Pharmaceutical composition for preventing or treating autism spectrum disorder, comprising lithium salt
Lithium salt is used to normalize protein phosphorylation and restore synaptic functions in individuals with DYRK1A mutations, effectively addressing ASD-related phenotypes such as microcephaly and behavioral deficits.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-11-21
- Publication Date
- 2026-05-28
AI Technical Summary
Current studies have not fully described the complete recovery of neurodevelopmental and ASD-related phenotypes associated with DYRK1A mutations, including reduced viability, developmental delay, microcephaly, and behavioral deficits, in human-mimicking animal models, and there is a need to investigate the relationship between DYRK1A and the pathophysiology of autism spectrum disorder (ASD).
The use of lithium salt as an active ingredient in a pharmaceutical composition to upregulate synapse-related genes, downregulate oligodendrocyte-related genes, normalize post-translational modification patterns of synaptic proteins, and restore signaling pathways in individuals with DYRK1A mutations, thereby addressing the underlying causes of ASD.
Lithium administration normalizes protein phosphorylation patterns, restores dendrite formation and excitatory synapse density, improves microcephaly, and reduces ASD-related behavioral phenotypes, providing a potential treatment and prevention strategy for ASD.
Smart Images

Figure KR2025019450_28052026_PF_FP_ABST
Abstract
Description
Pharmaceutical composition for the prevention or treatment of autism spectrum disorder containing lithium salt
[0001] This relates to a pharmaceutical composition for the prevention or treatment of autism spectrum disorder comprising a lithium salt.
[0002] DYRK1A (dual-specificity tyrosine-phosphorylation-regulated kinase 1 A) is a serine / threonine kinase involved in Down syndrome, a human disorder caused by chromosomal trisomy. Previous studies of DYRK1A using animal models of Down syndrome have primarily focused on phenotypes associated with the overexpression of DYRK1A, such as developmental delay, learning and memory impairments, and neuronal and synaptic defects.
[0003] Meanwhile, recent human genetic studies have shown that reduced DYRK1A expression is associated with various neurodevelopmental brain dysfunctions, including developmental delay, microcephaly, autism spectrum disorder (ASD), intellectual disability, and seizures. Reports that DYRK1A mutations are found in 0.1–0.5% of patients with autism spectrum disorder and / or intellectual disability, and in approximately 0.5% of patients with developmental disorders, support the clinical significance of DYRK1A downregulation. Therefore, it is necessary to investigate the relationship between Dyrk1A and the pathophysiology of ASD in human-mimicking animal models.
[0004] Previous studies on Dyrk1a-haploinsufficient mice have reported neurodevelopmental and ASD-related phenotypes, including reduced viability, developmental delay, microcephaly, behavioral deficits, and neuronal and synaptic changes. These results strongly suggest face validity for Dyrk1a-haploinsufficient and imply potential mechanisms for Dyrk1a-related mouse phenotypes. However, no studies published to date have fully described the complete recovery of these phenotypes, the associated causal mechanisms, or an in-depth characterization of mice carrying the DYRK1A mutation found in humans.
[0005] Against this background, the inventors manufactured Dyrk1aKnock In mice with the human DYRK1A mutation and analyzed their characteristics. By confirming that initial lithium treatment triggers a mechanism in which various signal transduction and synaptic proteins exert long-lasting therapeutic effects in this model, the inventors completed the present invention.
[0006] One aspect provides a pharmaceutical composition for the prevention or treatment of autism spectrum disorder comprising a lithium salt as an active ingredient.
[0007] Another aspect is to provide a health functional food for the prevention or improvement of autism spectrum disorder containing lithium salt as an active ingredient.
[0008] Another aspect is to provide a method for the prevention or treatment of autism spectrum disorder containing lithium salts as an active ingredient.
[0009] Another aspect is providing the use of lithium salts for the manufacture of drugs for the prevention or treatment of autism spectrum disorder.
[0010] One aspect provides a pharmaceutical composition for the prevention or treatment of autism spectrum disorder comprising a lithium salt as an active ingredient.
[0011] The term "autism spectrum disorder (ASD)" refers to a disorder characterized by impairments in social interaction, difficulties in verbal and nonverbal communication, and stereotyped behaviors. The term "spectrum" was included in the name because the severity and form of symptoms vary widely; major symptoms include a lack of eye contact, difficulties with interaction, delayed language development or unique speech patterns, and hypersensitivity or insensitivity to sensory stimuli. The causes of autism spectrum disorder cannot be explained by a single factor; it is understood that genetic factors play a significant role, interacting with environmental factors.
[0012] In one embodiment, the autism spectrum disorder may be caused by a mutation in the DYRK1A (dual-specificity tyrosine-phosphorylation-regulated kinase 1 A) gene. The DYRK1A gene is a gene that encodes a serine / threonine kinase protein, which plays an important role in brain development and the regulation of neuronal function. It is located on chromosome 21, the causative chromosome of Down syndrome, and is known to be involved in the differentiation, growth, and regulation of synaptic function of neurons. Decreased expression of the DYRK1A gene is associated with various neurodevelopmental disorders such as developmental delay, intellectual disability, microcephaly, autism spectrum disorder, and seizures. In particular, mutations in the DYRK1A gene are found in about 0.1 to 0.5% of human ASD patients.
[0013] The term "gene" may be used interchangeably with "polynucleotide" and refers to a nucleic acid (e.g., DNA or RNA, etc.) that codes for genetic information as a macromolecular substance formed by the combination of nucleotides. The polynucleotide may include all nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine, and uracil).
[0014] The term "protein" may be used interchangeably with "polypeptide" and "peptide" and refers to a polymer of amino acids of any length. The protein may include a modified amino acid polymer, for example, a polymer in a form conjugated with disulfide-forming, glycosylated, lipidized, or labeled components.
[0015] The mutation of the DYRK1A gene may cause one or more defects in the DYRK1A protein selected from the group consisting of decreased expression of the DYRK1A protein, decreased activity of the DYRK1A protein, and decreased stability of the DYRK1A protein. Specifically, the mutation of the DYRK1A gene may be one or more mutations selected from the group consisting of missense mutations, nonsense mutations, frameshift mutations, promoter / regulatory region mutations, splicing mutations, and mRNA stability changes.
[0016] In one embodiment, the autism spectrum disorder may be caused by DYRK1A syndrome. DYRK1A syndrome refers to a congenital neurodevelopmental disorder caused by a mutation or loss of function of the DYRK1A gene. Although the range and severity of symptoms of DYRK1A syndrome vary from person to person, language disorders, motor developmental delay, intellectual disability, microcephaly, behavioral problems, and growth delay are observed, and in particular, behavioral characteristics similar or identical to those of autism spectrum disorder may appear.
[0017] In one embodiment, the autism spectrum disorder may be characterized by the appearance of one or more symptoms selected from the group consisting of microcephaly, intellectual disability, anxiety, social deficits, language disorders, stereotyped behaviors, and febrile seizures. Specifically, the symptoms may be caused by mutations in the DYRK1A gene and may also be caused by mutations in other genes. In the present invention, it was confirmed that upon lithium administration, brain size recovered to a normal level and ASD-related abnormal behaviors improved, thereby enabling the prevention or treatment of autism spectrum disorder exhibiting the symptoms.
[0018] In one embodiment, the pharmaceutical composition may be administered from birth through infancy, from birth through childhood, from birth through adolescence, and from birth through adulthood. Specifically, the pharmaceutical composition may be administered from birth through childhood.
[0019] In the administration of pharmaceutical compositions, the effects may vary depending on the timing of administration because an individual’s drug metabolic capacity, rate of weight gain, and organ development status differ according to their life cycle. For example, individuals whose growth is not yet complete have immature livers and kidneys, resulting in a slow metabolic rate, while adolescents may experience changes in drug response due to hormonal changes associated with growth. For instance, regarding drug administration, the life cycle stages of an individual can be classified into infancy, childhood, adolescence, and adulthood. Infancy is the stage from immediately after birth until basic physiological functions stabilize, and it is the period when sensitivity to drugs is highest. Childhood is a stage where basic physiological functions stabilize, growth is rapid, and exploration of the external environment becomes active; while drug metabolic capacity improves, it has not yet reached the level of an adult. Adolescence is a period of rapid growth and sexual maturation; drug responsiveness and metabolic rates may fluctuate due to hormonal changes, and the drug absorption rate or duration of effect may vary as activity levels increase and energy consumption rises. The adult stage is a period when physical growth is complete and physiological functions are stable, exhibiting relatively predictable drug responses due to the balance between drug metabolism and excretion capabilities. For example, in humans, the period from 0 to 5 years can be considered infancy, 6 to 12 years childhood, 13 to 18 years adolescence, and 19 years and older adulthood; in mice, the period from P0 to P21 is infancy, from P22 to P35 childhood, from P36 to P56 adolescence, and from P57 onwards adulthood. However, since growth rates vary even within the same age group depending on the individual's health status, genetic differences, and environmental factors, the life cycle of an individual should be understood by considering developmental stages and physiological maturity together, rather than mechanically determining it based solely on age.
[0020] The term "administration" above means introducing a specific substance into an individual by an appropriate method, and "individual" refers to all living organisms, including rats, mice, pigs, horses, cattle, and livestock, including humans capable of harboring cancer. Specific examples may include mammals, including humans.
[0021] In one embodiment, the pharmaceutical composition may be administered orally or parenterally, and when administered parenterally, a method of administration may be selected, such as external application to the skin or intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intra-arterial injection, intramedullary injection, intracardiac injection, intrathecal injection, transdermal injection, intranasal injection, intra-intestinal injection, local injection, sublingual injection, rectal injection, or intrathoracic injection. Specifically, the pharmaceutical composition may be administered orally.
[0022] In one embodiment, the lithium salt may induce one or more selected from the group consisting of upregulation of synapse-related gene expression, upregulation of splicing-related genes, and downregulation of oligodendrocyte-related genes. In the present invention, it was confirmed that upon lithium administration, synapse-related genes and splicing-related genes are upregulated, and oligodendrocyte-related genes are downregulated.
[0023] The above synapse-related genes may be one or more selected from the group consisting of KCTD3 (potassium channel tetramerization domain containing 3), ALOXE3 (arachidonate lipoxygenase 3), ZC3H4 (zinc finger CCCH-type containing 4), TFAP2B (transcription factor AP-2 beta) and MET (MET proto-oncogene, receptor tyrosine kinase).
[0024] The above splicing-related genes may be one or more selected from the group consisting of REC8 (REC8 meiotic recombination protein), UCP2 (uncoupling protein 2), SCML2 (Scm polycomb group protein like 2), PIK3R3 (phosphoinositide-3-kinase regulatory subunit 3), RAPGEF5 (Rap guanine nucleotide exchange factor 5), DYRK1A (dual specificity tyrosine phosphorylation regulated kinase 1A), MXD4 (MAX dimerization protein 4), LRRK2 (leucine rich repeat kinase 2), ZNF426 (zinc finger protein 426), AUP1 (AUP1 lipid droplet regulating VLDL assembly factor), RNASEH2A (ribonuclease H2 subunit A), and WDPCP (WD repeat containing planar cell polarity effector).
[0025] The above oligodendrocyte-associated genes may be one or more selected from the group consisting of INPP5F (inositol polyphosphate-5-phosphatase F), UNC45B (unc-45 myosin chaperone B), BCAS3 (BCAS3 microtubule associated cell migration factor), EPS8L1 (EPS8 like 1), HEG1 (heart development protein with EGF like domains 1), INTS4 (integrator complex subunit 4), SIPA1 (signal-induced proliferation-associated 1), NPY (neuropeptide Y), LUZP2 (leucine zipper protein 2), THEM6 (thioesterase superfamily member 6), and VSIR (V-set immunoregulatory receptor).
[0026] In one embodiment, the lithium salt may normalize the post-translational modification pattern of synaptic proteins. The post-translational modification (PTM) refers to the chemical modification process that occurs after a protein is synthesized in a ribosome. Proteins are synthesized with amino acid sequences derived from genetic information, but they often cannot perform a complete function on their own and must undergo PTM to become activated or move to a specific location. PTM includes phosphorylation, acetylation, methylation, ubiquitination, glycosylation, and proteolysis / cleavage, and is carried out by attaching to specific amino acid residues of the protein or cleaving parts of the protein. In the present invention, it was confirmed that a difference in protein phosphorylation (PTM) patterns occurs between individuals with autism spectrum disorder and individuals without autism spectrum disorder, and it was confirmed that the difference in protein phosphorylation patterns narrows when lithium is administered early to individuals with autism spectrum disorder (561 out of a total of 766 recovered). Therefore, the normalization of the post-translational modification pattern of the above protein may mean that the level of post-translational modification of the protein is restored to the level of post-translational modification of the protein of an individual not possessing the autism spectrum. Specifically, the lithium salt may normalize one or more selected from the group consisting of the post-translational modification pattern of synaptic proteins in infancy, the post-translational modification pattern of synaptic proteins in childhood, the post-translational modification pattern of synaptic proteins in adolescence, and the post-translational modification pattern of synaptic proteins in adulthood; more specifically, the lithium salt may normalize all of the post-translational modification patterns of synaptic proteins, the post-translational modification pattern of synaptic proteins in childhood, the post-translational modification pattern of synaptic proteins in adolescence, and the post-translational modification pattern of synaptic proteins in adulthood.
[0027] 상기 시냅스 단백질은 Smg7, Cic, Cpeb2, Naxd, Calcoco1, Sp9, Tjp1, Map1a, Kmt2c, Phc3, Taf10, FAM120A, Cdk13, Ubr4, Senp7, Syngap1, Rpap3, Homer1, Dlgap3, Cck, Tshz1, B3gat3, Tmem151b, Tmem151b, Th, Rundc3a, Rundc3a, Pkn1, Bcar1, Bap1, Znf827, Gda, Slc5a6, Arnt2, Dennd2a, Pank1, Tjp1, Sorbs1, Camsap3, Mcf2l, Smg9, Prpsap2, Neurod6, Tbc1d9, Tbc1d9, Mbd2, Tsc22d3, Tsc22d3, Znf580, Kdm5a, Cstf2, L1cam, Nfatc2, Taok2, Rims2, Sgip1, Afdn, Hltf, Zmat1, Cpne8, Brpf1, Megf8, Meis2, Rtn4, Ralgapa1, Tp53bp1, Nrde2, Nrde2, Zmat1, Ttc3, Cpne6, Ppfia3, Ablim2, Add1, Gm11992, Mcrs1, Dennd4b, Ncor2, Stxbp5, Stxbp5, Stxbp5, Map1b, Csnk1g3, Tmem266, Pou3f3, Adgrl1, Rtn4, Arhgap21, Kif13a, Unk, Dmtn, Gprin1, FAM120A, Creb1, Src, Srrm1, Aff4, Kcnh7, Myo16, Tcf4, Nab1, Crk, Ralgapa1, Ralgapa1, Ralgapa1, Agap2, Camk2a, Cpne6, Rps6ka4, Kcnb1, Prkar1a, Tnip1, Syne1, Prmt3, Eif3k, Urb1, Wtap, Arid4b, Nipal3, Marcks, Nes, Nrde2, Nvl, Coro7, Actr2, Kiaa1109, Nfix, Znf318, Znf318, Srrm2, Eif4enif1, Cacna1a, Adam22, Pacs1,Map2k1, Xrn2, Mettl6, Adcy8, Gcc1, Med1, Ranbp1, Zdhhc18, Adra2a, Taf9, Ei24, Unk, Ccny, Retreg3, Mapk8, Hnrnpul2, Adgrl1, Adgrl1, Cadps, Map1b, Rprd1b, Prkab1, Irs2, Farp1, Fmr1, Phax, Shisa7, Cpsf1, Map3k12, Synpo, Aatk, Dzip3, Epha5, Arnt2, Msh6, Bsn, Ank2, Ank2, Foxn3, Samd4a, Samd4a, Rgs12, Rgs12, Ddi2, Arfgef1, Atrx, Atrx, Rcor1, Sympk, Agap2, Tbr1, Afdn, Hnrnpul2, Cdc42ep1, Tut7, Ppp4r2, Rab14, Map9, Arel1, Camsap2, Foxo3, Robo4, Rps6kc1, Plekha6, Washc2, Satb2, Camk4, Skt, Shank2, Rims1, Rims1, Npy1r, Ap3d1, Uqcrc2, Azi2, Abi1, Agap3, Hivep2, Prkaa1, Miga2, Ino80, Sorbs2, Gja1, Psd2, Gprin1, Tsc1, Npy1r, Ptprk, Deptor, Sbno1, Sbno1, Pitpnc1, Scn2a, Ksr1, Mia3, Tbc1d17, Ppp6r3, Kmt2c, Arfgef1, Dmxl1, Mark1, Il16, Kiaa1549, Golga4, Sh3rf1, Map1a, Tanc2, Tanc2, Trim2, Cep68, Ildr2, Gcfc2, Gcfc2, Epb41l2, Slc6a17, Rtn1, Rtn1, Mef2c, Zzz3, Syde1, Syde1, Srrm1, Unk, Emc4, Kndc1, Obi1, Klf3, Rprd2, Kcnq3, Itsn1, Ildr2, Dido1, Dido1, Dido1, Avl9, Lrrc8d, Mcrip1, Rictor, Ptprn2, Gpr37,It may be one or more selected from the group consisting of Macroh2a2, Map2, Arhgap32, Bcl7c, Srrm2, Bsn, Mef2c, Mcm2, Psd, Fat3, Arid2, Tbr1, Itih2, Kcnb1, Adgrb3, Tln2, Lrrc8a, Atrx, Prkra, Ywhae, Sf3b1, Uhrf1bp1l, Uhrf1bp1l, Ripor1, Clasp1, Farp2, Prr15, Kiaa1109, and Arhgap23. The above synaptic proteins are listed as proteins whose post-translational modifications downregulated by the DYRK1A mutation in P21 were restored by lithium administration.
[0028] 또한, 상기 시냅스 단백질은 Elavl2, Map2, Map2, Mast2, Soga3, Rufy3, Necab1, Pds5a, Hectd1, Atp1a3, Aff4, Ank1, Soga3, Cd2bp2, Kalrn, Kif21a, Ppip5k1, Arfgef1, Sptbn1, Als2, Ttc3, Spindoc, Cadps, Cnnm1, Dagla, Htr2a, Zc3h3, Atp1a3, Spry3, Prune1, Fam110b, Tubb2a, Bcas1, Sqor, Scrib, Nfasc, Nfasc, Phactr4, Phactr4, Tp53bp1, Dab1, Dab1, Chrna4, Rnf11, Rnf11, Tmf1, Acbd3, Arhgap23, Arhgap25, Arhgap25, Ccny, Chl1, Paics, Mia2, Tubb4a, Arpp21, Kcna4, Kcna4, Rell1, Agap2, Mcl1, Hspa12b, Rab39b, Tgs1, Mdc1, Nedd4, Pclo, Nefm, Kcna4, Kank4, Mical3, Ncor1, Tln2, Atg9a, Scn1b, Ace2, Hps5, Akap12, Prkar2a, Nmt1, Dido1, Fam171b, Sox8, Sox8, Pclo, Hint1, Dyrk1a, Sparcl1, Tsc2, Cacnb1, Anapc1, Ppip5k1, Nipbl, Nipbl, Sptbn1, Lnpk, Prr7, Zfhx2, Camkv, Nefh, Heg1, Med23, Arpp21, Ncbp1, Acbd3, Tpr, Tpr, Kcnh2, Peg10, Tjp1, Sacs, Sacs, Sacs, Tln1, Tln1, Dlgap2, Islr2, Nefh, Rtn3, Cfl1, Ddhd1, Chrna4, Brsk1, Unc80, Arfgap1, Syn3, Pabir1, Pde10a, Slc6a9, Syt7, Srrm2, Sorbs1, Slc16a1, Iqsec2, Panx2, Mindy1, Abcf1,Tbc1d22a, Hmgcs1, Atp6v0a1, Arhgap23, Sox10, Dbn1, Dlgap4, Nefh, Slc6a3, Cycs, Atxn2, Eps15l1, Map1b, Cask, Xrcc1, Fxyd1, Fxyd1, Abcc4, Stambp, Rtn1, Ank2, Rtn4, Bcas1, Snx8, Emb, Usp24, Nefm, Mark1, Rcsd1, Brwd1, Hcn1, Chrna4, Wdcp, Sort1, Camta2, Rgs19, Map4, Ctnna2, Rab14, Ccny, Itsn1, Adam22, Ywhag, Zfhx2, Slc5a3, Kcna3, Slain2, Fam177a1, Gphn, Kiaa1109, Plp1, Zc3hc1, Glcci1, Psd3, Arhgap23, Esd, Tppp, Nexn, Nexn, Sptbn1, Szt2, Hivep2, Tiam2, Map4k4, Ap2a1, Atg14, Nefm, Mbp, Rims3, Rsbn1, Dpysl2, Kcnh1, Rasgrf1, Rab6a, Anks1b, Dnajc5, Ppfia2, Cycs, Map3k5, Syt2, Fam171b, Usp8, Epb41l3, Slc25a5, Mtcl1, Arhgap32, Afdn, Synrg, Acsbg1, Emb, Tjp1, Atp2b2, Map7d1, Dlg2, Fut8, Shank3, Rasgrf1, Tnk2, Nefm, Ywhaz, Hgs, Zmiz2, Fam114a1, Snx25, Rassf5, Ube2d3, Mical3, Rap1gap, Sorbs1, Slc1a2, Zscan21, Ap3d1, Fam117b, Slc9a1, Gria1, Dip2b, Bin1, Adcy9, Arfgef3, Mark4, Xrcc1, Rtn4, Ahi1, Tp53bp1, Tln1, Ndfip2, Slc7a1, Sacs, Pacsin2, Pacsin2, Nefm, Dlg5, Tbc1d15, Nefh, Tjp1, Map4, Slc4a4,Fam117b, Usp24, Gab1, Gab1, Slc6a1, Syn2, Scaf1, Mfsd4a, Ncam1, Virma, Kank4, Fam131b, Tnks1bp1, Cacna1e, Ank2, Ywhaq, Otud7a, Rnf40, Nefh, Gpi, Znf532, Oxr1, Pak1, Myo18a, Palm2, Pag1, Mtx1, Syt11, Vdac1, Gnl1, Serinc1, Rbm14, Syt6, Reps1, Hcn2, Epb41l3, Gorasp1, Fscn1, Tiam2, Nav3, Dlg1, Tmf1, Aatk, Add1, Syt2, Gja1, Hrh3, Glcci1, Hspa4, Map7d1, Ncor1, It may be one or more selected from the group consisting of Trim47, S100a13, Gphn, Slc12a6, Elmo1, Cnksr3, Nefl, and Vdac1. The above synaptic proteins are listed as proteins in which post-translational modifications upregulated by the DYRK1A mutation in P21 were restored by lithium administration.
[0029] In addition, the synaptic proteins may be one or more selected from the group consisting of Rin1, Bsn, Camkv, Sucla2, Marcks, Palm, Amer2, Ap1s1, Thrap3, Akap5, Palm2, Atxn2l, Ppp3ca, Camkv, Tppp, Hspa4, Palm, Sik3, Nrcam, Supt5h, Brsk2, Mapre2, Sv2b, Pde4a, Palm, Trim32, Src, Matr3, Dock10, H1-4, Cap2, Dlgap4, Lyst, Mbp, Lrfn1, Map1a, Agap2, Rmdn3, Gprin1, Raly, and H1-4. The synaptic proteins listed are those in which post-translational modifications of proteins downregulated by DYRK1A mutations in P60 are restored by lithium administration.
[0030] In addition, the synaptic proteins may be one or more selected from the group consisting of Camsap2, Dbn1, Ctnnd2, Mia3, Tjp1, Cacng7, Kcnc1, Map2, Acsbg1, Map1b, Nefm, Shb, Fam117b, Tjp2, Map4, Prrc2c, Pak3, Ndrg2, Prr12, Dlgap4, Map1b, Tln2, Znf827, Zc3hc1, Aftph, Hlcs, Erbin, Tab3, Tsc1, Kcnc2, Cdc42ep4, Adgrb3, Tp53bp1, Pclo, Htt, Hmgn1, and Entpd3. The synaptic proteins listed are those in which post-translational modifications of proteins upregulated by DYRK1A mutations in P60 are restored by lithium administration.
[0031] In one embodiment, the lithium salt may normalize one or more signaling pathways selected from the group consisting of insulin, cAMP, oxytocin, AMPK, gap junction, ErbB, and autophagy. As described above, differences in protein phosphorylation levels in signaling pathways were frequently identified in the differences in protein post-translational modification patterns between individuals with and without autism spectrum disorder. Furthermore, it was confirmed that these differences were reduced and restored by early administration of lithium to individuals with autism spectrum disorder. Therefore, the normalization of the signaling pathway may mean that the level of post-translational modification appearing in proteins within the signaling pathway is restored to the level of individuals without autism spectrum disorder.
[0032] In one embodiment, the lithium salt may exhibit one or more effects selected from the group consisting of normalization of inhibited dendrite formation, recovery of reduced excitatory synapse density, improvement of microcephaly, and improvement of abnormal behavior. When the lithium salt was administered to an individual with autism spectrum disorder, dendrite formation, excitatory synapse density, and brain size were restored to the levels of an individual without autism spectrum disorder, and it was confirmed that ASD-related behavioral phenotypes were reduced or disappeared.
[0033] In one embodiment, the lithium salt is lithium carbonate (Li2CO3), lithium citrate (Li3C6H5O7), lithium sulfate (Li2SO4), lithium acetate (C2H3LiO2), lithium bromide (LiBr), lithium chloride (LiCl), lithium orotate (C5H3LiN2O4), and lithium gluconate (C6H 11 It may be one or more selected from the group consisting of LiO7). Specifically, the lithium salt may be lithium carbonate or lithium citrate. More specifically, the lithium salt may be lithium carbonate.
[0034] The term "salt" refers to a salt prepared using lithium and a relatively non-toxic acid or base.
[0035] The term "prevention" may refer to any act of suppressing or delaying cancer in an individual through the administration of a pharmaceutical composition according to one aspect.
[0036] The term "treatment" may refer to any act in which the symptoms of cancer in an individual are improved or beneficially altered by the administration of a pharmaceutical composition according to one aspect.
[0037] Additionally, the above pharmaceutical composition may be provided as a pharmaceutical composition comprising one or more pharmaceutically acceptable carriers, excipients, or diluents.
[0038] Specifically, the carrier may be, for example, a colloidal suspension, powder, saline solution, lipid, liposome, microsphere, or nano-spherical particle. These may form a complex with or be associated with a transport means and may be transported in vivo using a transport system known in the art, such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation agents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption-enhancing substances, or fatty acids.
[0039] When the above pharmaceutical composition is formulated, it may be prepared using diluents or excipients such as commonly used lubricants, sweeteners, flavorings, emulsifiers, suspending agents, preservatives, fillers, volume expanders, binders, wetting agents, disintegrants, and surfactants. Solid dosage forms for oral administration may include tablets, pills, powders, granules, capsules, etc., and these solid dosage forms may be prepared by mixing at least one excipient with the above composition, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition, lubricants such as magnesium stearate and talc may also be used in addition to simple excipients. Liquid formulations for oral administration include suspensions, oral liquids, emulsions, syrups, etc., and may contain various excipients, such as humectants, sweeteners, flavorings, and preservatives, in addition to commonly used simple diluents like water and liquid paraffin. Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspensions. Witepsol, macrogol, Tween 61, cacao oil, laurin oil, glycerogelatin, etc. may be used as bases for suppositories, and known diluents or excipients may be used when manufactured in the form of ophthalmic preparations.
[0040] In one embodiment, the composition may be administered in a pharmaceutically effective amount. The pharmaceutically effective amount and effective dosage of the composition may vary depending on the formulation method of the pharmaceutical composition, the mode of administration, the time of administration and / or the route of administration, etc. Furthermore, it may vary depending on various factors and similar factors well known in the pharmaceutical field, including the type and degree of response to be achieved by administering the composition, the type of individual to be administered, age, body weight, general health condition, symptoms or severity of disease, gender, diet, excretion, and the components of other compositions used simultaneously or at other times with the individual. A person skilled in the art can easily determine and prescribe a dosage effective for the intended treatment. The composition may be administered once a day or divided into several doses. Therefore, the dosage does not limit the scope of the present invention in any way. The dosage of the composition may be 1 μg / kg / day to 1,000 mg / kg / day.
[0041] In one embodiment, the composition may be administered once a day or divided into several doses. For example, it may be administered in a cycle of 6 days of administration followed by 1 day of rest, 5 days of administration followed by 2 days of rest, or 4 days of administration followed by 3 days of rest, based on a 7-day period, and more specifically, it may be administered in a cycle of 5 days of administration followed by 2 days of rest.
[0042]
[0043] In one embodiment, to determine whether the DYRK1A gene mutation (I48K) reported in patients with autism spectrum disorder causes symptoms such as microcephaly, intellectual disability, anxiety, social deficits, language disorders, stereotyped behaviors, and febrile seizures, Dyrk1a-knocked mice (Dyrk1a-KI mice) carrying the said mutation were prepared and their characteristics analyzed. As a result, it was confirmed that the DYRK1A protein level in the Dyrk1a-KI mice decreased by approximately 50%, developmental delay was observed through weight loss, and neurodevelopmental delay was observed through a decrease in brain weight, area, and brain-to-body weight ratio (see Example 1).
[0044] In the above example, to precisely analyze the reduction in brain weight and area observed in Dyrk1a-KI mice in terms of brain volume, the brains of 8-week-old Dyrk1a-KI mice were further analyzed using magnetic resonance imaging (MRI). As a result, generalized microcephaly was confirmed in the Dyrk1a-KI mice, and it was confirmed that a volume reduction of 5-25% was observed in the basal ganglia, diencephalon, and midbrain regions, and a significant volume reduction was observed in specific brain subregions including the hippocampal dentate gyrus and cingulate cortex (see Example 1-1).
[0045] In the above examples, a series of behavioral tests were conducted on male Dyrk1a-KI mice to determine whether the developmental delay and microcephaly observed in Dyrk1a-KI mice were associated with behavioral abnormalities. As a result, it was confirmed that despite normal motor activity and coordination abilities, the mice exhibited various behavioral abnormalities similar to symptoms in human patients, such as a significant decrease in ultrasonic vocalization (USV) during courtship (social communication deficit) and mild cognitive decline during adulthood, and an increase in anxiety-like behaviors during childhood (see Examples 1-2).
[0046] In the above examples, to identify changes in excitability (excitation / inhibition imbalance) in the brains of Dyrk1a-KI mice and their causes, a pentylenetetrazolium (PTZ)-induced seizure test was performed, and postsynaptic currents (mEPSC, mIPSC) of hippocampal CA1 neurons were measured and synaptic density analysis was performed using an electron microscope. As a result, it was confirmed that the brain excitation level of the Dyrk1a-KI mice was significantly reduced, and while there was no effect on inhibitory synaptic function or density, the ratio of excitatory-inhibitory synaptic transmission decreased as the density (number) of excitatory synapses in the hippocampus decreased (see Examples 1-3).
[0047] In one embodiment, to verify whether the autism spectrum disorder-related phenotypes (such as inhibition of dendrite formation and decrease in excitatory synapse density) in Dyrk1a-KI mice could be restored by early administration of lithium, chronic treatment was administered to newborn (P0) Dyrk1a-KI mice during the first 3 to 4 weeks of life, a period of brain development. As a result, it was confirmed that the early lithium treatment normalized dendrite formation, excitatory synapse density, and brain size (microcephaly) in Dyrk1a-KI mice, and restored behavioral phenotypes such as social communication (USV) and seizure sensitivity that appear during childhood and adulthood in the long term (see Example 2).
[0048] In one embodiment, to elucidate the fundamental molecular mechanism by which early lithium administration restores the autism spectrum disorder-related phenotype (microcephaly, synaptic defects) observed in Dyrk1a-KI mice, whole-brain samples from Dyrk1a-KI mice at P21 (21 days after birth), a time of active brain development, were used. First, transcriptome (RNA-Seq) and total proteome analyses were performed, and furthermore, focusing on post-translational modifications (PTMs) that regulate the functional activity of proteins, particularly phosphorylation, an in-depth comparative analysis of phosphorylated peptide (PTM-DEPP) profiles was conducted among normal mice (WT), vehicle (placebo)-treated Dyrk1a-KI mice, and lithium-treated Dyrk1a-KI mice. As a result, Dyrk1a-KI mutations induced only 13 minor changes at the total protein level, whereas 766 changes (PTM-DEPP) were identified at the protein phosphorylation (PTM) level. These changes in protein phosphorylation were mostly concentrated in proteins (SynGO) associated with postsynaptic density (PSD) and protein binding, and were abundant in multiple key signaling pathways such as insulin, cAMP, oxytocin, AMPK, and ErbB. Furthermore, early lithium treatment was confirmed to restore a total of 561 phosphorylation patterns among these abnormal PTM errors to normal mouse (WT) levels. These restored PTM-DEPPs exactly matched the key signaling pathways (8 out of 10) and the postsynaptic density protein family where errors occurred, and in particular, normalized the phosphorylation status of Elavl2 and Kalrn proteins, which are essential for dendrite formation and synapse assembly (see Example 3).
[0049] In one embodiment, to evaluate the long-term effects of early lithium treatment (P0-P28) and how its mechanism differs from that of P21 (childhood), brain PTM-DEPP (phosphorylated peptide) of Dyrk1a-KI mice was analyzed at the P60 (adult) stage, long after the treatment was terminated, and baseline differences and PTMs restored by lithium were identified. As a result, 306 P60 PTM-DEPPs showed a different pattern (SynGO enrichment ~46%), unlike P21 PTM-DEPPs, being concentrated about twice as strongly on synaptic proteins themselves, such as 'glutamate synapses' and 'GABAergic synapses,' rather than on signaling pathways. Additionally, early lithium treatment restored 78 P60 PTM-DEPPs to normal levels, which were concentrated on synapse-related functions, and it was confirmed that the PTM-DEPPs restored in P21 and P60 did not overlap. This suggests that early lithium treatment first restores the 'signal transduction' PTM in P21, and as a result, the 'synapse protein' PTM in P60 is normalized over the long term through a sequential mechanism (see Example 4).
[0050] In one embodiment, we aimed to elucidate the functional characteristics and underlying mechanism of PTM-DEPP (phosphorylated peptide) restored by lithium. To this end, we analyzed changes in the activity of GSK3β, a classic target of lithium (Ser9 phosphorylation), using Western blot and traced the upstream kinase of PTM-DEPP. Additionally, to verify the effect of phosphorylation of Kalirin-S488 and Elavl2-S221 restored by lithium on actual neuronal morphology in P21 mice, we constructed phosphorylation-mimicking (S→D) and non-phosphorylation (S→A) mutants, introduced them into cultured hippocampal neurons, and measured dendrite formation using Sholl assay. As a result, no changes in GSK3β activity were observed in Dyrk1a-KI mice, suggesting that lithium treatment follows a GSK3β-independent pathway, and confirmed the possibility that PTM-DEPP is a direct substrate of DYRK1A. In addition, it was confirmed that Kalirin-S488D and Elavl2-S221D (phosphorylation-mimicking) mutants significantly enhanced dendrite formation in both WT and Dyrk1a-HT neurons compared to non-phosphorylation mutants (see Example 5).
[0051]
[0052] Another aspect provides a health functional food for the prevention or improvement of autism spectrum disorder containing a lithium salt as an active ingredient.
[0053] The above terms "lithium salt," "autism spectrum disorder," etc., are within the scope described above.
[0054] The term "improvement" may refer to any action that at least reduces parameters related to the condition being treated, such as the severity of symptoms. In this case, the health functional food may be used for the prevention or improvement of cancer, either simultaneously with or separately from a therapeutic drug, either before or after the onset of the disease.
[0055] The above "health functional(s) food" includes health functional foods, health foods, and health supplements.
[0056] The term "functional food" is synonymous with "food for special health use (FosHU)," and refers to a food with high medical or health effects that is processed to efficiently exhibit bio-regulatory functions in addition to providing nutrition. Here, "functional" means obtaining useful effects for health purposes, such as regulating nutrients or physiological actions regarding the structure and function of the human body.
[0057] In addition, "health food" refers to food that has active effects on maintaining or promoting health compared to general food, and "health supplement food" refers to food intended for the purpose of health support.
[0058] In the above-mentioned health functional food, the lithium salt may be added directly to the food or mixed with other foods or food ingredients, and may be used appropriately according to conventional methods. The amount of lithium salt mixed may be appropriately determined according to its intended use (for the prevention or improvement of cancer). Generally, when manufacturing food or beverages, the lithium salt may be added in an amount of about 15% by weight or less, specifically about 10% by weight or less, with respect to the raw materials. However, in the case of long-term consumption for the purpose of health and hygiene or health control, the above amount may be less than the above range.
[0059] The above-mentioned health functional food may be formulated into one selected from the group consisting of tablets, pills, powders, granules, powders, capsules, and liquid formulations, by further including one or more of a carrier, a diluent, an excipient, and an additive. Foods to which a compound according to one aspect may be added include various food products, powders, granules, tablets, capsules, syrups, beverages, gum, tea, vitamin complexes, health functional foods, etc.
[0060] Specific examples of the above carrier, excipient, diluent, and additive may be one or more selected from the group consisting of lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water, sugar syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil.
[0061] In addition to containing the lithium salt mentioned above, the above-mentioned health functional food may contain other ingredients as essential components without special limitations. For example, it may contain various flavoring agents or natural carbohydrates as additional ingredients, such as in ordinary beverages. Examples of the above-mentioned natural carbohydrates may be monosaccharides, e.g., glucose, fructose, etc.; disaccharides, e.g., maltose, sucrose, etc.; polysaccharides, e.g., dextrin, cyclodextrin, etc., common sugars; and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As flavoring agents other than those mentioned above, natural flavoring agents (thaumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) may be advantageously used. The proportion of the above-mentioned natural carbohydrates may be appropriately determined by the choice of a person skilled in the art.
[0062] In addition to the above, a health functional food according to one aspect may contain various nutritional supplements, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. These ingredients may be used independently or in combination, and the proportion of these additives may also be appropriately selected by a person skilled in the art.
[0063] In one embodiment, the autism spectrum disorder may be caused by a mutation in the DYRK1A gene.
[0064] In one embodiment, the autism spectrum disorder may be caused by DYRK1A syndrome (DYKR1A syndrome).
[0065] In one embodiment, the autism spectrum disorder may be characterized by the appearance of one or more symptoms selected from the group consisting of microcephaly, intellectual disability, anxiety, social deficits, language disorders, stereotyped behaviors, and febrile seizures.
[0066] In one embodiment, the health functional food composition may be consumed from birth through childhood.
[0067] In one embodiment, the lithium salt is lithium carbonate (Li2CO3), lithium citrate (Li3C6H5O7), lithium sulfate (Li2SO4), lithium acetate (C2H3LiO2), lithium bromide (LiBr), lithium chloride (LiCl), lithium orotate (C5H3LiN2O4), and lithium gluconate (C6H 11It may be one or more selected from the group consisting of LiO7). Specifically, the lithium salt may be lithium carbonate or lithium orotate. More specifically, the lithium salt may be lithium carbonate.
[0068]
[0069] Another aspect provides a method for the prevention or treatment of autism spectrum disorder comprising a lithium salt as an active ingredient.
[0070]
[0071] Another aspect provides the use of lithium salts for the manufacture of drugs for the prevention or treatment of autism spectrum disorder.
[0072] According to one aspect of lithium salt, it triggers a mechanism in which various signal transduction and synaptic proteins exert long-lasting therapeutic effects during the initial treatment of autism spectrum disorder, and has the effect of improving excitatory synaptic density, microcephaly, or brain development / function, so it can be usefully used in the treatment of autism spectrum disorder, especially autism spectrum disorder with DYRK1A mutation.
[0073] Figure 1 is a schematic diagram of the Dyrk1a-I48K-knock-in (KI) strategy utilized in mice.
[0074] Figure 2 shows the results of Western blot analysis of DYRK1A protein levels in whole-brain total lysates of heterozygous Dyrk1a-KI mice (N-terminal antibody P21, C-terminal antibody P56).
[0075] Figure 3 is a figure showing the results of in situ hybridization for Dyrk1a mRNA expression identified in mouse brains of various developmental stages.
[0076] Figure 4 is a figure showing the Western blot results for DYRK1A and PSD-95 (control) proteins in whole brain lysates obtained from mice of various developmental stages.
[0077] Figure 5 is a figure showing the Western blot results for DYRK1A protein in several brain regions of WT mice (P14).
[0078] Figure 6 shows the results of body weight measurements from WT and Dyrk1a-KI male and female mice at various stages after birth.
[0079] Figure 7 shows the results of measuring brain weight, brain area, and brain-to-body weight ratio in WT and Dyrk1a-KI male mice at 3 and 8 weeks after birth.
[0080] Figures 8 and 9 show the results of immunostaining for DAPI (cell body), NeuN (neuron), S100β (astrocytocyte) or NF-M (axon).
[0081] Figure 10 is an MRI heatmap showing volume changes in various brain regions of Dyrk1a-KI mice (8 weeks old, male) compared to WT mice.
[0082] Figure 11 is a figure showing the results of a detailed analysis of brain regions with reduced volume in Dyrk1a-KI mice compared to WT mice.
[0083] Figure 12 is a figure showing the level of motor activity of Dyrk1a-KI mice in an open field test.
[0084] Figure 13 is a figure showing the level of motor activity of Dyrk1a-KI mice in the Laboras test.
[0085] Figure 14 is a figure showing the level of anxiety-like behavior in Dyrk1a-KI mice during a high-rise cross maze test.
[0086] Figure 15 is a figure showing the level of anxiety-like behavior in Dyrk1a-KI mice in a light-dark test.
[0087] Figure 16 is a figure showing the level of motor coordination ability of Dyrk1a-KI mice in the rotarod test.
[0088] Figure 17 is a figure showing the level of social interaction of Dyrk1a-KI mice in a three-chamber test.
[0089] Figure 18 is a figure showing the number, average duration, and total USV duration levels of WT and Dyrk1a-KI mice in a sociality / repetitiveness test.
[0090] Figure 19 is a figure showing the levels of repetitive climbing, repetitive body raising, and repetitive self-grooming in male Dyrk1a-KI mice (2-5 months old) during the light-off / light-on period for 3 consecutive days in a Laboras cage.
[0091] Figure 20 is a figure showing the situational fear memory retrieval levels after 24 hours and after 7 days in male Dyrk1a-KI mice (5 months old).
[0092] Figure 21 is a figure showing the level of cue fear conditioning and the level of situational spatial learning and memory in a Morris underwater maze of male Dyrk1a-KI mice (5 months old).
[0093] Figure 22 is a figure showing the residence time of juvenile Dyrk1a-KI mice in the mate finding test.
[0094] Figure 23 is a figure showing the level of motor activity in an open field test of juvenile Dyrk1a-KI mice.
[0095] Figure 24 is a figure showing the levels of play behavior and repetitive behavior in juvenile Dyrk1a-KI mice.
[0096] Figure 25 shows the USV levels when Dyrk1a-KI pups are separated from their mothers.
[0097] Figure 26 is a figure showing the seizure sensitivity scores of Dyrk1a-KI mice in a PTZ-induced seizure test.
[0098] Figure 27 shows the results of measuring mEPSC in CA1 hippocampal pyramidal neurons of WT and Dyrk1a-KI male mice (P19-21).
[0099] Figure 28 shows the results of measuring mIPSCs in CA1 hippocampal pyramidal neurons of WT and Dyrk1a-KI male mice (P21-22).
[0100] Figure 29 shows the results of observing excitatory synapses in the hippocampal CA1 region of Dyrk1a-KI mice using an electron microscope.
[0101] Figure 30 shows the results of observing inhibitory synapses in the hippocampal CA1 region of Dyrk1a-KI mice using an electron microscope.
[0102] Figure 31 is a graph showing the results measured at the hippocampal Schafer collateral (SC)-CA1 synapse of Dyrk1a-KI mice as the AMPA receptor-mediated synaptic transmission input-output curve, pair pulse ratio, and NMDA / AMPA ratio.
[0103] Figure 32 is a graph of high-frequency stimulation-induced long-term potentiation (HFS-LTP) at the hippocampal SC-CA1 synapse of Dyrk1a-KI mice.
[0104] Figure 33 is a graph of theta-burst stimulation-induced long-term potentiation (TBS-LTP) at the hippocampal SC-CA1 synapse of Dyrk1a-KI mice.
[0105] Figure 34 is a graph of low-frequency stimulation-induced long-term attenuation (LFS-LTD) at the hippocampal SC-CA1 synapse of Dyrk1a-KI mice.
[0106] Figure 35 is a graph of metabolic glutamate receptor (mGluR)-dependent long-term inhibition (mGluR-LTD) at the hippocampal SC-CA1 synapse of Dyrk1a-KI mice.
[0107] Figure 36 is a schematic diagram of the early chronic lithium treatment after birth.
[0108] Figure 37 is a figure showing the results of a Sholl analysis on hippocampal CA1 pyramidal neurons of lithium-treated Dyrk1a-KI male mice (P21).
[0109] Figure 38 is a figure showing the results of a Sholl analysis on prefrontal limbic system pyramidal neurons of lithium-treated Dyrk1a-KI male mice (P21).
[0110] Figure 39 is a graph showing the results of measuring mEPSDC and mIPSC in hippocampal CA1 pyramidal neurons of lithium-treated Dyrk1a-KI mice (P21).
[0111] Figure 40 shows the results of electron microscopy observation of the hippocampal CA1 region of lithium-treated Dyrk1a-KI mice.
[0112] Figure 41 is a graph showing the results of measuring PSD density, length, thickness, and perforation in the CA1 region of the hippocampus of lithium-treated Dyrk1a-KI mice.
[0113] Figure 42 is a graph showing the results of measuring the brain size of Dyrk1a-KI mice according to whether or not they were treated with lithium.
[0114] Figure 43 is a graph showing the results of the brood-finding test of Dyrk1a-KI mice (P21) according to whether or not lithium was treated.
[0115] Figure 44 is a graph showing the results of the courtship USV test of Dyrk1a-KI mice (P21) depending on whether or not they were treated with lithium.
[0116] Figure 45 is a graph showing the results of a seizure sensitivity test of Dyrk1a-KI mice (P21) depending on whether or not they were treated with lithium.
[0117] Figure 46 is a volcano plot showing differentially expressed genes (DEGs) in the forebrain transcriptome of Dyrk1a-KI mice (P21).
[0118] Figure 47 is a list of the top DEGs among the differentially expressed genes (DEGs) in the forebrain transcriptome of Dyrk1a-KI mice (P21).
[0119] Figure 48 is a GSEA result showing the enrichment of a set of autism spectrum disorder (ASD) related genes in the forebrain transcriptome of Dyrk1a-KI mice (P21).
[0120] Figure 49 is a figure showing enriched gene set clustering derived using the EnrichmentMap Cytoscape app and the gene ontology (GO) gene set for the whole-brain transcriptome GSEA results of Dyrk1a-KI / WT mice (P21).
[0121] Figure 50 is a volcano plot showing differentially expressed genes (DEGs) in the forebrain transcriptome of Dyrk1a-KI mice (P60).
[0122] Figure 51 is a list of the top DEGs among the differentially expressed genes (DEGs) in the forebrain transcriptome of Dyrk1a-KI mice (P60).
[0123] Figure 52 is a GSEA result showing the enrichment of a set of autism spectrum disorder (ASD) related genes in the forebrain transcriptome of Dyrk1a-KI mice (P21).
[0124] Figure 53 is a figure showing enriched gene set clustering derived using the EnrichmentMap Cytoscape app and the gene ontology (GO) gene set for the whole-brain transcriptome GSEA results of Dyrk1a-KI / WT mice (P60).
[0125] Figure 54 is a volcano plot showing the total differentially expressed P21 proteins (total-DEPs) obtained from early chronic (P0-P21) vehicle-treated WT mice and vehicle-treated heterozygous Dyrk1a-KI mice.
[0126] Figure 55 is a list listing examples of total differentially expressed P21 proteins (total-DEPs) obtained from early chronic (P0-P21) vehicle-treated WT mice and vehicle-treated heterozygous Dyrk1a-KI mice.
[0127] Figure 56 is a volcano plot showing the total differentially expressed P60 proteins (total-DEPs) obtained from early chronic (P0-P28) vehicle-treated WT mice and vehicle-treated heterozygous Dyrk1a-KI mice.
[0128] Figure 57 is a list listing examples of P60 total differential expression proteins (total-DEPs) obtained from early chronic (P0-P28) vehicle-treated WT mice and vehicle-treated heterozygous Dyrk1a-KI mice.
[0129] Figure 58 is a volcano plot showing P21 PTM-DEPP in vehicle-treated heterozygous Dyrk1a-KI mice compared to early chronic (P0-P21) vehicle-treated WT mice.
[0130] Figure 59 is a list of P21 PTM-DEPP examples in vehicle-treated heterozygous Dyrk1a-KI mice compared to early chronic (P0-P21) vehicle-treated WT mice.
[0131] Figure 60 shows the results of the DAVID-KEGG / Genetic Ontology (GO) analysis of P21 PTM-DEPP in vehicle-treated heterozygous Dyrk1a-KI mice compared to early chronic (P0-P21) vehicle-treated WT mice.
[0132] Figure 61 shows the results of SynGO analysis for P21 PTM-DEPP in vehicle-treated heterozygous Dyrk1a-KI mice compared to early chronic (P0-P21) vehicle-treated WT mice.
[0133] Figure 62 is a volcano plot highlighting the PTM-DEPP recovered by lithium in the volcano plot for P21 PTM-DEPP.
[0134] Figure 63 is a list listing examples of P21 PTM-DEPP recovered by lithium treatment.
[0135] Figure 64 is a graph showing the results of the DAVID-KEGG / Genetic Ontology (GO) analysis of P21 PTM-DEPP recovered by lithium.
[0136] Figure 65 is a figure showing the results of SynGO analysis for P21 PTM-DEPP recovered by lithium.
[0137] Figure 66 is a volcano plot showing PTM-DEPP at P60 in vehicle-treated heterozygous Dyrk1a-KI mice compared to early chronic (P0-P28) vehicle-treated WT mice.
[0138] Figure 67 is a list of examples of PTM-DEPP at P60 in vehicle-treated heterozygous Dyrk1a-KI mice compared to early chronic (P0-P28) vehicle-treated WT mice.
[0139] Figure 68 shows the results of the DAVID-KEGG / Genetic Ontology (GO) analysis of PTM-DEPP at P60 in vehicle-treated heterozygous Dyrk1a-KI mice compared to early chronic (P0-P28) vehicle-treated WT mice.
[0140] Figure 69 shows the results of SynGO analysis for PTM-DEPP at P60 in vehicle-treated heterozygous Dyrk1a-KI mice compared to early chronic (P0-P28) vehicle-treated WT mice.
[0141] Figure 70 is a volcano plot highlighting PTM-DEPP recovered by initial lithium treatment at time P60.
[0142] Figure 71 is a list listing examples of P60 PTM-DEPP recovered by lithium treatment.
[0143] Figure 72 is a graph showing the results of the DAVID-KEGG / Genetic Ontology (GO) analysis of P60 PTM-DEPP recovered by lithium.
[0144] Figure 73 is a figure showing the results of SynGO analysis for P60 PTM-DEPP recovered by lithium.
[0145] Figure 74 is a volcano plot showing P60 PTM-DEPP in untreated WT mice and homozygous Dyrk1a-KI mice.
[0146] Figure 75 is a list of examples of P60 PTM-DEPP in untreated WT mice and homozygous Dyrk1a-KI mice.
[0147] Figure 76 shows the results of the DAVID-KEGG / Gene Ontology (GO) analysis of PTM-DEPP in P60 of untreated homozygous Dyrk1a-KI mice compared to untreated WT mice.
[0148] Figure 77 shows the results of SynGO analysis on P60 PTM-DEPP in untreated homozygous Dyrk1a-KI mice.
[0149] Figure 78 shows the results of Western blot analysis of total GSK3β and GSK3β-Ser9 phosphorylation levels in the brains of P21 WT, Dyrk1a-HT(KI), and lithium-treated Dyrk1a-HT(KI-Li) mice.
[0150] Figure 79 shows the results of confirming the change in phosphorylation status of GSK3β-Ser9 phosphorylation to potential upstream kinases in PTM-DEPP of P21 and P60 Dyrk1a-HT mice.
[0151] Figure 80 is a list listing examples of potential upstream kinases (including DYRK1A and GSK3β) for downregulated PTM-DEPP in P21 Dyrk1a-HT mice.
[0152] Figure 81 is a list of examples of potential upstream kinases (including DYRK1A and GSK3β) for downregulated PTM-DEPP in P60 Dyrk1a-HT mice.
[0153] Figure 82 shows the results of observing dendrite formation of Kalirin-7-S448D / A (phosphorylation mimic / non-phosphorylation) and Elavl2-S221D / A (phosphorylation mimic / non-phosphorylation) mutants in cultured WT hippocampal neurons.
[0154] Figure 83 shows the results of observing dendrite formation of Kalirin-7-S448D / A (phosphorylation mimic / non-phosphorylation) and Elavl2-S221D / A (phosphorylation mimic / non-phosphorylation) mutants in cultured Dyrk1a-HT KI hippocampal neurons.
[0155] The present invention will be explained in more detail below through examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.
[0156]
[0157] Reference Example 1. Mouse Model
[0158] To prepare Dyrk1A-I48K knock-in (KI) mice, two nucleotides were removed to replace the 48th isoleucine residue in exon 3 with lysine, and a stop codon (I48K fsX2) generated by frameshift was introduced. A neomycin cassette surrounded by a flippase recognition target (FRT) element responsive to the flippase enzyme was added to the intron following exon 3. Subsequently, the mice were crossed with Protamine-Flp mice expressing flippase in the male gonads to remove the cassette and leave a residual segment detectable by polymerase chain reaction (PCR). The animals were allowed to feed freely (ad libitum) and were reared under a 12-hour light-dark cycle (light cycle 01:00 AM to 13:00 PM). The genotype of Dyrk1a-KI HT mice was determined by PCR using the following primer pairs: 5'- TCT GTA GAC AAA ACA TGA TGC TCA G-3' (forward; SEQ NO. 1) and 5'- AAT GTG TTC ACA GAG ATT TCA GC-3' (reverse; SEQ NO. 2).
[0159] Mice were discontinued from nursing at 21 days of age (P21) and littermates of the same sex with mixed genotypes were housed together until the experiment. Only male mice were used for adult behavior tests, while both male and female mice were used for pup and juvenile mouse tests. In most of the invention, heterozygous (HT) KI lines (Dyrk1a-I48KfsX2) on a C57BL / 6J background were used. KI / +Homozygous (HM) Dyrk1a-KI mice were produced by converting the genetic background of Dyrk1a-KI mice from purebred C57BL / 6J to the hybrid 129 Sv;C57BL / 6J (50:50) genetic background (hereinafter referred to as homozygous / HM Dyrk1a-KI mice). The two original mouse lines (C57BL / 6J and 129 Sv) were maintained independently for at least 5 generations before being crossbred or used to produce experimental mice.
[0160]
[0161] Reference Example 2. Ethical Approval
[0162] Experimental mice were bred and managed at the mouse facility of the Korea Advanced Institute of Science and Technology (KAIST) in accordance with KAIST's animal experiment requirements. All experimental procedures were performed in accordance with the Guidelines on Animal Research Requirements for the Protection of Animals Used for Scientific Purposes (Law on Experimental Animals No. 19918, January 2, 2024, Republic of Korea) and the KAIST Animal Welfare Guidelines, and were approved by the KAIST Animal Ethics Committee (KA2023-093-v1).
[0163]
[0164] Reference Example 3. MRI measurement of the mouse brain
[0165] Mice were anesthetized and intracardial perfusion was performed with 10 ml of 0.1 M PBS containing 10 U / ml heparin (PPC, cat#C504805) and 2 mM ProHance (gadolinium contrast agent, Bracco Diagnostics, cat#111181), followed by perfusion with 10 ml of 4% paraformaldehyde (PFA, Cedarlane cat#15710) containing 2 mM ProHance. After perfusion, the mice were decapitated. The brain and skull structures were incubated overnight in a 4% PFA + 2 mM ProHance solution at 4°C, then transferred to 0.1 M PBS containing 2 mM ProHance and 0.02% sodium azide, stored for at least 7 days, and then MRI was performed. For the anatomical MRI scan, a T2-weighted, 3D fast spin-echo sequence was used, with cylindrical k-space acquisition, a TR of 350 ms, a TE of 12 ms per echo for 6 echoes, and a field of view (FOV) of 20 × 20 × 25 mm. 3 Images of 0.040 mm isotropic voxels were obtained by setting the matrix size to 504 × 504 × 630. The total imaging time for this sequence was approximately 14 hours.
[0166]
[0167] Reference Example 4. Electrophysiology
[0168] Ex-vivo electrophysiological experiments were performed to evaluate excitatory / inhibitory synaptic transmission and extracellular field population recordings.
[0169] Mice (P17-23) were anesthetized with isofluorane (Terrell), and the brains were extracted after carefully removing the skulls. Sagittal hippocampal sections (300 μm) were prepared using a vibratome (Leica VT1200), and sections were performed in an ice-cooled sucrose-based artificial cerebrospinal fluid (sCSF) solution. The sCSF solution contained the following composition (mM) and was air-treated with 95% O2 and 5% CO2: 212 sucrose, 10 d-glucose, 25 NaHCO3, 5 KCl, 1.25 NaH2PO4, 1.25 I-ascorbic acid, 2 Na-pyruvic acid, 3.5 MgSO4, and 0.5 CaCl2. The prepared sections were immersed in artificial cerebrospinal fluid (aCSF) at 32°C for 30 minutes to recover, and the composition of the aCSF solution was as follows (mM): 125 NaCl, 10 d-glucose, 25 NaHCO3, 2.5 KCl, 1.25 NaH2PO4, 1.3 MgCl2, and 2.5 CaCl2. Afterward, the sections were recovered at room temperature for an additional 30 minutes and were continuously bubbled with 95% O2 and 5% CO2 during recovery and recording.
[0170] For whole-cell patch recording, a borosilicate glass pipette (Harvard Apparatus) was pulled out with a micropipette puller (Narishige). To record CA1 pyramidal cells, a recording pipette (3-4 MΩ) was filled with intracellular fluid of the following composition: (i) for EPSC measurement (mM): 117 CsMeSO4, 10 TEA-Cl, 8 NaCl, 10 HEPES, 5 QX-314-Cl, 4 Mg-ATP, 0.3 Na-GTP, 10 EGTA (pH 7.3, 285-300 mOsm), (ii) for IPSC measurement (mM): 115 CsCl2, 10 TEA-Cl, 8 NaCl, 10 HEPES, 5 QX-314-Cl, 4 Mg-ATP, 0.3 Na-GTP, 10 EGTA (pH 7.3, 285-300 mOsm).
[0171] Data were filtered at 2 kHz and digitized at 10 kHz using a Multiclamp 700B and 1440 Digitizer (Molecular Devices). Series resistance was monitored by measuring the peak amplitude of capacitance currents for a short hyperpolarization step pulse (5 mV, 40 ms) for each sweep. The collected data were analyzed using a Clampfit 10 (Molecular Devices).
[0172] Brain cells from P17-23 mice were used to measure miniature currents in a whole-cell configuration fixed at -70 mV. For mEPSC measurements, picrotoxin (100 μM) and tetrodotoxin (TTX; 10 μM) were added to aCSF to block action potentials and inhibitory currents, respectively. For mIPSC measurements, NBQX (100 μM), AP5 (100 μM), and tetrodotoxin (10 μM) were added to block AMPAR-mediated currents, NMDA-mediated currents, and action potentials, respectively. For spontaneous miniature recordings—sEPSC and sIPSC—the procedure was similar to that of mEPSC and mIPSC, but TTX was not added to allow for the modulation of neural network activity and synaptic transmission.
[0173] To measure the NMDA / AMPA ratio, picrotoxin (100 μM) was added to P17-21 segments to block GABAA receptor-mediated currents. CA1 pyramidal cells were recorded using a whole-cell patch and voltage clamped at -70 mV. To measure AMPAR-mediated EPSCs, the dendritic field of the stratum radiatum (SR) was stimulated every 15 seconds using a stimulation pipette filled with aCSF solution. After obtaining a stable baseline, 30 consecutive responses were recorded as AMPAR components. Subsequently, NMDAR-mediated EPSCs were measured by changing the holding potential of the same neurons to +40 mV, and the NMDA component was determined by measuring the amplitude at 60 ms after stimulation. The ratio was calculated by dividing the mean of the NMDAR EPSCs (peak amplitudes) by the mean of the AMPAR EPSCs.
[0174] For extracellular field recordings, both the stimulation pipette and the recording pipette were filled with aCSF solution, and Schaeffer collateral axonal fibers from CA3 were stimulated and recorded in the radial layer (SR) of the hippocampal CA1 region. To induce HFS-LTP, high-frequency stimulation (100 Hz, 1 second) was applied after a stable baseline of 20 minutes. For TBS-LTP, after acquiring a stable baseline, 4-6 week old slices were stimulated with 10 trains (theta bursts) consisting of 4 pulses at 100 Hz, and the response was recorded for 1 hour. For NMDA-dependent LTD, picrotoxin (100 μM) was added to aCSF, and slices P16-22 were used. After reaching a stable baseline at 20 minutes, the sections were stimulated with low-frequency stimulation (1 Hz, 900 pulses over 15 minutes), and the response was measured for 1 hour. For mGluR-dependent LTD, after a stable baseline at 20 minutes, LTD was induced by administering DHPG (50 μM) in a bath form to aCSF for 10 minutes, and the response was recorded for 1 hour in the presence of picrotoxin (100 μM). LTP and LTD analysis compared the mean of the fEPSP elevation slope during the last 10 minutes.
[0175] In the input-output analysis, the input was defined as the peak amplitude of the fiber volley, and the output as the initial slope of the fEPSP. The stimulation intensity was increased by 2.5 μA per minute in the range of 5–35 μA. Paired-pulse facilitation (PPF) was measured by inducing two fEPSPs at intervals of 25–300 ms, and was calculated as the value obtained by dividing the initial slope of the second fEPSP by the initial slope of the first fEPSP.
[0176]
[0177] Reference Example 5. Sholl Analysis
[0178] Intracellular fluid mixed with 0.3% biocitin was injected into CA1 pyramidal cells and Layer 2 prefrontal neurons of 3-week-old mice treated with vehicle or lithium. After injecting biocitin for 10 minutes, the glass capillary was slowly detached from the cell membrane until the giga-seal was observed again and the initial pipette resistance (3-4 MΩ) was restored. The injected sections were fixed overnight in 4% PFA, followed by fixation in PBS containing 3% donkey serum, 0.3% Triton X-100, Streptavidin, and Alexa Fluor. TM It was incubated for 24 hours at 4°C in a solution mixed with 488 Conjugate (ThermoFisher, S11223, 1:500).
[0179]
[0180] Reference Example 6. Sholl analysis of cultured hippocampal neurons
[0181] Primary cultures of mouse neurons were prepared from E17-day male Dyrk1A knock-in or WT embryos. Isolated hippocampal tissues were stored in plain Neurobasal-A medium (Thermo Fisher Scientific) for 1 to 3 days, during which time genotyping was performed. Subsequently, tissues were isolated by enzymatic treatment with papain (papain, Worthington Chemical, LS003127) and transfected with the following mutant constructs: Kalirin-7 (pEAK10-His-Myc-Kal7 (Addgene, #25454) S488A, Kalirin-7 S488D, Elavl2 (Origene, MG205762) S221A, Elavl2 S221D). To visualize neurons overexpressing each product, the plasmids were co-transfected with pAAV-hSyn-mCherry (Addgene, #114472).
[0182] To induce Kalirin-7 mutations, pEAK10-His-Myc-Kal7 was cleaved with NcoI and PciI, and PCR was performed using the following primers: primers for S488D mutation, cctggatgtcctgcagcgtcccctggaccctgggaactccgagtccctcacagcc (forward; SEQ NO. 3) and ggctgtgagggactcggagttcccagggtccaggggacgctgcaggacatccagg (reverse; SEQ NO. 4); primers for S488A mutation, ggctgtgagggactcggagttcccaggggccaggggacgctgcaggacatccagg (forward; SEQ NO. 5) and cctggatgtcctgcagcgtcccctggcccctgggaactccgagtccctcacagcc (reverse; SEQ NO. 6). Finally, the PCR product was linked to the original vector cleaved with NcoI and PciI.
[0183] To generate Elavl2 mutations, PCR was performed using Pfu (SPX16-R250 Solgent), and the following primers were used: primers for the S221A mutation cagctgtaccaggctccaaacagaagg (forward; SEQ No. 7) and ccttctgtttggagcctggtacagctg (reverse; SEQ No. 8); primers for the S221D mutation cagctgtaccaggatccaaacagaagg (forward; SEQ No. 9) and ccttctgtttggatcctggtacagctg (reverse; SEQ No. 10). The original plasmids were digested and processed with Dpn1 (Enzynomics), and all mutant products were confirmed by DNA sequencing. Transfection was performed using the Mouse Neuron Nuclofector Kit (Lonza, VPG-1001) according to the manufacturer's protocol.
[0184] After transfection, neurons were spread onto poly-D-lysine-coated 18 mm glass coverslips using smear medium (Neurobasal-A medium supplemented with 2% B-27, 10% FBS, 1% GlutaMax, and 1 mM sodium pyruvate) at a rate of 1 x 10⁶ per coverslip. 5Cells were plated at a cell density of 10. After 4 hours, the plate was replaced with FBS-free culture medium (Neurobasal-A medium supplemented with 2% B-27, 1% GlutaMax, and 1 mM sodium pyruvate). The medium was replenished by replacing 50% every 7 days. At appropriate times, neurons were fixed with 4% PFA and stained with anti-mCherry (ab205402, abcam) antibody for signal enhancement. Images were captured using a confocal microscope (Carl Zeiss, LSM780). Dendritic arbors were tracked using neuTube 1.0 software, and the number of intersections per 25 μm interval from the soma was analyzed using ImageJ.
[0185]
[0186] Reference Example 7. Brain size measurement
[0187] Brains were extracted from 3-week-old or 8-week-old Dyrk1a KI mice and WT control groups, and images were taken in a top-down view containing a grid. After correction using the grid within the captured images, brain size was analyzed using ImageJ.
[0188]
[0189] Reference Example 8. Brain lysate and Western blot
[0190] Mouse brains of the corresponding age were extracted on ice and homogenized in ice-cooled homogenization buffer (0.32 M sucrose, 10 mM HEPES, pH 7.4, 2 mM EDTA, pH 8.0, 2 mM EGTA, pH 8.0, protease inhibitor, phosphatase inhibitor). Total lysate was prepared by boiling with β-mercaptoethanol immediately after homogenization.
[0191] Western blots were incubated overnight at 4°C using the following primary antibodies: Dyrk1a (Abnova H00001859-M01 and Abcam ab156818), GSK3β (Cell Signaling 12456), p-GSK3β (S9, Cell Signaling 9336), PSD-95 (self-made #1689), β-actin (Sigma A5316), and α-tubulin (Sigma T5168). Fluorescent secondary antibody signals were detected using an Odyssey Fc Dual-Mode Imaging System.
[0192]
[0193] Reference Example 9. In situ hybridization
[0194] Hybridization in situ was performed according to previously reported methods. Mouse brains at embryonic day 18 (E18) and postnatal days 0, 7, 14, 21, and 56 (P0, P7, P14, P21, P56) were sectioned to a thickness of 14 μm using a cryostat (Leica CM 1950). Hybridization probes for mouse Dyrk1a mRNA were constructed using the following: a pGEM-7Zf vector containing nucleotides 147-446 (300 bp; SEQ ID NO. 11) of Dyrk1a mRNA (NM_001113389.1); 5'-GAG AGG GGA TCC ATG CAT ACA GGA GGA GAG AC-3' (forward; SEQ ID NO. 12) and 5'-GAG CTC GAA TTC CAA GTC CAC AGA GAG TTT TC-3' (reverse; SEQ ID NO. 13), Riboprobe System (Promega), and α-[35S] UTP.
[0195]
[0196] Reference Example 10. Immunohistochemical analysis
[0197] Adult WT and KI mice (2-3 months old) were cardiac-perfused with heparin solution and 4% formaldehyde (Sigma 252549), followed by 24-hour post-fixation. Coronal sections 40 μm thick were prepared using a vibrating cutter (Leica VT1200s). These sections were permeabilized in a TBST / NDS solution (1× TBS, 0.2% Triton X-100, 5% normal donkey serum) at room temperature for 2 hours. Subsequently, the permeabilized sections were incubated overnight at 4°C with a primary antibody mixed into the TBST / NDS solution. After staining with a secondary antibody, the sections were mounted in VECTASHIELD® Antifade Mounting Medium (Vector, H-1200) containing DAPI. To confirm the gross morphology of the brain, a NeuN antibody (Millipore ABN90, 1:1000) was used, glial cells were stained with an S100β antibody (Abcam ab52642), and neurofilaments were visualized with a Neurofilament M (NF-M) antibody (BioLegend 841001). Z-stack images were acquired using a confocal microscope (Zeiss LSM780).
[0198]
[0199] Reference Example 11. Transcriptome Analysis
[0200] RNA-Seq analysis was performed using i) P21 HT-Dyrk1a-KI mice, ii) P60 HT-Dyrk1a-KI mice, and WT mice (n=4-6). Excised mouse brains were preserved in RNAlater (Ambion) solution and stored at -20°C. Poly-A mRNA was purified using magnetic beads attached to Poly-T oligos. RNA concentration was quantified using Quant-IT RiboGreen (Invitrogen, R11490), and RNA integrity was evaluated using TapeStation RNA screen tape (Agilent Technologies). Only high-quality RNA (RIN > 7.0) was selected, and a cDNA library was constructed using the TruSeq Stranded mRNA 180 Sample Prep Kit (Illumina). The indexed library was applied to Illumina HiSeq 4000 (Illumina), and paired-end (2 x 100 bp) sequencing was performed in Theragen Bio. Transcript abundance was estimated using Salmon (v1.1.0) in a Quasi-mapping-based mode for the Mus musculus genome (GRCm38) with GC bias correction (-gcBias). The acquired abundance data were loaded into R (v.4.1.2) using the tximport package, and differential gene expression (DGE) analysis was performed using R / Bioconductor DEseq2 (v1.34.0). Normalized read counts were calculated by dividing raw read counts by size factors and fitted to a negative binomial distribution.P-values were adjusted for multiple testing using Benjamini-Hochberg correction. Genes with an adjusted p-value of less than 0.05 were considered differentially expressed.
[0201] Gene Set Enrichment Analysis (GSEA) was performed to determine whether predefined gene sets showed statistically significant differences in expression between Dyrk1a-KI mice and WT mice. GSEA analysis was conducted on gene set collections downloaded from the Molecular Signature Database (MSigDB, v7.5.1) using the GSEAPreranked module of GSEA Linux (v4.2.3). GSEAPreranked ranked the list of all expressed genes by fold change and applied the recommended default settings (1,000 permutations and classic scoring method) by multiplying by the reciprocal of the p-value. To control for false positive findings in a given Normalized Enrichment Score (NES), the False Discovery Rate (FDR) was calculated by comparing the tails of the observed distributions derived from 1,000 gene set permutations with the null distributions. Gene sets with an FDR of less than 0.05 were considered significant. Integration and visualization of GSEA results were performed using the EnrichmentMap Cytoscape App (version 3.8.1).
[0202]
[0203] Reference Example 12. Proteomic Analysis
[0204] Total proteome and PTM (post-translational modification) proteome analysis using LC-MS / MS was performed using i) P21 HT-Dyrk1a-KI mice, ii) P60 HT-Dyrk1a-KI mice, iii) P60-HM-Dyrk1a KI mice and WT controls.
[0205] i) For P21 HT-Dyrk1a-KI mice, peptide preparation and proteomic analysis were performed at Bertis (Korea). Forebrains of vehicle or lithium-treated male heterozygous Dyrk1a-KI and WT mice (4 biological repeats) were homogenized at 4°C using a hand-held homogenizer in a lysis buffer containing 8 M urea and a phosphatase inhibitor cocktail in 100 mM ammonium bicarbonate. The lysates were centrifuged and further sonicated, then reduced with 10 mM DTT (dithiothreitol) and alkylated with 25 mM IAA (iodoacetamide). The alkylated samples were subsequently treated with 0.4 μg / μL Promega trypsin (enzyme:protein = 1:25), desalted, and redissolved. The samples were labeled with 16-plex TMT isotopes and underwent a desalting process to remove residual TMT reagents. Phosphorylated peptides were concentrated using IMAC magnetic beads (Cell signaling) according to the manufacturer's instructions. After being divided into 12 fractions using a high pH fractionation kit (Thermo scientific), the samples were dried using SpeedVac and redissolved in 0.1% TFA prior to MS analysis.
[0206] LC-MS / MS analysis was performed using a Nano-LC Ultimate 3000 system connected to a Thermo Orbitrap Exploris 480. LC-DDA-MS / MS data were processed using the Comet search engine with the following settings: the database was the UniProt mouse reference database (April 2019); precursor and fragment mass tolerance was 20 ppm; semi-tryptic peptide search; up to 2 missed cleavages allowed; peptide lengths 7–50; carbamidomethylation of cysteine was set as a fixed modification, and oxidation of methionine as a variable modification. Then, PTMProphet and FragPipe (v18) were used to identify the modifications. The identification results were filtered based on a 1% FDR (false detection rate) at the PSM, peptide, and protein levels using Percolator and ProteinProphet4.
[0207] ii) For P60 HT-Dyrk1A-KI mice, peptide preparation and phosphorylated peptide enrichment were performed using the whole brains of lithium-treated / untreated heterozygous Dyrk1a-HT and WT mice (4 replicates). Mouse brains were lysed in 1x SDS (sodium dodecyl sulfate) buffer containing 5% SDS and 50 mM TEAB (triethylammonium bicarbonate) (pH 8.5). The lysates were digested by the S-trap method. Trypsin-digested peptides were labeled with an 18-plex TMT isotope (Thermo Fisher Scientific). After TMT labeling, all peptides were mixed and dried using Speed-Vac. Prior to LC-MS / MS analysis, samples were desalted using a Pierce peptide desalting spin column (Thermo Fisher Scientific) and separated into 20 fractions by reverse-phase liquid chromatography under basic conditions. 5% of the samples were used for total proteome analysis, and the remaining 95% were used for phosphorylated proteome analysis.
[0208] The remaining 95% of the samples were separated into 10 fractions for phosphorylated peptide concentration. First, Ni-NTA magnetic agarose beads were washed three times with distilled water (DW) and then incubated in 100 mM EDTA (pH 8.0) for 30 minutes. Next, 100 mM FeCl3 solution was added, and the mixture was incubated in a rotary manner for 30 minutes to Fe 3+ -NTA beads were prepared. After washing the prepared beads with distilled water, each sample was rotary incubated overnight at 4°C in an 80% ACN / 0.1% TFA solution. Finally, the phosphorylated peptides attached to the beads were lysed by exposing them to a lysis buffer (50% ACN in 1% ammonium hydroxide), and immediately after lysis, the solution was acidified to pH 3.5-4.0 using 10% TFA and then vacuum dried.
[0209] LC-MS / MS analysis was performed using an UltiMate 3000 RSLCnano system (Thermo Scientific) connected to an Orbitrap Fusion Lumos mass spectrometer (Thermo Fisher Scientific). Mobile phases A and B consisted of 0% and 95.0% acetonitrile containing 0.1% formic acid, respectively. For peptide separation, an LC gradient was applied for 120 minutes at a flow rate of 250 nL / min. The Orbitrap Fusion Lumos operated in data-dependent mode, and MS2 scans were performed with HCD grinding (37.5% collision energy). MS / MS spectra were identified and quantified using Integrated Proteomics Pipeline software utilizing the Uniprot mouse database: precursor mass tolerance of 20 ppm; fragment ion mass tolerance of 200 ppm; assignment of two or more peptides for protein identification at a false positive rate of less than 0.01; The TMT reporter ion mass tolerance was 20 ppm; for phosphorylated peptide identification, phosphorylation of serine, threonine, and tyrosine was set as differential modifications, and up to three additional modifications were allowed. Statistical analysis was performed using Perseus software (version 1.6.15). Protein and phosphorylated peptide expression between samples was compared using Welch's t-test with a p-value set to < 0.05.
[0210] iii) For P60 HM-Dyrk1a-KI and their WT controls, peptide preparation and proteomic analysis were performed by Cell Signaling. PTMScan MultiPathway results for WT and HM-Dyrk1a-KI mouse brains (2-3 months old) were obtained using the PTMScan Multi-Pathway Enrichment method (PTMScan® Multi-Pathway Enrichment Kit #75676, Cell Signaling Technology). For HM-Dyrk1a-KI mice, brains from one male and two female HM KI mice, as well as age- and sex-matched WT brains, were used. Specifically, mouse whole-brain samples were dissected on ice and rapidly frozen in liquid nitrogen. Subsequently, the brain samples were digested with trypsin and fractionated by solid-phase extraction. The digested phosphorylated peptides were concentrated with protein A beads (PTMScan® Multi-Pathway Enrichment Kit) conjugated with site-specific antibodies for immunoaffinity purification and analyzed by LC-MS / MS (Cell signaling).
[0211] DAVID Gene Ontology (GO) and SynGO analyses were performed on the results of the three proteomic analyses (i-iii). To annotate synaptic proteins and functions, significant items meeting the following criteria were used: p < 0.05; |fold change| > 1.2; (Analysis website: http: / david.ncifcrf.gov).
[0212]
[0213] Reference Example 13. Behavioral Test
[0214] All adult behavioral tests were performed on age-matched male WT and Dyrk1a-KI mice (2–5 months). Pup and juvenile tests were performed using both male and female mice. With the exception of home cage nesting behavioral and Laboras tests, all behavioral experiments were performed during a light-out period. A minimum rest period of one day was provided between experiments. Unless otherwise specified, all data were analyzed using an EthoVision XT 10 (Noldus).
[0215]
[0216] Reference Example 13-1. Ultrasonic Vocalization (USV) Test
[0217] The home cage of each subject mouse was placed inside the USV chamber. A microphone was positioned approximately 20 cm above the arena. Age-matched female mice (C57BL / 6J) were randomly placed into the cages of each subject male mouse. The subject male mice and the intruder female mice interacted freely for 5 minutes, during which time USV was recorded.
[0218] For the pup USV test, each pup (at 3, 5, 7, and 9 days old) was separated from its mother, and USV was recorded for 3 minutes in a USV chamber using an ultrasound microphone (Avisoft). The USV was analyzed using Avisoft SASLab Pro software, and spectrograms were generated with a Fourier transformation length of 256, 75% temporal resolution overlap, and a lower cutoff frequency of 25 kHz. The duration and frequency of calls in the spectrum were measured.
[0219]
[0220] Reference Example 13-2. Laboras Test
[0221] Long-term (96-hour) locomotor, climbing, reclining, grooming, eating, and drinking activities were recorded and automatically analyzed using the Laboratory Animal Behavior Observation Registration and Analysis System (LABORAS: Metris). Mice were housed in individual cages during the experiment and allowed to eat ad libitum.
[0222]
[0223] Reference Example 13-3. Juvenile play
[0224] Direct interactions were performed according to previously reported methods. Social interaction test sessions were conducted during the first half of the dark cycle in a quiet, dimly lit room illuminated by a single 25W red light. For the juvenile play test, P21 mice were brought from their home cages to the test room to pre-expose them to the experimental conditions. After 1 hour of isolation, a non-sibling pair of mice of the same sex and genotype but born from different litters were placed in the test space, and their interactions were recorded for 15 minutes. Nose-nose sniffing, following, mounting, and allo-grooming were manually quantified as measures of direct social interaction.
[0225]
[0226] Reference Example 13-4. Repetitive behaviors in childhood
[0227] For the home cage self-grooming test, each mouse was placed in a new home cage without bedding and allowed to move freely. Self-grooming activity was analyzed for 15 minutes, and the laboratory lighting was set to 50 lux. Self-grooming was defined as stroking or scratching the face or body, or licking parts of the body.
[0228] For the digging test, a home cage was filled with 2 cm of sawdust, and mice were placed inside for 5 minutes to observe and analyze their activity. Digging was defined as the act of digging out sawdust using the head or forelimbs. The duration of self-grooming and digging behaviors was scored using a double-blind method.
[0229]
[0230] Reference Example 13-5. Maternal Homing Test
[0231] The maternal homing test on juvenile mice was performed according to previously reported methods. P19 WT and Dyrk1a-KI mice were separated from their mothers for at least 30 minutes prior to the test. The test consisted of (i) a nest homing phase and (ii) a maternal homing phase. For nest homing, fresh sawdust was placed in one corner of a 40 x 40 x 40 cm white acrylic box, sawdust from a home cage was placed in the opposite corner, and the other two corners were left empty. The subjects were placed in one of the empty corners, and their movements were recorded for 3 minutes. For the maternal homing phase, an empty container and a container containing the subjects' mothers were placed in the two previously empty corners, respectively. Then, the subjects were placed in the corner containing the home cage sawdust, and their movements were recorded for 5 minutes.
[0232]
[0233] Reference Example 13-6. Rotarod Test
[0234] Mice were placed on a rotary rod device (Ugo Basile), and the experiment was conducted under conditions where the speed was increased from an initial speed of 4 rpm to a maximum of 40 rpm over a 5-minute test period. The lighting intensity was set to 40 lux, and the test was performed for 5 days. The time until the mouse fell off the rod (latency) was manually measured for each mouse.
[0235]
[0236] Reference Example 13-7. Open-field test
[0237] Each mouse was placed in a custom open-field box (40 cm x 40 cm x 40 cm) set to 100 lux, and the mice were allowed to move freely inside the box (1 hour for adults, 20 minutes for juveniles). Activity was videotaped, and activity parameters for each mouse, such as distance traveled and time spent in the center of the box, were analyzed using EthoVision XT 10 (Noldus).
[0238]
[0239] Reference Example 13-8. Three-chamber test
[0240] A three-chamber apparatus was used according to previously reported methods. The mice were isolated in a single cage starting 3 days before the test, while stranger mice (129S1 / SvlmJ strain) were housed in groups (4-6 mice).
[0241] The test consisted of two phases: the empty-empty (adaptation) phase and the stranger 1-mouse-object (S1-O) phase. The test was conducted after a 30-minute adaptation period in the experimental booth. A three-chamber device made of white acrylic (40 cm wide x 20 cm high x 26 cm deep, with a central chamber width of 12 cm and a side chamber width of 14 cm) contained two small containers for placing objects or stranger mice in the upper or lower corners of both side chambers. In the first adaptation phase, the subject mice were placed in the central area of the three-chamber device and allowed to freely explore the environment for 10 minutes. In the second S1-O phase, a stranger mouse (S1) and an inanimate blue cylindrical object (O) were placed in the two corner containers, respectively. The stranger mouse was randomly placed in either the left or right chamber. The subject mice were allowed to freely explore the stranger mouse or the object. For analysis, sniffing times were measured using EthoVision XT 10 (Noldus) software. Sniffing was defined as the nose of the subject mouse being located within 20% of the distance from the container.
[0242]
[0243] Reference Example 13-9. Elevated plus-maze and light-dark test
[0244] For the high-rise crossroads test, each mouse was placed in the center of the high-rise crossroads (EPM) and instructed to navigate for 10 minutes. This cross-shaped device was constructed from gray acrylic and installed at a height of 50 cm from the floor. It consisted of two open arms (30 x 5 x 0.5 cm, 300 lux) and two closed arms (30 x 5 x 30 cm, 30 lux). The time spent on the open or closed arms and the frequency of entry into each arm were automatically measured using an EthoVision XT 10 (Noldus).
[0245] For the light-light test (LD), mice were placed in a bright chamber with their heads facing the opposite wall of the dark chamber and were instructed to navigate a light-light device with a 5 cm wide entrance between the two chambers (bright chamber 20 x 13 x 20 cm, 300 lux; dark chamber 20 x 13 x 20 cm, 0 lux). The time taken to enter the dark chamber (latency) and the time spent in the bright and dark chambers were analyzed using an EthoVision XT 10 (Noldus).
[0246]
[0247] Reference Example 13-10. Fear-conditioning test
[0248] For the context-based fear conditioning test, the subject mice were placed in a fear chamber the day before conditioning and acclimatized to the chamber for 5 minutes. On the day of conditioning, the mice were placed back in the fear chamber and allowed to freely explore the environment for 2 minutes, after which five electric shocks (0.8 mA, duration 1 second, 120-second intervals) were administered. After the final shock, the mice were kept in the box for an additional 2 minutes, bringing the total experiment time to 12 minutes. After 24 hours, the mice were placed in the same conditioning box and allowed to freely explore for 10 minutes without any stimulation, and the level of freezing behavior was quantified (Fear Conditioning Test Version A). The same measurements were performed again on the 7th day after the final shock (for Fear Conditioning Test A). For Fear Conditioning Version B, the mice were placed back in the conditioning box for measurement only on the 7th day after the final shock, and the 24-hour measurement was not performed. All freezing behaviors were recorded and analyzed using FreezeFrame software (Coulbourn Instruments).
[0249] For cued fear conditioning, mice were placed in the same fear box and allowed to explore the environment for 3 minutes; then, at the end of the acoustic phase (75 dB, 8 kHz, duration 20 seconds), three electric shocks (0.8 mA, duration 1 second, unconditioned stimulus (US)) were administered at 1-minute intervals (a total of 6 minutes). The next day, the cued fear-conditioned mice were placed in a different fear box (Situation B) and allowed to move for 3 minutes without acoustics (CS-) and for 3 minutes under acoustics (CS+; 75 dB, 8 kHz, 3 minutes). Freezing behavior was analyzed using FreezeFrame 3 (Coulbourn Instrument).
[0250]
[0251] Reference Example 13-11. PTZ-Induced Seizure
[0252] After intraperitoneal injection of pentylenetetrazole (PTZ; Sigma; 40 mg / kg), the experimental mice were placed in clean, new home cages. Seizure phases defined as follows were analyzed using 30 minutes of video recording: Phase 1, behavior arrest; Phase 2, myoclonic seizure; Phase 3, generalized tonic-clonic seizure. The seizure susceptibility score was defined as follows: 0.2 x 1 / (latency to Phase 1) + 0.3 x 1 / (latency to Phase 2) + 0.5 x 1 / (latency to Phase 3).
[0253]
[0254] Reference Example 13-12. Morris water maze test
[0255] A hidden platform (10 cm in diameter) was installed inside a white plastic tank (120 cm in diameter). Mice were trained to find the hidden platform three times a day at 30-minute intervals between trials. Training was conducted for consecutive days until the time to reach the platform was less than 20 seconds. The next day, the hidden platform was removed, and a probe test was performed for 1 minute. The day after that, the platform's position was changed to the opposite side, and reversal learning was performed. Similarly, when the time to reach the platform was less than 20 seconds, the hidden platform was removed the following day, and a probe test was performed for 1 minute. The recorded videos were analyzed using Ethovision XT10 software (Nodulus). The time spent in each quadrant and the number of times the platform was traversed were quantified.
[0256]
[0257] Reference Example 14. Pharmacological Test
[0258] For pharmacological testing, lithium carbonate (Merck #255823) was supplied to drinking water at a concentration of 600 mg / L to indirectly transfer lithium to offspring via breast milk. Mother mice and offspring were treated with lithium via breast milk starting from day 3 of life, and lithium was administered until the offspring could directly drink lithium-containing water by P21. After reaching P21, the mice were weaned and housed in cages containing 3 to 6 mice of the same genetic background. After weaning, the mice were fed regular drinking water. The mother mice administered the drug were not returned to the mating cage. Although the levels of lithium carbonate and its metabolites in the serum of the offspring were not directly measured, previous studies using the same drug treatment strategy have demonstrated that lithium can reach the blood of offspring via breast milk and have reported detailed concentrations of serum fluoxetine and its metabolites during and after treatment.
[0259]
[0260] Reference Example 15. Electron microscopy observation
[0261] WT, vehicle-treated Dyrk1a-KI, and lithium-treated Dyrk1a-KI mice were deeply anesthetized with a mixture of ketamine (120 mg / kg) and xylazine (10 mg / kg), and 10 ml of heparin-treated saline was perfused intracardiac, followed by perfusion with 50 ml of a fixative freshly mixed with 2.5% glutaraldehyde and 1% paraformaldehyde in 0.1 M phosphate buffer (PB, pH 7.4). The hippocampus was excised from the entire brain, postfixed in the same fixative for 2 hours, and stored overnight in PB at 4°C. Sections were cut into 70 μm thick transverse sections using an electric cutter. After treating the sections with 0.5% osmium tetroxide (dissolved in PB) for 1 hour, they were dehydrated with alcohol with a concentration gradient, flat-embedded in Durcupan ACM (Fluka), and cured at 60°C for 48 hours. Small pieces containing the stratum radiatum of the hippocampal CA1 region were cut from wafers and attached to plastic blocks with cyanoacrylate. Ultrathin sections were fabricated and mounted on a Formvar-coated single-slot grid.
[0262] For the analysis of excitatory synapses, sections were stained with uranyl acetate and lead citrate and observed using an electron microscope (Hitachi H-7500; Hitachi) under 80 kV acceleration conditions. For the analysis of inhibitory synapses, immunogold staining for GABA was additionally performed on the sections.
[0263]
[0264] Reference Example 16. Immunogold staining after embedding for GABA
[0265] Sections were embedded and then immunostained for GABA using immunogold staining, with some modifications to previously reported methods. In summary, the grid was treated with 1% periodic acid for 5 minutes to etch the resin, treated with 9% sodium periodate for 8 minutes to remove osmium tetroxide, and then washed with distilled water. Subsequently, it was transferred to Tris-buffered saline (TBST; pH 7.4) containing 0.1% Triton X-100 for 10 minutes and incubated in TBST containing 2% human serum albumin (HSA) for 10 minutes. Then, the grid was incubated in TBST containing 2% HSA with anti-GABA rabbit antiserum (GABA 990, 1:10,000) at room temperature for 2 hours. The above antiserum (provided by Professor OP Ottersen of the Centre for Molecular Biology and Neuroscience at the University of Oslo) was generated against GABA conjugated to bovine serum albumin treated with glutaraldehyde and formaldehyde, and was characterized by spot testing. To eliminate cross-reactivity, the diluted antiserum was pre-adsorbed overnight with glutaraldehyde(G)-conjugated glutamate (500 μM) prepared according to previously reported methods. After thorough washing with TBST, the grid was incubated for 3 hours in goat anti-rabbit IgG conjugated with 15 nm gold particles (goat anti-rabbit IgG, diluted 1:25 in TBST containing 0.05% polyethylene glycol; BioCell). After washing with distilled water, the grid was counterstained with uranyl acetate and lead citrate and observed with an electron microscope (Hitachi H-7500; Hitachi) at an acceleration voltage of 80 kV.
[0266] To evaluate immunoreactivity to GABA, the gold particle density (number of particles / μm²) of each GABA+ terminal 2The gold particle density (background density) of the terminal containing round synaptic vesicles and forming asymmetric synaptic contacts with dendritic spines was measured and compared. If the gold particle density of the region containing the vesicles was at least 5 times higher than the background density, the terminal was determined to be GABA-immunopositive (+).
[0267]
[0268] Reference Example 17. Quantitative analysis of inhibitory synapses
[0269] For the quantification of excitatory synapses, 368.9 μm in each mouse 2 Twenty-four electron microscope images representing the neuropil region were taken at a magnification of 40,000x. The number of spines (PSD density), the ratio of perforated spines, PSD length, and PSD thickness were quantified in each WT and Dyrk1a-KI mouse (n=3) using ImageJ software.
[0270] For the quantification of inhibitory synapses, 655.5 μm in each mouse 2 Twenty-four electron microscope images representing the neural network region were captured at a magnification of 30,000x. The number of GABA+ terminals exhibiting clear PSDs (inhibitory synapse density), and the length and thickness of the PSDs adjoining the GABA+ terminals, were quantified in each WT and Dyrk1a-KI mouse (n=3) using ImageJ software. All measurements were performed by an experimenter whose genotype was unknown. Digital images were captured using GATAN DigitalMicrograph software driving a CCD camera (SC1000 Orius; Gatan) and saved as TIFF files. Image brightness and contrast were adjusted in Adobe Photoshop 7.0 (Adobe Systems).
[0271]
[0272] Reference Example 18. Data Collection and Statistical Analysis
[0273] Behavioral analysis was performed using a double-blind method. All data were expressed as mean values including standard deviation (SEM). All statistical analyses were performed using GraphPad Prism software (version 7.0). The statistical significance of the values is indicated in each figure as follows: *p< 0.05, **p< 0.01, ***p< 0.001.
[0274]
[0275] Example 1. Characterization of Dyrk1a-I48K-melted mice
[0276] Protein truncation mutations (Ile48LysfsX2) of the DYRK1A gene have been reported in patients with autism exhibiting the following symptoms: 1) microcephaly, 2) intellectual disability, 3) anxiety, 4) ASD-related social deficits, 5) language disorders, 6) stereotyped behaviors, and 7) febrile seizures. To determine whether this mutation could cause related defects in mice, Dyrk1a-knockin mice carrying the Ile48Lys (or I48K) mutation were produced (Fig. 1).
[0277] This protein cleavage mutation is located near the N-terminus of the protein, and the introduction of this mutation resulted in the removal of the entire protein, and the cleaved N-terminal peptide (48 amino acids) was not detected. This was confirmed by immunoblot analysis using both N-terminal and C-terminal antibodies, which showed a decrease of approximately 50% in DYRK1A protein levels in heterozygous Dyrk1a-lysed mice (Dyrk1a-KI mice) (Fig. 2). Consistent with previous results, homozygous Dyrk1a-KI mice were lethal during the embryonic stage.
[0278] Due to the embryonic lethality of homozygous Dyrk1a-KI mice, it was possible to evaluate the temporal expression patterns of Dyrk1a during the embryonic and postnatal stages. Through hybridization in situ, Dyrk1a mRNA was detected in various brain regions, including the olfactory bulb, cortex, hippocampus, and cerebellum, similar to previous findings (Fig. 3). DYRK1A protein levels were relatively high during the embryonic and early postnatal stages, then decreased to adult levels at 4 weeks of age (or approximately 28 days of age) (Fig. 4). At P14, DYRK1A protein levels were similar across multiple brain regions (Fig. 5).
[0279] Dyrk1a-KI mice exhibited developmental delays, as evidenced by body weight loss, which were more pronounced in males than in females during the juvenile and adult stages (Fig. 6). Brain weight, area, and brain-to-body weight ratio also decreased in male Dyrk1a-KI mice at weeks 3 and 8, corresponding to the juvenile and adult stages, respectively (Fig. 7). Immunostaining for DAPI (cell body marker), NeuN (neuron), S100β (astrocytocyte), and neurofibrillary M (axon) confirmed that the overall morphology of the Dyrk1a-KI mouse brain was generally normal (Figs. 8 and 9). These results collectively suggest that Dyrk1a deficiency causes neurodevelopmental delays that can be observed during the juvenile and adult stages.
[0280]
[0281] Example 1-1. Severe microcephaly in Dyrk1a-KI mice
[0282] Since patients with autism spectrum disorder having the DYRK1A-I48K mutation exhibited microcephaly and Dyrk1a-KI mice also showed reduced brain weight and area (Fig. 7), brain volume was further analyzed using magnetic resonance imaging (MRI). Brain MRI analysis of 8-week-old Dyrk1a-KI mice revealed generalized microcephaly, with the greatest reduction (5-25%) observed particularly in the basal ganglia, diencephalon, and midbrain regions (Fig. 10).
[0283] Specific brain subregions that showed greater volume reduction included the hippocampal dentate gyrus, cingulate cortex, globus pallidus, nucleus accumbens, medial septum, medial amygdala, hypothalamus, and superior colliculus (Fig. 11). These results, taken together, suggest that the Dyrk1a-I48K mutation in mice causes severe microcephaly.
[0284]
[0285] Example 1-2. Behavioral abnormalities in Dyrk1a-KI mice
[0286] To determine whether the developmental delay and microcephaly observed in Dyrk1a-KI mice were associated with behavioral abnormalities, a series of behavioral tests were conducted on the mutant mice. Since body weight loss was significant only in male mice, only male mice were used for the behavioral tests.
[0287] Adult Dyrk1a-KI mice (2–5 months old) showed generally normal motor activity in the open field test and Laboras test, which measure movement in new and familiar environments, respectively (Figs. 12 and 13). These mice also exhibited normal anxiety-like behavior in the open field, high-rise crosshair, and light-dark tests, and showed normal motor coordination ability in the rotarod test (Figs. 12 and 14 to 16).
[0288] In social / repetitive behavior tests, adult Dyrk1A-KI mice exhibited normal social interactions in the three-chamber test, but emitted significantly fewer ultrasonic vocalizations (USV) during courtship behavior (Figs. 17 and 18). This is reminiscent of the language delay and social deficits observed in human patients with the DYRK1A-I48K variant. Additionally, while self-grooming and lifting were normal, there were changes in repetitive behaviors, as climbing behavior was reduced (Fig. 19).
[0289] Adult Dyrk1A-KI mice showed somewhat reduced learning and memory abilities; spatial fear memory retrieval decreased after 24 hours but was at a normal level after 7 days (Fig. 20). On the other hand, spatial learning and memory in signal fear conditioning and the Morris water maze test were normal (Fig. 21). These results are also reminiscent of the intellectual disability observed in human patients with the DYRK1A-I48K mutation.
[0290] Juvenile Dyrk1a-KI mice spent more time with their mothers upon reunion after 30 minutes of separation (Fig. 22), which suggests anxiety-like behavior and is similar to the behavior observed in DYRK1A-I48K human individuals. However, motor activity and social / repetitive behaviors in these mice were within the normal range (Figs. 23 and 24). Dyrk1a-KI pups emitted normal levels of USV when separated from their mothers (Fig. 25), which indicates normal anxiety-like behavior.
[0291] Taken together, these results indicate that Dyrk1a-KI mice exhibit various behavioral abnormalities in the domains of social, repetitive, and cognitive behaviors during both childhood and adulthood.
[0292]
[0293] Examples 1-3. Reduction of seizure-sensitive and excitatory synapse density in the Dyrk1a-KI hippocampus
[0294] Autism spectrum disorder often involves an imbalance between the excitation and inhibition of brain function. Therefore, a pentylenetetrazolium (PTZ)-induced seizure test was performed on mutant mice to confirm changes in brain excitability in Dyrk1a-KI mice. As a result, the PTZ-induced brain excitation level in Dyrk1a-KI mice was significantly reduced (Fig. 26).
[0295] To determine whether this decrease in brain excitability is related to synaptic changes, micro-excitatory and inhibitory postsynaptic currents (mEPSC and mIPSC, respectively) were measured in CA1 pyramidal neurons of the hippocampus. The measured brain regions were those that showed detectable Dyrk1a expression and volume reduction in Dyrk1a mice (Figs. 3, 5, 10, and 11). As a result, in CA1 pyramidal neurons of Dyrk1a-KI mice, the amplitude of mEPSC remained unchanged around P21 (21 days after birth), but the frequency decreased (Fig. 27). On the other hand, mIPSC was normal in both frequency and amplitude in mutant neurons (Fig. 28). These results indicate that the ratio of excitatory to inhibitory synaptic transmission was reduced in mutant mice.
[0296] Electron microscopy analysis revealed a decrease in excitatory synapse density in the mutant CA1 region. Specifically, while the length, thickness, and perforations (a measure of maturity) of postsynaptic density (PSD) were normal, the number of PSDs facing the presynaptic axon terminal was lower (Fig. 29). In contrast, there was no change in the density, length, or thickness of inhibitory PSDs (Fig. 30). These results indicate a decrease in excitatory synapse density in the mutant hippocampus.
[0297] Interestingly, other measures of excitatory synaptic function were largely normal. There were no changes in basal AMPA receptor-mediated synaptic transmission (input-output curve) or the ratio of evoked NMDA to AMPA receptor-mediated current (NMDA / AMPA ratio), and only slight changes were observed in presynaptic emission (double pulse ratio) (Fig. 31). Additionally, there were no changes in measures of synaptic plasticity, including high-frequency stimulation long-term potentiation (HFS-LTP), theta-burst stimulation LTP (TBS-LTP), low-frequency stimulation long-term attenuation (LFS-LTD), and metabolic glutamate receptor-dependent LTD (mGluR-LTD) (Fig. 32).
[0298] Taken together, these results suggest that the Dyrk1a-KI mutation in mice reduces the ratio of excitatory to inhibitory synaptic transmission by reducing excitatory synaptic density in the hippocampus without affecting inhibitory synaptic density or other measures of excitatory synaptic function (basal transmission, NMDA receptor function, synaptic plasticity).
[0299]
[0300] Example 2. Recovery of Dyrk1a-KI mice by early administration of lithium
[0301] We hypothesized that inhibition of dendrite formation and reduction of excitatory synapse density in Dyrk1a-KI mice would be the key mechanisms underlying the phenotype of Dyrk1a-KI mice. To verify this hypothesis, we decided to treat Dyrk1a-KI mice with lithium, a treatment for bipolar disorder known to exert pleiotropic neurodevelopmental, neuroprotective, and neurosynaptic effects through various mechanisms, including GSK3β inhibition. Chronic treatment was adopted during the first 3–4 weeks of life, as 1) Dyrk1a protein levels remain high until ~P21, 2) a behavioral phenotype is detected during childhood, 3) excitatory synapse defects are observed during childhood, and 4) early correction of pathological mechanisms can elicit long-lasting effects. Specifically, newborn heterozygous Dyrk1a-KI offspring (~P0) were treated with lithium via breast milk until weaning (~P21), and at P21, dendrite formation, synaptic transmission and density, brain size, proteomic profiles, and maternal search behavior were evaluated (Fig. 36). After weaning at P21, other Dyrk1a-KI offspring continued to receive lithium treatment via drinking water until P28. At 2–3 months of age, social communication (adult USV) and seizure susceptibility were measured, and proteomic profiles were obtained.
[0302] Sholl analysis of Dyrk1a-KI mice treated with early lithium revealed normalized dendrite formation in hippocampal CA1 pyramidal neurons and prefrontal limbic pyramidal neurons at P21 compared to untreated Dyrk1a-KI mice (Figs. 37 and 38). Additionally, hippocampal neurons in lithium-treated Dyrk1a-KI mice showed normalized mEPSC frequencies at P21 without affecting mIPSCs (Fig. 39). Consistently, electron microscopy analysis of PSDs showed that lithium treatment normalized excitatory synaptic density without affecting PSD morphology (Figs. 40 and 41). Surprisingly, Dyrk1a-KI mice treated with early lithium exhibited normal brain size at P21 and did not show the microcephaly seen in the untreated control group (Fig. 42). Lithium also restored maternal seeking behavior at P21 and restored courtship USV and seizure sensitivity at 2–3 months of age (Figs. 43–45).
[0303] Taken together, these results suggest that early chronic lithium treatment in Dyrk1a-KI mice restores various Dyrk1a-KI phenotypes (dendritic formation, synaptic transmission and density, brain size, and behavior) immediately after treatment and long after the treatment has ended, and also has a long-term effect in preventing the appearance of behavioral phenotypes in the adult stage.
[0304]
[0305] Example 3. Analysis of Post-Translational Modifications in P21 Dyrk1a-KI Mice by Early Lithium Treatment
[0306] To better understand the therapeutic mechanism of early lithium administration on the Dyrk1a-KI phenotype, Dyrk1a-KI transcriptomes and proteomes were analyzed. Whole-brain samples were used because Dyrk1a is widely expressed in the brain and changes in brain volume and neuromorphology were observed in various brain regions.
[0307] Dyrk1a-KI forebrain RNA-Seq results for P21 showed a small number of differentially expressed genes (DEGs), but gene set enrichment analysis (GSEA) showed a significant increase in synapse-related gene expression and a "reverse-ASD" transcriptome pattern (changes opposite to those occurring in ASD) (Figs. 46 to 49). These results suggest compensatory transcriptome changes in P21 aimed at normalizing excitatory synaptic function. The P60 transcriptome showed a reverse-ASD pattern associated with upregulated splicing-related genes and downregulated oligodendrocyte-related genes (Figs. 50 to 53), suggesting compensatory changes occurring through other (or non-synaptic) mechanisms.
[0308] Next, the total proteome was analyzed using WT and Dyrk1a-KI mice of P21 and P60, and a small number of differentially expressed proteins (total-DEP; p< 0.05+ FC> 1.2; a total of 13 for P21 [8 increased, 5 decreased]; a total of 13 for P60 [5 increased, 8 decreased]) were identified (Figs. 54 to 57). There were no overlapping DEPs in P21 and P60. This suggests that Dyrk1a-KI mutations induce only small changes at the total protein level in P21 and P60.
[0309] Next, the Dyrk1a-KI proteome was analyzed with a focus on post-translational modifications (PTMs), which are known to regulate aspects such as protein stability, function, localization, and interactions. To this end, WT and Dyrk1a-KI mice were treated with vehicle / lithium for the first 3 weeks after birth, and PTM-differentially expressed phosphorylated peptides (DEPPs) were analyzed to determine baseline differences between vehicle-treated WT mice and vehicle-treated Dyrk1a-KI mice. Subsequently, among the baseline differences (vehicle-treated WT / Dyrk1a-KI), a subset (lithium-recovered PTM-DEPPs) in which there were no longer significant differences between lithium-treated Dyrk1a-KI mice and vehicle-treated WT mice was identified. Furthermore, to investigate the immediate and long-term effects of early lithium treatment, PTM-DEPPs obtained at P21 and P60 were compared.
[0310] Baseline comparison between vehicle-treated WT mice and vehicle-treated Dyrk1a-KI mice revealed a large number of P21 PTM-DEPPs (p < 0.05 + FC > 1.2; 766 total, 336 upregulated, 430 downregulated) (Fig. 58). Given the small number of total DEPs identified earlier, these PTM changes appear to reflect changes in protein phosphorylation levels rather than total protein levels. Many of the PTM-DEPPs that showed strong changes (p < 0.05 + FC > 2.0) belonged to synaptic proteins listed in the SynGO database, including Dock4 (dedicator of cytokinesis 4), Elavl2 (ELAV-like RNA-binding protein 2), Dagla (diacylglycerol lipase alpha), Prkcd (protein kinase C delta), Prr7 (proline-rich 7), and Map2 (microtubule-associated protein 2) (Fig. 59).
[0311] DAVID analysis using the KEGG database revealed that PTM-DEPP (766 peptide) was abundant in various signaling pathways, including insulin, cAMP, oxytocin, AMPK, ErbB, thyroid hormone, gap junctions, and autophagy (Fig. 60). DAVID analysis using the Gene Ontology (GO) database revealed that PTM-DEPP was abundant in 'postsynaptic density' and 'protein binding'. Consistently, PTM-DEPP was also found to be abundant in SynGO proteins / functions (21–27%) (Fig. 61). These results suggest that P21 PTM-DEPP may affect various signaling pathways and synaptic proteins, thereby inducing dendritic / synaptic defects observed in juvenile Dyrk1a-KI mice.
[0312] Next, PTM-DEPP in P21 vehicle-treated WT mice and lithium-treated Dyrk1a-KI mice was compared, and PTM-DEPP recovered by lithium was highlighted in volcano plots representing baseline differences between vehicle-treated WT mice and vehicle-treated Dyrk1a-KI mice (Figs. 62 and 63). DAVID-KEGG analysis revealed that PTM-DEPP recovered by lithium (total 561; 228 up, 333 down) was abundant in approximately 80% of the signaling pathways identified in the baseline difference analysis (8 out of 10 pathways: insulin, cAMP, oxytocin, AMPK, gap junction, longevity, ErbB, and autophagy pathways) (Fig. 64). DAVID-GO analysis results showed that lithium-recovered PTM-DEPP was abundant in 'postsynaptic density' and 'protein binding' (Fig. 64), which was similar to the baseline DAVID-GO enrichment pattern (Fig. 60). Lithium-recovered PTM-DEPP was also abundant in SynGO protein / function (24-31%) (Fig. 65), which was more similar to the pattern observed at baseline (Fig. 61). In particular, the lithium-recovered SynGO PTM-DEPP included Elavl2 (S221) and Kalrn (S488), and their reduced phosphorylation was restored to WT levels after lithium treatment. Although the function of this phosphorylation is unclear, Elavl2 is detected in synapses and regulates synaptic assembly and dendrite formation. In addition, Kalrn (Kalirin), a Rho-guanine nucleotide exchange factor (Rho-GEF) associated with neurodevelopmental disorders including schizophrenia, regulates synaptic function and dendrite formation.
[0313] These results collectively suggest that early chronic lithium treatment in Dyrk1a-KI mice restores the PTM patterns of various signal transduction and synaptic proteins observed immediately after weaning (P21).
[0314]
[0315] Example 4. Analysis of Post-Translational Modifications in P60 Dyrk1a-KI Mice by Early Lithium Treatment
[0316] When PTM-DEPP in P60 was analyzed to evaluate the long-term effects of early lithium treatment (P0-P28), multiple P60 PTM-DEPPs were identified in baseline comparisons between vehicle-treated WT mice and vehicle-treated Dyrk1a mice (p < 0.05 + FC > 1.2; total 306, 220 up, 86 down) (Fig. 66). Some synaptic proteins, including SynGO proteins (e.g., Shank3 and Shank2), Psd3 (pleckstrin and sec3 domain-containing 3), Kif1a (kinesin family member 1 A), Crk (CRK proto-oncogene, adaptor protein), Pura (purine-rich element binding protein A), Kcnma1 (potassium calcium-activated channel subfamily M alpha 1), Kif21a (kinesin family member 21 A), and Aak1 (AP2-associated kinase 1), showed strong upregulation of P60 PTM-DEPP (p < 0.05 + FC > 2.0) (Fig. 67). In the DAVID-KEGG analysis, P60 PTM-DEPP was found to be abundant in specific synapse-related pathways, including the glutamatergic synapse, GABAergic synapse, and synaptic vesicle cycle pathways (Fig. 68). These results differed from the observations in P21, where various signaling pathways were more strongly abundant (Fig. 60). The DAVID-GO analysis showed that P60 PTM-DEPP was abundant in postsynaptic density and protein binding (Fig. 68), which was similar to the results obtained from P21 PTM-DEPP (Fig. 48).Surprisingly, SynGO analysis results showed that P60 PTM-DEPP exhibited significant synaptic enrichment (~46% / 38%) in SynGO protein / function (Fig. 69), which was about twice as large as that observed in P21 PTM-DEPP (Fig. 61). Therefore, P60 PTM-DEPP was less abundant in signaling pathways but more strongly abundant in synaptic proteins than P21 PTM-DEPP, suggesting that P60 PTM-DEPP is different from P21 PTM-DEPP.
[0317] Next, P60 PTM-DEPP was identified in lithium-treated Dyrk1a-KI mice compared to vehicle-treated WT mice, and lithium-recovered PTM-DEPP was identified by comparing it with baseline PTM-DEPP (Figs. 70 and 71). P60 PTM-DEPP recovered by lithium treatment (total 78, 41 up, 37 down) contained various synaptic proteins including Bsn (bassoon presynaptic cytomatrix protein), Ap1s1 (adaptor-related protein complex 1 subunit sigma 1), Dock10 (dedicator of cytokinesis 10), Sv2b (synaptic vesicle glycoprotein 2B), Marcks (myristoylated alanine rich protein kinase C substrate), Cap2 (cyclase-associated actin cytoskeleton regulatory protein 2), Kcnc1 (potassium voltage-gated channel subfamily C member 1), Ctnnd2 (catenin delta 2), Pak3 (p21 (RAC1)-activated kinase 3) and Tsc1 (TSC complex subunit 1) (Fig. 71). DAVID-KEGG / GO analysis revealed that PTM-DEPP recovered by lithium treatment was strongly enriched in synapse-related functions (e.g., postsynaptic density) (Fig. 72). Additionally, PTM-DEPP recovered by lithium was found to be strongly enriched in SynGO proteins / functions as well (Fig. 73). There was no overlap between PTM-DEPP recovered by lithium treatment in P21 and P60.
[0318] Finally, PTM-DEPP was analyzed in homozygous Dyrk1a-KI mice at P60. Although homozygous Dyrk1a-KI mice could be born in a hybrid background (C57 / BL6J x 129 Sv), they could not be used to examine other phenotypes because they are born with a very low Mendelian ratio (WT / heterozygous / homozygous 1:1:0.015, rather than 1:2:1). This analysis identified numerous PTM-DEPPs (p < 0.05 + FC > 1.2; 223 total, 152 uplinked, 71 downlinked) (Fig. 74). PTM-DEPPs identified as showing stronger changes (p < 0.05 + FC > 1.2) included not only synaptic proteins but also mTOR and other signaling proteins (Fig. 75), and DAVID and SynGO analyses supported these results (Figs. 76 and 77). These findings differed from results obtained in heterozygous Dyrk1a-KI mice, where major changes were observed in synaptic proteins rather than signaling proteins. This suggests that distinct gene-dosage effects may exist.
[0319] In summary, our results suggest the following: 1) P60 PTM-DEPP is more abundant in synaptic proteins than in signaling proteins, and thus exhibits a different pattern from P21 PTM-DEPP; 2) Early lithium treatment in Dyrk1a-KI mice preferentially restores synaptic protein PTM over signaling protein PTM at baseline difference well after treatment (i.e., around P60); 3) Early lithium treatment can restore signaling protein PTM around P21 in order to restore synaptic protein PTM around P60.
[0320] The results of the study can be summarized as follows: 1) P60 PTM-DEPP is more abundant in synaptic proteins than in signaling proteins, and thus shows a different pattern from P21 PTM-DEPP; 2) Early lithium treatment in Dyrk1a-KI mice preferentially restores synaptic protein PTM over signaling protein PTM at baseline difference for a long time (~P60) after treatment; 3) Early lithium treatment can restore signaling protein PTM at P21 to restore synaptic protein PTM at P60.
[0321]
[0322] Example 5. Analysis of functional characteristics of PTM-DEPP recovered by lithium treatment in Dyrk1a-KI mice
[0323] Next, we aimed to further understand the underlying mechanism of lithium-induced recovery of PTM-DEPP. To determine whether the activity of GSK3β, known to be inhibited by lithium and regulate synaptic and neuronal function, was affected, we investigated changes in GSK3β-Ser9 phosphorylation and performed Western blot analysis using P21 and P60 Dyrk1a-HT brain lysates. Additionally, we conducted parallel analyses of potential GSK3β upstream kinases using previously reported methods.
[0324] Total proteome and PTM proteome analyses of P21 and P60 Dyrk1a-HT mice showed no significant changes in GSK3β Ser9 phosphorylation. Western blot analysis also revealed similar levels of total GSK3β and GSK3β-Ser9 phosphorylation between P21 WT mice and Dyrk1a-KI mice (Fig. 78). Consequently, potential GSK3β upstream kinases, including calcium / calmodulin-dependent kinase (CaMK) group / family kinases (CAMK1-4 and CAMKK), did not show changes in phosphorylation in PTM-DEPP of P21 and P60 Dyrk1a-HT mice (Fig. 79). These results suggest that GSK3β is unlikely to be important for the Dyrk1-HT phenotype.
[0325] Using the same method, we aimed to identify potential upstream kinases responsible for downregulated and lithium-responsive PTM-DEPP in P21 WT and Dyrk1a-KI mice. Downregulated PTM-DEPP was the primary subject of analysis because it is more likely to represent direct potential substrates of upstream kinases. Of the top 31 candidate upstream kinases of downregulated P21 PTM-DEPP, 24% belonged to the CMGC (CDK, MAPK, GSK, CLK) group kinases (DYRK1A belonged to CLK), and 13% belonged to the STE group (STE20 / 11 / 7) (Fig. 80). For the top 22 downregulated P60 PTM-DEPPs, 14% of the upstream kinases belonged to the CMGC group, 12% to the CAMK group, and 9% to the STE group (Fig. 81). These results suggest that some of the upstream downregulated P21 / P60 PTM-DEPPs are likely direct substrates of DYRK1A.
[0326] Next, as the functions of several PTM-DEPPs have not yet been elucidated, their functions were investigated. Specifically, we focused on Kalirin and Elavl2, which are known to regulate synaptic function and dendrite formation, even though Elavl2 had a relatively lower Dyrk1a / GSK3β-dependent phosphorylation score compared to Kalirin. Considering that the phosphorylation sites of these proteins, Kalirin-S488 and Elavl2-S221, are not well characterized, we generated phospho-mimic mutants (Kalirin-7-S488D and Elavl2-S221D) and non-phosphorylatable mutants (Kalirin-7-S488A and Elavl2-S221A). Then, the functions of these mutants were tested in cultured wild-type (WT) and Dyrk1a-HT KI hippocampal neurons. Kalirin-7-S488D (phosphorylation mimic) overexpressed in cultured neurons enhanced the level of dendrite formation in both WT and Dyrk1a-HT neurons compared to the non-phosphorylational form (Kalirin-7-S488A), as measured by Sholl analysis (Figs. 82 and 83). Similarly, Elavl2-S221D increased dendrite formation in WT and Dyrk1a-HT neurons compared to Elavl2-S221A (Figs. 82 and 83). These results suggest that Kalirin-S448 and Elavl2-S221 phosphorylation can regulate dendrite branching in hippocampal neurons, consistent with the results of inhibited dendrite formation in Dyrk1a-HT mice (Fig. 37).
Claims
1. A pharmaceutical composition for the prevention or treatment of autism spectrum disorder comprising a lithium salt as an active ingredient.
2. A pharmaceutical composition according to claim 1, wherein the autism spectrum disorder is caused by a mutation in the DYRK1A (dual-specificity tyrosine-phosphorylation-regulated kinase 1 A) gene.
3. A pharmaceutical composition according to claim 1, wherein the autism spectrum disorder is manifested by DYRK1A syndrome.
4. A pharmaceutical composition according to claim 1, wherein the autism spectrum disorder is characterized by the appearance of one or more symptoms selected from the group consisting of microcephaly, intellectual disability, anxiety, social deficits, language disorders, stereotyped behaviors, and febrile seizures.
5. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition is administered from birth through childhood.
6. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition is administered orally.
7. A pharmaceutical composition according to claim 1, wherein the lithium salt induces one or more selected from the group consisting of upregulation of synapse-related gene expression, upregulation of splicing-related genes, and downregulation of oligodendrocyte-related genes.
8. A pharmaceutical composition according to claim 1, wherein the lithium salt normalizes the post-translational modification (PTM) pattern of a synaptic protein.
9. A pharmaceutical composition according to claim 8, wherein the post-translational modification pattern of the synaptic protein is the post-translational modification pattern of the synaptic protein in adulthood.
10. A pharmaceutical composition according to claim 1, wherein the lithium salt normalizes one or more signaling pathways selected from the group consisting of insulin, cAMP, oxytocin, AMPK, gap junction, ErbB, and autophagy.
11. A pharmaceutical composition according to claim 1, wherein the lithium salt exhibits one or more effects selected from the group consisting of normalization of inhibited dendrite formation, recovery of reduced excitatory synapse density, improvement of microcephaly, and improvement of abnormal behavior.
12. A pharmaceutical composition according to claim 1, wherein the lithium salt is lithium carbonate or lithium citrate.
13. A health functional food composition for the prevention or improvement of autism spectrum disorder comprising a lithium salt as an active ingredient.
14. A health functional food composition according to claim 13, wherein the autism spectrum disorder is caused by a mutation in the DYRK1A gene.
15. A health functional food composition according to claim 14, wherein the autism spectrum disorder is caused by DYRK1A syndrome.
16. A health functional food composition according to claim 13, wherein the autism spectrum disorder is characterized by the appearance of one or more symptoms selected from the group consisting of microcephaly, intellectual disability, anxiety, social deficits, language disorders, stereotyped behaviors, and febrile seizures.
17. The health functional food composition of claim 13, wherein the health functional food composition is consumed from birth through childhood.
18. A health functional food composition according to claim 13, wherein the lithium salt is lithium carbonate or lithium orotate.