SNP molecular marker related to sheep heat stress resistance trait and use thereof

Abstract

Disclosed in the present application are an SNP molecular marker related to a heat stress resistance trait on the sheep TSHR gene and use thereof, and provided on the basis of the SNP molecular marker are an amplification primer, a detection reagent, and a kit, use of the molecular marker or the detection reagent thereof, and a method for identifying and breeding a sheep strain resistant to heat stress.

Description

SNP molecular markers associated with heat stress resistance in sheep and their applications

[0001] This application claims priority to Chinese Patent Application No. 202411742376.X, filed on November 29, 2024, entitled "SNP molecular markers associated with heat stress resistance traits in sheep and their applications thereof", the entire contents of which are incorporated herein by reference. Technical Field

[0002] This application belongs to the field of molecular biology, specifically, it relates to a SNP molecular marker associated with heat stress resistance in sheep and its application. Background Technology

[0003] Sheep are a vital source of animal protein for humans. To increase mutton production, large-scale, intensive sheep farming has become an inevitable trend in my country's sheep industry. In modern intensive sheep farming, increasing stocking densities makes the impact of environmental stress on sheep production and health undeniable. Thermal environment is often a significant factor affecting the development of the sheep farming industry. Temperature and humidity are the two most sensitive factors in a thermal environment. In hot and humid summer conditions, sheep are highly susceptible to heat stress, leading to physiological, biochemical, immune, and metabolic imbalances, thus affecting their production performance, including feed intake, daily weight gain, time to market, reproductive performance, and immune function, resulting in substantial economic losses for the sheep industry during the summer. Therefore, improving the heat stress resistance of sheep is of great significance for sheep farming. In sheep breeding, molecular markers with heat stress resistance can be used to identify individuals with better heat stress resistance for breeding purposes; however, currently, there are few suitable molecular markers for selecting heat stress resistance traits in local Chinese sheep breeds.

[0004] The sheep thyroid-stimulating hormone receptor (TSHR) gene is located on chromosome 7, has 10 exons, and encodes a 764-amino acid transmembrane protein. The TSHR protein has seven transmembrane structures; the extramembrane and intramembrane structures each form three loops. The intramembrane structure has a shorter amino acid sequence, including a C-terminus and a phosphorylation site. TSHR is mainly expressed in thyroid cells and plays an important role in controlling thyroid cell metabolism. It maintains the normal function of thyroid follicles and promotes their growth. Studies have also found that TSHR is expressed in tissues of the sheep brain, including the pituitary tubercle, median eminence, ependymal paraventricular nucleus, and third ventricle.

[0005] TSHR plays a crucial role in the hypothalamic-pituitary-gonadal axis, regulating photoperiodic response and seasonal reproduction. The increased T3 concentration resulting from the interaction of TSHR and TSHβ suppresses estrus in sheep. However, the mechanism differs in birds: in birds, photoperiodic signal transduction begins with stimulation of photoreceptors deep in the brain. This is then further converted into neuroendocrine signals transmitted to the pituitary tubercle, inducing thyroid-stimulating cells to secrete TSHβ. TSHβ from the pituitary tubercle binds to TSHR expressed by ependymal cells, inducing DIO2 expression and converting T4 to biologically active T3. Increased DIO2 expression under prolonged light exposure, coupled with T3 induced by prolonged light exposure, leads to increased LH and follicle-stimulating hormone (FSH) secretion, further affecting gonadal growth. Besides regulating the aforementioned seasonal reproductive pathway, TSHR also plays a regulatory role in certain animal biological functions. Studies have found that TSHR expression levels differ between female and male black bass during germ cell maturation in different seasons. In female black bass, the TSHR gene plays a regulatory role in egg maturation and ovulation. In male black bass, it plays a regulatory role in gamete maturation and sperm release. Summary of the Invention

[0006] The purpose of this application is to provide a SNP molecular marker associated with heat stress resistance in sheep and its application.

[0007] To achieve the objectives of this application, in a first aspect, this application provides an SNP molecular marker associated with heat stress resistance in sheep, the molecular marker containing a nucleotide sequence of polymorphism A / C at position 209 of the sheep TSHR gene as shown in SEQ ID NO:1.

[0008] Secondly, this application provides primers for amplifying the molecular marker, including an upstream primer as shown in SEQ ID NO:2 and a downstream primer as shown in SEQ ID NO:3.

[0009] Thirdly, this application provides detection reagents or kits containing the primers.

[0010] Fourthly, this application provides a method for identifying and breeding heat-stress-resistant sheep breeds, including:

[0011] 1) Extract total DNA from the sheep to be tested;

[0012] 2) Using DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO:2-3;

[0013] 3) Analyze the PCR amplification products.

[0014] Fifthly, this application provides any of the following applications of the said molecular marker or its detection reagent:

[0015] (1) Used for early prediction of heat stress in sheep;

[0016] (2) Used for molecular marker-assisted breeding of sheep. Attached Figure Description

[0017] Figure 1 shows the significant signal sites related to sheep temperature adaptability obtained through genome-wide association analysis in a preferred embodiment of this application.

[0018] Figure 2 shows the PCR results containing the target SNP site in a preferred embodiment of this application. The leftmost band is the DNA marker, and the remaining bands are PCR amplification bands of sheep DNA.

[0019] Figure 3 shows the Sanger sequencing results of the PCR product fragments in the preferred embodiment of this application. Detailed Implementation

[0020] This application aims to provide a method for screening major gene loci for heat stress resistance in local Chinese sheep and a corresponding detection method.

[0021] This application provides an SNP molecular marker associated with heat stress resistance in sheep, wherein the molecular marker contains a nucleotide sequence of polymorphism A / C at position 209 of the sheep TSHR gene as shown in SEQ ID NO:1.

[0022] Furthermore, sheep individuals with genotypes AA and AC at the aforementioned polymorphic sites exhibit higher heat stress resistance than sheep individuals with genotype CC.

[0023] In this application, the sheep TSHR gene has the reference sequence number NC_056060.1 and ARS-UI_Ramb_v2.0 in NCBI.

[0024] This application also provides a TSHR gene molecular marker and its application in sheep breeding.

[0025] The technical solution adopted in this application is as follows:

[0026] This application provides a method for breeding sheep with high heat stress resistance. The genotype at position 90568094 on chromosome 7 of sheep is detected. The reference genome version is ARS-UI_Ramb_v2.0, GCF_016772045.1. Individuals with genotypes AA and AC at this locus have higher heat stress resistance than individuals with genotype CC.

[0027] This application also provides the application of substances for detecting SNP locus genotypes in heat stress-resistant trait-assisted breeding of sheep, wherein the SNP locus is located at position 90568094 on sheep chromosome 7, at position 209 of the nucleotide sequence described in SEQ ID NO:1, and has A / C polymorphism (n = a or c).

[0028] Furthermore, the substance is a primer pair, the nucleotide sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0029] This application also provides a primer pair, the nucleotide sequence of which is shown in SEQ ID NO:2-3.

[0030] This application also provides a kit containing the primer pair described above.

[0031] The methods for identifying and breeding heat-stress-resistant sheep breeds provided in this application include:

[0032] 1) Extract total DNA from the sheep to be tested;

[0033] 2) Using DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO:2-3;

[0034] 3) Analyze the PCR amplification products.

[0035] Preferably, the PCR reaction system is as follows: 12.5 μL of 2×Phanta Max Master Mix, 50-100 ng of DNA template, 1 μL each of 10 μM upstream and downstream primers, and ddH2O to a final volume of 25 μL.

[0036] Preferably, the PCR reaction program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles; 72℃ final extension for 5 min.

[0037] Further, step 3) includes: performing Sanger sequencing on the amplified products to obtain the genotypes of the sites with the polymorphisms, and sheep individuals with genotypes AA and AC have higher heat stress resistance than sheep individuals with genotype CC.

[0038] By employing the above technical solution, this application has at least the following advantages and beneficial effects:

[0039] This application is the first to discover a SNP in the TSHR gene that is significantly associated with heat stress resistance in sheep, and can serve as a molecular marker for this trait. Sheep individuals identified using this method possess relatively strong heat stress resistance, and can be used to breed new sheep breeds with heat stress resistance.

[0040] The following embodiments are used to illustrate this application, but are not intended to limit the scope of this application. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0041] Example 1: Discovery of SNP molecular markers in the TSHR gene

[0042] Redundancy analysis (RDA) was performed on climate data and resequencing genomic data, revealing that annual temperature range (bio7) and precipitation in the driest month (bio14) could explain most of the environmental factor variation for different genotypes. Resequencing data from 400 individuals of eight local sheep breeds (Tibetan sheep, Oula sheep, Large-tailed Han sheep, Small-tailed Han sheep, Sishui fur sheep, Wadi sheep, Tan sheep, and Hu sheep) living in different temperature regions were used. Latent Factor Mixed Models (LFMM) were employed to correlate the environmental factor bio7 with genomic data. The results showed that significantly associated sites with bio7 were distributed across multiple chromosomes, suggesting the existence of major genes for adaptation to the bio7 environmental factor (Figure 1). Specifically, the chr7:90568094 locus in the intron region of the TSHR gene (reference genome version: ARS-UI Rammb v2.0) contained both A and C alleles. The frequency of the A allele was significantly higher than that of the C allele in sheep populations with strong heat stress resistance. Similarly, the frequency change of the chr7:90568094 allele was consistent with the distribution gradient of bio7, suggesting that the A allele at this locus helps sheep adapt to high-temperature environments and resist heat stress (Figure 1), and can be used as a molecular breeding marker for screening or introducing sheep with heat stress adaptability.

[0043] A SNP on the TSHR gene is significantly associated with heat stress resistance in sheep. This SNP is located at position 90568094 on sheep chromosome 7 (reference genome version: ARS-UI_Ramb_v2.0, GCF_016772045.1) and exhibits A / C polymorphism. When the genotype of this SNP locus is AA or AC, it has better heat resistance than CC and can be used as a molecular marker for heat stress resistance in sheep.

[0044] Example 2: Detection of SNP molecular markers

[0045] The SNP molecular marker detection method provided in this embodiment includes:

[0046] (1) The SNP is located at position 209 of the nucleotide sequence shown in SEQ ID NO:1. Based on the upstream and downstream sequences of this SNP site, specific primers for amplifying this fragment were designed:

[0047] Upstream primer TSHR-F1: 5′-TAGACTGGCTGCTGTAACCTC-3′ (SEQ ID NO:2)

[0048] Downstream primer TSHR-R1: 5′-CACAGCATTACCACAGTCTG-3′ (SEQ ID NO:3)

[0049] (2) Using the specific primers from (1), PCR amplification was performed on the sheep DNA sample to obtain an amplified product containing the mutated region. The amplified product was 460 bp (Figure 2). The sequence is as follows (where the 209th base is the mutated sequence), which is an A>C mutation: 5'-TAGACTGGCTGCTGTAACCTCTTACTTGGGTTTTTGTACATAAATGAGGTTAATTGACCCCCTTCCTCCATTTTTAGACTTCACAGTGCTCTGGAGCTTGATATCCAGCCATTGCCTGAAGAGGCCACGTCTGGACCATACCCTGTGGCATTTGTAAACAAGGCTGCTTATCACTGCCATCTGAGGAGTCAATTGGCCAGCACACCATNTGATGATTG ACTCTCTATCACTTTTTCCTTACAGTGAAAGTTTAGCATGGCCCACCTCATTATTTTGAAGGAAAAGTGCATTGCTTTTTTGATTCAATCCTTTATAACCTTCACTCAGGAGATAGTTACAGAGGCATTGTACTTGGCATTGGTGATACAGCAATGAGTAAGACAGAGCTTACATCCTGATTGGGGAGACAATGAAAAAGTAAACAAAGAAGCAAGATAATCACAGACTGTGGTAATGCTGTG-3'(SEQ ID NO:1).

[0050] The amplification system is shown in Table 1:

[0051] Table 1 TSHR amplification system

[0052] 2× Max Master Mix is ​​a high-fidelity PCR enzyme from Nanjing Novizan Biotechnology Co., Ltd., catalog number P525-02.

[0053] The amplification conditions were as follows: Amplification was performed using a PCR amplification instrument. The first stage was pre-denaturation at 95℃ for 5 min; the second stage was denaturation at 95℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 30 s, for 34 cycles; the third stage was final extension at 72℃ for 5 min, and storage at 4℃.

[0054] (3) The amplified products were subjected to Sanger sequencing to obtain the genotype of the SNP locus.

[0055] Example 3: Validation of SNP molecular markers

[0056] In August, the genomes of 78 Hu sheep living in the same factory area with an ambient temperature of 28-35℃ and respiratory rates measured at temperatures of 30-34℃ were amplified. The amplification primers, amplification conditions, and amplification system were the same as in Example 2. The sequencing results of the PCR products showed that 28 sheep were homozygous individuals containing the SNP locus (genotype CC), 43 sheep were heterozygous individuals containing the SNP locus (genotype AC), and 7 sheep were wild-type individuals (genotype AA, consistent with the reference genome).

[0057] The respiratory rate (breaths / minute) of all sheep was measured multiple times, with the respiratory rate reflecting the degree of heat stress. A variance analysis was performed on the respiratory rate of each sheep and its genotype, and the results are shown in Table 2. Homozygous individuals with this molecular marker mutation had a higher respiratory rate than wild-type and heterozygous individuals, indicating a higher degree of heat stress. Significant differences were observed among the three genotypes, suggesting that sheep with genotypes AA and AC had lower respiratory rates and stronger resistance to heat stress.

[0058] Table 2. Analysis of variance of mean respiratory rate in sheep of different genotypes. Note: Different lowercase letters on the same shoulder label indicate significant differences (P<0.05).

[0059] The experimental results above show that locus 90568094 on chromosome 7 of sheep (reference genome version is ARS-UI_Ramb_v2.0, GCF_016772045.1) has A / C polymorphism. When the genotype at this locus is AA or AC, the average respiratory rate and heat stress indicators are significantly reduced. Sheep individuals with genotypes AA and AC have better heat stress resistance than individuals with genotype CC.

[0060] Although this application has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, such modifications or improvements made without departing from the spirit of this application are all within the scope of protection claimed in this application.

Claims

1. SNP molecular markers associated with heat stress resistance in sheep, characterized in that, The molecular marker contains a nucleotide sequence of the sheep TSHR gene, as shown in SEQ ID NO:1, with a polymorphism of A / C at position 209.

2. The molecular marker of claim 1, wherein Sheep individuals with genotypes AA and AC at the aforementioned polymorphic sites exhibit higher heat stress resistance than sheep individuals with genotype CC.

3. The molecular marker according to claim 1, characterized in that, The sheep TSHR gene has the reference sequence number NC_056060.1 and ARS-UI_Ramb_v2.0 in NCBI.

4. Primers for amplifying the molecular marker according to any one of claims 1 to 3, characterized in that, This includes the upstream primer shown in SEQ ID NO:2 and the downstream primer shown in SEQ ID NO:

3.

5. A detection reagent or kit containing the primers described in claim 4.

6. A method for identifying and breeding heat-stress-resistant sheep breeds, characterized in that, include: 1) Extract total DNA from the sheep to be tested; 2) Using DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO:2-3; 3) Analyze the PCR amplification products.

7. The method of claim 6, wherein, The PCR reaction system consisted of 12.5 μL of 2×Phanta Max Master Mix, 50-100 ng of DNA template, 1 μL each of 10 μM upstream and downstream primers, and ddH2O to a final volume of 25 μL.

8. The method according to claim 6, characterized in that, The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles; 72℃ final extension for 5 min.

9. The method according to claim 6 or 7, characterized in that, Step 3) includes: performing Sanger sequencing on the amplified products to obtain the genotypes of the sites with the polymorphisms. Sheep individuals with genotypes AA and AC have higher heat stress resistance than sheep individuals with genotype CC.

10. Any of the following applications of the molecular marker or its detection reagent according to any one of claims 1 to 3: (1) Used for early prediction of heat stress in sheep; (2) Used for molecular marker-assisted breeding of sheep.

11. The application according to claim 10, characterized in that, Sheep individuals with genotypes AA and AC at the molecular marker sites exhibit higher heat stress resistance than sheep individuals with genotype CC.

Images