Lipid nanoparticles for efficient ophthalmic delivery of genome editing ribonucleoprotein

The LNP composition addresses delivery challenges of genome editing constructs by efficiently delivering RNPs to retinal pigment epithelium cells, achieving precise editing and improved therapeutic outcomes for inherited retinal disorders.

WO2026112530A1PCT designated stage Publication Date: 2026-05-28RGT UNIV OF CALIFORNIA
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
RGT UNIV OF CALIFORNIA
Filing Date
2025-11-21
Publication Date
2026-05-28

AI Technical Summary

Technical Problem

Current delivery methods for genome editing constructs, such as CRISPR/Cas9, base editors, and prime editors, face challenges including packaging limitations of viral vectors, prolonged expression leading to off-target editing, immunogenicity, and risks of viral genome integration, especially in post-mitotic cells like neurons, which limits their therapeutic efficacy.

Method used

A lipid nanoparticle (LNP) composition is developed for efficient ophthalmic delivery of genome editing ribonucleoproteins (RNP) to retinal pigment epithelium cells, encapsulating genome editing RNPs like prime editors or base editors, providing transient exposure and minimizing off-target effects.

Benefits of technology

The LNP composition efficiently transfects retinal pigment epithelium cells, achieving precise genome editing with reduced off-target effects and improved therapeutic outcomes for inherited retinal disorders, enhancing visual function by correcting pathogenic mutations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025056740_28052026_PF_FP_ABST
    Figure US2025056740_28052026_PF_FP_ABST
Patent Text Reader

Abstract

A lipid nanoparticle composition for delivery of genome editing ribonucleoprotein (RNP) includes a lipid component that encapsulates the genome editing ribronucleoprotein (RNP), wherein the lipid component includes an ionizable cationic lipid with a pK a > 6, at least one phospholipid, a structural lipid, and PEG-modified lipid.
Need to check novelty before this filing date? Find Prior Art

Description

PATENTLIPID NANOPARTICLES FOR EFFICIENT OPHTHALMIC DELIVERY OF GENOME EDITING RIBONUCLEOPROTEINRELATED APPLICATION

[0001] This application claims priority from U.S. Provisional Application No. 63 / 723,420, filed November 21, 2024, the subject matter of which is incorporated herein by reference in its entirety.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on November 20, 2025, is named UCL034163WO ORD.st.26 and is 65,817 bytes in size.BACKGROUND

[0003] Monogenic diseases arise from genetic mutations which lead to aberrant or absent gene expression, and many lack appropriate therapies. Advances in molecular biology have enabled several treatment approaches to address this unmet medical need and correct the molecular basis of inherited diseases. Gene augmentation therapy, for example, delivers a wild-type (WT) copy of a mutated gene via a viral vector to supplement expression.However, gene augmentation is limited by several major shortcomings, including potential loss of expression over long periods, lack of endogenous gene regulation, the inability to package large transgenes, and low efficacy when treating mutations that act in a dominant manner. An alternative approach to gene augmentation is genome editing. By correcting the genomic mutation in situ, a one-time treatment could be curative for the lifetime of the patient. Of the genome editing techniques, clustered regularly interspaced short palindromic repeats and CRISPR-associated protein 9 (CRISPR / Cas9) editing has shown great promise and has advanced to clinical trials. While these early trials have focused on treating monogenic diseases, it is possible to envision the application of genome editing for the treatment or prevention of common diseases with multifactorial or polygenic causes, such as malignancies, cardiovascular disorders, or neurodegenerative diseases.

[0004] The CRISPR / Cas9 system used in genome editing trials consists of a Cas9 nuclease that is targeted to a genomic site by a protospacer- adjacent motif (PAM), and guide RNA that focuses the binding of Cas9 on a 20-bp-long DNA protospaccr. WhileCRISPR / Cas9 is easily programmed by the substitution of the guide RNA, the doublestranded DNA cleavage mediated by the nuclease can lead to a heterogeneous pool of editing outcomes, namely random insertions and deletions (indels) by non-homologous end joining (NHEJ), as well as cytotoxicity, p53 pathway activation, and large chromosomal irregularities and rearrangements. Moreover, the efficiency of precise repair via homology-directed repair with a donor DNA template is low compared to NHEJ, especially in post-mitotic cells, including major cell types of interest such as neurons.

[0005] Two alternatives to genome editing with CRISPR / Cas9 nucleases are base and prime editors, which fuse a DNA effector domain to a partially inactivated Cas9 domain, termed a Cas9 nickase. These modifications combine the ease of programmability of CRISPR / Cas9 with the precision and direct chemistry of the effector domain of the base or prime editor, while avoiding NHEJ and cytotoxicity caused by double-stranded DNA breaks. Thus, the purity of editing outcomes is much greater for base and prime editors; because the DNA-repair mechanisms that enable base and prime editing are cell-cycle independent, the high editing efficiencies are maintained in post-mitotic cell types when genome editing is performed in vivo. CRISPR / Cas9 strategies, and base and prime editing in particular, are suitable approaches for dominant-negative diseases through correction of the pathogenic allele. However, bystander editing by base editors is a concern, as it could lead to unintended changes and hamper the therapeutic efficacy for the patient. As well, the potential off-target effects of prime editors have not yet been carefully explored and documented.

[0006] One major hurdle that limits the application of base and prime editors is the appropriate and efficient delivery of these editing constructs. The current standard for delivery of gene therapy and genome editing constructs is via viral vectors. However, the net size of the guide RNA constructs, along with the base or prime editors, exceeds the packaging limits of most commonly used viral vectors, such as lentiviruses (LV) and adeno- associated viruses (AAVs); indeed, base and prime editors delivered by AAV often are split into two viral vectors. Additionally, while these viral vectors have been engineered to be less immunogenic than their native counterparts, they still express base and prime editors over a sustained period. Whereas the intended “on-target” site is favored thermodynamically to be edited, prolonged expression of base and prime editors leads to an increased risk of off-target editing at less-favored sites on the genome and transcriptome, either in a Cas9-dependent or in an cffcctor-dcpcndcnt manner. Prolonged exposure to base editors has also been shown toincrease bystander editing. Lastly, there is a non- zero risk of viral genome integration, even when non-integrating viral vectors are used, and this risk could even be worsened by the deployment of Cas9 nucleases and nickases. Thus, as sustained expression of CR1SPR / Cas9 is unnecessary and only risks unintended editing outcomes, CRISPR / Cas9 should be delivered in a transient manner and rapidly degraded thereafter.SUMMARY

[0007] Embodiments described herein relate to a lipid nanoparticle (LNP) composition for efficient ophthalmic delivery of a genome editing ribonucleoprotein (RNP) to a cell, and particularly relate to a lipid nanoparticlc composition for efficient ophthalmic delivery of a genome editing RNP to treat a monogenic disease, such as an inherited retinal disorder. We developed an LNP composition capable of efficiently transfecting the retinal pigment epithelium (RPE), an important cell type that is implicated in many blinding diseases. The LNP composition efficiently encapsulates genome editing RNPs, such as a prime editor (PE) or base editor (BE) and guide RNA, is safe and non-toxic, and mediates efficient genome editing in the eye that results in physiological rescue of blindness. Advantageously, the RNP LNPs offer the most transient exposure to genome-editing agents. Compared to viral and viral-derived platforms, such as AAV and eVLPs, an LNP approach allows for a controllable synthetic therapeutic strategy with definable components, and LNPs provide more uniform and reproducible synthesis compared to lipoplex formulations, which can be used to deliver RNPs.

[0008] In some embodiments, the LNP composition can include a plurality of LNPs that each include a lipid component. The lipid component encapsulates genome editing RNP. The lipid component can include an ionizable cationic lipid with a p / L > 6, at least one phospholipid, a structural lipid, and a PEG-modified lipid.

[0009] In some embodiments, the genome editing RNP includes a base editor or prime editor complexed with a guide RNA configured for, respectively, base-editing or primeediting a pathogenic point mutation in a cell, such as a retinal cell and / or a retinal pigment epithelium cell, of a subject.

[0010] In some embodiments, the guide RNA hybridizes to or is complementary to the pathogenic point mutation of a target nucleic acid sequence of a mutant gene.

[0011] In some embodiments, the genome editing RNP includes an adenine base editor complexed with a guide RNA having the nucleic sequence of SEQ ID NO: 5.

[0012] In some embodiments, the genome editing RNP includes a prime editor complexed with a guide RNA having the nucleic sequence of SEQ ID NO: 6.

[0013] In some embodiments, the genome editing RNP is configured to correct the pathogenic point mutation, generate a non-pathogenic point mutation, or modulate expression of an inherited retinal disorder (IRD) related gene and / or restore visual function of the subject.

[0014] In some embodiments, the IRD is selected from Stargardt Disease, Leber's congenital amaurosis (LCA), pseudoxanthoma elasticum, rod cone dystrophy, exudative vitreoretinopathy, Joubert Syndrome, CSNB-1C, retinitis pigmentosa, Stickler syndrome, microcephaly, chorioretinopathy, CSNB 2, Usher syndrome, Wagner syndrome, or age- related macular degeneration.

[0015] In some embodiments, the pathogenic point mutation is a nonsense or missense mutation, and the genome editing RNP increases expression of the protein in a retinal cell or a retinal pigment epithelium cell by at least about 4%, 5%, 6%, 7 %, 8%, 9%, 10%, 20%, 30%, 40% or more.

[0016] In some embodiments, the pathogenic mutation is a nonsense or missense mutation of ABCA4, AIPL1, CABP4, CEP290, CLUAP1, CRB1, CRX, GDF6, GUCY2D, IFT140, IQCB1, KCNJ13, LCAS, LRAT, NMNAT1, PRPH2, RD3, RDH12, RHO, RPE65, RPGR1P1, SPATA7, and TULP1.

[0017] In some embodiments, the ionizable cationic lipid of the lipid component includes at least one of 8-[(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino]-octanoic acid, 1 -octylnonyl ester (SMI 02), 9-octadecenoic acid, l,l'-[7-[4-(dipropylamino)butyl]-7- hydroxy-l,13-tridccancdiyl] ester (CL4H6), l,2-diolcyloxy-3-dimcthylaminopropanc (DODMA), 4-(dimethylamino)-butanoic acid, (10Z,13Z)-l-(9Z,12Z)-9,12-octadecadien-l-yl- 10,13-nonadecadien-l-yl ester (DLin-MC3-DMA), 2-[2, 2-Di-[(9Z,12Z)-octadeca-9, 12- dienyl]-! ,3-dioxolan-4-yl]-WN-dimethylethanamine (Dlin-KC2-DMA), (4- Hydroxybutyl)azanediyl]di(hexane-6,l-diyl) bis(2-hexyldecanoate) (ALC-0315), cKK-E12, l,l'-[[2-[4-[2-[[2-[&z.s[(2S)-2-hydroxydodecyl]amino]ethyl][(2S)-2- hydroxydodecyl]amino]ethyl]- 1 -piperazinyl]ethyl]imino] to-2-dodecanol (Cl 2-200), 1 ,2- Dilinoleyloxy-N,N-dimethyl-3-aminopropane, N,N-dimethyl-2,3-bis[(9Z,12Z)-9,12- octadecadien-l-yloxy]-l-propanamine (Dlin-DMA), or 9-[4-(dimethylamino)-l-oxobutoxy]- hcptadecancdioic acid, l,17-di-(2Z)-2-noncn-l-yl ester, preferably SM102.

[0018] In some embodiments, the at least one phospholipid of the lipid component is selected from dilauroyl-phosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), dipalmitoyl-phosphatidylcholine (DPPC), dibehenoylglycerophosphocoline (DBPC), diarachidoyl-phosphatidylcholine (DAPC), distearoylphosphatidylcholine (DSPC), dioleoyl-phosphatidylcholine (DOPC), dimyristoyl-phosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), distearoyl phosphatidyl-ethanolamine (DSPE), dioleylphosphatidyl-ethanolamine (DOPE), diarachidoylphosphatidyl-ethanolamine (DAPE), dilinoleylphosphatidylethanolamine (DLPE), dimyristoylphosphatidylserine (DMPS), diarachidoyl phosphatidylserine (DAPS), dipalmitoyl phosphatidylserine (DPPS), distearoylphosphatidylserine (DSPS), dioleoylphosphatidylserine (DOPS), dipalmitoyl phosphatidic acid (DPPA), dimyristoyl phosphatidic acid (DMPA), distearoyl phosphatidic acid (DSPA), diarachidoylphosphatidic acid (DAP A) and their alkali metal salts, dimyristoylphosphatidylglycerol (DMPG) and its alkali metal salts, dipalmitoylphosphatidylglycerol (DPPG) and its alkali metal salts, distearoylphosphatidylglycerol (DSPG) and its alkali metal salts, dioleoylphosphatidylglycerol (DOPG), dilauroyl-phosphatidylinositol (DLPI), diarachidoylphosphatidylinositol (DAPI), dimyristoylphosphatidylinositol (DMPI), dipalmitoylphosphatidylinositol (DPPI), distearoylphosphatidylinositol (DSPI), dioleoylphosphatidylinositol (DOPI), l-stearoyl-2-oleoyl-sn-glycero-3-phosphoserine (SOPS), or mixtures thereof, preferably, l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) or 1- stearoyl-2-oleoyl-sn-glycero-3-phosphoserine (SOPS).

[0019] In some embodiments, the structural lipid of the lipid component is selected from cholesterol, fccostcrol, sitosterol, ergosterol, campcstcrol, stigmastcrol, brassicastcrol, tomatidine, ursolic acid, alpha-tocopherol, or mixtures thereof, preferably, cholesterol.

[0020] In some embodiments, the PEG modified lipid of the lipid component is selected from a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG- modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG- modified dialkylglycerol, or mixtures thereof, preferably PEG-modified phosphatidylethanolamines, such as DMPE-PEG1000, DMPE-PEG2000, DMPE-PEG3000, DMPE-PEG4000, DMPE-PEG5000, DPPE-PEG1000, DPPE-PEG2000, DPPE-PEG3000, DPPE-PEG4000, DPPE-PEG5000, DSPE-PEG1000, DSPE-PEG2000, DSPE-PEG3000, DSPE-PEG4000, DSPE-PEG5000, DAPE-PEG1000, DAPE-PEG2000, DAPE-PEG3000,DAPE-PEG4000 or DAPE-PEG5000, more preferably l,2-dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (DMG-PEG 2000).

[0021] In some embodiments, the lipid component can include about 40 mol % to about 60 mol % of the ionizable cationic lipid, for example, about 42 mol % to about 60 mol %, about 44 mol % to about 60 mol %, about 46 mol % to about 60 mol %, about 48 mol % to about 60 mol %, about 50 mol % to about 60 mol %, about 40 mol % to about 58 mol %. about 40 mol % to about 56 mol %, about 40 mol % to about 54 mol %, about 40 mol % to about 52 mol %, or about 40 mol % to about 50 mol % of the ionizable cationic lipid, including any range therebetween.

[0022] In some embodiments, the lipid component can include about 8 mol % to about 12 mol % of the phospholipid, for example, about 9 mol % to about 12 mol %, about 10 mol % to about 12 mol %, about 11 mol % to about 12 mol %, about 8 mol % to about 11 mol %, about 8 mol % to about 10 mol %, or about 8 mol % to about 9 mol % of the phospholipid, including any range therebetween.

[0023] In some embodiments, the lipid component can include about 28.5 mol % to about 48.5 mol % of the structural lipid, for example, about 30.5 mol % to about 48.5 mol %, about 32.5 mol % to about 48.5 mol %, about 34.5 mol % to about 48.5 mol %, about 36.5 mol % to about 48.5 mol %, about 38.5 mol % to about 48.5 mol %, about 28.5 mol % to about 46.5 mol %, about 28.5 mol % to about 44.5 mol %, about 28.5 mol % to about 42.5 mol %, about 28.5 mol % to about 40.5 mol %, or about 28.5 mol % to about 38.5 mol % of the structural lipid, including any range therebetween.

[0024] In some embodiments, the lipid component can include about 1.5 mol % to about 5 mol % of the PEG modified lipid, for example, about 1.5 mol % to about 4.5 mol %, about 1.5 mol % to about 4 mol %, about 1.5 mol % to about 3.5 mol %, about 1.5 mol % to about 3 mol %, about 2 mol % to about 5 mol %, about 2.5 mol % to about 5 mol %, or about 3 mol % to about 5 mol % of the PEG modified lipid, including any range therebetween.

[0025] In other embodiments, the lipid component can include about 40 mol % to about 60 mol % of the ionizable cationic lipid, about 8 mol % to about 12 mol % of the phospholipid, about 28.5 mol % to about 48.5 mol % of the structural lipid, and about 1.5 mol % to about 3 mol % of the PEG modified lipid.

[0026] In other embodiments, the lipid component can include about 40 mol % to about 60 mol % SM012, about 8 mol % to about 12 mol % DSPC, about 28.5 mol % to about 48.5 mol % cholesterol, and about 1.5 mol % to about 3 mol % DMG-PEG 2000.

[0027] In some embodiments, the LNP encapsulation efficiency of the genome editing RNP is at least about 80% or at least about 90%.

[0028] In some embodiments, the wt / wt ratio of the lipid component to RNA of the RNP is from about 30: 1 to about 70:1, preferably about 40: 1 to 60: 1.

[0029] In some embodiments, the lipid nanoparticle wt / wt ratio of the lipid component to protein component of genome editing RNP is from about 5: 1 to about 10: 1, preferably from about 7 : 1 to about 8:1.

[0030] In some embodiments, the lipid nanoparticles have an average nanoparticle diameter of about 50 nm to about 500 nm, preferably about 100 nm to about 300 nm.

[0031] In some embodiments, the lipid nanoparticle composition further includes at least one targeting group decorating the lipid nanoparticles that targets and / or binds to a retinal or visual protein. For example, the targeting group can include photoreceptor targeting peptides, such as DGPPRKPGGGSC (SEQ ID NO: 1), SPALHFLGGGS (SEQ ID NO: 2), SNLAAFPGGGSC (SEQ ID NO: 3), or MPVAVYRGGGSC (SEQ ID NO: 4). In another embodiment, the at least one targeting group can include all-trans-retinylamine or ( 1 R)-3 -amino- 1 - [3 -(cyclohexylmethoxy)phenyl]propan- 1 -ol.

[0032] Other embodiments described herein relate to a pharmaceutical composition that includes the LNP composition described herein and a pharmaceutically acceptable carrier.

[0033] In some embodiments, the pharmaceutical composition includes an amount of sucrose effective to enhance the stability of the lipid nanoparticlc composition under different storage temperatures, for example, storage temperatures can range from about -20°C to about 4°C. For example, the pharmaceutical composition can include about 5% to about 20% (w / v) sucrose.

[0034] Other embodiments described herein relate to a method of delivering a genome editing RNP to a mammalian cell. The method can include administering to the mammalian cell the LNP composition or pharmaceutical composition described herein. The administration can include contacting the cell with the LNP composition, whereby the RNP is delivered to the cell.

[0035] Still other embodiments relate to a method of treating a disorder, such as monogenic disease, associated with a pathogenic point mutation in a subject. The method can include administering to the subject the LNP composition or pharmaceutical composition as described herein.

[0036] In some embodiments, the disorder is an ocular disorder.

[0037] In some embodiments, the disorder is an inheritable retinal disorder.

[0038] In some embodiments, the disorder is selected from Stargardt Disease, Leber's congenital amaurosis (LCA), pseudoxanthoma elasticum, rod cone dystrophy, exudative vitreoretinopathy, Joubert Syndrome, CSNB-1C, retinitis pigmentosa, Stickler syndrome, microcephaly, chorioretinopathy, retinitis pigmentosa, CSNB 2, Usher syndrome, Wagner syndrome, or age-related macular degeneration.

[0039] In some embodiments, the LNP composition or pharmaceutical composition can be administered in a single dose.

[0040] In some embodiments, the LNP composition or pharmaceutical composition can be administered locally.

[0041] In some embodiments, the LNP composition or pharmaceutical composition can be administered intravitreally.

[0042] In some embodiments, the LNP composition or pharmaceutical composition can be administered subretinally.

[0043] In some embodiments, the LNP composition or pharmaceutical composition can be administered suprachoroidally.

[0044] In some embodiments, the concentration of the LNPs in the pharmaceutical composition is about 50 ng / pl to about 500 ng / pl, about 100 ng / pl to about 300 ng / pl, or about 150 ng / pl to about 250 ng / pl.

[0045] In some embodiments, the volume of the pharmaceutical composition administered to the subject is about 0.1 pL to about 2 pL, about 0.2 pL to about 1.5 pL, or about 0.5 pL to about 1 pL.

[0046] In some embodiments, the LNP composition or the pharmaceutical composition is effective in treating and / or improving the subject's visual function.

[0047] In some embodiments, visual function can be assessed by microperimetry, dark- adapted perimetry, assessment of visual mobility, visual acuity, ERG, or reading assessment.

[0048] In some embodiments, the method results in the prevention of or a slowing of the progression of decline of the subject's visual function due to the progression of the ocular disorder.

[0049] Other embodiments described herein relate to a method of treating an inherited retinal disease (IRD) associated with a pathogenic point mutation in a mutant allele of an IRD-related gene in the retina or the retinal pigment epithelium (RPE) of a subject in need thereof. The method can include administering to the subject the LNP composition or the pharmaceutical composition as described herein.

[0050] In some embodiments, the RNP of the LNP composition can base edit or prime edit the pathogenic point mutation in a retinal cell or a retinal pigment epithelium cell to correct the pathogenic point mutation, generate a non-pathogenic point mutation, or modulate expression of an IRD-related gene and / or restore visual function of the subject.

[0051] In some embodiments, the pathogenic point mutation is a nonsense or missense mutation, and the base editing increases expression of a protein in the retinal cell or the retinal pigment epithelium cell by at least about 4%, 5%, 6%, 7 %, 8%, 9%, 10%, 20%, 30%, 40% or more.

[0052] In some embodiments, the pathogenic mutation is a nonsense or missense mutation of an ABCA4, AIPL1, CABP4, CEP290, CLUAP1, CRB1, CRX, GDF6, GUCY2D, IFT140, IQCB1, KCNJ13, LCAS, LRAT, NMNAT1, PRPH2, RD3, RDH12, RHO. RPE65, RPGRIP1, SPATA7, and TULP1.

[0053] In some embodiments, the IRD can include at least one of chorioretinal atrophy or degeneration, cone or cone-rod dystrophy, congenital stationary night blindness, Leber congenital amaurosis, macular degeneration, ocular-retinal developmental disease, optic atrophy, retinitis pigmentosa, syndromic / systemic diseases with retinopathy, sorsby macular dystrophy, age-related macular degeneration, doyne honeycomb macular disease, juvenile macular degeneration, Stargardt disease, or retinitis pigmentosa.

[0054] In some embodiments, the IRD is Leber congenital amaurosis, Stargardt disease, or retinitis pigmentosa.

[0055] In some embodiments, the base editing or the prime editing causes less than 3%, less than 2%, or less than 1% indel formation.

[0056] In some embodiments, the pathogenic mutation is a nonsense or missense mutation of the RPE65 gene.

[0057] In some embodiments, the RNP of the LNP composition includes a guide RNA that hybridizes to or is complementary to the pathogenic point mutation of a target nucleic acid sequence of the mutant KPE65.

[0058] In some embodiments, the pathogenic mutation comprises a C to T missense or nonsense mutation of the RPE65 gene, and base editing by deamination of the A complementary to the T by the base editor and the guide RNA corrects the C to T mutation.BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figs. l(A-Q) illustrate schematics, plots, and immunoassays showing purification and characterization of genome-editing proteins. (A) Schematic cartoon of protein constructs utilized in this study. 1D4 = 9 amino acid C-terminal 1D4 rhodopsin peptide; MMLV RT = Moloney murine leukemia virus reverse transcriptase; NLS = nuclear localization signal; TadA* 8e = engineered tRNA deaminase. (B,C) Purification of Cre recombinase by (B) Ni-NTA and (c) SEC. Insets show SDS-PAGE gels of collected fractions after CBB staining. (D) SDS-PAGE (left) and Western blot analysis (right) of purified Cre recombinase. M = molecular weight marker; N = N-Cre-His; T = TAT-Cre-His; C = CPP5- Cre-His; A = ANTP-Cre-His. (E-G) TALON chromatography, 1D4 chromatography, and SEC, representing purification of ABE and PE proteins. Insets show SDS-PAGE gels of collected fractions stained with CBB. (II, I) SDS-PAGE (left) and Western blot (right) analyses of purified ABE and PE proteins. (J) Absorbance spectra of the fractions collected during purification of ABE, showing gradual removal of contaminating nucleic acids by decreasing absorbance at 260 nm relative to 280 nm. (K) SEC of ABE and PE proteins relative to standards consisting of blue dextran (2,000 kDa, determining void column volume), thyroglobulin (670 kDa), y-globulin (158 kDa), ovalbumin (44 kDa), myoglobin (17 kDa), and vitamin B 12 (1.35 kDa, determining accessible column volume). (L) Averaged (n = 3) DSF profiles of ABE with guide RNA in PBS containing 10% (w / v) sucrose. Inserts show rate of change of fluorescence intensity (-dF / dT) and melting temperatures. NF = nonfolded guide RNA; F = folded guide RNA. (M) A schematic diagram of the ABE activity assay. (N) Urea-PAGE gels imaged for fluorescein (left) and SYBR Gold (right), demonstrating activity of ABE in vitro. M = DNA standard; S = substrate; N = ABE without fused cell penetrating peptide; C = CPP5-ABE; T = TAT-ABE; A = ANTP-ABE. (O) Averaged (n = 3) DSF profiles of PE with guide RNA in PBS. Inserts show rate of change of fluorescence intensity (-dF / dT) and melting temperatures. (P) A schematic diagram of the PEactivity assay. (Q) Urea-PAGE gel imaged for fluorescein (left) and SYBR Gold (right), demonstrating activity of PE. “-S” = no substrate control; “S” = substrate-only control; “-R” = no epegRNA control; “-D” = no dN TP control; PE2 = sample containing PE RNP and dNTP. Asterisk indicates products extended beyond the reverse transcriptase template. Uncropped gels and blots are available within source data.

[0060] Figs. 2(A-P) illustrate images, plots, and schematics showing direct protein delivery of Cre recombinase mediated by cell-penetrating peptides. (A) Schematic cartoon of color-switch Cre reporter cell line. GFP is constitutively expressed, while a stop codon prevents expression of RFP. Upon Cre-mediated excision of GFP and the stop codon, RFP expression replaces expression of GFP. (B) Various formulations of cell-penetrating Cre mediate excision of the GFP gene and induce expression of RFP measured by fluorescence microscopy (upper) and flow cytometry (lower). From left to right: purified Cre recombinase delivered alone; with Lipofectamine 3000 (L3000); with fused CPP5 covalent cellpenetrating peptide; with fused TAT; with fused ANTP; with 6xHis-CM18-PTD4 non- covalent cell-penetrating peptide (6H-CM18-PTD4); with fused ANTP cell-penetrating peptide and 6xHis-CM18-PTD4 peptide. Scale bar represents 200 pm. (C) Quantification of Cre-mediated GFP to RFP conversion as a function of direct protein delivery with Cre recombinase alone or with fused cell-penetrating peptides, as measured by flow cytometry. Circle represents Cre alone, triangle represents CPP5 -fused Cre recombinase, square represents TAT-fused Cre recombinase, inverted triangle represents ANTP-fused Cre recombinase. Three biological replicates with 2 analytical replicates each, mean ± s.d. 1 pM corresponds to 41.9 pg ml1. (D) Quantification of enhancement of Cre-mediated GFP to RFP conversion with increasing concentrations of 6xHis-CM18-PTD4 peptide at a protein concentration of 0.5 pM. Symbols are consistent with panel c. Three biological replicates with 2 analytical replicates each, mean ± s.d. (E) Schematic cartoon of genetic construct of mT / mG Cre reporter-mouse model. In the mice, tdTomato is constitutively expressed, while a stop signal prevents expression of eGFP. Upon Cre-mediated excision of tdTomato and the stop signal, eGFP expression replaces expression of tdTomato. (F) Protein delivery to skin fibroblasts isolated from the mT / mG Cre-reporter mice, as observed with a fluorescent microscope and quantified by flow cytometry, 72 h post-delivery. Scale bar represents 100 pm. (G) Quantification by flow cytometry of Cre-recombinase delivery into mT / mG Cre reporter-mouse primary fibroblasts. Two separate experiments with 2 analytical replicateseach, mean ± s.d. (H) Schematic cartoon representing retinal cross-section orientation. RPE = retinal pigment epithelium; PR OS = photoreceptor outer segment; PR IS = photoreceptor inner segment; ONL = outer nuclear layer; OPL = outer plexiform layer. Created in BioRender, BioRender.com / i66ol07. (I-P) Cre-mediated tdTomato to eGFP expression, 1 week after subretinal delivery of Cre recombinase measured by two-photon excitation microscopy. The RPE layer is orientated toward the top, denoted with open yellow triangles. Scale is provided in micrometers. (I) AAV2 / 1-CMV-Cre; (J) VSV-G pseudotyped Cre-eVLP; (K) Cre recombinase alone; (L) Cre recombinase delivered with Lipofectamine 3000; (M) Cre recombinase delivered with 6xHis-CM18-PTD4 peptide; (N) CPP5-fused Cre recombinase; (O) TAT-fused Cre recombinase; (P) ANTP-fused Cre recombinase.

[0061] Figs. 3(A-M) illustrate schematics, graphs, images, and plots showing cellpenetrating peptide-mediated delivery of ABE in vitro and in vivo. (A) Schematic cartoon of fluorescent rdl2 reporter. Under the control of the CMV promoter, a gene expresses both mCherry and eGFP, with an intervening sequence from the Rpe65 rd.12 genomic sequence. The rdl2 mutation (c,130C > T; p.R44X) prevents expression of eGFP, but successful base editing restores the reading frame and co-expression of mCherry and eGFP. (B) Quantification of successful base editing of rdl2 reporter cells, 48 h after co-transfection of CMV-ABE8e-NG and sgRNA plasmids. Three biological replicates with 2 analytical replicates each, mean ± s.d. (C) Assessment by fluorescence microscopy and flow cytometry of ABE delivery to rdl2 reporter cells, 48 h post-treatment; mCherry and eGFP coexpression indicate successful delivery. Scale bar represents 100 pm. (D) Concentrationdependence of efficiency of delivery of ABE in the presence of 2% (w / v) sucrose, 10% (w / v) sucrose; and of 0.5 pM ABE with 10% (w / v) sucrose and 6xHis-CM18-PTD4 peptide. 1 pM corresponds to 224 pg ml1. Two biological replicates with 2 analytical replicates each, mean ± s.d. (E) Electroretinography (ERG) response curves from WT mice. (F) ERG response curves from rdl2 mice, two- weeks post -treatment with ABE8e NG RNP in the presence of high and low NaCl and sucrose, with and without 6xHis-CM18-PTD4 peptide. The left curves represent the highest responding eye from each treatment group, indicated with a star on the graph, while the right curves represent a low responding eye from each treatment group, indicated with a hash. (G) Quantification of ERG responses (b-wave amplitude) from rd!2 mice whose response curves are shown in panel e. ABE RNP concentrations are given in pM. 20 pM corresponds to 4.5 pg ABE RNP per eye, 36 pM - to 8.1 pg per eye. At least6 eyes, mean ± s.d., Kruskal-Wallis test with Dunn’s multiple comparisons test, *P < 0.05; **P < 0.01. (H, I) Quantification of genomic DNA editing (H) and cDNA transcripts containing the edit (1) in ABE-treated mice, whose responses are summarized in panel f. The colors are consistent with panel g. (J) ERG response curves from rdl2 mice, 2 weeks posttreatment with ABE8e RNP with or without fused cell -penetrating peptides. (K) Quantification of ERG responses (b-wave amplitude) from rd.12 mice whose response curves are shown in the panel J. The mice received 4.5 pg ABE RNP per eye. At least 6 eyes, mean ± s.d., Kruskal- Wallis test with Dunn’s multiple comparisons test,< 0.001. (L, M) Quantification of genomic DNA editing (L) and resulting proportion of transcripts containing the edit (M) in GPP- ABE treated mice, whose responses are summarized in panel J. The colors are consistent with panel K.

[0062] Figs. 4(A-Q) illustrate schematics, graphs, images, and plots showing lipid nanoparticle delivery of ABE RNPs. (A) Schematic cartoon of encapsulation of RNP into LNP. (B) Size-distribution analysis of ABE RNP LNP, with 1.5% DMG-PEG 2000 and ionizable lipids: SM102 (diameter d = 228 nm, polydispersity index Pdl = 0.072); CL4H6 (d = 235 nm, Pdl = 0.132); DODMA (d = 249 nm, Pdl = 0.079). Averaged plots are shown, n = 3 replicates. (C) A scheme of the immunoprecipitation of ABE RNP, free (red) or encapsulated into LNP (yellow), on a 1D4 resin. IN = input; NB = non bound; E = eluate.(D) Western blot analysis of the immunoprecipitation of ABE RNP, free and encapsulated into LNPs containing 1.5% DMG-PEG 2000 and ionizable lipids SMI 02, CL4H6, or DODMA. The band corresponding to ABE is indicated with an arrow. Bound material was eluted using a Laemmli sample buffer with DTT, and bands corresponding to the mouse 1D4 antibody stripped from the resin alongside ABE arc indicated with hashes (sec also Figs. 9A, B). (E) Delivery of ABE RNP by LNP after incubation of the rdl2 reporter cells with the LNPs for 1 - 48 h, quantified by flow cytometry. The concentration of ABE RNP was 20 nM, 4.5 pg ml1. Two biological replicates with 2 analytical replicates each, mean ± s.d. (F) Fluorescence microscopy and flow cytometry results demonstrating delivery of ABE by LNP to the rdl2 reporter cells, measured 24 h after treatment. Scale bar represents 100 pm. (G) Quantification of delivery of ABE RNP as LNP after incubation of the rd 12 reporter cells with 1 - 40 nM ABE RNP for 24 h. Two biological replicates with 2 analytical replicates each, mean ± s.d. (H) Summary of ERG b-wave responses of rdl2 mice treated with 1 pl ABE RNP LNP per eye. The concentration of ABE RNP in the LNP was approximately 2.3pM (SM102, CL4H6, 515 ng per eye) and approximately 1.8 pM (DODMA, 403 ng per eye). At least 10 eyes, mean ± s.d, Kruskal -Wallis test with Dunn’s multiple comparisons test, ***P < 0.001; ****P < 0.0001. (1) Size-distribution analysis of ABE RNP LNP with ionizable lipid SM102 and 0 - 10% DMG-PEG 2000. Average of 3 replicates. (J) Delivery of ABE RNP LNP with 0 - 10% DMG-PEG 2000, quantified by flow cytometry. The colors are consistent with panel i. Two biological replicates with 2 analytical replicates each, mean ± s.d. (K) Cryoelectron-microscopic image of optimized ABE RNP LNP containing ionizable lipid SM102 and 2.5% DMG-PEG 2000. (L) Schematic cartoon of targeted quantification of ABE and PE using mass spectrometry. (M) MS Quantification of ABE8e protein, RNP, and LNP with 2.5% DMG-PEG 2000 using peptides targeting Cas9 and evolved adenosine deaminase Tad AL relative to quantification by absorbance at 280 nm. Protein concentration in LNP was estimated by correcting for dilution throughout the encapsulation and dialysis. Three analytical replicates, mean ± s.d. (N) Rescue of expression of RPE65 in a cell line expressing Rpe65 rd.12 cDNA by ABE RNP, delivered with Lipofectamine 3000 (L3k) or via LNP containing ionizable lipid SM102 and 1.5 - 2.5% DMG-PEG 2000. (O) Next-generation sequencing analysis of ABE-editing outcomes in the cells with cDNA encoding Rpe65 rdl2, treated with ABE delivered on a plasmid with Lipofectamine 3000 (L3k) or as LNP. Three analytical replicates, mean ± s.d. (P) Off-target analysis of Rpe65 rd.12 cDNA cells. (Q) ERG b-wave responses of rdl2 mice treated with 1 pl ABE RNP LNP per eye, with ionizable lipid SM102 and 1.5 or 2.5% DMG-PEG 2000. The RNP concentrations were approximately 2.3 and 2.5 pM, respectively, and the doses 515 ng and 560 ng RNP per eye, respectively. At least 8 eyes, mean ± s.d, Kruskal-Wallis test with Dunn’s multiple comparisons test, ****P < 0.0001. Panels A, C, L created with BioRcndcr.com: BioRcndcr.com / a74c702, BioRender.com / m32e636, BioRender.com / w33y755, BioRender.com / zl4j704. Uncropped blots are available within source data.

[0063] Figs. 5(A- J) illustrate immunoassays, graphs, images, and plots showing lipid nanoparticle delivery of PE. (A) Immunoprecipitation-encapsulation assay of PE2 RNP LNP. (B) Particle size distribution of PE2 RNP LNP prepared with 1.5% DMG-PEG 2000 and ionizable lipids SM102 (d = 270 nm, Pdl = 0.068), CL4H6 (d = 298 nm, Pdl = 0.024), or DODMA (d = 176 nm, Pdl = 0.096), and with 2.5% DMG-PEG 2000 and ionizable lipid SM102 (d = 194 nm, Pdl = 0.040). Average plots are shown, n = 3 replicates. (C, D) Delivery of PE2 RNP LNP to rdl 2 reporter cells, analyzed by flow cytometry andfluorescence microscopy. Representative microscopic image is shown for rd.12 reporter cells, treated with 20 nM PE2 RNP LNP with 2.5% DMG-PEG 2000. 20 nM corresponds to 6 pg ml1. Scale bar represents 100 pm. Two biological replicates with two analytical replicates each, mean ± s.d. (E) Cryoelectron-microscopic image of PE2 RNP LNP, containing ionizable lipid SM102 and 2.5% DMG-PEG 2000. The scale bar represents 100 nm. (F) Mass spectrometric quantification of PE2 as protein, RNP, and LNP. Three analytical replicates, mean ± s.d. (G) PE-mediated rescue of expression of RPE65 in a cell line transformed with cDNA encoding Rpe65 rd.12. LNP with 2.5% DMG-PEG 2000 was used, and RNP concentration was 20 nM, 6 pg ml1. (H) Next-generation sequencing analysis of PE-editing outcome in the cells with cDNA encoding Rpe65 rdl2. Three analytical replicates, mean ± s.d. (I) Off-target analysis of Rpe65 rd!2 cells treated with PE RNP LNP. (J) Restoration of visual function in rdl2 mice treated with 1 .6 pM (CL4116, 476 ng RNP per eye), 2.0 pM (SM102, DODMA, 596 ng RNP per eye) or 2.2 pM (SM102 with 2.5% DMG- PEG 2000, 655 ng RNP per eye) PE2 LNP, 1 pl per eye, as evidenced by ERG. At least 5 eyes, mean ± s.d. Kruskal-Wallis test with Dunn’s multiple comparisons test, *P < 0.05; **P < 0.01; ****P < 0.0001; ns, P > 0.05. Uncropped blots are available within source data.

[0064] Figs. 6(A-I) illustrate immunoassays, graphs, images, and plots in vivo physiology and chemistry of Rpe65 correction. (A) ABE RNP LNP degradation kinetics after subretinal injection into WT mice; anti-Cas9 Western blot analysis of RPE / choroid / sclera and neural retina lysates collected at the indicated hours post-injection. (B, C) Next-generation sequencing of genomic DNA (B) and of transcripts (C) to document Rp<?(55-editing outcomes after treatment with ABE RNP LNP or PE RNP LNP. (D) Anti- RPE65 Western blot analysis of RPE / choroid / sclera lysates from WT, untreated rdl2, and ABE-RNP-LNP-treated rd!2. (E) HPLC quantification of 1 1 -m-relinal in whole eyes from dark-adapted untreated rdl2 mice, ABE-RNP-LNP- and PE-RNP-LNP-treated rd 12 mice, and WT mice. (F) RPE flatmounts of rd 12 untreated, ABE-RNP-LNP-treated rdl2, and WT mice stained for RPE65 (green) and counterstained with ZO-1 (magenta) and DAPI (blue). Scale bar, 50 pm. (G) Scotopic flash ERG a-wave (left) and b-wave (right) amplitudes for rdl2 mice treated with ABE RNP LNP or PE RNP LNP, compared to untreated rd!2 and W T mice. (H) Pupillary light reflex (PLR) after a IO1,2W m-2stimulus for ABE-RNP-LNP- and PE-RNP-LNP-treated rdl2 mice, compared to untreated rdl2 and WT mice. Data quantified as pupil diameter constriction post-stimulus compared to pupil diameter pre-stimulus in dark-adapted animals. Representative frames (left), and summarized data (right). Scale bar, 1 mm. (I) Representative SC (left) and VI (right) responses from WT mice (black), rd 12 mice treated with free ABE RNP (green), ABE RNP LNP (purple), or PE RNP LNP (red), and untreated rd!2 mice (orange). The mice received 1 pl of 2.5 pM ABE RNP (560 ng) or 2.2 pM PE RNP (655 ng) per eye. All data plotted as mean ± s.d. Data in e, g were analyzed by one-way ANOVA with Kruskal-Wallis test; in h, by one-way ANOVA with Dunnet’s multiple comparisons test., *P < 0.05; **P < 0.01; ***P<0.001; ****P < 0.0001; ns, P > 0.05. Uncropped blots are available within source data.

[0065] Figs. 7(A-D) illustrate images, plots, and graphs showing delivery of PE RNP into rdI2 reporter cells. (A) Analysis of delivery of 500 nM PE2 RNP (149 pg ml-1), with epegRNA targeting Rpe65 rd!2. into the rd!2 reporter cells using 2% (w / v) sucrose or 10% (w / v) sucrose, and with or without added cell-penetrating peptide 6xHis-CM18-PTD4; or using Lipofectamine 3000 (L3000). In parallel, the rd!2 reporter cells were transfected with PE2 and rd!2 epegRNA plasmids (right-most panel). The cells were analyzed using fluorescence microscopy and flow cytometry. Faint-yellow cells that were modified with PE2 RNP are highlighted with yellow circles. Scale bar: 100 pm. (B) Delivery of PE2 RNP using 10% sucrose and 6xHis-CM18-PTD4 peptide, quantified using flow cytometry. Two biological replicates with two analytical replicates each, mean ± s.d. One-way ANOVA with Tukey’s multiple comparisons test. ****P < 0.0001; ns, P > 0.05. (C) Comparison of efficiency of delivery of PE2 with Lipofectamine 3000 as RNP, and as a pair of PE and epegRNA plasmids. *P < 0.05; ****P < 0.0001. One-way ANOVA with Tukey’s multiple comparisons test. NE = minus enzyme control with Lipofectamine 3000 alone. (D) Titration of rd!2 reporter cells with increasing PE RNP and constant L3000, quantified by flow cytometry. Four biological replicates with 2 analytical replicates each, mean ± s.d.

[0066] Figs. 8(A-G) illustrate immunoassays, graphs, images, and plots showing delivery of ABE using Lipofectamine 3000. (A) Analysis of ABE editing of rdl2 reporter cells transfected with plasmids encoding ABE NG variants and guide RNA targeting Rpe65 rd!2. Two biological replicates with 2 analytical replicates each, mean ± s.d. (B, C) ABE RNPs were delivered to rd!2 reporter cells using Lipofectamine 3000. Efficiency of delivery was analyzed using (B) fluorescence microscopy (100 nM, 22.4 pg ml1RNP shown here) and (C) flow cytometry. Scale bar: 100 pm. Two biological replicates with 2 analytical replicates each, mean ± s.d. (D) Rescue of RPE65 protein expression in Nil I / 3T3-rd / 2 cellsby delivery of ABE and guide RNA plasmids (p), or 100 nM ABE RNP using Lipofectamine 3000 (RNP). Mouse retinal pigment epithelium (RPE) extract was used as a positive control. M = molecular weight marker; N = untreated cells. (E) NGS analysis of editing of NIH / 3T3- rdl2 cells treated with ABE. Two biological replicates with at least 3 analytical replicates each, mean ± s.d. (F, G) Rescue of visual function in rdl2 mice injected with 25 pM ABE8e RNP (5.6 pg per eye), 23.6 pM ABE8e RNP with 50%(v / v) Lipofectamine 3000 (4.5 pg per eye), or 23.6 pM ABE8e RNP with 10%(v / v) Lipofectamine 3000. Injected material additionally contained 25% (w / v) sucrose. At least 8 eyes, mean ± s.d, Kruskal- Wallis test with Dunn’s multiple comparisons test, **P < 0.01. Uncropped blots are available within Source data.

[0067] Figs. 9(A-K) illustrate immunoassays, graphs, images, and plots showing optimization of ABE RNP LNPs. (A,B) Immunoprecipitation of ABE RNP, free or encapsulated in the LNP with SMI 02 ionizable lipid and 1.5% DMG-PEG 2000, using 1D4 resin or control B6-30 resin. Elution was done using 1 mg ml-1 1D4 peptide (E) or using Laemmli sample buffer with DTT (E*). 1D4 and B6-30 resins treated with Laemmli sample buffer alone served as additional controls. The arrow (at the right) indicates the band corresponding to ABE; hash marks correspond to bands from mouse 1D4 and B6-30 antibodies detected by equine anti-mouse secondary HRP-linked antibody. (C) Relative cytotoxicity of LNP with ionizable lipid DODMA, with or without SOPS, demonstrated using fluorescence-microscopic images from three transfection experiments at 20 nM RNP (4.5 pg ml-1). (D) Stability (upon storage at 4 °C or -80 °C) of ABE RNP LNP made with 50% ionizable lipid and 1.5% DMG-PEG 2000, as tested with rdI2 reporter cells and 20 nM ABE RNP. Three replicates, mean ± s.d. (E, F) Particle size distribution and delivery efficiency of ABE RNP LNP made with various lipid:RNA weight ratios. Asterisks denote 2.5% DMG-PEG 2000; otherwise, the concentration was 1.5%. Plots shown in panels E and F represent data that were averaged from n = 3 replicates, mean ± s.d. (G) Encapsulation of ABE RNP into LNPs with ionizable lipid SM102 and 2.5% DMG-PEG 2000. (H) Size exclusion chromatograms of ABE8e RNP (black) and ABE8e RNP LNP with SM102 lipid and 2.5% DMG-PEG2000, 40: 1 lipid:sgRNA ratio (red) resolved on a Sephacryl S-500 HR column (top) and anti-Cas9 blots of collected fractions (bottom). (I, J) ABE editing in the rdJ2 reporter cells, using ABE RNP LNP visualized via fluorescence microscopy (here, 20 nM ABE8c RNP) and quantified by flow cytometry. Scale bar: 100 pm. Three replicates.(K) ERG responses of rd / 2 mice treated with ABE8e LNPs made using ionizable lipid SM102 and 1.5 - 2.5% DMG-PEG 2000 (2.3 and 2.5 pM, 515 and 560 ng, respectively), ABE8e N108Q LNPs made with 2.5% DMGPEG 2000 (2.3 pM, 515 ng), or ABE8e LNPs with non-targeting guide RNA (2.5 pM, 560 ng), 1 pl per eye. At least 8 eyes, mean ± s.d, Kruskal-Wallis test with Dunn’s multiple comparisons test, ***P < 0.001; ****P < 0.0001. Uncropped blots are available within Source data.

[0068] Figs. 10(A-D) illustrate plots and graphs showing treatment with editorcontaining nanoparticles restores visual responses in rdl2 mice. (A) Visually evoked potentials (VEPs) in the superior colliculus (SC) for untreated WT mice (black); rdl2 mice treated with free RNP (green); rdl2 mice treated with ABE RNP LNP (purple); rdl2 mice treated with PE RNP LNP (red); and untreated rdl2 mice (orange). Bar plots represent the summary of the VEPs from all tested animals. (B) Same analysis as in (A) performed for the primary visual cortex (VI). (C) Overlapped examples of histograms for single-neuron flash responses. (D) Single-cell examples of selective neurons recorded in the SC. The tuning curves present orientation selective cells, spatial frequency, and temporal frequency tuning curves for the tested mice. Numbers on the graphs indicate HWHH, optimal spatial frequency, and optimal temporal frequency.

[0069] Figs. l l(A-H) illustrate plots showing differential-scanning fluorimetry profiles of ABE and PE. ABE8e and PE2 proteins, with or without respective guide RNAs, were incubated with increasing concentrations of NaCl, and with optional additives. Plots were averaged from n = 3 replicates.

[0070] Figs. 12(A-B) illustrate images and plots showing titration of HEK293-loxP- GEP-RFP cells with CPP-fuscd Crc. Crc recombinase, with and without fused cellpenetrating peptides, was delivered to the HEK293-loxP-GFP-RFP cells; and delivery efficiency was analyzed by (A) fluorescence microscopy and (B) flow cytometry. Cell viability was assessed using inclusion of DAPI. Scale bar: 200 pm. Three experiments with two replicates each, mean ± s.d.

[0071] Figs. 13(A-B) illustrate images and plots showing titration of HEK293-loxP- GFP-RFP cells with Cre and 6xHis-CM18-PTD4 peptide. Cre recombinase (0.5 pM) with additional 6xHis-CM18-PTD4 peptide was delivered to the HEK293-loxP-GFP-RFP cells, and delivery efficiency was analyzed by (A) fluorescence microscopy and (B) flowcytometry. Cell viability was assessed according to inclusion of DAPI. Scale bar: 200 jam. Three experiments with two replicates each, mean ± s.d.

[0072] Figs. 14(A-B) illustrate images and plots showing minus-enzyme controls for HEK293-loxP-GFP-RFP cells with 6xHis-CM18-PTD4 peptide. The cells were treated with OptiMEM medium without or with additional 6xHis-CM18-PTD4 peptide, analogous to the experiments with Cre recombinase, and analyzed by (A) fluorescence microscopy and (B) flow cytometry. Scale bar: 200 pm. Three experiments with two replicates each, mean ± s.d.

[0073] Figs. 15(A-D) illustrate images, plots, and graphs showing delivery of PE RNP into rdl2 reporter cells. (A) Analysis of delivery of 500 nM PE2 RNP (149 pg ml1), with epegRNA targeting Rpe65 rdl2, into the rd! 2 reporter cells using 2% (w / v) sucrose or 10% (w / v) sucrose, and with or without added cell-penetrating peptide 6xHis-CM18-PTD4; or using Lipofectamine 3000. In parallel, the rd! 2 reporter cells were transfected with PE2 and rd!2 epegRNA plasmids (right-most panel). The cells were analyzed using fluorescence microscopy and flow cytometry. Faint-yellow cells that were modified with PE2 RNP are highlighted with yellow circles. Scale bar: 100 pm. (B) Delivery of PE2 RNP using 10% sucrose and 6xHis-CM18-PTD4 peptide, quantified using flow cytometry. Two biological replicates with two analytical replicates each, mean ± s.d. One-way ANOVA with Tukey’s multiple comparisons test. ****R < 0.0001; ns, P > 0.05. (C) Comparison of efficiency of delivery of PE2 with Lipofectamine 3000 as RNP, and as a pair of PE and epegRNA plasmids. *P < 0.05; ****P < 0.0001. One-way ANOVA with Tukey’s multiple comparisons test. NE = minus enzyme control with Lipofectamine 3000 alone. (D) Titration of rd 12 reporter cells with increasing PE RNP and constant Lipofectamine 3000, quantified by flow cytometry. Four biological replicates with 2 analytical replicates each, mean ± s.d.

[0074] Figs. 16(A-G) illustrate immunoassays, graphs, images, and plots showing delivery of ABE using Lipofectamine 3000. (A) Analysis of ABE editing of rdl2 reporter cells transfected with plasmids encoding ABE NG variants and guide RNA targeting Rpe65 rd!2. Two biological replicates with 2 analytical replicates each, mean ± s.d. (B, C) ABE RNPs were delivered to rd! 2 reporter cells using Lipofectamine 3000. Efficiency of delivery was analyzed using (B) fluorescence microscopy (100 nM, 22.4 pg ml1RNP shown here) and (C) flow cytometry. Scale bar: 100 pm. Two biological replicates with 2 analytical replicates each, mean ± s.d. (D) Rescue of RPE65 protein expression in NIH / 3T3-rriJ2 cells by delivery of ABE and guide RNA plasmids (p), or 100 nM ABE RNP using Lipofectamine3000 (RNP). Mouse retinal pigment epithelium (RPE) extract was used as a positive control. M = molecular weight marker; N = untreated cells. (E) NGS analysis of editing of NIH / 3T3- rdl2 cells treated with ABE. Two biological replicates with at least 3 analytical replicates each, mean ± s.d. (F, G) Rescue of visual function in rdl2 mice injected with 25 pM ABE8e RNP (5.6 pg per eye), 23.6 pM ABE8e RNP with 50%(v / v) Lipofectamine 3000 (4.5 pg per eye), or 23.6 pM ABE8e RNP with 10%(v / v) Lipofectamine 3000. Injected material additionally contained 25% (w / v) sucrose. At least 8 eyes, mean ± s.d, Kruskal- Wallis test with Dunn’s multiple comparisons test, **P < 0.01.

[0075] Fig. 17 illustrates structures of lipids used in the Example.

[0076] Figs. 18(A-K) illustrate immunoassays, graphs, images, and plots (A, B) Immunoprecipitation of ABE RNP, free or encapsulated in the LNP with SMI 02 ionizable lipid and 1.5% DMG-PEG 2000, using 1D4 resin or control B6-30 resin. Elution was done using 1 mg ml11D4 peptide (E) or using Laemmli sample buffer with DTT (E*). 1D4 and B6-30 resins treated with Laemmli sample buffer alone served as additional controls. The arrow (at the right) indicates the band corresponding to ABE; hash marks correspond to bands from mouse 1D4 and B6-30 antibodies detected by equine anti-mouse secondary HRP- linked antibody. (C) Relative cytotoxicity of LNP with ionizable lipid DODMA, with or without SOPS, demonstrated using fluorescence-microscopic images from three transfection experiments at 20 nM RNP (4.5 pg ml1). (D) Stability (upon storage at 4°C or -80°C) of ABE RNP LNP made with 50% ionizable lipid and 1.5% DMG-PEG 2000, as tested with rdl2 reporter cells and 20 nM ABE RNP. Three replicates, mean ± s.d. (E, F) Particle size distribution and delivery efficiency of ABE RNP LNP made with various lipid:RNA weight ratios. Asterisks denote 2.5% DMG-PEG 2000; otherwise, the concentration was 1.5%. Plots shown in panels E and F represent data that were averaged from n = 3 replicates, mean ± s.d. (G) Encapsulation of ABE RNP into LNPs with ionizable lipid SM102 and 2.5% DMG-PEG 2000. (H) Size exclusion chromatograms of ABE8e RNP (black) and ABE8e LNP with SM102 lipid and 2.5% DMG-PEG2000, 40:1 lipid:sgRNA ratio (red) resolved on a Sephacryl S-500 HR column (top) and anti-Cas9 blots of collected fractions (bottom). (I, J) ABE editing in the rdl2 reporter cells, using ABE RNP LNP visualized via fluorescence microscopy (here, 20 nM ABE8e RNP) and quantified by flow cytometry. Scale bar: 100 pm. Three replicates. (K) ERG responses of rd 12 mice treated with ABE8e LNPs made using ionizable lipid SM102 and 1.5 - 2.5% DMG-PEG 2000 (2.3 and 2.5 pM, 515 and 560 ng,respectively), ABE8e N108Q LNPs made with 2.5% DMG-PEG 2000 (2.3 pM, 515 ng), or ABE8e LNPs with non-targeting guide RNA (2.5 pM, 560 ng), 1 pl per eye. At least 8 eyes, mean ± s.d, Kruskal-Wallis test with Dunn’s multiple comparisons test, ***P < 0.001; ****p < 0.0001.

[0077] Figs. 19(A-E) illustrate mass spectrometric quantification of ABE and PE. (A) Reproducibly detected tryptic peptides of Cas9, ABE, and PE2. The peptides selected for quantification are highlighted. (B) Workflow for absolute quantification of protein abundance with stable-isotope-labeled (SIL) peptides. (C) Repeatability of SIL peptide- based quantification in LNP samples. (D) Linear response of SIL peptide-based quantification of Cas9, ABE, and PE2. (E) The MS2 spectra of the peptides and related SIL peptides for quantification of Cas9, ABE, and PE2.

[0078] Figs. 20(A-B) illustrate plots showing off-target analysis of rd 12 mice treated with ABE- and PE RNP LNP. (A) Quantification of deamination of target A6 (on-target) or adenosine closest to A5 (off- targets) in genomic DNA isolated from RPE cells of rdl2 mice treated with ABE RNP LNP, 560 ng per eye. (B) Quantification of target edit (on-target) or most edited nucleotide (off-targets) in genomic DNA isolated from RPE cells of rd!2 mice treated with PE RNP LNP.

[0079] Figs. 21(A-D) illustrate graphs showing non-targeting ABE and PE RNP LNPs do not result in correction of Rpe65 or restore scotopic flash ERG responses. (A, B) Nextgeneration sequencing of (A) genomic DNA and (B) transcripts to document RpeftJ-editing outcomes after treatment of rd!2 mice with non-targeting ABE RNP LNP or nontargeting PE RNP LNP. (C, D) Scotopic flash ERG a- wave and b-wave amplitudes for rd 12 mice treated with non-targeting ABE RNP LNP and non-targeting PE RNP LNP. The mice received 560 ng of ABE RNP or 655 ng of PE RNP per eye.

[0080] Figs. 22(A-D) illustrate plots and graphs showing treatment with editorcontaining nanoparticles restores visual responses in rdl2 mice. (A) Visually evoked potentials (VEPs) in the superior colliculus (SC) for untreated WT mice (black); rdl2 mice treated with free RNP (green); rd!2 mice treated with ABE RNP LNP (purple); rdl2 mice treated with PE RNP LNP (red); and untreated rd 12 mice (orange). Bar plots represent the summary of the VEPs from all tested animals. (B) Same analysis as in (A) performed for the primary visual cortex (VI). (C) Overlapped examples of histograms for single-neuron flash responses. (D) Single-cell examples of selective neurons recorded in the SC. The tuningcurves present orientation-selective cells, spatial frequency, and temporal frequency tuning curves for the tested mice. Numbers on the graphs indicate HWHH, optimal spatial frequency, and optimal temporal frequency.

[0081] Figs. 23(A-C) illustrate plots showing flow cytometry gating strategies. (A) HEK293-loxP-GFP-RFP cells, (B) mT / mG fibroblasts, (C) rdl2 reporter cells. The cells were gated on forward and side scatter (FSC-A and CCS-A, respectively) to select intact cells; and forward scatter area (FSC-A) and height (FSC-H) to isolate single cells. Fluorescence of GFP was quantified using a FITC filter (530 / 30 nm), and fluorescence of RFP, tdTomato, and mCherry was quantified using a PE filter (586 / 20 nm). Cell viability was estimated by DAPI exclusion using a Pacific Blue filter (445 / 45 nm).

[0082] Figs. 24(A-B) illustrate a plot and images showing optimization of formulation of ABE RNP LNP. (A) Flow cytometric quantification of conversion of rd!2 reporter cells by ABE RNP formulated at 1:3 and 1 :6 organic:aqueous ratio. 4 biological replicates.(B) Fluorescence microscopic images of rd / 2 reporter cells treated with 2.5 nM ABE RNP encapsulated at 1:3 and 1 :6 organic: aqueous ratio. Scale bar, 100 pm.

[0083] Figs. 24(A-B) illustrate a schematic and images showing encapsulation of RNP LNP targeting TIGER construct. (A) A schematic of TIGER construct. TIGER is a tdTomato construct with nonsense mutations that render it non-fluorescent. (B) Fluorescence microscopic images of TIGER IIEK cells treated with 50 nM ABE and PE RNP encapsulated into LNPs. Scale bar, 200 pm.DETAILED DESCRIPTION

[0084] As used herein and in the claims, the singular forms “a,” “an,” and “the” include the singular and the plural unless the context clearly indicates otherwise. Thus, for example, a reference to “an agent” includes a single agent and a plurality of such agents.

[0085] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5- fold, and more preferably within 2-fold, of a value. Where particular values are described inthe application and claims, unless otherwise stated, the term “about” meaning within an acceptable error range for the particular value should be assumed.

[0086] The term “deaminase” or “deaminase domain” refers to a protein or enzyme that catalyzes a deamination reaction. In some embodiments, the deaminase is an adenosine deaminase, which catalyzes the hydrolytic deamination of adenine or adenosine. In some embodiments, the deaminase or deaminase domain is an adenosine deaminase, catalyzing the hydrolytic deamination of adenosine or deoxy adenosine to inosine or deoxyinosine, respectively. In some embodiments, the adenosine deaminase catalyzes the hydrolytic deamination of adenine or adenosine in deoxyribonucleic acid (DNA). The adenosine deaminases (e.g., engineered adenosine deaminases, evolved adenosine deaminases) described herein may be from any organism, such as a bacterium. In some embodiments, the deaminase or deaminase domain is a variant of a naturally occurring deaminase from an organism. In some embodiments, the deaminase or deaminase domain does not occur in nature.

[0087] The term “adenosine deaminase” refers to an enzyme that catalyzes the deamination of adenosine, converting it to the nucleoside inosine. Under standard Watson- Crick hydrogen bond pairing, an adenosine base hydrogen bonds to a thymine base (or an uracil in the case of RNA). When adenine is converted to inosine, the inosine undergoes hydrogen bond pairing with cytosine. Thus, a conversion of “A” to inosine by adenosine deaminase will cause the insertion of “C” instead of a “T” during cellular repair and / or replication processes. Since the cytosine “C” pairs with guanine “G”, the adenosine deaminase in coordination with DNA replication, causes the conversion of an A T pairing to a C-G pairing in the double- stranded DNA molecule.

[0088] The term “base editing” is a genome editing technology that involves the conversion of a specific nucleic acid base into another at a targeted genomic locus. In certain aspects, this can be achieved without requiring double-stranded DNA breaks (DSB).

[0089] The term “base editors (BEs)” or “nucleobase editors (NBEs)” as used herein, refers to an agent comprising a polypeptide that is capable of making a modification to a base e.g., A, T, C, G, or U) within a nucleic acid sequence (e.g., DNA or RNA), for example, any of the Cas9 fusion proteins described herein. In some embodiments, the base editor is capable of deaminating a base within a nucleic acid. In some embodiments, the base editor is capable of deaminating a base within a DNA molecule. In some embodiments, the baseeditor is capable of deaminating an adenine (A) in DNA. In some embodiments, the base editor is a fusion protein comprising a nucleic acid programmable DNA binding protein (napDNAbp) fused to an adenosine deaminase. In some embodiments, the base editor is a Cas9 protein fused to an adenosine deaminase. In some embodiments, the base editor is a Cas9 nickase (nCas9) fused to an adenosine deaminase. In some embodiments, the base editor is a nuclease-inactive Cas9 (dCas9) fused to an adenosine deaminase. In some embodiments, the fusion protein comprises a nuclease-inactive Cas9 (dCas9) fused to a deaminase which still binds DNA in a guide RNA-programmed manner via the formation of an R-loop, but does not cleave the DNA backbone. In some embodiments, the fusion protein comprises a Cas9 or Cas9 nickase (nCas9) fused to an adenosine deaminase. Base editors comprising an adenosine deaminase (e.g., adenosine base editors) have been described in PCT / US2017 / 045381 (published as WO 2018 / 027078); PCT / US2018 / 056146 (published as WO 2019 / 079347); and PCT / 2019 / 033848; the entire contents of each of which are incorporated herein by reference. Exemplary adenosine base editors include, without limitation xCas9-3.7-ABE (xABE). Other base editors include cytidine base editors, which, in some embodiments, are fusion proteins comprising a Cas9 nickase fused to a deaminase, e.g., a cytidine deaminase (rAPOBECl) which converts a DNA base cytosine to uracil. One such base editor is referred to as “BE1” in the literature. In some embodiments, the fusion protein comprises a nuclease-inactive Cas9 fused to a deaminase and further fused to a UGI domain (uracil DNA glycosylase inhibitor, which prevents the subsequent U:G mismatch from being repaired back to a C:G base pair). One such base editor is referred to as “BE2” in the literature.

[0090] The term “Cas9” or “Cas9 nuclease” or “Cas9 moiety” refers to a CRISPR associated protein 9, or functional fragment thereof, and embraces any naturally occurring Cas9 from any organism, any naturally-occurring Cas9 equivalent or functional fragment thereof, any Cas9 homolog, ortholog, or paralog from any organism, and any mutant or variant of a Cas9, naturally-occurring or engineered. More broadly, a Cas9 is a type of “RNA-programmable nuclease” or “RNA-guided nuclease” or more broadly a type of “nucleic acid programmable DNA binding protein (napDNAbp)”. The term Cas9 is not meant to be particularly limiting and may be referred to as a “Cas9 or equivalent.” Examples of Cas9 proteins are further described herein and / or are described in the art and areincorporated herein by reference. The present disclosure is unlimited with regard to the particular Cas9 that is employed in the improved base editors of the invention.

[0091] A nuclease-inactivated Cas9 domain may interchangeably be referred to as a “dCas9” protein (for nuclease-“dead” Cas9). Methods for generating a Cas9 domain (or a fragment thereof) having an inactive DNA cleavage domain are known (see, e.g., Jinek et al., Science. 337:816-821(2012); Qi et al., “Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression” (2013) Cell. 28; 152(5): 1173- 83, the entire contents of each of which are incorporated herein by reference). For example, the DNA cleavage domain of Cas9 is known to include two subdomains, the HNH nuclease subdomain and the RuvCl subdomain. The I INI I subdomain cleaves the strand complementary to the gRNA, whereas the RuvCl subdomain cleaves the non-complementary strand. Mutations within these subdomains can silence the nuclease activity of Cas9. For example, the mutations D10A and H840A completely inactivate the nuclease activity of .S'. pyogenes Cas9 (Jinek et al., Science. 337:816-821(2012); Qi et al., Cell. 28; 152(5): 1173-83 (2013)). In some embodiments, proteins comprising fragments of Cas9 are provided. For example, in some embodiments, a protein comprises one of two Cas9 domains: (1) the gRNA binding domain of Cas9; or (2) the DNA cleavage domain of Cas9. In some embodiments, proteins comprising Cas9 or fragments thereof are referred to as “Cas9 variants.” A Cas9 variant shares homology to Cas9, or a fragment thereof.

[0092] The temr “CRISPR” refers to a family of DNA sequences (e.g., CRISPR clusters) in bacteria and archaea that represent snippets of prior infections by a virus that have invaded the prokaryote. The snippets of DNA are used by the prokaryotic cell to detect and destroy DNA from subsequent attacks by similar viruses and effectively compose, along with an array of CRISPR-associated proteins (including Cas9 and homologs thereof) and CRISPR- associated RNA, a prokaryotic immune defense system. In nature, CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). In certain types of CRISPR systems (e.g., type II CRISPR systems), correct processing of pre-crRNA requires a trans-encoded small RNA (tracrRNA), endogenous ribonuclease 3 (me) and a Cas9 protein. The tracrRNA serves as a guide for ribonuclease 3-aided processing of pre-crRNA. Subsequently, Cas9 / crRNA / tracrRNA endonucleolytically cleaves linear or circular dsDNA target complementary to the RNA. Specifically, the target strand not complementary to crRNA is first cut endonucleolytically, then trimmed 3’-5’ cxonuclcolytically. In nature, DNA-bindingand cleavage typically requires protein and both RNAs. However, single guide RNAs (“sgRNA”, or simply “gNRA”) can be engineered so as to incorporate aspects of both the crRNA and tracrRNA into a single RNA species - the guide RNA. See, e.g., Jinek M„ Chylinski K., Fonfara I., Hauer M., Doudna J.A., Charpentier E. Science 337:816-821(2012), the entire contents of which is hereby incorporated by reference. Cas9 recognizes a short motif in the CRISPR repeat sequences (the PAM or protospacer adjacent motif) to help distinguish self versus non-self. CRISPR biology, as well as Cas9 nuclease sequences and structures are well known to those of skill in the art (see, e.g., “Complete genome sequence of an Ml strain of Streptococcus pyogenes.” Ferretti et al, J.J., McShan W.M., Ajdic D.J., Savic D.J., Savic G., Lyon K., Primeaux C., Sezate S., Suvorov A.N., Kenton S., Lai H.S., Lin S.P., Qian Y., Jia H.G., Najar F.Z., Ren Q., Zhu H., Song L., White J., Yuan X., Clifton S.W., Roe B.A., McLaughlin R.E., Proc. Natl. Acad. Sci. U.S.A. 98:4658-4663(2001); “CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III.” Deltcheva E., Chylinski K., Sharma C.M., Gonzales K., Chao Y., Pirzada Z.A., Eckert M.R., Vogel J., Charpentier E., Nature 471:602-607(2011); and “A programmable dual-RNA- guided DNA endonuclease in adaptive bacterial immunity.” Jinek M., Chylinski K„ Fonfara L, Hauer M., Doudna J.A., Charpentier E. Science 337:816-821(2012), the entire contents of each of which are incorporated herein by reference). Cas9 orthologs have been described in various species, including, but not limited to, S. pyogenes and .S', thermophilus. Additional suitable Cas9 nucleases and sequences will be apparent to those of skill in the art based on this disclosure, and such Cas9 nucleases and sequences include Cas9 sequences from the organisms and loci disclosed in Chylinski, Rhun, and Charpentier, “The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems” (2013) RNA Biology 10:5, 726-737; the entire contents of which are incorporated herein by reference.

[0093] In certain types of CRISPR systems (e.g., type II CRISPR systems), correct processing of pre-crRNA requires a trans-encoded small RNA (tracrRNA), endogenous ribonuclease 3 (me), and a Cas9 protein. The tracrRNA serves as a guide for ribonuclease 3- aided processing of pre-crRNA. Subsequently, Cas9 / crRNA / tracrRNA endonucleolytically cleaves a linear or circular nucleic acid target complementary to the RNA. Specifically, the target strand not complementary to crRNA is first cut endonucleolytically, then trimmed 3 '-5' exonucleolytically. In nature, DNA-binding and cleavage typically requires protein and both RNAs. However, single guide RNAs (“sgRNA”, or simply “gRNA”) can be engineered so asto incorporate embodiments of both the crRNA and tracrRNA into a single RNA species the guide RNA.

[0094] In general, a “CRISPR system” refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g., tracrRNA or an active partial tracrRNA), a tracr mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. The tracrRNA of the system is complementary (fully or partially) to the tracr mate sequence present on the guide RNA.

[0095] The term “DNA synthesis template” refers to the region or portion of the extension arm of a pegRNA that is utilized as a template strand by a polymerase of a prime editor to encode a 3' single-strand DNA flap that contains the desired edit and which then, through the mechanism of prime editing, replaces the corresponding endogenous strand of DNA at the target site. The extension arm, including the DNA synthesis template, may be comprised of DNA or RNA. In the case of RNA, the polymerase of the prime editor can be an RNA-dependent DNA polymerase (e.g., a reverse transcriptase). In the case of DNA, the polymerase of the prime editor can be a DNA-dependent DNA polymerase. In various embodiments, the DNA synthesis template may comprise the “edit template” and the “homology arm”, and all or a portion of the optional 5' end modifier region, e2. That is, depending on the nature of the e2 region (e.g., whether it includes a hairpin, toeloop, or stcm / loop secondary structure), the polymerase may encode none, some, or all of the c2 region as well. Said another way, in the case of a 3' extension arm, the DNA synthesis template can include the portion of the extension arm that spans from the 5' end of the primer binding site (PBS) to 3' end of the gRNA core that may operate as a template for the synthesis of a single-strand of DNA by a polymerase (e.g., a reverse transcriptase). In the case of a 5' extension arm, the DNA synthesis template can include the portion of the extension arm that spans from the 5' end of the pegRNA molecule to the 3' end of the edit template. Preferably, the DNA synthesis template excludes the primer binding site (PBS) of pegRNAs either having a 3' extension arm or a 5' extension arm. Certain embodiments described here refer to an “an RT template,” which is inclusive of the edit template and thehomology arm, i.e., the sequence of the pegRNA extension arm that is actually used as a template during DNA synthesis. The term “RT template” is equivalent to the term “DNA synthesis template.”

[0096] The term “edit template” refers to a portion of the extension arm that encodes the desired edit in the single strand 3' DNA flap that is synthesized by the polymerase, e.g., a DNA-dependent DNA polymerase, RNA-dependent DNA polymerase (e.g., a reverse transcriptase). Certain embodiments described here refer to “an RT template,” which refers to both the edit template and the homology arm together, i.e., the sequence of the pegRNA extension arm that is actually used as a template during DNA synthesis. The term “RT edit template” is also equivalent to the term “DNA synthesis template,” but wherein the RT edit template reflects the use of a prime editor having a polymerase that is a reverse transcriptase, and wherein the DNA synthesis template reflects more broadly the use of a prime editor having any polymerase.

[0097] The term “extension arm” refers to a nucleotide sequence component of a pegRNA which provides several functions, including a primer binding site and an edit template for reverse transcriptase. In some embodiments, the extension arm is located at the 3' end of the guide RNA. In other embodiments, the extension arm is located at the 5' end of the guide RNA. In some embodiments, the extension arm also includes a homology arm. In various embodiments, the extension arm comprises the following components in a 5' to 3' direction: the homology arm, the edit template, and the primer binding site. Since polymerization activity of the reverse transcriptase is in the 5' to 3' direction, the preferred arrangement of the homology arm, edit template, and primer binding site is in the 5' to 3' direction such that the reverse transcriptase, once primed by an annealed primer sequence, polymerizes a single strand of DNA using the edit template as a complementary template strand. Further details, such as the length of the extension arm, are described elsewhere herein.

[0098] The extension arm may also be described as comprising generally two regions: a primer binding site (PBS) and a DNA synthesis template, for instance. The primer binding site binds to the primer sequence that is formed from the endogenous DNA strand of the target site when it becomes nicked by the prime editor complex, thereby exposing a 3' end on the endogenous nicked strand. As explained herein, the binding of the primer sequence to the primer binding site on the extension arm of the pegRNA creates a duplex region with anexposed 3' end (i.e., the 3' of the primer sequence), which then provides a substrate for a polymerase to begin polymerizing a single strand of DNA from the exposed 3' end along the length of the DNA synthesis template. The sequence of the single strand DNA product is the complement of the DNA synthesis template. Polymerization continues towards the 5' of the DNA synthesis template (or extension arm) until polymerization terminates. Thus, the DNA synthesis template represents the portion of the extension arm that is encoded into a single strand DNA product (i.e., the 3' single strand DNA flap containing the desired genetic edit information) by the polymerase of the prime editor complex and that ultimately replaces the corresponding endogenous DNA strand of the target site that sits immediately downstream of the PE-induced nick site. Without being bound by theory, polymerization of the DNA synthesis template continues towards the 5' end of the extension arm until a termination event. Polymerization may terminate in a variety of ways, including, but not limited to (a) reaching a 5' terminus of the pegRNA (e.g., in the case of the 5' extension arm wherein the DNA polymerase simply runs out of template), (b) reaching an impassable RNA secondary structure (e.g., hairpin or stem / loop), or (c) reaching a replication termination signal, e.g., a specific nucleotide sequence that blocks or inhibits the polymerase, or a nucleic acid topological signal, such as, supercoiled DNA or RNA.

[0099] The term “effective amount,” as used herein, refers to an amount of a biologically active agent that is sufficient to elicit a desired biological response. For example, in some embodiments, an effective amount of a base editor may refer to the amount of the base editor that is sufficient to edit a target site nucleotide sequence, e.g., a genome. In some embodiments, an effective amount of a base editor or prime editor described herein, e.g., of a fusion protein comprising a Cas9 and a nucleic acid editing domain (e.g., an adenosine deaminase domain) may refer to the amount of the fusion protein that is sufficient to induce editing of a target site specifically bound and edited by the fusion protein. As will be appreciated by the skilled artisan, the effective amount of an agent, e.g., a fusion protein, a nuclease, a deaminase, a hybrid protein, a protein dimer, a complex of a protein (or protein dimer) and a polynucleotide, or a polynucleotide, may vary depending on various factors as, for example, on the desired biological response, e.g., on the specific allele, genome, or target site to be edited, on the cell or tissue being targeted, and on the agent being used.

[0100] As used herein, the term “isolated protein” or “isolated nucleic acid” refers to a protein or nucleic acid that by virtue of its origin or source of derivation is not associatedwith naturally associated components that accompany it in its native state; is substantially free of other proteins or nucleic acids from the same species; is expressed by a cell from a different species; or does not occur in nature. Thus, a polypeptide or nucleic acid that is chemically synthesized or synthesized in a cellular system different from the cell from which it naturally originates will be "isolated" from its naturally associated components. A protein or nucleic acid may also be rendered substantially free of naturally associated components by isolation, using protein purification techniques well known in the art. In some embodiments, a protein is isolated if it makes up at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the proteins in an isolate. In some embodiments, a nucleic acid is isolated if it makes up at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the nucleic acids in an isolate.

[0101] The term “linker,” as used herein, refers to a chemical group or a molecule linking two molecules or moieties, e.g., a binding domain and a cleavage domain of a nuclease. In some embodiments, a linker joins a gRNA binding domain of an RNA- programmable nuclease and the catalytic domain of a deaminase. In some embodiments, a linker joins a Cas9 and base editor moiety (e.g., an adenosine deaminase). Typically, the linker is positioned between, or flanked by, two groups, molecules, or other moieties and connected to each one via a covalent bond, thus connecting the two. In some embodiments, the linker is an amino acid or a plurality of amino acids (e.g., a peptide or protein). In some embodiments, the linker is an organic molecule, group, polymer, or chemical moiety.

[0102] The term “mutation,” as used herein, refers to a substitution of a residue within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue. Various methods for making the amino acid substitutions (mutations) described herein are well known in the art, and are provided by, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual (4thed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)).

[0103] Mutations can include a variety of categories, such as single base polymorphisms, microduplication regions, indel, and inversions, and is not meant to be limiting in any way. One such example of a mutation is a nonsense mutation in the RPE65 gene on exon 3 (c. 130 C>T; p.R44X), which occurs in the an rdl2 mouse model that abolishes the expression of RPE65, a key isomerase in the classical visual cycle thatgenerates active visual chromophore, 11-cis-retinal and is used as model of Leber congenital amaurosis (LCA).

[0104] Mutations also embrace “gain-of-function” mutations, which is one which confers an abnormal activity on a protein or cell that is otherwise not present in a normal condition. Many gain-of-function mutations are in regulatory sequences rather than in coding regions, and can therefore have a number of consequences. For example, a mutation might lead to one or more genes being expressed in the wrong tissues, these tissues gaining functions that they normally lack. Alternatively, the mutation could lead to overexpression of one or more genes involved in control of the cell cycle, thus leading to uncontrolled cell division and hence to cancer. Because of their nature, gain-of-function mutations are usually dominant.

[0105] The terms “non-naturally occurring” or “engineered” are used interchangeably and indicate the involvement of the hand of man. The terms, when referring to nucleic acid molecules or polypeptides (e.g., Cas9 or deaminases) mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and / or as found in nature (e.g., an amino acid sequence not found in nature). These terms also embrace nucleic acid molecules and polypeptides that have been altered (e.g., mutated), such that they are different from nucleic acid molecules or polypeptides that occur in nature.

[0106] The terms “nucleic acid” and “nucleic acid molecule,” as used herein, refer to a compound comprising a nucleobase and an acidic moiety, e.g., a nucleoside, a nucleotide, or a polymer of nucleotides. Typically, polymeric nucleic acids, e.g., nucleic acid molecules comprising three or more nucleotides arc linear molecules, in which adjacent nucleotides arc linked to each other via a phosphodiester linkage. In some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, “nucleic acid” refers to an oligonucleotide chain comprising three or more individual nucleotide residues.

[0107] The term “nucleic acid programmable DNA / RNA binding protein (napDNA / RNAbp)” refers to any protein that may associate (e.g., form a complex) with one or more nucleic acid molecules (i.e., which may broadly be referred to as a “napDNA / RNAbp -programming nucleic acid molecule” and includes, for example, a guide RNA in the case of Cas systems) which direct or otherwise program the protein to localize toa specific target nucleotide sequence (e.g., a gene locus of a genome) that is complementary to the one or more nucleic acid molecules (or a portion or region thereof) associated with the protein, thereby causing the protein to bind to the nucleotide sequence at the specific target site. This term napDNA / RNAbp embraces CRISPR Cas 9 proteins, as well as Cas9 equivalents, homologs, orthologs, or paralogs, whether naturally occurring or non-naturally occurring (e.g., engineered or recombinant), and may include a Cas9 equivalent from any type of CRISPR system. However, the nucleic acid programmable DNA binding protein (napDNAbp) that may be used in connection with this invention are not limited to CRISPR- Cas systems. The invention embraces any such programmable protein, such as the Argonaute protein from Natronobacterium gregoryi (NgAgo) which may also be used for DNA-guided genome editing. NgAgo-guide DNA system does not require a PAM sequence or guide RNA molecules, which means genome editing can be performed simply by the expression of generic NgAgo protein and introduction of synthetic oligonucleotides on any genomic sequence. See Gao F, Shen XZ, Jiang F, Wu Y, Han C. DNA-guided genome editing using the Natronobacterium gregoryi Argonaute. Nat Biotechnol 2016; 34(7):768-73, which is incorporated herein by reference.

[0108] The term “napDNA / RNAbp-programming nucleic acid molecule” or equivalently “guide sequence” refers the one or more nucleic acid molecules which associate with and direct or otherwise program a napDNA / RNAbp to localize to a specific target nucleotide sequence (e.g., a gene locus of a genome) that is complementary to the one or more nucleic acid molecules (or a portion or region thereof) associated with the protein, thereby causing the napR / DNAbp protein to bind to the nucleotide sequence at the specific target site. A non-limiting example is a guide RNA of a Cas protein of a CRISPR-Cas genome editing system.

[0109] As used herein, a “nickase” refers to a napDNAbp (e.g., a Cas protein) which is capable of cleaving only one of the two complementary strands of a double- stranded target DNA sequence, thereby generating a nick in that strand. In some embodiments, the nickase cleaves a non-target strand of a double stranded target DNA sequence. In some embodiments, the nickase comprises an amino acid sequence with one or more mutations in a catalytic domain of a canonical napDNAbp (e.g., a Cas protein), wherein the one or more mutations reduces or abolishes nuclease activity of the catalytic domain. In some embodiments, the nickase is a Cas9 that comprises one or more mutations in a RuvC-likcdomain relative to a wild type Cas9 sequence or to an equivalent amino acid position in other Cas9 variants or Cas9 equivalents. In some embodiments, the nickase is a Cas9 that comprises one or more mutations in an HNH-like domain relative to a wild type Cas9 sequence or to an equivalent amino acid position in other Cas9 variants or Cas9 equivalents. In some embodiments, the nickase is a Cas9 that comprises an aspartate-to-alanine substitution (DIO A) in the RuvC I catalytic domain of Cas9 relative to a canonical Cas9 sequence or to an equivalent amino acid position in other Cas9 variants or Cas9 equivalents. In some embodiments, the nickase is a Cas9 that comprises an H840A, N854A, and / or N863A mutation relative to a canonical Cas9 sequence, or to an equivalent amino acid position in other Cas9 variants or Cas9 equivalents. In some embodiments, the term “Cas9 nickase” refers to a Cas9 with one of the two nuclease domains inactivated. This enzyme is capable of cleaving only one strand of a target DNA. In some embodiments, the nickase is a Cas protein that is not a Cas9 nickase.

[0110] As used herein, the term “nuclear localization signal or sequence” or “NLS” is an amino acid sequence that tags, designates, or otherwise marks a protein for import into the cell nucleus by nuclear transport. Typically, this signal consists of one or more short sequences of positively charged lysines or arginines exposed on the protein surface. Different nuclear localized proteins may share the same NTS. An NTS has the opposite function of a nuclear export signal (NES), which targets proteins out of the nucleus. Thus, a single nuclear localization signal can direct the entity with which it is associated to the nucleus of a cell. Such sequences can be of any size and composition, for example more than 25, 25, 15, 12, 10, 8, 7, 6, 5 or 4 amino acids, but will preferably comprise at least a four to eight amino acid sequence known to function as a nuclear localization signal (NES).

[0111] The term “nucleobase modification moiety” or equivalently a “nucleic acid effector domain” embraces any protein, enzyme, or polypeptide (or functional fragment thereof) which is capable of modifying a DNA or RNA molecule. Nucleobase modification moieties can be naturally occurring, or can be recombinant. For example, a nucleobase modification moiety can include one or more DNA repair enzymes, for example, and an enzyme or protein involved in base excision repair (BER), nucleotide excision repair (NER), homology-dependent recombinational repair (HR), non-homologous end-joining repair (NHEJ), microhomology end-joining repair (MMEJ), mismatch repair (MMR), direct reversal repair, or other known DNA repair pathway. A nucleobase modification moiety canhave one or more types of enzymatic activities, including, but not limited to endonuclease activity, polymerase activity, ligase activity, replication activity, proofreading activity.

[0112] Nucleobase modification moieties can also include DNA or RNA-modifying enzymes and / or mutagenic enzymes, such as DNA methylases and deaminating enzymes (i.e., deaminases, including cytidine deaminases and adenosine deaminases, all defined above), which deaminate nucleobases leading in some cases to mutagenic corrections by way of normal cellular DNA repair and replication processes. The “nucleic acid effector domain” (e.g., a DNA effector domain or an RNA effector domain) as used herein may also refer to a protein or enzyme capable of making one or more modifications (e.g., deamination of a cytidine residue) to a nucleic acid (e.g., DNA or RNA). Exemplary nucleic acid editing domains include, but are not limited to a deaminase, a nuclease, a nickase, a recombinase, a methyltransferase, a methylase, an acetylase, an acetyltransferase, a transcriptional activator, or a transcriptional repressor domain.

[0113] As used herein, the terms “oligonucleotide” and “polynucleotide” can be used interchangeably to refer to a polymer of nucleotides (e.g., a string of at least three nucleotides). In some embodiments, “nucleic acid” encompasses RNA as well as single and / or double-stranded DNA. Nucleic acids may be naturally occurring, for example, in the context of a genome, a transcript, an mRNA, tRNA, rRNA, siRNA, snRNA, a plasmid, cosmid, chromosome, chromatid, or other naturally occurring nucleic acid molecule. On the other hand, a nucleic acid molecule may be a non-naturally occurring molecule, e.g., a recombinant DNA or RNA, an artificial chromosome, an engineered genome, or fragment thereof, or a synthetic DNA, RNA, DNA / RNA hybrid, or including non-naturally occurring nucleotides or nucleosides. Furthermore, the terms “nucleic acid,” “DNA,” “RNA,” and / or similar terms include nucleic acid analogs, e.g., analogs having other than a phosphodiester backbone. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, and backbone modifications. A nucleic acid sequence is presented in the 5' to 3' direction unless otherwise indicated. In some embodiments, a nucleic acid is or comprises natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, dcoxyguanosinc, and dcoxycytidinc); nucleoside analogs (e.g., 2-aminoadcnosinc, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, 2- aminoadenosine, C5-bromouridine, C5-fluorouridine, C5 -iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7- deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)-methylguanine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite linkages).

[0114] The terms “protein,” “peptide,” and “polypeptide,” are used interchangeably herein, and refer to a polymer of amino acid residues linked together by peptide (amide) bonds. The terms refer to a protein, peptide, or polypeptide of any size, structure, or function. Typically, a protein, peptide, or polypeptide will be at least three amino acids long. A protein, peptide, or polypeptide may refer to an individual protein or a collection of proteins. One or more of the amino acids in a protein, peptide, or polypeptide may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a hydroxyl group, a phosphate group, a famesyl group, an isofamesyl group, a fatty acid group, a linker for conjugation, functionalization, or other modification, etc. A protein, peptide, or polypeptide may also be a single molecule or may be a multi-molecular complex. A protein, peptide, or polypeptide may be just a fragment of a naturally occurring protein or peptide. A protein, peptide, or polypeptide may be naturally occurring, recombinant, or synthetic, or any combination thereof. The term “fusion protein” as used herein refers to a hybrid polypeptide which comprises protein domains from at least two different proteins. One protein may be located at the amino-terminal (N-tcrminal) portion of the fusion protein or at the carboxyterminal (C-terminal) protein thus forming an “amino-terminal fusion protein” or a “carboxyterminal fusion protein,” respectively. A protein may comprise different domains, for example, a nucleic acid binding domain (e.g., the gRNA binding domain of Cas9 that directs the binding of the protein to a target site) and a nucleic acid cleavage domain or a catalytic domain of a recombinase. In some embodiments, a protein comprises a proteinaceous part, e.g., an amino acid sequence constituting a nucleic acid binding domain, and an organic compound, e.g., a compound that can act as a nucleic acid cleavage agent. In some embodiments, a protein is in a complex with, or is in association with, a nucleic acid, e.g., RNA. Any of the proteins described herein may be produced by any method known inthe art. For example, the proteins described herein may be produced via recombinant protein expression and purification, which is especially suited for fusion proteins comprising a peptide linker. Methods for recombinant protein expression and purification are well known, and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)), the entire contents of which are incorporated herein by reference. It should be appreciated that the disclosure provides any of the polypeptide sequences described herein without an N- terminal methionine (M) residue.

[0115] The term “recombinant” as used herein in the context of proteins or nucleic acids refers to proteins or nucleic acids that do not occur in nature, but are the product of human engineering. For example, in some embodiments, a recombinant protein or nucleic acid molecule comprises an amino acid or nucleotide sequence that comprises at least one, at least two, at least three, at least four, at least five, at least six, or at least seven mutations as compared to any naturally occurring sequence.

[0116] The term “RNA-programmable nuclease,” and “RNA-guided nuclease” are used interchangeably herein and refer to a nuclease that forms a complex with (e.g., binds or associates with) one or more RNA that is not a target for cleavage (e.g., a Cas9 or homolog or variant thereof). In some embodiments, an RNA-programmable nuclease, when in a complex with an RNA, may be referred to as a nuclease:RNA complex.

[0117] The term “guide nucleic acid” can refer to a nucleic acid that can hybridize to another nucleic acid. A guide nucleic acid can be RNA. A guide nucleic acid can be DNA. The guide nucleic acid can be programmed to bind to a sequence of nucleic acid site- spccifically. The nucleic acid to be targeted, or the target nucleic acid, can comprise nucleotides. The guide nucleic acid can comprise nucleotides. A portion of the target nucleic acid can be complementary to a portion of the guide nucleic acid. The strand of a doublestranded target polynucleotide that is complementary to and hybridizes with the guide nucleic acid can be called the complementary strand. The strand of the double-stranded target polynucleotide that is complementary to the complementary strand, and therefore may not be complementary to the guide nucleic acid can be called noncomplementary strand. A guide nucleic acid can comprise a polynucleotide chain and can be called a “single guide nucleic acid.” A single guide nucleic acid can comprise a crRNA. A single guide nucleic acid can comprise a crRNA and a tracrRNA. A guide nucleic acid can comprise two polynucleotidechains and can be called a “double guide nucleic acid.” A double guide nucleic acid can comprise a crRNA and a tracrRNA. If not otherwise specified, the term “guide nucleic acid” can be inclusive, referring to both single guide nucleic acids and double guide.

[0118] A guide nucleic acid can comprise a segment that can be referred to as a “nucleic acid-targeting segment” or a “nucleic acid-targeting sequence.” A nucleic acidtargeting segment can comprise a sub-segment that can be referred to as a “protein binding segment” or “protein binding sequence” or “Cas protein binding segment”.

[0119] The term “targeting sequence,” as used herein, refers to a nucleotide sequence and the corresponding amino acid sequence which encodes a targeting polypeptide which mediates the localization (or retention) of a protein to a sub-cellular location, e.g., plasma membrane or membrane of a given organelle, nucleus, cytosol, mitochondria, endoplasmic reticulum (ER), Golgi, chloroplast, apoplast, peroxisome or other organelle. For example, a targeting sequence can direct a protein (e.g., a receptor polypeptide or an adaptor polypeptide) to a nucleus utilizing a nuclear localization signal (NLS); outside of a nucleus of a cell, for example to the cytoplasm, utilizing a nuclear export signal (NES); mitochondria utilizing a mitochondrial targeting signal; the endoplasmic reticulum (ER) utilizing an ER- retention signal; a peroxisome utilizing a peroxisomal targeting signal; plasma membrane utilizing a membrane localization signal; or combinations thereof.

[0120] Guide RNAs or pegRNAs may comprise various structural elements that include, but are not limited to:

[0121] Spacer sequence — the sequence in the guide RNA or pegRNA (having about 20 nts in length) which has the same sequence as the protospacer in the target DNA.

[0122] gRNA core (or gRNA scaffold or backbone sequence) — the sequence within the gRNA that is responsible for Cas9 binding. It does not include the 20 bp spacer / targeting sequence that is used to guide Cas9 to target DNA.

[0123] Extension arm — a single strand extension at the 3' end or the 5' end of the pegRNA which comprises a primer binding site and a DNA synthesis template sequence that encodes via a polymerase (e.g., a reverse transcriptase) a single stranded DNA flap containing the genetic change of interest, which then integrates into the endogenous DNA by replacing the corresponding endogenous strand, thereby installing the desired genetic change.

[0124] The terms “prime editing guide RNA” or “pegRNA” or “extended guide RNA” refer to a specialized form of a guide RNA that has been modified to include one or moreadditional sequences for implementing the prime editing methods and compositions described herein. As described herein, the prime editing guide RNAs comprise one or more “extended regions” of nucleic acid sequence. The extended regions may comprise, but are not limited to, single-stranded RNA or DNA. Further, the extended regions may occur at the 3' end of a traditional guide RNA. In other arrangements, the extended regions may occur at the 5' end of a traditional guide RNA. In still other arrangements, the extended region may occur at an intramolecular region of the traditional guide RNA, for example, in the gRNA core region which associates and / or binds to the napDNAbp. The extended region comprises a “DNA synthesis template” which encodes (by the polymerase of the prime editor) a single-stranded DNA which, in turn, has been designed to be (a) homologous with the endogenous target DNA to be edited, and (b) which comprises at least one desired nucleotide change (e.g., a transition, a transversion, a deletion, or an insertion) to be introduced or integrated into the endogenous target DNA. The extended region may also comprise other functional sequence elements, such as, but not limited to, a “primer binding site” and a “spacer or linker” sequence, or other structural elements, such as, but not limited to aptamers, stem loops, hairpins, toe loops (e.g., a 3' toeloop), or an RNA-protein recruitment domain (e.g., MS2 hairpin). As used herein, the “primer binding site” comprises a sequence that hybridizes to a single-strand DNA sequence having a 3' end generated from the nicked DNA of the R-loop.

[0125] In certain embodiments, the pegRNAs have a 5' extension arm, a spacer, and a gRNA core. The 5' extension further comprises in the 5' to 3' direction a reverse transcriptase template, a primer binding site, and a linker. The reverse transcriptase template may also be referred to more broadly as the “DNA synthesis template” where the polymerase of a prime editor described herein is not an RT, but another type of polymerase.

[0126] In certain other embodiments, the pegRNAs have a 5' extension arm, a spacer, and a gRNA core. The 5' extension further comprises in the 5' to 3' direction a reverse transcriptase template, a primer binding site, and a linker. The reverse transcriptase template may also be referred to more broadly as the “DNA synthesis template” where the polymerase of a prime editor described herein is not an RT, but another type of polymerase.

[0127] In still other embodiments, the pegRNAs have in the 5' to 3' direction a spacer (1), a gRNA core (2), and an extension arm (3). The extension arm (3) is at the 3' end of the pegRNA. The extension arm (3) further comprises in the 5' to 3' direction a “primer binding site” (A), an “edit template” (B), and a “homology arm” (C). The extension arm (3) may alsocomprise an optional modifier region at the 3' and 5' ends, which may be the same sequences or different sequences. In addition, the 3' end of the pegRNA may comprise a transcriptional terminator sequence. These sequence elements of the pegRNAs are further described and defined herein.

[0128] In still other embodiments, the pegRNAs have in the 5' to 3' direction an extension arm (3), a spacer (1), and a gRNA core (2). The extension arm (3) is at the 5' end of the pegRNA. The extension arm (3) further comprises in the 3' to 5' direction a “primer binding site” (A), an “edit template” (B), and a “homology arm” (C). The extension arm (3) may also comprise an optional modifier region at the 3' and 5' ends, which may be the same sequences or different sequences. The pegRNAs may also comprise a transcriptional terminator sequence at the 3' end. These sequence elements of the pegRNAs are further described and defined herein.

[0129] The term “polymerase” refers to an enzyme that synthesizes a nucleotide strand and that may be used in connection with the prime editor delivery systems described herein. The polymerase can be a “template-dependent” polymerase (i.e., a polymerase that synthesizes a nucleotide strand based on the order of nucleotide bases of a template strand). The polymerase can also be a “template-independent” polymerase (i.e., a polymerase that synthesizes a nucleotide strand without the requirement of a template strand). A polymerase may also be further categorized as a “DNA polymerase” or an “RNA polymerase.” In various embodiments, the prime editor system comprises a DNA polymerase. In various embodiments, the DNA polymerase can be a “DNA-dependent DNA polymerase”(i.e., whereby the template molecule is a strand of DNA). In such cases, the DNA template molecule can be a pegRNA, wherein the extension arm comprises a strand of DNA. In such cases, the pegRNA may be referred to as a chimeric or hybrid pegRNA which comprises an RNA portion (i.e., the guide RNA components, including the spacer and the gRNA core) and a DNA portion (i.e., the extension arm). In various other embodiments, the DNA polymerase can be an “RNA-dependent DNA polymerase” (i.e., whereby the template molecule is a strand of RNA). In such cases, the pegRNA is RNA, i.e., including an RNA extension.

[0130] The term “polymerase” may also refer to an enzyme that catalyzes the polymerization of nucleotides (i.e., the polymerase activity). Generally, the enzyme will initiate synthesis at the 3 '-end of a primer annealed to a polynucleotide template sequence (e.g., such as a primer sequence annealed to the primer binding site of a pegRNA) and willproceed toward the 5' end of the template strand. A “DNA polymerase” catalyzes the polymerization of deoxynucleotides. As used herein in reference to a DNA polymerase, the term DNA polymerase includes a “functional fragment thereof’. A “functional fragment thereof’ refers to any portion of a wild-type or mutant DNA polymerase that encompasses less than the entire amino acid sequence of the polymerase and which retains the ability, under at least one set of conditions, to catalyze the polymerization of a polynucleotide. Such a functional fragment may exist as a separate entity, or it may be a constituent of a larger polypeptide, such as a fusion protein.

[0131] The term “protease cleavage site,” as used herein, refers to an amino acid sequence that is recognized and cleaved by a protease, i.e., an enzyme that catalyzes proteolysis and breaks down proteins into smaller polypeptides, or single amino acids. In some embodiments, a protease cleavage site is included in a cleavable linker in a fusion protein, as described herein. In certain embodiments, a protease cleavage site is cleaved by the protease of a gag-pro polyprotein. In some embodiments, a protease cleavage site comprises an MMLV protease cleavage site or an FMLV protease cleavage site

[0132] The term “subject,” as used herein, refers to an individual organism, for example, an individual mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a rodent. In some embodiments, the subject is a sheep, a goat, a cattle, a cat, or a dog. In some embodiments, the subject is a vertebrate, an amphibian, a reptile, a fish, an insect, a fly, or a nematode. In some embodiments, the subject is a research animal. In some embodiments, the subject is genetically engineered, e.g., a genetically engineered non-human subject. The subject may be of either sex and at any stage of development. In some embodiments, the subject is an unborn subject that is in utero. In some embodiments, the subject is a zygote. In some embodiments, the subject is a blastocyst. In some embodiments, the subject is an embryo. In some embodiments, the subject is a fetus. In some embodiments, the subject has a mutation in an RPE65 gene as compared to a wild- type version. In some embodiments, the subject has a point mutation in position 130 of the RPE65 gene, which replaces a cytosine with thymine.

[0133] The term “reverse transcriptase” describes a class of polymerases characterized as RNA-dcpcndcnt DNA polymerases. All known reverse transcriptases require a primer tosynthesize a DNA transcript from an RNA template. Historically, reverse transcriptase has been used primarily to transcribe mRNA into cDNA, which can then be cloned into a vector for further manipulation. Avian myoblastosis virus (AMV) reverse transcriptase was the first widely used RNA-dependent DNA polymerase (Verma, Biochim. Biophys. Acta 473:1 (1977)). The enzyme has 5'-3' RNA-directed DNA polymerase activity, 5'-3' DNA-directed DNA polymerase activity, and RNase H activity. RNase H is a processive 5' and 3' ribonuclease specific for the RNA strand for RNA-DNA hybrids (Perbal, A Practical Guide to Molecular Cloning, New York: Wiley & Sons, 1984)). Errors in transcription cannot be corrected by reverse transcriptase because known viral reverse transcriptases lack the 3'-5' exonuclease activity necessary for proofreading (Saunders and Saunders, Microbial Genetics Applied to Biotechnology, London: Croom Helm (1987)). A detailed study of the activity of AMV reverse transcriptase and its associated RNaseH activity has been presented by Berger et al., Biochemistry 22:2365-2372 (1983). Another reverse transcriptase that is used extensively in molecular biology is reverse transcriptase originating from Moloney murine leukemia virus (M-MLV or “MMLV”). See, e.g., Gerard, G. R., DNA 5:271-279 (1986) and Kotewicz, M. L., et al., Gene 35:249-258 (1985). M-MLV reverse transcriptase, substantially lacking in RNase H activity has also been described. See, e.g., U.S. Pat. No. 5,244,797. The invention contemplates the use of any such reverse transcriptases, or variants or mutants thereof.

[0134] In addition, the invention contemplates the use of reverse transcriptases that are error-prone, i.e., that may be referred to as error-prone reverse transcriptases or reverse transcriptases that do not support high fidelity incorporation of nucleotides during polymerization. During synthesis of the single-strand DNA flap based on the RT template integrated with the guide RNA, the error-prone reverse transcriptase can introduce one or more nucleotides that are mismatched with the RT template sequence, thereby introducing changes to the nucleotide sequence through erroneous polymerization of the single-strand DNA flap. These errors introduced during synthesis of the single strand DNA flap then become integrated into the double strand molecule through hybridization to the corresponding endogenous target strand, removal of the endogenous displaced strand, ligation, and then through one more round of endogenous DNA repair and / or sequencing processes. The disclosure provides in some embodiments prime editor fusion proteins comprising MMLV RT.

[0135] The term “reverse transcription” indicates the capability of an enzyme to synthesize a DNA strand (that is, complementary DNA or cDNA) using RNA as a template. In some embodiments, the reverse transcription can be “error-prone reverse transcription,” which refers to the properties of certain reverse transcriptase enzymes that are error-prone in their DNA polymerization activity.

[0136] The term “target site” refers to a sequence within a nucleic acid molecule that is deaminated by a deaminase or a fusion protein comprising a deaminase (e.g., a Cas9- deaminase fusion protein described herein). In some embodiments, the target site includes a mutant thymine at position 130 of exon 3 of an RPE65 gene, which can be targeted and mutated to a cytosine to correct the mutant thymine.

[0137] The terms “treatment,” “treat,” and “treating,” refer to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress of a disease or disorder, or one or more symptoms thereof, as described herein. As used herein, the terms “treatment,” “treat,” and “treating” refer to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress of a disease or disorder, or one or more symptoms thereof, as described herein. In some embodiments, treatment may be administered after one or more symptoms have developed and / or after a disease has been diagnosed. In other embodiments, treatment may be administered in the absence of symptoms, e.g., to prevent or delay onset of a symptom or inhibit onset or progression of a disease. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and / or in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example, to prevent or delay their recurrence.

[0138] As used herein the term “variant” should be taken to mean the exhibition of qualities that have a pattern that deviates from what occurs in nature, e.g., a variant Cas9 is a Cas9 comprising one or more changes in amino acid residues as compared to a wild type Cas9 amino acid sequence.

[0139] As used herein the term “wild-type” is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms.

[0140] Embodiments described herein relate to a lipid nanoparticle (LNP) composition for efficient ophthalmic delivery of a genome editing ribonuclcoprotcin to a cell, andparticularly relate to an LNP composition for efficient ophthalmic delivery of a genome editing ribonucleoprotein (RNP) to treat a monogenic disease, such as an inherited retinal disorder. We developed an LNP composition capable of efficiently transfecting the retinal pigment epithelium (RPE), an important cell type that is implicated in many blinding diseases. The LNP composition efficiently encapsulates genome editing RNPs, such as a prime editor (PE) or base editor (BE) and guide RNA, is safe and non-toxic, and mediates efficient genome editing in the eye that results in physiological rescue of blindness. We show that the encapsulation, via microfluidic mixing, of RNPs for adenine base editing and prime editing within the LNPs described herein can result in in vivo editing-efficiency enhancements larger than 300-fold (with respect to the delivery of the naked RNP without detectable off-target edits. Advantageously, the RNP LNPs offer the most transient exposure to genome-editing agents. Compared to viral and viral-derived platforms, such as AAV and eVLPs, an LNP approach allows for a controllable synthetic therapeutic strategy with definable components, and the LNPs provide more uniform and reproducible synthesis compared to previously described lipoplex formulations, which delivered RNPs. The LNPs described herein are safe and non-toxic and can mediate efficient genome editing in the eye that results in a physiological rescue of blindness.

[0141] In some embodiments, the LNP composition can include a plurality of LNPs that each include a lipid component. The lipid component can form a membrane or shell, which defines an outer surface of the LNP and encapsulates a genome editing RNP, such as BE or PE and guide RNA. The lipid component can include an ionizable cationic lipid with a pV-, > 6, at least one phospholipid, a structural lipid, and a PEG-modified lipid.

[0142] In some embodiments, the ionizable cationic lipid with a p / G > 6 of the lipid component can include at least one of 8-[(2-hydroxyethyl)[6-oxo-6- (undecyloxy)hexyl]amino]-octanoic acid, 1-octylnonyl ester (SM102) (pKa =6.68); 9- octadecenoic acid, l,l'-[7-[4-(dipropylamino)butyl]-7-hydroxy-l,13-tridecanediyl] ester (CL4H6) (pKa = 6.25); l,2-dioleyloxy-3-dimethylaminopropane (DODMA) (pKa = 6.59), 4- (dimethylamino)-butanoic acid, ( 10Z, 13Z)- 1 -(9Z, 12Z)-9, 12-octadecadien- 1 -yl- 10,13- nonadecadien-l-yl ester (DLin-MC3-DMA) (pKa = 6.44), 2-[2,2-Di-[(9Z,12Z)-octadeca- 9,12-dienyl]-l,3-dioxolan-4-yl]-V,V-dimethylethanamine (Dlin-KC2-DMA) (pKa = 6.7), (4- Hydroxybutyl)azanediyl]di(hexane-6,l-diyl) bis(2-hexyldecanoate) (ALC-0315) (pKa = 6.09), CKK-E12 (pKa = 6.5), 1 , 1 '-[[2-[4-[2-[[2-[to[(2S)-2-hy droxydodecy 1] amino] ethyl] [(2S )- 2-hy droxydodecy 1] amino] ethyl] - 1 - piperazinyl]ethyl]imino]to-2-dodecanol (C12-200) (pKa = 6.96), 1,2-Dilinoleyloxy-N,N- dimethyl-3-aminopropane, N,N-dimethyl-2,3-bis| (9Z, 12Z)-9, 12-octadecadien- 1 -yloxy |- 1 - propanamine (Dlin-DMA) (pKa = 6.7), 9- [4-(dimethylamino)-l -oxobutoxy ]- heptadecanedioic acid, l,17-di-(2Z)-2-nonen-l-yl ester (pKa =6.38), or mixtures thereof.

[0143] In some embodiments, the at least one phospholipid of the lipid component can be selected from neutral and / or negatively charged phospholipids. Examples of neutral and / or negatively charged phospholipids can include phosphatidylcholines, such as dilauroylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC), dibehenoylglycerophosphocoline (DBPC), diarachidoyl- phosphatidylcholine (DAPC), distearoylphosphatidylcholine (DSPC) or dioleoyl- phosphatidylcholine (DOPC); phosphatidylethanolamines such as dimyristoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), distearoyl phosphatidyl-ethanolamine (DSPE), dioleylphosphatidyl-ethanolamine (DOPE), diarachidoylphosphatidyl-ethanolamine (DAPE) or dilinoleylphosphatidylethanolamine (DLPE); phosphatidylserines, such as dimyristoylphosphatidylserine (DMPS), diarachidoyl phosphatidylserine (DAPS), dipalmitoyl phosphatidylserine (DPPS), distearoylphosphatidylserine (DSPS), dioleoylphosphatidylserine (DOPS); phosphatidic acid derivatives, such as dipalmitoyl phosphatidic acid (DPP A), dimyristoyl phosphatidic acid (DMPA), distearoyl phosphatidic acid (DSPA), diarachidoylphosphatidic acid (DAP A) and their alkali metal salts; phosphatidylglycerols such as dimyristoylphosphatidylglycerol (DMPG) and its alkali metal salts, dipalmitoylphosphatidylglycerol (DPPG) and its alkali metal salts, distcaroylphosphatidylglyccrol (DSPG) and its alkali metal salts, diolcoyl- phosphatidylglycerol (DOPG); phosphatidylinositols, such as dilauroyl-phosphatidylinositol (DLPI), diarachidoylphosphatidylinositol (DAPI), dimyristoylphosphatidylinositol (DMPI), dipalmitoylphosphatidylinositol (DPPI), distearoylphosphatidylinositol (DSPI), dioleoylphosphatidylinositol (DOPI), l-stearoyl-2-oleoyl-sn-glycero-3-phosphoserine (SOPS), or mixtures thereof.

[0144] In certain embodiments, the at least one phospholipid of the lipid component can include DSPC or SOPS.

[0145] In some embodiments, the structural lipid of the lipid component of the LNP can be selected from cholesterol, fccostcrol, sitosterol, ergosterol, campcstcrol, stigmastcrol,brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, or mixtures thereof. In some embodiments, the structural lipid is cholesterol.

[0146] In some embodiments, the PEG-modified lipid can be selected from a PEG- modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, or mixtures thereof. For example, the PEG-modified lipid can include PEG- modified phosphatidylethanolamines, such as DMPE-PEG1000, DMPE-PEG2000, DMPE- PEG3000, DMPE-PEG4000, DMPE-PEG5000, DPPE-PEG1000, DPPE-PEG2000, DPPE- PEG3000, DPPE-PEG4000, DPPE-PEG5000, DSPE-PEG1000, DSPE-PEG2000, DSPE- PEG3000, DSPE-PEG4000, DSPE-PEG5000, DAPE-PEG1000, DAPE-PEG2000, DAPE- PEG3000, DAPE-PEG4000. or DAPE-PEG5000.

[0147] In some embodiments, the lipid component of the LNP can include about 40 mol % to about 60 mol % of the ionizable cationic lipid, for example, about 42 mol % to about 60 mol %, about 44 mol % to about 60 mol %, about 46 mol % to about 60 mol %, about 48 mol % to about 60 mol %, about 50 mol % to about 60 mol %, about 40 mol % to about 58 mol %, about 40 mol % to about 56 mol %, about 40 mol % to about 54 mol %, about 40 mol % to about 52 mol %, or about 40 mol % to about 50 mol % of the ionizable cationic lipid, including any range therebetween.

[0148] In some embodiments, the lipid component of the LNP can include about 8 mol % to about 12 mol % of the phospholipid, for example, about 9 mol % to about 12 mol %, about 10 mol % to about 12 mol %, about 11 mol % to about 12 mol %, about 8 mol % to about 11 mol %, about 8 mol % to about 10 mol %, or about 8 mol % to about 9 mol % of the phospholipid, including any range therebetween.

[0149] In some embodiments, the lipid component of the LNP can include about 28.5 mol % to about 48.5 mol % of the structural lipid, for example about 30.5 mol % to about 48.5 mol %, about 32.5 mol % to about 48.5 mol %, about 34.5 mol % to about 48.5 mol %, about 36.5 mol % to about 48.5 mol %, about 38.5 mol % to about 48.5 mol %, about 28.5 mol % to about 46.5 mol %, about 28.5 mol % to about 44.5 mol %, about 28.5 mol % to about 42.5 mol %, about 28.5 mol % to about 40.5 mol %, or about 28.5 mol % to about 38.5 mol % of the structural lipid, including any range therebetween.

[0150] In some embodiments, the lipid component of the LNP can include about 1.5 mol % to about 5 mol % of the PEG modified lipid, for example, about 1.5 mol % to about4.5 mol %, about 1.5 mol % to about 4 mol %, about 1.5 mol % to about 3.5 mol %, about 1.5 mol % to about 3 mol %. about 2 mol % to about 5 mol %, about 2.5 mol % to about 5 mol %, or about 3 mol % to about 5 mol % of the PEG modified lipid, including any range therebetween.

[0151] In other embodiments, the lipid component of the LNP can include about 40 mol % to about 60 mol % of the ionizable cationic lipid, about 8 mol % to about 12 mol % of phospholipid, about 28.5 mol % to about 48.5 mol % of structural lipid, and about 1.5 mol % to about 3 mol % of PEG modified lipid.

[0152] In other embodiments, the lipid component of the LNP can include about 40 mol % to about 60 mol % of SM012, about 8 mol % to about 12 mol % of DSPC, about 28.5 mol % to about 48.5 mol % of cholesterol, and about 1.5 mol % to about 3 mol % of DMG-PEG 2000.

[0153] Optionally, the lipid component of the LNP can further include a targeting group that extends from the outer surface of the lipid membrane and targets and / or binds to a retinal or visual protein, such as an interphotoreceptor retinoid binding protein.

[0154] In some embodiments, the targeting group that targets and / or binds to a retinal or visual protein, such as an interphotoreceptor retinoid binding protein, can be attached to a lipid of the lipid component or indirectly through a linker (e.g., PEG linker) of the lipid component prior to or during the formation. The targeting group can include, for example, a retinoid, such as a retinylamine (e.g., all-trans-retinylamine) or retinoid derivative, such as (lR)-3-amino-l-[3-(cyclohexylmethoxy)phenyl]propan-l-ol; hydrochloride. In some embodiments, the targeting group is all-trans-retinylamine. In other embodiments, the targeting group is (lR)-3-amino-l-[3-(cyclohcxylmcthoxy)phcnyl]propan-l-ol; hydrochloride. In still other embodiments, the targeting group is a synthetic retinoid derivative, such as a synthetic retinoid derivative described in U.S. Patent Nos. 7,951,841 or 7,982,071 and PCT / US2015 / 062343, all of which are herein incorporated by reference in their entirety.

[0155] In some embodiments, the targeting group is indirectly attached to the compound by a linker. Examples of linkers include, but are not limited to, a polyamine group, a polyalkylene group, a polyamino acid group, or a polyethylene glycol group. The selection of the linker as well as the molecular weight of the linker can vary depending upon the desired properties. In one aspect, the linker is polyethylene glycol having a molecularweight from 500 to 10,000, 500 to 9,000, 500 to 8,000, 500 to 7,000, or 2,000 to 5,000. In certain aspects, the targeting group is first reacted with the linker in a manner such that the targeting group is covalently attached to the linker. For example, the linker can possess one or more groups that can react with an amino group present on a targeting group. The linker also possesses additional groups that react with and form covalent bonds with the compounds described herein. For example, the linker can possess maleimide groups that readily react with the thiol groups. The selection of functional groups present on the linker can vary depending on the functional groups present on the compound and the targeting group. In one aspect, the targeting group is a retinoid, such as a retinylamine (e.g., all-trans-retinylamine) or retinoid derivative, such as (lR)-3-amino-l-[3-(cyclohexylmethoxy)phenyl]propan-l-ol; hydrochloride, that is covalently attached to polyethylene glycol. In another aspect, the targeting group can include peptide ligands that target photoreceptors and retinal pigment epithelium, such as DGPPRKPGGGSC (SEQ ID NO: 1); SPALHFLGGGSC (SEQ ID NO: 2); SNLAAFPGGGSC (SEQ ID NO: 3); and MPVAVYRGGGSC (SEQ ID NO: 4), which are disclosed in Herrera-Barrera M, et al. Peptide-guided lipid nanoparticles deliver mRNA to the neural retina of rodents and nonhuman primates. Sci Adv. 2023 Jan 13;9(2) and U.S. Patent Publication No. US20240343760, which are incorporated herein by reference in their entirety.

[0156] In some embodiments, the linker can include an acid-labile bond, such as formed by incorporation of a hydrazone into the linker that is hydrolyzable in an endolysosomal environment following uptake into cells, such as retinal or retinal pigment epithelium cells. For example, the linker can be covalently linked to the compound by at least one of a covalent hydrolyzable ester, covalent hydrolyzable amide, covalent photodegradable urethane, covalent hydrolyzable ester, or covalent hydrolyzable acrylatethiol linkage. Following cellular uptake of the compound, within the late endosomes, the increasingly acidic environment can cleave the acid-labile linkage to promote shedding of a polymer linker, such as PEG, and expose the core of the LNP.

[0157] In some embodiments, the genome editing RNP encapsulated by the lipid component of the LNP can include a BE complexed with a guide RNA or a PE complexed with a pegRNA. The BE complexed with a guide RNA or the PE complexed with a pegRNA can be configured for, respectively, base-editing or prime-editing a pathogenic mutation, suchas a pathogenic point mutation, in a retinal cell and / or a retinal pigment epithelium cell of a subject.

[0158] In some embodiments, the BE complexed with a guide RNA or the PE complexed with a pegRNA can be configured to correct the pathogenic point mutation, generate a non-pathogenic point mutation, or modulate expression of an inherited retinal disorder (IRD) related gene and / or restore visual function of the subject.

[0159] In some embodiments, the IRD is selected from Stargardt Disease, Leber's congenital amaurosis (LCA), pseudoxanthoma elasticum, rod cone dystrophy, exudative vitreoretinopathy, Joubert Syndrome, CSNB-1C, retinitis pigmentosa, Stickler syndrome, microcephaly, chorioretinopathy, CSNB 2, Usher syndrome, Wagner syndrome, or age- related macular degeneration.

[0160] The genome editing RNP encapsulated in the LNP can be used, for example, in a treatment strategy for an inherited retinal disease (IRD). The strategy relies on a precise correction of a pathogenic point mutation in a mutant allele of an IRD-related gene in the retina or the retinal pigment epithelium (RPE) by subretinal delivery of the LNP encapsulated genome editing RNP. The genome editing RNP includes a BE or PE and a guide RNA that targets the pathogenic point mutation upon uptake, such as endosomal uptake, of the LNP by the retinal cell or the retinal pigment epithelium cell to generate a point mutation or point mutations in the IRD-related gene. Administration of the LNP encapsulated genome editing RNP to the retina cell or the retinal pigment epithelium can correct the pathogenic point mutation, generate a non-pathogenic point mutation, or modulate (e.g., increase) expression of an IRD-related gene.

[0161] The use of a genome editing RNP, such as a BE or PE and guide RNA, for the treatment of an IRD has unique advantages compared to prior developments of gene augmentation and CRISPR-Cas9-mediated homology-directed repair (HDR). Gene augmentation can compensate for loss-of-function RPE65 mutations by delivering a functional copy of the RPE65 gene. However, patients receiving the gene augmentation therapy continue to experience a decrease in visual sensitivity and retinal degeneration 1 to 3 years after the treatment. Although there is no clear explanation for these results, it is hypothesized that a decline in transgene expression from adeno-associated virus might be a contributing factor. Therefore, targeting the mutation with a genome-editing tool can introduce permanent genomic changes.

[0162] In particular, genome editing with a genome editing RNP can achieve a sufficient rate of precise mutation correction while minimizing undesired indel mutations and off- target effects.

[0163] As described herein, base editing or prime editing can provide an alternative to gene augmentation therapy to permanently rescue the function of a key vision-related protein disabled by mutations, or to correct dominant alleles for which gene augmentation may not be effective.

[0164] In comparison to the CRISPR-Cas9-mediated homology-directed repair (HDR) strategy, the genome editing system that includes a genome editing RNP provides a more accurate, precise, and safer genome editing strategy. Accuracy refers to the ratio of on- versus off-target genetic changes, whereas precision relates to the fraction of on-target edits among other DNA modifications, including indels. Since the BE or PE does not induce dsDNA cleavages, there is a low likelihood of non-homologous end-joining, which is primarily responsible for indel formations.

[0165] Some aspects of this disclosure relate to the use of LNPs that include genome editing RNPs for treating inherited retinal diseases (IRD), such as chorioretinal atrophy or degeneration, cone or cone-rod dystrophy, congenital stationary night blindness, Leber congenital amaurosis, macular degeneration, ocular-retinal developmental disease, optic atrophy, retinitis pigmentosa, syndromic / systemic diseases with retinopathy, sorsby macular dystrophy, age-related macular degeneration, doyne honeycomb macular disease, juvenile macular degeneration, Stargardt disease, or retinitis pigmentosa.

[0166] In some embodiments, the genome editing RNP encapsulated by the lipid component of the LNP includes a BE complexed with guide RNA. The BE can include an agent comprising a polypeptide that is capable of converting an existing nucleobase to a different nucleobase, such as: an adenine (A) to guanine (G); cytosine (C) to thymine (T); cytosine (C) to guanine (G); uracil (U) to cytosine (C); guanine (G) to adenine (A); hydrolytic deamination of an adenine or adenosine, or methylation of cytosine (e.g., CpG, CpA, CpT or CpC). In some embodiments, BEs edit a nucleobase on a ssDNA. In some embodiments, BEs edit a nucleobase on both strands of dsDNA. In some embodiments, BEs edit a nucleobase of an RNA.

[0167] In some embodiments, a base editing enzyme itself may or may not bind to the nucleic acid molecule containing the nucleobase. In some embodiments, upon binding to itstarget locus in the target nucleic acid (e.g., a DNA molecule), base pairing between the guide nucleic acid and target strand leads to displacement of a small segment of ssDNA in an “R- loop”. In some embodiments, DNA bases within the R-loop are edited by the BE having the deaminase enzyme activity. In some embodiments, BEs for improved efficiency in eukaryotic cells comprise a catalytically inactive effector protein that may generate a nick in the non-edited strand, inducing repair of the non-edited strand using the edited strand as a template.

[0168] In some embodiments, a base editing enzyme comprises a deaminase enzyme. For example, the BE can be a fusion protein comprising a nucleic acid programmable R / DNA binding protein (napR / DNAbp) fused to a deaminase (e.g., cytidine deaminase or adenosine deaminase) domain. The nucleic acid programmable D / RNA binding protein (napR / DNAbp) can include any protein that may associate (e.g., form a complex) with one or more nucleic acid molecules (i.e., which may broadly be referred to as a “napR / DNAbp-programming nucleic acid molecule” and includes, for example, guide RNA in the case of Cas systems) which direct or otherwise program the protein to localize to a specific target nucleotide sequence (e.g., a gene locus of a genome, or a RNA molecule) that is complementary to the one or more nucleic acid molecules (or a portion or region thereof) associated with the protein, thereby causing the protein to bind to the nucleotide sequence at the specific target site. This term napR / DNAbp embraces CRISPR Cas 9 proteins, as well as Cas9 equivalents, homologs, orthologs, or paralogs, whether naturally occurring or non-naturally occurring (e.g., engineered or recombinant), and may include a Cas9 equivalent from any type of CRISPR system (e.g., type II, V, VI), including Cpfl (a type-V CRISPR-Cas systems), C2cl (a type V CRISPR-Cas system), C2c2 (a type VI CRISPR-Cas system) and C2c3 (a type V CRISPR-Cas system). Further Cas-equivalents are described in Makarova et al., “C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector,” Science 2016; 353(6299), the contents of which are incorporated herein by reference. However, the nucleic acid programmable R / DNA binding protein (napR / DNAbp) that may be used is not limited to CRISPR-Cas systems. The napR / DNAbp includes any such programmable protein, such as the Argonaute protein from Natronobacterium gregoryi (NgAgo) which may also be used for DNA-guided genome editing. NgAgo-guide DNA system does not require a PAM sequence or guide RNA molecules, which means genome editing can be performed simply by the expression of generic NgAgo protein and introduction of synthetic oligonucleotides onany genomic sequence. See Gao F, Shen X Z, Jiang F, Wu Y, Han C. DNA-guided genome editing using the Natronobacterium gregoryi Argonaute. Nat Biotechnol 2016; 34(7):768-73, which is incorporated herein by reference.

[0169] In some embodiments, the napR / DNAbp is derived from a nuclease, such as Cas9 (e.g., dCas9 and nCas9), CasX, CasY, Casl4, Cpfl, C2cl, C2c2, C2c3, Argonaute protein, or a variant thereof. In some embodiments, the BE comprises a Cas9 (e.g., dCas9 and nCas9), CasX, CasY, Cpfl, C2cl, C2c2, C2c3, or Argonaute protein fused to a deaminase (e.g., cytidine deaminase or adenosine deaminase). In some embodiments, the BE comprises a Cas9 nickase (nCas9) fused to a deaminase (e.g., cytidine deaminase or adenosine deaminase). In some embodiments, the BE comprises a CasX protein fused to a deaminase (e.g., cytidine deaminase or adenosine deaminase). In some embodiments, the BE comprises a nuclease-inactive Cas9 (dCas9) fused to a deaminase (e.g., cytidine deaminase or adenosine deaminase). In some embodiments, the BE comprises a CasY protein fused to a deaminase (e.g., cytidine deaminase or adenosine deaminase). In some embodiments, the BE comprises a Casl4 protein fused to a deaminase (e.g., cytidine deaminase or adenosine deaminase). In some embodiments, the BE comprises a Cpfl protein fused to a deaminase (e.g., cytidine deaminase or adenosine deaminase). In some embodiments, the BE comprises a C2cl protein fused to a deaminase (e.g., cytidine deaminase or adenosine deaminase). In some embodiments, the BE comprises a C2c2 protein fused to a deaminase (e.g., cytidine deaminase or adenosine deaminase). In some embodiments, the BE comprises a C2c3 protein fused to a deaminase (e.g., cytidine deaminase or adenosine deaminase). In some embodiments, the BE comprises an Argonaute protein fused to a deaminase (e.g., cytidine deaminase or adenosine deaminase).

[0170] Examples of deaminases are described in US20210198330, WO2021041945, WO2021050571 Al, and WO2020123887, all of which are incorporated herein by reference in their entirety. Examples of deaminase domains are described in WO 2018027078 and W02017070632, and each is hereby incorporated in its entirety by reference. Also, additional examples of deaminase domains are described in Komor et al., Nature, 533, 420-424 (2016); Gaudelli et al., Nature, 551, 464-471 (2017); Komor et al., Science Advances, 3, eaao4774 (2017), and Rees et al., Nat Rev Genet. 2018 December; 19(12):770-788. doi: 10.1038 / s41576-018-0059-l, which are hereby incorporated by reference in their entirety. In some embodiments, the deaminase functions as a monomer. In some embodiments, thedeaminase functions as a heterodimer with an additional protein. In some embodiments, BEs comprise a DNA glycosylase inhibitor (e.g., an uracil glycosylase inhibitor (UGI) or uracil N- glycosylase (UNG)). In some embodiments, the fusion partner is a deaminase, e.g., ADAR1 / 2, ADAR-2, AID, or any functional variant thereof.

[0171] In some embodiments, a BE is a cytosine BE (CBE). In some embodiments, the CBE may convert a cytosine to a thymine. In some embodiments, a cytosine base editing enzyme may accept ssDNA as a substrate but may not be capable of cleaving dsDNA, as fused to a catalytically inactive effector protein. In some embodiments, when bound to its cognate DNA, the catalytically inactive effector protein of the CBE may perform local denaturation of the DNA duplex to generate an R-loop in which the DNA strand not paired with a guide nucleic acid exists as a disordered single- stranded bubble. In some embodiments, the catalytically inactive effector protein generated ssDNA R-loop may enable the CBE to perform efficient and localized cytosine deamination in vitro. In some embodiments, deamination activity is exhibited in a window of about 4 to about 10 base pairs. In some embodiments, fusion to the catalytically inactive effector protein presents a target site to the cytosine base editing enzyme in high effective molarity, which may enable the CBE to deaminate cytosines located in a variety of different sequence motifs, with differing efficacies. In some embodiments, the CBE is capable of mediating RNA- programmed deamination of target cytosines in vitro or in vivo. In some embodiments, the cytosine base editing enzyme is a cytidine deaminase. In some embodiments, the cytosine base editing enzyme is a cytosine base editing enzyme described by Koblan et al. (2018) Nature Biotechnology 36:848-846; Komor et al. (2016) Nature 533:420-424; Koblan et al. (2021) “Efficient C»G-to-G»C BEs developed using CRISPRi screens, target-library analysis, and machine learning,” Nature Biotechnology; Kurt et al. (2021) Nature Biotechnology 39:41-46; Zhao et al. (2021) Nature Biotechnology 39:35-40; and Chen et al. (2021) Nature Communications 12: 1384, all incorporated herein by reference.

[0172] In some embodiments, CBEs comprise a uracil glycosylase inhibitor (UGI) or uracil N-glycosylase (UNG). In some embodiments, base excision repair (BER) of U»G in DNA is initiated by a UNG, which recognizes a U»G mismatch and cleaves the glycosidic bond between a uracil and a deoxyribose backbone of DNA. In some embodiments, BER results in the reversion of the U»G intermediate created by the first CBE back to a C»G base pair. In some embodiments, the UNG may be inhibited by the fusion of a UGI. In someembodiments, the CBE comprises a UGI. In some embodiments, a C-terminus of the CBE comprises the UGI. In some embodiments, the UGI is a small protein from bacteriophage PBS. In some embodiments, the UGI is a DNA mimic that potently inhibits both human and bacterial UNG. In some embodiments, the UGI inhibitor is any protein or polypeptide that inhibits UNG. In some embodiments, the CBE may mediate efficient base editing in bacterial cells and moderately efficient editing in mammalian cells, enabling conversion of a C»G base pair to a T»A base pair through a U»G intermediate. In some embodiments, the CBE is modified to increase base editing efficiency while editing more than one strand of DNA.

[0173] In some embodiments, a CBE nicks a non-edited DNA strand. In some embodiments, the non-edited DNA strand nicked by the CBE biases cellular repair of a U»G mismatch to favor a U*A outcome, elevating base editing efficiency. In some embodiments, an APOBECl-nickase-UGI fusion efficiently edits in mammalian cells, while minimizing the frequency of non-target indels. In some embodiments, BEs do not comprise a functional fragment of the base editing enzyme. In some embodiments, BEs do not comprise a function fragment of a UGI, where such a fragment may be capable of excising a uracil residue from DNA by cleaving an N-glycosidic bond.

[0174] In some embodiments, the BE further comprises a non-protein uracil-DNA glycosylase inhibitor (npUGI). In some embodiments, the npUGI is selected from a group of small molecule inhibitors of uracil-DNA glycosylase (UDG), or a nucleic acid inhibitor of UDG. In some embodiments, the npUGI is a small molecule derived from uracil. Examples of small molecule non-protein uracil-DNA glycosylase inhibitors, fusion proteins, and Cas- CRISPR systems comprising base editing activity arc described in WO2021087246, which is incorporated by reference in its entirety.

[0175] In some embodiments, a cytosine base editing enzyme, and therefore a cytosine BE, is a cytidine deaminase. In some embodiments, the cytidine deaminase base editor is generated by ancestral sequence reconstruction as described in WO2019226953, which is hereby incorporated by reference in its entirety. Non-limiting exemplary cytidine deaminases suitable for use with effector proteins described herein include: APOBEC1, APOBEC2, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4, APOBEC3A, BE1 (APOBECl-XTEN-dCas9), BE2 (APOBECl-XTEN-dCas9-UGI), BE3 (APOBECl-XTEN-dCas9(A840H)-UGI), BE3-Gam, saBE3, saBE4-Gam, BE4, BE4-Gam,saBE4, and saBE4-Gam as described in WO2021163587, WO2021087246, WO2021062227, and W02020123887, which are incorporated herein by reference in their entirety.

[0176] In some embodiments, a BE is a cytosine to guanine base editor (CGBE). A CGBE may convert a cytosine to a guanine.

[0177] In some embodiments, a BE is an adenine base editor (ABE). An ABE may convert an adenine to a guanine. In some embodiments, an ABE converts an A»T base pair to a G»C base pair. In some embodiments, the ABE converts a target A»T base pair to G*C in vivo or in vitro. In some embodiments, ABEs described herein reverse spontaneous cytosine deamination, which has been linked to pathogenic point mutations. In some embodiments, ABEs described herein enable correction of pathogenic SNPs (~47% of disease-associated point mutations). In some embodiments, the adenine comprises an exocyclic amine that has been deaminated (e.g., resulting in altering its base pairing preferences). In some embodiments, deamination of adenosine yields inosine. In some embodiments, inosine exhibits the base-pairing preference of guanine in the context of a polymerase active site, although inosine in the third position of a tRNA anticodon is capable of pairing with A, U, or C in mRNA during translation. Non-limiting exemplary adenine base editing enzymes suitable for use with effector proteins described herein include: ABE8e, ABE8.20m, APOBEC3A, Anc APOBEC (a.k.a. AncBE4Max), and BtAPOBEC2. Non-limiting exemplary ABEs suitable for use herein include: ABE7, ABE8.1m, ABE8.2m, ABE8.3m, ABE8.4m, ABE8.5m, ABE8.6m, ABE8.7m, ABE8.8m, ABE8.9m, ABE8.10m, ABE8.11m, ABE8.12m, ABE8.13m, ABE8.14m, ABE8.15m, ABE8.16m, ABE8.17m, ABE8.18m, ABE8.19m, ABE8.20m, ABE8.21m, ABE8.22m, ABE8.23m, ABE8.24m, ABE8.1d, ABE8.2d, ABE8.3d, ABE8.4d, ABE8.5d, ABE8.6d, ABE8.7d, ABE8.8d, ABE8.9d, ABE8.10d, ABE8.11d, ABE8.12d, ABE8.13d, ABE8.14d, ABE8.15d, ABE8.16d, ABE8.17d, ABE8.18d, ABE8.19d, ABE8.20d, ABE8.21d, ABE8.22d, ABE8.23d, and ABE8.24d. In some embodiments, the adenine base editing enzyme is an adenine base editing enzyme described in Chu et al., (2021) The CRISPR Journal 4:2:169-177, incorporated herein by reference. In some embodiments, the adenine deaminase is an adenine deaminase described by Koblan et al. (2018) Nature Biotechnology 36:848-846, incorporated herein by reference. In some embodiments, the adenine base editing enzyme is an adenine base editing enzyme described by Tran et al. (2020) Nature Communications 11:4871.

[0178] In some embodiments, an adenine base editing enzyme of an ABE is an adenosine deaminase. Non-limiting exemplary adenosine base editors suitable for use herein include ABE9. In some embodiments, the ABE comprises an engineered adenosine deaminase enzyme capable of acting on ssDNA. The engineered adenosine deaminase enzyme may be an adenosine deaminase variant that differs from a naturally occurring deaminase. Relative to the naturally occurring deaminase, the adenosine deaminase variant may comprise one or more amino acid alterations, including a V82S alteration, a T166R alteration, a Y147T alteration, a Y147R alteration, a Q154S alteration, a Y123H alteration, a Q154R alteration, or a combination thereof.

[0179] Examples of configurations, sequences, and mutations thereof for deaminase domains, napR / DNAbp domains, UGI domains, and whole BE proteins, and examples of configurations of a base editing system (e.g., comprising both a BE and a guide sequence) that can be delivered by an LNP disclosed herein include those described in U.S. Patent Publication Nos. US20170121693, US20180073012, US20180312828, US20210230577, US20210198330, US20210277379, US2020399626, US2021371858, US2021380955, US2021277379, US2021301274; US20250034549, US20250144246, international patent publication nos. WO2015 / 089406, W02 17 / 070632, W02017 / 070633, WO2018 / 027078, WO2018 / 071868, W02017 / 048390, WO2018 / 031683, WO2018 / 021878, W02020 / 051562, WO2021 / 041885, W02021 / 050512, WO20 / 21113494, each of which is incorporated herein by reference in its entirety. Examples of configurations, sequences, and mutations thereof for deaminase domains, napR / DNAbp domains, UGI domains, and whole BE proteins that can be delivered by a delivery vehicle disclosed herein, also include those described in Komor AC ct al. Nature. 2016 May 19;533(7603):420-4; Kim YB ct al. Nat Biotechnol. 2017 April; 35(4):371-376; Rees HA et al. Nat Commun. 2017 Jun. 6; 8:15790; Newby GA et al. Mol Ther. 2021 Nov. 3; 29(11):3107-3124; Huang TP et al. Nat Protoc. 2021 Feb;16(2):1089- 1128; Lapinaite A et al. Science. 2020 Jul. 31; 369(6503):566-571; Anzalone AV et al. Nat Biotechnol. 2020 July;38(7):824-844; Rees HA et al. Nat Rev Genet. 2018 Dec;19(12):770- 788; Koblan LW et al. N at Biotechnol. 2018 October;36(9):843-846; and Gaudelli NM et al. Nature. 2017 Nov. 23; 551 (7681):464-471 ; each of which is incorporated herein by reference in its entirety.

[0180] In other embodiments, the genome editing RNP to be delivered by the LNP described herein can include a PE complexed with pcgRNA. The PE can include fusionconstructs comprising a napDNAbp (e.g., Cas9 nickase) and a reverse transcriptase that is capable of carrying out prime editing on a target nucleotide sequence in the presence of a pegRNA (or “extended guide RNA”). A PE complex can include a fusion protein complexed with a pegRNA, and / or further complexed with a second-strand nicking sgRNA. In some embodiments, the PE complex may also refer to the complex comprising a fusion protein (reverse transcriptase fused to a napDNAbp), a pegRNA, and a regular guide RNA capable of directing the second-site nicking step of the non-edited strand as described herein.

[0181] Prime editing refers to an approach for genome editing using napDNAbps, a polymerase (e.g., a reverse transcriptase), and specialized guide RNAs that include a DNA synthesis template for encoding desired new genetic information (or deleting genetic information) that is then incorporated into a target DNA sequence. Prime editing is described in Anzalone, A. V. et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149-157 (2019), which is incorporated herein by reference in its entirety

[0182] Prime editing represents a platform for genome editing that is a versatile and precise method to directly write new genetic information into a specified DNA site using a nucleic acid programmable DNA binding protein (“napDNAbp”) working in association with a polymerase (i.e., in the form of a fusion protein or otherwise provided in trans with the napDNAbp), wherein the prime editing system is programmed with a prime editing (PE) guide RNA (“pegRNA”) that both specifies the target site and templates the synthesis of the desired edit in the form of a replacement DNA strand by way of an extension (either DNA or RNA) engineered onto a guide RNA (e.g., at the 5' or 3' end, or at an internal portion of a guide RNA). The replacement strand containing the desired edit (e.g., a single nuclcobasc substitution) shares the same sequence as the endogenous strand (or is homologous to it) immediately downstream of the nick site of the target site to be edited (with the exception that it includes the desired edit). Through DNA repair and / or replication machinery, the endogenous strand downstream of the nick site is replaced by the newly synthesized replacement strand containing the desired edit. In some cases, prime editing may be thought of as a “search-and-replace” genome editing technology since the PEs, as described herein, not only search and locate the desired target site to be edited, but at the same time, encode a replacement strand containing a desired edit that is installed in place of the corresponding target site endogenous DNA strand. The mechanism of target-primed reverse transcription(TPRT) or “prime editing” can be leveraged or adapted for conducting precision CRISPR / Cas-based genome editing with high efficiency and genetic flexibility. TPRT is naturally used by mobile DNA elements, such as mammalian non-LTR retrotransposons and bacterial Group II introns. Cas protein- reverse transcriptase fusions or related systems are used to target a specific DNA sequence with a guide RNA, generate a single-strand nick at the target site, and use the nicked DNA as a primer for reverse transcription of an engineered reverse transcriptase template that is integrated with the guide RNA. However, while the concept begins with PEs that use reverse transcriptase as the DNA polymerase component, the PEs described herein are not limited to reverse transcriptases but may include the use of virtually any DNA polymerase. Indeed, while the application throughout may refer to PEs with “reverse transcriptases,” it is set forth here that reverse transcriptases are only one type of DNA polymerase that may work with prime editing. Thus, wherever the specification mentions a “reverse transcriptase,” the person having ordinary skill in the art should appreciate that any suitable DNA polymerase may be used in place of the reverse transcriptase. Thus, in one aspect, the PEs may comprise Cas9 (or an equivalent napDNAbp), which is programmed to target a DNA sequence by associating it with a specialized guide RNA (i.e., pegRNA) containing a spacer sequence that anneals to a complementary protospacer in the target DNA. The specialized guide RNA also contains new genetic information in the form of an extension that encodes a replacement strand of DNA containing a desired genetic alteration, which is used to replace a corresponding endogenous DNA strand at the target site. To transfer information from the pegRNA to the target DNA, the mechanism of prime editing involves nicking the target site in one strand of the DNA to expose a 3'-hydroxyl group. The exposed 3'-hydroxyl group can then be used to prime the DNA polymerization of the edit-encoding extension on pegRNA directly into the target site. In various embodiments, the extension — which provides the template for polymerization of the replacement strand containing the edit — can be formed from RNA or DNA. In the case of an RNA extension, the polymerase of the PE can be an RNA-dependent DNA polymerase (such as a reverse transcriptase). In the case of a DNA extension, the polymerase of the PE may be a DNA-dependent DNA polymerase. The newly synthesized strand (i.e., the replacement DNA strand containing the desired edit) that is formed by the PEs would be homologous to the genomic target sequence (i.e., have the same sequence as) except for the inclusion of a desired nucleotide change (e.g., a single nucleotide change, adeletion, or an insertion, or a combination thereof). The newly synthesized (or replacement) strand of DNA may also be referred to as a single- stranded DNA flap, which would compete for hybridization with the complementary homologous endogenous DNA strand, thereby displacing the corresponding endogenous strand. In certain embodiments, the system can be combined with the use of an error-prone reverse transcriptase enzyme (e.g., provided as a fusion protein with the Cas9 domain, or provided in trans to the Cas9 domain). The error- prone reverse transcriptase enzyme can introduce alterations during the synthesis of the single-stranded DNA flap. Thus, in certain embodiments, error-prone reverse transcriptase can be utilized to introduce nucleotide changes to the target DNA. Depending on the error- prone reverse transcriptase that is used with the system, the changes can be random or nonrandom. Resolution of the hybridized intermediate (comprising the single strand DNA flap synthesized by the reverse transcriptase hybridized to the endogenous DNA strand) can include removal of the resulting displaced flap of endogenous DNA (e.g., with a 5' end DNA flap endonuclease, FEN1), ligation of the synthesized single strand DNA flap to the target DNA, and assimilation of the desired nucleotide change as a result of cellular DNA repair and / or replication processes. Because templated DNA synthesis offers single nucleotide precision for the modification of any nucleotide, including insertions and deletions, the scope of this approach is very broad and could foreseeably be used for myriad applications in basic science and therapeutics.

[0183] In various embodiments, prime editing operates by contacting a target DNA molecule (for which a change in the nucleotide sequence is desired to be introduced) with a nucleic acid programmable DNA binding protein (napDNAbp) complexed with a prime editing guide RNA (pcgRNA). In various embodiments, the prime editing guide RNA (pegRNA) comprises an extension at the 3' or 5' end of the guide RNA, or at an intramolecular location in the guide RNA, and encodes the desired nucleotide change (e.g., single nucleotide change, insertion, or deletion). In step (a), the napDNAbp / extended gRNA complex contacts the DNA molecule, and the extended gRNA guides the napDNAbp to bind to a target locus. In step (b), a nick in one of the strands of DNA of the target locus is introduced (e.g., by a nuclease or chemical agent), thereby creating an available 3' end in one of the strands of the target locus. In certain embodiments, the nick is created in the strand of DNA that corresponds to the R-loop strand, i.e., the strand that is not hybridized to the guide RNA sequence, i.e., the “non-target strand.” The nick, however, could be introduced in citherof the strands. That is, the nick could be introduced into the R-loop “target strand” (i.e., the strand hybridized to the protospacer of the extended gRNA) or the “non-target strand” (i.e., the strand forming the single- stranded portion of the R-loop and which is complementary to the target strand). In step (c), the 3' end of the DNA strand (formed by the nick) interacts with the extended portion of the guide RNA in order to prime reverse transcription (i.e., “target-primed RT”). In certain embodiments, the 3' end DNA strand hybridizes to a specific RT priming sequence on the extended portion of the guide RNA, i.e., the “reverse transcriptase priming sequence” or “primer binding site” on the pegRNA. In step (d), a reverse transcriptase (or other suitable DNA polymerase) is introduced that synthesizes a single strand of DNA from the 3' end of the primed site towards the 5' end of the prime editing guide RNA. The DNA polymerase (e.g., reverse transcriptase) can be fused to the napDNAbp or alternatively can be provided in trans to the napDNAbp. This forms a single-strand DNA flap comprising the desired nucleotide change (e.g., the single base change, insertion, or deletion, or a combination thereof) and that is otherwise homologous to the endogenous DNA at or adjacent to the nick site. In step (e), the napDNAbp and guide RNA are released. Steps (f) and (g) relate to the resolution of the single-strand DNA flap such that the desired nucleotide change becomes incorporated into the target locus. This process can be driven towards the desired product formation by removing the corresponding 5' endogenous DNA flap that forms once the 3' single-strand DNA flap invades and hybridizes to the endogenous DNA sequence. Without being bound by theory, the cell’s endogenous DNA repair and replication processes resolve the mismatched DNA to incorporate the nucleotide change(s) to form the desired altered product. The process can also be driven towards product formation with “second-strand nicking.” This process may introduce at least one or more of the following genetic changes: transversions, transitions, deletions, and insertions.

[0184] Although in the embodiments described thus far the pegRNA constitutes a single molecule comprising a guide RNA (which itself comprises a spacer sequence and a gRNA core or scaffold) and a 5' or 3' extension arm comprising the primer binding site and a DNA synthesis template, the pegRNA may also take the form of two individual molecules comprised of a guide RNA and a trans PE RNA template (tPERT), which essentially houses the extension arm (including, in particular, the primer binding site and the DNA synthesis domain) and an RNA-protcin recruitment domain (e.g., MS 2 aptamer or hairpin) in the samemolecule which becomes co-localized or recruited to a modified PE complex that comprises a tPERT recruiting protein (e.g., MS2cp protein, which binds to the MS2 aptamer).

[0185] Examples of PE complexes can include: PEI, which is a fusion protein comprising Cas9(H840A) and a wild type MMLV RT having the following structure: [NLS]- [Cas9(H840A)]-[linker]-[MMLV_RT(wt)]+a desired pegRNA, wherein the PE fusion has the amino acid sequence of SEQ ID NO: 7; PE2, which is a fusion protein comprising Cas9(H840A) and a variant MMLV RT having the following structure: [NLS]- [Cas9(H840A)]-[linker]-[MMLV_RT(D200N)(T330P)(L603W)(T306K)(W313F)]+a desired pegRNA, wherein the PE fusion has the amino acid sequence of SEQ ID NO: 8; PE3, which includes PE2 plus a second-strand nicking guide RNA that complexes with the PE2 and introduces a nick in the non-edited DNA strand in order to induce preferential replacement of the edited strand; PE3b, which refers to PE3 but wherein the second-strand nicking guide RNA designed for temporal control such that the second strand nick is not introduced until after the installation of the desired edit; PE4, which includes PE2 plus an MLH1 dominant negative protein (i.e., wild-type MLH1 with amino acids 754-756 truncated, which may be referred to herein as “MLH1 A754-756” or “MLHldn”) expressed in trans; PE5, which refers to a system comprising PE3 plus an MLH1 dominant negative protein (i.e., wild-type MLH1 with amino acids 754-756 truncated) expressed in trans; PEmax, which includes a fusion protein comprising Cas9(R221K N39K II840A) and a variant MMLV RT pentamutant (D200N T306K W313F T330P L603W) having the following structure: [bipartite NLS]- [Cas9(R221K)(N394K)(H840A)]-[linker]-[MMLV_RT(D200N)(T330P)(L603W)]-[bipartite NLS]-[NLS]+a desired pegRNA, wherein the PE fusion has the amino acid sequence of SEQ ID NO: 9; PE4max, which refers to PE4 but wherein the PE2 component is substituted with PEmax; and PE5max, which refers to PE5 but wherein the PE2 component of PE3 is substituted with PEmax, all of which are described in US Patent Publication Nos. US 20250064979 and US 20250327045, both of which are herein incorporated by reference in their entirety.

[0186] Other prime editing complexes that can be delivered by LNPs described herein include those described in International Patent Publication Nos. WO2020191242, WO2020191234, W02020086908, WO2021072328, WO2021226558, and WO2020191248, and Anzalone A V, et al. Nature. 2019 December; 576(7785):149-157; Anzalone AV, et al. Nat Biotechnol. 2021 Dec. 9; Hsu J Y, et al. Nat Commun. 2021 Feb. 15; 12(1): 1034;Nelson J W, et al. Nat Biotechnol. 2021 Oct. 4; Chen P J, et al. Cell. 2021 Oct. 28; 184(22):5635-5652.e29; Scholefield J, et al. Gene Ther. 2021 August;28(7-8):396-401; Newby GA, et al. Mol Ther. 2021 Nov. 3; 29(11 ) :3107-3124, each of which is incorporated herein by reference in its entirety.

[0187] In some embodiments, the guide RNA or pegRNA complexed with the BE or PE is configured to generate a mutation in a nucleic acid, for example, to correct a point mutation in a gene (e.g., RPE65) that is associated with an IRD to modulate expression of one or more proteins (e.g., RPE65) and treat the IRD, e.g., LCA.

[0188] In some embodiments, the guide RNA or pegRNA comprises a guide sequence that comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleic acids that are 100% complementary to or hybridize with a target sequence, for example a target DNA sequence, that includes the point mutation of the IRD-related gene. In some embodiments, the guide RNA or pegRNA comprises a guide sequence that comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleic acids that are 100% complementary to a DNA sequence in a RPE65 gene that includes the point mutation of the RPE65 gene, for example a region of a human RPE65 gene that includes the point mutation of the IRD-related gene.

[0189] In some embodiments, any of the complexes described herein comprise a gRNA or pegRNA having a guide sequence that comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleic acids that are 100% complementary to any one of the nucleic acid sequences described herein. It should be appreciated that the guide sequence of the gRNA may comprise one or more nucleotides that arc not complementary to a target sequence. In some embodiments, the guide sequence of the gRNA is at the 5' end of the gRNA. In some embodiments, the G at the 5' end of the gRNA is not complementary with the target sequence. In some embodiments, the guide sequence of the gRNA comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides that are not complementary to a target sequence.

[0190] In some embodiments, the guide sequences are capable of guiding a BE or PE to correct a mutation in RPE65 (e.g., a C130T point mutation in RPE65). In various embodiments BEs (e.g., BEs described herein) or PEs can be complexed, bound, or otherwise associated with (e.g., via any type of covalent or non-covalent bond) one or more guide sequences, i.e., the sequence which becomes associated or bound to the BE and directs itslocalization to a specific target sequence having complementarity to the guide sequence or a portion thereof. The particular design aspects of a guide sequence will depend upon the nucleotide sequence of a genomic target site of interest and the type of napDNA / RNAbp (e.g., type of Cas protein) present in the BE or PE, among other factors, such as PAM sequence locations, percent G / C content in the target sequence, the degree of microhomology regions, secondary structures, etc.

[0191] In general, a guide sequence can include any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a napDNARNAbp (e.g., a Cas9, Cas9 homolog, or Cas9 variant) to the target sequence, such as a sequence within an RPE65 gene that comprises a point mutation. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence (e.g., RPE65), when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith- Waterman algorithm, the Needleman- Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).

[0192] In some embodiments, a guide sequence is about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 45, 50, 75, or more nucleotides in length.

[0193] In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length.

[0194] The ability of a guide sequence to direct sequence-specific binding of a BE or PE to a target sequence may be assessed by any suitable assay. For example, the components of a BE or PE, including the guide sequence to be tested, may be provided to a host cell having the corresponding target sequence (e.g., an NIH3T3 cell line), such as by transfection with vectors encoding the components of a BE or PE disclosed herein, followed by an assessment of preferential cleavage within the target sequence. Similarly, cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the targetsequence, components of a BE or PE, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions. Other assays are possible, and will occur to those skilled in the art.

[0195] In some embodiments, a guide sequence is provided that is designed to target a point mutation in RPE65. In some embodiments, the target sequence is an RPE65 sequence within the genome of a cell.

[0196] In some embodiments, portions of a mouse RPE65 gene and homo sapiens RPE65 gene, on exon 3, that include the C130T residue, which, when mutated, leads to the development of LCA, can have nucleotide sequences described, for example, in U.S. Patent Publication US20230190893, which is incorporated herein by reference in its entirety.

[0197] In some embodiments, the nucleic acid sequence of DNA encoding the guide sequence can include, for example:5 ’ - ACATC AGAGGAGACTGCCAGGTTTTAGAGCTAG AAAT AGC A AG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3’ (SEQ ID NO: 5): or5’-AGAGCCCTGGCCCACATCAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAG TCTCCTCCGATGTGGGCCGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA- 3’ (SEQ ID NO: 6).

[0198] In some embodiments, a guide sequence is selected to reduce the degree of secondary structure within the guide sequence. Secondary structure may be determined by any suitable polynucleotide folding algorithm. Some programs arc based on calculating the minimum Gibbs free energy. An example of one such algorithm is mFold, as described by Zuker and Stiegler (Nucleic Acids Res. 9 (1981), 133-148). Another example folding algorithm is the online Webserver RNAfold, developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g., A. R. Gruber et al., 2008, Cell 106(1): 23-24; and PA Carr and GM Church, 2009, Nature Biotechnology 27(12): 1151- 62). Further algorithms may be found in U.S. application Ser. No. 61 / 836,080; Broad Reference BI-2013 / 004A); incorporated herein by reference.

[0199] In some embodiments, the LNPs encapsulating the genome editing RNPs, such as BEs complexed with guide RNA or PEs complexed with pcgRNA, can be formed byinitially assembling the genome editing RNPs. The genome editing RNPs can be assembled by mixing purified BE (e.g., ABE) or PE with, respectively, synthetic guide RNA (sgRNA) or epegRNA at a 1: 1.1 molar ratio in a buffer. The buffer for the BE can include HEPES at a pH 7.0, NaCl, and glycerol 20% (v / v). For the PE, the buffer can include HEPES at a pH 7.0, NaCl, and glycerol 5% (v / v). The guide RNAs can be dissolved in water. The BE and PE solutions can be diluted, supplemented with cryopreservation agent or stabilizer, such as an aqueous sucrose solution, and added to guide RNA solutions to form the genome editing RNPs. Sucrose can be provided in all solutions to prevent aggregation of the genome editing RNPs, which occurs at RNP concentrations above 4 pM without sucrose.

[0200] The genome editing RNPs so formed can then be encapsulated within the lipid component of the LNP by combining the genome editing RNP in a lipid ethanol solution at a volume ratio of about 1 :3 to about 1:6 (ethanokaqueous) and a total lipid:guide RNA weight ratio of, for example, about 40:1 (approximate total lipid:protein weight ratio of about 7.75:1). The combination can be performed by microfluidic mixing using, for example, a Precision NanoSystems Ignite device (Precision NanoSystems, Vancouver, BC, Canada). Immediately after mixing, the formed LNPs can be dialyzed at room temperature against Tris, Na acetate, pH 7.4, sucrose (TAS buffer) solution, to remove the ethanol and deprotonate the ionizable cationic lipid at neutral pH.

[0201] By way of example, we assembled RNPs by mixing purified adenine base editor (ABE) with synthetic single guide RNA (sgRNA) at a 1:1.1 molar ratio. The buffer for ABE was HEPES 10 mM, pH 7.0, NaCl 500 mM, glycerol 20% (v / v), and guide RNA was dissolved in water. ABE was diluted, supplemented with sucrose, and added to guide RNA. Final composition of the buffer in which RNPs were assembled was HEPES 2.8 mM, pH 7.0, NaCl 140 mM, glycerol 5.6%(v / v), and sucrose 10% (w / v). The RNP was incubated at room temperature for at least 15 minutes. Immediately before LNP encapsulation, ABE RNP was diluted into 50 mM Tris-acetate buffer, pH 6.0, with 10% (w / v) sucrose, to achieve a final concentration of NaCl of 10 mM. The formulation of the LNP utilized an ionizable cationic lipid (CL4H6, SM102, or DODMA, where pKa is above 6.0) along with the co- lipids DSPC, cholesterol, and DMG-PEG 2000 at the molar composition of 50 / 10 / 38.5 / 1.5, respectively, to encapsulate pre- formed RNPs.

[0202] The lipids were dissolved in ethanol and rapidly combined with preformed RNP in the Tris-acetate buffer, pH 6, with 10% (w / v) sucrose at a volume ratio of 1:3(ethanol: aqueous). The combination was performed by microfluidic mixing using Precision NanoSystem’s “Ignite”, or rapid mixing via T-junction using a dual syringe pump. The ionizable lipid became protonated at low pH and electrostatically bound to the anionic phosphate backbone of the sgRNA and negatively charged surface of ABE, driving the vesicle formation and RNP encapsulation. pH was then raised to neutral by dialysis with > 100 volumes of Tris / Acetate / Sucrose buffer pH 7.4 for at least 5 hours to form neutral LNPs, and ethanol was removed simultaneously. Other monovalent low ionic strength buffers containing cryoprotectant may also be used.

[0203] The produced LNP was extensively characterized for (1) particle size and polydispersity index (PDI) by dynamic light scattering using a Malvern Zetasizer, (2) encapsulation by a protein pulldown assay, and (3) functional protein activity by in vitro and in vivo transfection.

[0204] Characterization results showed the LNP has an average particle size of 230 nm and low polydispersity. The produced LNP demonstrated efficient encapsulation by an affinity chromatography pull-down assay for free and encapsulated ABE RNP. When free ABE RNP was applied to the affinity resin, a minimal amount of protein was found in the unbound fraction, and most of the material was recovered after elution. In contrast, when the LNP was applied to the resin, most of the material was retrieved in the unbound fraction, and a minimal amount of ABE was found in the eluted fraction. This shows that after encapsulation, ABE was stored within the particles and did not interact significantly with the affinity resin.

[0205] In some embodiments, the amount of a genome editing RNP in an LNP composition may depend on the size, composition, desired target and / or application, or other properties of the LNP composition, as well as on the properties of the genome editing RNP. For example, the amount of genome editing RNP useful in a LNP composition may depend on the size, sequence, and other characteristics of the BE, PE, or guide RNA.

[0206] In some embodiments, the wt / wt ratio of the lipid component to the protein component of genome editing RNP in the LNP composition may be from about 5:1 to about 60:1, for example, about 5: 1 to about 50:1, about 5: 1 to about 45:1, about 5:1 to about 40: 1, about 5: 1 to about 35:1, about 5: 1 to about 30:1, about 5:1 to about 25:1, about 5:1 to about 20: 1, about 5:1 to about 15: 1, or about 5:1 to about 10:1, including any ranges therebetween.For example, the wt / wt ratio of the lipid component to the protein content of the genome editing RNP may be from about 7:1 to about 8:1, more preferably about 7.75:1.

[0207] In some embodiments, the total lipid:guide RNA weight ratio can be from about 30: 1 to about 80:1, for example, about 30: 1 to about 75:1, about 30:1 to about 70:1, about 30:1 to about 65:1, about 30:1 to about 60:1, about 30:1 to about 55:1, about 30:1 to about 50:1, about 30:1 to about 45:1, or about 35:1 to about 45: 1, include any range therebetween. In other embodiments, the total lipid:guide RNA can be about 35:1, about 36: 1, about 37: 1, about 38: 1, about 39:1, about 40: 1, about 41 :1, about 42:1, about 43:1, about 44: 1, or about 45: 1.

[0208] The characteristics of the LNP composition may depend on the components thereof. For example, an LNP composition including cholesterol as a structural lipid may have different characteristics than a nanoparticle composition that includes a different structural lipid. Similarly, the characteristics of a nanoparticle composition may depend on the absolute or relative amounts of its components. For instance, a LNP composition including a higher molar fraction of a phospholipid may have different characteristics than a LNP composition including a lower molar fraction of a phospholipid. Characteristics may also vary depending on the method and conditions of preparation of the nanoparticle composition.

[0209] LNP compositions may be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) may be used to examine the morphology and size distribution of a nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titrations) may be used to measure zeta potentials. Dynamic light scattering may also be utilized to determine particle sizes. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) may also be used to measure multiple characteristics of a nanoparticle composition, such as particle size, polydispersity index, and zeta potential.

[0210] In some embodiments, the LNPs that encapsulate the genome editing RNP, such as a BE RNP or PE RNP, can have an average nanoparticle diameter of about 50 nm to about 500 nm, for example, about 50 nm to about 450 nm, about 50 nm to about 400 nm, about 50 nm to about 350 nm, about 50 nm to about 300 nm, about 50 nm to about 250 nm, about 50 nm to about 150 nm, about 50 nm to about 100 nm, including any range therebetween. For example, the mean size of a LNP composition may be about 40 nm, 45 nm, 50 nm, 55 nm, 60nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, 150 nm. In some embodiments, the mean size of a LNP composition may be from about 50 nm to about 200 nm, from about 50 nm to about 190 nm, from about 50 nm to about 180 nm, from about 50 nm to about 170 nm, from about 50 nm to about 160 nm, from about 60 nm to about 200 nm, from about 60 nm to about 190 nm, from about 60 nm to about 180 nm, from about 60 nm to about 170 nm, from about 70 nm to about 200 nm, from about 70 nm to about 190 nm, from about 70 nm to about 180 nm, from about 80 nm to about 200 nm, from about 80 nm to about 190 nm, or from about 90 nm to about 200 nm.

[0211] The LNP composition may be relatively homogenous. A poly dispersity index may be used to indicate the homogeneity of a LNP composition, e.g., the particle size distribution of the nanoparticle compositions. A small (e.g., less than 0.2) polydispersity index generally indicates a narrow particle size distribution. A nanoparticle composition may have a poly dispersity index from about 0 to about 0.2, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, or 0.20. In some embodiments, the polydispersity index of the composition can be less than 0.15 or less than 0.1.

[0212] The efficiency of encapsulation of the genome editing RNP describes the amount of genome editing RNP that is encapsulated or otherwise associated with the LNP after preparation, relative to the initial amount provided. The encapsulation efficiency is desirably high (e.g., close to 100%). The encapsulation efficiency may be measured, for example, by comparing the amount of genome editing RNP in a solution containing the LNP composition before and after breaking up the LNP composition with one or more organic solvents or detergents. Fluorescence may be used to measure the amount of free genome editing RNP in a solution. For the LNP compositions described herein, the encapsulation efficiency of the genome editing RNP may be at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.

[0213] The LNP compositions may be formulated in whole or in part as pharmaceutical compositions. Pharmaceutical compositions may include one or more LNP compositions. For example, a pharmaceutical composition may include one or more LNP compositionsincluding one or more different genome editing RNP. Pharmaceutical compositions may further include one or more pharmaceutically acceptable excipients or accessory ingredients such as those described herein. General guidelines for the formulation and manufacture of pharmaceutical compositions and agents are available, for example, in Remington's The Science and Practice of Pharmacy, 21stEdition, A. R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, Md„ 2006. Conventional excipients and accessory ingredients may be used in any pharmaceutical composition, except insofar as any conventional excipient or accessory ingredient may be incompatible with one or more components of a nanoparticle composition. An excipient or accessory ingredient may be incompatible with a component of a nanoparticle composition if its combination with the component may result in any undesirable biological effect or otherwise deleterious effect.

[0214] In some embodiments, one or more excipients or accessory ingredients may make up greater than 50% of the total mass or volume of a pharmaceutical composition including the LNP composition. For example, the one or more excipients or accessory ingredients may make up 50%, 60%, 70%, 80%, 90%, or more of a pharmaceutical convention. In some embodiments, a pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, an excipient is approved for use in humans and for veterinary use. In some embodiments, an excipient is approved by United States Food and Drug Administration. In some embodiments, an excipient is pharmaceutical grade. In some embodiments, an excipient meets the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia.

[0215] Relative amounts of the one or more LNP compositions, the one or more pharmaceutically acceptable excipients, and / or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure will vary, depending upon the identity, size, and / or condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, a pharmaceutical composition may comprise between 0.1% and 100% (wt / wt) of one or more LNP compositions.

[0216] In certain embodiments, the LNP compositions and / or pharmaceutical compositions described herein are refrigerated or frozen for storage and / or shipment (e.g., being stored at a temperature of 4°C or lower, such as a temperature between about -150°C and about 0°C or between about -80°C and about -20°C (e.g., about -5°C, -10°C,-15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90° C, -130°C or -150° C). For example, the pharmaceutical composition comprising an LNP is a solution that is refrigerated for storage and / or shipment at, for example, about -20°C, -30°C, -40°C, -50°C, -60°C, -70°C, or -80°C. In certain embodiments, the disclosure also relates to a method of increasing stability of the LNP and / or pharmaceutical compositions comprising LNP by storing the LNP compositions and / or pharmaceutical compositions at a temperature of 4° C. or lower, such as a temperature between about -150°C and about 0°C or between about -80°C and about -20°C, e.g., about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C or -150°C). For example, the LNP compositions and / or pharmaceutical compositions disclosed herein are stable for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months, e.g., at a temperature of 4°C or lower e.g., between about 4°C and -20°C). In one embodiment, the formulation is stabilized for at least 4 weeks at about 4° C. In certain embodiments, the pharmaceutical composition of the disclosure comprises a LNP composition disclosed herein, and a pharmaceutically acceptable carrier selected from one or more of Tris, an acetate (e.g., sodium acetate), a citrate (e.g., sodium citrate), saline, PBS, and sucrose. In certain embodiments, the pharmaceutical composition of the disclosure has a pH value between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or between 7.4 and 8 or between 7 and 7.8). For example, a pharmaceutical composition described herein can include a LNP composition described herein, Tris, saline, and sucrose, and has a pH of about 7.4-8, which is suitable for storage and / or shipment at, for example, about -20°C. For example, a pharmaceutical composition of the disclosure comprises an LNP composition disclosed herein and PBS and has a pH of about 7-7.8, suitable for storage and / or shipment at, for example, about 4°C or lower. “Stability,” “stabilized,” and “stable” in the context of the present disclosure refers to the resistance of the LNP compositions and / or pharmaceutical compositions disclosed herein to chemical or physical changes (e.g., degradation, particle size change, aggregation, change in encapsulation, etc.) under given manufacturing, preparation, transportation, storage and / or in-use conditions, e.g., when stress is applied such as shear force, frcczc / thaw stress, etc.

[0217] In some embodiments, the pharmaceutical composition can include an amount sucrose effective to enhance the stability of the LNPs under different or differing storage temperatures. The different or differing storage temperatures can range from about -20°C to about 4°C. For example, the pharmaceutical composition can include about 5% to about 20% sucrose.

[0218] In some embodiments, the pharmaceutical composition is free of an excipient besides sucrose.

[0219] In other embodiments, the pharmaceutical composition includes a concentration of LNPs of about 50 ng / pl to about 500 ng / pl, about 100 ng / pl to about 300 ng / pl, or about 150 ng / pl to about 250 ng / pl.

[0220] LNP compositions and / or pharmaceutical compositions including one or more LNP compositions may be administered to any patient or subject, including those patients or subjects that may benefit from a therapeutic effect provided by the delivery of a therapeutic and / or prophylactic to one or more particular cells, tissues, organs, or systems or groups thereof, such as the renal system. Although the descriptions described herein of LNP compositions and pharmaceutical compositions including LNP compositions are principally directed to compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other mammal. Modification of compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and / or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the compositions is contemplated include, but arc not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats.

[0221] A pharmaceutical composition including one or more LNP compositions may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include bringing the LNPs into association with an excipient and / or one or more other accessory ingredients, and then, if desirable or necessary, dividing, shaping, and / or packaging the product into a desired single- or multi-dose unit.

[0222] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of singleunit doses. As used herein, a “unit dose” is a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient (e.g., LNP composition). The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and / or a convenient fraction of such a dosage, for example, one-half or one-third of such a dosage.

[0223] Pharmaceutical compositions may be prepared in a variety of forms suitable for a variety of routes and methods of administration. For example, pharmaceutical compositions may be prepared in liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules), dosage forms for topical and / or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and patches), suspensions, powders, and other forms.

[0224] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions, may be formulated according to the known art using suitable dispersing agents, wetting agents, and / or suspending agents. Sterile injectable preparations may be sterile injectable solutions, suspensions, and / or emulsions in nontoxic parenterally acceptable diluents and / or solvents, for example, as a solution in 1,3 -butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P., and isotonic sodium chloride solution. Sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil can be employed, including synthetic mono- or diglycerides. Fatty acids such as oleic acid can be used in the preparation of injectables.

[0225] Injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, and / or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use. A pharmaceutical composition may be prepared, packaged, and / or sold in a formulation suitable for ophthalmic administration. Such formulations may, for example, be in the form of eye drops including, for example, a 0. 1 / 1.0% (wt / wt) solution and / or suspension of the active ingredient in an aqueous or oily liquid excipient. Such drops may further comprise buffering agents, salts, and / or one or more other of any additional ingredients described herein. Other ophthalmically-administrable formulations which areuseful include those which comprise the active ingredient in microcrystalline form and / or in a liposomal preparation.

[0226] In some embodiments, a pharmaceutical composition including one or more LNP compositions described can be formulated for ocular delivery and treating ocular diseases or conditions, such as retinitis pigmentosa. One approach for ocular delivery includes injecting the pharmaceutical composition, including one or more LNP compositions, into patients with an IRD, such as retinitis pigmentosa, using subretinal, direct retinal, suprachoroidal, or intravitreal injection to direct the LNP to the desired ocular tissue or cell. Directly injecting the LNP composition into the proximity of the retinal pigment epithelial cells or Bruch's membrane can also provide for targeting of the LNP with some forms of ocular disorders, such as retinitis pigmentosa. In a specific embodiment, the pharmaceutical composition including one or more LNP compositions is administered via intra-ocular sustained delivery. In a specific embodiment, the pharmaceutical composition including one or more LNP compositions is delivered by posterior subtenon injection. In another specific embodiment, the pharmaceutical composition including one or more LNP compositions are delivered to ocular tissue to take up lipid from Bruch's membrane, retinal pigment epithelial cells, or both.

[0227] A skilled person will be familiar with and well able to carry out individual subretinal, direct retinal, suprachoroidal, or intravitreal injections.

[0228] Subretinal injections are injections into the subretinal space, i.e., underneath the neurosensory retina. During a subretinal injection, the injected material is directed into, and creates a space between, the photoreceptor cell and retinal pigment epithelial (RPE) layers.

[0229] When the injection is carried out through a small rctinotomy, a retinal detachment may be created. The detached, raised layer of the retina that is generated by the injected material is referred to as a "bleb".

[0230] The hole created by the subretinal injection may be sufficiently small that the injected solution does not significantly reflux back into the vitreous cavity after administration. Such reflux would be problematic when a medicament is injected, because the effects of the medicament would be directed away from the target zone. Preferably, the injection creates a self-sealing entry point in the neurosensory retina, i.e., once the injection needle is removed, the hole created by the needle reseals such that very little or substantially no injected material is released through the hole.

[0231] To facilitate this process, specialist subretinal injection needles are commercially available (e.g., DORC 41G Teflon subretinal injection needle, Dutch Ophthalmic Research Center International B V, Zuidland, The Netherlands). These are needles designed to carry out subretinal injections.

[0232] In some embodiments, subretinal injection comprises a scleral tunnel approach through the posterior pole to the superior retina with a Hamilton syringe and 34-gauge needle (ESS Labs, UK). Alternatively, or in addition, subretinal injections can comprise performing an anterior chamber paracentesis with a 33G needle prior to the subretinal injection using a WPI syringe and a bevelled 35G-needle system (World Precision Instruments, UK).

[0233] Animal subjects can be anaesthetized, for example, by intraperitoneal injection containing ketamine (80 mg / kg) and xylazine (10 mg / kg), and pupils fully dilated with tropicamide eye drops (Mydriaticum 1%, Bausch & Lomb, UK) and phenylephrine eye drops (phenylephrine hydrochloride 2.5%, Bausch & Lomb, UK). Proxymetacaine eye drops (proxymetacaine hydrochloride 0.5%, Bausch & Lomb, UK) can also be applied prior to subretinal injection. Post-injection, chloramphenicol eye drops can be applied (chloramphenicol 0.5%, Bausch & Lomb, UK), anaesthesia reversed with atipamezole (2 mg / kg), and carbomer gel applied (Viscotears, Novartis, UK) to prevent cataract formation. Unless damage to the retina occurs during the injection, and as long as a sufficiently small needle is used, the injected material remains localized between the detached neurosensory retina and the RPE at the site of the localized retinal detachment (i.e., does not reflux into the vitreous cavity). Indeed, the persistence of the bleb over a short time frame indicates that there may be little escape of the injected material into the vitreous. The bleb may dissipate over a longer time frame as the injected material is absorbed.

[0234] Visualizations of the eye, for example, the retina, using optical coherence tomography, may be made pre-operatively.

[0235] In some embodiments, the LNP composition or the pharmaceutical composition described herein may be delivered with accuracy and safety by using a two-step method in which a localized retinal detachment is created by the subretinal injection of a first solution. The first solution does not comprise the LNP composition. A second subretinal injection is then used to deliver the medicament comprising the LNP composition or the pharmaceutical composition into the subretinal fluid of the bleb created by the first subretinal injection. Because the injection delivering the LNP composition or the pharmaceutical composition isnot being used to detach the retina, a specific volume of solution may be injected in this second step.

[0236] The volume of solution injected to at least partially detach the retina may be, for example, about 10-1000 pL, for example, about 50-1000, 100-1000, 250-1000, 500-1000, 10- 500, 50-500, 100-500, 250-500 pL. The volume may be, for example, about 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 pL.

[0237] The volume of the pharmaceutical composition injected may be, for example, about 0.1-500 pL, for example, about .5-500, 1-500, 2-500, 3-500, 4-500, 5-250, 1-250, 2- 250, or 5-150 pL. In other embodiments, the volume of the pharmaceutical composition administered to the subject is about 0. 1 pL to about 2 pL, about 0.2 pL to about 1.5 pL, or about 0.5 pL to about 1 pL.

[0238] In some embodiments, the concentration of the LNP composition in the pharmaceutical composition is about 50 ng / pl to about 500 ng / pl, about 100 ng / pl to about 300 ng / pl, or about 150 ng / pl to about 250 ng / pl.

[0239] In another approach, the pharmaceutical composition, including one or more LNP compositions, can be administered through an ocular device suitable for direct implantation into the vitreous of the eye. The pharmaceutical composition, including one or more LNP compositions, may be provided in sustained release compositions, such as those described in, for example, U.S. Pat. Nos. 5,672,659 and 5,595,760. Such devices are found to provide sustained controlled release of a pharmaceutical composition, including one or more LNP compositions, to treat the eye without risk of detrimental local and systemic side effects. An object of the ocular method of delivery is to maximize the amount of drug contained in an intraocular device or implant while minimizing its size in order to prolong the duration of the implant. See, e.g., U.S. Pat. Nos. 5,378,475; 6,375,972, and 6,756,058, and U.S. Publications 20050096290 and 200501269448. Such implants may be biodegradable and / or biocompatible implants, or may be non-biodegradable implants.

[0240] Biodegradable ocular implants are described, for example, in U.S. Patent Publication No. 20050048099. The implants may be inserted into a chamber of the eye, such as the anterior or posterior chambers, or may be implanted in the sclera, transchoroidal space, or an avascularized region exterior to the vitreous. Alternatively, a contact lens that acts as a depot for compositions of the invention may also be used for drug delivery.

[0241] In some embodiments, the implant may be positioned over an avascular region, such as on the sclera, so as to allow for transcleral diffusion of the pharmaceutical composition, including one or more LNP compositions, to the desired site of treatment, e.g., the intraocular space and macula of the eye. Furthermore, the site of transcleral diffusion is preferably in proximity to the macula. Examples of implants for delivery of the pharmaceutical composition, including one or more LNP compositions, include, but are not limited to, the devices described in U.S. Pat. Nos. 3,416,530; 3,828,777; 4,014,335; 4,300,557; 4,327,725; 4,853,224; 4,946,450; 4,997,652; 5,147,647; 164,188; 5,178,635; 5,300,114; 5,322,691 ; 5,403,901 ; 5,443,505; 5,466,466; 5,476,511; 5,516,522; 5,632,984; 5,679,666; 5,710,165; 5,725,493; 5,743,274; 5,766,242; 5,766,619; 5,770,592; 5,773,019;5,824,072; 5.824,073; 5,830,173; 5,836,935; 5,869,079, 5,902,598; 5,904,144; 5,916,584; 6,001,386; 6,074,661; 6,110,485; 6,126,687; 6,146.366; 6,251,090; and 6,299,895, and in WO 01 / 30323 and WO 01 / 28474, all of which are incorporated herein by reference.

[0242] The pharmaceutical composition, including one or more LNP compositions described herein, may also be delivered topically. For topical delivery, the pharmaceutical composition, including one or more LNP compositions, are provided in any pharmaceutically acceptable excipient that is approved for ocular delivery. Preferably, the pharmaceutical composition, including one or more LNP compositions, is delivered in drop form to the surface of the eye. For some applications, the delivery of the pharmaceutical composition, including one or more LNP compositions, relies on the diffusion of the compounds through the cornea to the interior of the eye.

[0243] In one example, the pharmaceutical composition, including one or more LNP compositions, can be provided in an ophthalmic preparation that can be administered to the subject’s eye. The ophthalmic preparation can contain the LNPs in a pharmaceutically acceptable solution, suspension, or ointment. Some variations in concentration will necessarily occur, depending on the particular compound employed, the condition of the subject to be treated, and the like, and the person responsible for treatment will determine the most suitable concentration for the individual subject. The ophthalmic preparation can be in the form of a sterile aqueous solution containing, if desired, additional ingredients, for example, preservatives, buffers, tonicity agents, antioxidants, stabilizers, nonionic wetting or clarifying agents, and viscosity increasing agents.

[0244] In certain embodiments, the LNPs or a pharmaceutical composition thereof may be administered at dosage levels sufficient to deliver from about 0.0001 mg / kg to about 10 mg / kg, from about 0.001 mg / kg to about 10 mg / kg, from about 0.005 mg / kg to about 10 mg / kg, from about 0.01 mg / kg to about 10 mg / kg, from about 0.05 mg / kg to about 10 mg / kg, from about 0.1 mg / kg to about 10 mg / kg, from about 1 mg / kg to about 10 mg / kg, from about 2 mg / kg to about 10 mg / kg, from about 5 mg / kg to about 10 mg / kg, from about 0.0001 mg / kg to about 5 mg / kg, from about 0.001 mg / kg to about 5 mg / kg, from about 0.005 mg / kg to about 5 mg / kg, from about 0.01 mg / kg to about 5 mg / kg, from about 0.05 mg / kg to about 5 mg / kg, from about 0.1 mg / kg to about 5 mg / kg, from about 1 mg / kg to about 5 mg / kg, from about 2 mg / kg to about 5 mg / kg, from about 0.0001 mg / kg to about 2.5 mg / kg, from about 0.001 mg / kg to about 2.5 mg / kg, from about 0.005 mg / kg to about 2.5 mg / kg, from about 0.01 mg / kg to about 2.5 mg / kg, from about 0.05 mg / kg to about 2.5 mg / kg, from about 0.1 mg / kg to about 2.5 mg / kg, from about 1 mg / kg to about 2.5 mg / kg, from about 2 mg / kg to about 2.5 mg / kg, from about 0.0001 mg / kg to about 1 mg / kg, from about 0.001 mg / kg to about 1 mg / kg, from about 0.005 mg / kg to about 1 mg / kg, from about 0.01 mg / kg to about 1 mg / kg, from about 0.05 mg / kg to about 1 mg / kg, from about 0. 1 mg / kg to about 1 mg / kg, from about 0.0001 mg / kg to about 0.25 mg / kg, from about 0.001 mg / kg to about 0.25 mg / kg, from about 0.005 mg / kg to about 0.25 mg / kg, from about 0.01 mg / kg to about 0.25 mg / kg, from about 0.05 mg / kg to about 0.25 mg / kg, or from about 0.1 mg / kg to about 0.25 mg / kg of the BE RNPs or PE RNPs in a given dose, where a dose of 1 mg / kg (mpk) provides 1 mg of the BE RNPs or PE RNPs per 1 kg of subject body weight. In some embodiments, a dose of about 0.001 mg / kg to about 10 mg / kg of the BE RNPs or PE RNPs of the LNP composition may be administered. In other embodiments, a dose of about 0.005 mg / kg to about 2.5 mg / kg of the BE RNPs or PE RNPs may be administered. In certain embodiments, a dose of about 0. 1 mg / kg to about 1 mg / kg may be administered. In other embodiments, a dose of about 0.05 mg / kg to about 0.25 mg / kg may be administered. A dose may be administered one or more times per day, in the same or a different amount, to obtain a desired level of base editing or prime editing effect.

[0245] In various aspects, the instant specification provides LNPs encapsulating genome editing RNPs and methods of using the same to treat IRDs, such as LCA, Stargardt disease, or retinitis pigmentosa. In particular, it was surprisingly found that LNPs encapsulating BE RNPs (e.g., ABE RNP) or PE RNPs could be used to efficiently correct aC130T point mutation in the RPE65 gene both in vitro and in vivo, which is useful for the treatment of LCA with an efficiency effective to restore retinal and visual function at near normal levels.

[0246] In some embodiments, the disclosure provides methods of using LNPs that encapsulate BE RNPs and PE RNPs (e.g., any of the fusion proteins and guide RNAs described herein) to deliver the BE RNPs and PE RNPs to retinal pigment epithelium cells to generate an A to G and / or T to C mutation in the RPE65 gene. In some embodiments, the BE RNPs and PE RNPs can deaminate an adenosine nucleobase (A) in the RPE65 gene of a retinal pigment epithelium cell. In some embodiments, the RPE65 gene comprises a C to T or G to A mutation. In some embodiments, the C to T or G to A mutation in the RPE65 gene impairs the function of the RPE65 protein encoded by the RPE65 gene. In some embodiments, the C to T or G to A mutation in the RPE65 gene is nonsense mutation that results in a decrease in expression of at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or at least 99% RPE65.

[0247] In some embodiments, deaminating an adenosine (A) nucleobase complementary to the T corrects the C to T or G to A mutation in the RPE65 gene. In some embodiments, the C to T or G to A mutation in the RPE65 gene leads to a Cys (C) to Tyr (Y) mutation in the RPE65 protein encoded by the RPE65 gene. In some embodiments, deaminating the adenosine nucleobase complementary to the T corrects the Cys to Tyr mutation in the RPE65 protein.

[0248] In some embodiments, the guide sequence of the gRNA or pegRNA comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 contiguous nucleic acids that are 100% complementary to a target nucleic acid sequence of the RPE65 gene. In some embodiments, the BE and / or PE nick the target sequence that is complementary to the guide sequence.

[0249] In some embodiments, the target DNA sequence comprises a sequence associated with an IRD or disorder, e.g., LCA. In some embodiments, the target DNA sequence comprises a point mutation associated with a disease or disorder. In some embodiments, the activity of the BE or the PE, or the complex, results in a correction of the point mutation. In some embodiments, the target DNA sequence comprises a G to A or C to T point mutation associated with an IRD, and wherein the deamination of the mutant baseresults in a sequence that is not associated with a disease or disorder. In some embodiments, the target DNA sequence encodes a protein, and the point mutation is in a codon and results in a change in the amino acid encoded by the mutant codon as compared to the wild-type codon. In some embodiments, the deamination of the mutant base results in a change of the amino acid encoded by the mutant codon. In some embodiments, the deamination of the mutant base results in the codon encoding the wild-type amino acid. In some embodiments, the contacting is in vivo in a subject. In some embodiments, the subject has or has been diagnosed with an IRD.

[0250] In some embodiments, the purpose of the methods described herein is to restore the function of a dysfunctional gene via genome editing. The BE RNPs and PE RNPs described herein can be validated for genome editing-based human therapeutics in vitro, e.g., by correcting an IRD-associated mutation in human cell culture. It will be understood by the skilled artisan that the BE RNPs and PE RNPs described herein can be used to correct any single point G to A or C to T mutation. In the first case, deamination of the mutant A to G corrects the mutation, and in the latter case, deamination of the A that is base-paired with the mutant T, followed by a round of replication or followed by base editing repair activity, corrects the mutation.

[0251] As an alternative to injection or subretinal injection of LNPs encapsulating the BE RNPs or PE RNPs, cell replacement therapy can be used to prevent, correct or treat IRDs, where the methods of the present disclosure are applied to isolated patients' cells (ex vivo), which is then followed by the injection of "corrected" cells back into the patient.

[0252] In one embodiment, one or more LNPs encapsulating the BE RNPs or PE RNPs can be used to deliver the BE RNPs or PE RNPs into a eukaryotic cell. The cell may be a stem cell. Examples of stem cells include pluripotent, multipotent, and unipotent stem cells. Examples of pluripotent stem cells include embryonic stem cells, embryonic germ cells, embryonic carcinoma cells, and induced pluripotent stem cells (iPSCs). In one aspect, the iPSC is derived from a fibroblast cell.

[0253] For the treatment of IRD, the patient's iPS cells can be isolated and differentiated into retinal pigment epithelium (RPE) cells ex vivo. Patient's iPS cells or RPE cells characterized by a missense or nonsense mutation in an IRD-related gene may be manipulated using methods of the present disclosure in a manner that results in the correction of a mutant allele of the IRD-related gene.

[0254] Thus, the present disclosure provides methods for correcting IRD in a subject, wherein the method results in the replacement of a mutant allele of the IRD-related gene with the correct allele. The method may comprise administering to the subject a therapeutically effective amount of autologous or allogeneic retinal pigment RPE cells with the corrected allele of the IRD-related gene. Administration of the pharmaceutical preparations comprising RPE cells with the corrected allele of the IRD-related gene may be effective to reduce the severity of symptoms and / or to prevent further deterioration in the subject's condition. Such administration may be effective to fully restore any vision loss or other symptoms.

[0255] "Induced pluripotent stem cells," commonly abbreviated as iPS cells or iPSCs, refer to a type of pluripotent stem cell artificially prepared from a non-pluripotent cell, typically an adult somatic cell, or terminally differentiated cell, such as a fibroblast, a hematopoietic cell, a myocyte, a neuron, an epidermal cell, or the like, by introducing certain factors, referred to as reprogramming factors.

[0256] The present methods may further comprise differentiating the iPS cell into a differentiated cell, for example, an ocular cell.

[0257] For example, patient fibroblast cells can be collected from the skin biopsy and transformed into iPS cells. (See, e.g., Luo et al., Generation of induced pluripotent stem cells from skin fibroblasts of a patient with olivopontocerebellar atrophy, Tohoku J. Exp. Med. 2012, 226(2): 151-9). The base editing modification can be done at this stage. The corrected cell clone can be screened and selected by RFLP assay. The corrected cell clone is then differentiated into RPE cells and tested for its RPE-specific markers (e.g., Bestrophinl, RPE65, Cellular Retinaldehyde-binding Protein, and MFRP). Well-differentiated RPE cells can be transplanted autologously back to the donor patient.

[0258] In some embodiments, the cell may be autologous or allogeneic to the subject who is administered the cell.

[0259] The corrected cells for cell therapy to be administered to a subject (e.g., RPE cells) described in the present disclosure may be formulated with a pharmaceutically acceptable carrier. For example, cells can be administered alone or as a component of a pharmaceutical formulation. The cells (e.g., RPE cells) can be administered in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions (e.g., balanced salt solution (BSS)), dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just priorto use, which may contain antioxidants, buffers, bacteriostats, solutes or suspending or thickening agents.

[0260] The corrected cells (e.g., RPE cells) may be delivered in a pharmaceutically acceptable ophthalmic formulation by intraocular injection. Concentrations for injections may be at any amount that is effective and nontoxic. The pharmaceutical preparations of the cells of the present disclosure for treatment of a patient may be formulated at doses of at least about 10.sup.4 cells / mL. The cell preparations for treatment of a patient can be formulated at doses of at least or about 103, 104, 105, 106, 107, 108, 109, or IO10cells / mL.

[0261] Subjects, which may be treated according to the present disclosure, include all animals which may benefit from the present invention. Such subjects include mammals, preferably humans (infants, children, adolescents and / or adults), but can also be an animal such as dogs and cats, farm animals such as cows, pigs, sheep, horses, goats and the like, and laboratory animals (e.g., rats, mice, guinea pigs, and the like).

[0262] In some embodiments, the LNPs encapsulating the BE RNPs or PE RNPs or pharmaceutical compositions thereof and methods disclosed herein can be used to treat any inherited retinal disease (IRD) to permanently rescue the function of a key vision related protein disabled by mutations, or to correct dominant or recessive alleles for which gene augmentation may not be effective. The IRD can include chorioretinal atrophy or degeneration, cone or cone-rod dystrophy, congenital stationary night blindness, Leber congenital amaurosis, macular degeneration, ocular-retinal developmental disease, optic atrophy, retinitis pigmentosa, syndromic / systemic diseases with retinopathy, sorsby macular dystrophy, age-related macular degeneration, doyne honeycomb macular disease, juvenile macular degeneration, Stargardt disease, or retinitis pigmentosa.

[0263] In some embodiments, the methods described herein can be used for arresting the progression of or ameliorating vision loss associated with retinitis pigmentosa (RP) associated with a missense or nonsense mutation in the subject.

[0264] Vision loss may include a decrease in peripheral vision, central (reading) vision, night vision, day vision, loss of color perception, loss of contrast sensitivity, or reduction in visual acuity. The methods of the present disclosure can also be used to prevent, or arrest photoreceptor function loss or increase photoreceptor function in the subject.

[0265] RP is diagnosed in part through an examination of the retina. The eye exam usually reveals abnormal, dark pigment deposits that streak the retina. Additional tests for diagnosing RP include electroretinogram (ERG) and visual field testing.

[0266] Methods for measuring or assessing visual function, retinal function (such as responsiveness to light stimulation), or retinal structure in a subject are well known to one of skill in the art. See, e.g., Kanski's Clinical Ophthalmology: A Systematic Approach, Edition 8, Elsevier Health Sciences, 2015. Methods for measuring or assessing retinal response to light may include detecting an electrical response of the retina to a light stimulus. This response can be detected by measuring an electroretinogram (ERG; for example, full-field ERG, multifocal ERG, or ERG photostress test), visual evoked potential, or optokinetic nystagmus (see, e.g., Wester et al., Invest. Ophthalmol. Vis. Sci. 48:4542-4548, 2007). Furthermore, retinal response to light may be measured by directly detecting retinal response (for example, by use of a microelectrode at the retinal surface). ERG has been extensively described by Vincent et al. Retina, 2013; 33(1):5- 12. Thus, methods of the present disclosure can be used to improve visual function, retinal function (such as responsiveness to light stimulation), retinal structure, or any other clinical symptoms or phenotypic changes associated with ocular diseases in subjects afflicted with ocular disease.

[0267] In some embodiments, the LNP encapsulating the BE RNPs or PE RNPs described herein can be administered to the subject at an early stage or mid-stage of the non- syndromic autosomal dominant retinitis pigmentosa. The retinitis pigmentosa disease course can be conveniently divided into three stages, i.e., the early stage, mid-stage, and end-stage.

[0268] In the early stage, night blindness is the main symptom. It may be present from the first years of life or may appear during the second decade, or even later. At this stage, there may be peripheral visual field defects in dim light. However, these defects do not exist or are minimal in daylight, thus patients have normal life habits and the disease may appear stable. Diagnosis is difficult to establish at this stage, particularly when there is no familial history (about half of the cases). Visual acuity is normal or subnormal. Fundus examination may seem normal, as bone spicule-shaped pigment deposits are not present or are rare. Moreover, the attenuation of retinal arterioles is modest, and the optic disc is normal. The electroretinogram (ERG) is the key test. In most cases, it shows a decreased amplitude of the b-wave that predominates in scotopic conditions. However, ERG may appear normal when the retina is only partially affected, though the a decrease in maximum ERG amplitude.

[0269] In the mid-stage, the clinical picture is complete. Night blindness is obvious, with difficulties driving at night, and walking in the evening and in dark staircases. Patients become aware of the loss in the peripheral visual field in daylight conditions through stereotypic situations: while driving, they do not see pedestrians or side-coming cars, they miss hands in handshaking, and they frequently step into various objects. Consequently, patients adapt by avoiding night driving and circulation in unfamiliar places.Dyschromatopsia to pale colors (particularly blue and yellow hues) is often present. In addition, patients become photophobic, especially in the presence of diffuse light (white cloudy weather). This leads to reading difficulties, with a narrow window between insufficient and too bright light. Difficulties with reading are also due to decreased visual acuity, partly because of macular involvement (macular edema or mild foveomacular atrophy) and subcortical posterior cataract. Fundus examination reveals the presence of bone spicule-shaped pigment deposits in the midperiphery, along with atrophy of the retina. Narrowing of the retinal vessels is evident, and the optic disc is moderately pale. In contrast, the extreme periphery and the macular region appear relatively spared, although mild macular involvement is frequent. The ERG is usually unrecordable in scotopic conditions (rods), and the cone responses (30-Hz flickers, bright light) are markedly hypovolted.

[0270] In the end stage, patients can no longer move autonomously, as a result of peripheral vision loss (classical tunnel vision), with a few degrees of remaining visual field around the fixation point. Reading is difficult, and magnifying glasses are necessary. Photophobia is intense. Fundus examination reveals widespread pigment deposits reaching the macular area. Vessels are thin, and the optic disc has a waxy pallor. Fluorescein angiography detects chorioretinal atrophy in the periphery and also in the foveomacular area. The ERG is unrecordable.

[0271] In one embodiment, a subject is diagnosed as having symptoms of retinitis pigmentosa (such as impaired vision, night blindness, light sensitivity, tunnel vision, and loss of peripheral vision to total loss of vision), and then the LNPs encapsulating the BE RNPs or PE RNPs are administered. In another embodiment, a subject may be identified as being at risk for developing retinitis pigmentosa (risk factors may include family history or testing positive for a rhodopsin mutation), and then the LNPs encapsulating the BE RNPs or PE RNPs are administered. In yet another embodiment, a subject may be diagnosed as having retinitis pigmentosa, and then the LNPs encapsulating the BE RNPs or PE RNPs arcadministered. In another embodiment, a subject is diagnosed as having symptoms of other forms of retinal degeneration whose etiology involves a rhodopsin mutation (e.g., a P23H rod opsin mutation) in photoreceptor cells of a subject, and then the LNPs encapsulating the BE RNPs or PE RNPs are administered. In another embodiment, a subject may be identified as being at risk for developing other forms of retinal degeneration whose etiology is a rhodopsin mutation in photoreceptor cells, and then the LNPs encapsulating the BE RNPs or PE RNPs are administered. In some embodiments, the LNPs encapsulating the BE RNPs or PE RNPs are administered prophylactically. In some embodiments, a subject has been diagnosed as having the disease before retinal damage is apparent. In some embodiments, a human subject may know that he or she is in need of the retinal generation treatment or prevention.

[0272] In some embodiments, a subject may be monitored for the extent of retinal degeneration. A subject may be monitored in a variety of ways, such as by eye examination, dilated eye examination, fundoscopic examination, visual acuity test, and / or biopsy.Monitoring can be performed at a variety of times. For example, a subject may be monitored after a compound is administered. The monitoring can occur, for example, one day, one week, two weeks, one month, two months, six months, one year, two years, five years, or any other time period after the first administration of a compound. A subject can be repeatedly monitored. In some embodiments, the dose of a compound may be altered in response to monitoring.

[0273] It will be appreciated that the methods described herein can be used to prevent the development and progression of any IRD. For example, a patient may be a carrier of an IRD-related mutation, but the phenotypic expression of a disease has not yet been manifested, although the genomic defect has been identified by screening. The methods described herein may be applied to such a patient to prevent the onset of disease. Thus, all the methods described herein can be used to prevent, correct, or treat an IRD that arises due to the presence of autosomal dominant mutations and autosomal recessive mutations and, hence, treat an autosomal dominant IRD or an autosomal recessive IRD.

[0274] Examples of autosomal dominant and autosomal recessive IRD-related diseases are disclosed below. In all cases where accession numbers are used, the accession numbers refer to one embodiment of the gene, which may be used with the methods of the present disclosure. In one embodiment, the accession numbers are NCBI (National Center for Biotechnology Information) reference sequence (RcfScq) numbers.

[0275] For example, the autosomal dominant IRD-related gene in retinitis pigmentosa may include, but are not limited to, ARL3(NC_000010.11 (102673727 . . . 102714433, complement)), BEST1 (e.g., NG_009033.1), CA4 (NG_012050.1). CRX (NG_008605.1), FSCN2 (NG_015964.1), GUCA1B (NG_016216.1), HK1 (NG_012077.1), IMPDH1 (NG_009194.1), KLHL7 (NG_016983.1), NR2E3 (NG_009113.2), NRL (NG_011697.1), PRPF3 (NGJJ08245.1), PRPF4 (NG_034225.1), PRPF6 (NG_029719.1), PRPF8(NG_009118.1), PRPF31 (NG_009759.1), PRPH2 (NG_009176.1), RDH12 (NG_008321.1), RHO (NG_009115.1), ROM1 (NG_009845.1), RP1 (NG_009840.1), RP9 (NG_012968.1), RPE65 (NG_008472.1), SEMA4A (NG_027683.1), SNRNP200 (NG_016973.1), SPP2 (NG_008668.1), and TOPORS (NG_017050.1). Genes and mutations causing autosomal dominant retinitis pigmentosa are discussed in detail by Daiger et al. (Cold Spring Harb Perspect Med. 2014 Oct. 10; 5(10)).

[0276] Another type of autosomal dominant IRD-related gene is the autosomal dominant chorioretinal atrophy or degeneration-related gene, which may include: PRDM13 (NC_000006.12 (99606774 . . . 99615578)), RGR (NG_009106.1), and TEAD1 (NG_021302.1).

[0277] Another example of the autosomal dominant IRD-related gene is autosomal dominant cone or cone-rod dystrophy-related gene, which can include: AIPL1 (NG_008474.1), CRX (NG_008605.1), GUCA1A (NG_009938.1), GUCY2D (NG_009092.1), PITPNM3 (NG_016020.1), PROMI (NG_011696.1), PRPH2 (NG_009176.1), RIMS1 (NG_() 16209.1), SEMA4A (NG_027683.1), and UNCI 19 (NG_012302.1).

[0278] In one embodiment, the autosomal dominant IRD-related gene is the autosomal dominant congenital stationary night blindness-related gene, including: GNAT1 (NG_009831.1), PDE6B (NG_009839.1), and RHO (NG_009115.1).

[0279] Another type of autosomal dominant IRD-related gene is the autosomal dominant Leber congenital amaurosis-related gene, which may include: CRX(NG_008605.1), (NG_009194.1), and OTX2(NG_008204.1).

[0280] Another example of the autosomal dominant IRD-related gene is autosomal dominant macular degeneration-related gene, which can include: BESTl(NG_009033.1), C1QTNF5 (NG_012235.1), CTNNA1 (NC_000005.10 (138753396 . . . 138935034)), EFEMP1 (NG_009098.1), ELOVL4 (NG_00 108.1), FSCN2 (NG_015964.1), GUCA1B(NG_016216.1), HMCN1 (NG_011841.1), IMPG1 (NG_041812.1), 0TX2 (NG_008204.1), PRDM13 (NC_000006.12 (99606774 . . . 99615578)), PROMI (NG_011696.1), PRPH2 (NG_009176.1), RP1L1 (NGJ128035.1), and T1MP3(NG_OO9117.1).

[0281] In one embodiment, the autosomal dominant IRD-related gene is an autosomal dominant ocular retinal developmental disease-related gene, such as VCAN(NG_012682.1).

[0282] In another embodiment, the autosomal dominant IRD-related gene is an autosomal dominant optic atrophy -related gene, including: MFN2 (NG_007945.1), NR2F1 (NG_034119.1), and OPA1 (NG_01 1605.1).

[0283] In one embodiment, the autosomal dominant IRD-related gene is autosomal dominant syndromic / systemic disease with retinopathy-related gene, including: ABCC6 (NG_007558.2), ATXN7 (NG_008227.1), COL11A1 (NG_008033.1), COL2A1(NG_008072.1), JAG1 (NG_007496.1), KCNJ13 (NG J) 16742.1), KIF11 (NG_032580.1), MFN2 (NG_007945.1), OP A3 (NG_013332.1), PAX2 (NG_008680.2), TREX1 (NG_009820.1), and VC AN (NG_012682.1).

[0284] Another example of the autosomal dominant IRD-related gene is autosomal dominant retinopathy-related gene, including: BEST1 (NG_009033.1), CAPN5 (NG_033002.1), CRB1 (NG_008483.2), FZD4 (NG_011752.1), ITM2B (NG_013069.1), LRP5 (NG_015835.1), MAPKAPK3 (NC_000003.12(50611862 . . . 50649297)), MIR204 (NR 029621.1), OPN1SW (NG_009094.1), RBI (NG_009009.1), TSPAN12 (NG_023203.1), and ZNF408 (NC_000011.10 (46700767 . . . 46705916).

[0285] One type of the autosomal recessive IRD-related gene is congenital stationary night-related gene, including: CABP4(NG_021211.1), GNATl(NG_009831.1), GNB3 (NG_009100.1), GPR179(NG_032655.2), GRKl(NC_000013.11(113667279 . . . 113671659)), GR M6(NG_008105.1), LRIT3(NG_033249.1), RDH5(NG_008606.1), SAG(NG_009116.1), SLC24 Al(NG_031968.2), and TRPM1(NG_O16453.2).

[0286] Another type of the autosomal recessive IRD-related gene is bardet-biedl syndrome-related gene, including: ADIPOR1 (NC_000001.1 (202940825 . . . 202958572, complement)), ARL6 (NG_008119.2), BBIP1 (NG_041778.1), BBS1 (NG_009093.1), BBS2 (NG_009312.1), BBS4 (NG_009416.2). BBS5 (NG_011567.1), BBS7 (NG_009111.1), BBS9 (NG_009306.1), BBS10 (NG_016357.1), BBS12 (NG_021203.1), C8orf37 (NG_032804.1), CEP290 (NG_008417.1), IFT172 (NG_034068.1), IFT27 (NG_034205.1), INPP5E (NG_016126.1), KCNJ13 (NG_016742.1), LZTFL1 (NG_033917.1), MKKS(NG_009109.1), MKS1 (NG_013032.1), NPHP1 (NG_008287.1), SDCCAG8 (NG_027811.1), TRIM32 (NG_011619.1), and TTC8 (NG_008126.1).

[0287] One example of the autosomal recessive IRD-related gene is cone or cone-rod dystrophy-related gene, including, but not limited to, ABCA4(NG_009073.1), ADAMS (NG_016335.1), ATF6 (NG_029773.1), C21orf2 (NG_032952.1), C8orf37 (NG_032804.1), CACNA2D4 (NG_012663.1), CDHR1 (NG_028034.1), CERKL (NG_021178.1), CNGA3 (NG_009097.1), CNGB3 (NG_016980.1), CNNM4 (NG_016608.1), GNAT2(NG_009099.1), KCNV2 (NG_012181.1), PDE6C (NG_016752.1), PDE6H (NG_016859.1), POC1B (NG_041783.1), RAB28 (NG_033891.1), RAX2 (NG_011565.1), RDH5 (NG_008606.1), RPGRIP1 (NG_008933.1), and TTLL5(NG_016974.1).

[0288] Another example of the autosomal recessive IRD-related gene is deafness (alone or syndromic)-related gene including: CDH23(NG_008835.1), CIB2(NG_033006.1), DFNB31 (NG_016700.1), MY07A (NG_009086.1), PCDH15 (NG_009191.2), PDZD7 (NG_028030.1), and USHlC(NG_011883.1).

[0289] In one embodiment, the autosomal recessive IRD-related gene is Leber congenital amaurosis-related gene, including: AIPLl(NG_008474.1), CABP4(NG_021211.1), CEP290 (NG_008417.1), CLUAP1 (NC_000016.10(3500945 . . . 3539048)), CRB1 (NG_008483.2), CRX (NG_008605.1), DTHD1 (NG_032962.1), GDF6 (NG_008981.1), GUCY2D (NG_009092.1), IFT140 (NG_032783.1), IQCB1(NG_015887.1), KCNJ13 (NG_016742.1), LCAS (NG_016011.1), LRAT (NG_009110.1), NMNAT1 (NGJ132954.1), PRPH2 (NG_009176.1), RD3 (NG_013042.1), RDH12 (NG_008321.1), RPE65 (NGJ108472.1), RPGRIP1 (NG_008933.1), SPATA7 (NG_021183.1), and TULP1 (NG_009077.1).

[0290] In another embodiment, the autosomal recessive IRD-related gene is optic atrophy-related gene, including: RTN4IPl(NC_000006.12 (106571028 . . . 106630500, complement)), SLC25A46 (NC_000005.10 (110738136 . . . 110765161)), and TMEM126A(NG_017157.1).

[0291] One example of the autosomal recessive IRD-related gene is retinitis pigmentosa-related gene, including: ABCA4 (NG_009073.1), AGBLS (NC_000002.12 (27051423 . . . 27070622)), ARL6 (NG_008119.2), ARL2BP (NGJ133905.1), BBS1 (NG_009093.1), BBS2 (NG_009312.1), BEST1 (NG_009033.1), C2orf71 (NG_021427.1), C8orf37 (NG_032804.1), CERKL (NG_021178.1), CLRN1 (NG_009168.1), CNGA1(NG_009193.1), CNGB1 (NG_016351.1), CRB1 (NG_008483.2), CYP4V2 (NG_007965.1), DHDDS (NG_029786.1), DHX38 (NG_034207.1), EMC1 (NG_032948.1), EYS (NG_023443.2), EAM161A (NG_028125.1), GPR125 (NC_000004.12 (22387374 . . . 22516058, complement)), HGSNAT(NG_009552.1), IDH3B (NG_012149.1), IFT140 (NG_032783.1), IFT172 (NG_034068.1), IMPG2 (NG_028284.1), KIAA1549 (NG_032965.1), KIZ (NG_033122.1), LRAT (NG_009110.1), MAK (NG_030040.1), MERTK (NG_011607.1), MVK (NG_007702.1), NEK2 (NG_029112.1), NEURODI (NG_011820.1), NR2E3 (NG_009113.2), NRL (NG_ 11697.1), PDE6A (NG_009102.1), PDE6B (NG_009839.1), PDE6G (NG_009834.1), POMGNT1 (NG_009205.2), PRCD (NG_016702.1), PROMI (NG_011696.1), RBP3(NG_029718.1), RGR(NG_009106.1), RHO(NG_009115.1), RLBPl(NG_008116.1), RPl(NG_009840.1), RP1L1(NG_O28O35.1), RPE65(NG J108472.1), S AG(NG_009116.1), SLC7 A 14(NG_034121.1 ), SPATA7(NG_021183.1), TTC8(NG_008126.1), TULPl(NG_009077 0.1), USH2A(NG_009497.1), ZNF408(NC_000011.10 (46700767 . . . 46705916)), and ZNF513 (NG_028219.1).

[0292] Another example of the autosomal recessive IRD-related gene is syndromic / systemic disease with retinopathy-related gene, including: ABCC6(NG_007558.2), ABHD12 (NG_028119.1), ACBDS (NG_032960.2), ADAMTS 18(NG_031879.1), ADIPOR1 (NC_000001.11(202940825 . . . 202958572, complement)), AHIl(NG_008643.1), ALMS1 (NG_011690.1). CC2D2A(NG_013035.1), CEP164(NG_033032.1), CEP290 (NG_008417.1), CLN3(NG_008654.2), COL9A1(NG_011654.1), CSPPl(NG_034100.1), ELOVL4(NG_009108.1), EXOSC2 (NC_000009.12 (130693760 . . . 130704894)), FLVCRl(NG_028131.1), FLVCR1 (NG_028131.1), GNPTG(NG_016985.1), HARS(NG_032158.1), HGSNAT(NG_009552.1), H MXl(NG_013062.2), IFF 140(NG_032783.1), INPP5E(NG_016126.1), INVS(NG_008316.1), IQ CBl(NG_015887.1), LAMA1(NG_O34251.1), LRP5(NG_015835.1), MKS1(NG_O13O32.1), M TTP(NG_011469.1), NPHPl(NG_008287.1), NPHP3(NG_008130.1), NPHP4(NG_011724.2), 0 PA3(NG_013332.1), PANK2(NG_008131.3), PCYT1A(NG_O42817.1), PEXl(NG_008341.1), PEX2(NG_008371.1), PEX7(NG_008462.1), PHYH(NG_012862.1), PLK4(NG_041821.1), PNP LA6(NG_013374.1), POC1B(NG_041783.1), PRPSl(NG_008407.1), RDH11(NG_O42282.1), RPGRIP1L(NG_OO8991.2),SDCCAG8(NG_027811.1), SLC25A46(NC_000005.10(110738136 . . . 110765161)), TMEM237(NG_032049.1), TRNTl(NG_041800.1), TTPA(NG_016123.1),TUB(NG_029912.1), TUBGCP4(NG_042168.1), TUBGCP6(NG_032160.1), WDPCP(NG_028144.1), WDR19(NG_031813.1), WFSl(NG_011700.1), and ZNF423(NG_032972.2).

[0293] One type of the autosomal recessive IRD-related gene is usher syndrome-related gene, including: ABHD12(NG_028119.1), CDH23(NG_008835.1), CEP250 (NC_000020. 11 (35455139 . . . 35517531)), CIB2(NG_033006.1), CLRNl(NG_009168.1),DFNB31(NG_016700.1), GPR98(NG_007083.1), HARS(NG_032158.1),MYG7A(NG_009086.1), PCDII15(NG_00919 1.2), USIIlC(NG_011883.1), USH1G(NG_OO7882.1), and USH2A(NG_009497.1).

[0294] Another type of the autosomal recessive IRD-related gene is retinopathy-related gene, including: BESTl(NG_009033.1), C12orf65(NG_027517.1), CDH3(NG_009096.1), CNGA3NG_009097.1), CNGB3(NG_016980.1), CNNM4(NG_016608.1), CYP4V2(NG_00796 5.1), LRP5(NG_015835.1), MFRP(NG_012235.1), MVK(NG_007702.1), NBAS (NG_032964.1), NR2E3 (NG_009113.2),O AT(NG_008861. 1 ), PLA2G5(NG_032045.1 ), PROM 1 (NG_011696.1 ),RBP4(NG_009104.1), RGS9(NG_013021.1), RGS9BP (NG_016751.1), and RLBP1 (NG_008116.1).

[0295] Yet another type of the autosomal recessive IRD-related gene is macular degeneration-related gene, including: ABCA4(NG_009073.1), CFH(NG_007259.1), DRAM2 (NC_000001.l l (1 11117332 . . . 111140216, complement)), IMPG1(NG_O41812.1), and MFSD8(NG_008657.1).

[0296] In addition to being used for the prevention, correction, or treatment of autosomal dominant and recessive IRDs, the methods described herein can be used to prevent, correct, or treat any X-linked IRDs. Thus, all the methods described here, as applicable to autosomal dominant and recessive IRDs and autosomal dominant and recessive genes or fragments, can be adopted for use in the treatment of X-linked diseases.

[0297] Furthermore, the methods described herein can be used to prevent, correct, or treat IRDs that arise due to the presence of an X-linked mutation. Examples of such IRDs include: X-linked cone or cone-rod dystrophy, X-linked congenital stationary night blindness, X-linkcd macular degeneration, X-linkcd retinitis pigmentosa, X-linked syndromic / systcmicdiseases with retinopathy, X-linked optic atrophy, and X-linked retinopathies. According to the methods described here, the X-linked IRD-related gene is corrected and can, in part or fully, restore the function of a wild-type gene.

[0298] One example of the X-linked IRD-related gene is the cone or cone-rod dystrophy-related gene, including: CACNA1F(NG_OO9O95.2) and RPGR(NG_009553.1).

[0299] Another example of the X-linked IRD-related gene is the congenital stationary night blindness-related gene, including CACNA1F(NG_OO9O95.2) and NYX(NG_009112.1).

[0300] In one embodiment, the X-linked IRD-related gene is a macular degeneration- related gene, such as RPGR(NG_009553.1).

[0301] In another embodiment, the X-linked IRD-related gene is an optic atrophy- related gene, such as TIMM8A(NG_011734.1).

[0302] One type of X-linked IRD-related gene is retinitis pigmentosa-related gene, including: OFD1 (NG_008872.1), RP2 (NG_009107.1), and RPGR (NG_009553.1).

[0303] Another type of X-linked IRD-related gene is syndromic / systemic disease with retinopathy-related gene, including: OFD1(NG_008872.1) and TIMM8A(NG_011734.1).

[0304] Yet another example of an X-linked disease-related gene is retinopathy- related gene, including CACNA1F (NG_009095.2), CHM (NG_009874.2), DMD (NG_012232.1), NDP (NG_009832.1), 0PN1LW (NG_009105.2), OPNIMW(NGJ) 11606.1), PGKl(NG_008862.1), and RS1(NG_OO8659.3).

[0305] Some aspects of the disclosure are based on the recognition that any of the BE RNPs and PE RNPs described herein are capable of modifying a specific nucleotide base without generating a significant proportion of indels. An “indel”, as used herein, refers to the insertion or deletion of a nucleotide base within a nucleic acid. Such insertions or deletions can lead to frame shift mutations within a coding region of a gene. In some embodiments, it is desirable to generate BEs that efficiently modify (e.g., mutate or deaminate) a specific nucleotide within a nucleic acid, without generating a large number of insertions or deletions (i.e., indels) in the nucleic acid. In certain embodiments, any of the BEs described herein are capable of generating a greater proportion of intended modifications e.g., point mutations or deaminations) versus indels. In some embodiments, the BE RNPs and PE RNPs described herein are capable of generating a ratio of intended point mutations to indels that is greater than 1: 1.

[0306] In some embodiments, the BE RNPs and PE RNPs described herein are capable of generating a ratio of intended point mutations to indels that is at least 1.5: 1, at least 2: 1, at least 2.5: 1, at least 3: 1, at least 3.5: 1, at least 4: 1, at least 4.5: 1, at least 5: 1, at least 5.5: 1, at least 6: 1, at least 6.5: 1, at least 7: 1, at least 7.5: 1, at least 8: 1, at least 10: 1, at least 12: 1, at least 15: 1, at least 20: 1, at least 25: 1, at least 30: 1, at least 40: 1, at least 50: 1, at least 100: 1, at least 200: 1, at least 300: 1, at least 400: 1, at least 500: 1, at least 600: 1, at least 700: 1, at least 800: 1, at least 900: 1, or at least 1000: 1, or more. The number of intended mutations and indels may be determined using any suitable method. In some embodiments, to calculate indel frequencies, sequencing reads are scanned for exact matches to two bp sequences that flank both sides of a window in which indels might occur. If no exact matches are located, the read is excluded from analysis. If the length of this indel window exactly matches the reference sequence, the read is classified as not containing an indel. If the indel window is two or more bases longer or shorter than the reference sequence, then the sequencing read is classified as an insertion or deletion, respectively.

[0307] In some embodiments, the BE RNPs and PE RNPs described herein are capable of limiting the formation of indels in a region of a nucleic acid. In some embodiments, the region is at a nucleotide targeted by the BE RNPs and PE RNPs or a region within 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of a nucleotide targeted by the BE RNPs and PE RNPs. In some embodiments, any of the BE RNPs and PE RNPs described herein are capable of limiting the formation of indels at a region of a nucleic acid to less than 1%, less than 1.5%, less than 2%, less than 2.5%, less than 3%, less than 3.5%, less than 4%, less than 4.5%, less than 5%, less than 6%, less than 7%, less than 8%, less than 9%, less than 10%, less than 12%, less than 15%, or less than 20%. The number of indels formed at a nucleic acid region may depend on the amount of time a nucleic acid (e.g., a nucleic acid within the genome of a cell) is exposed to the BE RNPs and PE RNPs. In some embodiments, a number or proportion of indels is determined after at least 1 hour, at least 2 hours, at least 6 hours, at least 12 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 3 days, at least 4 days, at least 5 days, at least 7 days, at least 10 days, or at least 14 days of exposing a nucleic acid (e.g., a nucleic acid within the genome of a cell) to a BE.

[0308] In some embodiments, the BE RNPs and PE RNPs can be selected by measuring the base editing or prime editing efficiency of candidate BE RNPs and PE RNPs in vitro using a cell or population of cells having the point mutation associated with the IRD relatedgene. The cells can be autologous cells from a subject being treated or allogeneic cells that have been genetically modified to integrate the IRD-related gene.

[0309] In some embodiments, mouse embryonic fibroblasts, such as N1H3T3 cells, can be transduced with a vector comprising the IRD-related gene with a nonsense mutation and optionally a reporter molecule. The LNPs encapsulating the BE RNPs and PE RNPs can be delivered to the genetically modified NIH3T3 cells, and the expression of the corrected gene can be measured by, for example, Western blot analysis to determine rescue of gene expression of the IRD-related gene. The correction rate and base editing or prime editing efficiency of the selected BE RNPs and PE RNPs can then be determined using sequencing analysis.

[0310] By way of example, NIH3T3-RPE65 (rdl2) stable cell lines were generated by transduction of NIH3T3 cells with retrovirus obtained from Phoenix-Eco cells transfected with pMXs-RPE65(rr / 72)-IRES-GFP. To make RPE65 expression vectors, an rdl2 mouse RPE65 cDNA sequence, flanked by EcoRI and Noil, was cloned into the multiple cloning site of pMXs-IRES-GFP. The downstream sequence of the internal ribosomal entry site (IRES) and enhanced green fluorescence protein (EGFP) allows co-expression of RPE65 and EGFP, thereby enabling cell sorting by flow cytometry. The NIH3T3-RPE65 (rdl2) cells were seeded on a 24-well plate, and ABE RNP LNPs were delivered to the cells. The LNPs effected rapid delivery of active ABE to the cells and exhibited high conversion efficiency, nearing 100% for the LNPs. ABE RNP LNPs were highly potent, using as little as 20 nM ABE RNP (4.5 pg ml1), eliciting nearly total conversion of the reporter cells.

[0311] It will be appreciated that the cells used for in vitro selection or screening of BE RNPs and PE RNPs need not be limited to mouse embryonic fibroblasts and that other cells, such as fibroblasts obtained from the subject or induced pluripotent cells, can be used to select and screen BE RNPs and PE RNPs having the desired correction rate and base editing or prime editing efficiency. For example, fibroblasts from a subject to be treated can be isolated and optionally transformed into iPS cells. The isolated fibroblast and / or iPS can be delivered with LNPs with the selected BE RNPs and PE RNPs to determine the correction rate and base efficiency.

[0312] In some embodiments, the determined correction rate and base editing efficiency of the selected BE and gRNA can be compared to a control correction rate to select BEs and gRNA for use in treating a subject.

[0313] In some embodiments, the selected BE RNPs and PE RNPs identified using in vitro cell assays described herein can increase the expression of a visual cycle protein, such as RPE65, and an amount effective to enhance vision and / or restore normal vision. In certain embodiments of any of the foregoing methods, the selected BE RNPs and PE RNPs can increase the expression of a visual cycle protein (e.g., RPE65) associated with a nonsense or missense mutation of an IRD (e.g., LCA). For example, in certain embodiments, a cell contains about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90% of the gene product relative to a cell without the missense or nonsense mutation. In certain embodiments, the cell contains from about 5% to about 80%, about 5% to about 60%, about 5% to about 40%, about 5% to about 20%, about 5% to about 10%, about 10% to about 80%, about 10% to about 60%, about 10% to about 40%, about 10% to about 20%, about 20% to about 80%, about 20% to about 60%, about 20% to about 40%, about 40% to about 80%, about 40% to about 60%, or about 60% to about 80% of the gene product relative to a cell without the missense or nonsense mutation. In certain embodiments, there is no detectable gene product in the cell. Gene product amount or expression may be measured by any method known in the art, for example, Western blot or ELISA.

[0314] In certain embodiments, wherein the gene is a IRD related gene (e.g., RPE65 gene) with a nonsense mutation (e.g., C130T) that encodes visual cycle protein, the BEs described herein can be selected to increases the visual cycle protein (e.g., RPE65) expression in a cell by at least about 4%, about 5%, about 6%, about 7 %, about 8%, about 9%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 110%, about 120%, about 130%, about 140%, about 150%, about 160%, about 170%, about 180%, about 190%, about 200%, about 250%, about 300%, about 350%, about 400%, about 450%, about 500%, about 600%, about 700%, about 800%, about 900%, or about 1000% relative to a cell, tissue, or subject without the nonsense mutation.

[0315] In certain embodiments, the BE RNPs and PE RNPs can be selected that increase visual cycle protein (e.g., RPE65) expression in a cell from about 20% to about 200%, about 20% to about 180%, about 20% to about 160%, about 20% to about 140%, about 20% to about 120%, about 20% to about 100%, about 20% to about 80%, about 20% to about 60%, about 20% to about 40%, about 40% to about 200%, about 40% to about 180%,about 40% to about 160%, about 40% to about 140%, about 40% to about 120%, about 40% to about 100%, about 40% to about 80%, about 40% to about 60%, about 60% to about 200%, about 60% to about 180%, about 60% to about 160%, about 60% to about 140%, about 60% to about 120%, about 60% to about 100%, about 60% to about 80%, about 80% to about 200%, about 80% to about 180%, about 80% to about 160%, about 80% to about 140%, about 80% to about 120%, about 80% to about 100%, about 100% to about 200%, about 100% to about 180%, about 100% to about 160%, about 100% to about 140%, about 100% to about 120%, about 120% to about 200%, about 120% to about 180%, about 120% to about 160%, about 120% to about 140%, about 140% to about 200%, about 140% to about 180%, about 140% to about 160%, about 160% to about 200%, about 160% to about 180%, or about 180% to about 200% relative to a cell, tissue, or subject with the RPE65 mutation.

[0316] In other embodiments, the selected BE RNPs and PE RNPs identified using in vitro cell assays described herein can increase the expression of a visual cycle protein, such as RPE65, at an amount effective to enhance vision and / or restore normal vision. In certain embodiments of any of the foregoing methods, the selected BE RNPs and PE RNPs can increase the expression of a visual cycle protein (e.g., RPE65) associated with a nonsense or missense mutation of an IRD (e.g., LCA) in the retina or retinal pigment epithelium of the subject. For example, in certain embodiments, a retina cell or retinal pigment epithelium cell of the subject expresses about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90% of the gene product relative to a cell without the missense or nonsense mutation. In certain embodiments, the retina cell or retinal pigment epithelium cell expresses from about 5% to about 80%, about 5% to about 60%, about 5% to about 40%, about 5% to about 20%, about 5% to about 10%, about 10% to about 80%, about 10% to about 60%, about 10% to about 40%, about 10% to about 20%, about 20% to about 80%, about 20% to about 60%, about 20% to about 40%, about 40% to about 80%, about 40% to about 60%, or about 60% to about 80% of the gene product relative to a cell without the missense or nonsense mutation. In certain embodiments, there is no detectable gene product in the retina cell or retinal pigment epithelium cell. Gene product amount or expression may be measured by any method known in the art, for example, Western blot or ELISA.

[0317] In certain embodiments, where the gene is a RPE65 gene with a nonsense mutation (e.g., C130T), the selected BE RNPs and PE RNPs described herein can increaseRPE65 expression in a retina cell or retinal pigment epithelium cell by at least about 4%, about 5%, about 6%, about 7 %, about 8%, about 9%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 110%, about 120%, about 130%, about 140%, about 150%, about 160%, about 170%, about180%, about 190%, about 200%, about 250%, about 300%, about 350%, about 400%, about450%, about 500%, about 600%, about 700%, about 800%, about 900%, or about 1000% relative to a retina cell or retinal pigment epithelium cell without the nonsense mutation.

[0318] In certain embodiments, the method increases RPE65 expression in a retina cell or retinal pigment epithelium cell by from about 20% to about 200%, about 20% to about 180%, about 20% to about 160%, about 20% to about 140%, about 20% to about 120%, about 20% to about 100%, about 20% to about 80%, about 20% to about 60%, about 20% to about 40%, about 40% to about 200%, about 40% to about 180%, about 40% to about 160%, about 40% to about 140%, about 40% to about 120%, about 40% to about 100%, about 40% to about 80%, about 40% to about 60%, about 60% to about 200%, about 60% to about 180%, about 60% to about 160%, about 60% to about 140%, about 60% to about 120%, about 60% to about 100%, about 60% to about 80%, about 80% to about 200%, about 80% to about 180%, about 80% to about 160%, about 80% to about 140%, about 80% to about 120%, about 80% to about 100%, about 100% to about 200%, about 100% to about 180%, about 100% to about 160%, about 100% to about 140%, about 100% to about 120%, about 120% to about 200%, about 120% to about 180%, about 120% to about 160%, about 120% to about 140%, about 140% to about 200%, about 140% to about 180%, about 140% to about 160%, about 160% to about 200%, about 160% to about 180%, or about 180% to about 200% relative to a retina cell or retinal pigment epithelium cell with the RPE65 mutation.

[0319] Further, the example below shows the feasibility and efficacy of LNPs encapsulating RNPs as a safer genome base editing and prime editing approach for treating a wide range of inherited retinal diseases (IRDs) caused by different mutations, rather than a therapy for this single mutation. The significance lies in the fact that in vivo base editing and prime editing in the eye showed a remarkable rescue of visual function and correction of the pathogenic mutation with minimal off-target effects. Such a level of vision restoration has not been achieved by any other pharmacological or genome-editing approach. Given that gene transfer via subretinal injection is already performed in the clinical setting, personalized gene therapy based on LNP-cncapsulatcd BE RNP and PE RNP delivery can be a newtreatment paradigm for a wide range of inherited retinal diseases. This also provides a potential framework for optimizing base editing or prime editing gene therapy for any possible mutation by screening for an effective BE or PE and gRNA using an in vitro cell line with the same genetic background and translating it into a therapeutic viral delivery platform. As such, base editing and prime editing outcomes may be tailored to the unique needs of a patient.

[0320] It will be appreciated that the methods and compositions described herein can be used alone or in combination with other therapeutic agents and / or modalities. The term administered “in combination,” as used herein, is understood to mean that two (or more) different treatments are delivered to the subject during the course of the subject’s affliction with the disorder, such that the effects of the treatments on the patient overlap at a point in time. In certain embodiments, the delivery of one treatment is still occurring when the delivery of the second begins, so that there is overlap in terms of administration. This is sometimes referred to herein as “simultaneous” or “concurrent delivery.” In other embodiments, the delivery of one treatment ends before the delivery of the other treatment begins. In certain embodiments of either case, the treatment is more effective because of combined administration. For example, the second treatment is more effective, e.g., an equivalent effect is seen with less of the second treatment, or the second treatment reduces symptoms to a greater extent than would be seen if the second treatment were administered in the absence of the first treatment, or the analogous situation is seen with the first treatment. In certain embodiments, delivery is such that the reduction in a symptom, or other parameter related to the disorder, is greater than what would be observed with one treatment delivered in the absence of the other. The effect of the two treatments can be partially additive, wholly additive, or greater than additive. The delivery can be such that the effect of the first treatment delivered is still detectable when the second is delivered.

[0321] The function and advantage of these and other embodiments described herein will be more fully understood from the Example below. The following Example is intended to illustrate the benefits of the present invention and to describe particular embodiments, but is not intended to exemplify the full scope of the invention. Accordingly, it will be understood that the Example is not meant to limit the scope of the invention.Example

[0322] This Example describes the restoration of visual function in a mouse model of inherited retinal degeneration using purified adenine base editor (ABE) and prime editor (PE) ribonucleoproteins (RNPs) encapsulated in lipid nanoparticles (LNPs). This success opens the way to create chemically defined and protected delivery technologies for CRISPR / Cas9- mediated genome editing.MethodsAnimals

[0323] Pigmented Gt(ROSA)26Sortm4(ACTB-tdTomato’EGFP)Luo(ROSAmT / mG) mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA, JAX 007676) and crossed with BALB / cJ albino mice (JAX 000651) to establish an albino ROSAmT / mGline, referred to as mT / mG mice. The C57BL / 6J (”WT", JAX 000664) and rdl2 (JAX 005379) mouse lines were purchased from the Jackson Laboratory and housed in the vivarium at the University of California, Irvine, where they were maintained on a normal mouse chow diet and a 12 h / 12 h light / dark cycle. All animal procedures were approved by the Institutional Animal Care and Use Committee of the University of California, Irvine, and were conducted in accordance with the NIH guidelines for the care and use of laboratory animals, and with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Visual Research.Molecular cloning

[0324] The N-terminal Cre recombinase fusion proteins were produced from recombinant plasmids based on pTAT-Cre. p TAT-Cre was purchased from Addgene (#35619), and pCPP5-Cre and pN-Cre inserts were synthesized and cloned by GeneWiz (South Plainfield, NJ, USA) and clone into pET-28b. The antennapedia (ANTP) DNA sequence was generated by single-strand oligo annealing, using ANTP-Or_F and ANTP- Or_R primers. (Table 1). The two oligonucleotides were mixed in a 1 : 1 molar ratio at a total DNA concentration of 80 pM in 50 mM Tris-HCl, pH 7.4, 62.5 mM NaCl, and 10 mM ethylenediaminetetraacetic acid (EDTA). The annealing was done in a thermocycler with an initial heating step of 2 min at 95 °C, and gradual cooling for 45 min to 25 °C. The pANTP- Cre plasmid was obtained by replacing the TAT sequence with ANTP between the Ncol and Ndel cloning sites. The plasmids were propagated in Escherichia coli NEB 5-alpha cells (New England Biolabs, Ipswich, MA, USA, C2987H). To produce a positive control CreeVLP, Cre (Addgene, 123133) was subcloned into pCMV-MMLVgag-3xNES-ABE7.10-NG (Addgene, 181753) via USER cloning, and eVLPs were prepared.

[0325] Genes encoding ABE7.10, ABE8e, and PE2 constructs were subcloned into pRha rhamnose-inducible expression vectors via USER cloning (NEB). The 1D4 peptide with a preceding tobacco etch virus (TEV) protease recognition site was introduced by PCR site-directed mutagenesis and KLD cloning (NEB #M0554S). Sequences encoding cell penetrating peptides were introduced into ABE using PAGE-purified single-strand oligonucleotides (Sigma-Aldrich, Burlington, MA, USA). The oligonucleotides were annealed at a final concentration of 25 pM in 10 mM Tris-HCl pH 8.0, 50 mM NaCl, 1 mM EDTA, 5 mM MgCh by heating at 95 °C for 5 min and slow cooling in a thermocycler. Assembled duplexes were ligated at a 100-fold excess into the protein expression vectors linearized with FastDigest Ndel (Thermo Fisher, Waltham, MA, USA, FD0584). The ligation mixtures were transformed into NEB5a cells and plated onto LB-agar plates with 25 pg ml1kanamycin. Candidate clones were identified using colony PCR and confirmed by Sanger sequencing (GeneWiz).Expression and purification of Cre recombinase

[0326] The plasmids were transformed into Escherichia coli BL21star (DE3) (Thermo Fisher Scientific, C601003), and the selected clones were grown in Terrific Broth (TB, Thermo Fisher Scientific, 22711-022) with 50 pg ml1kanamycin (Goldbio, St. Louis, MO, USA, K-120-SL25), overnight at 37°C with mixing at 190 rpm. The production cultures were inoculated with overnight cultures and incubated at 37°C with mixing at 190 rpm. After Aeoonm reached 0.5, protein expression was induced with 0.5 mM isopropyl P-D-l- thiogalactopyranoside (IPTG, Goldbio, 12481C25) and incubation was continued at 20°C for 16 h. The cells were harvested by centrifugation at 7,000g at 4°C for 10 min, and the pellets were stored at -80°C until used further for protein purification.

[0327] Cre recombinase was kept on ice or refrigerated at 4-8°C throughout the purification procedure. The cell pellet from a 1.5-liter culture was thawed in a roomtemperature water bath, resuspended in the Cre-lysis buffer (50 mM Na phosphate pH 7.4, 1 M NaCl, 1 cOmplete EDTA-free protease inhibitor cocktail tablet (MilliporeSigma, St. Louis, MO, USA, COEDTAF-RO) per 50 ml buffer) and lysed by sonication (125-W pulses (5 sec on / 5 sec off) for 10 min total); or French press (3 passes at up to 15,000 psi). The lysate was centrifuged at 48,500g for 15 min and incubated with 1 ml of a suspension of Ni-Sepharose High Performance beads (Cytiva, Uppsala, Sweden, 17526801) in a rotating mixer for 1 h. The resin was centrifuged at 500g for 5 min, washed with 40 ml of the Cre-wash buffer (25 mM Na phosphate pH 7.4, 500 mM NaCl), centrifuged again, packed in a Tricorn 5 / 50 column and connected to a Bio-Rad DuoFlow system (Bio-Rad, Hercules, CA, USA) and perfused at 0.5 ml min1. The resin was washed with 20 ml of the Cre-wash buffer or until a stable absorbance baseline was observed; then, the proteins were eluted with 30 ml of a continuous gradient of the Cre-elution buffer (25 mM Na phosphate, pH 7.4, containing 500 mM NaCl, 500 mM imidazole). The fractions containing Cre recombinase that were identified by SDS-PAGE and CBB staining (Quick Coomassie stain, Anatrace, Maumee, OH, USA, GEN-QC-STAIN-1L) were concentrated and subjected to size-exclusion chromatography on a Superdex 200 Increase 10 / 300 GL column (Cytiva, 28990944), or a HiLoad 16 / 600 Superdex 200 pg column (28989335), with P500G buffer (sodium phosphate 20 mM pH 7.4, NaCl 500 mM, glycerol 20% (v / v)) as the mobile phase. Fractions containing pure Cre recombinase were concentrated, snap frozen in liquid nitrogen, and stored at -80°C.Expression and purification of ABE and PE

[0328] E. coh BL21star (DE3) cells (Thermo Fisher Scientific, C6 1003) were transformed with the expression plasmids and grown overnight on Luria-Bertani (LB)-agar plates with 25 pg ml1kanamycin; single clones were used to inoculate starter cultures in TB with kanamycin, and grown overnight. One and a half liter of TB with kanamycin was inoculated with 10 ml of starter culture, and the cells were grown at 37°C with mixing at 190 rpm until they reached an Aeoonm of 1.5. Then, the cultures were cooled in an ice- water slurry for 30 min - 1 h, and protein expression was induced with 0.8% (w / v) rhamnose (Goldbio, R- 105-250). The proteins were expressed at 17°C with mixing at 190 rpm for 16-24 h. The cells were harvested by centrifugation at 5,000g, 10 min, 4°C, and the pellets were stored at - 80°C.

[0329] All protein purification steps were conducted in a cold room (~4-8°C), or on ice. The thawed cells from a 1.5 -liter culture were homogenized with a 40 ml Bounce homogenizer in a lysis buffer (100 mM Bis-Tris Propane, pH 8.0, 1 M NaCl, 20% glycerol (v / v), 5 mM tris(2-carboxyethyl)phosphine (TCEP), 1 cOmplete Ultra EDTA-Free protease inhibitor tablet per 40 ml of the buffer), and lysed by sonication with a Qsonica Q125 sonicator (125 W) with a 1 / 8-inch microtip at 100% amplitude for a total of 20 min (intermittent pulses: 5 sec on; 5 sec off). The lysate was clarified two times at 4°C bycentrifugation at 48,500g for 10 min. ABE was captured on a 3-ml TALON metal- affinity resin (Takara Bio, San Jose, CA, USA, 635502). The resin was then washed with 100 ml of the lysis buffer without inhibitors, and with 10 ml of the wash buffer (100 mM Bis-Tris Propane, pH 8.0, 500 mM NaCl, 20% glycerol (v / v), 1 mM TCEP). The proteins were eluted with the wash buffer supplemented with 150 mM imidazole.

[0330] In a second step, ABE was purified by immunoaffinity chromatography using a 1D4 resin (Sepharose CL-4B resin (Cytiva, 17043001), with immobilized 5-10 mg ml11D4 antibody purified in house). The 1D4 resin (4 ml) was packed in a DWK Life Sciences Kimble™ Kontes™ FlexColumn™. The column was equilibrated with the wash buffer (described above). ABE was loaded by gravity flow. The column was washed with at least 40 ml of the wash buffer at 0.5 ml min1, and then ABE was eluted with 1 mg ml"11D4 peptide in the wash buffer at approximately 1 ml h"1. Fractions containing ABE were pooled, concentrated, and further purified to remove contaminating nucleic acids and aggregates, by size exclusion chromatography on a Superdex 200 Increase 10 / 300 GL column, or a Superdex 200 16 / 60 Prep Grade column. The protein was eluted with the ABE storage buffer (4-(2-Hydroxyethyl)-l -piperazine ethanesulfonic acid (HEPES) 10 mM, pH 7.0, 500 mM NaCl, 20% glycerol). The fractions containing pure ABE were concentrated using Amicon Ultra centrifugal filters with 30-kDa molecular weight cut-off membranes (Merck, UFC903024), sterilized by passage through 0.22-pm filters, quantified using UV absorption at 280 nm, divided into aliquots, and snap frozen in a chilled metal block for storage at - 80°C.

[0331] PE was purified using a similar procedure as for ABE. Cells expressing PE were lysed using a single pass through the French press and subsequent sonication for 10 min. Metal affinity and immunoaffinity steps were identical as for ABE, except the wash buffer contained 400 mM NaCl. After immunoaffinity chromatography, PE was subjected to heparin-affinity chromatography (HiTrap Heparin HP 5 ml, Cytiva, 17040703) at 0.5 ml min"x. The heparin column was equilibrated with the wash buffer containing 400 mM NaCl. After PE was loaded, the column was washed with at least 50 ml of the wash buffer until the UV baseline was stable, and then bound proteins were eluted with a 200 ml NaCl gradient (0.4 M - 1.0 M). Purest fractions were selected for size exclusion chromatography on a Superdex 200 16 / 60 Prep Grade column, with PE-storage buffer (HEPES 10 mM pH 7.0, NaCl 500 mM, glycerol 5% (v / v)) as the eluent. Pure PE was concentrated, filtered,quantified using UV absorption at 280 nm, distributed into aliquots, and snap frozen for storage at -80°C.

[0332] The protein purity was assessed using SDS-PAGE in hand-cast Tris-glycine- SDS discontinuous gels with 4% acrylamide in a stacking gel (pH 6.8) and 10% acrylamide in a resolving gel (pH 8.8) with 2.7% cross-linker (acrylamide:bis-acrylamide ratio of 37.5:1, Bio-Rad 1610158). The samples were mixed with 4x-concentrated Laemmli sample buffer (Bio-Rad 1610747) and supplemented with 50 mM dithiothreitol (DTT, MilliporeSigma D9779), denatured at 70°C for 10 min and centrifuged before applying on gel. The protein concentration was quantified using UV absorption spectroscopy by measuring absorbance at 280 nm with a Nanodrop ND- 1000 spectrophotometer. Separation of contaminating nucleic acids was followed by monitoring the ratio of absorbance at 260 nm to absorbance at 280 nm; a ratio < 0.60 was used as an indication of protein free from nucleic acids. A typical A260 nm / A280nm value for purified ABE and PE was 0.55. Extinction coefficients of the constructs were estimated using the ProtParam tool (https: / / web.expasy.org / protparam / ).ABE and PE activity assay

[0333] Synthetic 60 bp-long DNA oligonucleotides (Sigma) labeled with fluorescein on the strand undergoing deamination were annealed, in a 1 :1 ratio in 10 mM Tris pH 8.0, 50 mM NaCl, 1 mM EDTA, by incubation at 95 °C for 5 min, and subsequent slow cooling to 20°C. End-modified sgRNA and epegRNA were ordered from IDT Technologies (Coralville, IA, USA) with 2'-O-methyl groups on the first three and last three nucleotides, and the first and last three phosphodiester bonds were replaced with phosphorothioate bonds. The guide RNAs were dissolved in nuclease-free water at 37°C, 15 min, 500 rpm in a thermomixer, and folded by incubation at approximately 75 °C for 5 min, followed by slow cooling. Prepared nucleic acids were quantified using UV absorption spectroscopy by measuring absorbance at 260 nm. Accordingly, an A260nm value of 1.0 corresponded to a DNA concentration of 50 pg / ml, or an RNA concentration of 40 pg / ml. DNA was stored at - 20°C, RNA at -80°C.

[0334] For the ABE enzymatic assay, ABE ribonucleoprotein was assembled by incubation with 1.5-fold molar excess of sgRNA in a reaction buffer (20 mM Bis-Tris Propane, pH 7.5, 100 mM KC1, 2.5 mM MgSCE, 2 mM DTT, 5% glycerol (v / v)) for 15 min at room temperature. Additional 10% (w / v) sucrose was used when RNPs were assembled above 4 p M. Then, ABE was diluted to 1 p M with the reaction buffer, preheated at 37°C,and 15 ng of DNA substrate (0.02 pM final) was added. The deamination was conducted for 10 - 60 min for ABE8e. The 20- l reactions were quenched by addition of 30 pl of water preheated to 95°C and incubated for 2 min at 95°C. After cooling, the mixtures were treated with 1 pl of RNase A (20 mg / ml) and 1 pl of proteinase K (20 mg / ml) for 15 min at room temperature; then DNA products were purified using an Oligo Clean & Concentrator kit (Zymo Research, Irvine, CA, USA, D4061). Purified DNA was nicked with 5 units of Endonuclease V (EndoV, NEB) for 2-3 h at 37°C, after which the reaction was quenched by addition of TriTrack DNA-loading dye (lx final) (Thermo Fisher Scientific, R1161) and incubation at 95°C for 2 min. The cleavage products were analyzed by denaturing polyacrylamide gel electrophoresis with urea (Urea-PAGE) in Bio-Rad MiniProtean continuous hand-cast 15% acrylamide gels in Tris-borate-EDTA (TBE, Bio-Rad 1610770) with 7 M urea and 5% crosslinker (acrylamide:bis-acrylamide ratio of 19:1, Bio-Rad 1610144). The voltage was controlled to maintain at least 42°C in the electrophoresis chamber. Imaging was done using the ChemiDoc MP system (Bio-Rad). For fluorescein, it was done immediately after electrophoresis, and for the SYBR Gold (Thermo Fisher SI 1494) - after 30 min staining with lx dye in IxTBE.

[0335] For the in vitro reverse-transcriptase elongation assay of PE, the activity assay was earned out in the same reaction buffer as for ABE, supplemented with 0.5 mM deoxyribonucleotides (dNTP). PE2 RNP was assembled with 1.1 -fold molar excess epegRNA, targeting the rd 12 locus in the reaction buffer without added sucrose for 15 min at room temperature. Then, reactions were preheated at 37°C, and 45 ng of fluorescein-labeled substrate was added to a final volume of 15 pl. After 15 min, the reactions were quenched with 1 pl each of proteinase K (20 mg mF1) and RNase A (20 mg mF1), denatured at 95 °C for 2 min, supplemented with 6xTriTrack loading dye, and 15 ng of substrate was analyzed by Urea-PAGE, as for ABE.Differential scanning fluorimetry

[0336] ABE and PE proteins were complexed with 1.5-fold molar excess of guide RNA in phosphate-buffered saline (PBS) at room temperature for 15 min to obtain 10 pM RNP. ABE RNP contained an additional 10% (w / v) sucrose. Subsequently, the RNPs were diluted with PBS to 1 pM, SYPRO Orange probe was added to a final concentration of 5x, the samples were aliquoted (10 pl per well) into a 384-well plate (Applied Biosystems, 4483319), and the plate was sealed with optical foil (Applied Biosystems, 4360954). Afteran additional 15 min incubation, the plate was centrifuged at 1 ,000g for 1 min at room temperature, and was installed in a pre-equilibrated Bio-Rad CFX384 thermocycler. The fluorescence was measured in Forster resonance energy transfer (FRE ) mode every 0.2°C from 20°C to 95°C. The rate of change of fluorescence (-dF / dT) was used to estimate the melting temperature (Tm). All samples were run in triplicate, and plots of averaged data are reported.Mammalian cell culture

[0337] HEK293-loxP-GFP-RFP cells (referred to as “CS cell line” GenTarget Inc., San Diego, CA, USA, SC018-Bsd), NIH / 3T3 rdl2 cells,41and rdl2 reporter cells were maintained in DMEM / F-12 medium with GlutaMAX supplement (Thermo Fisher, Waltham, MA, USA, 10565018) or in DMEM with glutamine (Thermo Fisher, 11965092), both supplemented with 10% FBS (Genesee Scientific, San Diego, CA, USA, 25-514H) and optional 100 U ml1penicillin-streptomycin (Thermo Fisher, 15140122) (complete medium) in a humidified incubator at 37°C, 5% CO2.

[0338] Primary fibroblasts were isolated from the skin of P0-P3 Rosa mT / mG mice. The mice were euthanized, the skin separated and washed with PBS containing 100 U ml1penicillin-streptomycin and 40 pg mF1gentamicin (Thermo Fisher 15710072). The skins were digested in a 100 mm cell culture dish by 1 : 1 mixture of 0.25% trypsin without EDTA (Thermo Fisher, 15050065) and 5 U ml1dispase (STEMCELL Technologies, Cambridge, MA, USA, 07913) for 1 h at 37°C, after which the dermis was collected to a new dish and digested with 0.25% collagenase I (Thermo Fisher, 17018029) in serum-free DMEM / F12 for 1 h at 37°C. The tissue fragments were thoroughly resuspended, filtered through a 70-um strainer, and extensively washed with DMEM / F12 with 15% FBS and 100 U ml1penicillin- streptomycin by two centrifugation steps at 180g, 5 min, room temperature. The cells were maintained in DMEM / F12 with 15% FBS and passaged every 3-4 days, using 0.05% trypsin- EDTA (Thermo Fisher Scientific, 25300054). After the first passage, the cells were filtered through a 40-prn strainer to remove undigested aggregates that permeated through the 70-pm strainer. Both freshly isolated and cryopreserved cells that were passaged at least twice were used for the experiments. For Cre delivery, medium with 10% FBS was used, and the procedure was the same as for the CS cell line. For protein delivery experiments, the cells were seeded 24 h prior to the experiment in 24-, 48- and 96-well plates to reach 50-70% confluency (approximately 100,000, 50,000 and 25,000 cells per well, respectively, for CScell line and NIH / 3T3 rdl2 cells, and 50,000, 24,000 and 10,000 cells per well, respectively, for rd 12 reporter cells and primary fibroblasts).Delivery of Cre recombinase

[0339] The CS cells and primary Rosa mT / mG fibroblasts were plated on 48-well treated tissue-culture plates in complete medium with 10% FBS. Cre recombinase, fused separately with each of the cell -penetrating peptides (CPFs: CPP5 (KLPVM), TAT (RKKRRQRRR), or ANTP (RQIKIWFQNRRMKWKK) was prepared at various final concentrations (0.10, 0.25, 0.50, 0.75 or 1.00 pM, 4.2, 10.5, 21.0, 31.4 or 41.9 pg ml1, respectively) in 250 pl each of OptiMEM medium (Thermo Fisher, 31985070). Only the 0.5 pM Cre proteins were tested in the primary fibroblasts. For non-covalent complexation with 6xHis-CM18-PTD4 peptide (Genscript), an aliquot of the non-covalent peptide was added to Cre recombinase (free or fused with one of the CPPs) and incubated for 15 min at room temperature. The reporter cells were washed with 180 pl of OptiMEM medium, which was then exchanged with OptiMEM plus one of the various preparations of Cre recombinase. After 3 h, the medium was exchanged with complete medium. The CS cells and Rosa mT / mG fibroblast cells were maintained post treatment for a total of 24 h and 72 h, respectively. For imaging, the medium was exchanged to FluoroBrite DMEM (Thermo Fisher, A1896701), and the cells were imaged using a Keyence BZ-X810 microscope with GFP and Texas Red optical filters.Flow cytometry

[0340] Cells were washed with PBS (Thermo Fisher, 10010023), detached with 0.05% trypsin (Thermo Fisher Scientific, 25300054), transferred to a 96-well round bottom plate, and centrifuged at 180# for 5 min at room temperature. Centrifuged cells were washed with a FACS buffer (PBS with 2% FBS, 100 U ml1penicillin-streptomycin), centrifuged again and resuspended in the FACS buffer with 1 pg ml14',6-diamidino-2-phenylindole (DAPI, Thermo Fisher, 62248). The cells were analyzed using a Novocyte Quanteon (Agilent) flow cytometer with Pacific Blue (445 / 45 nm), FITC (530 / 30 nm), and PE (586 / 20 nm) optical filters. Cells were gated on forward and side scatter, viability via DAPI exclusion, and single cells (Fig. 19).Subretinal injections

[0341] Cre proteins with or without fused cell-penetrating peptides were diluted in OptiMEM to 10 pM. 6xHis-CM18-PTD4 peptide was optionally added to Cre in ten- fold excess and incubated for at least 15 min before injection. A lipoplex of Cre with Lipofectamine 3000 was injected at 10 pM, with 2% Lipofectamine 3000 by volume (419 ng Cre per eye, 0.02 pl Lipofectamine 3000 per eye). AAV2 / 1-Cre (Addgene, 105537-AAV1, 1.8 x 1010vg) or vesicular stomatitis virus G glycoprotein (VSV-G) pseudotyped eVLP-Cre (concentrated by ultracentrifugation 1,000- fold as described) were injected as a positive control for mT / mG mice. Mice were anesthetized by intraperitoneal injection of a cocktail consisting of 20 mg ml1ketamine and 1 .60 mg ml1xylazine in PBS at a dose of 100 mg kg1of ketamine and 8 mg kg1of xylazine, and their pupils were dilated by topical administration of 1% tropicamide ophthalmic solution (Akorn, 17478-102-12) and 10% phenylephrine ophthalmic solution (MWI Animal Health, 054243). The corneas were hydrated with GenTeal Severe Lubricant Eye Gel (0.3% Hypromellose, Alcon). Subretinal injections were performed using an ophthalmic surgical microscope (Zeiss). An incision was made through the cornea adjacent to the limbus at the nasal side, using a 27-gauge needle. A 34-gauge blunt-end needle (World Precision Instruments, NF34BL-2), connected to an RPE-KIT (World Precision Instruments RPE-KIT) with SilFlex tubing (World Precision Instruments; SILFLEX-2), was inserted through the comeal incision while avoiding the lens and advanced into the subretinal space. Each mouse received a 1 pl injection per eye, and volume and rate were controlled with a UMP3 UltraMicroPump (World Precision Instruments, UMP3-4). After surgery, the mice were placed on a heating pad and anesthesia was reversed with intraperitoneal atipamezole (2.5 mg kg1, MWI Animal Health #032800). Triple antibiotic ophthalmic ointment (neomycin, polymyxin, and bacitracin) was administered to the cornea to promote recovery.Two-photon imaging of mouse eyes

[0342] After sacrifice, intact enucleated mouse eyes were submerged in room temperature PBS. Pulsing IR light from a Ti:sapphire laser (Coherent, Vision S, Santa Clara, CA; tunable between 690 and 1050 nm) was set to 950 nm and attenuated in a controlled, variable manner with an electro-optic modulator (EOM). To image and spectrally separate GFP and tdTomato, two internal spectral detectors were used with their detection bandwidths set to 490 - 545 nm for GFP, and 590 - 680 nm for tdTomato. A 1.0 NA 20x Leica objective was used for the imaging.Generation of the rd! 2 reporter cell line

[0343] The rd!2 reporter construct was synthesized by GenScript according to the following strategy: 198 bp of the mouse Rpe65 cDNA was flanked by 5’-mChcrry and 3’- eGFP, and the whole construct was inserted into the pcDNA3.1 / (Zeo)+ backbone with BamHI and Xhol restriction sites (mCherry-r<772-eGFP). The mCherry-r<772-eGFP construct was then subcloned into pMXs-IRES-Blasticidin via double digestion of the backbone with BamHI and Xhol. The downstream sequence of the internal ribosomal entry site (IRES) and blasticidin-resistance gene enabled co-expression of the reporter and selectable marker. The rd] 2 reporter cell line was generated by transduction of NIH / 3T3 cells with retrovirus obtained from Phoenix-Eco cells, transfected with pMXs-mCherry-rr / 72-eGFP-IRES- Blasticidin according to a previously published protocol. Transduced cells were then selected with blasticidin for 10 days (5 pg ml1Thermo Scientific # R25001). The surviving cells were sorted using flow cytometry to select high-expressing mCherry -positive clones and then seeded into 96-well plates for clonal selection. Single colonies were screened for proper expression and editability via Gene Juice (Millipore Sigma #70967-3) co-transfection of pCMV-NG-SpCas9-ABE7.10max and pSPgRNA-n7 / 2-A6, and via proper co-expression of mCherry and eGFP. Finally, the clones were sequenced. No additional characterization was performed on the sorted cells.Delivery of ABE and PE in vitro

[0344] ABE RNP was assembled by incubation of up to 20 pM ABE for at least 15 min at room temperature with 1. 1 -fold excess of sgRNA in OptiMEM medium supplemented with 10% (w / v) sucrose. The sgRNA used for experiments in cell lines and in vivo contained additional modifications as described, rdl2-A6-sgRNA highly modified), and was supplied by IDT. 6xHis-CM18-PTD4 peptide was dissolved in 100 mM HEPES, pH 8.0 to achieve a peptide concentration of 10 mM; the final pH of this stock solution was approximately 7.0. 6xHis-CM18-PTD4 peptide was diluted to 400 pM with water, added to ABE RNP, and incubated for an additional 1 min. CPP fusions of ABE with or without 6xHis-CM18-PTD4 peptide were diluted to their final concentrations in OptiMEM, containing 2% sucrose or 10% sucrose; and 100 pl of each of the mixtures was applied on the cells in a 48- well plate that had been washed with OptiMEM medium. After 3 h, the medium was exchanged with 250 pl of complete medium.

[0345] To assemble Lipofectamine 3000 lipoplexes, 0.5 pl of Lipofectamine 3000 per well of a 48-well plate or 0.2 pl per well of a 96-well plate was diluted with OptiMEM containing 10% (w / v) sucrose to 12.5 and 5 pl per well, respectively; the ABE RNPs diluted with OptiMEM with 10% (w / v) sucrose to 12.5 pl (48-well) or 5 pl (96-well) were then added to the diluted lipids and incubated for 15 min at room temperature. A lipoplex of ABE with Lipofectamine 3000 in a volume of 25 pl was added to the cells with 225 pl fresh complete medium in a 48-well plate, or 10 pl was added to the cells with 90 pl medium in a 96-well plate. The cells were incubated for 48 h before analysis. Plasmid DNA transfections were done in 48-well plates using 160 ng pCMV-NG-SpCas9-ABE, 80 ng pSPgRNA-ra?72- A6, and 0.75 pl Lipofectamine 3000 per well, following the manufacturer’s protocol. PE was delivered in vitro, similarly as ABE, but without sucrose, unless otherwise noted. Activities of ABE and PE in the rdl2 reporter cell line were analyzed by fluorescence microscopy and flow cytometry, as described above for Cre delivery.

[0346] Rescue of RPE65 expression was analyzed using NIH / 3T3 cells stably expressing Rpe65 rd.12 cDNA, as previously described. The ABE and PE were applied on these cells, and after 48 h, the cells were detached using trypsin and washed three times with PBS. One-tenth of the cell suspension was lysed with 10 mM Tris pH 7.5, 0.05% SDS with 0.02 mg ml1proteinase K for 1 h at 37°C, then the proteinase K was inactivated at 85°C for 45 min. The lysate was used as a template for PCR, and the products were subjected to nextgeneration sequencing. The remaining cells were lysed in lx RIPA buffer (Cell Signaling Technology, 9806) with lx cOmplete Ultra EDTA-free protease inhibitors (Roche) for 1 h on a rotator in a cold room, and then centrifuged at 17,000 - 21,400g for 20 min at 4°C, and the supernatant was used for analysis. Protein concentration in the extracts was measured using the BCA assay (Thermo Fisher Scientific, 23252), and the extracts were subjected to Western blotting.Next-generation sequencing

[0347] Complementary DNA (cDNA) was synthesized from RNA with the High Capacity RNA-to-cDNA kit (Thermo Fisher 4387406), according to manufacturer’s instructions. 0.5 - 1 pl of the isolated genomic DNA or cDNA was used as input for the first of two PCR reactions (PCR1). Genomic loci were amplified in PCR1, using Phusion Plus polymerase (Thermo Fisher Scientific F631S). PCR1 primers for genomic loci are listed in Table 2 (marked as HTS_fwd and HTS_rev). PCR1 was performed as follows: 98°C for30 sec; 30 cycles at 98°C for 10 sec, 60°C for 20 sec, and 72°C for 30 sec; 72°C for 5 min. PCR1 products were confirmed on a 2% agarose gel. One microliter of PCR1 was used as input for PCR2 to install Illumina barcodes. PCR2 was conducted for nine cycles of amplification using a Phusion HS II kit (Life Technologies). Following PCR2, samples were pooled, and gel-purified in a 1% agarose gel using a Qiaquick Gel Extraction Kit (Qiagen). Library concentration was quantified using the Qubit High-Sensitivity Assay Kit (Thermo Fisher Scientific). Samples were sequenced on an Illumina MiSeq instrument (paired-end read, read 1 : 200-280 cycles, read 2: 0 cycles) using an Illumina MiSeq 300 v2 Kit (Illumina).High-throughput sequencing data analysis

[0348] Sequencing reads were demultiplexed using the MiSeq Reporter software (Illumina) and were analyzed using CRISPResso2 as previously described. Batch analysis mode (one batch for each unique amplicon and sgRNA combination analyzed) was used in all cases. Reads were filtered according to minimum average quality score (Q > 30) prior to analysis. The following quantification window parameters were used: -w 20 -wc -10. Base editing efficiencies are reported as the percentage of sequencing reads containing a given base conversion at a specific position. Prism 10 (GraphPad) was used to generate dot plots and bar plots.Western blotting

[0349] Protein was analyzed via Western blotting and detected using mouse anti- RPE65 antibody (produced in house) or mouse anti-SpCas9 (clone 7A9, Biolegend #844302), diluted 1 :1,000 in 5% non-fat dry milk in PBS (Bio-Rad, 1610780) with 0.1% Tween 20 (MilliporeSigma, P9416) (PBST). The lysates (7-10 pg total protein) were separated by SDS-PAGE, transferred to a polyvinylidene fluoride (PVDF) membrane (MilliporeSigma, IPVH00010), blocked for 1 h with 5% non-fat dry milk in PBST at room temperature, and incubated with the primary antibodies overnight in the cold room. After washing 4 times with PBST for 5 min each, the blots were incubated for 1 h at room temperature with a horseradish peroxidase (HRP)-linked horse anti-mouse antibody (Vector Laboratories, Newark, CA, USA, PI-2000-1), diluted 1 :2,500 in 5% non-fat dry milk in PBST. The signals were detected with SuperSignal West Pico Plus Chemiluminescent substrate (Thermo Fisher 34577). Next, the antibodies were stripped from the membrane with 0.2 M glycine pH 2.2,0.1% SDS, 1% Tween 20; then, the membranes were washed, blocked, and re-probed for 1 h at room temperature using rabbit anti-(3-actin polyclonal antibody (1 :2,000; Cell Signaling Technology; 4970S). Goat anti-rabbit IgG with HRP (1 :2,500; Cell Signaling Technology; 7074S) was used as the secondary antibody before developing the blots, as described above.Delivery of ABE in vivo

[0350] ABE was diluted into OptiMEM containing additional sucrose (10 or 25% (w / v) final, as indicated); or into the ABE storage buffer containing high salt concentration (390 mM NaCl final) without added sucrose. To form RNPs, ABE was added to guide RNA dissolved in water and incubated for 15 min at room temperature. For combination with fivefold molar excess of 6xHis-CM18-PTD4 peptide, ABE RNPs were added to a peptide stock solution diluted to 1 mM. In the case of Lipofectamine 3000, ABE RNPs were added to the undiluted reagent. RNPs were incubated with the reagents for at least 15 min at room temperature before subretinal injection into rd.12 mice as described.RPE dissociation, genomic DNA and RNA, and lysate preparation

[0351] Mouse eyes were dissected under a light microscope to separate the posterior eyecup (containing RPE, choroid, and sclera) from the retina and anterior segment. Each posterior cyccup was immediately immersed in RLT Plus (Qiagen). RPE, choroid, and scleral cells were detached from the posterior eyecup by gentle pipetting, followed by removal of the remaining posterior eyecup. Cells were then processed for genomic DNA and RNA using the AllPrep DNA / RNA Micro kit according to manufacturer instructions (Qiagen 80284). To prepare the protein lysate from the mouse RPE tissue, the dissected mouse posterior eyecup was transferred to a microcentrifuge tube containing 40 pl of ice-cold RIPA buffer with protease inhibitors, and homogenized with a motorized tissue grinder (Fisher Scientific K749540-0000), incubated on ice for 20 min, and then centrifuged for 20 min at 21,000g at 4°C. The resulting supernatant was pre-cleared with Dynabeads Protein G (Thermo Fisher 10003D) by rotation at 4°C for 15 min to remove immunoglobulin contaminants from blood prior to loading on the gel.Immunohistochemistry of RPE flatmounts and cryosections

[0352] Mouse eyes were enucleated and fixed with 4% paraformaldehyde in PBS for 20 min at room temperature and washed three times in PBS for 5 min each. To make RPE flatmounts, the anterior segment and retina were removed from the posterior eyecup under adissecting microscope, and four radial cuts were made toward the optic nerve to flatten the eyecup into an RPE flatmount. Samples were permeabilized and blocked in 0.1% Triton X- 100 (Sigma- Aldrich, T8532) with 3% normal goat serum (NGS) in PBS for 30 min and incubated with the following primary antibodies in PBS, 0.1% Triton X-100 and 3% NGS: mouse anti-RPE65 antibody (1:100; in-house) and rabbit anti-ZO-1 polyclonal antibody (1:100; Invitrogen, 61-7300) overnight at 4°C. The next day, samples were washed three times in PBS for 5 min each and then incubated with the appropriate secondary antibodies in PBS, 0.1 % Triton X-100 and 3% NGS, including Alexa Fluor 555-conjugated goat antimouse IgG (1:200; Thermo Fisher; Al 1032) and Alexa Fluor 647-conjugated goat anti-rabbit IgG (1 :200; Thermo Fisher) for 2 h at room temperature in the dark. The secondary antibodies were then removed, and the flatmounts were incubated in DAPI (1 pg ml1, Thermo Fisher, 62248) in PBS for 10 min. Samples were washed three times in PBS for 5 min each. The samples were then mounted with VECTASHIELD HardSet Antifade Mounting Medium (Vector Labs H- 1400- 10) and imaged on a Keyence BZ-X810 All-in-One fluorescence microscope.Electroretinography (ERG)

[0353] Prior to ERG recording, mice were dark adapted for 1 week. Under a safety light, mice were anesthetized by isoflurane inhalation, and their pupils were dilated with topical administration of 1% tropicamide ophthalmic solution (Akorn; 17478-102-12) and 10% phenylephrine ophthalmic solution (MWI Animal Health #054243), followed by hypromellose (Akorn; 9050-1) for hydration. The mouse was placed on a heated Diagnosys Celeris rodent-ERG device (Diagnosys LCC, Lowell, MA, USA). Ocular stimulator electrodes were placed on the corneas, the reference electrode was positioned subdermally between the ears, and a ground electrode was placed in the rear leg. The eyes were stimulated with a green-light stimulus (peak emission 544 nm, bandwidth ~ 160 nm) of -0.3 log (cd s m-2). The responses for 10 stimuli with an inter-stimulus interval of 10 sec were averaged, and the a- and b-wave amplitudes were acquired from the averaged ERG waveform. Data were analyzed with Espion V6 software (Diagnosys LLC). For the RNP LNP optimization study, eyes that received LNP and had no ERG response after treatment were excluded from the analyses.Pupillary light reflex

[0354] The pupillary light reflex (PLR) was characterized in mice (n = 5 for each group) using the A2000 computerized pupillometer (Neuroptics, San Clemente, CA, USA). Mice were dark-adapted for 6 h prior to recordings in a dark room. This pupilometer system consists of a sensing device equipped with two infrared cameras that independently record and track dynamics of each pupil. The light profile consisted of four white-light stimuli (1.2 log, IO1 2W m-2), each for 500 msec. For the duration of the PLR testing routine, mice were kept under isoflurane anesthesia. The experiments were carried out under scotopic conditions, with no background illumination from the pupillometer, with the infrared cameras as the primary light source. The maximum size of the pupil after dark adaptation was quantified at 2 min after anesthesia and was used to establish baseline size. The pupil response was expressed as percent constriction of the pupil when compared to baseline. Captured digital movies of pupil responses were recorded using the Active Presenter software (v. 9.1.3; Atomi Systems, Inc, Hanoi, Vietnam), and the videos were subsequently decomposed into individual frames using Adobe Premiere Rush program (v. 10.0.1; Adobe Systems, Inc., San Jose, CA, USA) for manual verification of pupil dynamics and calculation of absolute pupil diameters from the recorded images.Retinoid analysis

[0355] Mice were dark adapted for 2 days before eye enucleation. Eyes were homogenized in 1 ml of a 10 mM sodium phosphate buffer (pH 8.0) containing 50% methanol (v / v) (Sigma-Aldrich; 34860-1L-R) and 100 mM hydroxyl amine, pH 8.0 (Sigma- Aldrich; 159417-100G). After 15 min incubation at room temperature, 2 ml of 3 M NaCl was added. The resulting sample was extracted twice with 3 ml ethyl acetate (Fisher Scientific; E195-4). Then, the combined organic phase was dried in vacuo and reconstituted in 250 pl hexane. Extracted retinoids (100 pl) were separated on a normal-phase HPLC column (Zorbax Sil; 5 pm; 4.6 mm x 250 mm; Agilent Technologies) connected to an Agilent Infinity 1260 HPLC system equipped with a diode-array detector. Separation was achieved with a mobile phase of 0.6% ethyl acetate in hexane (Fisher Scientific; H302-4) at a flow rate of 1.4 ml min-1for 17 min, followed by a step increase to 10% ethyl acetate in hexane for an additional 25 min. Retinoids were detected by monitoring absorbance at 325 nm and 360 nm using Agilent ChemStation software.Encapsulation of ABE and PE LNPs

[0356] RNPs were assembled by mixing 10 pM purified ABE or PE with synthetic sgRNA (ABE) or cpcgRNA (PE) at a 1 : 1. 1 molar ratio. The buffer for ABE was HEPES 10 mM, pH 7.0, NaCl 500 mM, glycerol 20% (v / v); for PE, the buffer was HEPES 10 mM, pH 7.0, NaCl 500 mM, glycerol 5% (v / v); and guide RNA was dissolved in water. Proteins were diluted, supplemented with 10% (w / v) sucrose from 50% (w / v) stock in water, and added to guide RNA. Final composition of the buffer in which RNPs were assembled was HEPES 2.8 mM, pH 7.0, NaCl 140 mM, sucrose 10% (w / v), glycerol 5.6% (v / v) (ABE); or glycerol 1.4% (v / v) (PE). The RNPs were incubated at room temperature for at least 15 min. Transient turbidity, which cleared during incubation, was observed. Immediately before encapsulation, RNPs were diluted to 0.711 pM in a 50 mM Tris-acetate buffer, pH 6.0, with 10% (w / v) sucrose, to achieve a final concentration of NaCl of 10 mM. The lipids used to encapsulate pre-formed RNPs were comprised of an ionizable cationic lipid (either CL4H6 (Cayman Chemical, Ann Arbor, MI, USA, 37279), SM102 (Broadpharm, San Diego, CA, USA, BP- 25499), or DODMA (Avanti Polar Lipids, Alabaster, AL, USA, 890899), all of which have p Cs > 6.0 at 6.25, 6.68 and 6.59 respectively), and co-lipids DSPC (Avanti Polar Lipids, 850365), cholesterol (Avanti Polar Lipids, 700100), and DMG-PEG 2000 (Avanti Polar Lipids, 880151) (Fig. 15) at a molar composition of 50 / 10 / 38.5 / 1.5, respectively, to encapsulate pre-formed RNPs. For optimization of DMG-PEG 2000 lipid content from 1 .5 to 10 mole%, the concentration of cholesterol was decreased accordingly. In some formulations, 2.5 mole% of SOPS (18:0-18:1 PS, Avanti Polar Lipids 840039C) was used with 7.5 mole% of DSPC. In brief, the lipids were dissolved in ethanol and rapidly combined with preformed RNP at a volume ratio of 1 :3 (ethanokaqueous) and a total lipid:guide RNA weight ratio of 40:1 (approximate total lipid:protein weight ratio of 7.75:1). The combination was performed by microfluidic mixing using a Precision NanoSystems Ignite device (Precision NanoSystems, Vancouver, BC, Canada). Immediately after mixing, the formed LNPs were dialyzed two times for 2 h each at room temperature, against 20 mM Tris, 4.3 mM Na acetate, pH 7.4, 10% (w / v) sucrose (TAS buffer), to remove the ethanol and deprotonate the ionizable cationic lipid at neutral pH. Final concentration of protein was approximately 0.53 pM (0.10 mg ml1ABE8e, 0.13 mg ml1PE), and of guide RNA - 0.59 pM (0.02 mg ml1sgRNA, 0.03 mg ml1epegRNA). The LNPs were transferred to ice and concentrated to no less than one fifth initial volume, using an Amicon Ultra centrifugal filterwith molecular weight cutoff of 30 kDa (Merck, UFC903024); the concentrated LNPs were distributed into aliquots, quickly frozen on a pre-cooled metal block, and stored at -80°C. The percent recovery and concentration factor of the LNPs were estimated using SDS-PAGE electrophoresis and CBB staining. Fluorescence intensity of Coomassie dye bound to protein was measured using ChemiDoc MP imager, and analyzed using ImageLab software version 6.1.0 (Bio-Rad). Doses of RNP LNP are reported in vitro as a final concentration of RNP and in vivo as RNP concentration and injected volume.Particle-size distribution analysis

[0357] Particle-size distribution was measured using a Malvern Zctasizcr Advance Nano (Malvern Panalytical, Malvern, UK). Twenty microliters of freshly dialyzed LNP were diluted to 200 pl with TAS buffer and subjected to particle-size distribution measurement in triplicates. The particle size distributions were processed by the accompanying software to calculate average particle diameter and polydispersity index (Pdl).Cryoelectron-microscopic imaging of LNPs

[0358] LNP samples were concentrated 3-4 times in an Amicon Ultra 0.5 device with a 10 kDa molecular weight cutoff. LNP solution (2.5 pl) was applied onto a Quantifoil 200 mesh grid coated with a thin carbon film (Ted Pella). Grids were blotted for 2 sec with filter paper, then plunged into liquid ethane using a manual plunger. The image was collected on a FE1 Tecnai TF20 high resolution Transmission Electron Microscope equipped with a K2 Direct-Detection Camera at an accelerating voltage of 200 kV.ABE encapsulation immunoassay

[0359] LNPs were diluted 1 :3 in an immunoprecipitation buffer (HEPES 10 mM, pH 7.0, NaCl 150 mM, sucrose 10% (w / v)), and 80 pl of diluted LNPs were incubated with 20 pl of 1D4 resin for 30 min in a cold room in an overhead mixer. As a control, pre-formed free RNP was diluted in the TAS buffer to the approximate concentration of RNP in a prepared LNP, and also incubated with 20 pl of 1D4 resin. Samples were then centrifuged at 700g for 5 min at 4°C. The supernatant was filtered with centrifugation at 200g for 2 min through a 30-pm polyethylene filter. Pelleted resin was resuspended in 500 pl of the immunoprecipitation buffer and washed by centrifugation at 700g for 5 min. The supernatant was discarded, and the washing process was repeated four separate times to ensure thorough washing. To elute the RNP, 80 pl of the elution buffer (1 mg ml1of 1D4 peptide in theimmunoprecipitation buffer) was introduced to the resin, and the samples were incubated overnight in a cold room in an overhead mixer. After incubation, the samples were centrifuged and filtered as described above. Filtered samples were then analyzed by Western blot.Size exclusion chromatography of ABE LNP

[0360] The LNPs containing ABE8e RNP or free ABE8e RNP (112 pg RNP in both) were diluted into 500 pl of lx PBS (Corning, 46-013-CM) with 0.001% Pluronic F-68 (Gibco, 24040032), filtered on a pre-washed 0.22-pm cellulose acetate centrifugal filter (Corning, 8160) and resolved on a HiPrcp 16 / 60 Sephacryl S-500 HR column (Cytiva, 28935606) at a flow rate of 0.4 ml min1. One milliliter fractions were collected and analyzed by Western blot with anti-Cas9 antibodies as described.Quantification of ABE and PE by mass spectrometry

[0361] Deionized water in all experiments was generated using a Milli-Q waterpurification system (Millipore Corporation, Bedford, USA). Formic acid (FA), ammonium bicarbonate (NH4HCO3) and acetonitrile (ACN) of MS grade were purchased from Fisher chemical (Fair Lawn, NJ, USA). lodoacetic acid (IAA) and DTT were of analytical grade and supplied by Milliporc Corporation (Bedford, USA). Sequencing-grade modified trypsin was provided by Promega (Madison, WI, USA). Stable-isotope-labeled peptides (SIL peptides) were synthesized with alkylated cysteines by GenScript (Piscataway, NJ, USA). The stock solutions of all the peptides were prepared by accurately weighing the synthetic peptides and then dissolving them in water or dimethyl sulfoxide (DMSO) following the manufacturer’s instructions. The SIL peptides were diluted in water before adding to the samples (Table 3).

[0362] The samples were diluted with 50 mM ammonium bicarbonate and reduced with 10 mM DTT for 1 h at 56°C, and alkylated with 20 mM iodoacetic acid for 30 min at room temperature in the dark. Then, the stable-isotope-labeled peptides (SIL peptides) were spiked into protein samples, and then free trypsin was added at a trypsin to protein ratio of 1:50 and incubated overnight at 37°C. Trypsin activity was inhibited by acidification with 0.1% FA, and the samples were then desalted using a Cl 8 desalting column (Nest). After drying completely by speed vacuum, peptides were dissolved in 0.1% formic acid. The samples were analyzed using LC-MS / MS using a Vanquish LC instrument (Thermo Fisher Scientific),coupled in-line with a Q Exactive mass spectrometer (Thermo Fisher Scientific), with an ESI source. Mobile phase A was composed of 0.1 % FA in water, and mobile phase B was comprised of 0.1% FA in acetonitrile. The total flow rate was 0.4 ml min1. Peptides were separated with a 25-min gradient on an Acquity UPLC® BEH C18 column (1.7 pm, 2.1 mm x 100 mm, Waters Corporation). The acquisition method combined a full scan method with a time- scheduled sequential parallel-analysis monitoring (PRM) method. For PRM, MS2 scan parameters were set to select the m / z ratio of the natural peptides of Cas9, TadA deaminase, and reverse transcriptase, and their corresponding SIL peptides, with defined elution time windows. MSI scans were acquired at the m / z range of 300-1000, mass resolution of 70,000, automatic gain control (AGC) target of le6, and maximum ion injection time of 50 msec. The PRM scans were acquired at a resolution of 17,500, AGC target value of le5, maximum ion injection time of 50 msec, isolation window of 2.0 m / z.Local field potential and single unit recordings, visual stimulation, and data analysis

[0363] Mice were initially anesthetized with 2% isoflurane in a mixture of N2O / O2 (70% / 30%) and then placed into a stereotaxic apparatus. A small, custom-made plastic chamber was glued (Vetbond, St. Paul, MN, US) to the exposed skull. After one day of recovery, re-anesthetized animals were placed in a custom-made hammock, maintained under isoflurane anesthesia (1-2% in O2), and multiple single tungsten electrodes were inserted into a small craniotomy above the VI and SC. Once the electrodes were inserted, the chamber was filled with sterile agar and sealed with sterile bone wax. During recording sessions, animals were kept under isoflurane anesthesia (0.5 - 1% in 30% O2). EEG and EKG scans were monitored throughout the experiments, and body temperature was maintained with a heating pad (Harvard Apparatus, Holliston, MA).

[0364] Data were acquired using a 32-channel Scout recording system (Ripple, UT, USA). The local field potential (LFP) from multiple locations was bandpass filtered from 0.1 Hz to 250 Hz and stored with spiking data on a computer with a 1-kHz sampling rate. The LFP signal was cut according to stimulus time stamps and averaged across trials for each recording location to calculate visually evoked potentials (VEP). The evoked potential across all layers was recorded, and the most robust response was used for comparisons between groups at the same SC or VI layer.

[0365] The spike signal was bandpass filtered from 500 Hz to 7 kHz and stored in a computer hard drive at a 30 kHz sampling frequency. Spikes were sorted online in Trellissoftware (Ripple, UT, USA) while performing visual stimulation. Visual stimuli were generated in Matlab (Mathworks, USA) using Psychophysics Toolbox and displayed on a gamma-corrected LCD monitor (55 inches, 60 Hz; 1920 x 1080 pixels; 52 cd m-2mean luminance). Stimulus onset times were corrected for LCD-monitor delay using a photodiode and microcontroller (in-house design).

[0366] Vision was assessed using protocols published in our previous work. Cells were first tested with 100 repetitions of a 500 msec bright flash of light (105 cd m‘2) for the presence of the visually evoked responses. When cells showed signs of robust visually driven activity, we used further drifting grating stimuli to assess the properties of the spatiotemporal receptive fields. Briefly, each cell was evaluated for orientation selectivity, optimal stimulus size, optimal spatial frequency, optimal temporal frequency, and contrast sensitivity. Recorded tuning curves were further normalized between 0 and 1 for visual purposes and plotted together for comparison. Data are presented as mean ± SEM. The level of statistical significance was set at P < 0.05 for two-tailed Mann- Whitney U-tests. The figures show single recording locations from the SC and VI recordings as examples.

[0367] Tuning curves were calculated based on the average spike rate. Optimal visual parameters were chosen as the maximum response value. Orientation tuning was measured in degrees at the half- width at half-height (HWHH; 1.18 x o) based on fits to Gaussian distributions using equation (1):where Osis the stimulus orientation, Rosis the response to different orientations, Opis the preferred orientation, Rpand Rnarc the responses at the preferred and non-preferred direction, o is the tuning width, and “baseline” is the offset of the Gaussian distribution. Gaussian fits were estimated without subtracting spontaneous activity.

[0368] The optimal spatial and temporal frequency was extracted from the data fitted to Gaussian distributions using equation (2):where RSF / TF is the estimated response, and Rpref indicates response at a preferred spatial or temporal frequency. SF / TF indicates spatial or temporal frequency, o is the standard deviation of the Gaussian, and the baseline is the Gaussian offset.Statistical analyses

[0369] Unless otherwise stated, the data are presented as mean ± s.d., and statistical analyses were performed using GraphPad Prism 10.0. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, P > 0.05.ResultsExpression and characterization of Cre, ABE, and PE

[0370] The potential for therapeutic benefit from administered proteins hinges upon successful delivery across cellular membranes. A number of agents have been demonstrated to enhance intracellular delivery of genome-editing proteins and RNPs, including CPPs. Accordingly, we genetically fused three different CPPs (TAT, CPP5, and ANTP) to the N- terminus of Cre recombinase and ABE8e-SpCas9-NG (hereafter referred to as ABE8e), which recognizes the NG PAM (Fig. 1 A). To facilitate purification, we also fused the 1D4 peptide tag to the C-termini of ABE8e and the PE protein, PE2 (Fig. 1 A). Although Cre recombinase and Cas9-based genome-editing proteins possess distinct physicochemical properties, such as size and charge, we hypothesized that insights from the study of intracellular delivery of Cre recombinase would inform the design of delivery vehi...

Claims

Having described the invention, we claim:

1. A lipid nanoparticle composition comprising a plurality of lipid nanoparticles, each lipid nanoparticle including a lipid component that encapsulates genome editing ribronucleoprotein (RNP), wherein the lipid component includes an ionizable cationic lipid with a p 'a > 6, at least one phospholipid, a structural lipid, and PEG-modified lipid.

2. The lipid nanoparticle composition of claim 1, wherein the genome editing RNP includes a base editor or prime editor complexed with a guide RNA configured for, respectively, base-editing or prime-editing a pathogenic point mutation in a cell, such as a retinal cell and / or a retinal pigment epithelium cell, of a subject.

3. The lipid nanoparticle composition of claim 2, wherein the guide RNA hybridizes to or is complementary to the pathogenic point mutation of a target nucleic acid sequence of a mutant gene.

4. The lipid nanoparticle composition of any of claims 1 to 3, wherein the genome editing RNP includes an adenine base editor complexed with a guide RNA having the nucleic sequence of SEQ ID NO: 5.

5. The lipid nanoparticle composition of any of claims 1 to 3, wherein the genome editing RNP includes a prime editor complexed with a guide RNA having the nucleic sequence of SEQ ID NO: 6.

6. The lipid nanoparticle composition of any of claims 2 to 5, wherein the genome editing RNP is configured to correct the pathogenic point mutation, generate a non- pathogenic point mutation, or modulate expression of an inherited retinal disorder (IRD) related gene in the retinal cell and / or the retinal pigment epithelium cell and / or restore visual function of the subject.

7. The lipid nanoparticle of claim 6, wherein the IRD is selected from Stargardt Disease, Leber's congenital amaurosis (LCA), pseudoxanthoma elasticum, rod cone dystrophy, exudative vitreoretinopathy, Joubert Syndrome, CSNB-1C, retinitis pigmentosa, Stickler syndrome, microcephaly, chorioretinopathy, CSNB 2, Usher syndrome, Wagner syndrome, or age-related macular degeneration.

8. The lipid nanoparticle of any of claims 2 to 7, wherein the pathogenic point mutation is a nonsense or missense mutation, and the genome editing RNP increases expression of a protein of the retinal cell or the retinal pigment epithelium cell by at least about 4%, 5%, 6%, 7 %, 8%, 9%, 10%, 20%, 30%, 40% or more.

9. The lipid nanoparticle of any of claims 2 to 8 wherein the pathogenic point mutation is nonsense or missense mutation of ABCA4, AIPL1, CABP4, CEP290, CLUAP1, CRB1, CRX, GDF6, GUCY2D, IFT140, IQCB1, KCNJ13, LCAS, LRAT, NMNAT1, PRPH2, RD3, RDH12, RHO, RPE65, RPGR1P1, SPATA7, and TULPL10. The lipid nanoparticle composition of any of claims 1 to 9, wherein the ionizable cationic lipid comprises at least one of 8-[(2-hydroxyethyl)[6-oxo-6- (undecyloxy)hexyl]amino]-octanoic acid, 1-octylnonyl ester (SM102), 9-octadecenoic acid, l,T-[7-[4-(dipropylamino)butyl]-7-hydroxy-l,13-tridecanediyl] ester (CL4H6), 1,2- dioleyloxy-3-dimethylaminopropane (DODMA), 4-(dimethylamino)-butanoic acid,(10Z, 13Z)- 1 -(9Z, 12Z)-9, 12-octadecadien- 1 -yl- 10, 13-nonadecadien- 1 -yl ester (DLin-MC3- DMA), 2-[2,2-Di-[(9Z,12Z)-octadcca-9,12-dicnyl]-l,3-dioxolan-4-yl]-A,A- dimethylethanamine (Dlin-KC2-DMA), (4-Hydroxybutyl)azanediyl]di(hexane-6, 1 -diyl) bis(2-hexyldecanoate) (ALC-0315), CKK-E12, 1,1 '-[[2-[4-[2-[[2-[te[(2S)-2- hydroxydodecyl]amino]ethyl][(2S)-2-hydroxydodecyl]amino]ethyl]-l- piperazinyl]ethyl]imino]hA-2-dodecanol (Cl 2-200), l,2-Dilinoleyloxy-N,N-dimethyl-3- aminopropane, N,N-dimethyl-2,3-bis[(9Z, 12Z)-9, 12-octadecadien- 1 -yloxy ]- 1 -propanamine (Dlin-DMA), 9-[4-(dimethylamino)-l-oxobutoxy]-heptadecanedioic acid, 1, 17-di-(2Z)-2- nonen-l-yl ester, preferably SMI 02.

11. The lipid nanoparticle composition of any of claims 1 to 10, wherein the at least phospholipid is selected from dilauroyl-phosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), dipalmitoyl-phosphatidylcholine (DPPC), dibehenoylglycerophosphocoline (DBPC), diarachidoyl-phosphatidylcholine (DAPC), distearoylphosphatidylcholine (DSPC), dioleoyl-phosphatidylcholine (DOPC), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), distearoyl phosphatidyl-ethanolamine (DSPE), dioleylphosphatidyl-ethanolamine (DOPE), diarachidoylphosphatidyl-ethanolamine (DAPE), dilinoleylphosphatidylethanolamine (DLPE), dimyristoylphosphatidylserine (DMPS), diarachidoyl phosphatidylserine (DAPS), dipalmitoyl phosphatidylserine (DPPS), distearoylphosphatidylserine (DSPS), dioleoylphosphatidylserine (DOPS), dipalmitoyl phosphatidic acid (DPPA), dimyristoyl phosphatidic acid (DMPA), distearoyl phosphatidic acid (DSPA), diarachidoylphosphatidic acid (DAPA) and their alkali metal salts, dimyristoylphosphatidylglycerol (DMPG) and its alkali metal salts, dipalmitoylphosphatidylglycerol (DPPG) and its alkali metal salts, distearoylphosphatidylglycerol (DSPG) and its alkali metal salts, dioleoylphosphatidylglycerol (DOPG), dilauroyl-phosphatidylinositol (DLPI), diarachidoylphosphatidylinositol (DAPI), dimyristoylphosphatidylinositol (DMPI), dipalmitoylphosphatidylinositol (DPPI), distearoylphosphatidylinositol (DSPI), dioleoylphosphatidylinositol (DOPI), l-stearoyl-2-oleoyl-sn-glycero-3-phosphoserine (SOPS), or mixtures thereof, preferably, l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) or 1- stearoyl-2-oleoyl-sn-glycero-3-phosphoserine (SOPS).

12. The lipid nanoparticlc composition of any of claims 1 to 11, wherein the structural lipid is selected from cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, or mixtures thereof, preferably, cholesterol.

13. The lipid nanoparticle composition of any of claims 1 to 12, wherein the PEG modified lipid is selected from a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, or mixtures thereof, preferably PEG- modified phosphatidylcthanolamincs, such as DMPE-PEG1000, DMPE-PEG2000, DMPE-PEG3000, DMPE-PEG4000, DMPE-PEG5000, DPPE-PEG1000, DPPE-PEG2000, DPPE- PEG3OOO, DPPE-PEG4000, DPPE-PEG5OOO, DSPE-PEG1OOO, DSPE-PEG2000, DSPE- PEG3000, DSPE-PEG4000, DSPE-PEG5OOO, DAPE-PEG1000, DAPE-PEG2000, DAPE- PEG3000, DAPE-PEG4000 or DAPE-PEG5000, more preferably 1,2-dimyristoyl-rac- glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG 2000).

14. The lipid nanoparticle composition of any of claims 1 to 13, wherein the lipid component comprises about 40 mol % to about 60 mol % of the ionizable cationic lipid, for example, about 42 mol % to about 60 mol %, about 44 mol % to about 60 mol %, about 46 mol % to about 60 mol %, about 48 mol % to about 60 mol %, about 50 mol % to about 60 mol %, about 40 mol % to about 58 mol %, about 40 mol % to about 56 mol %, about 40 mol % to about 54 mol %, about 40 mol % to about 52 mol %, or about 40 mol % to about 50 mol % of the ionizable cationic lipid, including any range therebetween15. The lipid nanopaiticle composition of any of claims 1 to 14, wherein the lipid component comprises about 8 mol % to about 12 mol % of the phospholipid, for example, about 9 mol % to about 12 mol %, about 10 mol % to about 12 mol %, about 11 mol % to about 12 mol %, about 8 mol % to about 11 mol %, about 8 mol % to about 10 mol %, or about 8 mol % to about 9 mol % of the phospholipid, including any range therebetween.

16. The lipid nanoparticle composition of any of claims 1 to 15, wherein the lipid component comprises about 28.5 mol % to about 48.5 mol % of the structural lipid, for example about 30.5 mol % to about 48.5 mol %, about 32.5 mol % to about 48.5 mol %, about 34.5 mol % to about 48.5 mol %, about 36.5 mol % to about 48.5 mol %, about 38.5 mol % to about 48.5 mol %, about 28.5 mol % to about 46.5 mol %, about 28.5 mol % to about 44.5 mol %, about 28.5 mol % to about 42.5 mol %, about 28.5 mol % to about 40.5 mol %, or about 28.5 mol % to about 38.5 mol % of the structural lipid, including any range therebetween.

17. The lipid nanoparticle composition of any of claims 1 to 16, wherein the lipid component comprises about 1.5 mol % to about 5 mol % of the PEG modified lipid, for example, about 1.5 mol % to about 4.5 mol %, about 1.5 mol % to about 4 mol %, about 1.5mol % to about 3.5 mol %, about 1.5 mol % to about 3 mol %, about 2 mol % to about 5 mol %, about 2.5 mol % to about 5 mol %, or about 3 mol % to about 5 mol % of the PEG modified lipid, including any range therebetween.

18. The lipid nanoparticle composition of any of claims 1 to 17, wherein the lipid component comprises about 40 mol % to about 60 mol % of the ionizable cationic lipid, about 8 mol % to about 12 mol % of the phospholipid, about 28.5 mol % to about 48.5 mol % of the structural lipid, and about 1.5 mol % to about 3 mol % of the PEG modified lipid.

19. The lipid nanoparticle composition of any of claims 1 to 18, wherein the lipid component comprises about 40 mol % to about 60 mol % SM012, about 8 mol % to about 12 mol % DSPC, about 28.5 mol % to about 48.5 mol % cholesterol, and about 1.5 mol % to about 3 mol % DMG-PEG 2000.

20. The nanoparticle composition of any of claims 1 to 19, wherein the lipid nanoparticle encapsulation efficiency of the genome editing RNP is at least about 80% or at least about 90%.

21. The lipid nanoparticle composition of any of claims 1 to 20, wherein the lipid nanoparticle wt / wt ratio of the lipid component to RNA of the genome editing RNP is from about 30: 1 to about 70:1, preferably about 40: 1 to 60: 1.

22. The lipid nanoparticlc composition of any of claims 1 to 21, wherein the lipid nanoparticle wt / wt ratio of the lipid component to protein component of genome editing RNP is from about 5:1 to about 10: 1, preferably from about 7:1 to about 8: 1.

23. The lipid nanoparticle composition of any of claims 1 to 22, wherein the lipid nanoparticles have an average diameter of about 50 nm to about 500 nm, preferably about 100 nm to about 300 nm.

24. The lipid nanoparticle composition of any of claims 1 to 22, further comprising at least one targeting group decorating the lipid nanoparticles that targets and / or binds to a retinal or visual protein.

25. The lipid nanoparticle composition of claim 24, wherein the targeting group comprises at least one photoreceptor targeting peptide, such as DGPPRKPGGGSC (SEQ ID NO: 1), SPALHFEGGGS (SEQ ID NO: 2), SNLAAFPGGGSC (SEQ ID NO: 3), or MPVAVYRGGGSC (SEQ ID NO: $).

26. The lipid nanoparticle composition of claim 24, wherein the at least one targeting group includes all-trans-retinylamine or (lR)-3-amino-l-[3- (cyclohexylmethoxy)phenyl]propan- 1 -oL27. A pharmaceutical composition comprising the lipid nanoparticle composition of any of claims 1 to 26 and a pharmaceutically acceptable carrier.

28. The pharmaceutical composition of claim 27, further comprising an amount of sucrose effective to enhance the stability of the lipid nanoparticle composition under different storage temperatures, for example, storage temperatures ranging from about -20°C to about 4°C.

29. The pharmaceutical composition of claim 27 or 28, comprising about 5% to about 20% (w / v) sucrose.

30. A method of treating a disorder, such as a monogenic disease, associated with a pathogenic point mutation in a subject, the method comprising: administering to the subject the lipid nanoparticle composition or pharmaceutical composition of any of claims 1 to 29, wherein the genome editing RNP includes a base editor or prime editor complexed with a guide RNA configured for, respectively, base-editing or prime-editing the pathogenic point mutation in a cell, such as a retinal cell and / or a retinal pigment epithelium cell, of the subject.

31. The method of claim 30, wherein the disorder is an ocular disorder.

32. The method of claim 30 or 31, wherein the disorder is an inheritable retinal disorder.

33. The method of any one of claims 30 to 32, wherein the disorder is selected from Stargardt Disease, Leber's congenital amaurosis (LCA), pseudoxanthoma elasticum, rod cone dystrophy, exudative vitreoretinopathy, Joubert Syndrome, CSNB-1C, retinitis pigmentosa, Stickler syndrome, microcephaly, chorioretinopathy, retinitis pigmentosa, CSNB 2, Usher syndrome, Wagner syndrome, or age-related macular degeneration.

34. The method of any one of claims 30 to 33, wherein the lipid nanoparticle composition or pharmaceutical composition is administered locally.

35. The method of any of claims 30 to 34, wherein the lipid nanoparticle composition or pharmaceutical composition is administered intravitreally.

36. The method of any of claims 30 to 34, wherein the lipid nanoparticle composition or pharmaceutical composition is administered subretinally.

37. The method of any of claims 30 to 34, wherein the lipid nanoparticle composition or pharmaceutical composition is administered suprachoroidally.

38. The method of any of claims 30 to 37, wherein the concentration of the lipid nanoparticles in the pharmaceutical composition is about 50 ng / pl to about 500 ng / pl. about 100 ng / pl to about 300 ng / pl, or about 150 ng / pl to about 250 ng / nl .

39. The method of any of claims 30 to 38, wherein the volume of the pharmaceutical composition administered to the subject is about 0. 1 pL to about 2 pL, about 0.2 pL to about 1.5 pL, or about 0.5 pL to about 1 pL.

40. The method of any of claims 30 to 39, wherein the lipid nanoparticle composition or the pharmaceutical composition is effective in treating and / or improving the subject's visual function.

41. The method of claim 40, wherein visual function is assessed by microperimetry, dark-adapted perimetry, assessment of visual mobility, visual acuity, ERG, or reading assessment.

42. The method of claim 40, wherein the method results in the prevention of or a slowing of the progression of decline of the subject’s visual function due to progression of the ocular disorder.

43. A method of treating an inherited retinal disease (IRD) associated with a pathogenic point mutation in a mutant allele of an IRD-related gene in retina or retinal pigment epithelium (RPE) of a subject in need thereof, the method comprising: administering to the subject the lipid nanoparticle composition or pharmaceutical composition of any of claims 1 to 29.

44. The method of claim 43, wherein the genome editing RNP of the lipid nanoparticle composition base edits or prime edits the pathogenic point mutation in a retinal cell or a retinal pigment epithelium cell to correct the pathogenic mutation, generate a non- pathogenic point mutation, or modulate expression of an IRD-related gene and / or restore visual function of the subject.

45. The method of claim 43 or 44, where the pathogenic mutation is a nonsense or missense mutation and the base editing or prime editing increases expression of a protein the retinal cell or retinal pigment epithelium cell by at least about 4%, 5%, 6%, 7 %, 8%, 9%, 10%, 20%, 30%, 40% or more.

46. The method of claim 45, wherein the pathogenic mutation is a nonsense or missense mutation of ABCA4, AIPL1, CABP4, CEP290, CLUAP1, CRB1, CRX, GDF6, GUCY2D, IFT140, IQCB1, KCNJ13, EGAS. LRAT, NMNAT1, PRPH2, RD3, RDH12, RHO, RPE65, RPGRIP1, SPATA7, and TULP1.

47. The method of any of claims 43 to 46, wherein the IRD includes at least one of chorioretinal atrophy or degeneration, cone or cone-rod dystrophy, congenital stationary night blindness, Leber congenital amaurosis, macular degeneration, ocular-retinal developmental disease, optic atrophy, retinitis pigmentosa, syndromic / systemic diseases with retinopathy, sorsby macular dystrophy, age-related macular degeneration, doyne honeycomb macular disease, juvenile macular degeneration, Stargardt disease, or retinitis pigmentosa48. The method of any of claims 43 to 47, wherein the IRD is Leber congenital amaurosis, Stargardt disease, or retinitis pigmentosa.

49. The method of any of claims 44 to 48, wherein the base editing or prime editing causes less than 3%, less than 2%, or less than 1% indel formation.

50. The method of any of claims 43 to 49, wherein the pathogenic mutation is anonsense or missense mutation of an RPE65 gene.

51. The method of claim 50, wherein the genome editing RNP of the lipid nanoparticlc composition includes a guide RNA that hybridizes to or is complementary to the pathogenic point mutation of a target nucleic acid sequence of the mutant RPE65.

52. The method of claim 51, wherein the pathogenic point mutation comprises a C to T missense or nonsense mutation of the RPE65 gene and base editing by deamination of the A complementary to the T by the base editor and the guide RNA corrects the C to T mutation.