGGGTGG56 Primer 25gaccaTGATTACGCCAAGCTCGACGCAGAAGGTGTGATCC57 Primer 26aattggcagctaagtagggtTTAGCCCACCTTCTGGTGCG58 Primer 27CAGAAGGTGGGCTAAaccctacttagctgccaattattcc59 Primer 28TAAATTCCGTAAATCTTCATgggtaaaaaatcctttcgta60 Primer 29aaggatttttttacccATGAAGATTTACGGAATTTATATGG61 Primer 30TCACGGCAAAGCGAGGTACTTATAAAAGCTCTTCGTACG62 Primer 31CGTACGAAGAGCTTTTATAAGTACCTCGCTTTGCCGTGAC63 Primer 32ggtacCCGGGGATCCTCTAGCGAAGCTTGCCGTGTGCAGG64 Primer 33GTTGGGCAGGAGTATATTGggatccATGACCACCGAAATCCGCCCGGATG65 Primer 34ggtccatatggacgggcctgcaggtTCAGAGCACGCCCAGCCGGGTCAGG66 Primer 35TCTCAGCGATCACTGAaccctacttagctgccaattattc67 Primer 36GTATGAGAGATCTTCCACgggtaaaaaatcctttcgtagg68 Primer 37aaggattttttacccGTGGAAGATCTCTCATACCGCATCC69 Primer 38CAAGGGTCCGGCTTTTTGTTAGCCCACCTTCTGGTGCGCG70 Primer39CAGAAGGTGGGCTAACAAAAAGCCGGACCCTTGCTTTAAG71Primer 40GTTGGGCAGGAGTATATTGggatccATGTCGTTTGATACTCGTGATGAGC72Primer 41ggtccatatggacgggcctgcaggtTCAGAGCAGGCCGAGCTGCTGCAGG

[0110]

[0111] 2-2. Production of mutant strains with an established 1,4-BDO production pathway

[0112] After introducing the pk19mobsacB-gadB(E89Q,△452-466)gabT vector prepared in Example 2-1 above into a competent cell Corynebacterium glutamicum ATCC13032 strain by electroporation using an electroporator (BIO-RAD), the vector was plated onto 2YT KM agar medium (containing tryptone 16 g / l, yeast extract 10 g / L, NaCl 5 g / L, agar 20 g / L, and kanamycin 30 mg / L) and cultured in a 30°C incubator for 2 days to obtain colonies. Among the colonies in which primary homologous recombination was induced, those confirmed by PCR were cultured in 2YT liquid medium (containing tryptone 16 g / L, yeast extract 10 g / L, and NaCl 5 g / L) for 12 hours, and then plated onto 2YT sucrose agar medium (containing tryptone 16 g / L, yeast extract 10 g / L, NaCl 5 g / L, agar 20 g / L, and sucrose 100 g / L) to remove antibiotic markers through secondary homologous recombination. The selected colonies were finally confirmed to have the gadB and gabT genes introduced as intended through PCR and sequencing analysis.

[0113] Subsequently, the above process was carried out sequentially using the pk19mobsacB-yqhD, pk19mobsacB-car, and pk19mobsacB-sfp vectors produced in Example 2-1 above to produce a Corynebacterium glutamicum mutant strain in which the gadB, gabT, yqhD, car, and sfp genes were introduced to establish a pathway for producing 1,4-butanediol from glutamic acid, and this strain was named WB04-P001.

[0114]

[0115] Example 3. Preparation of Corynebacterium glutamicum mutant strains expressing wild-type McaCAR or a variant thereof

[0116] 3-1. Construction of Vectors for McaCAR, McaCAR(M377F), or McaCAR(G402T) Expression

[0117] PCR was performed using primers 33 and 34 of Table 5 above with the pET30a-McaCAR vector, pET30a-McaCAR(M377F), and pET30a-McaCAR(G402T) vectors as templates, respectively. The PCR products obtained above were each linked to the pCES208H30 vector (Microbial Cell Factories volume 15, Article number: 174 (2016)) treated with restriction enzymes BamHI and XbaI, and the plasmids obtained therefrom were named pCES208H30-McaCAR, pCES208H30-McaCAR(M377F), and pCES208H30-McaCAR(G402T).

[0118] Here, the Wizard Genomic DNA Purification Kit (Promega) was used to extract DNA from each vector. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc.) in the presence of 1 unit of PrimeSTAR Max DNA Polymerase (Takara) by adding 1 pM of oligonucleotide and 10 ng of template DNA to a reaction mixture containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP). Each plasmid was constructed using NEBuilder HiFi DNA Assembly Master Mix (NEB) and restriction enzymes HindIII (NEB) and XbaI (NEB).

[0119]

[0120] 3-2. Production of McaCAR, McaCAR(M377F), or McaCAR(G402T) Expressing Mutants

[0121] The Corynebacterium glutamicum-based 1,4-butanediol-producing strain WB04-P001 of Example 2 was used as the parent strain to introduce each of the three plasmids produced in Example 3-1. For the transformation of the WB04-P001 strain, an electro-competent cell preparation method modified based on the method of van der Rest et al. was used. First, a seed culture was prepared by primary culturing the WB04-P001 strain in 10 ml of medium (containing beef extract 10 g / ℓ, brain heart infusion 40 g / ℓ, and sorbitol 30 g / ℓ). Subsequently, OD in 100 ml of medium (containing beef extract 10 g / L, brain heart infusion 40 g / L, and sorbitol 30 g / L, glycine 2.5 g / L, isoniazid 400 mg / L, and tween80 100 µL / L) 610After inoculating the seed culture medium until the value becomes 0.3, incubate at 30℃ and 200 rpm for 1.5 to 2 hours to obtain the OD 610 The value was adjusted to be between 0.5 and 0.6. The culture medium was left on ice for 30 minutes, and then centrifuged at 4°C and 3,500 rpm for 5 minutes. Afterward, the supernatant was discarded, and the precipitated strain was washed three times with a 10% glycerol solution. Finally, competent cells were prepared by resuspending the precipitated strain in 0.5 ml of a 10% glycerol solution. Electroporation was performed using an electroporator from Bio-Rad. After adding the plasmid to the competent cells prepared in an electroporation cuvette (0.2 mm), an electric shock was applied under conditions of 2.5 kV, 200 Ω, and 12.5 μF. Immediately after the electric shock ended, 1 ml of regeneration medium (containing beef extract 10 g / L, brain heart infusion 40 g / L, and sorbitol 30 g / L) was added, and heat treatment was performed at 46°C for 6 minutes. Afterward, the tubes were cooled by placing them on ice, incubated at 30°C for 2 hours, and plated onto screening medium (containing beef extract 10 g / L, brain heart infusion 40 g / L, sorbitol 30 g / L, agar 20 g / L, and kanamycin 30 µg / L). Colonies were obtained by incubating in a 30°C incubator for 2 days. Finally, the strain into which pCES208H30-McaCAR was introduced was named WB04-P008, the strain into which pCES208H30-McaCAR(M377F) was introduced was named WB04-P013, and the strain into which pCES208H30-McaCAR(G402T) was introduced was named WB04-P014.

[0122]

[0123] Example 4. Preparation of Corynebacterium glutamicum mutant strains expressing wild-type McoCAR or a variant thereof

[0124] 4-1. Construction of Vectors for McoCAR, McoCAR(M387F), or McoCAR(G412T) Expression

[0125] PCR was performed using primers 40 and 41 of Table 5 above with the pET30a-McoCAR vector, pET30a-McoCAR(M387F), and pET30a-McoCAR(G412T) vectors as templates, respectively. The PCR products obtained above were each linked to the pCES208H30 vector (Microbial Cell Factories volume 15, Article number: 174 (2016)) treated with restriction enzymes BamHI and XbaI, and the plasmids obtained therefrom were named pCES208H30-McoCAR, pCES208H30-McoCAR(M387F), and pCES208H30-McoCAR(G412T).

[0126] Here, the Wizard Genomic DNA Purification Kit (Promega) was used to extract DNA from each vector. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc.) in the presence of 1 unit of PrimeSTAR Max DNA Polymerase (Takara) by adding 1 pM of oligonucleotide and 10 ng of template DNA to a reaction mixture containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP). Each plasmid was constructed using NEBuilder HiFi DNA Assembly Master Mix (NEB) and restriction enzymes HindIII (NEB) and XbaI (NEB).

[0127]

[0128] 4-2. Production of McoCAR, McoCAR(M387F), or McoCAR(G412T) Expressing Mutants

[0129] The Corynebacterium glutamicum-based 1,4-butanediol-producing strain WB04-P001 of Example 2 was used as the parent strain to introduce each of the three plasmids produced in Example 4-1. The transformation of the WB04-P001 strain was performed in the same manner as in Example 3-1.

[0130] Finally, the strain into which pCES208H30-McoCAR was introduced was named WB04-P009, the strain into which pCES208H30-McoCAR(M387F) was introduced was named WB04-P016, and the strain into which pCES208H30-McoCAR(G412T) was introduced was named WB04-P017.

[0131]

[0132] Experimental Example 1. Evaluation of 1,4-Butanediol Production Capacity

[0133] The 1,4-BDO production capacity of the McaCAR and McoCAR-related variants produced in Examples 3 and 4 was evaluated.

[0134] Each strain was inoculated into flask medium (containing 10% glucose, 0.25% MgSO4, 2.5% yeast extract, 0.25% KH2PO4, 2.5% (NH4)2SO4, 100 ppm FeSO4, 2.5% peptone, 100 µg / L biotin, 25 ppm nicotinamide, and 25 ppm CPN) and cultured at 30°C for 48 hours. After the culture was completed, the culture medium was filtered through a 0.45 μm filter, and the 1,4-butanediol content in the culture medium was analyzed using high-performance liquid chromatography (HPLC) (Agilent, 1260 infinity II) equipped with a column (Avantor HPLC Column Apollo C18). 0.1 M phosphate buffer was used as the mobile phase, and analysis was performed using an RI detector for 15 minutes at a temperature of 40°C and a flow rate of 0.8 mL / min. The results are shown in Table 6 below.

[0135] Strain 1,4-Butanediol (g / L) McaCAR; WB04-P008 1.73 McaCAR(M377F); WB04-P013 2.94 McaCAR(G402T); WB04-P014 3.81 McoCAR ; WB04-P009 1.62 McoCAR(M387F); WB04-P016 2.43 McoCAR(G412T); WB04-P017 3.24

[0136] As shown in Table 6 above, compared to the mutant strain (WB04-P008) expressing a carboxylic acid reductase derived from Mycobacterium canariasensae, the mutant strains (WB04-P013 and WB04-P014) expressing carboxylic acid reductase variants with the 377th and 402nd amino acids substituted in the amino acid sequences, respectively, were found to have increased 1,4-butanediol production by approximately 1.7 times and approximately 2.2 times, respectively.

[0137] In addition, compared to the mutant strain (WB04-P009) expressing a carboxylic acid reductase derived from Mycobacterium conceptionense, the mutant strains (WB04-P016 and WB04-P017) expressing carboxylic acid reductase variants with the 387th and 412th amino acids substituted in the amino acid sequences, respectively, were found to have increased 1,4-butanediol production by approximately 1.5 times and approximately 2 times, respectively.

[0138] These results suggest that the introduction of point mutations of carboxylic acid reductase derived from Mycobacterium canariasensae or Mycobacterium conceptionense has an effective effect on improving 1,4-butanediol production capacity.

[0139]

[0140] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.

Claims

1. One carboxylic acid reductase variant selected from (1) to (4) below: (1) A variant composed of the amino acid sequence of SEQ ID NO. 4, in which the 377th methionine in the amino acid sequence of SEQ ID NO. 2 is substituted with phenylalanine; (2) A variant composed of the amino acid sequence of SEQ ID NO. 6, in which the 402nd glycine in the amino acid sequence of SEQ ID NO. 2 is substituted with threonine; (3) A variant composed of the amino acid sequence of SEQ ID NO. 10, in which the 387th methionine in the amino acid sequence of SEQ ID NO. 4 is substituted with phenylalanine; and (4) A variant composed of the amino acid sequence of SEQ ID NO. 12, in which the 412th glycine in the amino acid sequence of SEQ ID NO. 4 is substituted with threonine.

2. A polynucleotide encoding a variant of Claim 1.

3. A transformant comprising a variant of Claim 1 or a polynucleotide of Claim 2.

4. In Claim 3, The above transformant is a transformant that is a microorganism of the genus Corynebacterium.

5. In Claim 3, The above transformant is a transformant having the ability to produce 1,4-butanediol.

6. A step of culturing the transformant of claim 3 in a medium; and A method for producing 1,4-butanediol comprising the step of recovering 1,4-butanediol from the transformant or a medium in which the transformant is cultured.