Mutant mir396 and use thereof

By introducing the mutant miR396 into maize, the problem of maize diseases and pests was solved, the disease resistance and yield of maize were enhanced, and high resistance to bacterial wilt and stalk rot and yield improvement were achieved.

WO2026113886A1PCT designated stage Publication Date: 2026-06-04SHANDONG SHUNFENG BIOTECH CO LTD

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
SHANDONG SHUNFENG BIOTECH CO LTD
Filing Date
2025-11-07
Publication Date
2026-06-04

AI Technical Summary

Technical Problem

Current technologies suffer from severe diseases and pests that affect corn production, and there is a lack of effective gene regulation methods to improve corn's disease resistance and yield.

Method used

By introducing mutant miR396, especially miR396c and miR396d, into maize, base mutations such as deletions or insertions can be performed to enhance maize's disease resistance and increase its yield.

Benefits of technology

It enhances corn's resistance to bacterial wilt and stalk rot, increases corn yield and ear size, and increases single kernel weight, enhancing disease resistance by at least 10-500% and increasing yield by 5-100%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025133265-FTAPPB-I100001
    Figure PCTCN2025133265-FTAPPB-I100001
  • Figure PCTCN2025133265-FTAPPB-I100002
    Figure PCTCN2025133265-FTAPPB-I100002
  • Figure PCTCN2025133265-FTAPPB-I100003
    Figure PCTCN2025133265-FTAPPB-I100003
Patent Text Reader

Abstract

Provided are a mutant miR396 and use thereof. The mutant miR396 has a base mutation relative to a parent miR396. The parent miR396 is a wild-type miR396 derived from corn. The miR396 comprises miR396c and / or miR396d. The mutant miR396 can enhance the corn disease resistance and improve the corn yield.
Need to check novelty before this filing date? Find Prior Art

Description

A mutated miR396 and its applications

[0001] This application claims priority to Chinese patent application CN202411734385.4, filed on November 29, 2024. The entire contents of the aforementioned Chinese patent application are incorporated herein by reference. Technical Field

[0002] This invention belongs to the field of biotechnology, specifically relating to a mutated miR396 and its applications, particularly to a mutated miR396 and its application in enhancing maize disease resistance and increasing maize yield. Background Technology

[0003] Corn is an important food, feed, and industrial raw material, playing a vital role in global food production. However, corn production is significantly impacted by diseases and pests, including ear rot, stalk rot, bacterial wilt, large leaf spot, and southern rust.

[0004] To obtain superior maize lines, we studied relevant genes in maize. MicroRNAs (miRNAs) are a class of non-coding single-stranded small RNA molecules that regulate target genes by binding to their mRNA through base pairing. During plant growth, plant miRNAs play a crucial role in regulating meristematic tissue characteristics, leaf polarity, and flowering patterns. Our research on miRNAs revealed that the miR396 mutation in maize enhances disease resistance and increases yield. Summary of the Invention

[0005] The purpose of this invention is to provide a mutated miR396 and its applications.

[0006] On one hand, the present invention provides a mutated miR396, wherein the mutated miR396 has a base mutation relative to the parent miR396, wherein the parent miR396 is a wild-type miR396 derived from maize, and the miR396 includes miR396c and / or miR396d.

[0007] In one embodiment, the base mutation includes base deletion, base insertion, or base substitution.

[0008] In one implementation, the mutated miR396 is selected from any one of the following (1)-(5):

[0009] (1) The nucleic acid sequence of the parent miR396c is as shown in SEQ ID No.3, and the mutated miR396c has a base deletion relative to the sequence shown in SEQ ID No.3;

[0010] (2) The nucleic acid sequence of the parent miR396d is as shown in SEQ ID No. 4, and the mutated miR396d has a base deletion relative to the sequence shown in SEQ ID No. 4;

[0011] (3) The nucleic acid sequence of the parent miR396d is as shown in SEQ ID No. 4, and the mutated miR396d has a base insertion relative to the sequence shown in SEQ ID No. 4;

[0012] (4) The nucleic acid sequence of the parent miR396c is as shown in SEQ ID No. 3, and the mutated miR396c has a base deletion relative to the sequence shown in SEQ ID No. 3; the nucleic acid sequence of the parent miR396d is as shown in SEQ ID No. 4, and the mutated miR396d has a base insertion relative to the sequence shown in SEQ ID No. 4.

[0013] (5) The nucleic acid sequence of the parent miR396c is as shown in SEQ ID No. 3, and the mutated miR396c has a base deletion relative to the sequence shown in SEQ ID No. 3; the nucleic acid sequence of the parent miR396d is as shown in SEQ ID No. 4, and the mutated miR396d has a base deletion relative to the sequence shown in SEQ ID No. 4.

[0014] In one embodiment, the mutated miR396c lacks bases 141-151 relative to the sequence shown in SEQ ID No. 3. Preferably, the nucleic acid sequence of the mutated miR396c is as shown in SEQ ID No. 5.

[0015] In one embodiment, the mutated miR396c lacks the 151st base relative to the sequence shown in SEQ ID No. 3. Preferably, the nucleic acid sequence of the mutated miR396c is as shown in SEQ ID No. 8.

[0016] In one embodiment, the mutated miR396c lacks bases 146-156 relative to the sequence shown in SEQ ID No. 3. Preferably, the nucleic acid sequence of the mutated miR396c is as shown in SEQ ID No. 9.

[0017] In one embodiment, the mutated miR396d lacks bases 198-208 relative to the sequence shown in SEQ ID No. 4. Preferably, the nucleic acid sequence of the mutated miR396d is as shown in SEQ ID No. 6.

[0018] In one embodiment, the mutated miR396d inserts a base after the 203rd base relative to the sequence shown in SEQ ID No. 4. Preferably, the nucleic acid sequence of the mutated miR396d is shown in SEQ ID No. 7.

[0019] In one embodiment, the mutated miR396c lacks the 151st base relative to the sequence shown in SEQ ID No. 3, and the mutated miR396d has an inserted base after the 203rd base relative to the sequence shown in SEQ ID No. 4. Preferably, the nucleic acid sequence of the mutated miR396c is shown in SEQ ID No. 8, and the nucleic acid sequence of the mutated miR396d is shown in SEQ ID No. 7.

[0020] In one embodiment, the mutated miR396c lacks bases 146-156 relative to the sequence shown in SEQ ID No. 3, and the mutated miR396d lacks bases 198-208 relative to the sequence shown in SEQ ID No. 4. Preferably, the nucleic acid sequence of the mutated miR396c is shown in SEQ ID No. 9, and the nucleic acid sequence of the mutated miR396d is shown in SEQ ID No. 6.

[0021] In one embodiment, the parent miR396 is a wild-type miR396 derived from maize.

[0022] In one embodiment, the maize is maize inbred line Chang 7-2.

[0023] In one embodiment, the parent miR396c is derived from maize and has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the sequence shown in SEQ ID No. 3.

[0024] In one specific embodiment, the sequence of the parent miR396c is shown in SEQ ID No. 3.

[0025] In one embodiment, the parent miR396d is derived from maize and has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the sequence shown in SEQ ID No. 4.

[0026] In one specific embodiment, the sequence of the parent miR396d is shown in SEQ ID No. 4.

[0027] On the other hand, the present invention provides the use of the above-mentioned mutated miR396 for improving maize traits, or for use in the preparation of reagents or kits for improving maize traits, wherein the improved traits are selected from one or more of the following (i)-(iv):

[0028] (i) Enhance disease resistance;

[0029] (ii) Increase production;

[0030] (iii) Increase the size of the fruit cluster;

[0031] (iv) Increase particle weight.

[0032] In one embodiment, the enhanced disease resistance refers to enhanced resistance to bacterial wilt and / or stem rot.

[0033] In one embodiment, the enhanced disease resistance refers to enhanced resistance to Fusarium, Pythium, or Anthrax.

[0034] In one embodiment, the enhanced disease resistance means that the maize containing the mutant miR396 has at least 10% more disease resistance than the parent maize (containing wild-type miR396), preferably 20%, preferably 30%, preferably 40%, preferably 50%, preferably 100%, preferably 200%, preferably 300%, preferably 400%, preferably 500%.

[0035] In one embodiment, the enhanced disease resistance means that the disease resistance level of maize containing the mutant miR396 is improved by at least one level compared with the parent maize (containing wild-type miR396), preferably by two levels, preferably by three levels, and preferably by four levels.

[0036] In one embodiment, the increased yield means that the maize containing the mutant miR396 has a yield, or yield per plant, or yield per acre that is at least 5% higher than that of the parent maize (containing wild-type miR396), preferably 10%, preferably 15%, preferably 20%, preferably 21%, preferably 25%, preferably 30%, preferably 40%, preferably 50%, preferably 60%, preferably 100%.

[0037] In one embodiment, the enlarged ear refers to the ear of maize containing the mutant miR396 being at least 3% larger than that of the parent maize (containing wild-type miR396), preferably 5%, preferably 6%, preferably 10%, preferably 15%, preferably 20%, preferably 23%, preferably 25%, preferably 30%, preferably 40%, preferably 50%, preferably 100%.

[0038] In one embodiment, the increase in kernel weight means that the single kernel weight, hundred kernel weight, or thousand kernel weight of maize containing the mutant miR396 is increased by at least 5%, preferably by 10%, preferably by 12%, preferably by 13%, preferably by 15%, preferably by 20%, preferably by 25%, preferably by 30%, preferably by 40%, preferably by 50%, and preferably by 100% compared to the parental maize (containing wild-type miR396).

[0039] On the other hand, the present invention provides a method for preparing trait-modified maize cells, or maize seeds, or maize tissues, or maize parts, or maize, the method comprising the step of introducing the mutated miR396 into the maize cells, or maize seeds, or maize tissues, or maize parts, or maize.

[0040] In one embodiment, introducing the mutated miR396 includes the step of mutating endogenous miR396 in maize to introduce the mutated miR396.

[0041] In one implementation, methods for introducing mutations include natural variation, physical mutagenesis (such as ultraviolet mutagenesis, X-ray or gamma-ray mutagenesis), chemical mutagenesis (such as nitrite, hydroxylamine, EMS, nitrosoguanidine, etc.), biological mutagenesis (such as virus or bacterial-mediated mutagenesis), and gene editing.

[0042] In one embodiment, the mutated miR396 is introduced into maize cells, or maize seeds, or maize tissues, or maize parts, or maize through gene editing.

[0043] In one embodiment, the method includes the following steps:

[0044] (1) Introduce an expression vector containing gene editing tools into maize cells, or maize seeds, or maize tissues, or maize parts, or maize.

[0045] (2) Apply gene editing tools to maize endogenous miR396 and induce mutations in it;

[0046] (3) Screen for mutated large maize cells, or maize seeds, or maize tissues, or maize parts, or maize;

[0047] (4) Isolate the gene editing tool.

[0048] In one implementation, the gene editing tools include CRISPR, TALEN, and ZFN.

[0049] In one embodiment, the gene editing tool is a Cas enzyme.

[0050] In one specific implementation, the gene editing is performed using the Cas enzyme in maize cells, or maize seeds, or maize tissues, or maize parts, or maize.

[0051] In one embodiment, introducing the mutated miR396 includes the step of expressing the mutated miR396 in maize cells, or maize seeds, or maize tissues, or maize parts, or maize.

[0052] On the other hand, the present invention also provides a method for preparing maize with improved traits or improving maize traits, the method comprising the steps of: regenerating maize cells, or maize seeds, or maize tissues, or maize parts prepared by the above method into maize plants, thereby obtaining maize with improved traits.

[0053] On the other hand, the present invention also provides a method for gene editing of maize, the method comprising the steps of:

[0054] (a) Gene editing is performed in maize cells, maize seeds, maize tissues or maize parts using Cas enzyme and gRNA to obtain gene-edited maize cells, maize seeds, maize tissues or maize parts;

[0055] (b) Regenerate maize plants from the gene-edited maize cells, maize seeds, maize tissues or maize parts from step (a);

[0056] The gRNA targets miR396 in maize.

[0057] In one embodiment, the Cas enzyme is Cas9, Cas12i, or a Cas12i mutant protein (e.g., Cas-SF01).

[0058] In one embodiment, the amino acid sequence of the Cas-SF01 is shown in SEQ ID No. 1.

[0059] In one specific embodiment, the Cas enzyme is linked to one or more NLS sequences. In one embodiment, the NLS sequence is linked to the N-terminus and / or C-terminus of the protein.

[0060] In one embodiment, the gRNA includes a first segment and a second segment; the first segment is also referred to as a "backbone region", "protein binding region", "protein binding sequence", or "direct repeat sequence"; the second segment is also referred to as a "target sequence for targeting nucleic acid", "target segment for targeting nucleic acid", or "guide sequence for targeting target sequence".

[0061] The first segment, "backbone region," "protein-binding region," "protein-binding sequence," or "homogeneous repeat sequence" of the gRNA can interact with the Cas enzyme of the present invention, thereby forming a complex between the Cas enzyme and the gRNA. The gRNA of the present invention guides the interacting Cas enzyme protein to a specific nucleotide sequence within the target nucleic acid through the targeting sequence of the target nucleic acid.

[0062] In one embodiment, the gRNA includes a unidirectional repeat sequence that binds to the Cas enzyme and a guide sequence that hybridizes to the target sequence.

[0063] The target sequence or target region of the nucleic acid targeted by this invention comprises a nucleotide sequence complementary to a sequence in the target nucleic acid. In other words, the target sequence or target region of the nucleic acid targeted by this invention interacts with the target nucleic acid in a sequence-specific manner through hybridization (i.e., base pairing). Therefore, the target sequence or target region of the nucleic acid targeted by this invention can be altered or modified to hybridize with any desired sequence within the target nucleic acid.

[0064] Preferably, the gRNA comprises a first segment and a second segment in the 5' to 3' direction.

[0065] In this invention, the second segment can also be understood as a guide sequence for hybridization with the target sequence.

[0066] In one embodiment, the guide sequence of the gRNA is shown in SEQ ID No. 2.

[0067] In one embodiment, the unidirectional repeat sequence of the gRNA is agagaaugugugcauagucacac.

[0068] In other embodiments, the homologous repeat sequence of the gRNA may have base deletions, substitutions, or additions based on agagaaugugugcauagucacac, as long as it can ensure the binding ability with Cas enzyme, for example, "agagaaugugugcauagucaacac", "agagaaugugugcauagucuacac", "agagaaugugugcauaguccacac", or "agagaaugugugcauagucgacac" as described in Chinese patent application (CN113337502A).

[0069] In one embodiment, the nucleic acid sequence encoding the Cas enzyme and the nucleic acid encoding the guide RNA are artificially synthesized.

[0070] In one embodiment, the gene editing method of the present invention includes the steps of delivering Cas enzyme and gRNA to maize cells, maize seeds, maize tissues or maize parts or maize.

[0071] The above delivery can be performed using any method known in the art. Such methods include, but are not limited to, transformation, transfection, electroporation, lipid transfection, microinjection, acoustic pore effect, gene gun, calcium phosphate-mediated transfection, cationic transfection, liposome transfection, dendritic transfection, heat shock transfection, nuclear transfection, magnetic transfection, lipid transfection, puncture transfection, optical transfection, reagent-enhanced nucleic acid uptake, and delivery via liposomes, immunoliposomes, viral particles, vectors, viral vectors, artificial viruses, etc.

[0072] In some implementations, one or more AAV vectors, lentiviral vectors, nanoparticles, or combinations thereof are used to deliver one or more components of Cas enzyme and gRNA.

[0073] In one embodiment, Cas enzyme and gRNA are delivered to maize cells, maize seeds, maize tissues or maize parts or maize via Agrobacterium-mediated transformation.

[0074] The aforementioned gRNA targets miR396 in maize cells and guides the Cas protein to the genomic locus, whereby it modifies, edits, or cuts the target sequence, thereby causing a mutation in miR396.

[0075] On the other hand, the present invention also provides a method for preparing hybrid maize, the method comprising the step of hybridizing the maize obtained by the above method with other maize to prepare hybrid maize.

[0076] Terminology Definition

[0077] Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0078] The terms “polynucleotide,” “nucleotide sequence,” “nucleic acid sequence,” “nucleic acid molecule,” and “nucleic acid” are used interchangeably and include DNA, RNA, or their hybrids, which can be double-stranded or single-stranded.

[0079] The terms "protein," "polypeptide," and "peptide" are used interchangeably in this invention to refer to polymers of amino acid residues, including polymers in which one or more amino acid residues are chemical analogs of natural amino acid residues. The proteins and polypeptides of this invention can be generated through recombinant synthesis or through chemical synthesis.

[0080] The term "amino acid" refers to a carboxylic acid containing an amino group. Various proteins in living organisms are composed of 20 basic amino acids.

[0081] The term "encoding" refers to the inherent characteristics of a specific nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, which serves as a template for the synthesis of other polymers and macromolecules in biological processes that have defined nucleotide sequences (i.e., rRNA, tRNA, and mRNA) or defined amino acid sequences and the biological characteristics they produce. Therefore, if the transcription and translation of the mRNA corresponding to a gene produces a protein in a cell or other biological system, then that gene encodes that protein.

[0082] As used herein, the term "identity" refers to the sequence matching between two polypeptides or two nucleic acids. Two compared sequences are identical at a position when the same base or amino acid monomeric subunit occupies the same location (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine). The "percentage identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared × 100. For example, if six out of ten positions in two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (three out of six positions match). Typically, two sequences are compared to produce the maximum identity. Such comparisons can be made using methods readily available, for example, computer programs such as the Align program (DNAstar, Inc.) Needleman et al. (1970) J. Mol. Biol. 48: 443-453. The percentage identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4:11-17 (1988)) integrated into the ALIGN program (version 2.0), which uses a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percentage identity between two amino acid sequences can be determined using the Needleman and Wunsch algorithm (J MoI Biol. 48:444-453 (1970)) in the GAP program integrated into the GCG software package (available at www.gcg.com), which uses a Blossum 62 matrix or a PAM250 matrix, along with gap weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6.

[0083] The term "regulatory element," as used herein, is intended to include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences), for detailed description in Goeddel, *Gene Expression Technology: Methods in Enzymology*, 185, Academic Press, San Diego, California (1990). In some cases, regulatory elements include those sequences that direct constitutive expression of a nucleotide sequence in many types of host cells and those sequences that direct expression of that nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can primarily direct expression in the desired tissue of interest, such as muscle, neurons, bone, skin, blood, specific organs (e.g., liver, pancreas), or specific cell types (e.g., lymphocytes). In some cases, regulatory elements can also direct expression in a time-dependent manner (e.g., cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue- or cell type-specific. In some cases, the term "regulatory element" encompasses enhancer elements such as WPRE; CMV enhancer; the R-U5' fragment in the LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), pp. 466-472, 1988); SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), pp. 1527-31, 1981).

[0084] As used herein, the term "promoter" has the meaning known to those skilled in the art, referring to a non-coding nucleotide sequence located upstream of a gene that initiates the expression of a downstream gene. A constitutive promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when the cell is a cell of the tissue type corresponding to that promoter.

[0085] The term "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" a protein to allow it to be transported to the cell nucleus via nuclear transport; that is, a protein with an NLS is transported to the cell nucleus. Typically, an NLS contains positively charged Lys or Arg residues exposed on the protein surface. Exemplary nuclear localization sequences include, but are not limited to, NLS from the following: SV40 large T antigen, EGL-13, c-Myc, and TUS protein.

[0086] As used herein, the term “operably linked” is intended to mean that the nucleotide sequence of interest is linked to one or more regulatory elements in a manner that allows the expression of that nucleotide sequence (e.g., in an in vitro transcription / translation system or in the host cell when the vector is introduced into the host cell).

[0087] wild type

[0088] As used herein, the term “wildtype” has the meaning commonly understood by those skilled in the art as referring to the typical form of an organism, strain, or gene, or the characteristic that distinguishes it from mutant or variant forms when it exists in nature, is separable from its natural source and has not been intentionally modified by humans.

[0089] carrier

[0090] The term "vector" refers to a nucleic acid molecule capable of delivering another nucleic acid molecule linked to it. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; nucleic acid molecules including one or more free ends, or without free ends (e.g., circular); nucleic acid molecules including DNA, RNA, or both; and a wide variety of other polynucleotides known in the art. A vector can be introduced into a host cell through transformation, transduction, or transfection, thereby enabling the expression of its carried genetic material elements in the host cell. A vector can be introduced into a host cell to produce transcripts, proteins, or peptides, including proteins, fusion proteins, isolated nucleic acid molecules, etc., as described herein (e.g., CRISPR transcripts, such as nucleic acid transcripts, proteins, or enzymes). A vector may contain a variety of elements controlling expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, the vector may contain a replication initiation site.

[0091] One type of vector is a "plasmid," which is a circular double-stranded DNA loop into which another DNA fragment can be inserted, for example, using standard molecular cloning techniques.

[0092] Another type of vector is the viral vector, in which a virus-derived DNA or RNA sequence is present in a vector used to package the virus (e.g., retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno-associated viruses). Viral vectors also contain polynucleotides carried by the virus used for transfection into a host cell. Some vectors (e.g., bacterial vectors with bacterial origins of replication and episodic mammalian vectors) are capable of autonomous replication in the host cells into which they are introduced.

[0093] Other vectors (e.g., non-attachment mammalian vectors) integrate into the host cell's genome upon introduction and thereby replicate along with the host genome. Furthermore, some vectors are capable of directing the expression of genes they are operatively linked to. Such vectors are referred to herein as "expression vectors."

[0094] host cells

[0095] As used herein, the term “host cell” refers to a cell that can be used to introduce a vector, including but not limited to prokaryotic cells such as Escherichia coli or Bacillus subtilis, and eukaryotic cells such as microbial cells, fungal cells, animal cells, and plant cells.

[0096] Those skilled in the art will understand that the design of expression vectors can depend on factors such as the selection of host cells to be transformed and the desired expression level.

[0097] animal

[0098] For example, mammals, such as bovids, equines, sheep, suidae, canids, felines, lagos, rodents (e.g., mice or rats), non-human primates (e.g., macaques or cynomolgus monkeys), or humans. In some embodiments, the subject (e.g., a human) suffers from a condition (e.g., a condition caused by a disease-related gene defect).

[0099] plant

[0100] The term "plant" should be understood as any differentiated multicellular organism capable of photosynthesis, including crop plants at any stage of maturity or development, particularly monocotyledonous or dicotyledonous plants, vegetable crops including artichokes, kohlrabi, arugula, leeks, asparagus, lettuce (e.g., head lettuce, leaf lettuce, longleaf lettuce), bok choy, taro, cucurbits (e.g., melons, watermelons, crenshaw, cantaloupes, Roman melons), rapeseed crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, headless cabbage, Chinese cabbage, bok choy), artichokes, carrots, napa cabbage, okra, onions, celery, parsley, chickpeas, parsnip, chicory, peppers, potatoes, gourds (e.g., zucchini, cucumbers, baby zucchini, squash, pumpkin), radishes, dried artichokes, etc. Onions, turnips, purple eggplant (also known as eggplant), ginseng, lettuce, scallions, chicory, garlic, spinach, green onions, squash, leafy greens, beets (sugar beets and fodder beets), sweet potatoes, romaine lettuce, wasabi, tomatoes, turnips, and spices; fruits and / or vine crops such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, citrus fruits, blueberries, boysenberry. y), cranberries, currants, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pears, melons, mangoes, papayas, and lychees; field crops such as clover, alfalfa, evening primrose, miscanthus, corn / maize (feed corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain cereals (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, legumes (beans, lentils, peas, soybeans). Oil-bearing plants (rapeseed, mustard, poppy, olive, sunflower, coconut, castor oil plants, cocoa beans, peanuts), Arabidopsis, fiber plants (cotton, flax, hemp, jute), Lauraceae (cinnamon, camphor), or a plant such as coffee, sugarcane, tea, and natural rubber plants; and / or bedding plants, such as flowering plants, cacti, succulents and / or ornamental plants, and trees such as forests (broadleaf trees and evergreen trees, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other seedlings.

[0101] The term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant callus, plant masses, as well as plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, kernels, spikes, roots, root tips, anthers, etc.

[0102] The term “plant cell” should be understood as any cell that is derived from or found in a plant and is capable of forming, for example: undifferentiated tissues such as callus, differentiated tissues such as embryos, components of a plant, or seeds.

[0103] Gene editing

[0104] The term "gene editing" technology includes CRISPR, TALEN, and ZFN technologies. CRISPR technology refers to clustered, regularly interspaced short palindromic repeats derived from the microbial immune system. Gene editing tools include guide RNA and Cas proteins (such as Cas9, Cpf1, Cas12b, and Cas12i). The gene editing tools referred to in TALEN technology are restriction enzymes capable of cleaving specific DNA sequences, comprising a TAL effector DNA-binding domain and a DNA-cleaving domain. The gene editing tools referred to in ZFN technology are also restriction enzymes capable of cleaving specific DNA sequences, comprising a zinc finger DNA-binding domain and a DNA-cleaving domain. Those skilled in the art know that by constructing nucleotides and other regulatory elements encoding gene editing tools into suitable vectors and then transforming them into cells, intracellular genome editing can be achieved, including gene knockout, insertion, and base editing.

[0105] CRISPR system

[0106] As used herein, the terms “regularly clustered short palindromic repeats (CRISPR)-CRISPR-related (Cas) (CRISPR-Cas) system” or “CRISPR system” are used interchangeably and have the meaning commonly understood by those skilled in the art, which typically includes transcripts or other elements relating to the expression of CRISPR-related (“Cas”) genes, or transcripts or other elements capable of directing the activity of said Cas genes.

[0107] Cas protein

[0108] Cas protein, Cas enzyme, or CRISPR-related protein refers to a nuclease applicable to the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system. Preferably, the Cas protein is a CRISPR enzyme, including but not limited to: Cas9, Cas12, Cas13, Cas14, Csm1, and FDK1 proteins. The Cas proteins can have different structures depending on their origin, such as SpCas9 from *Streptococcus pyogenes* and SaCas9 from *Staphylococcus aureus*; they can also be classified according to structural features (such as domains), such as the Cas12 family including Cas12a (also known as Cpf1), Cas12b, Cas12c, and Cas12i. The Cas proteins can be double-stranded, single-stranded, or have no cleavage activity. The Cas protein described in this invention can be wild-type or a mutant thereof. The mutation types of the mutants include amino acid substitution, replacement, or deletion. The mutants may or may not alter the enzymatic cleavage activity of the Cas protein. As is known to those skilled in the art, various Cas proteins with nucleic acid cleavage activity have been reported in the prior art. These known proteins or their modified variants can achieve the functions of this invention, and are included in the scope of protection herein by reference.

[0109] As is well known in the art, one or more amino acid residues can be altered (replaced, deleted, truncated, or inserted) from the N and / or C ends of a protein while retaining its functional activity. Therefore, proteins that have one or more amino acid residues altered from their N and / or C ends while retaining their desired functional activity are also within the scope of this invention. These alterations can include those introduced by modern molecular methods such as PCR, which includes PCR amplification that alters or lengthens the protein-coding sequence by means of oligonucleotides containing amino acid-coding sequences used in the PCR amplification.

[0110] It should be recognized that proteins can be altered in various ways, including amino acid substitutions, deletions, truncations, and insertions, and methods for such operations are generally known in the art. For example, amino acid sequence variants of the aforementioned proteins can be prepared by mutating DNA. This can also be accomplished through other forms of mutagenesis and / or directed evolution, for example, using known mutagenesis, recombination, and / or shuffling methods, combined with relevant screening methods, to perform single or multiple amino acid substitutions, deletions, and / or insertions.

[0111] Those skilled in the art will understand that these minor amino acid changes in the Cas protein of the present invention can occur (e.g., naturally occurring mutations) or be generated (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site, or other functional domains of the protein, the properties of the polypeptide may be altered, but the polypeptide may retain its activity. If the mutations are not located near the catalytic domain, active site, or other functional domains, a smaller impact can be expected.

[0112] Those skilled in the art can identify the essential amino acids of the Cas mutant protein of the present invention using methods known in the art, such as localized mutagenesis, protein evolution, or bioinformatics analysis. The catalytic domains, active sites, or other functional domains of the protein can also be determined through physical structural analysis, such as by techniques like nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, combined with mutations in presumed key site amino acids.

[0113] In this invention, amino acid residues can be represented by a single letter or by three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamic acid (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), and arginine (Arg, R).

[0114] The biological functions of the Cas protein include, but are not limited to, activities that bind to guide RNA, endonuclease activities, and activities that bind to and cleave specific sites of target sequences under the guidance of guide RNA, including but not limited to Cis cleavage activities and Trans cleavage activities.

[0115] Guide RNA (gRNA)

[0116] As used herein, the terms “guide RNA (gRNA),” “mature crRNA,” and “guide sequence” are used interchangeably and have the meanings commonly understood by those skilled in the art. Generally, guide RNA may comprise a direct repeat sequence and a guide sequence, or consist substantially of or composed of a direct repeat sequence and a guide sequence.

[0117] In some cases, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence to hybridize with the target sequence and guide the specific binding of the CRISPR / Cas complex to the target sequence. In one embodiment, the complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% when optimal alignment is achieved. Determining the optimal alignment is within the capabilities of a person skilled in the art. For example, publicly available and commercially available alignment algorithms and programs exist, such as, but not limited to, ClustalW, the Smith-Waterman algorithm in MATLAB, Bowtie, Geneious, Biopython, and SeqMan.

[0118] target sequence

[0119] A "target sequence" refers to a polynucleotide targeted by a guide sequence in the gRNA, such as a sequence complementary to that guide sequence, where hybridization between the target and guide sequences will promote the formation of a CRISPR / Cas complex (including the Cas protein and gRNA). Perfect complementarity is not required, as long as sufficient complementarity exists to induce hybridization and promote the formation of a CRISPR / Cas complex.

[0120] The target sequence can contain any polynucleotide, such as DNA or RNA. In some cases, the target sequence is located inside or outside the cell. In some cases, the target sequence is located in the cell nucleus or cytoplasm. In some cases, the target sequence may be located in an organelle of a eukaryotic cell, such as a mitochondrion or chloroplast. The sequence or template that can be used for recombination into a target locus containing the target sequence is referred to as an "edit template," "edit polynucleotide," or "edit sequence." In one embodiment, the edit template is a foreign nucleic acid. In one embodiment, the recombination is homologous recombination.

[0121] In this invention, the "target sequence," "target polynucleotide," or "target nucleic acid" can be any endogenous or exogenous polynucleotide for a cell (e.g., a eukaryotic cell). For example, the target polynucleotide can be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or useless DNA). In some cases, the target sequence should be associated with a protospacer adjacent motif (PAM).

[0122] miR396

[0123] miR396 is a highly conserved class of endogenous non-coding single-stranded small RNA molecules, 20–24 nucleotides in length. The plant miR396 family exhibits minimal sequence variation throughout long-term biological evolution, demonstrating high conservation. miR396 influences the growth and development of various plant organs by binding to the mRNA of target gene growth-regulating factors (GRFs) through base pairing, thereby regulating their expression.

[0124] In one embodiment, the sequence of corn miR396c is shown in SEQ ID No. 3; the sequence of corn miR396d is shown in SEQ ID No. 4.

[0125] The sequence involved in this invention is as follows:

[0126] The main advantages of this invention are:

[0127] This invention uses gene editing technology to directionally edit maize miR396, and found that after the miR396c and / or miR396d mutations, the disease resistance of maize is enhanced and the yield is increased. Attached Figure Description

[0128] Figure 1. Comparison of ears of edited plants and wild-type plants. The control is wild-type maize plant (Chang 7-2), and KO1-KO5 are edited plants.

[0129] Figure 2. Comparison of 100-grain weight between edited plants and wild-type plants. The control group is wild-type maize plants (Chang 7-2), and KO1-KO5 are edited plants.

[0130] Figure 3. Comparison of yield per plant between edited and wild-type plants. The control group is wild-type maize plant (Chang 7-2), and KO1-KO5 are edited plants.

[0131] Figure 4. Comparison of bacterial wilt incidence between edited and wild-type maize plants. The control group is wild-type maize plant (Chang 7-2), and KO1-KO5 are edited plants. Detailed Implementation

[0132] The present invention will be further described below with reference to embodiments. The following description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make equivalent modifications to the disclosed technical content to create equivalent embodiments. Any simple modifications or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the scope of the invention are all within the protection scope of the present invention.

[0133] Example 1: Obtaining Gene-Edited Maize

[0134] 1. Target design and vector construction

[0135] This embodiment utilizes Cas-SF01 and gRNA targeting miR396c and miR396d to edit the two genes mentioned above in maize. The specific operation method can be performed in accordance with conventional methods in the art. Among them, Cas-SF01 is a mutated Cas protein BC26312 from CN116004573B, and its amino acid sequence is shown in SEQ ID No. 1.

[0136] The nucleic acid sequences of maize miR396c and miR396d are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively. Based on these sequences, gRNAs were designed, and the guide sequence for the designed gRNAs is as follows:

[0137] The direct repeat sequence of the above gRNA is agagaaugugugcauagucacac (5' to 3'). The above gRNA includes the above direct repeat sequence and the guide sequence sequentially from 5' to 3'.

[0138] After the above gRNA targets the precursor sequences of miRNA396c and miRNA396d, it can cause mutations in the same mature sequence (UCCACAGGCUUUCUUGAACUGU) of miRNA396c and miRNA396d, thereby achieving the purpose of inactivating miR396c and miR396d.

[0139] The amino acid sequence of Cas-SF01 (SEQ ID No. 1):

[0140] The nucleic acid sequence of miR396c (SEQ ID No. 3):

[0141] The nucleic acid sequence of miR396d (SEQ ID No. 4):

[0142] Annealing primers were designed based on the target. After annealing, the primers were homologously ligated into a gene editing backbone vector using the T5 exonuclease. The gene editing vector contained the Cas-SF01 protein and the aforementioned gRNA.

[0143] The above ligation products were transformed into competent E. coli Trans-T1 cells, plated on Kans plates, and 8 colonies were selected for liquid culture for 2 hours. PCR was performed on the bacterial culture, and 2 correct single clones were selected for further analysis.

[0144] Select the correctly sequenced single clones for propagation, preservation, and plasmid extraction.

[0145] 2. Genetic transformation

[0146] The maize inbred line Chang 7-2 was selected, and gene editing was performed using the vector from step 1.

[0147] Transformation of Agrobacterium: The vector from step 1 was transformed into Agrobacterium strain EHA105 using the heat shock method. Single clones were picked, liquid cultured, and identified by PCR, and then stored in a -80℃ freezer for later use.

[0148] Strain activation: Remove the bacteria from the refrigerator and streak them on YEP solid medium.

[0149] Prepare Agrobacterium infection solution: Scrape fresh bacteria from the reactivated bacterial plate and resuspend them in the infection solution.

[0150] Extracting corn embryos: Take corn ears about 10 days after pollination, remove the husks and silks, pick out the embryos, and put them into an infection medium (without Agrobacterium) containing AS.

[0151] Infection: Wash the embryos to be transformed 3 times with the infection solution until the solution is clear. Pour out the infection solution and add 1 ml of bacterial solution. Gently invert the plate 10 times and let it stand for 5-10 minutes. Take a clean petri dish, place 3 sheets of sterile filter paper on it, and after infection, invert the plate a few times and quickly pour the bacterial solution onto the filter paper. Hold the petri dish and change its orientation to ensure that the bacterial solution carrying the embryos is evenly distributed on the filter paper.

[0152] Co-culture: When the bacterial culture is no longer visible on the top layer of filter paper, use tweezers to pick up the top layer of filter paper and place the side with the embryo on the co-culture medium. Use tweezers to remove the air bubbles between the filter paper and the medium, then use tweezers to hold a corner of the filter paper and quickly peel it off. Transfer the embryo left on the filter paper to the medium with an embryo removal knife, with the embryo shield facing up, and incubate in the dark at 22°C for 3 days.

[0153] Recovery culture: After co-culturing for 3 days, the embryos were transferred to recovery culture medium.

[0154] Differentiation: The embryos of the transformation vector differentiated directly on the differentiation medium.

[0155] Rooting: Transfer the differentiated seedlings to rooting medium, 3-4 seedlings per bottle, and culture at 25-28℃ under light until they grow into complete plants. White roots will grow out after 7 days of rooting culture, and samples can be taken for testing.

[0156] 3. Screening of positive seedlings and editing of plant types

[0157] For regenerated seedlings, a small number of leaves were taken and genomic DNA was extracted using the CTAB method.

[0158] If the target product can be amplified in the transformed seedlings using primers (CasF:CTGCTGAGGATCAAGGCCAA and Cas R:CCCACATGTTCCTGAACGGA), then the regenerated seedlings are transgenic positive seedlings.

[0159] For transgenic positive seedlings, the corresponding gene fragment was amplified using primers. The amplified product was sequenced using the Sanger method to confirm the editing pattern. If the sequencing result showed a double peak, the PCR product was ligated into a T vector, and five clones were selected for sequencing to confirm the editing pattern. The sequencing primers are as follows:

[0160] After 2-3 generations of self-pollination, homozygous edited seedlings without foreign gene insertion were obtained.

[0161] Editing miRNA396c and miRNA396d in the inbred line Chang 7-2 yielded edited plants KO1-KO5.

[0162] The editing type of the plant KO1 is: miRNA396c single mutation, miRNA396c deletes 11 bases from position 141 to 151, and its nucleic acid sequence is shown in SEQ ID No. 5. miRNA396d is wild type;

[0163] The editing type of the plant KO2 was: miRNA396d single mutation, miRNA396d deleted 11 bases from position 198 to 208, and its nucleic acid sequence of miRNA396d is shown in SEQ ID No. 6. miRNA396c is wild type;

[0164] The editing type of plant KO3 is: miRNA396d single mutation, with G inserted after the 203rd base of miRNA396d. The nucleic acid sequence of miRNA396d is shown in SEQ ID No.7. miRNA396c is wild type.

[0165] The editing type of the plant KO4 was: double mutation of miRNA396c and miRNA396d, with miRNA396c having a deletion of the 151st base, and its nucleic acid sequence is shown in SEQ ID No. 8; and miRNA396d having a G insertion at the 203rd base, and its nucleic acid sequence is shown in SEQ ID No. 7.

[0166] The editing type of plant KO5 is: double mutation of miRNA396c and miRNA396d. miRNA396c is missing 11 bases from position 146 to 156, and its nucleic acid sequence is shown in SEQ ID No. 9; and miRNA396d is missing 11 bases from position 198 to 208, and its nucleic acid sequence is shown in SEQ ID No. 6.

[0167] The miR396c nucleic acid sequence of KO1 (SEQ ID No. 5):

[0168] The nucleic acid sequence of KO2 miRNA396d (SEQ ID No. 6):

[0169] The nucleic acid sequence of KO3 miRNA396d (SEQ ID No. 7):

[0170] The miR396c nucleic acid sequence of KO4 (SEQ ID No. 8):

[0171] The miR396c nucleic acid sequence of KO5 (SEQ ID No. 9):

[0172] The editing types for plants KO1-KO5 are summarized below:

[0173] Example 2: Agronomic traits of gene-edited maize

[0174] The agronomic traits of wild-type maize plants (Chang 7-2) and edited plants KO1-KO5 were statistically analyzed.

[0175] Compared with wild-type maize plants, the ears of the edited materials KO1-KO5 were all larger (Fig. 1), the 100-kernel weight was significantly increased (Fig. 2), and the yield per plant was significantly increased (Fig. 3).

[0176] Natural incidence of bacterial wilt and stem rot in the field:

[0177] Bacterial wilt of maize is caused by single or combined infection of several Fusarium or Pythium fungi. Symptoms begin to appear during the grain-filling stage, with peak symptoms occurring from the milk stage to the waxy stage. Field observations at the waxy stage revealed that, compared to wild-type maize plants, edited plants KO1-KO5 showed significantly enhanced resistance to bacterial wilt. The resistance of miRNA396c and miRNA396d double mutants (KO4 and KO5) to bacterial wilt was even more pronounced than that of miRNA396c single mutants (KO1) and miRNA396d single mutants (KO2 and KO3) (Figure 4).

[0178] Maize stalk rot is a disease caused by the rotting of roots and stem bases due to the single or combined infection of various pathogens, mainly Pythium, Anthracnose, and Fusarium. Natural disease incidence in the field was recorded during the waxy ripening and large trumpet stages. The presence of irregular water-soaked lesions on the middle stem and leaf sheaths, the extent of plant rot, plant wilting, leaf death from top to bottom, and the presence of longitudinally expanding irregular brown spots and internal hollowing at the stem base internodes were used to assess the stalk rot infection status. Results showed that compared with wild-type maize plants, the edited plants KO1-KO5 exhibited significantly enhanced resistance to stalk rot. The resistance of the miRNA396c and miRNA396d double mutants (KO4 and KO5) to stalk rot was even more significantly enhanced than that of the miRNA396c single mutant (KO1) and the miRNA396d single mutant (KO2 and KO3).

[0179] The resistance of wild-type maize plants (Chang 7-2) and edited plants KO1-KO5 to bacterial wilt and stalk rot is shown in the table below:

[0180] Disease resistance levels: High resistance refers to an incidence rate of 0.0-5.0%; Resistance refers to an incidence rate of 5.1-10.0%; Moderate resistance refers to an incidence rate of 10.1-30.0%; Susceptibility refers to 30.1-40.0%; High susceptibility refers to 40.1% or higher.

[0181] This indicates that the miR396c and / or miR396d mutations in maize can increase maize yield and enhance maize disease resistance.

[0182] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. A mutated miR396, said mutated miR396 having a base mutation relative to a parent miR396, said parent miR396 being a wild-type miR396 derived from maize, said miR396 including miR396c and / or miR396d.

2. The mutated miR396 according to claim 1, characterized in that, The mutated miR396 is selected from any one of the following groups (1)-(5): (1) The mutated miR396c has a base deletion relative to the sequence shown in SEQ ID No. 3; (2) The mutated miR396d has a base deletion relative to the sequence shown in SEQ ID No. 4; (3) The mutated miR396d has a base insertion relative to the sequence shown in SEQ ID No. 4; (4) The mutated miR396c has a base deletion relative to the sequence shown in SEQ ID No. 3, and the mutated miR396d has a base insertion relative to the sequence shown in SEQ ID No. 4; (5) The mutated miR396c has a base deletion relative to the sequence shown in SEQ ID No. 3, and the mutated miR396d has a base deletion relative to the sequence shown in SEQ ID No.

4.

3. The use of the mutated miR396 according to any one of claims 1-2, characterized in that, The intended use is for improving maize traits, or for use in the preparation of reagents or kits for improving maize traits, wherein the improved trait is selected from one or more of the following (i)-(iv): (i) Enhance disease resistance; (ii) Increase production; (iii) Increase the size of the fruit cluster; (iv) Increase particle weight.

4. A method for preparing trait-modified maize cells, or maize seeds, or maize tissues, or maize parts, characterized in that, The method includes the step of introducing the miR396 mutation of any one of claims 1-2 into corn cells, or corn seeds, or corn tissues, or corn parts, or corn.

5. The method according to claim 4, characterized in that, Introducing the mutated miR396 according to any one of claims 1-2 includes the step of mutating endogenous miR396 in maize to introduce the mutated miR396.

6. The method according to claim 4, characterized in that, The mutated miR396 is introduced into maize cells, seeds, tissues, parts, or maize through gene editing.

7. A method for preparing trait-improved maize or improving maize traits, characterized in that, The method includes the following steps: The maize cells, maize seeds, maize tissues, or maize parts prepared by any of the methods described in claims 4-6 are regenerated into maize plants to obtain maize with the improved traits.

8. A method for gene editing in maize, characterized in that, The method includes the following steps: (a) Gene editing is performed in maize cells, maize seeds, maize tissues or maize parts using Cas enzyme and gRNA to obtain gene-edited maize cells, maize seeds, maize tissues or maize parts; (b) Regenerate maize plants from the gene-edited maize cells, maize seeds, maize tissues or maize parts from step (a); The gRNA targets miR396 in maize.

9. The method according to claim 8, characterized in that, The guide sequence in the gRNA that hybridizes with the target sequence is shown in SEQ ID No.

2.

10. A method for preparing hybrid maize, the method comprising the step of hybridizing maize prepared by any one of the methods of claims 4-9 with other maize to prepare hybrid maize.