Methods for reducing the environmental impact of manure

The use of calcium cyanamide and hydrogen peroxide in manure additives addresses the challenges of greenhouse gas emissions and zoonotic pathogens, improving soil health and plant growth through synergistic effects, offering a safer and more effective solution than existing technologies.

WO2026114764A1PCT designated stage Publication Date: 2026-06-04SOCIETE DES PRODUITS NESTLE SA
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/083836
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-11-26
Filing Date
2025-11-21
Publication Date
2026-06-04

Smart Images

  • Figure IMGF000019_0001_TABLE
    Figure IMGF000019_0001_TABLE
  • Figure IMGF000021_0001_TABLE
    Figure IMGF000021_0001_TABLE
  • Figure IMGF000023_0001_TABLE
    Figure IMGF000023_0001_TABLE
Patent Text Reader

Abstract

The present invention relates to a method for improving or reducing the environmental impact of manure. In particular, the invention relates to methods for maintaining or improving the health of manure treated soil, in particular through the management of zoonotic pathogens in manure by the application of manure additives. The invention further relates to a method of reducing the level of zoonotic pathogens in manure, particularly throughout storage of manure. Finally, the invention also relates to methods for reducing greenhouse gas emissions.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Methods for reducing the environmental impact of manure

[0002] Field of the invention

[0003] The present invention relates to a method for improving or reducing the environmental impact of manure. In particular, the invention relates to methods for maintaining or improving the health of manure treated soil, in particular through the management of zoonotic pathogens in manure by the application of manure additives. The invention further relates to a method of reducing the level of zoonotic pathogens in manure, particularly throughout storage of manure. Finally, the invention also relates to methods for reducing greenhouse gas emissions.

[0004] Background

[0005] It is widely accepted that animal manure is an excellent organic fertilizer. For example, it is known that the addition of animal manure to soil can provide nutrients, such as phosphorous, potassium and nitrogen, which are essential for plant growth, neutralize soil acidity and increase the carbon content of soil. However, particularly during storage, animal manure is degraded by microorganisms leading to the emission of greenhouses gases (GHG) such as methane and nitrous oxide, as well as other gases, such as ammonia and hydrogen sulfide.

[0006] A number of mitigation strategies exist to reduce GHG emissions, including manure additives. The currently recommended and scientifically proven additive for odour and emissions reduction is sulfuric acid. Nevertheless, this compound may lead to operational hazards at the farm level and therefore requires a specific application system which can be expensive. Other compounds, such as nitric acid, effectively reduce methane but lead to higher nitrogen emissions, particularly the greenhouse gas nitrous oxide.

[0007] Other products are commercially available, yet many do not demonstrate effectiveness based on scientific research. Their efficacy may be based on non-substantiated claims and farmer experiences. These additives consist of various chemical and biological compounds as well as minerals and other types of ingredients. The active ingredients are often not disclosed and the mode of action of the products remains unclear. Few commercially available additives are found to be effective in reducing odours and greenhouse gas emissions based on scientific evidence.

[0008] EP 3863 776 B1 relates to a method for treating organic waste comprising: contacting organic waste with a composition that is capable of generating a reactive species; wherein the composition comprises an oxidizing agent, and wherein the reactive species are generated from a source of iodide (G) and the oxidizing agent.

[0009] Biological degradation of manure is the breakdown by microbes (e.g. bacteria, archaea, fungi, etc.) of valuable and useful organic compounds into less valuable smaller organic compounds, which are then further degraded and lost from the waste as gases (e.g. CH4, NH3, CO2, N2, etc.). The larger organic compounds in non-degraded organic waste are useful and valuable because they can act as slow-release sources of fertilizing compounds and as fiber sources to improve biodiversity and soil health. There is therefore a need to provide methods for treating manure that reduce biological degradation.

[0010] Typical dosages of standard acidifying manure additives are in the range of 3-25 kg per m3(approximately 500-1000 kg with dry matter 5-10%) slurry every two to four weeks. For example: Sulfuric acid (H2SO4): 3.5-15 I for a target pH of 5.5; nitric acid (HNO3): 10-25 l for a target pH of 5.5; and acetic acid (CH3COOH): 3-14 I for a target pH of 5.5.

[0011] These additives function by acidifying the manure which reduces methane producing microbial activity and diminishes emissions specifically from a pH of 5.5 and below. Although there is a large body of evidence demonstrating that manure acidification is efficient in managing emissions and odours, the operational costs and hazards limit a large-scale application.

[0012] Notwithstanding the above, animal manure is also recognized as a source of infectious agents, ranging from bacteria to protozoa to viruses, and can lead to zoonotic disease. In particular, when manure is applied to agricultural land, any pathogens within the manure can be transmitted to the soil, leach into waterways and ultimately contaminate crops intended for consumption, as well as the environment. As such, minimizing levels of zoonotic pathogens in manure and preventing the spread of such pathogens in the agricultural system is equally as important as reducing GHG emissions.

[0013] It would therefore be desirable to prevent the spread and / or reduce the level of harmful pathogens in manure. Such methods can be used to maintain or even improve soil health and consequently plant growth.

[0014] Any reference to prior art documents in this specification is not to be considered an admission that such prior art is widely known or forms part of the common general knowledge in the field.

[0015] Summary of the Invention

[0016] In one aspect of the invention, there is provided a method of increasing the environmental benefit of manure or manure-treated soil, the method comprising administering to manure or manure-treated soil, a manure additive, wherein the manure additive is or comprises calcium cyanamide (CaCN2). Preferably, the method comprises adding 0.17 - 0.35g of calcium cyanamide (CaCN2) per 1 kg manure. More preferably, the method comprises adding 0.17-0.3g of calcium cyanamide (CaCN2) per 1 kg manure.

[0017] In one embodiment, the method comprises maintaining or improving the health of manure-treated soil. In a further embodiment, maintaining the health of manure-treated soil comprises maintaining the level of one or more zoonotic pathogens in manure below a level harmful to human health. Alternatively, improving the health of manure-treated soil comprises reducing the level of one or more zoonotic pathogen in manure below the level of the zoonotic pathogen present in untreated manure.

[0018] In one embodiment, the zoonotic pathogen is selected from Escherichia coli and / or the genus Shigella.

[0019] In another embodiment, the method further comprises reducing the emission of at least one greenhouse gas from manure, limit(s) the generation of gaseous emissions from the manure including greenhouse gases (CO2, CH4, N2O) and odorous compounds (H2S) under strict anaerobic or / and aerobic conditions as well as atmospheric conditions. In a further embodiment, the method further comprises administering to the manure or the manure-treated soil a second manure additive, wherein the second manure additive is or comprises hydrogen peroxide (H2O2). In one embodiment, the manure additive comprises 5 - 15 wt. % of hydrogen peroxide (H2O2). More preferably, the second manure additive is or comprises 5.5 - 14.5 wt. % hydrogen peroxide (H2O2). In another embodiment, the method comprises adding 1.7 - 3.5g, preferably 1.7-2.8g of hydrogen peroxide (H2O2) per 1kg manure.

[0020] Accordingly, in another aspect of the invention, there is provided a method of maintaining or improving the health of manure-treated soil, the method comprises administering at least two manure additives to the manure, wherein the first manure additive is or comprises calcium cyanamide (CaCN2), and the second manure additive is or comprises hydrogen peroxide (H2O2).

[0021] In another aspect of the invention, there is provided a method of reducing the level of at least one zoonotic pathogen in manure, the method comprises administering at least two manure additive to the manure, wherein the first manure additive is or comprises calcium cyanamide (CaCN2), and the second manure additive is, or comprises, hydrogen peroxide (H2O2).

[0022] In a further embodiment, the method further comprises administering to the manure or the manure-treated soil a third manure additive, wherein the third manure additive is biochar. In one embodiment, the method comprises administering 10 - 60 g, preferably 20-50g of biochar per 1 kg manure.

[0023] In another embodiment, the method comprises administering 1.7 - 2.8 g of hydrogen peroxide (H2O2) per 1 kg manure and / or 20 - 50 g of biochar per 1 kg manure to the manure.

[0024] In a further embodiment, the manure additive further comprises additives selected from the group consisting of calcium hydroxide, calcium carbonate, magnesium carbonate, or a combination thereof.

[0025] In another (or additional) aspect of the invention, there is provided a method of reducing the level of at least one nitrifying bacteria in manure, or manure-treated soil, the method comprising administering to the manure or the manure-treated soil, the manure additive of the invention. In one embodiment, the nitrifying bacteria is selected from one or more of Nitrosomonas, Nitrosococcus, Nitrobacter, Nitrospira and Nitrospina.

[0026] In another (or additional) aspect of the invention, there is provided a method of reducing the level of at least one methanogen in manure, or manure-treated soil, -treated soil, the method comprising adding to manure or manure-treated soil, a manure additive, wherein the manure additive is or comprises hydrogen peroxide (H2O2), wherein the manure additive comprises adding 1.7- 3.5g of hydrogen peroxide (H2O2) per 1kg of manure.

[0027] In one embodiment, the methanogen is selected from Candidatus Methanogranum, Candidatus Methanoperedens, Candidatus Methanoplasma, Methanobrevibacter, Methanocorpusculum, Methanolobus, Methanomethylovorans and Methanomicrobium. In another embodiment, the methanogen is selected from an aerobic methanotrophic bacteria, preferably selected from Methylobacter, Methylocaldum, Methylocystis, Methylogaea, Methylomonas, Methyloterricola and Methylovulum.

[0028] Brief Description of the figures

[0029] The invention is further described in the following non-limiting figures:

[0030] Figure 1 shows the cumulative emissions of CO2, CH4, N2O, H2S under aerobic conditions at the laboratory scale of manure treated with hydrogen peroxide (H2O2).

[0031] Figure 2 shows the cumulative emissions of CO2, CH4, N2O, H2S under anaerobic conditions at the laboratory scale of manure treated with hydrogen peroxide (H2O2).

[0032] Figure 3 shows the global warming potential (100 years) under anaerobic and aerobic conditions at the laboratory scale of manure treated with hydrogen peroxide (H2O2).

[0033] Figure 4 shows the cumulative emissions of CO2, CH4, N2O, H2S emissions under aerobic conditions at the laboratory scale of manure treated with calcium cyanamide (CaCN2). Figure 5 shows the cumulative emissions of CO2, CH4, N2O, H2S emissions under anaerobic conditions at the laboratory scale of manure treated with calcium cyanamide (CaCN2).

[0034] Figure 6 shows the global warming potential (100 years) under anaerobic and aerobic conditions at the laboratory scale of manure treated with calcium cyanamide (CaCN2).

[0035] Figure 7 shows the pilot scale 500 I test chambers filled with 20 kg of manure.

[0036] Figure 8 shows the cumulative emissions of CO2, CH4, N2O, H2S under atmospheric conditions at the pilot scale of manure treated with hydrogen peroxide (H2O2), calcium cyanamide (CaCN2), their combination, and sulfuric acid (H2SO4) as a positive control.

[0037] Figure 9 shows the global warming potential (100 years) under atmospheric conditions at the pilot scale of manure treated with selected additives.

[0038] Figure 10 shows the effect of manure additives on the texture of manure at pilot scale.

[0039] Figure 11 shows an example of a plant growth trial with maize where the invention has a beneficial effect on plant growth.

[0040] Dosage optimization - lab scale

[0041] Figures 12A, 12B, 12C, and 12D show the cumulative emissions of CO2, CH4, N2O, H2S under aerobic conditions at the laboratory scale of manure treated with hydrogen peroxide (H2O2) at different dosage ratios and combined with calcium cyanamide (CaCN2). 500m3 chambers were filled with 20kg of fresh manure. The emissions are shown for: CTRL + 100 CaCN2+100 H2O2;and CaCN250+50 H2O2

[0042] Figures 13A, 13B, 13C, and 13D show the cumulative emissions of CO2, CH4, N2O, H2S under aerobic conditions at the laboratory scale of manure treated with hydrogen peroxide (H2O2) at different dosage ratios and combined with biochar (B). The emissions are shown, one per gas, with combinations of different ratios of H2O2 and biochar (just the two), Figures 14A, 14B, 14C, and 14D show the cumulative emissions of CO2, CH4, N2O, H2S under aerobic conditions at the laboratory scale of manure treated with calcium cyanamide (CaCN2) at different dosage ratios and combined with biochar. The 4 graphs (N2O, CH4, CO2, H2S) one per gas show the combinations of different ratios of CaCN2and biochar.

[0043] Figures 15A. 15B, and 15C show the global warming potential (100 years) under aerobic conditions at the laboratory scale of manure treated with calcium cyanamide (CaCN2) at different dosage ratios and combined with hydrogen peroxide (H2O2) or combined with biochar.

[0044] Figures 16.1A, 16.1B, 16.1C, and 16.1D; show the cumulative emissions of CO2, CH4, N2O, H2S under aerobic conditions at the laboratory scale of manure treated at different dosage ratios depending on the additive (concentrations ranging from 75, 50, 25 ratio compared to recommended 100) with calcium cyanamide (CaCN2) and combined with hydrogen peroxide (H2O2) and with biochar at different dosage ratios.

[0045] Figures 16.2A, 16.2B, 16.2C, and 16.2D show the cumulative emissions of CO2, CH4, N2O, H2S under aerobic conditions at the laboratory scale of manure treated at different dosage ratios depending on the additive (concentrations ranging from 75, 50, 25 ratio compared to recommended 100) with calcium cyanamide (CaCN2) and combined with hydrogen peroxide (H2O2) and with biochar at different dosage ratios.

[0046] Figures 16.3A, 16.3B, 16.3C, and 16.3D show the cumulative emissions of CO2, CH4, N2O, H2S under aerobic conditions at the laboratory scale of manure treated at different dosage ratios depending on the additive (concentrations ranging from 75, 50, 25 ratio compared to recommended 100) with calcium cyanamide (CaCN2) at different dosage ratios depending on the additive (concentrations ranging from 75, 50, 25 ratio compared to recommended 100) and combined with hydrogen peroxide (H2O2) and with biochar at different dosage ratios.

[0047] Figures 17A, 17B, and 17C show the global warming potential (100 years) under aerobic conditions at the laboratory scale of manure treated with calcium cyanamide (CaCN) at different dosage ratios and combined with hydrogen peroxide (H2O2) and with biochar. The 3 graphs show of global warming potential (GWP) (100 years); Dosage optimization - pilot scale

[0048] Figures 18A, 18B, and 18C show the cumulative emissions of CO2, CH4, N2O, under atmospheric conditions at the pilot scale of manure treated at different dosage ratios depending on the additive (concentrations ranging from 100, 75, 50 ratio compared to recommended 100) with calcium cyanamide (CaCN2) and combined with hydrogen peroxide (H2O2) and with biochar at different dosage ratios. 18D shows the global warming potential (100 years) under atmospheric conditions at the pilot scale of manure treated with combinations of the selected additives.

[0049] Figure 19 shows a selection of samples for pathogenic and amplicon analyses from treatments and controls.

[0050] Figure 20 shows a the counts of the colony-forming unit per grams (cfu / g) of those microorganisms that were analysed in the laboratory in manure and soil. CFU: colony forming units.T0Pathogens analysed at time 0 of manure mixed with soil.T23Pathogens analysed after 23 days of manure mixed with soil.0 / o(S'TO)% removal of pathogens at TO compared to original slurry S1-6.%<S-T23) % removal of pathogens at T23 compared to original slurry S1-6. ND: not detected. CN is calcium cyanamide (CaCN2), HO is hydrogen peroxide (H2O2), HS is Sulfuric acid (H2SO4), HOCN is combination of hydrogen peroxide (H2O2), and calcium cyanamide (CaCN2).

[0051] Figure 21 shows a table displaying the relative abundance of main pathogens genera detected via amplicon sequencing.aPathogens analysed at time 0.bPathogens analysed at time 23.c% removal of pathogens in treatments compared to untreated manure at time 0.d% removal of pathogens of the same treatment from time 23 compared to time 0. * This indicates that significant differences were found using an ANOVA test at p<0.05. CN is calcium cyanamide (CaCN2), HO is hydrogen peroxide (H2O2), and CNHO is combination of hydrogen peroxide (H2O2), and calcium cyanamide (CaCN2).

[0052] Figure 22 shows methanogenic archeal genera detected via shotgun metagenomics, a Methanogenic genera analysed via shotgun in the original slurry (time 0). b Methanogenic genera analysed via shotgun after the storage for 28 days (UM) and treatment for 28 days, c % removal of methanogenic genera in UM and treatments compared to slurry at time 0. d % removal of methanogenic genera in treatments compared to the untreated manure of each trial at time 28. * This indicates that significant differences were found using a Post-hoc Games-Howell test at p<0.05. CN is calcium cyanamide (CaCN2), HO is hydrogen peroxide (H2O2), HS is Sulfuric acid (H2SO4), HOCN is combination of hydrogen peroxide (H2O2), and calcium cyanamide (CaCN2).

[0053] Figure 23 shows shows aerobic methanotrophic genera detected via shotgun metagenomics.aAerobic methanotrophic genera analysed via shotgun in the original slurry (time 0).bAerobic methanotrophic genera analysed via shotgun after the storage for 28 days (UM) and treatment for 28 days.c% removal of methanotrophic genera in UM and treatments compared to slurry at time 0.d% removal of methanotrophic genera in treatments compared to the untreated manure of each trial at time 28. * This indicates that significant differences were found using a Post-hoc Games-Howell test at p<0.05. CN is calcium cyanamide (CaCN2), HO is hydrogen peroxide (H2O2), HS is Sulfuric acid (H2SO4), HOCN is combination of hydrogen peroxide (H2O2), and calcium cyanamide (CaCN2).

[0054] Figure 24 shows changes in manure microbiome by the addition of additives from metagenome sequencing.aNitrifying genera analysed via shotgun in the original slurry (time 0).bNitrifying genera analysed via shotgun after the storage for 28 days (UM) and treatment for 28 days.c% removal of nitrifying genera in UM and treatments compared to slurry at time 0.d% removal of nitrifying genera in treatments compared to the untreated manure of each trial at time 28. * This indicates that significant differences were found using a Post-hoc Games-Howell test at p<0.05.

[0055] Figure 25 shows shows the activity of different Bacteria genus.

[0056] Figure 26A is a schematic of the methane cycle. Figure 26B is a schematic of methane metabolism by different microorganisms.

[0057] Detailed description of the invention

[0058] The following embodiments apply to all aspects of the invention. The present invention will now be further described. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.

[0059] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of botany, microbiology, tissue culture, molecular biology, chemistry and biochemistry, which are within the skill of the art. Such techniques are explained fully in the literature.

[0060] The objective of the present invention is to maintain or improve the health of manure treated soil, in particular through the management of zoonotic pathogens in the manure. A further objective of the invention is to reduce greenhouse gas emissions from manure or manure-treated soil. An even further objective of the invention is to improve the growth or health of plants and / or seed viability of plants grown in the manure treated soil. Through these combination of benefits the invention provides a method of reducing any environmental impact of manure. Or put another way, the invention maximises the agricultural and environmental benefits of manure. It is hoped that the above additional benefits, in combination with an improvement to soil health, will facilitate a broader adoption of this technology.

[0061] Accordingly, in one aspect of the invention, there is provided a method of increasing the environmental benefit of manure or manure-treated soil, the method comprising administering to manure or manure-treated soil, a manure additive, wherein the manure additive is or comprises is or comprises calcium cyanamide (CaCN2).

[0062] Preferably, the amount of hydrogen peroxide added in at least 75%, or at least 50%, or at least 25% of the recommended dose of calcium cyanamide (CaCN2) recommended. Preferably, the method comprises adding 0.17 - 0.35g of calcium cyanamide (CaCN2) per 1 kg manure. More preferably, the method comprises adding 0.17-0.3g of calcium cyanamide (CaCN2) per 1 kg manure. For example, in one embodiment, the method comprises adding 0.5 - 1.5 wt. % calcium cyanamide. A manure additive comprising calcium cyanamide (CaCN2) may be referred to as “CN” in the Examples and Figures.

[0063] As described above, the environmental benefit of manure or manure-treated soil can be improved by maintaining or improving the health of manure-treated soil. Accordingly, in one embodiment, the method comprises maintaining or improving the health of manure-treated soil. In a further embodiment, maintaining the health of manure-treated soil comprises maintaining the level of one or more zoonotic pathogens in manure below a level harmful to human health. Alternatively, improving the health of manure-treated soil comprises reducing the level of one or more zoonotic pathogens in manure below the level of the zoonotic pathogen present in untreated manure. The level of a given bacterium (bacteria) may be measured by measuring colony-forming units per gram of substrate (e.g. manure or manure-treated soil). Alternatively, levels of a given bacterium (bacteria) may be measured using an amplicon based sequencing method or shotgun metagenomics sequencing methods.

[0064] Soil health is defined as “the continued capacity of soil to function as a living ecosystem that sustains plants, animals, and humans”. As discussed above, manure is an excellent fertilizer and can significantly contribute to soil health. However, pathogens, and in particular bacterial pathogens, within manure can negatively affect soil health, and lead to disease in humans and animals.

[0065] By “maintaining” soil health is meant that the addition of the at least one manure additive as described herein does not increase the number of at least one (type of) pathogen and in particular zoonotic pathogens, in the manure, or the manure-treated soil. The number or level of pathogens in a manure or manure-treated soil sample can be determined using standard techniques in the art. For example, using the methods described in the example section, which describe determining pathogen numbers using wet lab techniques to establish the numbers of colony forming units / g. Alternatively, culture-free methods, such as metagenomics next generation sequencing may be used to identify pathogens in a sample. Alternative techniques would also be known to the skilled person.

[0066] By “improving” soil health is meant that the addition of at least one manure additive as described herein decreases the number of at least one (type of) pathogen, and in particular zoonotic pathogens, in the manure or the manure-treated soil. Again, the number of level of pathogens in a manure or manure-treated soil sample can be determined using standard techniques in the art. By a “decrease” herein may be meant a decrease of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, or 100% compared to level or number of pathogens in the slurry, manure or the manure-treated soil without any manure additives.

[0067] By “zoonotic pathogen” is meant any pathogen that is capable of causing disease in humans or animals. There are several bacterial pathogens present in manure that are capable of causing disease in humans. In one embodiment, the pathogen is bacteria, such as Escherichia coli, Listeria, Campylobacter, Salmonella, Escherichia, Yersinia, Klebsiella, Enterobacter, Citrobacter and Staphylococcus.

[0068] In one embodiment, the pathogen is Escherichia coli. For example, the Escherichia coli may be the strain O157: H7.

[0069] In another embodiment the pathogen is selected from the Shigella genus, such as Shigella dysenteriae, Shigella flexneri, Shigella boydii and Shigella sonnei.

[0070] The method may further comprises reducing the emission of at least one greenhouse gas from manure, wherein preferably the greenhouse gas is selected from nitrous oxide (NO2), methane (CH4) and carbon dioxide (CO2).

[0071] In another aspect of the invention, there is provided a method of reducing the level of at least one zoonotic pathogen in manure, the method comprises administering at least two manure additives to the manure, wherein the first manure additive is or comprises calcium cyanamide (CaCN2) and the second manure additive is or comprises hydrogen peroxide (H2O2). The level of a given bacterium (bacteria) may be measured by measuring colony-forming units per gram of substrate (e.g. manure or manure-treated soil). Alternatively, levels of a given bacterium (bacteria) may be measured using an amplicon based sequencing method or shotgun metagenomics sequencing methods.

[0072] In a further embodiment, the at least one manure additive may further reduce the emission of at least one greenhouse gas (GHG). Accordingly, while prior art products are able to address only one of these challenges associated with manure application - e.g. greenhouse emission reduction (and associated odours) or management of levels of zoonotic pathogens in manure, the present invention addresses both these aspects simultaneously.

[0073] Moreover, the Applicant has found that the effect of addition of at least two of the described additives on greenhouse gas emissions is synergistic. That is, the effect of a combination of calcium cyanamide (CaCN2) and hydrogen peroxide (H2O2) on GHG emission is greater than the effect of any one of calcium cyanamide (CaCN2) or hydrogen peroxide (H2O2) alone. This synergy means that each additive can be applied at a much lower amount than the amount ordinarily applied to achieve the same effect on GHG emissions with a single additive. This is particularly important because the additives can be hazardous to handle. As such, lower doses are also safer for the user.

[0074] Thus, this invention addresses the major problems related to long-term livestock manure storage by leveraging the synergistic effects of the combination of additives. These additives consistently limit the production of GHG emissions compared to the control at anaerobic, aerobic, and atmospheric conditions. Additionally, the selected combination at BELOW the STANDARD dose also diminishes unwanted odours from manure storage.

[0075] Thus, application of the combination of manure additives of the invention to manure also provides the following additional benefits:

[0076] 1) Greenhouse gases and odours are reduced under atmospheric conditions

[0077] 2) Greenhouse gases and odours are reduced under anaerobic conditions

[0078] 3) Greenhouse gases and odours are reduced under aerobic conditions

[0079] 4) Nitrogen and carbon is retained in the manure due to reduced emissions

[0080] 5) Ammonia (NH3) fixation improved increasing further the fertilizing power of manure 6) Reduction of odours because of lower hydrogen sulfide (H2S) emissions

[0081] It is hoped that the above additional benefits, in combination with an improvement to soil health, will facilitate a broader adoption of this technology.

[0082] In one embodiment, the greenhouse gas may be selected from one or more of nitrous oxide (N2O), methane (CH4) and carbon dioxide (CO2), hydrogen sulphide (H2S), ammonia (NH3) and nitrogen (N2) or a combination thereof, as well as odorous compounds, such as hydrogen sulfide (H2S), ammonia (NH3), nitrogen (N2), volatile fatty acids (VFAs) or a combination thereof.

[0083] By a “reduction in GHG emissions” is meant a reduction of at one green-house gas by least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more, or 100% or more compared to the level of at least one greenhouse gas emitted from slurry, untreated manure or manure-treated soil. The level of a greenhouse gas can be measured using standard techniques in the art. In one embodiment, the at least one green-house gas may be reduced in strict anaerobic or aerobic conditions or atmospheric conditions.

[0084] Accordingly, in a further embodiment, the method comprises administering at least a first manure additive to the manure, wherein the at least first manure additive is or comprises calcium cyanamide (CaCN2), and the second manure additive is comprises hydrogen peroxide (H2O2). This combination may be referred to herein as “HOCN” in the examples.

[0085] Preferably, the method comprises adding 0.17 - 0.35, preferably 0.17-0.3g of calcium cyanamide (CaCN2) per 1 kg manure and 1.7 - 3.5 g, preferably 1.7-2.8g of hydrogen peroxide (H2O2) per 1 kg manure. This provides the additional advantage of minimizing nitrogen volatilization reducing nitrous oxide (N2O) emissions and odour generation due to lowered hydrogen sulfide (H2S) emissions.

[0086] The first and second manure additives may be added (or administered, such terms are interchangeable) to the manure sequentially or concurrently. The manure may then be added to soil in a desired ratio. In one embodiment, the manure and at least one manure additive is distributed onto fields, preferably by spray irrigation, surface spreading, injection, or broadcasting.

[0087] In one embodiment of the invention the manure additive comprises 0.5 - 1.5 wt. % calcium cyanamide, preferably 0.5-1.5wt % calcium cyanamide.

[0088] In one embodiment of the invention, the manure additive comprises 5 to 15 wt.%, preferably 5.5 - 14.5 wt. % hydrogen peroxide (H2O2). In one embodiment, the hydrogen peroxide may be provided in the form of pure H2O2. The calcium cyanamide (CaCN2) is preferably in powder form.

[0089] In a further embodiment, the method further comprises administering to the manure or the manure-treated soil a further manure additive, wherein the further manure additive is biochar.

[0090] Accordingly, in one embodiment, the methods of the invention comprise administering to the manure or manure-treated soil, a first manure additive wherein the first manure additive is or comprises hydrogen peroxide (H2O2), and a second manure additive, wherein the second manure additive is, or comprises, biochar. In one embodiment, the method comprises administering 10 - 60 g of biochar per 1 kg manure, preferably 20-50g of biochar per 1kg manure. In another embodiment, the method comprises administering 1.7 -3.5g, preferably, 1.7 - 2.8 g of hydrogen peroxide (H2O2) per 1 kg manure and / or 20 - 50 g of biochar per 1 kg manure to the manure.

[0091] In one embodiment, the manure additive comprises 85-99.5 wt.% biochar.

[0092] In another embodiment, the manure additive comprises 84-94 wt.% biochar, 0.5-1.5 wt.% calcium cyanamide and 5.5 -14.5% wt. % hydrogen peroxide.

[0093] In a further embodiment, the manure additive comprises 98-99.5 wt.% biochar, and 0.5 -1.7 wt.% calcium cyanamide, preferably 0.5-1.5 wt.% calcium cyanamide.

[0094] As discussed above, the invention also relates to a manure additive for reducing emissions from manure comprising calcium cyanamide, and optionally H2O2and / or biochar. It is preferred that the manure additive according to the invention comprises 5-15 wt. % of hydrogen peroxide (H2O2). Furthermore, preferably the manure additive according to the invention comprises 85 - 99.5 wt. % biochar. In a preferred embodiment of the invention, the manure additive further comprises 0.5 - 1.4 wt. % of calcium cyanamide (CaCN2). This combination of hydrogen peroxide (H2O2), biochar, and calcium cyanamide (CaCN2) is particularly preferred because it provides the advantage of addressing the reduction of methane (CH4) emissions, nitrogen retention in the manure due to the reduction of nitrous oxide (N2O) and hydrogen sulfide (H2S) emissions, and improved carbon content for plant health. Alternatively, in one embodiment, the methods of the invention comprise administering to the manure or manure-treated soil, a first manure additive wherein the first manure additive is or comprises calcium cyanamide (CaCN2), a second manure additive, wherein the second manure additive is, or comprises, hydrogen peroxide (H2O2), and a third manure additive, wherein the third manure additive is or comprises biochar. This combination may be referred to as “MD50L75”, in the Examples and Figures.

[0095] In the present context, biochar is made up of elements such as carbon, nitrogen, calcium, magnesium, oxygen, phosphorus, and potassium, as well as minerals in the ash fraction. It is produced during pyrolysis, a thermal decomposition of biomass in an oxygen-limited environment.

[0096] In a preferred embodiment of the invention, the biochar is from substrate that is wood. The surface area may vary. Advantageously, the specific surface area is larger than 300 m2 per g of biochar.

[0097] In the present context, manure preferably refers to livestock manure from ruminants and swine, chicken manure. Preferably the manure is cow manure.

[0098] The manure may be stored for a period of time before being added to the soil. For example, the manure may be stored for at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 weeks before being added to the soil to be treated. The manure may be stored under anaerobic or aerobic conditions.

[0099] In summary, this invention addresses the major problems related to long-term livestock manure storage by leveraging the synergistic effect on GHG emissions achieved when the above-described manure additives are combined, together with the effect of these combinations of manure additives on zoonotic pathogen levels. Regarding the reapplication of the treated manure, plant growth is positively impacted both in seed germination and leaf number and width, as shown in Figure 11. Hence, this invention can not only reduce the carbon footprint associated with livestock farming but can also positively contribute to soil health, ensuing benefits on plant growth and crop production. Advantageously, in the method according to the invention, hydrogen peroxide (H2O2) and / or calcium cyanamide (CaCN2) and / or biochar are mixed thoroughly before addition to the manure. The mixture is appropriately added to the respective amount of manure.

[0100] Manure additive according to the invention may be in a liquid or powder form.

[0101] Furthermore, the manure additive according to the invention may comprise additives selected from the group consisting of calcium hydroxide, calcium carbonate, magnesium carbonate, or a combination thereof. The manure additive may be mixed with other components before the distribution of the manure additive into the manure. The manure additive may also comprise a filler.

[0102] While the foregoing disclosure provides a general description of the subject matter encompassed within the scope of the present invention, including methods, as well as the best mode thereof, of making and using this invention, the following examples are provided to further enable those skilled in the art to practice this invention and to provide a complete written description thereof. However, those skilled in the art will appreciate that the specifics of these examples should not be read as limiting on the invention, the scope of which should be apprehended from the claims and equivalents thereof appended to this disclosure. Various further aspects and embodiments of the present invention will be apparent to those skilled in the art in view of the present disclosure.

[0103] Unless context dictates otherwise, the descriptions and definitions of the features set out above are not limited to any particular aspect or embodiment of the invention and apply equally to all aspects and embodiments, which are described.

[0104] The invention is now described in the following non-limiting examples.

[0105] Example 1: Methods of reducing greenhouse gas emissions

[0106] Example 1 - Laboratory and pilot scale trials

[0107] The manure additives according to the invention were tested as follows: All laboratory tests are performed batch-wise under both aerobic and anaerobic conditions and three different dosages in duplicate in 2.1 I gas-tight bottles. The additive is applied to 1.5 kg of fresh manure contained in 10 I vessels. Then, 20 g of the mixture (manure + additive) is transferred into 2.1 I bottles. The headspace atmosphere of anaerobic tests is flushed with nitrogen gas (N2) for at least 10 minutes. Afterwards, both aerobic and anaerobic bottles are pressurized up to 500 mbar using compressed air and N2, respectively. Headspace conditions are restored by flushing and pressurization whenever the pressure drops under 100 mbar and / or oxygen (O2) concentration drops below 10 % for aerobic tests. Trials are run together with controls (untreated manure with no presence of additive) in a temperature-controlled room at 25°C for 28 days.

[0108] Figure 7 shows the pilot scale 500 I test chambers filled with 20 kg of manure.

[0109] All pilot tests are performed batch-wise under mixed atmospheric conditions for one selected dose in triplicate 500 I test chambers. The internal headspace mixing is performed by fans. The additives and a combination thereof respectively are each applied once to 20 kg of fresh manure which serves as the load for the test chamber. The control consists of 20 kg of untreated manure. Headspace monitoring occurs three times per week and renewal is performed with air when oxygen (O2) is <7 %. Manure monitoring occurs twice a week. Trials are run together with controls (untreated manure with no presence of additive) in a temperature-controlled room at 25°C for 28 days.

[0110] Example 1.1 – Laboratory manure additive trial - Hydrogen peroxide (H2O2)

[0111] The conditions of the trial are as follows:

[0112] 1. Manure slurry: 20 g

[0113] 2. Temperature: 25°C

[0114] 3. Atmosphere: Air (aerobic) & N2 (anaerobic)

[0115] 4. Number of replicates: 2

[0116] 5. Number of assays: 12

[0117] 6. Pressurized at 500 mbar

[0118] 7. Additive tested: hydrogen peroxide (H2O2)

[0119] Trial design: Application dosages of hydrogen peroxide (H2O2) for 1.5 kg of manure.

[0120] 3 different conditions are prepared in 10 I vessels for 1.5 kg of manure. Previously

[0121] recommended 50% above Additive 50% below (BELOW)

[0122] dosage (ABOVE) (STANDARD)

[0123] Hydrogen peroxide

[0124] 7.46 ml 3.73 ml 11.19 ml (H2O2)

[0125]

[0126] Considerations: Hydrogen peroxide (H2O2) is applied directly to the manure and stirred vigorously.

[0127] Characterization of the fresh manure

[0128] pH 6.97 ± 0.01

[0129] Total solids (%) 12.60 ± 0.17

[0130] Volatile solids (%) 10.41 ± 0.25

[0131] N-NH4+(mg kg-1 sample) 1278 ± 5

[0132] TKN (g kg-1 sample) 4919 ± 65

[0133] CODt (g O2L-1) 111 ± 5

[0134] NO2; NO3- (mg L-1) 0

[0135] Volatile Fatty Acids (VFAs)

[0136] Acetic (g L-1) 4.61 ± 0.20

[0137] Propionic (g L-1) 1.11 ± 0.04

[0138] Butyric (g L-1) 1.01 ± 0.04

[0139] Isobutyric (mg L-1) 0.06 ± 0.01

[0140] Isovaleric (mg L-1) 0.05 ± 0.01

[0141] Valeric (mg L-1) 0

[0142] Isocaproic (mg L-1) 0

[0143] Hexanoic (mg L-1) 0

[0144] Heptanoic (mg L-1) 0

[0145] Manure treated with hydrogen peroxide (H2O2) - Emission tests (CO2, CH4, N2O, H2S – ANAEROBIC and AEROBIC)

[0146] Figures 1 and 2 show cumulative CO2, CH4, N2O, and H2S emissions under anaerobic and aerobic conditions. It can be demonstrated that: - The below dose in anaerobic conditions slightly decreases CO2 production compared to CONTROL assays.

[0147] - All dosages tested significantly reduce CH4 production compared to CONTROL assays under anaerobic conditions.

[0148] - There is no N2O production for the different dosages tested under anaerobic conditions.

[0149] - All dosages tested report a higher H2S production than the CONTROL test under anaerobic conditions.

[0150] - All dosages tested show a similar CO2 production to CONTROL assays under aerobic conditions.

[0151] - All dosages tested significantly reduce CH4 production compared to CONTROL assays under aerobic conditions.

[0152] STANDARD and BELOW doses slightly minimize N2O production compared to CONTROL assays.

[0153] Similar behavior in H2S production is observed for all dosages tested.

[0154] Manure with hydrogen peroxide (H2O2) – Global warming potential – anaerobic (AN) and aerobic (AE) tests

[0155] Figure 3 shows the global warming potential (100 years) under anaerobic (AN) and aerobic (AE) conditions. It can be demonstrated that:

[0156] - The global warming potential is significantly minimized for all doses tested under anaerobic conditions.

[0157] - The global warming potential is highly influenced by N2O production under aerobic conditions.

[0158] - BELOW and STANDARD

[0159] doses significantly minimize the global warming potential at the end of the experimental time compared to CONTROL assays under aerobic conditions.

[0160] Example 1.2 – Laboratory manure additive trial - Calcium cyanamide (CaCN2) The conditions of the trial are as follows:

[0161] 8. Manure slurry: 20 g

[0162] 9. Temperature: 25°C

[0163] 10. Atmosphere: Air (aerobic) & N2 (anaerobic)

[0164] 11. Number of replicates: 2

[0165] 12. Number of assays: 12 13. Pressurized at 500 mbar

[0166] 14. Additive tested: Calcium cyanamide (CaCN2)

[0167] Trial design: Application dosages of calcium cyanamide (CaCN2) for 1.5 kg of manure.

[0168] 3 different conditions are prepared in 10 I vessels for 1.5 kg of manure.

[0169] Recommended

[0170] 50% below 50% above Additive dosage

[0171] (BELOW) (ABOVE) (STADARD)

[0172] Calcium cyanamide

[0173] 0.84 g 0.42 g 1.26 g (CaCN2)

[0174] Considerations: Calcium cyanamide (CaCN2) is crushed / ground before application.

[0175] Characterization of the fresh manure

[0176] pH 7.34 ± 0.01

[0177] Total solids (%) 21.8 ± 0.5

[0178] Volatile solids (%) 9.4 ± 0.2

[0179] N-NH4+(mg kg-1 sample) 2026.9 ± 50.0

[0180] TKN (g kg-1 sample) 4.9 ± 0.2

[0181] CODt (g O2L-1) 121.8 ± 1.9

[0182] NO2; NO3- (mg L-1) 0

[0183] Volatile Fatty Acids (VFAs)

[0184] Acetic (g L-1) 4.4 ± 0.4

[0185] Propionic (g L-1) 1.1 ± 0.1

[0186] Butyric (g L-1) 0.8 ± 0.1

[0187] Isobutyric (mg L-1) 29.3 ± 4.9

[0188] Isovaleric (mg L-1) 94.2 ± 16.0

[0189] Valeric (mg L-1) 0

[0190] Isocaproic (mg L-1) 0

[0191] Hexanoic (mg L-1) 0

[0192] Heptanoic (mg L-1) 0

[0193]

[0194] Manure with calcium cyanamide (CaCN2)- Emission tests (CO2, CH4, N2O, H2S - ANAEROBIC and AEROBIC) Figures 4 and 5 show cumulative CO2, CH4, N2O, and H2S emissions under anaerobic and aerobic conditions. It can be demonstrated that:

[0195] - The STANDARD and above dose slightly decreases CO2 production compared to anaerobic control assays.

[0196] - All dosages tested significantly reduce CH4 production compared to CONTROL assays under anaerobic conditions.

[0197] - There is no N2O production for the different dosages tested under anaerobic conditions.

[0198] - The STANDARD and above dose report a lower H2S production than CONTROL tests.

[0199] - All dosages tested show a significant reduction in CO2 production compared to CONTROL assays under aerobic conditions.

[0200] - All doses tested inhibit the N2O production compared to aerobic CONTROL assays.

[0201] - The STANDARD and ABOVE doses reduce CH4 production compared to CONTROL assays under aerobic conditions.

[0202] Similar behavior in H2S production is observed for all dosages tested under aerobic conditions.

[0203] The following experiments are conducted with the method described above.

[0204] Manure with calcium cyanamide (CaCN2) - Global warming potential - anaerobic (AN) and aerobic (AE) tests

[0205] Figure 6 shows the global warming potential (100 years) under anaerobic (AN) and aerobic (AE) conditions. It can be demonstrated that:

[0206] - The global warming potential is significantly minimized when STANDARD and ABOVE doses are tested under anaerobic conditions.

[0207] - The global warming potential is highly influenced by N2O production under aerobic conditions.

[0208] - All dosages tested significantly minimize the global warming potential compared to CONTROL assays.

[0209] Example 1.3 Pilot scale manure additives trial

[0210] The conditions of the trial are as follows:

[0211] 1. Manure slurry: 20 kg 2. Temperature: 25°C

[0212] 3. Atmosphere: Air (aerobic)

[0213] 4. Number of replicates: 3 month-long trials

[0214] 5. Number of assays: 15

[0215] 6. Additives tested: Hydrogen peroxide (H2O2), calcium cyanamide (CaCN2), their combination, sulfuric acid (H2SO4, positive control)

[0216] Trial design: Application dosages of hydrogen peroxide (H2O2), calcium cyanamide (CaCN2), their combination, biochar, and sulfuric acid (H2SO4, positive control) previously evaluated for 20 g of manure.

[0217] Three trials under atmospheric conditions are prepared in 500 I vessels for 20 kg of manure.

[0218] Additive Dosage

[0219] Hydrogen peroxide (H2O2) 99.5 ml

[0220] Calcium cyanamide (CaCN2) 11.2 g

[0221] Hydrogen peroxide (H2O2) +

[0222] 99.5 ml + 11.2 g Calcium cyanamide (CaCN2)

[0223] Biochar 1000 g

[0224] H2SO4 (3M) was added until reaching an Sulfuric acid (H2SO4)

[0225] initial target pH of 5.5

[0226]

[0227] Considerations: Additives are applied directly to manure and stirred vigorously

[0228] Characterization of the fresh manure

[0229] Parameters Trial 1 Trial 2 Trial 3 pH 7.13 ± 0.02 7.43 ± 0.01 6.61 ± 0.01 Total solids (%) 11.46 ± 0.98 23.97 ± 2.33 12.02 ± 0.34 Volatile solids (%) 9.18 ± 0.66 9.30 ± 0.21 9.31 ± 0.12 N-NH4+(mg kg-1 sample) 2317 ± 158.0 1834 ± 109 2191 ± 30 TKN (mg kg-1 sample) 5390 ± 20 4375 ± 149 4816 ± 119 CODt (g O2L-1) 112 ± 5 116 ± 2 97 ± 1 NO2; NO3- (mg L-1) 0 0 0

[0230] Volatile Fatty Acids (VFAs)

[0231] Parameters Trial 1 Trial 2 Trial 3 Acetic (g L-1) 4.61 ± 0.20 3.83 ± 0.05 4.76 ± 0.02 Propionic (g L-1) 1.11 ± 0.04 1.07 ± 0.01 1.94 ± 0.04 Butyric (g L-1) 1.01 ± 0.04 0.55 ± 0.01 0.99 ± 0.01 Isobutyric (mg L-1) 60.7 ± 2.6 0 0 Isovaleric (mg L-1) 52.9 ± 12.4 48.5 ± 11.3 64.6 ± 19.3 Valeric (mg L-1) 0 0 0 Isocaproic (mg L-1) 0 0 0 Hexanoic (mg L-1) 0 0 0 Heptanoic (mg L-1) 0 0 0

[0232] Manure treated with selected additives - Emission tests (CO2, CH4, N2O, H2S -ATMOSPHERIC)

[0233] Figure 7 shows the cumulative emissions of CO2, CH4, N2O, H2S under atmospheric conditions at the pilot scale of manure treated with hydrogen peroxide (H2O2), calcium cyanamide (CaCN2), their combination, biochar, and sulfuric acid (H2SO4) as a positive control.

[0234] It can be demonstrated that:

[0235] - The additives tested show significant differences compared to the CONTROL test in CH4 production.

[0236] Hydrogen sulfide (H2O2), calcium cyanamide (CaCN2), hydrogen sulfide (H2O2) + calcium cyanamide (CaCN2), and sulfuric acid (H2SO4) significantly minimize CH4 emissions.

[0237] - The combination of hydrogen sulfide (H2O2) + calcium cyanamide (CaCN2) demonstrates a reduction > 55% compared to CONTROL.

[0238] Sulfuric acid (H2SO4) reports similar N2O production than CONTROL.

[0239] Hydrogen sulfide (H2O2), calcium cyanamide (CaCN2), and hydrogen sulfide (H2O2) + calcium cyanamide (CaCN2) inhibited the production of N2O. - The production of hydrogen sulfide (H2S) was low for all assays. Calcium cyanamide (CaCIXh), hydrogen sulfide (H2O2) + calcium cyanamide (CaCN2), and sulfuric acid (H2SO4) were the best additives for limiting emissions.

[0240] Manure treated with selected additives - Global warming potential - atmospheric tests

[0241] Figure 8 shows the global warming potential (100 years) under atmospheric conditions at the pilot scale of manure treated with selected additives. It can be demonstrated that:

[0242] - The global warming potential is highly influenced by N2O production under atmospheric conditions.

[0243] - All additives tested report a lower global warming potential than CONTROL tests.

[0244] Hydrogen sulfide (H2O2) + Calcium cyanamide (CaCN2) are the best additives to minimize the global warming potential.

[0245] Example 1.4 Effect of manure additives on manure texture

[0246] Figure 9 shows the effect of the selected manure additives on the texture of manure at pilot scale.

[0247] It can be demonstrated that:

[0248] Manure treated with hydrogen peroxide (H2O2) and hydrogen peroxide (H2O2) + calcium cyanamide (CaCN2) demonstrate a useful effect regarding texture at the end of the 28-day trials. The selected treatments liquify the manure compared to the CONTROL and sulfuric acid (H2SO4).

[0249] - The sulfuric acid (H2SO4) treatment leads to increased generation of fungi on the surface.

[0250] - The biochar treatment made the manure denser and darker than the CONTROL.

[0251] Example 2 Plant health assessments

[0252] Example 2.1 Seed germination test for toxicity evaluation on grass and maize The manure additives according to the invention are tested as follows:

[0253] The treatments evaluate distilled water (control), untreated, and treated cow manure with hydrogen peroxide (H2O2), calcium cyanamide (CaCN2), biochar, and hydrogen sulfide (H2O2) + calcium cyanamide (CaCN2). Manure liquid extract diluted at 10% (MLE10%) and 50% (MLE50%) is applied to 10 maize and 20 grass seeds per replicate. All treatments are assessed in triplicate. Weight (0.35 g) is the selection parameter for forage maize seeds. Grass seeds are selected using a stereoscope to select those without visible damage. One irrigation per day is performed using 5 mL in a laminar flow hood (sterile conditions). The last irrigation is performed with 3 mL of the extract. The incubation occurs at 25 ± 1°C under dark conditions and the duration of the assay is 96-100 hours. The evaluation of the seed germination index is performed at the end of the incubations. The incubation time is defined based on the time needed by the control treatment to achieve the threshold germination, which is 90% and 80% for the seeds of maize and grass, respectively. The number of germinated seeds and the length of the main root are measured, and the seed germination index is calculated.

[0254] It can be demonstrated that:

[0255] - When adding MLE10% of treated manure to grass seeds the combination of hydrogen peroxide (H2O2) + calcium cyanamide (CaCN2) results in an improved seed germination compared to untreated manure and sulfuric acid (H2SO4). - When adding MLE50%, biochar performs better compared to untreated manure, favoring the seed germination of grass.

[0256] MLE10% with hydrogen peroxide (H2O2), biochar, and hydrogen peroxide (H2O2) + calcium cyanamide (CaCN2) improves maize root development compared to untreated manure while sulfuric acid (H2SO4) has a detrimental effect compared to untreated manure.

[0257] MLE50% of untreated manure to maize seeds has a more detrimental effect compared to MLE10% solution. The treated manure has an improved effect compared to the untreated manure. This is not the case for sulfuric acid (H2SO4). Manure treated with hydrogen peroxide (H2O2), calcium cyanamide (CaCN2), biochar, and hydrogen peroxide (H2O2) + calcium cyanamide (CaCN2) demonstrates an improved effect over the number and rates of seeds germinated. In particular, additives biochar and hydrogen peroxide (H2O2) improve root formation.

[0258] 10% of Cont Untrea Manure Manure Manure Manure Manure manure in rol ted + + + + +

[0259]

[0260] solution for wate manur additiv additiv additiv additiv additiv grass r e e A e B e C e D e E % AvSG 93,3 88,3 93,3 86,7 85,0 83,3 95,0 AvRL 19,0 17,3 14,9 17,2 18,5 14,0 22,7 % IG 93,3 88,9 92,7 70,6 114,6 84,3 118,3 50% of Cont Untrea Manure Manure Manure Manure Manure manure in rol ted + + + + + solution for wate manur additiv additiv additiv additiv additiv grass r e e A e B e C e D e E 50 50 50 50 50 50 50 % AvSG 86,3 85,0 85,0 86,7 81,7 81,7 83,3 AvRL 6,5 6,2 6,2 3,6 4,2 9,5 5,1 % IG 34,4 31,6 31,6 14,6 24,2 54,0 21,2 10 % of Cont Untrea Manure Manure Manure Manure Manure manure in rol ted + + + + + solution for wate manur additiv additiv additiv additiv additiv maize r e e A e B e C e D e E % AvSG 85,8 59,2 43,3 50,0 66,7 56,7 50,0 AvRL 47,1 55,6 7,5 50,0 79,9 74,1 94,1 % IG 85,8 62,1 21,9 43,3 64,6 64,6 42,9 50 % of Cont Untrea Manure Manure Manure Manure Manure manure in rol ted + + + + + solution for wate manur additiv additiv additiv additiv additiv maize r e e A e B e C e D e E % AvSG 85,8 43,3 36,7 66,7 56,7 53,3 43,3 AvRL 47,1 58,5 19,3 25,0 74,1 78,4 71,6 % IG 85,8 40,1 43,1 36,9 64,6 58,4 22,4

[0261]

[0262] Legend: (A) Sulfuric acid (H2SO4), (B) Calcium cyanamide (CaCN2), (C) Hydrogen peroxide (H2O2), (D) Biochar, (E) Hydrogen peroxide (H2O2) + Calcium cyanamide (CaCN2), % AvSG = % Seed germinated average, AvRL = Root length average (mm), % IG = Germination Index

[0263] Example 2.2 Early seedling growth test in pots on grass and maize

[0264] The manure additives according to the invention are tested as follows: A substrate composed of a mixture of blonde peat and black peat, superfine structure, and good water retention capacity is chosen for the germination of grass seeds. The treatments include the control (substrate) and the substrate diluted to 50% with fresh untreated manure. The substrate is hydrated (1 mL / g substrate) before being mixed with manure. Small pots with 6 cm height are utilized for the test. Control pots contain 40 g of soil, while pots containing manure hold 40 g of soil and 40 g of manure. The mixture of soil and manure is well homogenized. The test is conducted in triplicate using 20 seeds per replicate. 4 seeds of grass are sown in each pot. The seeds are incubated at a constant temperature (25°C) with photoperiods of 16:8 h and white LED lamps of 2200 lux. The early growth of seeds is evaluated after 20-25 days of incubation. The number of germinated seeds and the length of the stem are measured. The total wet weight of the root is also recorded for each treatment.

[0265] It can be demonstrated that:

[0266] - The effect of adding manure to soil for plant growth is improved when using manure treated with additives according to the invention. Parameters such as % of seed germinated (%SG), total stem length (TSL) and total wet weight (TWW) are improved compared to using soil with untreated manure.

[0267] Grass seedlings of the control soil and biochar showed better development (SG%) and growth (TSL) compared to the other treatments that showed clear symptoms of salinity stress.

[0268] Manure treated with sulfuric acid (H2SO4) had a lower beneficial effect on plant growth compared to the additives according to the invention.

[0269] Plants grown on soil with manure treated with the mixture hydrogen peroxide (H2O2) + calcium cyanamide (CaCN2) had significantly better results compared to the control soil.

[0270] Contro Untrea Manure Manure Manure Manure Manure I soil ted + + + + +

[0271] manur additive additive additive additive additive e A B C D E SG (%) 95,8 48,6 91,7 95,0 98,3 100,0 96,7 TNL 250,8 118,9 206,0 256,0 218,0 223,0 290,0

[0272]

[0273] TSL 2469,0 1300,3 2670,0 2516,0 2785,0 2798,0 2768,0 TWW 18,8 9,6 17,9 18,3 18,2 18,3 22,6 TDW 1,7 1,7 1,6 1,8 1,6 1,6 2,1

[0274]

[0275] Legend: (A) Sulfuric acid (H2SO4), (B) Calcium cyanamide (CaCN2), (C) Hydrogen peroxide (H2O2), (D) Biochar, (E) Hydrogen peroxide (H2O2) + Calcium cyanamide (CaCN2), SG (%) = % Seed germinated, TNL = Total number leaves, TSL (mm) = Total stem length (mm), TWW (g) = Total wet weight (g), TDW (g)= Total dry weight(g)

[0276] Figure 11 shows an example of a plant growth trial with maize. It can be demonstrated that:

[0277] Maize with the control soil and manure with biochar show the best development and growth compared to the other treatments.

[0278] - The total number of leaves, average stem diameter, average stem height, and average wet weight is highest with biochar compared to the control and the additive treatments.

[0279] - The other additives showed symptoms of salinity stress and hence reduced plant development.

[0280] Example 3 - Dosage optimization - laboratory scale

[0281] In the laboratory scale trials manure additives according to the inventions in different dosages were tested as described in Example 1. 100 represents the recommended dose (STANDARD). Doses BELOW 100 at25, 50, and 75 were tested in various combinations for effectiveness evaluation.

[0282] Figures 12A, 12B, 12C, and 12D show the cumulative emissions of CO2, CH4, N2O, H2S under aerobic conditions at the laboratory scale of manure treated with hydrogen peroxide (H2O2) at different dosage ratios and combined with calcium cyanamide (CaCN). The methodology used is described in Example 1. The emissions are shown for: CTRL + 100 CaCN2+100 H2O2;and CaCN250+50 H2O2

[0283] Figures 13A, 13B, 13C, and 13D show the cumulative emissions of CO2, CH4, N2O, H2S under aerobic conditions at the laboratory scale of manure treated with hydrogen peroxide (H2O2) at different dosage ratios and combined with biochar (B). The emissions are shown, one per gas, with combinations of different ratios of H2O2 and biochar (just the two):

[0284] CTRL BIO: B(50)

[0285] 26: H2O2 (100)+B(50)

[0286] 27: H2O2 (50)+B(50)

[0287] 28: H2O2 (50)+B(25)

[0288] Figures 14A, 14B, 14C, and 14D show the cumulative emissions of CO2, CH4, N2O, H2S under aerobic conditions at the laboratory scale of manure treated with Calcium cyanamide (CaCN2) at different dosage ratios and combined with biochar. The 4 graphs (N2O, CH4, CO2, H2S) one per gas show the combinations of different ratios of CaCN2 and biochar as follows:

[0289] CTRL CTRL BIO: B(50)

[0290] 23: CaCN2(100)+B(50)

[0291] 24: CaCN2(50)+B(50)

[0292] 25: CaCN2(50)+B(25)

[0293] Figures 15A. 15B, and 15C show the global warming potential (100 years) under aerobic conditions at the laboratory scale of manure treated with Calcium cyanamide (CaCN2) at different dosage ratios and combined with hydrogen peroxide (H2O2) or combined with biochar as follows:

[0294] 22: CaCN2E50+ H2O2(50)

[0295] 1 graph showing the GWP for Fig 13 (CTRL BIO: B50; 26: G(100)+B(50) 27: H2O2 (50)+B50; 28: H2O2(50)+B(25))

[0296] 1 graph showing the GWP for Fig 14 (CTRL BIO: B50; 23: CaCN2 (100)+B(50)

[0297] 24: CaCN2(50)+B(50); 25: CaCN2(50)+B(25))

[0298] Figures 16.1A, 16.1B, 16.1C, and 16.1D show the cumulative emissions of CO2, CH4, N2O, H2S under aerobic conditions at the laboratory scale of manure treated with Calcium cyanamide (CaCN2) at at different dosage ratios (concentration for the 75, 50, 25 ratio') and combined with hydrogen peroxide (H2O2) and with biochar at different dosage ratios. 1) Figures 16.1A, 16.1 B, 16.1C, and 16.1 D: The 4 graphs (N2O, CH4, CO2, H2S) one per gas show the combinations of different ratios of CaCN2 at 75 + H2O2+ biochar (focus on CaCN275) as follows:

[0299] CTRL CTRL +: CaCN2100+ H2O2100

[0300] CTRL BIO: B50

[0301] 4: CaCN275+ H2O225+B25

[0302] 7: CaCN275+ H2O250+B25

[0303] 10: CaCN275+ H2O275+B25

[0304] 13: CaCN275+ H2O225+B50

[0305] 16: CaCN275+ H2O250+B50

[0306] 19: CaCN275+ H2O275+B50

[0307] 2) Figures 16.2A, 16.2B, 16.2C, and 16.2D 4 graphs (N2O, CH4, CO2, H2S) one per gas and showing the combinations of different ratios of CaCN2 at 50 + H2O2 + biochar (focus on CaCN250) as follows

[0308] CTRL CTRL +: CaCN2100+ H2O2100

[0309] CTRL BIO: B50

[0310] 5: CaCN250+ H2O225+B25

[0311] 8: CaCN250+ H2O250+B25

[0312] 11: CaCN250+ H2O275+B25

[0313] 14: CaCN250+ H2O225+B50

[0314] 17: CaCN250+ H2O250+B50

[0315] 20: CaCN250+ H2O275+B50

[0316] 3) Figures 16.3A, 16.3B, 16.3C, and 16.3D 4 graphs (N2O, CH4, CO2, H2S) one per gas and showing the combinations of different ratios of CaCN2 at 25 + H2O2 + biochar (focus on CaCN225) as follows:

[0317] CTRL CTRL +: CaCN2100+G100

[0318] CTRL BIO: B50

[0319] 6: CaCN225+ H2O225+B25

[0320] 9: CaCN225+ H2O250+B25 12: CaCN225+ H2O275+B25

[0321] 15: CaCN225+ H2O225+B50

[0322] 18: CaCN225+ H2O250+B50

[0323] 21: CaCN225+ H2O275+B50

[0324] Figures 17A, 17B, and 17C show the global warming potential (100 years) under aerobic conditions at the laboratory scale of manure treated with Calcium cyanamide (CaCN) at different dosage ratios and combined with hydrogen peroxide (H2O2) and with biochar. The 3 graphs show of global warming potential (GWP) (100 years);

[0325] 17. A 1 graph showing the GWP for Fig 16. A (CaCN275 and combinations) 17. B 1 graph showing the GWP for Fig 16. B (CaCN250 and combinations) 17. C 1 graph showing the GWP for Fig 16. C (CaCN225 and combinations)

[0326] Table 1: Optimized dosage

[0327] CaCN2Biochar H2O2CaCN2Biochar H2O2(mL)

[0328] (g) (g) 1

[0329] CTRO 0 0 0 0 0 0 L - 2

[0330] CTRO 100 100 0 2.5 0.65 0 L +

[0331] 3

[0332] CTRO 0 0 50 0 0 12.5 L B

[0333] 4 25 75 25 0.63 0.5 6.25 5 25 50 25 0.63 0.33 6.25 6 25 25 25 0.63 0.16 6.25 7 50 75 25 1.25 0.5 6.25 8 50 50 25 1.25 0.33 6.25

[0334]

[0335] 9 50 25 25 1.25 0.16 6.25 10 75 75 25 1.88 0.5 6.25 11 75 50 25 1.88 0.33 6.25 12 75 25 25 1.88 0.16 6.25 13 25 75 50 0.63 0.5 12.5 14 25 50 50 0.63 0.33 12.5 15 25 25 50 0.63 0.16 12.5 16 50 75 50 1.25 0.5 12.5 17 50 50 50 1.25 0.33 12.5 18 50 25 50 1.25 0.16 12.5 19 75 75 50 1.88 0.5 12.5 20 75 50 50 1.88 0.33 12.5 21 75 25 50 1.88 0.16 12.5 22 50 50 0 1.25 0.33 0 23 0 100 50 0 0.65 12.5 24 0 50 50 0 0.33 12.5 25 0 50 25 0 0.33 6.25 26 100 0 50 2.5 0 12.5 27 50 0 50 1.25 0 12.5 28 50 0 25 1.25 0 6.25

[0336]

[0337] Example 4 - Dosage optimization - pilot scale

[0338] In the pilot scale trials manure additives according to the inventions in different dosages were tested as described in Example 1 and shown in Table 1.

[0339] Figures 18A, 18B, 18C, and 18D show the cumulative emissions of CO2, CH4, N2O per one gas and the GWP under atmospheric conditions at the pilot scale of manure treated at different dosage ratios depending on the additive (concentrations ranging from 100, 75, 50 ratio compared to recommended 100) with calcium cyanamide (CaCN2) and combined with hydrogen peroxide (H2O2) and with biochar at different dosage ratios. Graphs show the combinations of different ratios of CaCN2 at 25 + H2O2 + biochar (focus on CaCN225) as follows:

[0340] CTRL CTRL BIO: B50

[0341] CaCN250+ H2O275+B50

[0342] CaCN275+ H2O250+B50

[0343] CaCN275+ H2O275+B50

[0344] CaCN2100+ H2O275+B50

[0345] The results from the laboratory and pilot scale evaluation of the combined additives are consistent in reducing GHG emissions and addressing additional benefits for utilization at the farm. In particular, the combination of CaCN2 + H2O2 + Biochar at BELOW dosages demonstrated particularly well how the synergistic effect further improves GHG mitigation and nutrient retention in the manure well as benefits plant growth and reduces odours from storage in atmospheric conditions.

[0346] Example 5: Methods of reducing levels of zoonotic pathogens in manure and manure-treated soil

[0347] 1.1. Materials and methods: Experimental design

[0348] Over the course of a year, six batches of fresh manure, containing both faeces and urine, were collected, covering all seasonal periods (autumn, winter, spring, and summer). All assays were performed batchwise under aerobic conditions in 2.1-L gas-tight bottles sealed with butyl-septa and aluminium screw caps (Fisher Scientific, France). The assays were conducted in duplicate with controls and the additive to study the effect of treated and untreated manure on GHG emissions, physicochemical parameters, and microbial communities via shotgun metagenomics. The incubation was carried out at 25°C for a duration of 28 days. At the end of the 28-day incubation period, the stored manure, both treated and untreated, was mixed with 50% universal substrate for plants. This mixture was used for grass growth assays and to analyse pathogenic and microbial communities via cultivation methods and amplicon sequencing after the 28-day storage period. For pathogenic analysis, duplicates of each control and treatment, as well as the original fresh manure, were sent as the initial point (Day 0). For community assessment, biological triplicates were sent for amplicon sequencing after each treatment as the initial point (Day 0). The grass growth assays were conducted for 23 days. Upon completion, new samples in duplicate were sent for pathogenic assessment, and biological triplicates were taken for DNA extraction and amplicon sequencing (Day 23). Figure 19 depicts the workflow followed during this research.

[0349] 1.2 Pathogens analysis through cultivation methods

[0350] The pathogenic species analysed were selected based on the European legislation's maximum limits for microorganisms in growing media of organic origin and fertilizers (ECDC), 2019). The targeted pathogen was Escherichia coli. Samples of fresh manure, and of the mixture of the stored manure with plant substrate (Day 0) and at the end of the growth assay (Day 23) were sent for their analysis to the quality control and analysis laboratory (Labdial, Spain). E. coli detection employed the ISO-GRID hydrophobic grid membrane filter method. The membrane filter, retaining bacterial cells, was subsequently incubated on SD-39 agar medium. For enzymatic enhancement, 5 mL of a 10-fold diluted homogenate was combined with 1 mL of B-glucuronidase and incubated for 20-30 minutes in a water bath at 35°C. The detection and quantification of E. coli is represented as colony-forming units per gram of substrate (CFU-g-1).

[0351] 1.3 Amplicon metagenomic analysis of the microbial community

[0352] The community structure of the bacterial biomass present in the control samples and treated samples was determined at the end of the GHG assay after mixing 50:50 % (v / v) of the stored manure and the substrate for plants (Time 0) and at the end of the growth assay (Time 23). The DNA was extracted from each biological triplicate with a FastDNA™ SPIN Kit for Soil (MP Biomedicals, USA). PCR amplification of regions 16S-V4-V5 was performed with the primers GTGCCAGCMGCCGCGGTAA (SEQ ID NO: 1), CCGTCAATTCCTTTGAGTTT (SEQ ID NO: 2) connecting with barcodes. Libraries were checked with Qubit and real-time PCR for quantification, while a bioanalyzer was used for size distribution detection. Quantified libraries were pooled and sequenced on a paired-end Illumina platform to generate 250bp paired-end raw reads in Novogene UK (Cambridge, UK). Paired- end reads were assigned to samples based on their unique barcodes and truncated by cutting off the barcodes and primer sequences. The whole process was performed through Python (V3.6.13) and adaptors were removed through cutadapt (V3.3). Paired-end reads were merged using FLASH (V1.2.11, http: / / ccb.jhu.edu / software / FLASH / ; Magoc & Salzberg, 2011). Data filtration and chimera removal were performed using the fastp (VO.23.1) software and the UCHIME Algorithm (http: / / www.drive5.com / usearch / manual / uchime_algo.html) (Edgar et al., 2011). Clustering of the sequences into Operational Taxonomic Units (OTUs) was based on the gene reference database SILVA (V138.1) and the ribosomal data base project (V18) (Quast et al., 2013) using QIIME (V 1.9.1). The sequences obtained have been deposited in Genbank as Bioproject PRJNA1020663. Bar graphs and heatmaps were plotted with R using the package ggplot2 (Wickham et al., 2019) and R pheatmap (Kolde, 2019). Alpha diversity was calculated with QIIME (V 1.9.1) and displayed with R software (V 4.0.3) (Bolyen et al., 2018). Function prediction according to marker genes was performed with the R package PICRUSt2 (V2.3.0) (Douglas et al., 2020).

[0353] Based on literature searches across multiple articles and databases such as Integrated Microbial Genomes and Microbiomes (IMG / M) of the Joint Genome Institute (JGI), and the laboratory results for the detection and quantification of pathogenic bacteria and protozoa through cultivation methods. The.txt files with the species and genes relative abundance (Unigenes. relative. ko / ec.xls & Unigenes. relative. s.xls) were analysed using RStudio software. Some RScript were designed using package “Tidyverse” (Wickham et al., 2019), while heatmaps were performed with the function “pheatmap” (version 1.0.12) (Kolde, 2019). Moreover, a sequence similarity search of E. coli toxin genes in proteins predicted from metagenomics data was performed. A blast database was created with each of the 2 toxin files using the following command line: “makeblastdb -dbtype prot -in toxins. file -out toxins”. For each protein sequence file in each metagenomics sample, the following BlastP command line was run: “blastp -query sample. protein. fa -out sample. protein_vs_toxins.blastP-best-hit.tab” -db toxins -outfmt '6 qaccver saccver pident length qstart qend qlen sstart send slen evalue bitscore stifle' -max_target_seqs 1 -evalue 1e-3 -qcov_hsp_perc 80 -num_threads 16. Then, the results file for all replicates of an experiment were merged. On the merged files, query coverage and subject coverage added, filtered with the following thresholds: percent identity (pident) > 80%, query coverage (qcov) > 70% and subject coverage (scov) > 70%.

[0354] 2. Results:

[0355] As raw manure samples were not analysed by amplicon, they were omitted from the shotgun results for this analysis. CN is calcium cyanamide (CaCN2), HO is hydrogen peroxide (H2O2), HS is Sulfuric acid (H2SO4), HOCN is combination of hydrogen peroxide (H2O2), and calcium cyanamide (CaCN2).

[0356] 2.1 Pathogenic protozoa and zoonotic bacteria via cultivation

[0357] In Figure 20 the logarithm of the colony forming units per gram (CFU / g) of E. coli analysed in the laboratory through cultivation is depicted, displaying together their abundance at time 0 (beginning of the growth assay) and time 23 (end of the growth assay). The level of Campylobacter found was below the maximum limits of these microorganisms in growing media of organic origin and fertilizers (Campylobacter. 101.38log (<25) CFU / g).

[0358] Of note, levels of pathogenic E. coli actually increased in the samples treated with sulfuric acid (H2SO4), which is currently the recommended additive for reducing odour and greenhouse gas emissions. As such, the present invention provides a significant advantage over the currently approved manure additives.

[0359] 2.2 Pathogenic zoonotic bacteria via amplicon

[0360] In Figure 21 it can be seen that the relative abundance of Escherichia-Shigella genera was high before the growth assay, taking its highest values in the H2SO4 treatment and the combined treatment of calcium cyanamide (CaCN2) and hydrogen peroxide (H2O2) (referred to herein as HOCN). However, its levels decreased after the end of the growth assay. In terms of Campylobacter genera, its relative abundance was nearly null, before and after the growth assay.

[0361] As shown in Figure 21, the level of reduction of E.coli amplicons from TO to T23 in the manure treated with HOCN was 90%, 50% with CN and 93% with HO. This level of reduction was significantly higher than that seen in the controls - e.g. the untreated manure.

[0362] Conclusion

[0363] In all cases, pathogens were not detected in risky levels in the treated manure or soil mixed with the treated manure. In general, the treated manure had lower doses of potential pathogens as detected from all techniques in comparison to the untreated manure and therefore the treatment of manure with additives brings a microbial safety effect.

Claims

1. CLAIMS:

1. A method of increasing the environmental benefit of manure or manure-treated soil, the method comprising administering to manure or manure-treated soil, a manure additive, wherein the manure additive is or comprises calcium cyanamide (CaCIXL), wherein the method comprises administering 0.17 - 0.35g of calcium cyanamide (CaCN2) per 1 kg manure.

2. The method of claim 1, wherein the method comprises maintaining or improving the health of manure-treated soil.

3. The method of claim 2, wherein maintaining the health of manure-treated soil comprises maintaining the level of one or more zoonotic pathogens in manure below a level harmful to human health.

4. The method of claim 2, wherein improving the health of manure-treated soil comprises reducing the level of one or more zoonotic pathogen in manure below the level of the zoonotic pathogen present in untreated manure.

5. The method any of claims 2 to 4, wherein the zoonotic pathogen is selected from Escherichia coli and / or the genus Shigella.

6. The method of any of claims 1 to 5, wherein the method comprises reducing the emission of at least one greenhouse gas from manure, limit(s) the generation of gaseous emissions from the manure including greenhouse gases (CO2, CH4, N2O) and odorous compounds (H2S) under strict anaerobic or / and aerobic conditions as well as atmospheric conditions.

7. The method of any of claims 1 to 6, wherein the method further comprises administering to the manure or the manure-treated soil a second manure additive, wherein the second manure additive is or comprises hydrogen peroxide (H2O2), preferably 1.7 - 3.5g of hydrogen peroxide (H2O2) per 1kg manure.

8. The method of any of claims 1 to 8, wherein the method further comprises administering to the manure or the manure-treated soil a third manure additive, wherein the third manure additive is biochar.

9. The method of claim 9, wherein the method comprises administering 10 - 60 g of biochar per 1 kg manure.

10. The method of any of claim 9, wherein the method comprises administering 1.7 - 2.8 g of hydrogen peroxide (H2O2) per 1 kg manure and / or 20 - 50 g of biochar per 1 kg manure to the manure.

11. The method of any preceding claim, wherein the manure additive further comprises additives selected from the group consisting of calcium hydroxide, calcium carbonate, magnesium carbonate, or a combination thereof.

12. A method of reducing the level of at least one nitrifying bacteria in manure, or manure-treated soil, the method comprising adding to manure or manure-treated soil, a manure additive, wherein the manure additive is or comprises hydrogen peroxide (H2O2), wherein the manure additive comprises adding 1.7 - 3.5g of hydrogen peroxide (H2O2) per 1kg of manure.

13. The method of claim 12, wherein the nitrifying bacteria is selected from one or more of Nitrosomonas, Nitrosococcus, Nitrobacter, Nitrospira and Nitrospina.

14. A method of reducing the level of at least one methanogen in manure, or manure- treated soil, the method comprising adding to manure or manure-treated soil, a manure additive, wherein the manure additive is or comprises hydrogen peroxide (H2O2), wherein the manure additive comprises adding 1.7 - 3.5g of hydrogen peroxide (H2O2) per 1kg of manure.

15. The method of claim 14, wherein the methanogen is selected from Candidatus Methanogranum, Candidatus Methanoperedens, Candidatus Methanoplasma, Methanobrevibacter, Methanocorpusculum, Methanolobus, Methanomethylovorans and Methanomicrobium, or wherein the methanogen is selected from an aerobic methanotrophic bacteria, preferably selected fromMethylobacter, Methylocaldum, Methylocystis, Methylogaea, Methylomonas, Methyloterricola and Methylovulum.

16. The method of any of claims 12 to 15, wherein the method comprises adding 1.7- 2.8g of hydrogen peroxide (H2O2) per 1kg of manure.

17. The method of any of claims 12 to 16, wherein the method further comprises administering to the manure or the manure-treated soil a second manure additive, wherein the second manure additive is or comprises calcium cyanamide (CaCN2).

18. The method of any of claims 12 to 17, wherein the method comprises administering 0.17 - 0.35g of calcium cyanamide (CaCN2) per 1 kg manure.

19. The method of any of claims 12 to 18, wherein the method further comprises adding to the manure or the manure-treated soil a third manure additive, wherein the third manure additive is biochar.

20. The method of claim 19, wherein the method comprises adding 10 - 60 g of biochar per 1 kg manure.

21. The method of any of claim 20, wherein the method comprises administering 1.7 - 2.8 g of hydrogen peroxide (H2O2) per 1 kg manure and / or 20 - 50 g of biochar per 1 kg manure to the manure.

22. The method of claims 12 to 21, wherein the manure additive further comprises additives selected from the group consisting of calcium hydroxide, calcium carbonate, magnesium carbonate, or a combination thereof.

Citation Information

Patent Citations

  • Root-system senescence-resistance yield-increasing organic slow-release fertilizer for wheat planting

    CN107089858A

  • Compound fertilizer having high utilization rate and capable of improving metal ion adsorption capacity

    CN108440089A

  • Process for the reduction of gas emission from farm manure

    US20220002212A1

  • Ozonized biochar phosphorus sustainability and sand soilization

    WO2020005760A1