Methods and compositions for cell-type-specific nucleic acid delivery

Abstract

Disclosed herein are modified RNAs comprising one or more one or more modified nucleotides at position +1 to position +6 with reference to a 5' terminus of the RNA, and methods of making the same. Also provided are compositions comprising one or more of the modified RNAs provided herein, and methods of using said compositions for therapeutic applications.

Description

Atty. Docket No. 114203-1901METHODS AND COMPOSITIONS FOR CELL-TYPE-SPECIFIC NUCLEIC ACID DELIVERYCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit under 35 U. S. C. § 119(e) of U. S. Provisional Patent Application No. 63 / 724,599, filed November 25, 2024, the entire contents of which are incorporated herein by reference in their entireties.BACKGROUND

[0002] The following discussion is merely provided to aid the reader in understanding the disclosure and is not admitted to describe or constitute prior art thereto.

[0003] Messenger RNA (mRNA) technology is an emerging alternative to conventional small molecule, DNA, and protein therapeutics and conventional vaccine approaches because it is potent, programmable, and increasingly conducive to large-scale production. mRNA therapy is a rapidly developing field and has been used for the expression of therapeutic proteins, including vascular regeneration factors (e.g., vascular endothelial growth factor A (VEGF-A), erythropoietin (EPO), GATA Binding Protein 4 (GATA4), Myocyte Enhancer Factor 2C (MEF2C), T-Box Transcription Factor 5 (TBX5), Myocardin (MYOCD), and for vaccines against COVID-19, influenza, and Zika virus. Despite recent clinical successes, mRNA therapy still faces challenges of instability, toxicity, short-term efficacy, and potential immunological responses. Increasing the stability and translation efficiency of mRNAs to enhance their efficiency in vivo remains an important problem that must be solved to increase the feasibility of mRNA therapeutics for clinical applications.SUMMARY

[0004] Provided herein are RNAs with 5’ modifications that promote cell-type-specific expression, thereby enhancing the targeting of RNA expression to cells of interest. Also provided are methods of making and using such modified RNAs.

[0005] In one aspect, the present disclosure provides an RNA comprising (i) one or more modified nucleotides at position +1 to position +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap. In some embodiments, the RNA comprises a modified nucleotide at: (a) position +1 with reference to the 5’ terminus; or (b) position +3 with reference to the 5’14931-5478-7195.1Atty. Docket No. 114203-1901terminus; or (c) positions +1, +3, and +5 with reference to the 5’ terminus; or (d) positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the one or more modified nucleotides comprises a modified sugar. In some embodiments, the modified sugar is selected from the group consisting of 2'-deoxy fluoro (2FA), Z-adenosine (ZA), 2'-deoxyadenosine (dA), locked nucleic acid (LNA), 2'-methoxy (20Me), 2'-methoxyethoxy (2M0E), 2 '-thioribose, 2', 3 '-dideoxyribose, 2'-amino-2'-deoxyribose, 2' deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino-2', 3 '-dideoxyribose, 3 '-azido-2', 3 '-dideoxyribose, 3 '-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5 '-aminoribose, 5 '-thioribose, 5-nitro-l-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked ribose, and 2'-O,4'-C-thio-linked ribose. In some embodiments, the one or more modified nucleotides comprises a modified phosphate. In some embodiments, the modified phosphate is selected from the group consisting of phosphorothioate (PS), thiophosphate, 5'-O-methylphosphonate, 3 '-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphorami date, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate. In some embodiments, the one or more modified nucleotides comprises a modified nucleobase. In some embodiments, the modified nucleobase is selected from the group consisting of inosine, xanthine, allylamino uracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6-chloropurineriboside, N6-methyladenosine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5 -methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-Indolyl)propionamide-N-allyl]uracil, 5-aminoallylcytosine, 5 -aminoallyluracil, 5-bromouracil, 5 -bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5 -fluorouracil, 5 -formyl cytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine,24931-5478-7195.1Atty. Docket No. 114203-1901aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16-aminoallylcytosine, biotin- 16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3 -aminoallylcytosine, cyanine 3 -aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5 -aminoallyl cytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3-aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, Nl-ethylpseudouracil, N1 -methoxymethylpseudouracil, N1 -methyladenine, N1 -methylpseudouracil, N1 -propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6-methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3 -deazaadenine, 2,6-diaminoadenine, 2,6-daminoguanine, 5-carboxamide-uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio-N6-threonyl carbamoyl adenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6, N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A). In some embodiments, the one or more modified nucleotides comprise one or more modified sugars, one or more modified phosphates, one or more modified nucleobases, or any combination thereof. In some embodiments, the 5’ cap is selected from the group consisting of 7-methyguanosine (m7G), N7,3’-O-dimethyl-guanosine-5’ -triphosphate-5 ’-guanosine (m7G-3’m-ppp-G), N7,2’-O-dimethyl-guanosine-5’ -triphosphate-5 ’-guanosine (m7Gm-ppp-G), 7-benzylguanosine (Bn7G), chlorobenzylguanosine (ClBn7G), m7G bearing an LNA sugar (m7G-LNA), chlorobenzyl-O-ethoxyguanosine (ClBnOEt7G), 7-(4-chlorophenoxyethyl)-guanosine, 7-ethyl guanosine (e7G), 7-propyl guanosine (p7G), 7-isopropyl guanosine (ip7G), 7-butyl guanosine (b7G), 7-isobutyl guanosine (ib7G), 7-cyclopentyl guanosine (cp7G), 7-(carboxymethyl) guanosine (cm7G), 7-(2-phenylethyl) guanosine [7-(2-PhEt)G], 7-(l-phenylethyl) guanosine [7-(l-PhEt)G], m7GpppBH3G (DI and D2 stereoisomers), m7GppBH3G (DI and D2 stereoisomers), m7GpBH3G (DI and D2 stereoisomers), m7GppBH3pm7G, m27’2' °GpppBH3G (DI and D2 stereoisomers), m27’2'°GppBH3pG (DI and D2 diastereomers), m27,2' °GppspG (DI and D2 diastereomers), N-Arylmethyl analogs, glyceryl, 4',5'-methylene34931-5478-7195.1Atty. Docket No. 114203-1901nucleotide, l-(beta-D- erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L-nucleotides, alpha-nucleotide, modified base nucleotide, threo-pentofuranosyl nucleotide, acyclic 3',4'-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5-dihydroxypentyl nucleotide, 3'-3 '-inverted nucleotide moiety, 3 '-3 '-inverted abasic moiety, 3'-2'-inverted nucleotide moiety, 3'-2 '-inverted abasic moiety, 1,4-butanediol phosphate, 3'-phosphoramidate, hexylphosphate, aminohexyl phosphate, 3'-phosphate, 3'-phosphorothioate, phosphorodithioate, capl, cap2, cap3, cap4, ARC A, modified ARC A, inosine, Nl-methylguanosine, LNA-guanosine, 2-azido-guanosine, and a bridging or non-bridging methylphosphonate moiety. In some embodiments, the RNA further comprises at least one poly-A tail. In some embodiments, the 5’ cap is added to the RNA through a chemical capping method. In some embodiments, the RNA further comprises a 5’ untranslated region (5’ UTR). In some embodiments, the 5’ UTR comprises a promoter. In some embodiments, the RNA further comprises a 3’ untranslated region (3’ UTR). In some embodiments, the 3’ UTR comprises at least one exonuclease-resistant modification. In some embodiments, the exonuclease-resistant modification is selected from the group consisting of phosphorothioate (PS) linkage, 2’-O-methyl (20Me), 2’ Fluoro, inverted deoxythymidine (dT), inverted dideoxythymidine (ddT), 3’ phosphorylation, C3 spacer, 2'-O-methoxy-ethyl (2'-M0E), G-quadruplex, and 2'-3'-dideoxy nucleotide (ddN). In some embodiments, the RNA comprises two or more 5’ caps. In some embodiments, the RNA comprises two or more poly-A tails. In some embodiments, the RNA further comprises an open reading frame (ORF). In some embodiments, the ORF encodes a protein. In some embodiments, the protein is a therapeutic protein. In some embodiments, the protein is an antigen. In some embodiments, the RNA further comprises a sequence encoding a therapeutic nucleic acid. In some embodiments, the therapeutic nucleic acid is an antisense oligonucleotide (ASO), an aptamer, an RNA decoy, an siRNA, a shRNA, a miRNA, or a gRNA. In some embodiments, the RNA is a circular RNA. In some embodiments, the one or more modifications are selected from the group consisting of 2'-O-methyladenosine (20Me-A), locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-dimethyladenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5-methyl-locked nucleic acid (LNA)cytosine, -d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-O-methyl-P-O-methyladenosine, N6, N6-dimethyladenine (m62A), Nl-methyl-44931-5478-7195.1Atty. Docket No. 114203-1901inosine (NIT), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine, 2 '-methoxy ethoxy-adenosine (2M0E), and 5-methylcytosine (m5C). In some embodiments, the RNA comprises a m7G 5’ cap and an LNA modification at position +1 with reference to the 5’ terminus. In some embodiments, the RNA comprises a m7G 5’ cap and an LNAm5C modification at position +1 with reference to the 5’ terminus. In some embodiments, the RNA comprises a m7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and a 20Me modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the RNA comprises an LNAm7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and a 20Me modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the RNA comprises a m7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the RNA comprises a LNAm7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the RNA comprises a m7G 5’ cap and a 2M0E modification at position +1 with reference to the 5’ terminus. In some embodiments, the RNA comprises a m7G 5’ cap and a 2M0E modification at each of positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the RNA comprises an LNAm7G 5’ cap and a 2M0E modification at each of positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the RNA comprises a m7G 5’ cap, a 2M0E modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the RNA comprises an LNAm7G 5’ cap, a 2M0E modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the RNA further comprises a microRNA (miRNA) element. In some embodiments, the miRNA sequence is a miRNA-off element and is located 5’ of the polyA tail. In some embodiments, the miRNA sequence is a miRNA-on element and is located 3’ of the polyA tail. In some embodiments, the RNA comprises a miRNA-off element and a miRNA-on element. In some embodiments, the modified mRNA further comprises an RNA degron signal. In some embodiments, the RNA encodes Atohl or Ngn2, wherein the RNA comprises a54931-5478-7195.1Atty. Docket No. 114203-1901LNAm7G 5’ cap, a LNA modification at position +1 from the 5’ terminus, and a PS_2M0E modification at each of the 6 nucleotide positions closest to the 3’ terminus of the RNA followed by a terminal 2', 3 '-dideoxy cytidine (ddC). In some embodiments, the RNA comprises a nucleotide sequence selected from SEQ ID NO: 5 or SEQ ID NO: 6. In some embodiments, the RNA encodes IL-23, IL-36y, or OX40L, wherein the RNA comprises a m7G 5’ cap, a LNA modification at positions +1, +2, +3, +4, +5, and +6 from the 5’ terminus, and a PS 2MOE modification at each of the 6 nucleotide positions closest to the 3’ terminus of the RNA followed by a terminal 2', 3 '-dideoxycytidine (ddC). In some embodiments, the RNA comprises at least two 5’ caps. In some embodiments, the RNA comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.

[0006] In one aspect, the present disclosure provides a method of expressing a modified RNA in a liver cell (e.g., a hepatocyte or a HepG2 cell), comprising contacting the liver cell with a modified RNA comprising (i) one or more modified nucleotides at one or more of positions +1, +2, +3, +4, +5, or +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap. In some embodiments, the modified RNA comprises a modified nucleotide at position +1 with reference to the 5’ terminus. In some embodiments, the one or more modified nucleotide is selected from the group consisting of 2'-O-methyladenosine (2OMe-A), locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-dimethyladenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5-methyl-locked nucleic acid (LNA)cytosine, P-d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-O-methyl-P-O-methyladenosine, N6, N6-dimethyladenine (m62A), Nl-methyl-inosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine, 2'-methoxyethoxy-adenosine (2M0E), and 5-methylcytosine (m5C). In some embodiments, the modified RNA comprises a m5C modification at position +1 with reference to the 5’ terminus. In some embodiments, the modified RNA comprises a m5C modification at each of positions +1, +3, and +5 with reference to the 5’ terminus. In some embodiments, the modified RNA comprises: (a) an N6-m ethyl -locked nucleic acid (LNA)adenine (LNA-m6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or (b) an N6-benzyL locked nucleic acid (LNA)adenine (LNA-Bn6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or (c) an N6,2'-O-dimethyladenosine (m6Am) modification at64931-5478-7195.1Atty. Docket No. 114203-1901positions +1, +3, and +5 with reference to the 5’ terminus; or (d) a 2'-O-methyladenosine (20Me-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or (e) a locked nucleic acid (LNA)adenosine (LNA-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the modified RNA comprises: (a) a m7G 5’ cap and an LNA modification at position +1 with reference to the 5’ terminus; (b) a m7G 5’ cap and an LNAm5C modification at position +1 with reference to the 5’ terminus; (c) a m7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and a 20Me modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus; (d) an LNAm7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and a 20Me modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus; (e) a m7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or (f) a LNAm7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

[0007] In one aspect, the present disclosure provides a method of expressing a modified RNA in a leukocytic cell (e.g., a monocyte or a JAWSII cell), comprising contacting the leukocytic cell with a modified RNA comprising (i) one or more modified nucleotides at one or more of positions +1, +2, +3, +4, +5, or +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap. In some embodiments, the modified RNA comprises a modified nucleotide at position +1 with reference to the 5’ terminus. In some embodiments, the one or more modified nucleotide is selected from the group consisting of 2'-O-methyladenosine (20Me-A), locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-dimethyladenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5-methyl-locked nucleic acid (LNA)cytosine, P-d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-O-methyl-P-O-methyladenosine, N6, N6-dimethyladenine (m62A), N1 -methylinosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine, 2 '-methoxy ethoxy-adenosine (2M0E), and 5-methylcytosine (m5C). In some embodiments, the modified RNA comprises a m5C modification at each of positions +1, +3, and +5 with reference to the 5’ terminus. In some embodiments, the modified74931-5478-7195.1Atty. Docket No. 114203-1901RNA comprises: (a) an N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or (b) an N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or (c) an N6,2'-O-dimethyladenosine (m6Am) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or (d) an N6-benzyl-2'-O-methyladenosine (Bn6Am) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or (e) a 2'-methoxyethoxy-adenosine (2M0E) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or (f) a 2 '-methoxy ethoxy-adenosine (2M0E) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or (g) a 2'-O-methyladenosine (20Me-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or (h) a locked nucleic acid (LNA)adenosine (LNA-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the modified RNA comprises: (a) a m7G 5’ cap and a 2M0E modification at position +1 with reference to the 5’ terminus; (b) a m7G 5’ cap and a 2M0E modification at each of positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; (c) an LNAm7G 5’ cap and a 2M0E modification at each of positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; (d) a m7G 5’ cap, a 2M0E modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or (e) an LNAm7G 5’ cap, a 2M0E modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

[0008] In one aspect, the present disclosure provides a method of expressing a modified RNA in a skin cell (e.g., a melanocyte or D4M-3A cell), comprising contacting the skin cell with a modified RNA comprising (i) one or more modified nucleotides at one or more of positions +1, +2, +3, +4, +5, or +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap. In some embodiments, the modified RNA comprises a modified nucleotide at position +1 with reference to the 5’ terminus. In some embodiments, the one or more modified nucleotide is selected from the group consisting of 2'-O-methyladenosine (20Me-A)„ locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-dimethyladenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5-methyl-locked nucleic acid (LNA)cytosine, P-d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-84931-5478-7195.1Atty. Docket No. 114203-1901O-methyl-P-O-methyladenosine, N6, N6-dimethyladenine (m62A), Nl-methyl-inosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine, 2'-methoxyethoxy-adenosine (2M0E), and 5-methylcytosine (m5C). In some embodiments, the modified RNA comprises: (a) an N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or (b) an N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or (c) a 2'-O-methyladenosine (20Me-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or (d) a locked nucleic acid (LNA)adenosine (LNA-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

[0009] In one aspect, the present disclosure provides a method of expressing a modified RNA in a human induced pluripotent stem cell (hiPSc), comprising contacting the hiPSc with a modified RNA comprising (i) one or more modified nucleotides at one or more of positions +1, +2, +3, +4, +5, or +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap. In some embodiments, the modified RNA comprises a modified nucleotide at position +1 with reference to the 5’ terminus. In some embodiments, the one or more modified nucleotide is selected from the group consisting of 2'-O-methyladenosine (2OMe-A), locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-dimethyladenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5 -methyl -locked nucleic acid (LNA)cytosine, P-d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-O-methyl-P-O-methyladenosine, N6, N6-dimethyladenine (m62A), Nl-methyl-inosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine, 2'-methoxyethoxy-adenosine (2M0E), and 5-methylcytosine (m5C). In some embodiments, the modified RNA comprises: (a) a m7G 5’ cap and a LNA modification at position +1 with reference to the 5’ terminus; (b) a LNAm7G 5’ cap and a LNA modification at position +1 with reference to the 5’ terminus; (c) a m7G 5’ cap and a m5C modification at position +1 with reference to the 5’ terminus; or (d) a LNAm7G 5’ cap and a m5C modification at position +1 with reference to the 5’ terminus.

[0010] In some embodiments, the modified mRNA further comprises a microRNA (miRNA) element. In some embodiments, the miRNA element is a miRNA-off element and is located 5’ of94931-5478-7195.1Atty. Docket No. 114203-1901the polyA tail. In some embodiments, the miRNA element is a miRNA-on element and is located 3’ of the polyA tail. In some embodiments, the modified mRNA comprises a miRNA-off element and a miRNA-on element. In some embodiments, the modified mRNA further comprises an RNA degron signal.

[0011] In one aspect, the present disclosure provides a method for inducing differentiation of a human induced pluripotent stem cell (hiPSc) into a neuron, comprising contacting the hiPSc with a modified mRNA encoding Atohl or Ngn2, wherein the modified mRNA comprises a LNAm7G 5’ cap, a LNA modification at position +1 from the 5’ terminus, and a PS_2MOE modification at each of the 6 nucleotide positions closest to the 3’ terminus of the RNA followed by a terminal 2', 3 '-dideoxy cytidine (ddC). In some embodiments, the modified mRNA comprises a nucleotide sequence selected from SEQ ID NO: 5 and SEQ ID NO: 6.

[0012] In one aspect, the present disclosure provides a method for treating melanoma in a subject, comprising administering to the subject a modified mRNA encoding IL-23, IL-36y, or OX40L, wherein the modified mRNA comprises a m7G 5’ cap, a LNA modification at positions +1, +2, +3, +4, +5, and +6 from the 5’ terminus, and a PS_2MOE modification at each of the 6 nucleotide positions closest to the 3’ terminus of the RNA followed by a terminal 2', 3 '-di deoxycytidine (ddC). In some embodiments, the modified mRNA comprises at least two 5’ caps. In some embodiments, the modified mRNA comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9.

[0013] In one aspect, the present disclosure provides a vector comprising the RNA of any one of the foregoing embodiments.

[0014] In one aspect, the present disclosure provides a delivery agent comprising the RNA of any of the foregoing embodiments, wherein the delivery agent comprises a lipid, a peptide, a protein, an antibody, a carbohydrate, a nanoparticle, or a microparticle. In some embodiments, the nanoparticle or microparticle is a lipid nanoparticle or a lipid microparticle, a polymer nanoparticle or a polymer microparticle, a protein nanoparticle or a protein microparticle, or a solid nanoparticle or a solid microparticle.

[0015] In one aspect, the present disclosure provides a cell comprising the RNA of any of the foregoing embodiments, or the vector of any of the foregoing embodiments. In some embodiments, the cell is a mammalian cell.104931-5478-7195.1Atty. Docket No. 114203-1901

[0016] In one aspect, the present disclosure provides a composition comprising the RNA of any of the foregoing embodiments, the vector of any of the foregoing embodiments, the delivery agent of any of the foregoing embodiments, or the cell of any of the foregoing embodiments. In some embodiments, the composition further comprises an additional agent. In some embodiments, the additional agent is an agent which has a therapeutic effect when administered to a subject. In some embodiments, the additional agent is a nucleotide, a nucleic acid, an amino acid, a peptide, a protein, a small molecule, an aptamer, a lipid, or a carbohydrate. In some embodiments, the nucleotide is a shRNA, a siRNA, a miRNA, or an antisense oligonucleotide (ASO). In some embodiments, the additional agent is an antigen or adjuvant. In some embodiments, the composition is a pharmaceutical composition comprising a pharmaceutically acceptable excipient.

[0017] In one aspect, the present disclosure provides a kit comprising the composition of any of the foregoing embodiments, a device for administering the composition to a subject, and / or instructions for administering the composition to the subject.

[0018] The foregoing general description and following detailed description are examples and are intended to provide further explanation of the disclosure as claimed. Other objects, advantages, and novel features will be readily apparent to those skilled in the art from the following brief description of the drawings and detailed description of the disclosure.

[0019] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below are provided as being part of the inventive subject matter disclosed herein and may be employed in any combination to achieve the benefits described herein.BRIEF DESCRIPTION OF THE DRAWINGS

[0020] FIGS. 1A-1I show schematics and experimental data related to the construction of a modified mRNA library and activity screening in various cell types. FIG. 1A is a schematic showing how LEGO enables the construction of mRNA libraries with a series of 5' modifications including base modifications, backbone modifications and multi-bases modification. FIG. 1B is a panel of chemical structures of the modifications included in the modified mRNA library. FIG.1C is a heatmap of dual-luciferase assay screening chemically modified mRNAs in seven cell types. Protein expression of FLuc luminescence reporter was normalized to RLuc luminescence114931-5478-7195.1Atty. Docket No. 114203-1901(transfection control) and compared to the regular cap (1) construct (red line) at 24 hours after transfection (n = 3 biological replicates; mean± s.e.m.). FIG. 1D is a heatmap showing the results of activity screening for multiple-base modifications in different cell lines. FIG. 1E is a scatter plot showing the average translation efficiency and relative specificity among different cell types. FIG. 1F is a bar plot showing the results of a dual-luciferase assay at 24 hours post transfection with combinatory 5' chemical modifications in HepG2 cells. FIG. 1G is a bar plot showing the results of a dual-luciferase assay at 24 hours post transfection with combinatory 5' chemical modifications in JAWSII cells. FIG. 1H is a bar plot showing the results of a dualluciferase assay at 24 hours post transfection with combinatory 5' chemical modifications in hiPScs. FIG. 1I is a bar plot showing the results of a dual-luciferase assay at 24 hours post transfection with combinatory 5' chemical modifications in D4M 3A cells. P values were calculated by a two-sided unpaired t-test using 24-h expression data compared to the m7G-rA (construct 1).

[0021] FIGS. 2A-2H show conceptualization and assessment of the effect of optimized combinations of mRNA 5' chemical modifications on mRNA expression in various cell lines. FIG. 2A is a schematic illustrating a workflow for validation of the cell type specificity in hepatocyte and monocyte-derived cell lines. FIG.2B is a graph depicting the results of a dualluciferase assay screen for chemically modified mRNAs in the JAWSII cell line at 24 hours post transfection. FIG. 2C is a graph depicting the results of a dual-luciferase assay screen for chemically modified mRNAs in the HepG2 cell line at 24 hours post transfection. The relative luminescence intensity was normalized to the control construct (m7G+rA, 1). (n = 3 biological replicates; mean ± s.e.m.) FIG.2D is a schematic and plots depicting a workflow for in vivo validation of the cell type specificity. FIG. 2E is a graph depicting the relative fold change of mNeon positive cells in various tissue types of mice administered the modified or unmodified mRNA. FIG. 2F is a graph depicting the relative fold change of mNeon / tdTomato MFI in various tissue types of mice administered the modified or unmodified mRNA. FIG. 2G is a schematic depicting the combination of cell-type-specific 5’ modifications with miRNA elements to further improve specificity. Hepatocytes overexpress miR-122, while immune cells overexpress miR-142. miRNA-off elements are placed within 3' UTR and endogenous miRNA can trigger the cleavage then turn off mRNA expression in specific cell types. Meanwhile, miRNA-on elements are placed after polyA, followed by an RNA degron signal. Binding and124931-5478-7195.1Atty. Docket No. 114203-1901cleavage by corresponding endogenous miRNA in specific cell types trigger the release of functional mRNA to achieve turn-on specificity. FIG.2H is a panel of graphs showing the results of dual-luciferase assays for screening chemically modified mRNAs in Huh7 cell line and JAWSII cell line at 24 hours post transfection. Specificity was calculated based on the ratio of luminescence signal in either Huh7 or JAWSII. (n = 3 biological replicates; mean± s.e.m.).

[0022] FIGS. 3A-3L show schematics and experimental data illustrating that differential binding to cap-binding proteins contributes to cell-type-specific mRNA expression. FIG. 3A is a schematic for SILAC proteomics pulldown MS analysis using JAWSII cell lysate. Biotin labeled unmodified or modified oligonucleotides were bound to streptavidin beads respectively, followed by pulling down with light or heavy cell lysate. The interactome was profiled with MS / MS. Four independent pull downs were performed for each construct. (n=4). FIG. 3B is a heatmap showing the difference in interactome for LNAm5C modified oligonucleotides or 2MOE*6 modified oligonucleotides. FIG.3C is a graph showing the effects of certain 5’ modifications on oligonucleotide affinity for cap binding protein eIF4El by EMSA. FIG.3D is a graph showing the effects of certain 5’ modifications on oligonucleotide affinity for cap binding protein eIF4E2 by EMSA. FIG. 3E is a graph showing the effects of certain 5’ modifications on oligonucleotide affinity for cap binding protein eIF4E3 by EMSA. FIG. 3F is a graph showing the effects of certain 5’ modifications on oligonucleotide affinity for cap binding protein IFIT1 by EMSA. FIG. 3G is a heatmap of relative binding affinity for different modifications. The Kd of each modification was normalized to m7G+UnmodA and 1 / Kd was plotted as relative binding affinity. FIG. 3H is a heatmap showing the gene expression profile of selected proteins of seven cell lines. Expression level was shown by log(TPM+l). FIG. 3I is a plot showing the predicted relative translation activity and correlation results of the LASSO regression model Activity=LASSO[ii(expressiongenei)] of LNAm5C (R2=0.92). FIG.3J is a plot showing the predicted relative translation activity and correlation results of the LASSO regression model Activity=LASSO[ii(expressiongenei)] of 2MOE*6 (R2=0.73. The color bar showed the weight of each gene in the regression model. The relative translation activity was defined by Activity=(RLUmodifi cation). FIG.3K is a graph showing the results of a dual-luciferase assay evaluating the effects of elFs overexpression for LNAm5C modified mRNA in the HepG2 cell line and the JAWSII cell line, (n = 3 biological replicates; mean ± s.e.m.). FIG. 3L is a graph showing the results of a dual -luciferase assay evaluating the effects of elFs overexpression for134931-5478-7195.1Atty. Docket No. 114203-19012MOE*6 modified mRNA in the HepG2 cell line and the JAWSII cell line, (n = 3 biological replicates; mean± s.e.m.)

[0023] FIGS. 4A-4E show schematics and experimental data illustrating the application of celltype-specific modification design for efficient mRNA-based iPSc differentiation. FIG. 4A shows a schematic illustrating a workflow for application of optimized mRNA constructs for dopaminergic neuron differentiation. FIG. 4B is a schematic illustrating an experimental time course in which mRNAs encoding Atohl and Ngn2 were transfected to iPS cells respectively at indicated time points with different mRNA dosages or transfection frequency as shown. The expression of cell type marker gene was evaluated using qPCR assay at day 7, followed by immunostaining at day 35. FIG. 4C is a graph depicting the relative NeuroDl expression level at day 7 quantified by qPCR. NeuroDl expression was normalized to GAPDH. (n = 3 biological replicates; mean± s.e.m.) FIG. 4D is a panel of images showing a characterization of iPS cell-derived dopaminergic neurons by immunostaining after in vitro maturation for 35 days. DA neuron markers (TH and dopamine transporter (DAT)), neuronal exon marker (Tuj 1) and nuclei (DAPI) were stained (scale bar: 20 pm). FIG. 4E is a graph depicting the quantification of DA neurons using the DAPI signal. 10-12 random fields-of-view were used for neuron counting. (n= 10; mean± s.e.m.).

[0024] FIGS. 5A-5F show schematics and experimental data illustrating the application of celltype-specific modification design for cancer immunotherapy. FIG. 5A is a schematic and graph showing that multidimensional optimization dramatically enhanced mRNA translation capacity in the D4M 3A melanoma cell line, (n = 3 biological replicates; mean ± s.e.m.). FIG. 5B is an image of a western blot showing that optimized constructs enhanced protein expression of an mRNA cocktail. FIG. 5C is a schematic showing an experimental workflow in which three dosages of mRNA cocktail-LNP complex were intratum orally injected into a mouse model bearing the D4M 3A melanoma cell line. Tumor growth was monitored at indicated time points. A rechallenging assay was performed for survivors after 90 days. FIG. 5D is a panel of graphs showing tumor volumes of individual animals following mRNA cocktail treatment, (n = 10 biological replicates). FIG. 5E is a graph depicting survival curves of D4M 3A tumor-bearing mice following mRNA cocktail treatment. FIG. 5F is a graph depicting survival curves for a rechallenging assay. 4 survivors from FIG. 5E and 4 wild-type mice were challenged with D4M-3A, followed by tumor growth measurement, (n = 4 biological replicates).144931-5478-7195.1Atty. Docket No. 114203-1901DETAILED DESCRIPTION

[0025] Provided herein are modified RNAs comprising modified 5’ regions comprising one or more modified nucleotides in order to enable cell-type-specific expression of the modified RNA in cells and thereby enhance the cell-type-specific production of encoded gene products, such as proteins. Also provided are methods of using the modified RNAs described herein by contacting cells of specific subtypes with the

[0026] In some embodiments, an RNA comprising a modified 5’ region comprises a 5’ cap and one or more modifications at one or more of positions +1, +2, +3, +4, +5, or +6 with reference to the 5’ terminus of the RNA. In some embodiments, the region comprising one or more modifications comprises one or more modified nucleobases, phosphodiester linkages, sugar backbones, and / or 5’ caps.Equivalents

[0027] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure. All references, patents and patent applications 154931-5478-7195.1Atty. Docket No. 114203-1901disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.

[0028] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

[0029] In the claims, as well as in the specification, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of’ and “consisting essentially of’ shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., “comprising”) are also contemplated, in alternative embodiments, as “consisting of’ and “consisting essentially of’ the feature described by the open-ended transitional phrase. For example, if the disclosure describes “a composition comprising A and B,” the disclosure also contemplates the alternative embodiments “a composition consisting of A and B” and “a composition consisting essentially of A and B.”

[0030] In the claims, as well as in the specification, recitation of the phrase “between X and Y”, wherein X and Y are two separate values, it should be appreciated that these ranges include the use of these end values. For example, if a claim recites a range of between 1 and 10, this includes the values of 1, 10, and any value in between (e g., 2, 3, 4, 5, 6, 7, 8, 9, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, etc.).

[0031] A “messenger RNA” (“mRNA”) as used herein refers to a nucleic acid comprising an open reading frame (ORF) encoding a gene product, such as a protein. An mRNA may comprise a poly-A region that is 3’ to the ORF. An mRNA may also comprise a 5’ untranslated region (5’ UTR) that is 5’ to (upstream of) the ORF, and a 3’ untranslated region (3’ UTR) that is 3’ to (downstream of) the ORF. A mRNA may also comprise a 5’ cap at the 5’ end of the mRNA.

[0032] An “open reading frame” (“ORF”), such as an ORF encoding a protein, as used herein refers to a nucleic acid sequence comprising a coding sequence that leads to the production of the protein when the ORF is translated. The nucleic acid sequence may be an RNA sequence, in which case translation of the RNA sequence produces a polypeptide with the amino acid164931-5478-7195.1Atty. Docket No. 114203-1901sequence of the protein. The nucleic acid sequence may be a DNA sequence, in which case the protein is produced when an RNA polymerase uses the DNA sequence to transcribe an RNA molecule comprising an RNA sequence that is complementary to the DNA sequence, and translation of the RNA sequence produces a polypeptide with the amino acid sequence of the protein. An ORF typically begins with a START codon, such as AUG in the RNA sequence (ATG in the DNA sequence), and ends with a STOP codon, such as UAG, UAA, or UGA in the RNA sequence (TAG, TAA, or TGA in the DNA sequence), with the number of bases between the G of the start codon and the T or U of the STOP codon being a multiple of 3 (e.g., 3, 6, 9, 12, etc.).

[0033] With reference to numbering of the nucleotide positions within a nucleic acid molecule, a position of +1 refers to the first nucleotide of the nucleic acid molecule (e.g., of the RNA molecule), +2 is the second nucleotide, +3 is the third nucleotide, and so on.

[0034] In some embodiments of the modified mRNAs provided herein, the mRNA comprises a 5' untranslated region (5' UTR) and a 3' untranslated region (3' UTR). 5' and 3' UTRs are sequences within an mRNA that do not encode amino acids of the protein encoded by the mRNA, and are thus not part of the open reading frame. The 5' UTR is 5' to (upstream of) the open reading frame. The 3' UTR is 3' to (downstream of) the open reading frame. In some embodiments, the 3' UTR comprises one or more nucleotides that are 3' to the open reading frame and 5' to (upstream of) the poly-A region of the mRNA.

[0035] In some embodiments of the modified mRNAs provided herein, the mRNA comprises, in 5’-to-3’ order: 1) a 5’ cap, optionally modified; 2) a modified 5’ UTR; 3) an open reading frame (ORF); 4) a 3’ UTR; and 5) a poly-A region. In some embodiments, the first nucleotide of the 5’ UTR is 3’ to (downstream of) the 5’ cap, and the last nucleotide of the 5’ UTR is 5’ to (upstream of) the first nucleotide of the ORF. In some embodiments, the first nucleotide of the ORF is 3’ to (downstream of) the last nucleotide of the 5’ UTR, and the last nucleotide of the ORF is 5’ to (upstream of) the first nucleotide of the 3’ UTR. In some embodiments, the ORF is between the last nucleotide of the 5’ UTR and the first nucleotide of the 3’ UTR. In some embodiments, the first nucleotide of the 3’ UTR is 3’ to (downstream of) the last nucleotide of the ORF, and the last nucleotide of the 3’ UTR is 5’ to (upstream of) the first nucleotide of the poly-A region. In some embodiments, the 5’ UTR is between the 5’ cap and the first nucleotide of the ORF. In some embodiments, the 3’ UTR is between the ORF and the poly-A region. In some174931-5478-7195.1Atty. Docket No. 114203-1901embodiments, the 5’ cap is 5’ to (upstream of) the first nucleotide of the 5’ UTR. In some embodiments, the first nucleotide of the poly-A region is 3’ to (downstream of) the last nucleotide of the 3’ UTR.

[0036] In some embodiments, the RNA is a linear RNA. A linear RNA is an RNA with a 5' terminal nucleotide and a 3' terminal nucleotide. The 5' terminal nucleotide of a linear RNA is covalently bonded to only one adjacent nucleotide of the RNA, with the adjacent nucleotide occurring 3' to the 5' terminal nucleotide in the nucleic acid sequence of the RNA. The 3' terminal nucleotide of a linear RNA is covalently bonded to only one adjacent nucleotide of the RNA, with the adjacent nucleotide occurring 5' to the 3' terminal nucleotide in the nucleic acid sequence of the RNA. In a nucleic acid sequence comprising every nucleotide of a linear RNA in 5'-to-3' order, the 5' terminal nucleotide is the first nucleotide in the sequence, and the 3' terminal nucleotide is the last nucleotide in the sequence.

[0037] In some embodiments, the mRNA is a circular mRNA. A circular mRNA is an mRNA with no 5' terminal nucleotide or 3' terminal nucleotide. Every nucleotide in a circular mRNA is covalently bonded to both 1) a 5' adjacent nucleotide; and 2) a 3' adjacent nucleotide. In a circular mRNA with a nucleic acid sequence comprising every nucleotide of the circular mRNA in 5 '-to-3 ' order, the last nucleotide of the nucleic acid sequence is covalently bonded to the first nucleotide of the nucleic acid sequence. In some embodiments of circular mRNAs with a 5' cap region, a 5' UTR, a 3' UTR, and a poly-A region, the poly-A region is 3' to (downstream from) the 3' UTR and 5' to (upstream of) the 5' cap region.

[0038] An RNA molecule that can be translated is referred to as a messenger RNA, or mRNA. A DNA or RNA sequence encodes a gene through codons. A codon refers to a group of three nucleotides within a nucleic acid, such as DNA or RNA, sequence. An anticodon refers to a group of three nucleotides within a nucleic acid, such as a transfer RNA (tRNA), that are complementary to a codon, such that the codon of a first nucleic acid associates with the anticodon of a second nucleic acid through hydrogen bonding between the bases of the codon and anticodon. For example, the codon 5'-AUG-3' on an mRNA has the corresponding anticodon 3'-UAC-5' on a tRNA. During translation, a tRNA with an anticodon complementary to the codon to be translated associates with the codon on the mRNA, generally to deliver an amino acid that corresponds to the codon to be translated, or to facilitate termination of translation and release of a translated polypeptide from a ribosome.184931-5478-7195.1Atty. Docket No. 114203-1901

[0039] Translation is the process in which the RNA coding sequence is used to direct the production of a polypeptide. The first step in translation is initiation, in which a ribosome associates with an mRNA, and a first transfer RNA (tRNA) carrying a first amino acid associates with the first codon, or START codon. The next phase of translation, elongation, involves three steps. First, a second tRNA with an anticodon that is complementary to codon following the START codon, or second codon, and carrying a second amino acid, associates with the mRNA. Second, the carbon atom of terminal, non-side chain carboxylic acid moiety of the first amino acid reacts with the nitrogen of the terminal, non-side chain amino moiety of the second amino acid carried, forming a peptide bond between the two amino acids, with the second amino acid being bound to the second tRNA, and the first amino acid bound to the second amino acid, but not the first tRNA. Third, the first tRNA dissociates from the mRNA, and the ribosome advances along the mRNA, such that the position at which the first tRNA associated with the ribosome is now occupied by the second tRNA, and the position previously occupied by the second tRNA is now free for an additional tRNA carrying an additional amino acid to associate with the mRNA. These three steps of 1) association of a tRNA carrying amino acid, 2) formation of a peptide bond, which adds an additional amino acid to a growing polypeptide, and 3) advancement of the ribosome along the mRNA, continue until the ribosome reaches a STOP codon, which results in termination of translation. Generally, tRNAs that associate with STOP codons do not carry an amino acid, so the association of a tRNA that does not carry an amino acid during the elongation step results in cleavage of the bond between the polypeptide and the tRNA carrying the final amino acid in the polypeptide, such that the polypeptide is released from the ribosome.Alternatively, ribosomes may dissociate from the mRNA and release the polypeptide if no tRNA associates with the STOP codon.

[0040] A “nucleic acid,” or “polynucleotide,” as used herein, refers to an organic molecule comprising two or more covalently bonded nucleotides. A “nucleotide,” as used herein, refers to an organic molecule comprising a 1) a nucleoside comprising a sugar covalently bonded to a nitrogenous base (nucleobase); and 2) a phosphate group that is covalently bonded to the sugar of the nucleoside. Nucleotides in a polynucleotide are typically joined by a phosphodi ester bond, in which the 3' carbon of the sugar of a first nucleotide is linked to the 5' carbon of the sugar of a second nucleic acid by a bridging phosphate group. Typically, the bridging phosphate comprises two non-bridging oxygen atoms, which are bonded only to a phosphorus atom of the phosphate,194931-5478-7195.1Atty. Docket No. 114203-1901and two bridging oxygen atoms, each of which connects the phosphorus atom to either the 3' carbon of the first nucleotide or the 5' carbon of the second nucleotide. In a nucleic acid sequence describing the order of nucleotides in a nucleic acid, a first nucleotide is said to be 5' to (upstream of) a second nucleotide if the 3' carbon of first nucleotide is connected to the 5' carbon of the second nucleotide. Similarly, a second nucleotide is said to be 3' to (downstream of) a first nucleotide if the 5' carbon of the second nucleotide is connected to the 3' carbon of the first nucleotide. Nucleic acid sequences are typically read in 5 '->3' order, starting with the 5' nucleotide and ending with the 3' nucleotide.

[0041] A “modified nucleotide,” as used herein, refers to a nucleotide with a structure that is not the canonical structure of an adenosine nucleotide, cytidine nucleotide, guanine nucleotide, or uracil nucleotide. A canonical structure of a molecule refers to a structure that is generally known in the art to be the structure referred to by the name of the molecule. A canonical structure of an adenosine nucleotide, which comprises an adenine base, ribose sugar, and one or more phosphate groups, is shown below, in the form of adenosine monophosphate:The canonical structure of AMP also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, and structures in which an oxygen atom of the phosphate and / or the 3' oxygen atom of the sugar are bound to an adjacent nucleotide in a nucleic acid sequence.

[0042] The canonical structure of a cytosine nucleotide which comprises a cytosine base, ribose sugar, and one or more phosphate groups, is shown below, in the form of cytidine monophosphate:0[i LHO-P-O— |OH KHOHOH (CMP). The canonical structure of CMP also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar204931-5478-7195.1Atty. Docket No. 114203-1901are deprotonated, and structures in which an oxygen atom of the phosphate and / or the 3' oxygen atom of the sugar are bound to an adjacent nucleotide in a nucleic acid sequence.

[0043] The canonical structure of a guanine nucleotide which comprises a guanine base, ribose sugar, and one or more phosphate groups, is shown below, in the form of guanosinemonophosphate:(GMP). The canonical structure of GMP also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, and structures in which an oxygen atom of the phosphate and / or the 3' oxygen atom of the sugar are bound to an adjacent nucleotide in a nucleic acid sequence.

[0044] The canonical structure of a uracil nucleotide which comprises a uracil base, ribose sugar, and one or more phosphate groups, is shown below, in the form of uridine monophosphate:OH OH (UMP). The canonical structure of UMP also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, and structures in which an oxygen atom of the phosphate and / or the 3' oxygen atom of the sugar are bound to an adjacent nucleotide in a nucleic acid sequence.

[0045] The structure of a modified nucleotide may differ from the structure of a canonical nucleotide due to one or more modifications in the sugar, nitrogenous base, or phosphate of the nucleotide. In some embodiments, the modified nucleotide comprises a modified nucleoside that is not the canonical structure of an adenine nucleoside, cytosine nucleoside, guanine nucleoside, or uracil nucleoside.

[0046] An example of a canonical structure of adenosine, an adenine nucleoside, is reproduced below:214931-5478-7195.1Atty. Docket No. 114203-1901NOH 61- (adenosine). The canonical structure of adenosine also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, structures in which the 5' carbon is bound to a 5' phosphate in a nucleic acid sequence, and structures in which a 3' oxygen atom is bound to a 5' phosphate group of an adjacent nucleotide in a nucleic acid sequence.

[0047] An example of a canonical structure of cytidine, a cytosine nucleoside, is reproduced below:OH OH (cytidine). The canonical structure of cytidine also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, structures in which the 5' carbon is bound to a 5' phosphate in a nucleic acid sequence, and structures in which a 3' oxygen atom is bound to a 5' phosphate group of an adjacent nucleotide in a nucleic acid sequence.

[0048] An example of a canonical structure of guanosine, a guanine nucleoside, is reproduced below:NHOH OH (guanosine). The canonical structure of guanosine also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, structures in which the 5' carbon is bound to a 5' phosphate in a nucleic acid sequence, and structures in which a 3' oxygen atom is bound to a 5' phosphate group of an adjacent nucleotide in a nucleic acid sequence.

[0049] An example of a canonical structure of uridine, a uracil nucleoside, is reproduced below:224931-5478-7195.1Atty. Docket No. 114203-1901O’ A NHHO." NOH OH (uridine). The canonical structure of uridine also refers to structures in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, structures in which the 5' carbon is bound to a 5' phosphate in a nucleic acid sequence, and structures in which a 3' oxygen atom is bound to a 5' phosphate group of an adjacent nucleotide in a nucleic acid sequence.

[0050] A “ligase,” as used herein, refers to an enzyme that is capable of forming a covalent bond between two nucleotides, and the process of “ligation” refers to the formation of the covalent bond between the two nucleotides.

[0051] A “poly-A tail,” as used herein, refers to a nucleic acid sequence comprising adenosine nucleotides that is attached to the 3' end of a nucleic acid, such as an RNA. A poly-A tail or poly-A region may consist of nucleotides that are 25-100%, 30-100%, 40-100%, 50-100%, 60-100%, 70-100%, 80-100%, 90-100%, 95-100%, 96-100%, 97-100%, 98-100%, or 99-100% adenosine nucleotides. As used herein, the terms “poly-A tail” and “poly-A region” are used interchangeably. The adenosine nucleotides comprised by a poly-A tail may be canonical adenosine nucleotides or modified (non-canonical) adenosine nucleotides.

[0052] A “5' cap,” as used herein, refers to one or more nucleotides that are covalently attached to the 5' end of a nucleic acid, such as an RNA molecule. A “5' cap region,” as used herein, refers to a nucleic acid comprising a 5' nucleotide cap and one or more modified nucleotides. A 5' cap may comprise a 5' capping nucleotide that is attached to the 5' end of a mRNA by a 5' to 5' triphosphate intemucleotide linkage. In some embodiments, a nucleotide attached to a mRNA by a 5' to 5' triphosphate intemucleotide linkage is referred to as a “native” 5' capping nucleotide. In some embodiments, a native 5' capping nucleotide is a 7-methylguanosine (m7G) nucleotide. In some embodiments, a 5' cap is a modified 5' cap, comprising one or more modified nucleotides, such as the 5' capping nucleotide, or one or more modified intemucleotide modifications, such as modifications to the 5' to 5' triphosphate intemucleotide linkage. In some embodiments, a 5' cap comprises one or more nucleotides with a sugar modification, such as 2'-O-methylation.234931-5478-7195.1Atty. Docket No. 114203-1901

[0053] An example of a canonical structure of 7-methylguanosine (m7G) attached to a ribonucleic acid sequence (e.g., a mRNA) by a 5' to 5' triphosphate internucleotide linkage is reproduced below:

[0054] A “counterion” or “anionic counterion” is a negatively charged group associated with a positively charged group in order to maintain electronic neutrality. In some embodiments, an anionic counterion is monovalent (e.g., including one formal negative charge). An anionic counterion may also be multivalent (e.g., including more than one formal negative charge), such as divalent or trivalent. Exemplary counterions include halide ions (e.g., F, Cl", Br, I"), NCh", CIO4, OH, H2PO4, HCO3, HSO4, sulfonate ions (e.g., methanesulfonate, trifluoromethanesulfonate, p-toluenesulfonate, benzenesulfonate, 10-camphor sulfonate, naphthalene-2-sulfonate, naphthalene-l-sulfonic acid-5-sulfonate, ethane-l-sulfonic acid-2-sulfonate, and the like), carboxylate ions (e.g., acetate, propanoate, benzoate, glycerate, lactate, tartrate, glycolate, gluconate, and the like), BF4, PF 4, PFe", AsFe, SbFe, B[3,5-(CF3)2CeH3]4]A B(C6FS)4-, BP114-, A1(OC(CF3)3)4", and carborane anions (e.g., CBi il I12 or (HCBnMesBre) ). Exemplary counterions which may be multivalent include CO32, HPO42, PO43, B4O72, SO42, S2O32-, carboxylate anions (e.g., tartrate, citrate, fumarate, maleate, malate, malonate, gluconate, succinate, glutarate, adipate, pimelate, suberate, azelate, sebacate, salicylate, phthalates, aspartate, glutamate, and the like), and carboranes.

[0055] Use of the phrase “at least one instance” refers to 1, 2, 3, 4, or more instances, but also encompasses a range, e.g., for example, from 1 to 4, from 1 to 3, from 1 to 2, from 2 to 4, from 2 to 3, or from 3 to 4 instances, inclusive.Modified RNAs

[0056] In some aspects, the present disclosure provides modified RNAs comprising a 5’ cap region, wherein the 5’ cap region comprises a 5’ nucleotide cap and one or more modified244931-5478-7195.1Atty. Docket No. 114203-1901nucleotides. In some embodiments a modified RNA is a modified mRNA. In some embodiments, a modified mRNA is a modified linear mRNA. In some embodiments, a modified mRNA is a modified circular mRNA.

[0057] The “5' cap region”, as used herein, refers to a region of an mRNA that is 5' to (upstream of) the ORF. In some embodiments, the 5’ cap region comprises a 5’ untranslated region (5’ UTR). In some embodiments, the 5’ cap region comprises a 5’ cap. In eukaryotic cells, mRNAs possess a cap structure in which an N7-methylguanine (m7G) moiety is linked to the first transcribed nucleotide by a 5’-5’-triphosphate bridge. The 5' cap plays multiple roles in pre-mRNA splicing, mRNA export, RNA stability through blocking degradation by the 5 ’-3’ exoribonuclease (ExoN), escaping recognition of the cellular innate immune system, and the production of proteins encoded by mRNAs. The presence of a 5' cap in an mRNA facilitates the initiation of translation (see, e.g., Gallie. Genes & Dev. 1991. 5:2108-2116, and Munroe et al. Mol Cell Biol. 1990. 10(7):3441-3455). The 5' cap is added by a 5' capping enzyme, such as mRNA guanylyltransferase. Translation initiation is a rate-limiting step of mRNA translation and heavily depends on the 5’ N7-methylguanosine (m7G) cap and its interaction with eukaryotic translation initiation factors (elFs), including the cap-binding eIF4E protein. Chemical modification on or near the 5’ cap influence binding of elFs and decapping enzymes, which subsequently impact downstream mRNA translation and stability. For example, the presence of 2’ O-methyl (2’0Me) groups on the first and second transcribed nucleotides (known as Cap-0 / 1 / 2, referring to zero, one, or two 2’OMe groups) reduces mRNA immunogenicity and increases protein expression. Additionally, N6-methyladenosine (m6A) on the first base controls mRNA stability through increased resistance to decapping by Dcp2. Furthermore, the 5' cap stabilizes the mRNA by protecting the ORF from the activity of exonucleases, such as polynucleotide phosphorylase (PNPase), which can remove 3' and 5' nucleotides from an mRNA. As an exonuclease removes nucleotides, the mRNA becomes progressively shorter, and once all the nucleotides downstream of the open reading frame are removed, the nucleotides removed by the exonuclease will be nucleotides of the ORF. Removal of nucleotides from the ORF prevents translation of the encoded protein. Additionally, the association of an exonuclease with the mRNA near the ORF can inhibit translation by sterically hindering ribosomes and tRNAs from associating with the mRNA. The composition of a 5' cap typically comprises a 5' m7G attached to the mRNA by a 5' to 5 ' triphosphate intemucleotide linkage.254931-5478-7195.1Atty. Docket No. 114203-1901

[0058] In some embodiments of the modified RNAs provided herein, the modified RNA comprises one or more modified nucleotides in the 5' cap region of the mRNA. In some embodiments, the 5' cap region includes one or more nucleotides that are not canonical adenosine, cytidine, guanosine, or uridine nucleotides. In some embodiments, the 5' cap region comprises between 1 and 3, between 3 and 5, between 5 and 7, or between 7 and 105' caps. In some embodiments, the 5' cap region comprises between 10-500 nucleotides. In some embodiments, the 5' cap region comprises between 10 and 15, between 15 and 20, between 20 and 25, between 25 and 50, between 50 and 100, between 100 and 150, between 150 and 200, between 200 and 300, between 300 and 400, or between 400 and 500 nucleotides.

[0059] In some embodiments of the modified RNAs provided herein, the modified RNA comprises one or more modified nucleotides at position +1 to position +6 with reference to a 5’ terminus of the RNA. In some embodiments, the modified RNA comprises (i) one or more modified nucleotides at position +1 to position +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap, and (ii) at least one 5’ cap.

[0060] In some embodiments, an RNA comprises a modified nucleotide at position +1 with reference to the 5’ terminus. In some embodiments, an RNA comprises a modified nucleotide position +3 with reference to the 5’ terminus. In some embodiments, an RNA comprises a modified nucleotide at positions +1, +3, and +5 with reference to the 5’ terminus. In some embodiments, an RNA comprises a modified nucleotide at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, an RNA comprises a modified nucleotide at position +1 with reference to the 5’ terminus; or position +3 with reference to the 5’ terminus; or positions +1, +3, and +5 with reference to the 5’ terminus; or positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

[0061] In some embodiments, the modified RNA comprises a modified sugar. In some embodiments, the modified RNA comprises a modified phosphate. In some embodiments, the one or more modified nucleotides comprises a modified nucleobase. In some embodiments, the one or more modified nucleotides comprise one or more modified sugars, one or more modified phosphates, one or more modified nucleobases, or any combination thereof.

[0062] In some embodiments of the modified RNAs provided herein, the 5’ cap is selected from the group consisting of 7-methy guanosine (m7G), N7,3’-O-dimethyl-guanosine-5’ -triphosphates’ -guanosine (m7G-3’m-ppp-G), N7,2’-O-dimethyl-guanosine-5 ’-triphosphate-5 ’-guanosine264931-5478-7195.1Atty. Docket No. 114203-1901(m7Gm-ppp-G), 7-benzylguanosine (Bn7G), chlorobenzylguanosine (ClBn7G), m7G bearing an LNA sugar (m7G-LNA), chlorobenzyl-O-ethoxyguanosine (ClBnOEt7G), 7-(4-chlorophenoxyethyl)-guanosine, 7-ethyl guanosine (e7G), 7-propyl guanosine (p7G), 7-isopropyl guanosine (ip7G), 7-butyl guanosine (b7G), 7-isobutyl guanosine (ib7G), 7-cyclopentyl guanosine (cp7G), 7-(carboxymethyl) guanosine (cm7G), 7-(2-phenylethyl) guanosine [7-(2-PhEt)G], 7-(l-phenylethyl) guanosine [7-(l-PhEt)G], m7GpppBH3G (DI andD2 stereoisomers), m7GppBH3G (DI and D2 stereoisomers), m7GpBH3G (DI and D2 stereoisomers), m7GppBH3pm7G, m27’2’°GpppBH3G (DI and D2 stereoisomers), m27’2’°GppBH3pG (DI and D2 diastereomers), m27,2'°GppspG (DI and D2 diastereomers), N-Arylmethyl analogs, glyceryl, 4',5'-methylene nucleotide, l-(beta-D- erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, C-nucleotides, alpha-nucleotide, modified base nucleotide, threo-pentofuranosyl nucleotide, acyclic 3',4'-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5-dihydroxypentyl nucleotide, 3'-3 '-inverted nucleotide moiety, 3 '-3 '-inverted abasic moiety, 3'-2'-inverted nucleotide moiety, 3'-2 '-inverted abasic moiety, 1,4-butanediol phosphate, 3'-phosphoramidate, hexylphosphate, aminohexyl phosphate, 3'-phosphate, 3'-phosphorothioate, phosphorodithioate, capl, cap2, cap3, cap4, ARC A, modified ARC A, inosine, Nl-methylguanosine, LNA-guanosine, 2-azido-guanosine, and a bridging or non-bridging methylphosphonate moiety. In some embodiments, the 5’ cap is added to the RNA through a chemical capping method.

[0063] In some embodiments of the modified RNAs provided herein, the modified RNA further comprises at least one poly-A tail.

[0064] In some embodiments of the modified RNAs provided herein, the modified RNA further comprises a 5’ untranslated region (5’ UTR). In some embodiments, the 5’ UTR comprises a promoter.

[0065] In some embodiments of the modified RNAs provided herein, the modified RNA further comprises a 3’ untranslated region (3’ UTR). In some embodiments, the 3’ UTR comprises at least one exonuclease-resistant modification. In some embodiments, the exonuclease-resistant modification is selected from the group consisting of phosphorothioate (PS) linkage, 2’-O-methyl (2OMe), 2’ Fluoro, inverted deoxythymidine (dT), inverted dideoxythymidine (ddT), 3’ phosphorylation, C3 spacer, 2'-O-methoxy-ethyl (2'-M0E), G-quadruplex, and 2'-3 '-dideoxy nucleotide (ddN).274931-5478-7195.1Atty. Docket No. 114203-1901

[0066] In some embodiments of the modified RNAs provided herein, the modified RNA comprises two or more 5’ caps. In some embodiments of the modified RNAs provided herein, the modified RNA comprises two or more poly-A tails.

[0067] In some embodiments of the modified RNAs provided herein, the modified RNA comprises an open reading frame (ORF). In some embodiments, the ORF encodes a protein. In some embodiments, the protein is a therapeutic protein. In some embodiments, the protein is an antigen.

[0068] In some embodiments of the modified RNAs provided herein, the modified RNA comprises a sequence encoding a therapeutic nucleic acid. In some embodiments, the therapeutic nucleic acid is an antisense oligonucleotide (ASO), an aptamer, an RNA decoy, an siRNA, a shRNA, a miRNA, or a gRNA.

[0069] In some embodiments of the modified RNAs provided herein, the modified RNA comprises a microRNA (miRNA) element that enhances the cell-type-specificity of the modified RNA. The incorporation of miRNA-responsive elements can be employed to control expression in a cell type-dependent manner. By leveraging the differential endogenous expression levels of miRNAs across cell types, miRNA target sequences can be incorporated into either untranslated regions (UTRs) of the mRNA as “off-switches” or downstream of the poly(A) tail together with RNA degron sequences as “on-switches.” Specifically, binding of endogenous miRNAs to “miRNA-off ’ elements induces degradation of the corresponding mRNA, thereby silencing translation, whereas interaction with “miRNA-on” elements leads to cleavage and release of the RNA degron, restoring translation. For example, hepatocytes overexpress miR-122, while immune cells overexpress miR-142. miRNA-off elements can be placed within 3' UTR and endogenous miRNA can trigger the cleavage then turn off mRNA expression in specific cell types. Meanwhile, miRNA-on elements are generally placed after the polyA tail, followed by an RNA degron signal. Binding and cleavage by corresponding endogenous miRNA in specific cell types trigger the release of functional mRNA to achieve turn-on specificity. In some embodiments, the miRNA element is a miRNA-off element and is located 5’ of the polyA tail. In some embodiments, the miRNA element is a miRNA-on element and is located 3’ of the polyA tail. In some embodiments, the modified mRNA comprises a miRNA-off element and a miRNA-on element. In some embodiments, the modified mRNA further comprises an RNA degron signal.284931-5478-7195.1Atty. Docket No. 114203-1901

[0070] In some embodiments of the modified RNAs provided herein, the one or more modifications are selected from the group consisting of 2'-O-methyladenosine (2OMe-A), locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl -locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-dimethyladenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5-methyl-locked nucleic acid (LNA)cytosine, P-d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-O-methyl-P-O-methyladenosine, N6, N6-dimethyladenine (m62A), N1 -methylinosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine, 2 '-meth oxy ethoxy-adenosine (2M0E), and 5-methylcytosine (m5C).

[0071] In some embodiments of the modified RNAs provided herein, a modified RNA comprises a m7G 5’ cap and an LNA modification at position +1 with reference to the 5’ terminus. In some embodiments, the RNA comprises a m7G 5’ cap and an LNAm5C modification at position +1 with reference to the 5’ terminus. In some embodiments, the RNA comprises a m7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and a 20Me modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the RNA comprises an LNAm7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and a 20Me modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the RNA comprises a m7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the RNA comprises a LNAm7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the RNA comprises a m7G 5’ cap and a 2M0E modification at position +1 with reference to the 5’ terminus. In some embodiments, the RNA comprises a m7G 5’ cap and a 2M0E modification at each of positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the RNA comprises an LNAm7G 5’ cap and a 2M0E modification at each of positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the RNA comprises a m7G 5’ cap, a 2M0E modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to294931-5478-7195.1Atty. Docket No. 114203-1901the 5’ terminus. In some embodiments, the RNA comprises an LNAm7G 5’ cap, a 2M0E modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus.Chemical synthesis of 5’ cap regions

[0072] Existing methods for preparing capped linear mRNA do not accommodate modifications that are not tolerated by RNA polymerase or capping enzymes, nor modifications that extend beyond the first two bases, creating a screening bias due to differing cap incorporation efficiencies. To overcome these challenges, the capping process was decoupled from mRNA synthesis as described herein.

[0073] In some embodiments of the methods provided herein, the method comprises first synthesizing a 5 ’-phosphorylated RNA oligonucleotide with a specific sequence and / or desired modifications. In the methods described herein, the synthesized 5 ’-phosphorylated RNA oligonucleotide defines the 5’ UTR when ligated to an RNA transcript. Thus, as used herein, the terms “5’-phosphorylated RNA oligonucleotide,” “5 ’-phosphorylated oligonucleotide,” and “5’-phosphorylated UTR” are used interchangeably. In some embodiments, the 5 ’-phosphorylated RNA oligonucleotide comprises one or more modified nucleotides which may affect RNA translation and / or stability.

[0074] In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises a modified phosphate, resulting in a modified intemucleotide linkage. Modified phosphates used in the present invention may be, but are not limited to, phosphorothioate (PS), thiophosphate, 5'-O-methylphosphonate, 3 '-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate. In some embodiments, more than one modified phosphate is used. In some embodiments, the 5’-phosphorylated oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more modified phosphates. In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, or between 100 and 200 modified phosphates. In some embodiments, the modified304931-5478-7195.1Atty. Docket No. 114203-1901phosphates of the 5 ’-phosphorylated oligonucleotide comprise about 3%, about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or 100% of the total phosphates in the 5 ’-phosphorylated oligonucleotide.

[0075] In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises a modified sugar. Modified sugars used in the present invention may be, but are not limited to, 2'-deoxy fluoro (2FA), Z-adenosine (ZA), 2'-deoxyadenosine (dA), locked nucleic acid (LNA) (2'-O,4'-C-methyleneadenosine), 2'-methoxy (20Me), 2 '-methoxy ethoxy (2M0E), 2'-thioribose, 2 ',3'-dideoxyribose, 2’-amino-2'-deoxyribose, 2' deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3 '-amino-2', 3 '-dideoxyribose, 3'-azido-2', 3 '-dideoxyribose, 3 '-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5 '-aminoribose, 5 '-thioribose, 5-nitro-l-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked ribose, and 2'-O,4'-C-thio-linked ribose. Z-adenosine (ZA) refers to the enantiomer of Z>-adenosine. A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2’ and 4’ carbons. This structure effectively “locks” the ribose in the 3’-endo structural conformation. In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more modified sugars. In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, or between 100 and 200 modified sugars. In some embodiments, the modified sugars of the 5 ’-phosphorylated oligonucleotide comprise about 3%, about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or 100% of the total sugars in the 5 ’-phosphorylated oligonucleotide.

[0076] In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises a modified nucleobase. Modified nucleobases used in the present invention may be, but are not limited to, inosine, xanthine, allylamino uracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6-chloropurineriboside, N6-methyladenosine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-Indolyl)propionamide-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-314931-5478-7195.1Atty. Docket No. 114203-1901bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5 -fluorouracil, 5-formylcytosine, 5-formyluracil, 5 -hydroxy cytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5 -hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin- 16-aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3 -aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5 -aminoallyl cytosine, cyanine 5 -aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3-aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, N1 -ethylpseudouracil, Nl-methoxymethylpseudouracil, N1 -methyladenine, N1 -methylpseudouracil, Nl-propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6-methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3 -deazaadenine, 2,6-diaminoadenine, 2,6-daminoguanine, 5-carboxamide-uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio-N6-threonyl carbamoyl adenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6, N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A). In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more modified nucleobases. In some embodiments, the 5 ’-phosphorylated oligonucleotide comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, or between 100 and 200 modified nucleobases. In some embodiments, the modified nucleobases of the 5 ’-phosphorylated oligonucleotide comprise324931-5478-7195.1Atty. Docket No. 114203-1901about 3%, about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or 100% of the total nucleobases in the 5’-phosphorylated oligonucleotide.

[0077] In some embodiments, the 5 ’-phosphorylated oligonucleotide is synthesized on a solidphase support. In some embodiments, the solid support is controlled-pore glass (CPG) or polystyrene (PS). In some embodiments, the 5 ’-phosphorylated oligonucleotide is synthesized via phosphorami di te oligonucleotide synthesis. In some embodiments, the 5 ’-phosphorylated oligonucleotide is synthesized in a solvent system comprising a nonpolar counterion. In some embodiments, the nonpolar counterion used in oligonucleotide synthesis is ammonium. In some embodiments, the nonpolar counterion used in oligonucleotide synthesis is ammonium.

[0078] In some embodiments, a 5’ cap is added to the 5 ’-phosphorylated oligonucleotide to produce a 5’-capped oligonucleotide (i.e., a 5’-capped UTR). A 5’ cap can be added to an RNA oligonucleotide via enzymatic or chemical reactions. In some embodiments, the cap is added to the 5 ’-phosphorylated oligonucleotide through chemical capping methods. Chemical capping may be performed by any method known in the art. Preferably, the chemical capping reaction is performed through an anhydrous reaction between the 5 ’-phosphorylated RNA oligonucleotide and a capping nucleotide conjugated to imidazole in the presence of 1 -methylimidazole (see Abe et al., “Complete Chemical Synthesis of Minimal Messenger RNA by Efficient Chemical Capping Reaction” ACS Chem. Biol. 2022, 17: 1308-1314). In this method, the cap of interest is first conjugated to imidazole. A chemical reaction is then performed between the imidazole-conjugated capping oligonucleotide and a 5’-phoshporylated oligonucleotide under anhydrous conditions and in the presence of 1 -methylimidazole. In some embodiments, the capping reaction is performed in dimethyl sulfoxide (DMSO). The desired product of this reaction is an oligonucleotide capped on its 5’ end with the cap of interest.

[0079] In some embodiments, the 5’ cap used in the present invention may be, but is not limited to, 7-methy guanosine (m7G), N7,3’-O-dimethyl-guanosine-5’-triphosphate-5’-guanosine (m7G-3’m-ppp-G), N7,2’-O-dimethyl-guanosine-5’-triphosphate-5’-guanosine (m7Gm-ppp-G), 7-benzylguanosine (Bn7G), chlorobenzylguanosine (ClBn7G), m7G bearing an LNA sugar (m7G-LNA), chlorobenzyl-O-ethoxyguanosine (ClBnOEt7G), 7-(4-chlorophenoxyethyl)-guanosine, 7-ethyl guanosine (e7G), 7-propyl guanosine (p7G), 7-isopropyl guanosine (ip7G), 7-butyl guanosine (b7G), 7-isobutyl guanosine (ib7G), 7-cyclopentyl guanosine (cp7G), 7-334931-5478-7195.1Atty. Docket No. 114203-1901(carboxymethyl) guanosine (cm7G), 7-(2-phenylethyl) guanosine [7-(2-PhEt)G], 7-(1-phenylethyl) guanosine [7-(l-PhEt)G], m7GpppBH3G (DI and D2 stereoisomers), m7GppBH3G (DI and D2 stereoisomers), m7GpBH3G (DI and D2 stereoisomers), m7GppBH3pm7G, m27’2’ °GpppBH3G (DI and D2 stereoisomers), m27’2'°GppBH3pG (DI and D2 diastereomers), m27’2’" °GppspG(D1 and D2 diastereomers), N-Arylmethyl analogs, glyceryl, 4',5'-methylene nucleotide, l-(beta-D- erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L-nucleotides, alpha-nucleotide, modified base nucleotide, threo-pentofuranosyl nucleotide, acyclic 3',4'-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5-dihydroxypentyl nucleotide, 3'-3 '-inverted nucleotide moiety, 3'-3'-inverted abasic moiety, 3'-2'-inverted nucleotide moiety, 3'-2 '-inverted abasic moiety, 1,4-butanediol phosphate, 3'-phosphoramidate, hexylphosphate, aminohexyl phosphate, 3'-phosphate, 3'-phosphorothioate, phosphorodithioate, capl, cap2, cap3, cap4, ARC A, modified ARC A, inosine, Nl-methylguanosine, LNA-guanosine, 2-azido-guanosine, and a bridging or non-bridging methylphosphonate moiety.

[0080] Thus, in some embodiments, a 5’ cap region provided herein comprises a 5’-capped oligonucleotide (i.e., a 5’-capped UTR) synthesized as described above. In some embodiments, the 5’ cap region comprises a modified 5’ cap, one or more modified phosphates, one or more modified sugars, and / or one or more modified nucleobases. The 5’ cap region may comprise any combination of modifications. In some embodiments, the 5’ cap region is between 5 and 50, between 10 and 45, between 15 and 40, between 20 and 35, between 25 and 30, or more than 30 nucleotides in length. In some embodiments, the 5’ cap region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more modified nucleotides. In some embodiments, the 5’ cap region comprises between 1 and 3, between 3 and 5, between 5 and 10, between 10 and 15, between 15 and 30, between 30 and 50, between 50 and 100, or between 100 and 200 modified nucleotides. In some embodiments, the modified nucleotides of the 5’ cap region comprise about 3%, about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or 100% of the total nucleotides in the 5’ cap region.

[0081] In some embodiments, a capped RNA transcript as provided herein comprises more than one 5’ cap or 5’ UTR region. In some embodiments, a capped RNA transcript as provided herein comprises more than one poly-A tail. Methods of producing multi-capped RNA strands have344931-5478-7195.1Atty. Docket No. 114203-1901been described in U. S. Patent Application Number 63 / 300,602, the contents of which are incorporated herein in their entirety. These methods comprise incorporating azide handles into an RNA molecule such that it is compatible with an alkyne-containing nucleotide to undergo a click chemistry reaction. The present application builds upon these techniques. In some embodiments, an azide handle is introduced into the RNA molecule through tRNA guanine transglycosylase (TGT) in combination with a pre-queuosine 1 (preQi) substrate (Ehret et al. “Site-specific covalent conjugation of modified mRNA by tRNA guanine transglycosylase.” Mol. Pharm. 15, 737-742 (2018)). In some embodiments, an azide handle is incorporated into an RNA molecule (e.g., 5 ’-phosphorylated RNA oligonucleotide or a capped RNA transcript) through during transcription, providing an azide-linked nucleotide as substrate for incorporation into a growing RNA strand (e.g., 5-Azido-PEG4-CTP). In some embodiments, more than one azide handle is introduced into an RNA molecule. In some embodiments, more than one azide handle is introduced into an RNA molecule using more than one introduction technique (e.g., both TGT and IVT).Producing RNAs with a modified 5’ cap region

[0082] In some aspects, the methods provided herein produce a capped RNA transcript with a modified 5’ cap region. In some embodiments, the methods comprise attaching a 5’ cap region as described herein to an RNA precursor, thereby producing a capped RNA transcript comprising a modified 5’ cap and UTR.

[0083] In some aspects, the present disclosure provides methods of producing modified RNAs comprising ligating an RNA (e.g., an RNA precursor) to a 5’ cap region comprising a 5’ cap and a 5’ UTR in the presence of a ligase, whereby the ligase forms a covalent bond between the 3’ nucleotide of the 5’ cap region and the 5’ nucleotide of the RNA (e.g., the RNA precursor) to produce capped RNA transcript, (e.g., a modified capped RNA transcript). In some embodiments, a 5’ cap region is produced as described herein. When a ligase forms a covalent bond between two linear nucleic acids, a new nucleic acid is produced, with the produced nucleic acid comprising the nucleic acid sequences of both nucleic acids. Ligation of the 3’ terminal nucleotide of a first nucleic acid to the 5’ terminal nucleotide of a second nucleic acid produces a third nucleic acid, with the third nucleic acid comprising the sequence of the first nucleic acid and the second nucleic acid, and the second nucleic acid being 3’ to (downstream of) the first354931-5478-7195.1Atty. Docket No. 114203-1901nucleic acid sequence. Ligation by an RNA ligase occurs in several steps. First, an amino (-NH2) group of an amino acid e.g., a lysine) of the ligase bonds to a phosphate group of adenosine triphosphate (ATP), such that an adenosine monophosphate (AMP) group is bound to the RNA ligase. Second, a 5' terminal phosphate of the second nucleic acid displaces the phosphate of the RNA ligase-bound AMP. Finally, an oxygen of the 3' terminal hydroxyl group of the first nucleic acid binds to the phosphorus atom of the 5' terminal phosphate of the second nucleic acid. This final step forms a phosphodiester bond between terminal nucleotides of the nucleic acids, thereby forming a single nucleic acid with a continuous sugar-phosphate backbone. In some embodiments, the ligase is T4 RNA Ligase I, T4 RNA Ligase II, or RtcB. In some embodiments, the ligation is performed using a split ribozyme (see, e.g., Gambill et al., “A split ribozyme that links detection of a native RNA to orthogonal protein outputs.” Nat Commun 14, 543 (2023)).

[0084] In some embodiments, the RNA precursor comprises an open reading frame (ORF). In some embodiments, the ORF encodes a therapeutic protein. As used herein, a “therapeutic protein” refers to a protein that prevents, reduces, or alleviates one or more signs or symptoms of a disease or disorder when expressed in a subject, such as a human subject that has, for example, an essential enzyme, clotting factor, transcription factor, growth factor, cytokine, chemokine, antibody (or antibody fragment thereof), protein hormone, signaling protein, structural protein, or cell surface receptor encoded by a gene that is mutated in a subject. A mutation in a gene encoding such a protein may cause diminished levels of the protein to be expressed in one or more cells of the subject. For example, IPEX syndrome in humans is caused by a mutation in the F0XP3 gene, which hinders development of FOXP3+ regulatory T cells and results in increased susceptibility to autoimmune and inflammatory disorders. Expression of an essential enzyme, clotting factor, transcription factor, growth factor, cytokine, chemokine, antibody (or antibody fragment thereof), protein hormone, signaling protein, structural protein, or cell surface receptor from an RNA may therefore compensate for a mutation in the gene encoding such a protein in a subject. In some embodiments, the therapeutic protein is a protein that is expressed in one or more cells of a subject a level that is less than (e.g., significantly less than) that of a reference value, such as the level of expression of the protein that is typical in cells of one or more healthy subjects (i.e., subjects who do not have and are not at risk for developing the disease or disorder). Non-limiting examples of therapeutic proteins include base editors (e.g., adenine base editors or364931-5478-7195.1Atty. Docket No. 114203-1901RNA base editors), CRISPR-associated proteins (Cast, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Casl2 [Cpfl], or Casl3 [C2c2] endonuclease), RNase proteins (e.g., RNase III), hormones (e.g., insulin, renin, parathyroid hormone, thyroid hormone), thrombin, fibrinogen, metabolic enzymes, erythropoietin (EPO), growth hormone (e.g., GSH), interferons, antibodies (e.g., monoclonal antibodies), colony-stimulating factors (CSFs, e.g., granulocyte colony-stimulating factor [G-CSF]), tissue plasminogen activator (tPA), Factor VIII, Factor IX, enzymes (e.g., for conditions such as Gaucher’s disease or Fabry disease), interleukins, bone morphogenic proteins (BMPs), relaxin, alpha- 1 antitrypsin, filgrastim, oxytocin, somatostatin, calcitonin, glucagon, liraglutide, vasopressin, epigenetic modulating proteins, and growth factors.

[0085] In some embodiments, the ORF encodes an antigen. As used herein, “antigen” refers to a molecule (e.g., a protein) that, when expressed in a subject, elicits the generation of antibodies in the subject that bind to the antigen. In some embodiments, the antigen is a protein derived from a pathogen, such as a pathogenic virus, bacterium, protozoan, or fungus. In some embodiments, the antigen is a protein derived from a virus (viral antigen) or a fragment thereof. In some embodiments, the antigen is a protein derived from a bacterium (bacterial antigen) or a fragment thereof. In some embodiments, the antigen is a protein derived from a protozoan (protozoal antigen) or a fragment thereof. In some embodiments, the antigen is a protein derived from a fungus (fungal antigen) or a fragment thereof. A fragment of a full-length protein refers to a protein with an amino acid sequence that is present in, but shorter than, the amino acid sequence of the full-length protein. Thus, in some embodiments, the RNA transcripts produced by the methods provided herein may be used for prophylactic purposes, such as for vaccination of a subject.

[0086] In another aspect, the methods disclosed herein provide an RNA precursor and / or a capped RNA transcript comprising one or more noncoding genes. In some embodiments, the noncoding heterologous genes are therapeutic nucleic acids. As used herein, a therapeutic nucleic acid is a nucleic acid or related compound that alters gene expression to prevent or treat diseases or disorders. In some embodiments, the therapeutic nucleic acid is an antisense oligonucleotide (ASO), N-acetylgalactosamine (GalNAc) ligand-modified short interfering RNA (siRNA) conjugate, DNA aptamer, RNA aptamer, ribozyme, RNA decoy, siRNA, shRNA, miRNA, gRNA, or CRISPRi molecule.374931-5478-7195.1Atty. Docket No. 114203-1901

[0087] In some embodiments, a composition provided herein (e.g., a pharmaceutical composition) further comprises one or more additional agents. In some embodiments, the additional agent is a nucleotide, a nucleic acid, an amino acid, a peptide, a protein, a small molecule, an aptamer, a lipid, or a carbohydrate. In some embodiments, the additional agent is an agent which has a therapeutic effect when administered to a subject. In some embodiments, the additional agent is an agent that is capable of modulating expression of a gene and / or protein is a subject, such as a short hairpin RNA (shRNA), a small interfering RNA (siRNA), or an antisense oligonucleotide (ASO). In some embodiments, the additional agent is a small molecular inhibitor. In some embodiments, the additional agent is an agent that is capable of eliciting or enhancing an immune response in a subject. In some embodiments, the additional agent is an antigen (e.g., a viral antigen, a bacterial antigen). In some embodiments, the additional agent is an adjuvant, which is defined as an agent that is sufficient for enhancing an immune response in a subject when administered at an effective amount, but does not elicit an immune response in a subject when administered alone. In some embodiments, the additional agent is an enzyme, such as an enzyme that is capable of catalyzing one or more chemical reactions in a subject or in cells of a subject.

[0088] In some embodiments of the methods provided herein, an RNA precursor for which 5’ capping is desired must first be chemically prepared for capping. In vitro transcription (IVT) of RNA results in uncapped 5 ’-triphosphorylated RNA. The 5 ’-triphosphate of the in vitro transcribed RNA is incompatible with enzymatic ligation on its 5’ end, as enzymatic ligation requires 5 ’-monophosphorylated RNA. For example, T4 RNA Ligase 1 catalyzes the ligation of a 5’-phosphoryl-terminated nucleic acid donor (e.g., the RNA precursor described herein) to a 3’ hydroxyl-terminated nucleic acid acceptor (e.g., the 5’ cap region described herein) through the formation of a 3’- 5’ phosphodiester bond with hydrolysis of adenosine triphosphate (ATP) to adenosine monophosphate (AMP) and pyrophosphate (PPi). Thus, in some embodiments, an RNA precursor is prepared for capping by removing pyrophosphate from the 5’ end of the triphosphorylated RNA, leaving a 5 ’-monophosphorylated RNA to be used in a ligation reaction. In some embodiments of the methods provided herein, RNA 5’ Pyrophosphohydrolase (RppH) is used to produce 5 ’-monophosphorylated RNA from 5 ’ -triphosphorylated RNA.

[0089] Ligation of the 5’ cap region to the RNA precursor using conventional enzymatic ligation methods demonstrated the requirement of a high ratio (>200) of 5’ cap region oligo: RNA384931-5478-7195.1Atty. Docket No. 114203-1901precursor (oligo:mRNA) to achieve complete labeling of the RNA precursor. The requirement for such high levels of 5’ cap region oligos is inconsistent with scalability of such methods. Thus, to address this issue, in some embodiments a short unstructured spacer region was introduced into the 5’ end of the RNA precursor such that the 5’ end was exposed, allowing enzymes (e.g., RNA ligase) better access to the 5’ end.

[0090] In some embodiments, the spacer region comprises a plurality of identical consecutive nucleotides. In some embodiments, the spacer region comprises between 5 and 10, between 10 and 20, between 15 and 30, between 20 and 50, between 50 and 100, or between 100 and 200 consecutive adenosine, cytosine, guanine, or thymine nucleotides. In some embodiments, the spacer region comprises about 15 consecutive adenosine nucleotides. In some embodiments, the spacer region comprises at least one non-canonical nucleotide (e.g., inosine).

[0091] In some embodiments, the RNA precursor to which the 5’ cap region is ligated comprises one or more exonuclease-resistant nucleotide modifications in its 3’ end. Modified nucleotides containing one or more structural modifications to the nucleobase, sugar, or phosphate linkage of the RNA can interfere with 3’ and 5’ exonuclease activity, rendering the RNA more stable. Nucleotide modifications conferring exonuclease resistance are known in the art. In some embodiments, the RNA precursor comprises one or more modified phosphates, sugars, and / or nucleobases to confer exonuclease resistance. In some embodiments, the RNA precursor comprises one or more 2’-O-Methyl (2’0Me) modifications. In some embodiments, the RNA precursor comprises one or more 2’-fluoro bases. In some embodiments, the RNA precursor comprises one or more phosphorothioate (PS) or thiophosphate (SP) linkages. In some embodiments, the 3’ end of the RNA precursor comprises a phosphate group. In some embodiments, the RNA precursor comprises a C3 spacer incorporated internally or at its 3’ end. A C3 spacer modification adds a 3-carbon spacer to the 3’ terminus of an oligonucleotide. In some embodiments, the RNA precursor comprises a 2’-O-methoxy-ethyl base (2’-M0E), a G-quadruplex, or a 2’-3’-dideoxy nucleotide (ddN). In some embodiments, the RNA precursor comprises one or a combination of any of the modifications known in the art to confer exonuclease resistance (see, e.g., Clave et al., “Modified internucleoside linkages for nuclease-resistant oligonucleotides.” RSC Chem. Biol. (2021) 2:94-150)394931-5478-7195.1Atty. Docket No. 114203-1901Capped-circular mRNA (QRNA)

[0092] Despite advances in circular RNA (circRNA) engineering, current constructs rely on IRES (Internal Ribosome Entry Site) or TEE (Translation Enhancing Element)-mediated translation, which are embodiments that enable cap-independent translation. Linear mRNAs are capable of undergoing cap-dependent translation through interaction with eIF4E and other eukaryotic translation initiation factors, which is the predominant form of translation in cells (Sonenberg and Hinnebusch, 2009, Cell 136: 731-745) and is generally more efficient than capindependent translation (Koch etal., 2020, Nat. Struct. Mol. Biol. 27:1095-1104).

[0093] As described herein, a “capped-circular mRNA” is a circular mRNA characterized by one or more covalent linkages to one or more cap structures (or a derivative thereof). The circular mRNA can contain all the canonical elements of a linear mRNA: (1) Cap, (2) 5’ UTR (untranslated region), (3) protein-coding regions (CDS), (4) 3’ UTR, and (5) poly(A) tail. By circularizing these features into a capped-circular RNA, it is intended to enhance half-life (increased nuclease resistance) of a canonical circular mRNA, while retaining the benefits of efficient cap-dependent translation, such as in linear mRNA.

[0094] The RNA embodiments and methods disclosed herein take advantage of the exonucleaseresistant feature of circRNA while utilizing the strong m7G-cap dependent translation initiation machinery. Such features can be achieved via chemical conjugation of a capped oligonucleotide with a circRNA through click chemistries such as copper catalyzed azide-alkyne cycloaddition (CuAAC) or tetrazine-trans cyclooctene inverse electron demand Diels- Alder reaction (IEDDA). Two generic structures of capped circular messenger RNAs (QRNAs) are the following: Type 1 QRNA and Type 2 QRNA. In Type 1 QRNA, a circular poly-phosphodiester backbone is present while capping is achieved via chemical ligation of a short, capped oligonucleotide to an internal handle on the circular mRNA through click chemistry. The 5’ cap may comprise of a 7-methylguanylate that enables efficient translation of an mRNA or alternative common mRNA cap structures, as shown, for example, in Mccaffreyanton, 2019, Genetic Engineering & Biotechnology News. 39. In Type 2 QRNA, a continuous mRNA poly-phosphodiester backbone is present; circularization is achieved via chemical conjugation between the 3’-end and 5’-UTR of the mRNA through click chemistry.

[0095] The 5’ capping and 3’ poly(A) tailing steps are useful in producing active synthetic mRNA; these modifications prevent mRNA degradation and facilitate translation initiation in404931-5478-7195.1Atty. Docket No. 114203-1901eukaryotic cells. As used herein, “capping” means modification at the 5’ end of an mRNA by an addition of a “cap” molecule such as a 7-methylguanosine (m7G) cap. Other cap structures and modifications of the cap as described below can be used to optimize the translation efficiency.

[0096] Enzymes capable of catalyzing the reaction of linking a cap molecule to the mRNA include, but are not limited to, Vaccinia capping system including 2’-O-Methyl Transferase, tRNA guanine transglycosylase (TGT), Faustovirus capping enzyme, and T4-RNA ligase.Capping can also occur during the synthesis of mRNA called co-transcriptional capping.

[0097] As used herein, the term “molecular handle” or “handle” refers to a chemical group that is attached to a nucleotide on mRNA and can form a covalent bond to another molecule that is separate from the mRNA to link this other molecule to the mRNA. The covalent bond can be formed via various appropriate functional crosslinking reactions. In some embodiments described herein, the crosslinking reaction comprises click chemistry. As used herein, the term “click handle” refers to a molecule on mRNA that can covalently bind to another molecule via click chemistry reaction. Examples of a handle include, but are not limited to, alkyne or azide (when CuAAC is used in click chemistry), or trans-cyclooctene or tetrazine (when IEDDA is used in click chemistry), or hydrozone or oxime, or any equivalent structures thereof. Other crosslinking chemistries including thio-ene and thiol-yne reactions (Escorihuela et al., 2014, Bioconjug. Chem. 25:618-627), a phosphate-amine based reaction (El-Sagheer and Brown, 2017, Chem. Commun. 53:10700-10702; Kalinowski et al., 2016, Chembiochem. 17: 1150-1155), thiol-yne, amino-yne, and hydroxyl-yne reactions (Worch et al., 2021, Chem Rev. 121(12): 6744-6776), and other bioconjugation reactions (Gassensmith, chem.libretexts.org / Bookshelves / Organic Chemi stry / Supplemental Modules (Organic Chemist ry) / Reactions / Introduction_to_Bioconjugation, accessed June 23, 2023) have also been contemplated.

[0098] As used herein, the term “hairpin” or “hairpin oligonucleotide” refers to a single-stranded oligonucleotide that has a sequence of complementary base pairs at both ends capable of forming a “stem-and-loop” structure.

[0099] As used herein and understood in the art, the term “click chemistry” is intended to encompass chemical methods for linking chemical components together, including but not limited to nucleotides into polynucleotides and amino acids into peptides and polypeptides, that are “simple to perform, have high yields, require no or minimal purification, and are versatile in414931-5478-7195.1Atty. Docket No. 114203-1901joining diverse structures without the prerequisite of protection steps” (see, for example, Hein et al., 2006, Pharm. Res. 10: 2216-2230). In current chemical synthetic practice four primary reactions are employed: 1) cycloadditions (including for example monovalent copper-catalyzed Huisgen 1,3-dipolar cycloadditions of azides and alkynes, the most widely used); 2) nucleophilic ring openings (including ring systems comprising strained heterocyclic electrophiles); 3) non-Aldol carbonyl chemistry (including for example hydrazone / oxime ether formation); and 4) carbon multiple bond additions (including for example certain Michael additions and formation of various three-membered rings by inter alia epoxidations). Click chemistry has been found to be particularly useful for polymeric substances such as proteins and nucleic acids as illustrated herein.

[0100] As used herein, the term “equivalent structure” means any molecule that are sufficiently structurally similar and perform the same function in a chemical reaction.

[0101] As used herein, the terms “derivatized” or “functionalized” means modification of a nucleotide that leads to some functional consequences in its chemical properties or reactivity or both. Both terms shall be understood to be equivalent to the extent that particular embodiments of the capped, circular RNA molecules have by benefit of derivatization thereof a function, particularly with regard to crosslink-dependent circularization embodiments provided herein. In some embodiments, a derivatized nucleotide is a nucleotide that is modified to comprise a chemical group / handle can participate in a cross-linking reaction.

[0102] As used herein, the term “QRNA” is intended as a generic term meaning capped circular messenger RNAs. Particularly encompassed by this term are the various species of circularized RNA molecules and in particular circularized mRNA molecules disclosed herein, but these examples are not intended to be limiting.

[0103] In some embodiments, the synthesis pathway of Type 1 and Type 3 QRNA enables multiple oligonucleotides containing 5’ cap binding to the circular RNA. For example, circular RNA can include multiple derivatized nucleotides that can covalently bind to multiple oligonucleotides containing 5’ cap. Alternatively, a single circular RNA backbone can encode multiple TGT sites to enable binding of multiple oligonucleotides containing 5’ cap onto the circular RNA simultaneously.

[0104] In some embodiments, the capped, circular RNA molecule comprises an mRNA region encoding one or a plurality of peptides or polypeptides.424931-5478-7195.1Atty. Docket No. 114203-1901

[0105] As provided herein, the cap used in the capped, circularized RNA molecules of the invention can include 7-methylguanine (m7G) but in addition cap analogues as set forth, inter alia, in U. S. patent application No. 2020 / 0055891 to Walczak et al.; Holstein et al., 2016, Agnew Chem. Int. Ed. Engl. 55: 10899-10903; Walczak et al., 2017, Chem. Sci. 8: 260-267; Muttach et al., 2017, J. Org. Chem. 13: 2819-2832) can be incorporated into the circular RNA molecule precursors to create the capped, circularized RNA molecules provided herein.Cap modifications for QRNA

[0106] Several variations of the cap structure have been contemplated here to optimize translation efficiency of QRNA. These variations include: including multiple cap structures (cap 0, 1, and 2; Shanmugasundaram et al., 2022, Chem Rec. 22(8): e202200005); including N6, 2’-O-dimethyladenosine (m6Am) as a terminal modification adjacent to the mRNA cap (Sun et al., 2021, Nat Commun. 12(1): 4778); using cap structures with modified triphosphate bridges (Sun et al., 2021, Nat Commun. 12(1): 4778; Wojtczak etal., 2018, J Am Chem Soc. 140(18): 5987-5999); incorporating Locked Nucleic Acid (LNA)-modified cap analogs (Kore etal., 2009, J Am Chem Soc. 131(18): 6364-5); introducing cap analogs with alternative functionalities such as light reactivity and click groups (Klocker et al., 2022, Nat Chem. 14(8): 905-913; Nowakowska et al., 2014, Org. Biomol. Chem. 12: 4841-4847); hydrophobic cap analogs (WO 2017066782 Al); and others (Wojcik et al., 2021, Pharmaceutics 13(11): 1941; Grudzien et al., RNA 10(9): 1479-1487; Grzela et al., 2023, RNA 29(2): 200-216).

[0107] In some embodiments, the methyl group in 7-methylguanosine (m7G) cap structure can be modified to produce 7-benzylguanosine (Bn7G), 7-chlorobenzylguanosine (ClBn7G), and chlorobenzyl-O-ethoxyguanosine (ClBnOEt7G). Introduction of one or more Locked Nucleic Acid (LNA), 2’ -methoxy (20Me), and 2 -methoxy ethoxy (2M0E) into m7G structure significantly increase mRNA translation. In some embodiments, the cap structures include, but are not limited to, m7G-LNA, LNAm7G-LNA, LNAm7G-LNAx6, LNAm7G-2OMex6. In some embodiments, the cap structure is m7G diphosphate imidazolide (m7GDP-Im).Nucleotide modifications

[0108] In some embodiments, as disclosed and recognized herein it is beneficial to alter the type of nucleotide / nucleotide identity, specifically incorporation of adenosine (A), guanosine 434931-5478-7195.1Atty. Docket No. 114203-1901(G), 6-methyladenosine (m6A), or the non-canonical inosine (I) in the mRNA, preferably, at the +1 position, increases translation efficiency. In some embodiments, substitution of some or all uridine residues to N1-methylpseudouridine (m’T) in the mRNA also boosts the translation. The nucleotides are numbered according to their position immediately downstream of the cap structure. For example, the cap structure found at the 5' end of eukaryotic mRNAs consists of a 7-methylguanosine (m7G) moiety linked to the first nucleotide (+1 position) of the transcript via a 5'-5' triphosphate bridge.

[0109] Other modified nucleotides include, but are not limited to, pseudouridine, 5-methylcytidine, 2-thiouridine, 5-methoxyuridine, 4-acetylcytidine, xanthine, allylamino uracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6-chloropurineriboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5 -methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-Indolyl)propionamide-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5 -bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5 -fluorouracil, 5 -formyl cytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16-ami noallyl cytosine, biotin-16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3 -aminoallylcytosine, cyanine 3 -aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3-aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, Nl-ethylpseudouracil, N1 -methoxymethylpseudouracil, N1 -methyladenine, N1 -methylpseudouracil, N1 -propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6-methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3 -deazaadenine, 2,6-diaminoadenine, 2,6-444931-5478-7195.1Atty. Docket No. 114203-1901daminoguanine, 5-carboxamide-uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio-N6-threonyl carbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6, N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A) have also been contemplated at +1 and other positions.

[0110] In some embodiments, the modified phosphate backbone can be phosphorothioate (PS), thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphorami date, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, or guani di nopropyl phosphoramidate.

[0111] In some embodiments, introduction of locked nucleic acid (LNA), 2’-methoxyribose (2-OMe), and 2-methoxyethoxy (2 -MOE) into the ribose sugar backbone increases mRNA translation. Addition of multiple 2-OMe and 2-MOE modified bases increases translation further. LNA specifically increased expression at the +1 position.

[0112] In some embodiments, the modified sugar can be 2-thioribose, 2,3-dideoxyribose, 2-amino-2-deoxyribose, 2’ deoxyribose, 2’-azido-2’-deoxyribose, 2’-fluoro-2’-deoxyribose, 2’-O-methylribose, 2’-O-methyldeoxyribose, 3’-amino-2’, 3 ’-dideoxyribose, 3’-azido-2, 3 -dideoxyribose, 3 ’-deoxyribose, 3’-O-(2-nitrobenzyl)-2’-deoxyribose, 3’-O-methylribose, 5 ’-aminoribose, 5 ’-thioribose, 5-nitro-l-indolyl-2’-deoxyribose, 5’-biotin-ribose, 2’-O,4’-C-methylene-linked, 2’-O,4’-C-amino-linked ribose, or 2’-O,4’-C-thio-linked ribose.

[0113] Other modified nucleotides include, but are not limited to, N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2’-O-dimethyladenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5-methyl-locked nucleic acid (LNA)cytosine, P-d-arabinonucleosides (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-O-methyl-P-O-methyladenosine, Nl-methyl-inosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, and 5-methylcytosine (m5C).454931-5478-7195.1Atty. Docket No. 114203-1901

[0114] In these backbone modifications, stereoisomer structures are also considered since they have been shown to impact the RNA’s nuclease-resistance properties (Iwamoto et al., 2017, Nat. Biotech. 35: 845-851; Jahns etal., 2022, Nucleic Acids Res. 50(3): 1221-1240).

[0115] Modification of nucleotides on traditional circRNA is limited because not all of them are compatible with the internal ribosome entry site (IRES). QRNA translation does not require an IRES; thus, is tolerable to more modified nucleotides in a wide range of percentage. These modifications could be spiked into the circular backbone in varying percentages (m6A is typically spiked in at 5%). And the “stem” oligo containing the cap, or the 573’ UTR and tails could likely tolerate a higher percentage of modifications. Alternatively, these modifications can be present in different percentages along different regions of the circular RNA backbone (e.g. in the 5’ UTR, or 3’ UTR, or CDS, or close to the cap structure, or combinations thereof).Furthermore, the “stem” oligo of a Type 1 QRNA (the oligonucleotide containing the cap) is chemically synthesized and could potentially tolerate more complex structures that are difficult to enzymatically incorporate, such as locked nucleic acids (LNAs), 2’ O-methyl nucleotides, peptide nucleic acids (PNAs), morpholinos, and various internal chemical linkers as provided herein.Peptides and polypeptides encoded by QRNA

[0116] Polypeptides encoded by the capped, circularized RNA molecules provided by the invention include any therapeutically useful polypeptide for treatment or intervention of any disease process associated with or dependent on polymorphic or mutant polypeptide species, heritable or acquired as a result of environmental insult or injury. QRNA can encode multiple polypeptides, for example, self-amplifying mRNA cassettes, or multiple therapeutic peptides or polypeptides. In some embodiments, the capped, circular RNA molecule comprises an mRNA region encoding one or a plurality of peptides or polypeptides. A plurality of polypeptides include multiple copies of the same polypeptide or multiple copies of different polypeptides.

[0117] An IRES, or self-cleaving peptide such as T2A sequence, can exist between the multiple polypeptide coding sequences on the QRNA. Alternatively, an RNA oligonucleotide containing cap residue site is located before each polypeptide coding sequence, which ultimately will result in a QRNA with multiple cap residue-containing RNA oligonucleotides and ensure that all coding sequences are translated efficiently.464931-5478-7195.1Atty. Docket No. 114203-1901

[0118] Peptides encoded by capped, circularized RNA molecules of the invention can include but are not limited to therapeutic peptides or antigenic peptides, particularly antigenic peptides suitable for presentation by antigen-presenting cells to humoral (B cells) or cellular (T cells) immune system cells. In certain embodiments these antigenic peptides are adapted to and effective for use as vaccines. In other embodiments the antigenic peptides are adapted to or effective in suppressing immune responses, for example in autoimmune diseases or transplant patients. In additional embodiments the antigenic peptides are adapted to and effective for eliciting specific antitumor immune responses in tumor cells or in attracting cytotoxic native (natural killer cells) or engineered (e.g., CAR-T) cells. Therapeutic peptides encoded by capped, circularized RNA molecules of the invention can include but are not limited to human parathyroid hormone, filgrastim, oxytocin, somatostatin, calcitonin, glucagon, insulin, liraglutide, vasopressin, and the like (see, Fosgerau & Hoffman, 2015, Drug Discovery Today 20:122-128; al Musaimi etal., 2021, Pharmaceuticals (Basil) 14: 145; Wang et al., 2022, Signal Transduct, and Targeted Therap. 7: 1-27).

[0119] In some embodiments, peptides encoded by the capped, circular RNA molecules of the invention can include, but are not limited, to Cas9 or derivatives (Rothgangl et al., 2021, Nat. Biotechnol. 39: 949-957) and adenine base editors or other base editors (Gaudelli et al., 2017, Nature 551: 464-471), or RNA base editors for delivery of genome or epigenome editing therapies.

[0120] In some embodiments, peptides encoded by the capped, circular RNA molecules of the invention can be selected from any of several target categories including, but not limited to, biologies, antibodies, vaccines, therapeutic proteins or peptides, cell penetrating peptides, secreted proteins, plasma membrane proteins, cytoplasmic or cytoskeletal proteins, intracellular membrane bound proteins, nuclear proteins, proteins associated with human disease, or targeting moieties.Synthesis of QRNA

[0121] Type 2: The invention also provides methods for producing a type 2 capped, circularized RNA molecules of this aspect of the invention, the methods comprising: synthesizing an RNA oligonucleotide comprising a 5’ end containing a cap structure, an mRNA encoding a peptide or polypeptide, a derivatized nucleotide located between the cap structure and the mRNA region encoding the polypeptide, and a 3’ end containing moiety; and reacting the474931-5478-7195.1Atty. Docket No. 114203-1901derivatized nucleotide with the 3’ end moiety to form the covalently linked capped circular RNA molecule.

[0122] Type 1: The invention also provides methods for producing a type 1 capped, circularized RNA molecules of this aspect of the invention, the methods comprising the steps of: producing a circularized RNA molecule comprising an mRNA region encoding a peptide or polypeptide, and a derivatized nucleotide outside the mRNA region; synthesizing an RNA oligonucleotide comprising a 5’ end containing cap structure and a 3’ end containing a moiety reactive with the derivatized nucleotide; and reacting the derivatized nucleotide with the 3’ end moiety of the RNA oligonucleotide form a covalently link between the RNA oligonucleotide and the circular RNA. In certain embodiments, the derivatized nucleotide comprises a moiety that can react with the 3’ end moiety by bioconjugation chemistry, wherein in the bioconjugation chemistry is click chemistry. In addition, the circularized RNA is produced by ribozyme-mediated splicing, enzymatic ligation, or click chemistry-mediated circularization.

[0123] Type 3: The invention also provides methods for producing a type 3 capped, circularized RNA molecules of this aspect of the invention, the methods comprising the steps of: producing a circularized RNA molecule comprising an mRNA region encoding a peptide or polypeptide, and a derivatized nucleotide outside the mRNA region; synthesizing an RNA oligonucleotide comprising a 5’ end containing cap structure and a 3’ end containing a moiety reactive with the derivatized nucleotide; and reacting the derivatized nucleotide with the 3’ end moiety of the RNA oligonucleotide form a covalently link between the RNA oligonucleotide and the circular RNA, wherein the synthesis of the circular RNA oligonucleotide, further comprises the steps of: synthesizing an RNA oligonucleotide comprising the mRNA region encoding a peptide or polypeptide, a hairpin structure containing an enzyme-recognition site, and a twister ribozyme sequence on both 5’ and 3’ ends; reacting the RNA oligonucleotide with the enzyme to produce the derivatized nucleotide within the hairpin structure; circularizing the RNA oligonucleotide using the twister ribozyme sequence.

[0124] The derivatized nucleotide in these 3 types of QRNA can be generated using different strategies. Namely, the derivatized nucleotide can be specifically targeted by having a hairpin structure containing a specific enzyme-recognition site. The enzyme described in some examples in tRNA guanine transferases (TGT). In other examples, the derivatized nucleotide is generated by replacement of a single cytidine with azide-cytidine.484931-5478-7195.1Atty. Docket No. 114203-1901

[0125] Circularization of RNA molecule in type 1 and type 3 can be achieved by ligation with T4 ligase, RtcB ligase, or ribozyme-mediated splicing. In these embodiments, the 5’ end and 3’ end of the linear oligonucleotide comprise the appropriate moiety to participate in the enzymatic reaction to form the circular RNA. Alternatively, the click chemistry moiety has also been contemplated for the circularization. In some embodiments, additional splint probe containing complementary sequences to the 5’ and 3’ ends of the linear oligonucleotide can be used to bring the two ends in proximity and facilitate circularization.Purification of modified RNAs

[0126] In some embodiments, the nucleic acids described herein are purified by any method known in the art to remove undesired components from IVT or associated reactions (including unincorporated rNTPs, protein enzymes, salts, metal ions, etc.). Techniques for the isolation of RNA molecules are well known in the art. Well-known procedures include phenol / chloroform extraction and or precipitation with alcohol (ethanol, isopropanol) in the presence of monovalent cations or lithium chloride. Additional non-limiting examples of purification procedures which can be used include size exclusion chromatography (Lukavsky, P. J. and Puglisi, J. D., 2004, Large-scale preparation and purification of polyacrylamide-free RNA oligonucleotides, RNA v.10, 889-893), silica-based affinity chromatography and polyacrylamide gel electrophoresis (Bowman, et al. in RNA in vitro transcription and RNA purification by denaturing PAGE in Recombinant and in vitro RNA syntheses Methods v. 941 Conn G. L. (ed), New York, N. Y. Humana Press, 2012). Purification can be performed using a variety of commercially available kits including, but not limited to SV Total Isolation System (Promega) and In Vitro Transcription Cleanup and Concentration Kit (Norgen Biotek).Techniques to remove contaminants, such as dsDNA, have been developed and are known in the art including but not limited to scalable HPLC purification (see, e.g., Kariko, et al., 2011, Nucl Acid Res, v. 39 el42; Weissman, et al., 2012, Synthetic Messenger RNA and Cell Metabolism Modulation v.969 (Rabinovich, P. H. Ed)). In a preferred embodiment, the capped RNA described herein is purified through HPLC, as HPLC-purified RNA has been reported to be translated at much greater levels compared to other purification methods, particularly in primary cells and in vivo.494931-5478-7195.1Atty. Docket No. 114203-1901

[0127] In some aspects, the modified RNA oligonucleotides provided herein (e g., comprising one or more modified oligonucleotides) are purified by high-performance liquid chromatography (HPLC). In some embodiments, the modified RNA oligonucleotide is purified by reverse-phase HPLC (RP-HPLC). The addition of a counterion to the mobile phase of a HPLC setup can improve separation of the desired product from unwanted products. In a preferred embodiment, HPLC gradients used to isolate the modified RNA oligonucleotides comprise hydrophobic hexylammonium ions. In some embodiments, the gradient is chosen from ethyl ammonium, diethyl ammonium, triethyl ammonium, propyl ammonium, dipropyl ammonium, hexyl ammonium, dihexyl ammonium, octyl ammonium, dioctyl ammonium, etc. The number and lengths of carbon chains may be altered based on the lengths of the oligonucleotide to be captured and the desired feature for separation. In some embodiments, the concentration of hydrophobic ions (e g., hexylammonium ions) used for HPLC purification of RNA oligonucleotides is between 10 mM to 200 mM. In some embodiments, the concentration of hydrophobic ions is between 10 mM and 20 mM, between 20 mM and 30 mM, between 30 mM and 40 mM, between 40 mM and 50 mM, between 50 mM and 60 mM, between 60 mM and 70 mM, between 70 mM and 80 mM, between 80 mM and 90 mM, between 90 mM and 100 mM, between 100 mM and 110 mM, between 110 mM and 120 mM, between 120 mM and 130 mM, between 130 mM and 140 mM, between 140 mM and 150 mM, between 150 mM and 160 mM, between 160 mM and 170 mM, between 170 mM and 180 mM, between 180 mM and 190 mM, or between 190 mM and 200 mM. In some embodiments, the concentration of hydrophobic ions is greater than 200 mM.Compositions comprising modified RNAs

[0128] In some aspects, the present disclosure provides a delivery reagent comprising any of the modified RNAs provided herein. In some embodiments, any of the modified RNA transcripts provided herein are conjugated to a delivery agent. Any of the modified RNAs provided herein may be conjugated to a delivery agent that includes, for example, to a lipid, a peptide, a protein, an antibody, or a carbohydrate. Lipids used in the conjugation and delivery of modified mRNAs are generally known in the art, and include, for example, cholesterol. Peptides, proteins, antibodies, and carbohydrates used in the conjugation and delivery of modified mRNAs are generally known in the art and include, for example, any peptide, protein, antibody, or504931-5478-7195.1Atty. Docket No. 114203-1901carbohydrate known to bind specifically to a moiety (e.g., a protein) on the surface of a target cell type. Methods for conjugating a lipid, peptide, protein, antibody, or carbohydrate to a modified RNA include, for example, methods of conjugating a lipid, peptide, protein, antibody, or carbohydrate to a modified RNA at a 5’ or 3’ terminus, and are generally known in the art.

[0129] In some embodiments, any of the capped RNA transcripts provided herein are conjugated to or encapsulated by a delivery agent that includes, for example, a nanoparticle, a microparticle, or an exosome. A nanoparticle refers to a particle having a diameter between approximately 10 nm and 1000 nm. A microparticle is defines as a particle having a diameter greater than 1000 nm (1 pm), such as a particle having a diameter between approximately 1 pm and 100 pm. In some embodiments, a nanoparticle or microparticle is approximately spherical. In some embodiments, a nanoparticle or microparticle is hollow, comprising an internal core. In some embodiments, a nanoparticle or microparticle is a lipid nanoparticle or lipid microparticle, respectively. A lipid nanoparticle or lipid microparticle refers to a composition comprising one or more lipids that form an aggregate of lipids, or an enclosed structure with an interior surface and an exterior surface. In some embodiments, a lipid nanoparticle or lipid microparticle comprises a lipid bilayer that encloses an aqueous core. Lipids used in the formulation of lipid nanoparticles and lipid microparticles for delivering RNAs are generally known in the art, and include, but are not limited to, ionizable amino lipids, non-cationic lipids, sterols, and polyethylene glycol-modified lipids. See, e.g., Buschmann et al. Vaccines. 2021. 9(1):65. In some embodiments, the capped RNA transcript is surrounded by the lipids of the lipid nanoparticle or the lipid microparticle and are present in the interior of the lipid nanoparticle or lipid microparticle. In some embodiments, the modified RNA is dispersed throughout the lipids of the lipid nanoparticle or lipid microparticle. In some embodiments, the lipid nanoparticle or lipid microparticle comprises an ionizable amino lipid, a non-cationic lipid, a sterol, and / or a polyethylene glycol (PEG)-modified lipid. Lipid nanoparticles and lipid microparticles comprising modified mRNAs may be prepared by any means generally known in the art, such as, for example, detergent dialysis, emulsion, centrifugation, evaporation, thin film hydration, or ethanol dilution. See, e.g., Barba et al. Pharmaceutics. 2019. 11 (8):360. An exosome refers to a type of lipid nanoparticle produced by eukaryotic cells as a result of the inward budding of vesicles within multivesicular bodies and are generally between 30 nm and 150 nm in diameter. Exosomes comprise a heterogenous mixture of endogenous lipids, such as phospholipids,514931-5478-7195.1Atty. Docket No. 114203-1901membrane-anchored proteins, and carbohydrates present in eukaryotic cells, and enclose an aqueous core. Exosomes may have beneficial features that are difficult to achieve with synthetically produced lipid nanoparticles, such as, for example, the ability to pass through the blood brain barrier and deliver modified RNAs to tissues within the brain. Exosomes comprising modified RNAs may be produced by any means generally known in the art, such as, for example, by sonicating or electroporating isolated exosomes in the presence of a modified RNA, or mixing exosomes with a lipid-conjugated modified RNA, such as, for example, a modified RNA that has been conjugated to cholesterol. See, e.g., Roberts et al. Nat Rev Drug Discov. 2020. 19(10):673-694.

[0130] In some embodiments, a nanoparticle or microparticle is a polymeric nanoparticle or polymeric microparticle, respectively. A polymeric nanoparticle or polymeric microparticle refers to a nanoparticle or microparticle composition, respectively, comprising one or more polymers that form an aggregate of polymers, or an enclosed structure with an interior surface and an exterior surface. In some embodiments, a polymeric nanoparticle or polymeric microparticle comprises a polymeric layer that encloses an aqueous core. Polymers used in the formulation of polymeric nanoparticles and polymeric microparticles for delivering RNA are generally known in the art, and include cationic polymers such as, but are not limited to, polyethylenimine (PEI), poly-amido-amine (PAA), poly-beta amino-esters (PBAEs), polylysine (PLL), spermine, chitosan, polyurethane, and derivatives thereof (e.g., PEI stearic acid (PSA) copolymer). See, e.g., Liu et al. Front Bioeng Biotechnol. 2021. 9:718753. In some embodiments, the modified RNA is surrounded by the polymers of the polymeric nanoparticle or the polymeric microparticle and are present in the interior of the polymeric nanoparticle or polymeric microparticle. In some embodiments, the modified RNA is dispersed throughout the polymers of the polymeric nanoparticle or polymeric microparticle.

[0131] In some embodiments, a nanoparticle or microparticle is a protein nanoparticle or protein microparticle, respectively. A protein nanoparticle or protein microparticle refers to a nanoparticle or microparticle composition, respectively, comprising one or more proteins that form an aggregate of proteins, or an enclosed structure with an interior surface and an exterior surface. In some embodiments, a protein nanoparticle or protein microparticle comprises a protein layer that encloses an aqueous core. Proteins used in the formulation of protein nanoparticles and protein microparticles for delivering RNA are generally known in the art, and524931-5478-7195.1Atty. Docket No. 114203-1901include but are not limited to, viral coat proteins and ferritin. See, e.g., Wang et al. Nat Ncmotechnol. 2020. 15(5):406-416. In some embodiments, the modified RNA is surrounded by the proteins of the protein nanoparticle or the protein microparticle and are present in the interior of the protein nanoparticle or protein microparticle. In some embodiments, the modified RNA is external to the proteins of the protein nanoparticle or the protein microparticle and are attached to the exterior surface of the protein nanoparticle or protein microparticle. In some embodiments, the modified RNA is conjugated to proteins of the protein nanoparticle or protein microparticle through a covalent linkage, such as, for example, that formed by a click chemistry reaction, or by fusing the modified RNA and protein each to a protein or peptide of a protein / peptide pair known to react to form a covalent linkage.

[0132] In some embodiments, a nanoparticle or microparticle is a solid nanoparticle or solid microparticle. A solid nanoparticle or solid microparticle refers to a nanoparticle or microparticle composition, respectively, comprising one or more materials that form a solid structure, which has an external surface and may or may not comprise an internal surface. A solid nanoparticle or solid microparticle may comprise any suitable material that is generally known in the art, such as, for example, gold, silver, or silicon dioxide (silica). In some embodiments, a modified RNA is conjugated to the external surface of a solid nanoparticle or solid microparticle. Solid nanoparticles and solid microparticles comprising modified RNAs may be produced by any means generally known in the art, such as, for example, by linking the modified RNAs to the surface of the solid nanoparticle or solid microparticle through thiol linkages (e.g., modifying the DNA to comprise cyclic disulfide-anchoring groups), or by modifying the external surface of the solid nanoparticle or solid microparticle with one or more cationic materials (e.g., PEI) within which modified RNAs are present. See, e.g., Roberts et al. Nat Rev Drug Discov. 2020. 19(10):673-694, Lee et al. Nano Lett. 2007, 7(7):2112-2115, and Paris and Vallet-Regi. Pharmaceutics. 2020, 12(6): 526.

[0133] In some aspects, the present disclosure provides cells comprising any of the modified RNAs provided herein. In some embodiments, the cell is a human cell comprising any one of the modified RNAs provided herein. A “cell” is the basic structural and functional unit of all known independently living organisms. It is the smallest unit of life that is classified as a living thing. Some organisms, such as most bacteria, are unicellular (consist of a single cell). Other organisms, such as plants, fungi, and animals, including cattle, horses, chickens, turkeys,534931-5478-7195.1Atty. Docket No. 114203-1901sheep, swine, dogs, cats, and humans, are multicellular. In some embodiments, the half-life of the modified RNA in the cell is 15-900 minutes. In some embodiments, the half-life of the modified RNA in the cell is 30-600 minutes. In some embodiments, the half-life of the modified RNA in the cell is 60-300 minutes. In some embodiments, the half-life of the modified RNA is at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60 minutes. In some embodiments, the half-life of the modified RNA in the cell is at least 30, at least 60, at least 90, at least 120, at least 150, at least 180, at least 210, at least 240, at least 270, at least 300, at least 330, at least 360, at least 390, at least 420, at least 450, at least 480, at least 510, at least 540, at least 570, at least 600, at least 630, at least 660, at least 690, at least 720, at least 750, at least 780, at least 810, at least 840, or at least 870 minutes. In some aspects, the present disclosure provides compositions comprising any of the modified mRNAs, delivery agents, or cells provided herein. In some embodiments, the composition further comprises one or more additional agents, such as a nucleotide, a nucleic acid, an amino acid, a peptide, a protein, a small molecule, an aptamer, a lipid, or a carbohydrate. In some embodiments, the additional agent has a therapeutic effect when administered to a subject. In some embodiments, the additional agent is an agent for use in modulating the expression and / or activity of one or more gene products (e.g., proteins) in a subject. In some embodiments, the additional agent is a nucleic acid for use in decreasing the expression and / or activity of one or more gene products (e.g., proteins), such as a short hairpin RNA (shRNA), small interfering RNA (siRNA), or an antisense oligonucleotide (ASO). In some embodiments, the additional agent is an inhibitor for decreasing the activity of one or more gene products (e.g., proteins). In some embodiments, the agent is a small molecular inhibitor. In some embodiments, the additional agent is an agent for enhancing an immune response in a subject. In some embodiments, the additional agent is an antigen, such as a nucleic acid antigen, a protein antigen, or a phospholipid antigen. In some embodiments, the additional agent is an adjuvant, such as, for example, aluminum hydroxide or potassium aluminum sulfate (alum), monophosphoryl lipid A (MPL), an oil-in-water emulsion (e.g., a squalene emulsion), a cytosine phosphoguanine (CpG) oligodeoxynucleotide, or another adjuvant that is known in the art. See, e.g., Di Pasquale, A et al. Vaccines. 2015. 3(2):320-343. In some embodiments, the composition is a pharmaceutical composition comprising any one of the modified RNAs, delivery agents, or cells provided herein, and a pharmaceutically acceptable excipient. Pharmaceutically acceptable excipients,544931-5478-7195.1Atty. Docket No. 114203-1901carriers, buffers, stabilizers, isotonicising agents, preservatives or antioxidants, or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may depend on the route of administration, e.g., parenteral, intramuscular, intradermal, sublingual, buccal, ocular, intranasal, subcutaneous, intrathecal, intratumoral, oral, vaginal, or rectal.

[0134] In some aspects, the present disclosure provides a method of administering to a subject any of the modified RNAs, delivery agents, cells, compositions, or pharmaceutical compositions provided herein. In some embodiments, the subject is a human. In some embodiments, the administration is parenteral, intramuscular, intradermal, sublingual, buccal, ocular, intranasal, subcutaneous, intrathecal, intratumoral, oral, vaginal, or rectal. In some embodiments, the composition is to be stored below 50°C, below 40 °C, below 30 °C, below 20 °C, below 10 °C, below 0 °C, below -10 °C, below -20 °C, below -30 °C, below -40 °C, below -50 °C, below -60°C, below -70 °C, or below -80 °C, such that the nucleic acids are relatively stable over time. In some embodiments, the modified RNA is introduced into a cell in a subject by in vivo electroporation. In vivo electroporation is the process of introducing nucleic acids or other molecules into a cell of a subject using a pulse of electricity, which promote passage of the nucleic acids or other molecules through the cell membrane and / or cell wall. See, e.g., Somiari et al. Molecular Therapy., 2000. 2(3): 178-187. The modified RNA to be delivered is administered to the subject, such as by injection, and a pulse of electricity is applied to the injection site, whereby the electricity promotes entry of the nucleic acid into cells at the site of administration. In some embodiments, the modified RNA is delivered to and taken up by cells of the subject (e.g., cells local to the site of administration or throughout the subject) via a delivery agent that is associated with (e.g., conjugated to) the modified RNA. In some embodiments, the modified RNA is administered with other elements, such as buffers and / or excipients, that increase the efficiency of electroporation.

[0135] In some aspects, the present disclosure provides a kit comprising any of the capped RNA oligonucleotides, RNA precursors, or modified RNAs provided herein. The capped RNA oligonucleotide and RNA precursor can be combined in the presence of an RNA ligase to produce a modified RNA, such as one of the modified RNAs provided herein. In some embodiments, the kit comprises a ligase. In some embodiments, the kit comprises an RNA554931-5478-7195.1Atty. Docket No. 114203-1901ligase. In some embodiments, the kit comprises a T4 RNA ligase. In some embodiments, a kit comprises a T4 RNA ligase 1. In some embodiments, a kit comprises a T4 RNA ligase 2. In some embodiments, the kit comprises an RtcB RNA ligase. In some embodiments, the kit further comprises a buffer for carrying out the ligation. In some embodiments, the kit further comprises a nucleotide triphosphate, such as ATP, to provide energy required by the ligase. In some embodiments, the kit is to be stored below 50 °C, below 40 °C, below 30 °C, below 20 °C, below 10 °C, below 0 °C, below -10 °C, below -20 °C, below -30 °C, below -40 °C, below -50 °C, below -60°C, below -70 °C, or below -80 °C, such that the nucleic acids are relatively stable over time.

[0136] In some aspects, the present disclosure provides a kit comprising any of the pharmaceutical compositions provided herein and a delivery device. A delivery device refers to machine or apparatus suitable for administering a composition to a subject, such as a syringe or needle. In some embodiments, the kit is to be stored below 50 °C, below 40 °C, below 30 °C, below 20 °C, below 10 °C, below 0 °C, below -10 °C, below -20 °C, below -30 °C, below -40 °C, below -50 °C, below -60°C, below -70 °C, or below -80 °C, such that the nucleic acids of the pharmaceutical composition are relatively stable over time. In some embodiments, the kit further comprises instructions for administering any of the pharmaceutical compositions provided herein to a subject.Pharmaceutical compositions for delivery and methods therefore

[0137] This invention provides pharmaceutical compositions comprising capped RNA molecules of the disclosure, particularly linear and circularized mRNA molecules. In certain embodiments pharmaceutical compositions of the invention further comprise pharmaceutically acceptable excipients and in certain other embodiments comprise one or more additional therapeutics agents.

[0138] In some embodiments, the compositions are suitable to be administered to a human subject in need thereof. In the context of the present disclosure, “active ingredient” refers generally to the capped RNA molecules described herein, particularly linear and circularized mRNA molecules as well as any additional therapeutic agents provided therewith.

[0139] It is generally understood by a person of ordinary skill in the art that the compositions described herein are also suitable for administration to any non-human subjects as564931-5478-7195.1Atty. Docket No. 114203-1901well. A person of ordinary skill in the veterinary arts will understand that pharmaceutical compositions described herein can be suitable for administration to mammals including but not limited to primates, cattle, pigs, horses, sheep, goats, cats, dogs, mice, rats, whales, and other mammals. A person of ordinary skill in the veterinary arts also will understand that pharmaceutical compositions described herein can be suitable for administration to birds including by not limited to chickens, ducks, geese, turkey, and other domesticated birds, as well as wild birds particularly endangered species of such birds. Additionally, a person of ordinary skill in the veterinary arts will understand that pharmaceutical compositions described herein can be suitable for administration to a wide variety of fish including commercial or wild salmon, tuna, cod, sardine, zebra fish, shark, or the like.

[0140] Pharmacological compositions described herein can be prepared by any method known or developed in the art of pharmacology, immunology, virology, or in biotechnology in general.

[0141] In some embodiments, the formulations of a pharmacological composition described herein can comprise a unit dose of at least one RNA, in addition to at least one other pharmaceutically acceptable excipient. Such excipients can include but are not limited to, solvents, dispersions, buffers, diluents, surfactants, emulsifiers, isotonic agents, preservatives, thickeners, lubricating agents, oils, or the like.

[0142] In some embodiments, the pharmacological composition can comprise a delivery mechanism further comprising a lipid nanoparticle. The size of the lipid nanoparticle can be altered to counteract immunogenic response from the subject, or to allow for increased potency and pharmacological activity.

[0143] In other embodiments, the pharmacological composition can comprise a delivery mechanism further comprising a lipidoid as previously described in the art. See Akinc etal., 2008, Nat Biotechnol. 26:561-596; Frank-Kamenetsky etal., Proc Natl A cad Set USA. 2008 105:11915- 11920; Akinc et al., 2009, Mol Ther. 17:872-879; Love et al., 2010. Proc Natl Acad Sci USA 107:1864- 1869; Leuschner et al., 2011, Nat Biotechnol. 29: 1005-1010, all of which is incorporated herein in their entirety. Lipidoids refers broadly to lipid nanoparticles, liposomes, lipid emulsions, lipid micelles and the like. Lipidoids containing the pharmacological composition comprising the derivatized RNA can be administered parenterally by means including but not limited to,574931-5478-7195.1Atty. Docket No. 114203-1901intravenous injection, intramuscular injection, subcutaneous injection, via dialysate, intrathecal injection, or intracranial injection.

[0144] A person of ordinary skill in the art would also recognize that other nucleotide delivery mechanisms exist such as the use of viral like, or viral derived particles. See Rohovie et al., 2016, Bioengineering & Translational Med. 2(1): 43-57. Virus like particles can include coat proteins or viral capsids of a virus. Such particles can be PEGylated or further annealed to compounds that avoid phagocytotic clearance. Additionally, the surface of the virus like particle can be further functionalized to provide cellular specific targeting, facilitate extravasation, facilitate radio labeling, improve permeability across cellular boundaries, or to transcytose the blood-brain barrier. The virus like particles can be derived for animal viruses, bacteriophages, or plant viruses. Examples of suitable virus for derivation of a virus like particle delivery mechanism include but are not limited to cowpea chlorotic mottle virus, cowpea mosaic virus, hepatitis B virus (core), enterobacteria phage MS2, Salmonella typhimurium P22, enterobacteria phage Q0 amongst other suitable viruses. Derivatized RNA payloads can be loaded into the virus like particles by electrostatic adsorption or any other suitable method known to a person of ordinary skill in the art.

[0145] Various exemplary embodiments of compositions and methods according to this invention are now described in the following non-limiting Examples. The Examples are offered for illustrative purposes only and are not intended to limit the scope of the invention in any way. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and the following examples and fall within the scope of the appended claims.

[0146] In some aspects, the present disclosure provides methods of targeted delivery RNAs to cells. Delivery can be accomplished in vitro or in vivo. In some embodiments, cell-type-specific delivery of RNAs can be achieved by delivering to cells a modified RNA as described herein. In some embodiments, cell-type-specific delivery is achieved as a result of specific combinations of nucleotide modifications near the 5’ terminus of the RNA at one or more of positions +1, +2, +3, +4, +5, or +6 with reference to a 5’ terminus of the RNA.

[0147] In some aspects, the present disclosure provides a method of expressing a modified RNA in a liver cell, such as a hepatocyte (e.g., a HepG2 cell). In some embodiments, the present disclosure provides a method of expressing a modified RNA in a liver cell, comprising contacting the liver cell with a modified RNA comprising (i) one or more modified nucleotides at one or more584931-5478-7195.1Atty. Docket No. 114203-1901of positions +1, +2, +3, +4, +5, or +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap. In some embodiments, the modified RNA comprises a modified nucleotide at position +1 with reference to the 5’ terminus. In some embodiments, the one or more modified nucleotide is selected from the group consisting of 2'-O-methyladenosine (20Me-A), locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-dimethyladenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5-methyl-locked nucleic acid (LNA)cytosine, P-d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-O-methyl-P-O-methyladenosine, N6, N6-dimethyladenine (m62A), Nl-methyl-inosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine, 2'-methoxyethoxy-adenosine (2M0E), and 5-methylcytosine (m5C). In some embodiments, the modified RNA comprises a m5C modification at position +1 with reference to the 5’ terminus. In some embodiments, the modified RNA comprises a m5C modification at each of positions +1, +3, and +5 with reference to the 5’ terminus. In some embodiments, the modified RNA comprises an N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus. In some embodiments, the modified RNA comprises an N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus. In some embodiments, the modified RNA comprises an N6,2'-O-dimethyladenosine (m6Am) modification at positions +1, +3, and +5 with reference to the 5’ terminus. In some embodiments, the modified RNA comprises a 2'-O-methyladenosine (20Me-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the modified RNA comprises a locked nucleic acid (LNA)adenosine (LNA-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the modified RNA comprises: an N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or an N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or an N6,2'-O-dimethyladenosine (m6Am) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or a 2'-O-methyladenosine (20Me-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or a locked nucleic acid (LNA)adenosine (LNA-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus.594931-5478-7195.1Atty. Docket No. 114203-1901

[0148] In some embodiments of expressing a modified RNA in a liver cell (e g., a hepatocyte or HepG2 cell), the modified RNA comprises: a m7G 5’ cap and an LNA modification at position +1 with reference to the 5’ terminus; a m7G 5’ cap and an LNAm5C modification at position +1 with reference to the 5’ terminus; a m7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and a 20Me modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus; an LNAm7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and a 20Me modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus; a m7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or a LNAm7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

[0149] In some aspects, the present disclosure provides a method of expressing a modified RNA in a leukocytic cell, such as a monocyte (e.g., a JAWSII cell), comprising contacting the leukocytic cell with a modified RNA comprising (i) one or more modified nucleotides at one or more of positions +1, +2, +3, +4, +5, or +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap. In some embodiments, the modified RNA comprises a modified nucleotide at position +1 with reference to the 5’ terminus. In some embodiments, the one or more modified nucleotide is selected from the group consisting of 2'-O-methyladenosine (20Me-A), locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-dimethyladenosine (m6Am), N6-benzyl-2’-O-methyladenosine (Bn6Am), 5-methyl-locked nucleic acid (LNA)cytosine, P-d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-O-methyl-P-O-methyladenosine, N6, N6-dimethyladenine (m62A), Nl-methyl-inosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine, 2 '-methoxy ethoxy-adenosine (2M0E), and 5 -methyl cytosine (m5C). In some embodiments, the modified RNA comprises a m5C modification at each of positions +1, +3, and +5 with reference to the 5’ terminus. In some embodiments, the modified RNA comprises: an N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or an N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A) modification at positions +1, +3, and +5 with reference to the 5’604931-5478-7195.1Atty. Docket No. 114203-1901terminus; or an N6,2'-O-dimethyladenosine (m6Am) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or an N6-benzyl-2'-O-m ethyladenosine (Bn6Am) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or a 2'-methoxyethoxy-adenosine (2M0E) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or a 2'-methoxyethoxy-adenosine (2M0E) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or a 2'-O-methyladenosine (20Me-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or a locked nucleic acid (LNA)adenosine (LNA-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus. In some embodiments, the modified RNA comprises: a m7G 5’ cap and a 2M0E modification at position +1 with reference to the 5’ terminus; a m7G 5’ cap and a 2M0E modification at each of positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; an LNAm7G 5’ cap and a 2M0E modification at each of positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; a m7G 5’ cap, a 2M0E modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or an LNAm7G 5’ cap, a 2M0E modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

[0150] In some aspects, the present disclosure provides a method of expressing a modified RNA in a skin cell, such as a melanocyte (e.g., a D4M 3A cell), comprising contacting the skin cell with a modified RNA comprising (i) one or more modified nucleotides at one or more of positions +1, +2, +3, +4, +5, or +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap. In some embodiments, the skin cell is a cancer cell, such as a melanoma. In some embodiments, the modified RNA comprises a modified nucleotide at position +1 with reference to the 5’ terminus. In some embodiments, the one or more modified nucleotide is selected from the group consisting of 2'-O-methyladenosine (20Me-A), locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-dimethyladenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5-methyl-locked nucleic acid (LNA)cytosine, P-d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thioLinosine, 2'-O-methyl-P-O-methyladenosine, N6, N6-dimethyladenine (m62A), Nl-methyl-inosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine,614931-5478-7195.1Atty. Docket No. 114203-19012'-methoxyethoxy-adenosine (2M0E), and 5-methylcytosine (m5C). In some embodiments, the modified RNA comprises: an N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or an N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or a 2'-O-methyladenosine (20Me-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or a locked nucleic acid (LNA)adenosine (LNA-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

[0151] In some aspects, the present disclosure provides a method of expressing a modified RNA in a human induced pluripotent stem cell (hiPSc), comprising contacting the hiPSc cell with a modified RNA comprising (i) one or more modified nucleotides at one or more of positions +1, +2, +3, +4, +5, or +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap. In some embodiments, the modified RNA comprises a modified nucleotide at position +1 with reference to the 5’ terminus. In some embodiments, the one or more modified nucleotide is selected from the group consisting of 2'-O-methyladenosine (2OMe-A), locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-dimethyladenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5-methyl-locked nucleic acid (LNA)cytosine, P-d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-O-methyl-P-O-methyladenosine, N6, N6-dimethyladenine (m62A), Nl-methyl-inosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine, 2 '-methoxy ethoxy-adenosine (2M0E), and 5-methylcytosine (m5C). In some embodiments, the modified RNA comprises: a m7G 5’ cap and a LNA modification at position +1 with reference to the 5’ terminus; a LNAm7G 5’ cap and a LNA modification at position +1 with reference to the 5’ terminus; a m7G 5’ cap and a m5C modification at position +1 with reference to the 5’ terminus; or a LNAm7G 5’ cap and a m5C modification at position +1 with reference to the 5’ terminus.

[0152] In one aspect, the present disclosure provides a method for inducing differentiation of a human induced pluripotent stem cell (hiPSc). In some embodiments, the present disclosure provides a method for inducing differentiation of a hiPSc into a neuron, comprising contacting the hiPSc with a modified mRNA encoding Atohl or Ngn2. In some embodiments, the modified mRNA comprises a LNAm7G 5’ cap, a LNA modification at position +1 from the 5’ terminus,624931-5478-7195.1Atty. Docket No. 114203-1901and a PS 2M0E modification at each of the 6 nucleotide positions closest to the 3’ terminus of the RNA followed by a terminal 2', 3 '-dideoxy cytidine (ddC). In some embodiments, the modified mRNA comprises a nucleotide sequence selected from SEQ ID NO: 5 and SEQ ID NO: 6.

[0153] In some aspects, the present disclosure provides a method for treating cancer in a subject. In one aspect, the present disclosure provides a method for treating melanoma in a subject, comprising administering to the subject a modified mRNA encoding IL-23, IL-36y, or OX40L. In some embodiments, the modified mRNA comprises a m7G 5’ cap, a LNA modification at positions +1, +2, +3, +4, +5, and +6 from the 5’ terminus, and a PS_2MOE modification at each of the 6 nucleotide positions closest to the 3’ terminus of the RNA followed by a terminal 2', 3'-dideoxycytidine (ddC). In some embodiments, the modified mRNA comprises at least two 5’ caps. In some embodiments, the modified mRNA comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9.

[0154] The disclosed methods of expressing a modified RNA in a particular cell type can be for therapeutic or diagnostic purposes. For example, any of the foregoing aspects of expressing a modified RNA in a particular cell type (e.g., a liver cell, a leukocyte, a skin cell, etc.) may comprise administering the modified RNA to a subject with a disease, condition, or disorder that is in need of treatment or diagnosis of the disease, condition, or disorder. The modified RNA may be administered to the subject parenterally (e.g., intravenously, subcutaneously, subdermally, intradermally, intramuscularly, etc ). The disease, condition, or disorder may impact a particular cell type and therefore be amenable to treatment or diagnosis via the disclose modified RNAs that possess cell-type specificity of expression. For example, in a subject with a skin cancer, such as a melanoma, the disclosed modified RNAs with specificity for expression in a skin cell could be administered to the subject to (i) express a therapeutic protein, or (ii) express a protein that would allow for diagnosis / tracking of metastasis, such as a fluorescent protein. Alternatively, the disclosed modified RNAs could be used to treat a disease that does not directly involved the cell type for which the modified RNA is specific. For example, the disclosed modified RNAs with specificity for expression in a leukocyte cell could be used to express a particular receptor (e.g., a chimeric antigen receptor or a T-cell receptor) that would improve targeting of the cell for a cancer in the subject.634931-5478-7195.1Atty. Docket No. 114203-1901EXAMPLESExample 1: Cell-type specific regulation of translation by 5’ mRNA chemical modifications

[0155] Current mRNA drugs are limited by its short half-life and relatively low translation capacity. Increasing the functional protein expressed from mRNA (translatability), through enhancements to its lifetime and translation efficiency, will benefit therapeutics from vaccination to functional protein delivery. Current mRNA engineering efforts are focusing on the generation of universally modified mRNA for every therapeutical application; however, different therapeutics have different requirements for cell-type specific protein expression to maximize the therapeutical effect and minimize the off-target effects. For example, selective protein expression in liver is desired for liver diseases-associated gene therapies to obtain optimal therapeutical performance and avoid side effect induced by off-target delivery; more protein expression in and presentation to antigen-presenting cells is beneficial in vaccine setting; higher and selective protein expression within tumor cells will boost the performance of most intratumoral injection settings. Therefore, chemical modifications with cell type specificity will be helpful to achieve optimal mRNA performance and different sets of modifications should be applied in different therapeutics.

[0156] As shown in FIG. 1, Applicant constructed a 5 ’-modified mRNA library and screened their activity screening within different cell types. As shown in FIG. 1A, LEGO enables the construction of mRNA libraries with 5' modifications, including base modifications, backbone modifications, and multi-base modification. FIG. IB shows the chemical structures of modified nucleotides screened in the study. Table 1 lists the chemical name for each modified nucleotide structure evaluated in the experiments described herein.Table 1. Modified Nucleotide Structures in Fig. IB _Structure Structure NameNumber1 Adenosine (rA)2 N6-methyladenosine (m6A)3 7,9-de-8-thiol-inosine4 N6, N6-dimethyladenosine644931-5478-7195.1Atty. Docket No. 114203-1901Structure Structure NameNumber5 N 1 -methylinosine6 Inosine7 5 -methylcytosine (m5C)8 2'-methoxy-adenosine (2'OMe)9 Locked nucleic acid (LNA)-adenosine10 ANA-adenosine [chemical name for ANA: P-d-arabinonucleosides]11 2'OMe-P-OMe12 ANA-2 'OMe13 2'MOEOE-adenosine14 2 '-deoxy adenosine15 Phosphorothioated adenosine16 2'-methoxy ethoxy-adenosine (2'MOE)17 N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A)18 N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A)19 N6,2'-O-dimethyladenosine (m6Am)20 N6-benzyl-2'-O-methyladenosine (Bn6Am)21 5-methyl-locked nucleic acid (LNA)cytosine22 2 '-methoxy-adenosine (2'OMe) sugar modification for base 1 to 623 Locked nucleic acid (LNA) sugar modification for base 1 to 624 2 '-methoxy ethoxy-adenosine (2'MOE) sugar modification for base 1 to 625 N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A) for base 1,3,526 N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A) for base 1,3,5 27 N6,2'-O-dimethyladenosine (m6Am) for base 1,3,528 N6-benzyl-2'-O-methyladenosine (Bn6Am) for base 1,3,5654931-5478-7195.1Atty. Docket No. 114203-1901

[0157] The screening workflow employed by Applicant involved generation of a modified mRNA library followed by transfection of modified mRNAs to various cell-types. Different modifications were incorporated to the 5' of oligonucleotides (12nt) through solidphase DNA / RNA synthesis, followed by chemical capping to introduce m7G cap and ligation with a Firefly luciferase (Flue) reporter mRNA prepared by in-vitro transcription (IVT). The resulting modified firefly mRNAs together with Renilla luciferase (Rluc) as transfection control were transfected into various different cell lines (HepG2, JAWSII and D4M 3 A). Luminescence signals were recorded at indicated time point as a readout of expression.

[0158] FIG. 1C shows a heatmap representing the results of a dual-luciferase assay experiment involving the screening of chemically modified mRNAs in seven different cell types (Human induced pluripotent stem cells (iPSCs), neurons, fibroblasts, immune cells, cancer cells (melanoma), and hepatocytes). Tested cell types include HepG2 cells, JAWSII cells, D4M cells, 3T3 cells, neurons, iPSCs, and BJ cells. Protein expression of FLuc luminescence reporter was normalized to RLuc luminescence (transfection control) and compared to the regular cap (1) construct (red line) at 24 hours after transfection (n = 3 biological replicates; mean± s.e.m.). The indicated modified nucleotide was present at position +1 from the 5’ terminus of the RNA.

[0159] FIG. ID shows a heatmap representing the results of a dual-luciferase assay experiment involving the screening of chemically modified mRNAs having multiple modified bases in several different cell lines, as shown in the schematic. In particular “(1)” means that the indicated modified nucleotide is present at position +1 from the 5’ terminus of the RNA; “(3)” means that the indicated modified nucleotide is present at position +3 from the 5’ terminus of the RNA; “x3” means that the indicated modified nucleotide is present at positions +1, +3, and +5 from the 5’ terminus of the RNA; and “x6” means that the indicated modified nucleotide is present at positions +1, +2, +3, +4, +5, and +6 from the 5’ terminus of the RNA. Luminence was measured at 8 and 24 hours post-transfection. Protein expression of the FLuc luminescence reporter was normalized to RLuc luminescence (transfection control) and compared with the regular cap (mono-m7G-rA) construct at 8 and 24 hours post transfection, n = 3, biological replicates. Mean ± sem. The same experimental conditions were applied to experiments to test the expression of such constructs in JAWSII cells, HepG2 cells, iPScs, and D4M 3A cells. FIG.664931-5478-7195.1Atty. Docket No. 114203-1901IE is a scatter plot showing the average translation efficiency and relative cell type specificity for each of the mRNA modifications across different cell types.

[0160] To optimize cell-type specific expression of mRNAs, Applicant tested the effect of various combinations of modifications on expression in the three tested cell lines. Applicant generated mRNAs having various combinations of the 5’ mRNA modifications described above. Different optimal modifications on the first nucleotide or multiple positions of the mRNA were combined in one construct through solid-phase oligonucleotide synthesis. In FIGS. 1F-1I, the construct naming scheme is as follows: cap - first nucleotide - second nucleotide - third nucleotide...where *5 means that the next 5 contiguous nucleotides are of the indicated modification, and where *6 means that the next 6 contiguous nucleotides are of the indicated modification. The protein expression of resulting oligonucleotides with combined modifications were tested in different cell lines to evaluate their cell type selectivity. FIG. IF shows luciferase (Flue) activity after transfection of HepG2 cells with control mRNA (mono-m7G-rA) construct or modified mRNA containing successive optimizations. FIG. 1G shows luciferase (Flue) activity after transfection of JAWSII cells with control mRNA (mono-m7G-rA) construct or modified mRNA containing successive optimizations. FIG. 1H shows luciferase (Flue) activity after transfection of hiPS cells with control mRNA (mono-m7G-rA) construct or modified mRNA containing successive optimizations. FIG. II shows luciferase (Flue) activity after transfection of D4M 3A cells with control mRNA (mono-m7G-rA) construct or modified mRNA containing successive optimizations. Certain combinations of modifications were highly selective for expression in particular cell types. In all experiments, protein expression of the FLuc luminescence reporter was normalized to RLuc luminescence (transfection control) and compared with the regular cap (mono-m7G-rA) construct (red line), n = 3, biological replicates. Mean ± sem. These experiments demonstrated that 5’ mRNA modifications of particular types and in particular positions and combinations were sufficient to enable cell-type specific expression of such mRNAs.

[0161] Certain combinations of modifications were observed to impart cell-type-specific expression patterns in various different cell types. Applicant validated this observed cell-type-specificity in hepatocyte and monocyte-derived cell lines, as shown in FIG. 2. The SAR analysis also identified several chemical modifications that exhibited pronounced cell type-dependent674931-5478-7195.1Atty. Docket No. 114203-1901expression, enhancing translation in certain cell types while suppressing it in others. This feature is advantageous for mRNA design, as maximizing protein production in target cells while minimizing expression in therapeutically irrelevant cells is equally critical for effective disease treatment and for reducing potential off-target effects. To further demonstrate this feature, Applicant selected HepG2 and JAWSII cell lines as models, as maximizing the expression contrast between hepatocytes and immune cells could be advantageous for therapeutic applications such as correcting liver-related metabolic disorders or developing dendritic cell-targeted vaccines. Applicant first screened a panel of 5' chemical modifications in both HepG2 and JAWSII cell lines. mRNA constructs containing 2'MOE sugar backbone modifications on base +1 to +6 showed preferential expression in JAWSII cells compared to HepG2, exhibiting up to 3.1-fold selectivity. Replacing the modification from 2'MOE to LNA on base +2 to +6 further improved the overall translation in the JAWSII cell line, but with compromised specificity. (FIGS. 2A-2B). Conversely, Applicant identified LNAm5C as a 5' modification that preferentially enhanced translation in HepG2 cells while suppressing it in JAWSII cells (FIG.1C). To further explore the potential of LNAm5C-associated mRNA constructs, Applicant generated a series of modified mRNAs incorporating LNAm5C alone or in combination with other chemical modifications and evaluated their translational performance in both cell lines. While either the m5C base modification or LNA sugar backbone modification alone produced a measurable expression contrast between HepG2 and JAWSII cells, their combination resulted in an even more pronounced effect, achieving a 7.1-fold selectivity. (FIG. 2C) Additional modification with either 2'0Me on base +2 to +6 or LNAm7G cap analog further improved translation in both cell lines leading to compromised specificity. Overall, the 2'MOE sugar backbone modification at bases +1 to +6 and the LNAm5C modification at the first base were identified as the most pronouncedly specific candidates for the JAWSII and HepG2 cell lines, respectively. Applicant therefore selected these two modifications for further exploration of celltype-specific expression.

[0162] Applicant next developed and tested a workflow for assessing cell-type specificity of certain modified mRNA constructs in vivo. As shown in FIG. 2D, modified mNeon Green mRNA was co-encapsulated with unmodified tdTomato mRNA in a lipid nanoparticle (LNP). 16 hours after retro-orbital (R. O.) injection in mice, the livers of the mice were harvested and assayed using flow cytometry -based cell typing. Relative mNeon / tdTomato positive cells (FIG.684931-5478-7195.1Atty. Docket No. 114203-19012E) and MFI (FIG. 2F) were evaluated in different cell types, (n = 3 biological replicates; mean± s.e.m.). Applicant observed greater mNeon Green expression in the livers of mice administered modified mRNA when compared to the livers of mice administered unmodified mRNA. Expression differences in other tested tissue types were not observed. Moreover, Applicant observed that modification did not increase the positive cell population in the immune cells within the liver. These experiments suggest that the 5’ modification enable cell-type-specific expression of the mRNA in vivo.

[0163] Achieving cell type-specific expression is essential for the therapeutic efficacy of mRNA-based therapies. To further improve specificity, Applicant examined whether chemical modifications are compatible with other technologies that confer cell type-selective expression of mRNA. In particular, Applicant explored the inclusion of miRNA elements, such as miRNA on-switches and miRNA off-switches.

[0164] As a proof of concept, Applicant engineered mRNA constructs that selectively produce proteins in either hepatocytes or immune cells by combining chemical modifications with miRNA off- and on-switch elements. (FIG. 2G) The hepatocellular carcinoma cell line Huh7, which expresses high levels of miR-122 and low levels of miR-142, and the JAWSII cell line, which exhibits the opposite pattern — high miR-142 and low miR-122 expression — were used as model systems for expression evaluation. Accordingly, the LNAm5C modification at the first nucleotide, a miR-142 off-element in the 3'UTR, and miR-122 on-elements were combined to generate a hepatocyte-specific construct. Initially, the miR-142 off-element reduced translation of the unmodified mRNA in the JAWSII cell line, resulting in a 1.8-fold selectivity favoring the Huh7 cell line. Further incorporation of the miR-122 on-element produced only a negligible effect on specificity. In contrast, the LNAm5C modification alone yielded a 3.2-fold specificity for Huh7 cells, while its combination with the miR-142 off-element alone or with both the miR-142 off- and miR-122 on-elements further improved specificity up to 4.1-fold (FIG. 2H). Meanwhile, for immune cell-specific expression, Applicant evaluated constructs incorporating the 2MOE><6 modification together with miR-122 off- and miR-142 on-elements. The miR-122 off-element alone conferred 3.1-fold specificity, which increased to 6.6-fold upon combination with the miR-142 on-element in unmodified mRNA. The 2MOE><6 modification alone achieved a 3.28-fold specificity, and when combined with both miRNA elements, it produced a striking 16.6-fold selectivity in the JAWSII cell line (FIG. 2H). Notably, although694931-5478-7195.1Atty. Docket No. 114203-1901miRNA regulatory elements enhanced the specificity of mRNA constructs, they generally reduced overall translation levels. In contrast, chemical modifications acted through a distinct mechanism — enhancing translation selectively in the target cell type. Consequently, a strong synergistic effect was observed when combining chemical modifications with miRNA regulatory elements.Example 2: Differential binding to cap-binding proteins contributes to cell type-specific mRNA expression.

[0165] To elucidate the mechanism underlying chemical modification-induced ceil typespecific mRNA expression, Applicant selected LNAm5C and 2'MOE><6 modifications as representative examples for further investigation. Using a mass spectrometry -based pull-down assay, Applicant profiled the proteins bound to these modified mRNAs and found that 2'MOE><6 preferentially enriched ribosomal and translation -rel ted proteins, whereas LNAm5C showed reduced enrichment. These findings are consistent with Applicant’s earlier observations that LNAm5C inhibited translation in the JAWSII cell line, while 2'MOE><6 markedly enhanced translation (FIGS. 3A-3B).

[0166] Applicant next performed gel-shift assays to further evaluate the binding affinities of various 5 '-modified oligonucleotides to cap-binding proteins, including eIF4El, eIF4E2, eIF4E3, and IFIT1. The results revealed that different chemical modifications conferred distinct affinities toward individual cap-binding proteins (FIGS. 3C-3G).

[0167] Applicant then examined the mRNA expression levels of cap-binding proteins across different cell lines and observed marked cell type-specific signatures in translation -rel ted components (FIG. 3H). Correlating the expression levels of individual translation initiation factors with the translation efficiencies measured previously in each cell type revealed strong correlations for both LNAm5C and 2'MOE*6 modifications (FIGS. 3I-3J). To further validate these correlations, Applicant conducted overexpression experiments of selected elF proteins in representative cell lines. For LNAm5C-modified mRNA, the correlation coefficient between eIF4El expression and translation was positive, indicating a direct relationship, whereas eIF4E3 showed a negative correlation. Consistently, overexpression of eIF4El in JAWSII cells significantly decreased firefly luciferase expression, while overexpression of eIF4E3 in HepG2 cells led to reduced translation (FIGS. 3K-3L). Overall, these results indicate that the differential binding of chemically modified mRNAs to cap-binding proteins, together with cell type-specific704931-5478-7195.1Atty. Docket No. 114203-1901expression patterns of endogenous translation factors, collectively contribute to the observed chemical modification-induced cell type specificity.Example 3: Optimized mRNA for more efficient stem cell differentiation

[0168] Stem cell engineering has emerged as a promising approach in regenerative medicine, utilizing either autologous or allogeneic cells for the regeneration and replacement of specific cell types for disease treatment. Recent clinical advances have demonstrated the alleviation of Parkinson’s disease symptoms through transplantation of hiPSC-derived dopaminergic neurons into patients, further underscoring the importance of efficient and well-controlled cell manufacturing in vitro.

[0169] To demonstrate the capacity and necessity of applying mRNAs with cell type specificity, Applicant next generated mRNA constructs optimized with specific combinations of chemical modifications for human iPSC differentiation. mRNA constructs encoding Atohl and Ngn2, two transcription factors that promote dopaminergic neuron lineage commitment from hiPSCs, were synthesized using the RNA LEGO platform incorporating an LNAm7G cap modification and an LNA sugar backbone modification at base +1. To enhance mRNA stability, an additional ligation step was performed to introduce nuclease-resistant phosphorothioate (PS) linkages and a terminal 2', 3 '-di deoxycytidine (ddC) residue at the 3' end, which slowed mRNA deadenylation and prevented self-ligation. The structure of these linkages is designated PS_2MOE*6+ddC; the 3’ end of the modified RNA contained the following structure:( / i2MOErA / * A2MOErA / * / i2MOErA / i2MOErG / * / i2MOErG / * / i2MOErG / * / 3ddC / ). The optimized construct was first validated using firefly luciferase reporter mRNA, showing a 2.55-fold increase in the area under the curve (AUC) of luminescence.

[0170] Subsequently, Applicant applied a previously established mRNA-based hiPSC differentiation protocol and designed three transfection regimens varying in mRNA dosage and transfection frequency (FIG. 4B). Briefly, Atoh l mRNA, either unmodified or chemically optimized, was transfected during the first three days, followed by Ngn2 mRNA transfection on day 4. Cells were harvested on day 6 to assess marker gene expression and quantify differentiation efficiency and subsequently reseeded for in vitro maturation. To evaluate differentiation efficiency, Applicant measured the expression of NeuroDl, a neuronal progenitor cell marker, using qPCR. The results showed that mRNAs with optimized chemical modifications induced significantly higher NeuroDl expression compared to unmodified control714931-5478-7195.1Atty. Docket No. 114203-1901mRNAs. Remarkably, a single transfection of optimized Atohl mRNA (1.5 pg) produced NeuroDl expression levels comparable to those achieved with three transfections of the control mRNA. Moreover, chemical modification enabled robust differentiation even at a lower mRNA dose (0.5 pg), with up to a 5.2-fold increase in NeuroDl expression (FIG. 4C).

[0171] To evaluate neuronal yield, total neuron numbers were quantified on day 35 postdifferentiation using DAPI staining, revealing that optimized mRNAs produced a significantly higher number of neurons (FIG. 4E). To further characterize the differentiated dopaminergic neurons, immunostaining was performed, confirming strong expression of key dopaminergic markers including tyrosine hydroxylase (TH) and dopamine transporter (DAT), as well as Tuj 1, which outlines neuronal morphology (FIG. 4D). Applicant observed that optimized mRNAs generated a substantially greater number of dopaminergic neurons with more mature morphology. Overall, these results demonstrate that mRNAs carrying optimized chemical modifications — designed to maximize protein expression in hiPSCs — induced more efficient and higher-quality differentiation into dopaminergic neurons.Example 4: Cancer cell specific modification enables enhanced mRNA-based cancer immunotherapy

[0172] In addition to demonstrating the potential of cell type-specific mRNA modifications for in vitro stem cell differentiation, Applicant further evaluated their performance in cancer immunotherapy. (FIG. 5A) Previous studies have shown that intratumoral injection of mRNA cocktails encoding cytokines such as IL-23 and IL-36y, together with the T cell costimulatory ligand OX40L, induces robust immune cell infiltration into tumors and promotes effective tumor clearance in hepatoma and colon carcinoma mouse models. Applicant hypothesized that maximizing tumor cell-specific mRNA expression could further enhance immune activation, thereby eliciting stronger anti-tumor effects. To test this hypothesis, Applicant selected the D4M-3A mouse melanoma cell line, a well-established poorly immunogenic and difficult-to-treat tumor model, to evaluate the therapeutic performance of the optimized mRNA cocktail.

[0173] Applicant began with the m7G + LNA*6 combination, previously identified as the optimal modification pattern for maximizing mRNA expression in the D4M 3A cell. In parallel, Applicant employed a dual-capped mRNA topology with 3 '-tail stabilization to further enhance overall protein production. Notably, Applicant developed a novel synthetic strategy724931-5478-7195.1Atty. Docket No. 114203-1901enabling the direct solid-phase synthesis of branched oligonucleotides for constructing dualcapped oligos, thereby improving scalability and programmability of synthesis. Specifically, a 5-methyl-2'-deoxy cytidine (5-Me-dC) brancher phosphoramidite monomer carrying a levulinyl protection group was introduced during stem-strand synthesis on a controlled pore glass (CPG) support. Subsequent hydrazine-based deprotection exposed a secondary hydroxyl group on the brancher monomer, which served as an initiation site for branch-strand extension. The resulting branched oligonucleotide was then cleaved from the CPG, deprotected, and subjected to chemical capping followed by enzymatic ligation. This workflow significantly simplified the preparation of branched oligonucleotide intermediates and eliminated the need for click chemistry, which may otherwise cause RNA degradation and restrict synthesis scalability.Moreover, the method is fully compatible with any chemical modifications available in phosphoramidite form. To validate and optimize the performance of branched oligonucleotides synthesized via this direct solid-phase approach, Applicant systematically screened the stem- and branch-strand lengths as well as a panel of linker structures, using firefly luciferase mRNA as the reporter. Applicant identified 6 nt and 7 nt as the optimal lengths for the stem and branch strands, respectively, along with a hexane-diol linker for the branch strand. By combining the 5' modification (LNA*6), dual capping topology and tail stabilization (PS_2MOE*6+ddC), Applicant achieved a 6.9-fold increase in protein expression in the D4M-3A cell line at 24 hours post-transfection and a 7.4-fold increase at 48 hours post-transfection.

[0174] Applicant next applied the optimized construct to IL-23, IL-36y, and OX40L mRNAs and observed markedly enhanced protein expression in the D4M-3A cell line as confirmed by western blotting (FIG. 5B). A total of 3 pg of the mRNA cocktail-LNP complex, with or without chemical modifications, was intratumorally injected into tumor-bearing mice every other day for three doses (FIG. 5C). PolyC RNA was used as a negative control to exclude nonspecific effects arising from RNA or lipid vehicle administration. Tumor growth was monitored following mRNA-LNP administration. Both the unmodified and optimized mRNA cocktails significantly suppressed tumor progression, whereas the PolyC RNA-LNP treatment produced no detectable effect, indicating that the expressed cytokine and costimulatory proteins were responsible for eliciting immune activation and anti-tumor responses (FIG. 5D). Notably, the optimized mRNA cocktail exhibited superior therapeutic efficacy, achieving complete tumor regression in 40% of D4M-3A melanoma-bearing mice, while the control mRNA cocktail failed734931-5478-7195.1Atty. Docket No. 114203-1901to induce tumor clearance 50 days post-implantation (FIG. 5E). To assess whether the optimized mRNA cocktail induced long-term anti-tumor immune memory, rechallenge experiments were conducted using parental melanoma cells in mice that had completely regressed after treatment. All naive animals succumbed to tumor growth, whereas previously treated survivors remained tumor-free (FIG. 5F). Together, these results demonstrate that chemical modifications tailored to maximize tumor-specific protein expression significantly enhance the efficacy of mRNA-based cancer immunotherapy.Table 2. Sequences of certain tested mRNA constructsSEQ Figure Description SequenceID NO1 2G Construct of agaaaaagaataaactagtattcttctggtccccacagactcagagagaacccgcca miR-122 off ccatggaagatgccaaaaacattaagaagggcccagcgccattctacccactcgaa gacgggaccgccggcgagcagctgcacaaagccatgaagcgctacgccctggtg cccggcaccatcgcctttaccgacgcacatatcgaggtggacattacctacgccga gtacttcgagatgagcgttcggctggcagaagctatgaagcgctatgggctgaatac aaaccatcggatcgtggtgtgcagcgagaatagcttgcagttcttcatgcccgtgttg ggtgccctgttcatcggtgtggctgtggccccagctaacgacatctacaacgagcg cgagctgctgaacagcatgggcatcagccagcccaccgtcgtattcgtgagcaag aaagggctgcaaaagatcctcaacgtgcaaaagaagctaccgatcatacaaaagat catcatcatggatagcaagaccgactaccagggcttccaaagcatgtacaccttcgt gacttcccatttgccacccggcttcaacgagtacgacttcgtgcccgagagcttcga ccgggacaaaaccatcgccctgatcatgaacagtagtggcagtaccggattgccca agggcgtagccctaccgcaccgcaccgcttgtgtccgattcagtcatgcccgcgac cccatcttcggcaaccagatcatccccgacaccgctatcctcagcgtggtgccatttc accacggcttcggcatgttcaccacgctgggctacttgatctgcggctttcgggtcgt gctcatgtaccgcttcgaggaggagctattcttgcgcagcttgcaagactataagatt caatctgccctgctggtgcccacactatttagcttcttcgctaagagcactctcatcga caagtacgacctaagcaacttgcacgagatcgccagcggcggggcgccgctcag caaggaggtaggtgaggccgtggccaaacgcttccacctaccaggcatccgccag ggctacggcctgacagaaacaaccagcgccattctgatcacccccgaaggggac gacaagcctggcgcagtaggcaaggtggtgcccttcttcgaggctaaggtggtgg acttggacaccggtaagacactgggtgtgaaccagcgcggcgagctgtgcgtccg tggccccatgatcatgagcggctacgttaacaaccccgaggctacaaacgctctcat cgacaaggacggctggctgcacagcggcgacatcgcctactgggacgaggacg agcacttcttcatcgtggaccggctgaagagcctgatcaaatacaagggctaccag gtagccccagccgaactggagagcatcctgctgcaacaccccaacatcttcgacgc cggggtcgccggcctgcccgacgacgatgccggcgagctgcccgccgcagtcgt cgtgctggaacacggtaaaaccatgaccgagaaggagatcgtggactatgtggcc agccaggttacaaccgccaagaagctgcgcggtggtgttgtgttcgtggacgaggt gcctaaaggactgaccggcaagttggacgcccgcaagatccgcgagattctcatta aggccaagaagggcggcaagatcgccgtgtgataatagctcgaggctggagcctcggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttcctgcac744931-5478-7195.1Atty. Docket No. 114203-1901SEQ Figure Description SequenceID NOccgtacccccCAAACACCATTGTCACACTCCAgtggtctttgaa taaagtctgagtgggcggcacaattgaaaaaaaaaaaaaaaaaaaaaaaaaaaaa gcatatgactaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2 Construct of agaaaaagaataaactagtattcttctggtccccacagactcagagagaacccgcca miR-142 off ccatggaagatgccaaaaacattaagaagggcccagcgccattctacccactcgaa gacgggaccgccggcgagcagctgcacaaagccatgaagcgctacgccctggtg cccggcaccatcgcctttaccgacgcacatatcgaggtggacattacctacgccga gtacttcgagatgagcgttcggctggcagaagctatgaagcgctatgggctgaatac aaaccatcggatcgtggtgtgcagcgagaatagcttgcagttcttcatgcccgtgttg ggtgccctgttcatcggtgtggctgtggccccagctaacgacatctacaacgagcg cgagctgctgaacagcatgggcatcagccagcccaccgtcgtattcgtgagcaag aaagggctgcaaaagatcctcaacgtgcaaaagaagctaccgatcatacaaaagat catcatcatggatagcaagaccgactaccagggcttccaaagcatgtacaccttcgt gacttcccatttgccacccggcttcaacgagtacgacttcgtgcccgagagcttcga ccgggacaaaaccatcgccctgatcatgaacagtagtggcagtaccggattgccca agggcgtagccctaccgcaccgcaccgcttgtgtccgattcagtcatgcccgcgac cccatcttcggcaaccagatcatccccgacaccgctatcctcagcgtggtgccatttc accacggcttcggcatgttcaccacgctgggctacttgatctgcggctttcgggtcgt gctcatgtaccgcttcgaggaggagctattcttgcgcagcttgcaagactataagatt caatctgccctgctggtgcccacactatttagcttcttcgctaagagcactctcatcga caagtacgacctaagcaacttgcacgagatcgccagcggcggggcgccgctcag caaggaggtaggtgaggccgtggccaaacgcttccacctaccaggcatccgccag ggctacggcctgacagaaacaaccagcgccattctgatcacccccgaaggggac gacaagcctggcgcagtaggcaaggtggtgcccttcttcgaggctaaggtggtgg acttggacaccggtaagacactgggtgtgaaccagcgcggcgagctgtgcgtccg tggccccatgatcatgagcggctacgttaacaaccccgaggctacaaacgctctcat cgacaaggacggctggctgcacagcggcgacatcgcctactgggacgaggacg agcacttcttcatcgtggaccggctgaagagcctgatcaaatacaagggctaccag gtagccccagccgaactggagagcatcctgctgcaacaccccaacatcttcgacgc cggggtcgccggcctgcccgacgacgatgccggcgagctgcccgccgcagtcgt cgtgctggaacacggtaaaaccatgaccgagaaggagatcgtggactatgtggcc agccaggttacaaccgccaagaagctgcgcggtggtgttgtgttcgtggacgaggt gcctaaaggactgaccggcaagttggacgcccgcaagatccgcgagattctcatta aggccaagaagggcggcaagatcgccgtgtgataatagctcgaggctggagcctc ggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttcctgcac ccgtacccccTCCATAAAGTAGGAAACACTACAgtggtctttg aataaagtctgagtgggcggcacaattgaaaaaaaaaaaaaaaaaaaaaaaaaaa aagcatatgactaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 3 Construct of agaaaaagaataaactagtattcttctggtccccacagactcagagagaacccgcca miR-122 ccatggaagatgccaaaaacattaagaagggcccagcgccattctacccactcgaa off-miR142 gacgggaccgccggcgagcagctgcacaaagccatgaagcgctacgccctggtgon cccggcaccatcgcctttaccgacgcacatatcgaggtggacattacctacgccga754931-5478-7195.1Atty. Docket No. 114203-1901SEQ Figure Description SequenceID NOgtacttcgagatgagcgttcggctggcagaagctatgaagcgctatgggctgaatac aaaccatcggatcgtggtgtgcagcgagaatagcttgcagttcttcatgcccgtgttg ggtgccctgttcatcggtgtggctgtggccccagctaacgacatctacaacgagcg cgagctgctgaacagcatgggcatcagccagcccaccgtcgtattcgtgagcaag aaagggctgcaaaagatcctcaacgtgcaaaagaagctaccgatcatacaaaagat catcatcatggatagcaagaccgactaccagggcttccaaagcatgtacaccttcgt gacttcccatttgccacccggcttcaacgagtacgacttcgtgcccgagagcttcga ccgggacaaaaccatcgccctgatcatgaacagtagtggcagtaccggattgccca agggcgtagccctaccgcaccgcaccgcttgtgtccgattcagtcatgcccgcgac cccatcttcggcaaccagatcatccccgacaccgctatcctcagcgtggtgccatttc accacggcttcggcatgttcaccacgctgggctacttgatctgcggctttcgggtcgt gctcatgtaccgcttcgaggaggagctattcttgcgcagcttgcaagactataagatt caatctgccctgctggtgcccacactatttagcttcttcgctaagagcactctcatcga caagtacgacctaagcaacttgcacgagatcgccagcggcggggcgccgctcag caaggaggtaggtgaggccgtggccaaacgcttccacctaccaggcatccgccag ggctacggcctgacagaaacaaccagcgccattctgatcacccccgaaggggac gacaagcctggcgcagtaggcaaggtggtgcccttcttcgaggctaaggtggtgg acttggacaccggtaagacactgggtgtgaaccagcgcggcgagctgtgcgtccg tggccccatgatcatgagcggctacgttaacaaccccgaggctacaaacgctctcat cgacaaggacggctggctgcacagcggcgacatcgcctactgggacgaggacg agcacttcttcatcgtggaccggctgaagagcctgatcaaatacaagggctaccag gtagccccagccgaactggagagcatcctgctgcaacaccccaacatcttcgacgc cggggtcgccggcctgcccgacgacgatgccggcgagctgcccgccgcagtcgt cgtgctggaacacggtaaaaccatgaccgagaaggagatcgtggactatgtggcc agccaggttacaaccgccaagaagctgcgcggtggtgttgtgttcgtggacgaggt gcctaaaggactgaccggcaagttggacgcccgcaagatccgcgagattctcatta aggccaagaagggcggcaagatcgccgtgtgataatagctcgaggctggagcctc ggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttcctgcac ccgtacccccCAAACACCATTGTCACACTCCAgtggtctttgaa taaagtctgagtgggcggcacaattgaaaaaaaaaaaaaaaaaaaaaaaaaaaaa gcatatgactaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaTCCATAAAGTAGGAAACACTACAATTT ATTTATTTATTTATTTATTTATTTTTT4 Construct of agaaaaagaataaactagtattcttctggtccccacagactcagagagaacccgcca miR-142 ccatggaagatgccaaaaacattaagaagggcccagcgccattctacccactcgaa off-miR- gacgggaccgccggcgagcagctgcacaaagccatgaagcgctacgccctggtg 122on cccggcaccatcgcctttaccgacgcacatatcgaggtggacattacctacgccga gtacttcgagatgagcgttcggctggcagaagctatgaagcgctatgggctgaatac aaaccatcggatcgtggtgtgcagcgagaatagcttgcagttcttcatgcccgtgttg ggtgccctgttcatcggtgtggctgtggccccagctaacgacatctacaacgagcg cgagctgctgaacagcatgggcatcagccagcccaccgtcgtattcgtgagcaag aaagggctgcaaaagatcctcaacgtgcaaaagaagctaccgatcatacaaaagat catcatcatggatagcaagaccgactaccagggcttccaaagcatgtacaccttcgtgacttcccatttgccacccggcttcaacgagtacgacttcgtgcccgagagcttcga764931-5478-7195.1Atty. Docket No. 114203-1901SEQ Figure Description SequenceID NOccgggacaaaaccatcgccctgatcatgaacagtagtggcagtaccggattgccca agggcgtagccctaccgcaccgcaccgcttgtgtccgattcagtcatgcccgcgac cccatcttcggcaaccagatcatccccgacaccgctatcctcagcgtggtgccatttc accacggcttcggcatgttcaccacgctgggctacttgatctgcggctttcgggtcgt gctcatgtaccgcttcgaggaggagctattcttgcgcagcttgcaagactataagatt caatctgccctgctggtgcccacactatttagcttcttcgctaagagcactctcatcga caagtacgacctaagcaacttgcacgagatcgccagcggcggggcgccgctcag caaggaggtaggtgaggccgtggccaaacgcttccacctaccaggcatccgccag ggctacggcctgacagaaacaaccagcgccattctgatcacccccgaaggggac gacaagcctggcgcagtaggcaaggtggtgcccttcttcgaggctaaggtggtgg acttggacaccggtaagacactgggtgtgaaccagcgcggcgagctgtgcgtccg tggccccatgatcatgagcggctacgttaacaaccccgaggctacaaacgctctcat cgacaaggacggctggctgcacagcggcgacatcgcctactgggacgaggacg agcacttcttcatcgtggaccggctgaagagcctgatcaaatacaagggctaccag gtagccccagccgaactggagagcatcctgctgcaacaccccaacatcttcgacgc cggggtcgccggcctgcccgacgacgatgccggcgagctgcccgccgcagtcgt cgtgctggaacacggtaaaaccatgaccgagaaggagatcgtggactatgtggcc agccaggttacaaccgccaagaagctgcgcggtggtgttgtgttcgtggacgaggt gcctaaaggactgaccggcaagttggacgcccgcaagatccgcgagattctcatta aggccaagaagggcggcaagatcgccgtgtgataatagctcgaggctggagcctc ggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttcctgcac ccgtacccccTCCATAAAGTAGGAAACACTACAgtggtctttg aataaagtctgagtgggcggcacaattgaaaaaaaaaaaaaaaaaaaaaaaaaaa aagcatatgactaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaCAAACACCATTGTCACACTCCAATTTAT TTATTTATTTATTTATTTATTTTTT5 4 Atohl agaaaaagaataaactagtattcttctggtccccacagactcagagagaacccgcca ccatgtctcgcctgctgcacgctgaagaatgggccgaagtgaaagagttggggga ccaccataggcagcctcagcctcaccatcttcctcaaccgccccccccaccacaac ctccagctacgctgcaagctagagagcaccccgtgtatccgccagaactgtctcttc tggatagtacagatcctcgggcttggctggcgcctacccttcagggcatttgcaccg cccgagccgcccagtatctgttgcactccccggaactcggagcctcagaagctgcc gctcctcgggacgaggtggacggacggggcgaactcgtccggaggtcatccggc ggagcctcaagctccaagtctccaggtcccgtgaaggttcgagaacaactctgcaa gctgaagggtggagtagtcgttgacgagcttggatgctcaaggcagagggcccca tccagcaagcaggttaatggcgtccagaagcaaagacggctggcagcaaacgca agggagagacgcaggatgcatgggctgaaccacgcatttgatcagctgaggaacg tgatcccctctttcaacaatgacaagaaactcagcaagtacgaaacactgcagatgg cacagatctacatcaacgccctgagcgagttgctccagaccccttcaggaggagaa cagccaccacctcctcccgctagctgtaaatctgatcaccatcatctccggacagct gcatcctacgaaggtggagcgggcaacgcaacagctgccggggcgcagcaagc ctcaggtggatctcagcgacctacccccccaggaagttgtagaacacggttctccg ctccagcttctgcgggcggttacagtgtacagcttgacgccttgcacttctctacttttgaggactccgctctcaccgctatgatggctcagaagaacttgtctcctagtttgcccgg774931-5478-7195.1Atty. Docket No. 114203-1901SEQ Figure Description SequenceID NOgtctattctgcagccggtccaggaggagaattcaaagaccgcgcctcgctcacatc gaagcgacggggagttcgccccacattctcattatagcgattcagatgaagcatcct gataatagctcgaggctggagcctcggtggccatgcttcttgccccttgggcctccc cccagcccctcctccccttcctgcacccgtacccccgtggtctttgaataaagtctga gtgggcggcacaattgaaaaaaaaaaaaaaaaaaaaaaaaaagcatatgactaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa6 Ngn2 agaaaaagaataaactagtattcttctggtccccacagactcagagagaacccgcca ccatgtttgtcaaatccgaaacacttgaactcaaagaggaggaggacgtcctcgttct tctgggatccgctgcaccggcactggccgcacttacaccactgagttctagcgcag acgaggaggaggaggaggagcccggtgcctctggtggagcgcgcagacagcg aggagctgaagctggccaaggcgcacgcggtggcgtggctgcaggcgctgaag ggtgcagaccggcacgactcctgggactggtccacgattgtaagcggagaccatc ccgggcccgggcggtttccagaggtgcaaagaccgcagagactgtgcagagaat caagaaaaccaggcgcctcaaagccaataacagggaacggaatcgaatgcacaa tctgaatgccgctctggacgctcttcgggaggtcctgccgacttttcccgaggatgca aagctgactaagatagagaccttgcgctttgctcacaattacatttgggcactgacgg aaaccctgcgactcgccgatcattgcggagggggaggaggaggcttgcctgggg ctctgttctccgaggccgtgttgttggctcccgggggggcttccgctgctctcagctc aagtggggacgcacccgcacctgccagtacatggtcttgtactaacgcccccgctc ctagtagctctgtatccagcaactcaacagctccctactcttgcactcttgccccagct gctccagctgggagcgacatggactactggcagcccccacctccggataagcacc ggtacgctcctcatctgcctatcgcccgggattgcatctgataatagctcgaggctgg agcctcggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttc ctgcacccgtacccccgtggtctttgaataaagtctgagtgggcggcacaattgaaa aaaaaaaaaaaaaaaaaaaaaaagcatatgactaaaaaaaaaaaaaaaaaaaaaa 3aa3aaaa3aaaa3aaaa37 5 IL23 agaaaaaaaaaaaaaaaggaataaactagtattcttctggtccccacagactcagag agaacccgccaccatgtgtcctcagaagctaaccatctcctggtttgccatcgttttgc tggtgtctccactcatggccatgtgggagctggagaaagacgtttatgttgtagaggt ggactggactcccgatgcccctggagaaacagtgaacctcacctgtgacacgcctg aagaagatgacatcacctggacctcagaccagagacatggagtcataggctctgga aagaccctgaccatcactgtcaaagagtttctagatgctggccagtacacctgccac aaaggaggcgagactctgagccactcacatctgctgctccacaagaaggaaaatg gaatttggtccactgaaattttaaaaaatttcaaaaacaagactttcctgaagtgtgaag caccaaattactccggacggttcacgtgctcatggctggtgcaaagaaacatggact tgaagttcaacatcaagagcagtagcagttcccctgactctcgggcagtgacatgtg gaatggcgtctctgtctgcagagaaggtcacactggaccaaagggactatgagaag tattcagtgtcctgccaggaggatgtcacctgcccaactgccgaggagaccctgcc cattgaactggcgttggaagcacggcagcagaataaatatgagaactacagcacca gcttcttcatcagggacatcatcaaaccagacccgcccaagaacttgcagatgaag cctttgaagaactcacaggtggaggtcagctgggagtaccctgactcctggagcac tccccattcctacttctccctcaagttctttgttcgaatccagcgcaagaaagaaaaga tgaaggagacagaggaggggtgtaaccagaaaggtgcgttcctcgtagagaagacatctaccgaagtccaatgcaaaggcgggaatgtctgcgtgcaagctcaggatcgc784931-5478-7195.1Atty. Docket No. 114203-1901SEQ Figure Description SequenceID NOtattacaattcctcatgcagcaagtgggcatgtgttccctgcagggtccgatccggtg ggggcggcagtggtggtggcggctctggaggcggtggtagtgtgcctaggagta gcagtcctgactgggctcagtgccagcagctctctcggaatctctgcatgctagcct ggaacgcacatgcaccagcgggacatatgaatctactaagagaagaagaggatga agagactaaaaataatgtgccccgtatccagtgtgaagatggttgtgacccacaagg actcaaggacaacagccagttctgcttgcaaaggatccgccaaggtctggctttttat aagcacctgcttgactctgacatcttcaaaggggagcctgctctactccctgatagcc ccatggagcaacttcacacctccctactaggactcagccaactcctccagccagag gatcacccccgggagacccaacagatgcccagcctgagttctagtcagcagtggc agcgcccccttctccgttccaagatccttcgaagcctccaggcctttttggccatagct gcccgggtctttgcccacggagcagcaactctgactgagcccttagtgccaacagc ttaatgatagctcgaggctggagcctcggtggccatgcttcttgccccttgggcctcc ccccagcccctcctccccttcctgcacccgtacccccgtggtctttgaataaagtctg agtgggcggcacaattgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaagcatatga ctaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaa8 IL36y agaaaaaaaaaaaaaaaggaataaactagtattcttctggtccccacagactcagag agaacccgccaccatgttttctaaacacccattttctacacacatctcaggaagagaa actcctgactttggggaggtttttgacttggaccagcaggtgtggatctttcgtaatca ggcccttgtgacagttccacgaagccacagagtaaccccagtcagcgtgactatcct cccatgcaagtacccagagtctcttgaacaggacaaagggattgccatttatttggga attcagaatccagataaatgcctgttttgtaaggaagttaatggacaccctactttgctg ctaaaggaagagaagattttggatttgtaccaccaccctgagccaatgaagccattc ctgttttaccacacccggacaggtggaacatccacctttgaatcagtggctttccctg gccactatattgcctcctccaagactggcaaccccatcttcctcacatcaaaaaaggg agaatattacaacattaacttcaatttagatataaagtcttaataatagctcgaggctgg agcctcggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttc ctgcacccgtacccccgtggtctttgaataaagtctgagtgggcggcacaattgaaa aaaaaaaaaaaaaaaaaaaaaaaaaaagcatatgactaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 9 OX40L agaaaaaaaaaaaaaaaggaataaactagtattcttctggtccccacagactcagag agaacccgccaccatggaaggagagggggttcaaccactggatgagaacctgga aaatggaagccggcccaggttcaagtggaagaagaccctgcgtcttgtggtcagtg gaattaaaggtgctggcatgctgctctgctttatttatgtgtgcttacagctgtcttcctc cccagccaaggacccgcccatccagaggcttagaggtgctgtgactcgctgtgaa gatggccagctctttattagcagctacaagaatgagtaccagaccatggaggtgcag aacaacagtgttgtcatcaagtgtgatgggctttatatcatctacctgaagggctcattc ttccaggaagtgaaaattgatctgcatttccgggaagaccacaaccctatatcgatcc ccatgctcaatgacgggcgaagaatagtctttacggtagtagcatcactagcctttaa agacaaagtgtatttgactgtgaacgcacctgacaccctatgtgagcacctgcaaat caatgatggagagctcattgttgtccaattgacaccaggctactgcgcccctgaggg ctcctatcattctacagtcaaccaggtgcctttgtgataatagctcgaggctggagcct cggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttcctgcacccgtacccccgtggtctttgaataaagtctgagtgggcggcacaattgaaaaaaaa794931-5478-7195.1Atty. Docket No. 114203-1901SEQ Figure Description SequenceID NOaaaaaaaaaaaaaaaaaaaaaagcatatgactaaaaaaaaaaaaaaaaaaaaaaa

[0175] These examples are provided for illustrative purposes only and not to limit the scope of the claims provided herein.

[0176] While certain embodiments have been illustrated and described, it should be understood that changes and modifications can be made therein in accordance with ordinary skill in the art without departing from the technology in its broader aspects as defined in the following claims.

[0177] The present disclosure is not to be limited in terms of the particular embodiments described in this application. Many modifications and variations can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and compositions within the scope of the disclosure, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the appended claims. The present disclosure is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled. It is to be understood that this disclosure is not limited to particular methods, reagents, compounds, or compositions, which can of course vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0178] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0179] All publications, patent applications, issued patents, and other documents referred to in this specification are herein incorporated by reference as if each individual publication, patent application, issued patent, or other document was specifically and individually indicated to be incorporated by reference in its entirety. Definitions that are contained in text incorporated by reference are excluded to the extent that they contradict definitions in this disclosure.

[0180] Other embodiments are set forth in the following claims.804931-5478-7195.1

Claims

Atty. Docket No. 114203-1901CLAIMSWhat is claimed is:

1. An RNA comprising (i) one or more modified nucleotides at position +1 to position +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap.

2. The RNA of claim 1, wherein the RNA comprises a modified nucleotide at:(a) position +1 with reference to the 5’ terminus; or(b) position +3 with reference to the 5’ terminus; or(c) positions +1, +3, and +5 with reference to the 5’ terminus; or(d) positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

3. The RNA of claim 1 or 2, wherein the one or more modified nucleotides comprises a modified sugar.

4. The RNA of claim 3, wherein the modified sugar is selected from the group consisting of 2'-deoxy fluoro (2FA), Z-adenosine (ZA), 2'-deoxyadenosine (dA), locked nucleic acid (LNA), 2'-methoxy (20Me), 2 '-meth oxy ethoxy (2M0E), 2'-thioribose, 2', 3 '-dideoxyribose, 2'-amino-2'-deoxyribose, 2' deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3 '-amino-2', 3 '-dideoxyribose, 3'-azido-2',3'-dideoxyribose, 3 ’-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'-aminoribose, 5 '-thioribose, 5-nitro-l-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked ribose, and 2'-O,4'-C-thio-linked ribose.

5. The RNA of any one of claims 1-4, wherein the one or more modified nucleotides comprises a modified phosphate.

6. The RNA of claim 5, wherein the modified phosphate is selected from the group consisting of phosphorothioate (PS), thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5 '-hydroxyphosphonate, hydroxyphosphanate, phosphorosel enoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guani di nopropyl phosphoramidate.814931-5478-7195.1Atty. Docket No. 114203-19017. The RNA of any one of claims 1 -6, wherein the one or more modified nucleotides comprises a modified nucleobase.

8. The RNA of claim 7, wherein the modified nucleobase is selected from the group consisting of inosine, xanthine, allylamino uracil, allyaminothymidine, hypoxanthine, digoxigeninated adenine, digoxigeninated cytosine, digoxigeninated guanine, digoxigeninated uracil, 6-chloropurineriboside, N6-methyladenosine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-Indolyl)propionamide-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5 -bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16-aminoallylcytosine, biotin- 16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabcyl-5-3-aminoallyluracil, desthiobiotin- 16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, Nl-ethylpseudouracil, N1 -methoxymethylpseudouracil, N1 -methyladenine, N1 -methylpseudouracil, N1 -propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6-methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3 -deazaadenine, 2,6-diaminoadenine, 2,6-daminoguanine, 5-carboxamide-uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio-N6-threonyl carbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine 824931-5478-7195.1Atty. Docket No. 114203-1901(m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalyl carbamoyladenine (ms2hn6A), N6, N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A).

9. The RNA of any one of claims 1-8, wherein the one or more modified nucleotides comprise one or more modified sugars, one or more modified phosphates, one or more modified nucleobases, or any combination thereof.

10. The RNA of any one of claims 1-9, wherein the 5’ cap is selected from the group consisting of 7-methyguanosine (m7G), N7,3’-O-dimethyl-guanosine-5’-triphosphate-5’-guanosine (m7G-3’m-ppp-G), N7,2’-O-dimethyl-guanosine-5’-triphosphate-5’-guanosine (m7Gm-ppp-G), 7-benzylguanosine (Bn7G), chlorobenzylguanosine (ClBn7G), m7G bearing an LNA sugar (m7G-LNA), chlorobenzyl-O-ethoxyguanosine (ClBnOEt7G), 7-(4-chlorophenoxyethyl)-guanosine, 7-ethyl guanosine (e7G), 7-propyl guanosine (p7G), 7-isopropyl guanosine (ip7G), 7-butyl guanosine (b7G), 7-isobutyl guanosine (ib7G), 7-cyclopentyl guanosine (cp7G), 7-(carboxymethyl) guanosine (cm7G), 7-(2-phenylethyl) guanosine [7-(2-PhEt)G], 7-(l-phenylethyl) guanosine [7-(l-PhEt)G], m7GpppBH3G (DI andD2 stereoisomers), m7GppBH3G (DI and D2 stereoisomers), m7GpBH3G (DI and D2 stereoisomers), m7GppBH3pm7G, m272’°GpppBH3G (DI and D2 stereoisomers), m27’2'^GppBmpG (DI and D2 diastereomers), m27-2'°GppspG (DI and D2 diastereomers), N-Arylmethyl analogs, glyceryl, 4',5'-methylene nucleotide, l-(beta-D- erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L-nucleotides, alpha-nucleotide, modified base nucleotide, threo-pentofuranosyl nucleotide, acyclic 3',4'-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5-dihydroxypentyl nucleotide, 3'-3 '-inverted nucleotide moiety, 3 '-3 '-inverted abasic moiety, 3'-2'-inverted nucleotide moiety, 3'-2 '-inverted abasic moiety, 1,4-butanediol phosphate, 3'-phosphoramidate, hexylphosphate, aminohexyl phosphate, 3'-phosphate, 3'-phosphorothioate, phosphorodithioate, capl, cap2, cap3, cap4, ARC A, modified ARC A, inosine, Nl-methylguanosine, LNA-guanosine, 2-azido-guanosine, and a bridging or non-bridging methylphosphonate moiety.

11. The RNA of any one of claims 1-10, further comprising at least one poly-A tail.

12. The RNA of any one of claims 1-11, wherein the 5’ cap is added to the RNA through a chemical capping method.834931-5478-7195.1Atty. Docket No. 114203-190113. TheRNA of any one of claims 1-12, further comprising a 5’ untranslated region (5’ UTR).

14. The RNA of claim 13, wherein the 5’ UTR comprises a promoter.

15. The RNA of any one of claims 1-14, further comprising a 3’ untranslated region (3’ UTR).

16. The RNA of claim 15, wherein the 3’ UTR comprises at least one exonuclease-resistant modification.

17. The RNA of claim 16, wherein the exonuclease-resistant modification is selected from the group consisting of phosphorothioate (PS) linkage, 2’-O-methyl (20Me), 2’ Fluoro, inverted deoxythymidine (dT), inverted dideoxythymidine (ddT), 3’ phosphorylation, C3 spacer, 2'-O-methoxy-ethyl (2'-M0E), G-quadruplex, and 2'-3'-dideoxy nucleotide (ddN).

18. The RNA of any one of claims 1-17, comprising two or more 5’ caps.

19. The RNA of any one of claims 1-18, comprising two or more poly-A tails.

20. The RNA of any one of claims 1-19, further comprising an open reading frame (ORF).

21. The RNA of claim 20, wherein the ORF encodes a protein.

22. The RNA of claim 21, wherein the protein is a therapeutic protein.

23. The RNA of claim 21, wherein the protein is an antigen.

24. The RNA of any one of claims 20-23, further comprising a sequence encoding a therapeutic nucleic acid.

25. The RNA of claim 24, wherein the therapeutic nucleic acid is an antisense oligonucleotide (ASO), an aptamer, an RNA decoy, an siRNA, a shRNA, a miRNA, or a gRNA.

26. The RNA of any one of claims 1-25, wherein the RNA is a circular RNA.844931-5478-7195.1Atty. Docket No. 114203-190127. The RNA of any one of claims 1 -26, wherein the one or more modifications are selected from the group consisting of 2 '-O-m ethyladenosine (20Me-A), locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl -locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-dimethyladenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5-methyl-locked nucleic acid (LNA)cytosine, -d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-O-methyl-P-O-methyladenosine, N6, N6-dimethyladenine (m62A), Nl-methyl-inosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine, 2 '-methoxy ethoxy-adenosine (2M0E), and 5 -methyl cytosine (m5C).

28. The RNA of any one of claims 1-27, wherein the RNA comprises a m7G 5’ cap and an LNA modification at position +1 with reference to the 5’ terminus.

29. The RNA of any one of claims 1-27, wherein the RNA comprises a m7G 5’ cap and an LNAm5C modification at position +1 with reference to the 5’ terminus.

30. The RNA of any one of claims 1-27, wherein the RNA comprises a m7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and a 20Me modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

31. The RNA of any one of claims 1-27, wherein the RNA comprises an LNAm7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and a 2OMe modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

32. The RNA of any one of claims 1-27, wherein the RNA comprises a m7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

33. The RNA of any one of claims 1-27, wherein the RNA comprises a LNAm7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

34. The RNA of any one of claims 1-27, wherein the RNA comprises a m7G 5’ cap and a 2M0E modification at position +1 with reference to the 5’ terminus.854931-5478-7195.1Atty. Docket No. 114203-190135. The RNA of any one of claims 1 -27, wherein the RNA comprises a m7G 5’ cap and a 2M0E modification at each of positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

36. The RNA of any one of claims 1-27, wherein the RNA comprises an LNAm7G 5’ cap and a 2M0E modification at each of positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

37. The RNA of any one of claims 1-27, wherein the RNA comprises a m7G 5’ cap, a 2M0E modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

38. The RNA of any one of claims 1-27, wherein the RNA comprises an LNAm7G 5’ cap, a 2M0E modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

39. The RNA of any one of claims 1-38, wherein the RNA further comprises a microRNA (miRNA) element.

40. The RNA of claim 39, wherein the miRNA sequence is a miRNA-off element and is located 5’ of the polyA tail.

41. The RNA of claim 39, wherein the miRNA sequence is a miRNA-on element and is located 3’ of the polyA tail.

42. The RNA of any one of claims 39-41, wherein the RNA comprises a miRNA-off element and a miRNA-on element.

43. The RNA of any one of claims 39-42, wherein the modified mRNA further comprises an RNA degron signal.

44. The RNA of any one of claims 1-43, wherein the RNA encodes Atohl or Ngn2, wherein the RNA comprises a LNAm7G 5’ cap, a LNA modification at position +1 from the 5’ terminus, and a PS 2MOE modification at each of the 6 nucleotide positions closest to the 3’ terminus of the RNA followed by a terminal 2 ',3 '-dideoxy cytidine (ddC).864931-5478-7195.1Atty. Docket No. 114203-190145. The RNA of claim 44, wherein the RNA comprises a nucleotide sequence selected from SEQ ID NO: 5 or SEQ ID NO: 6.

46. The RNA of any one of claims 1-43, wherein the RNA encodes IL-23, IL-36y, or OX40L, wherein the RNA comprises a m7G 5’ cap, a LNA modification at positions +1, +2, +3, +4, +5, and +6 from the 5’ terminus, and a PS_2M0E modification at each of the 6 nucleotide positions closest to the 3’ terminus of the RNA followed by a terminal 2', 3 '-dideoxycytidine (ddC).

47. The RNA of claim 46, wherein the RNA comprises at least two 5’ caps.

48. The RNA of claim 46 or 47, wherein the RNA comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.

49. A method of expressing a modified RNA in a liver cell, comprising contacting the liver cell with a modified RNA comprising (i) one or more modified nucleotides at one or more of positions +1, +2, +3, +4, +5, or +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap.

50. The method of claim 49, wherein the modified RNA comprises a modified nucleotide at position +1 with reference to the 5’ terminus.

51. The method of claim 49 or 50, wherein the one or more modified nucleotide is selected from the group consisting of 2'-O-methyladenosine (2OMe-A), locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl -locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-dimethyladenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5-methyl-locked nucleic acid (LNA)cytosine, 0-d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-O-methyl-P-O-m ethyladenosine, N6, N6-dimethyladenine (m62A), Nl-methyl-inosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine, 2 '-methoxy ethoxy-adenosine (2M0E), and 5 -methyl cytosine (m5C).

52. The method of any one of claims 49-51, wherein the modified RNA comprises a m5C modification at position +1 with reference to the 5’ terminus.874931-5478-7195.1Atty. Docket No. 114203-190153. The method of any one of claims 39-52, wherein the modified RNA comprises a m5C modification at each of positions +1, +3, and +5 with reference to the 5’ terminus.

54. The method of any one of claims 39-51, wherein the modified RNA comprises:(a) an N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or(b) an N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or(c) an N6,2'-O-dimethyladenosine (m6Am) modification at positions +1, +3, and +5 with reference to the 5 ’ terminus; or(d) a 2'-O-methyladenosine (20Me-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or(e) a locked nucleic acid (LNA)adenosine (LNA-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

55. The method of any one of claims 49-51, wherein the modified RNA comprises:(a) a m7G 5’ cap and an LNA modification at position +1 with reference to the 5’ terminus;(b) a m7G 5’ cap and an LNAm5C modification at position +1 with reference to the 5’ terminus;(c) a m7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and a 20Me modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus;(d) an LNAm7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and a 20Me modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus;(e) a m7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5 ’ terminus; or(f) a LNAm7G 5’ cap, an LNAm5C modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus.884931-5478-7195.1Atty. Docket No. 114203-190156. A method of expressing a modified RNA in a leukocytic cell, comprising contacting the leukocytic cell with a modified RNA comprising (i) one or more modified nucleotides at one or more of positions +1, +2, +3, +4, +5, or +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap.

57. The method of claim 56, wherein the modified RNA comprises a modified nucleotide at position +1 with reference to the 5’ terminus.

58. The method of claim 56 or 57, wherein the one or more modified nucleotide is selected from the group consisting of 2 '-O-m ethyladenosine (20Me-A), locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl -locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-dimethyladenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5-methyl-locked nucleic acid (LNA)cytosine, -d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-O-methyl-P-O-methyladenosine, N6, N6-dimethyladenine (m62A), Nl-methyl-inosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine, 2 '-methoxy ethoxy-adenosine (2M0E), and 5 -methyl cytosine (m5C).

59. The method of any one of claims 56-58, wherein the modified RNA comprises a m5C modification at each of positions +1, +3, and +5 with reference to the 5’ terminus.

60. The method of any one of claims 56-58, wherein the modified RNA comprises:(a) an N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or(b) an N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or(c) an N6,2'-O-dimethyladenosine (m6Am) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or(d) an N6-benzyl-2'-O-methyladenosine (Bn6Am) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or(e) a 2 '-methoxy ethoxy-adenosine (2M0E) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or894931-5478-7195.1Atty. Docket No. 114203-1901(f) a 2'-methoxyethoxy-adenosine (2M0E) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or(g) a 2'-O-methyladenosine (20Me-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or(h) a locked nucleic acid (LNA)adenosine (LNA-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

61. The method of any one of claims 56-58, wherein the modified RNA comprises:(a) a m7G 5’ cap and a 2M0E modification at position +1 with reference to the 5’ terminus;(b) a m7G 5’ cap and a 2M0E modification at each of positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus;(c) an LNAm7G 5’ cap and a 2M0E modification at each of positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus;(d) a m7G 5’ cap, a 2M0E modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or(e) an LNAm7G 5’ cap, a 2M0E modification at position +1 with reference to the 5’ terminus, and an LNA modification at each of positions +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

62. A method of expressing a modified RNA in a skin cell, comprising contacting the skin cell with a modified RNA comprising (i) one or more modified nucleotides at one or more of positions +1, +2, +3, +4, +5, or +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap.

63. The method of claim 62, wherein the modified RNA comprises a modified nucleotide at position +1 with reference to the 5’ terminus.

64. The method of claim 62or 63, wherein the one or more modified nucleotide is selected from the group consisting of 2'-O-methyladenosine (20Me-A), locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl -locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-904931-5478-7195.1Atty. Docket No. 114203-1901di methyl adenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5 -methyl -locked nucleic acid (LNA)cytosine, -d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-O-methyl-P-O-methyladenosine, N6, N6-dimethyladenine (m62A), Nl-methyl-inosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine, 2'-methoxyethoxy-adenosine (2M0E), and 5-methylcytosine (m5C).

65. The method of any one of claims 60-62, wherein the modified RNA comprises:(a) an N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or(b) an N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A) modification at positions +1, +3, and +5 with reference to the 5’ terminus; or(c) a 2'-O-methyladenosine (20Me-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus; or(d) a locked nucleic acid (LNA)adenosine (LNA-A) modification at positions +1, +2, +3, +4, +5, and +6 with reference to the 5’ terminus.

66. A method of expressing a modified RNA in a human induced pluripotent stem cell (hiPSc), comprising contacting the hiPSc with a modified RNA comprising (i) one or more modified nucleotides at one or more of positions +1, +2, +3, +4, +5, or +6 with reference to a 5’ terminus of the RNA, and (ii) at least one 5’ cap.

67. The method of claim 66, wherein the modified RNA comprises a modified nucleotide at position +1 with reference to the 5’ terminus.

68. The method of claim 66 or 67, wherein the one or more modified nucleotide is selected from the group consisting of 2 '-O-m ethyladenosine (20Me-A), locked nucleic acid (LNA) adenosine (LNA-A), N6-methyladenine (m6A), N6-methyl-locked nucleic acid (LNA)adenine (LNA-m6A), N6-benzyl-locked nucleic acid (LNA)adenine (LNA-Bn6A), N6,2'-O-dimethyladenosine (m6Am), N6-benzyl-2'-O-methyladenosine (Bn6Am), 5-methyl-locked nucleic acid (LNA)cytosine, P-d-arabinonucleoside (ANA)-adenosine, 7,9-de-8-thiol-inosine, 2'-O-methyl-P-O-methyladenosine, N6, N6-dimethyladenine (m62A), Nl-methyl-inosine (Nil), 2'-O-methyl-ANA-adenosine, 2'-MOEOE-adenosine, Inosine, deoxy-adenosine, Phosphorothioated adenosine, 2'-methoxyethoxy-adenosine (2M0E), and 5-methylcytosine (m5C).914931-5478-7195.1Atty. Docket No. 114203-190169. The method of any one of claims 66-68, wherein the modified RNA comprises:(a) a m7G 5’ cap and a LNA modification at position +1 with reference to the 5’ terminus;(b) a LNAm7G 5’ cap and a LNA modification at position +1 with reference to the 5’ terminus;(c) a m7G 5’ cap and a m5C modification at position +1 with reference to the 5’ terminus; or(d) a LNAm7G 5’ cap and a m5C modification at position +1 with reference to the 5’ terminus.

70. The method of any one of claims 66-69, wherein the modified mRNA further comprises a microRNA (miRNA) element.

71. The method of claim 70, wherein the miRNA element is a miRNA-off element and is located 5’ of the polyA tail.

72. The method of claim 70, wherein the miRNA element is a miRNA-on element and is located 3’ of the polyA tail.

73. The method of any one of claims 70-72, wherein the modified mRNA comprises a miRNA-off element and a miRNA-on element.

74. The method of any one of claims 70-73, wherein the modified mRNA further comprises an RNA degron signal.

75. A method for inducing differentiation of a human induced pluripotent stem cell (hiPSc) into a neuron, comprising contacting the hiPSc with a modified mRNA encoding Atohl or Ngn2, wherein the modified mRNA comprises a LNAm7G 5’ cap, a LNA modification at position +1 from the 5’ terminus, and a PS 2MOE modification at each of the 6 nucleotide positions closest to the 3’ terminus of the RNA followed by a terminal 2', 3 '-dideoxy cytidine (ddC).

76. The method of claim 75, wherein the modified mRNA comprises a nucleotide sequence selected from SEQ ID NO: 5 and SEQ ID NO: 6.924931-5478-7195.1Atty. Docket No. 114203-190177. A method for treating melanoma in a subject, comprising administering to the subject a modified mRNA encoding IL-23, IL-36y, or OX40L, wherein the modified mRNA comprises a m7G 5’ cap, a LNA modification at positions +1, +2, +3, +4, +5, and +6 from the 5’ terminus, and a PS 2MOE modification at each of the 6 nucleotide positions closest to the 3’ terminus of the RNA followed by a terminal 2', 3 '-dideoxycytidine (ddC).

78. The method of claim 77, wherein the modified mRNA comprises at least two 5’ caps.

79. The method of claim 77 or 78, wherein the modified mRNA comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9.

80. A vector comprising the RNA of any one of claims 1-48.

81. A delivery agent comprising the RNA of any one of claims 1-48, wherein the delivery agent comprises a lipid, a peptide, a protein, an antibody, a carbohydrate, a nanoparticle, or a microparticle.

82. The delivery agent of claim 81, wherein the nanoparticle or microparticle is a lipid nanoparticle or a lipid microparticle, a polymer nanoparticle or a polymer microparticle, a protein nanoparticle or a protein microparticle, or a solid nanoparticle or a solid microparticle.

83. A cell comprising the RNA of any one of claims 1-48 or the vector of claim 80.

84. The cell of claim 83, wherein the cell is a mammalian cell.

85. A composition comprising the RNA of any one of claims 1-48, the vector of claim 80, the delivery agent of claim 81 or 82, or the cell of claim 83 or 84.

86. The composition of claim 85, further comprising an additional agent.

87. The composition of claim 86, wherein the additional agent is an agent which has a therapeutic effect when administered to a subject.

88. The composition of claim 86 or 87, wherein the additional agent is a nucleotide, a nucleic acid, an amino acid, a peptide, a protein, a small molecule, an aptamer, a lipid, or a carbohydrate.934931-5478-7195.1Atty. Docket No. 114203-190189. The composition of claim 88, wherein the nucleotide is a shRNA, a siRNA, a miRNA, or an antisense oligonucleotide (ASO).

90. The composition of any one of claims 85-89, wherein the additional agent is an antigen or adjuvant.

91. The composition of any one of claims 85-90, wherein the composition is a pharmaceutical composition comprising a pharmaceutically acceptable excipient.

92. A kit comprising the composition of any one of claims 85-91, a device for administering the composition to a subject, and / or instructions for administering the composition to the subject.944931-5478-7195.1

Images