Method, system, and kit for nucleic acid detection using morphological analysis of magnesium pyrophosphate microparticles

Abstract

The present invention relates to a method for target nucleic acid detection using a loop-mediated isothermal amplification (LAMP) technique. In order to solve the problem of high cost, complexity, or low specificity of conventional LAMP detection methods, the present invention confirms that magnesium pyrophosphate, which is a byproduct of a LAMP reaction, is produced as microparticles having unique morphological characteristics under a specific condition, and provides a new detection principle for directly identifying spherical microparticles having an average diameter in the range of 0.5-2.0 micrometers present in a reaction mixture by using a high-magnification (400x or higher) optical device. Through such morphological analysis, false positive signals resulting from non-specific amplification may be effectively excluded, and whether nucleic acid amplification occurs may be determined with high reliability.

Description

Method, system, and kit for nucleic acid detection using morphological analysis of magnesium pyrophosphate microparticles

[0001] The present invention relates to nucleic acid amplification and detection technology, and more specifically, to a method for rapidly and accurately detecting target nucleic acids by optically analyzing byproducts of a loop-mediated isothermal amplification (LAMP) reaction, a system for carrying out said method, and a kit.

[0002] Recently, the importance of molecular diagnostic technologies that provide immediate results on-site has been growing for the rapid diagnosis and prevention of infectious diseases. Among these, Loop-mediated Isothermal Amplification (LAMP) technology enables the amplification of target nucleic acids within one hour at a constant temperature of 60–65°C without complex temperature cycling equipment. 9 It can amplify by more than a factor of 100, making it a highly suitable technology for resource-constrained environments or rapid point-of-care testing (POCT).

[0003] Currently, real-time fluorescence analysis is widely used as a standard method for detecting LAMP amplification products. While this method has the advantage of high sensitivity, it has limitations that offset the inherent advantages of LAMP technology, such as low cost and on-site capability, as it requires expensive real-time PCR equipment or fluorescence measurement devices. Electrophoresis is also used, but it has disadvantages such as a cumbersome and time-consuming procedure, the risk of cross-contamination due to the need to open reaction tubes, and the use of hazardous reagents.

[0004] As an alternative to overcome these drawbacks, a method has been proposed to measure the turbidity of the solution caused by the magnesium pyrophosphate (Mg2P2O7) precipitate, a byproduct of the LAMP reaction. While this method is convenient as it can determine amplification without the need for separate fluorescent materials, it frequently results in false positives because it merely measures the degree of cloudiness in the entire solution, which can lead to signals generated by non-specific amplification or primer dimer formation. In other words, there is a significant technical challenge regarding the low specificity and reliability of detection (Yasuyoshi Mori et al., Real-time turbidimetry of LAMP reaction for quantifying template DNA, Journal of Biochemical and Biophysical Methods 59(2):145-157).

[0005] Therefore, in order to maximize the field applicability of LAMP technology, there is a need to develop an innovative detection technology that (1) does not require expensive equipment or complex procedures, and (2) can secure high reliability without the problem of false positives caused by non-specific reactions.

[0006] The technical problem that the present invention aims to solve is to resolve the issues of high cost, complexity, or low specificity associated with existing loop-mediated isothermal amplification (LAMP) detection methods, and to provide a rapid, low-cost, and high-reliability nucleic acid detection means suitable for point-of-care testing.

[0007] Another objective of the present invention is to provide a specific method, system, and kit for implementing the detection means.

[0008] However, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by a person skilled in the art from the description below.

[0009] To solve the above problem, the present invention provides a method for determining the presence or absence of a target nucleic acid sequence included in a sample, comprising: (a) the sample, magnesium ions (Mg 2+ A method for detecting a target nucleic acid sequence is provided, comprising: a step of generating a reaction mixture by performing a loop-mediated isothermal amplification (LAMP) reaction in a reaction solution containing ); and (b) a step of observing the reaction mixture at a magnification of at least 400 times using an optical magnification device to identify the presence or absence of spherical magnesium pyrophosphate (Mg2P2O7) microparticles having an average diameter in the range of 0.5 micrometers to 2.0 micrometers, wherein the presence of the microparticles indicates the presence of the target nucleic acid sequence.

[0010] According to one side, the “sphere” may have an aspect ratio of 1.3 or less, which is the ratio of the major axis to the minor axis measured from a two-dimensional image.

[0011] According to one aspect, the optical magnification device may be an optical microscope or a microscanner.

[0012] According to one aspect, the reaction mixture may be contained within a well of a multi-well microplate or a channel of a microfluidic chip.

[0013] According to one aspect, the target nucleic acid sequence may be of pathogen origin, and preferably may be of SARS-CoV-2 origin.

[0014] According to another embodiment of the present invention, a target nucleic acid sequence detection system is provided, comprising: (a) a temperature control module configured to maintain a loop-mediated isothermal amplification (LAMP) reaction mixture at a substantially constant temperature; (b) an optical detection module configured to capture an image of the reaction mixture and including a magnification lens and an image sensor providing at least 400x magnification; and (c) a processor programmed to be communicably connected to the optical detection module and to execute a command to analyze the captured image to identify the presence or absence of solid-phase microparticles satisfying predefined morphological criteria, namely (i) a spherical shape and (ii) an average diameter in the range of 0.5 micrometers to 2.0 micrometers, thereby determining the presence or absence of the target nucleic acid sequence.

[0015] According to one side, the “sphere” may have an aspect ratio of 1.3 or less, which is the ratio of the major axis to the minor axis measured from a two-dimensional image.

[0016] According to one side, the processor may be programmed to output a positive signal when the presence of the microparticle is identified and a negative signal when it is not identified.

[0017] According to another embodiment of the present invention, a kit for detecting a target nucleic acid sequence is provided, comprising: (a) a set of primers specific to said target nucleic acid sequence for use in a loop-mediated isothermal amplification (LAMP) reaction; (b) a reagent for performing said LAMP reaction comprising DNA polymerase and magnesium ions; and (c) a user manual instructing the user to perform a LAMP reaction using said (a) and (b), and to observe the resulting reaction mixture at a magnification of at least 400x using an optical magnification device to confirm that the presence of substantially spherical magnesium pyrophosphate (Mg2P2O7) microparticles with an average diameter in the range of 0.5 micrometers to 2.0 micrometers indicates a positive result.

[0018] According to one side, the “sphere” may have an aspect ratio of 1.3 or less, which is the ratio of the major axis to the minor axis measured from a two-dimensional image.

[0019] According to one aspect, a positive control sample containing the target nucleic acid sequence and a negative control sample without the target nucleic acid sequence may be additionally included.

[0020] According to one side, the primer may be specific to the RdRP gene of the SARS-CoV-2 virus.

[0021] According to the present invention, the presence of nucleic acid amplification can be clearly determined using only a general optical microscope or microscanner without expensive fluorescence equipment or complex electrophoresis procedures, thereby drastically reducing the cost and time required for diagnosis.

[0022] In addition, the present invention goes beyond simply measuring the presence or absence of precipitates or turbidity; by directly identifying magnesium pyrophosphate microparticles having a specific shape (spherical) and size (0.5-2.0 μm) that are specifically generated in the LAMP reaction, it can fundamentally solve the problem of false positives caused by non-specific reactions, which was a limitation of conventional turbidity methods, and achieve high specificity of up to 100%.

[0023] The effects of the present invention are not limited to those mentioned above, and other unmentioned effects will be clearly understood by a person skilled in the art from the description below.

[0024] Figure 1 is an optical microscope image showing the reaction products of the method according to the present invention and a comparative example (qPCR) at different magnifications. It shows that in the LAMP reaction product, spherical microparticles begin to be observed starting from 200x magnification and are clearly identifiable at 400x and 1000x magnifications, whereas in the qPCR reaction product, such particles are not observed even at 1000x magnification.

[0025] Figure 2 is a diagram showing a comparison of the results of the method according to the present invention and detection methods according to the prior art. While both LAMP and qPCR appear positive with the conventional fluorescence detection method and electrophoresis method, the superior specificity of the present invention is demonstrated by showing that specific spherical microparticles are detected only in the LAMP reaction product using the microscanner (400x) image analysis method according to the present invention.

[0026] Figure 3 is an image of the reaction products of the method according to the present invention and the comparative example (qPCR) observed at 5,000x magnification using a field emission scanning electron microscope (FE-SEM). It can be confirmed that distinct spherical microparticles are observed only in the LAMP-positive results.

[0027] Figure 4 is an image of the LAMP reaction product according to the present invention observed at 30,000x magnification using FE-SEM. This clearly shows that the average diameter of the generated spherical microparticles is in the range of approximately 0.5 to 2.0 micrometers.

[0028] Figure 5 shows the results of Fourier Transform Infrared Spectroscopy (FTIR) analysis to identify the chemical identity of the microparticles generated according to the present invention. By showing that the spectrum of the LAMP reaction byproduct (black) matches the spectrum of the standard magnesium pyrophosphate material (red), it is proven that the observed microparticles are magnesium pyrophosphate.

[0029] As a result of repeated research to solve the problems of the prior art, the inventors discovered for the first time that magnesium pyrophosphate, a byproduct of the LAMP reaction, precipitates into microparticles with unique morphological characteristics under specific conditions, unlike other amplification reactions (e.g., PCR). They developed a new detection principle to determine whether nucleic acid amplification has occurred by directly analyzing the morphological characteristics of these microparticles, thereby completing the present invention.

[0030] To solve the above problem, the present invention provides a method for determining the presence or absence of a target nucleic acid sequence included in a sample, comprising: (a) the sample, magnesium ions (Mg 2+ A method for detecting a target nucleic acid sequence is provided, comprising: a step of generating a reaction mixture by performing a loop-mediated isothermal amplification (LAMP) reaction in a reaction solution containing ); and (b) a step of observing the reaction mixture at a magnification of at least 400 times using an optical magnification device to identify the presence or absence of spherical magnesium pyrophosphate (Mg2P2O7) microparticles having an average diameter in the range of 0.5 micrometers to 2.0 micrometers, wherein the presence of the microparticles indicates the presence of the target nucleic acid sequence.

[0031] In this specification, “loop-mediated isothermal amplification (LAMP)” refers to a technique for amplifying a target nucleic acid at a constant temperature using four to six specific primers and a DNA polymerase having strand substitution activity. This is a technique widely known in the art, and the present invention can be carried out under standard LAMP reaction conditions.

[0032] In this specification, “magnesium pyrophosphate (Mg2P2O7) microparticles” refers to pyrophosphate ions (P2O7) generated as a byproduct when nucleotides bind to a DNA strand during a LAMP reaction. 4- ) magnesium ions (Mg ) in the reaction solution 2+ It refers to a solid precipitate formed by combining with ). The key feature of the present invention is based on the discovery that this precipitate exists in the form of individual particles having a specific size and shape, rather than as an irregular aggregate.

[0033] In this specification, the term “optical magnification device” includes any device capable of visually magnifying and observing microstructures in micrometer units, and may be, for example, a general optical microscope, a digital microscope, or a microscanner that automatically scans and analyzes images of a microplate or chip, but is not limited thereto.

[0034] In the present invention, “a magnification of at least 400 times” is a preferred condition for clearly identifying fine particles of 0.5 to 2.0 micrometers in size as individual particles and analyzing their morphology. According to experiments by the inventors, at magnifications of less than 400 times, it is difficult to distinguish individual particles and difficult to accurately determine morphological characteristics, which may reduce the reliability of detection. Therefore, it is preferable to observe at a magnification of 400 times or more, preferably at a magnification of 400 to 1000 times.

[0035] In the present invention, “average diameter of 0.5 micrometers to 2.0 micrometers” is an important criterion for determining the detection specificity of the present invention. Experimental results by the inventors confirmed that magnesium pyrophosphate particles generated in a positive LAMP reaction specifically have a size within the above range. Since particles outside this size range are likely to be non-specific aggregates or other impurities, the specificity of detection can be maximized by identifying them based on this range. Furthermore, even if some particles aggregate and are observed in the form of clusters, the boundaries of individual particles and the average particle size can be sufficiently distinguished through high-magnification (400x or more) microscopic analysis; thus, such clusters can also be identified through quantitative and morphological analysis.

[0036] In this specification, the term “spherical” is a concept that includes not only a perfect geometric sphere but also a shape that is close to a circle when observed as a two-dimensional image through an optical device. More specifically, it may refer to a case where the “aspect ratio,” defined as the ratio of the longest diameter (major axis) and the shortest diameter (minor axis) perpendicular thereto in a two-dimensional image of the particle, is 1.3 or less. Most preferably, it may be 1.25 or less. This morphological criterion serves as a key indicator for clearly distinguishing between irregularly shaped non-specific precipitates and the microparticles that are the specific signal of the present invention.

[0037] According to another embodiment of the present invention, a system for performing the method is provided. The system may include a temperature control module for a LAMP reaction, an optical detection module for observing the microparticles, and a processor that automatically determines the presence or absence of the microparticles from a captured image. The processor may output a positive or negative result by counting the number of particles satisfying predefined morphological criteria (size, aspect ratio, etc.) or determining their presence or absence through an image analysis algorithm.

[0038] According to another embodiment of the present invention, a kit for carrying out the method is provided. The kit may include a set of primers required for a LAMP reaction, a reagent comprising DNA polymerase and magnesium ions, and an instruction manual that guides the user to determine whether a result is positive by observing spherical magnesium pyrophosphate microparticles having a specific size and shape at high magnification, which is the core principle of the present invention. The kit may be used for the point-of-care diagnosis of infectious diseases, etc.

[0039]

[0040] Hereinafter, embodiments are described in detail with reference to the attached drawings. However, various modifications may be made to the embodiments, and thus the scope of the patent application is not limited or restricted by these embodiments. It should be understood that all modifications, equivalents, and substitutions to the embodiments are included within the scope of the rights.

[0041]

[0042] The terms used in the embodiments are for illustrative purposes only and should not be interpreted as intended to be limiting. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this specification, terms such as "comprising" or "having" are intended to indicate the existence of the features, numbers, steps, actions, components, parts, or combinations thereof described in the specification, and should be understood as not precluding the existence or addition of one or more other features, numbers, steps, actions, components, parts, or combinations thereof.

[0043]

[0044] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as generally understood by those skilled in the art to which the embodiments pertain. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and should not be interpreted in an ideal or overly formal sense unless explicitly defined in this application.

[0045]

[0046] In addition, when describing with reference to the attached drawings, identical components are assigned the same reference numeral regardless of drawing symbols, and redundant descriptions thereof are omitted. In describing the embodiments, if it is determined that a detailed description of related prior art could unnecessarily obscure the essence of the embodiments, such detailed description is omitted.

[0047]

[0048] Example 1: Performing LAMP analysis for SARS-CoV-2 detection according to the present invention

[0049] To verify the performance of the nucleic acid detection method according to the present invention, a LAMP analysis targeting the RdRP (RNA-dependent RNA polymerase) gene of the SARS-CoV-2 virus was performed.

[0050] A LAMP primer set for use in the method of the present invention was designed as shown in Table 1 below. The primer mix was prepared with the composition of Table 2 below, and the final LAMP reaction solution was prepared with the composition of Table 3 below, respectively, and the LAMP reaction was carried out under the reaction conditions of Table 4.

[0051] Sequence (5'-3') Target gene1 LAMPprimer setWuhan_orf1ab_F3-1CCG ATA AGT ATG TCC GCA ATRdRP2Wuhan_orf1ab_B3GCT TCA GAC ATA AAA ACA TTG T3COVID19_RDRP_FIPATG CGT AAA ACT CAT TCA CAA AGT CCA ACA CAG ACT TTA TGA GTG TC4COVID19_RDRP_BIPTGA TAC TCT CTG ACG ATG CTG TTT AAA GTT CTT TAT GCT AGC CAC5Wuhan_orf1ab_LFTGT GTC AAC ATC TCT ATT TCT ATA G6Wuhan_orf1ab_LBTCA ATA GCA CTT ATG CAT CTC AAG G7COV19_RDRP_LB_P4_HEXHEX-CGGGCCCGTACAAAGGGAACACCCACACTCCGTCA ATA GCA CTT ATG CAT CTC AAG G8개발 바이오센서용LAMPprimer setWuhan_orf1ab_F3-1CCG ATA AGT ATG TCC GCA ATRdRP9Wuhan_orf1ab_B3GCT TCA GAC ATA AAA ACA TTG T10COVID19_RDRP_FIPATG CGT AAA ACT CAT TCA CAA AGT CCA ACA CAG ACT TTA TGA GTG TC11COVID19_RDRP_BIPTGA TAC TCT CTG ACG ATG CTG TTT AAA GTT CTT TAT GCT AGC CAC12Wuhan_orf1ab_LFTGT GTC AAC ATC TCT ATT TCT ATA G13Wuhan_orf1ab_LBTCA ATA GCA CTT ATG CAT CTC AAG G

[0052] LAMPCOVID-19 LAMP primer setVol(ul)TotalLAMPprimer for fluorescence detection mixWuhan_orf1ab_F3-14100Wuhan_orf1ab_B34COVID19_RDRP_FIP32COVID19_RDRP_BIP32Wuhan_orf1ab_LF10Wuhan_orf1ab_LB4COV19_RDRP_LB_P4_HEX6DW8 Development LAMPprimer for biosensor mixWuhan_orf1ab_F3-14100Wuhan_orf1ab_B34COVID19_RDRP_FIP32COVID19_RDRP_BIP32Wuhan_orf1ab_LF10Wuhan_orf1ab_LB4DW14

[0053] LAMP Classification Volume Total LAMP for Fluorescence Detection Primer Mix RM 1 2.5 2.5 Distilled Water 5 Primer Mix 1 1X Quencher 4 1.5 Template 5 LAMP for Development Biosensor Primer Mix RM 1 2.5 2.5 Distilled Water 6.5 Primer Mix 1 Template 5

[0054]

[0055] Experiment 1. COVID-19 LAMP assay Temperature / Reaction Time: 62°C, 1 min, 29 Cycles, Total Reaction Time: 30 min

[0056] Comparative Example 1: Perform qPCR analysis

[0057] For comparison with the method of the present invention, a conventional qPCR (quantitative Polymerase Chain Reaction) analysis was performed on the same SARS-CoV-2 virus target.

[0058] For qPCR analysis, primers targeting the N gene of the SARS-CoV-2 virus were prepared as shown in Table 5 below. The primer mix was prepared with the composition shown in Table 6 below, and the final qPCR reaction mixture was prepared with the composition shown in Table 7 below. Subsequently, the qPCR reaction was performed for a total of 90 minutes according to the conditions in Table 8.

[0059] Sequence Number Sequence (5'-3') Sequence (5'-3') Target gene 14 Probe included qPCR primer setNF1 ForwardAAATTTTGGGGACCAGGAACN15NR1 ReverseTGGCACCTGTGTAGGTCAAC16N Probe 1FAM- ATGTCGCGCATTGGCATGGA -[BHQ1] 17 Probe not included qPCR primer setNF1 ForwardAAATTTTGGGGACCAGGAACN18NR1 ReverseTGGCACCTGTGTAGGTCAAC

[0060] qPCRCOVID-19 qPCR primer setVol(ul)Total Includes probe qPCRprimer mixNF1Forward10100NR1Reverse10N Probe15DW75 Includes probe qPCRprimer mixNF1Forward10100NR1Reverse10DW80

[0061] Category Volume RM5 Distilled water 14.5 Primer mix 0.5 Template 5 TOTAL 25

[0062] Experiment 1. COVID-19 LAMP assay Temperature Reaction Time 50 ℃ 10 min 98 ℃ 3 min 98 ℃ 20 sec 44 Cycles 55 ℃ 40 sec Total reaction time 90 min

[0063] Experimental Example 1: Analysis of Morphological and Chemical Characteristics of Amplification By-products

[0064] The presence and characteristics of amplification by-products in the reaction mixture obtained in Example 1 and Comparative Example 1 were analyzed using various optical instruments.

[0065]

[0066] 1. Optical Microscope and Microscanner Observation

[0067] The reaction mixtures of Example 1 (LAMP) and Comparative Example 1 (qPCR) were each observed using an optical microscope at magnifications of 100x, 200x, 400x, and 1000x. The results are shown in Figure 1. As can be seen in Figure 1, in the case of Comparative Example 1 (qPCR), no specific particles were observed at any magnification, whereas in the case of Example 1 (LAMP), distinct spherical microparticles began to be observed starting from 200x magnification and were clearly identifiable at 400x and 1000x magnifications.

[0068] In addition, as shown in Figure 2, when observed at a magnification of 400x using a microscanner (Biogentech), specific microparticles were observed only in Example 1 (LAMP). This demonstrates that even in situations where both reactions are identified as positive by conventional fluorescence detection methods or electrophoresis methods, the method of the present invention can specifically distinguish only the LAMP reaction.

[0069]

[0070] 2. Field Emission Scanning Electron Microscope (FE-SEM) Analysis

[0071] To confirm the detailed shape and size of the microparticles, the reaction mixture was observed using FE-SEM. Figure 3 is an image observed at 5,000x magnification; while no particles were observed in Comparative Example 1 (qPCR), clear spherical particles were observed in Example 1 (LAMP). Figure 4 is an image of the positive sample from Example 1 magnified at 30,000x magnification, confirming that the size of the generated microparticles was in the range of approximately 0.5 to 2.0 micrometers.

[0072] To quantitatively evaluate the morphological characteristics of the particles, the major and minor axes of individual particles were measured using FE-SEM images (500x and 1,000x magnification), and the aspect ratio (AR = major axis / minor axis) was calculated. After excluding aggregates and irregular particles and selecting and analyzing only single particles, the average AR for the 500x images (n=37) was 1.25 ± 0.15, and the average AR for the 1,000x images (n=75) was 1.26 ± 0.16. Most particles showed an AR in the range of 1.0 to 1.3, indicating a nearly spherical shape, while asymmetric or deformed particles were very limited.

[0073]

[0074] To further evaluate the morphological integrity of the particles, circularity (Circularity = 4πA / P²) and solidity (Solidity = A / A h The ) indicators were calculated together. The average roundness of the single particle was found to be 0.85 or higher and the solidity was 0.95 or higher, confirming that the particle shape was homogeneous with smooth surface boundaries and no defects (Table 9).

[0075] Separation Analysis Number of Particles (n) Aspect Ratio (AR) Circularity Solidity Average Diameter (μm) 500x Image 3 7 1.25 ± 0.1 5 0.86 ± 0.0 7 0.96 ± 0.0 3 0.58 ± 0.2 6 1,000x Image 7 5 1.26 ± 0.1 6 0.87 ± 0.0 6 0.95 ± 0.0 4 0.76 ± 0.2 4 Overall Average (Single Particle Basis) 1 1 2 1.25 ± 0.1 6 0.87 ± 0.0 6 0.95 ± 0.0 4 0.70 ± 0.25

[0076] · Aspect Ratio (AR) = Major axis / Minor axis, Circularity = 4πA / P², Solidity = A / Ah (A: particle area, P: perimeter, A h : Convex Hull Area)

[0077] · The average value is expressed as the arithmetic mean ± standard deviation (mean ± SD) of the individual particle analysis results (n = 112).

[0078] 3. Fourier Transform Infrared Spectroscopy (FTIR) Analysis

[0079] FTIR analysis was performed to determine the chemical identity of the generated microparticles. Figure 5 compares the analysis results of the standard magnesium pyrophosphate (Mg2P2O7) material (red spectrum) and the microparticles generated in Example 1 (black spectrum). The perfect match between the two spectra clearly demonstrated that the spherical microparticles generated in the LAMP reaction are magnesium pyrophosphate.

[0080]

[0081] Experimental Example 2: Limit of Detection (LOD) Evaluation

[0082] To evaluate the analytical sensitivity of the method according to the present invention, the limit of detection (LOD) was determined by sequentially diluting the SARS-CoV-2 virus (10^4 TCID50 / ml) from 10^4 to 10^{-2}. For comparison, the conventional real-time fluorescence detection method (CT value measurement) and the microscanner image analysis method according to the present invention were performed simultaneously, and the results are shown in Table 10 below.

[0083] SARS-CoV-2 (TCID50 / ml) COVID LAMP assay Micro scanner CTRF10 4 10.783024Positive10 3 12.113285Positive10 2 13.923273 Positive 10 1 14.153000Positive10 0 18.433078Positive10 -1 N / A-0.407 Voice 10 -2N / A1.24 Voice DWN / A1.65 Voice

[0084] As can be seen in Table 10 above, the microscanner analysis method according to the present invention was able to stably detect positive results up to a concentration of 10^0 TCID50 / ml, which means that it has an excellent detection limit equivalent to that of existing real-time fluorescence detection methods.

[0085]

[0086] Experimental Example 3: Clinical Performance Evaluation (Sensitivity and Specificity)

[0087] To evaluate the diagnostic performance of the present invention on actual clinical specimens, an analysis was performed on 65 SARS-CoV-2 positive patient specimens and 73 negative patient specimens. Using the existing real-time fluorescence detection method as the standard method, the sensitivity and specificity of the microscanner-based analysis method according to the present invention were evaluated, and the results are summarized in Table 11 below.

[0088] COVID-19LAMP assayImage of Micro scannerPositiveNegativePositiveNegativeDetected640640Not Detected173173Total65736573Sensitivity (%)98.6-98.6-Specificity (%)-100-100

[0089] As shown in the results of Table 11 above, the microscanner analysis method according to the present invention showed a 100% agreement with the standard method, real-time fluorescence detection. Specifically, the sensitivity was confirmed to be 98.6% (64 / 65) and the specificity 100% (73 / 73). This result demonstrates that the method of the present invention provides very accurate and reliable diagnostic performance even in actual clinical settings.

[0090]

[0091] Although the embodiments have been described above with reference to the limited drawings, those skilled in the art can apply various technical modifications and variations based on the above. For example, suitable results may be achieved even if the described techniques are performed in a different order than described, and / or if the components of the described system, structure, device, circuit, etc. are combined or assembled in a form different from described, or replaced or substituted by other components or equivalents.

[0092] Therefore, other implementations, other embodiments, and equivalents to the claims also fall within the scope of the claims set forth below.

Claims

1. A method for determining the presence or absence of a target nucleic acid sequence contained in a sample, wherein (a) the sample contains magnesium ions (Mg 2+ A method for detecting a target nucleic acid sequence, comprising: a step of generating a reaction mixture by performing a loop-mediated isothermal amplification (LAMP) reaction in a reaction solution containing ); and (b) a step of observing the reaction mixture at a magnification of at least 400 times using an optical magnification device to identify the presence or absence of spherical magnesium pyrophosphate (Mg2P2O7) microparticles having an average diameter in the range of 0.5 micrometers to 2.0 micrometers, wherein the presence of the microparticles indicates the presence of the target nucleic acid sequence.

2. In Paragraph 1, A method characterized in that the above "sphere" has an aspect ratio of 1.3 or less, which is the ratio of the major axis to the minor axis measured from a two-dimensional image.

3. In Paragraph 1, A method characterized in that the above optical magnification device is an optical microscope or a microscanner.

4. In Paragraph 1, A method characterized by the above reaction mixture being received within a well of a multi-well microplate or a channel of a microfluidic chip.

5. In Paragraph 1, A method characterized by the above target nucleic acid sequence being of pathogen origin.

6. A system for detecting a target nucleic acid sequence, comprising: (a) a temperature control module configured to maintain a loop-mediated isothermal amplification (LAMP) reaction mixture at a substantially constant temperature; (b) an optical detection module configured to capture an image of the reaction mixture and including a magnification lens and an image sensor providing at least 400x magnification; and (c) a processor programmed to be communicably connected to the optical detection module and to execute a command to analyze the captured image to identify the presence or absence of solid-phase microparticles satisfying predefined morphological criteria, namely (i) a spherical shape and (ii) an average diameter in the range of 0.5 micrometers to 2.0 micrometers, thereby determining the presence or absence of the target nucleic acid sequence.

7. In Paragraph 6, The above "spherical" is a system characterized by an aspect ratio, which is the ratio of the major axis to the minor axis measured from a two-dimensional image, of 1.3 or less.

8. In Paragraph 6, A system characterized by the processor being programmed to output a positive signal when the presence of the microparticle is identified and a negative signal when it is not identified.

9. A kit for detecting a target nucleic acid sequence, characterized by comprising: (a) a set of primers specific to said target nucleic acid sequence for use in a loop-mediated isothermal amplification (LAMP) reaction; (b) a reagent for performing said LAMP reaction comprising DNA polymerase and magnesium ions; and (c) an instruction manual instructing the user to perform the LAMP reaction using said (a) and (b), and to observe the resulting reaction mixture at a magnification of at least 400x using an optical magnification device to confirm that the presence of substantially spherical magnesium pyrophosphate (Mg2P2O7) microparticles with an average diameter in the range of 0.5 micrometers to 2.0 micrometers indicates a positive result.

10. In Paragraph 9, The above "spherical" is a kit characterized by having an aspect ratio of 1.3 or less, which is the ratio of the major axis to the minor axis measured from a two-dimensional image.

11. In Paragraph 9, A kit characterized by further including a positive control sample containing the above-mentioned target nucleic acid sequence and a negative control sample without the above-mentioned target nucleic acid sequence.

12. In Paragraph 9, A kit characterized by the above primer being specific to the RdRP gene of the SARS-CoV-2 virus.

Images