ESR1 transcriptional repressors and uses thereof

Abstract

The present disclosure relates to method of modulating ERα mRNA expression, modulating the activity of the ESR1 transcriptional repressor (MERARs), and treatment of cancers including breast cancer, estrogen receptor positive or "ER(+)" breast cancer, resistant breast cancer, breast cancer with ESR1 mutations, ER positive breast cancer with ESR1 mutations, ER positive resistant breast cancer with ESR1 mutations, prostate cancer, non-small cell lung cancer, and metastatic cancer using MERAR compounds and pharmaceutical compositions comprising the MERAR compounds. A kit comprising one or more of the MERAR compound is also provided.

Description

Atty. Docket No. 2920571-025977ESRI TRANSCRIPTIONAL REPRESSORS AND USES THEREOFCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This International Patent Application claims the benefit of U. S. Provisional Patent Application No. 63 / 726,017, filed 27 November 2024, which is hereby incorporated by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under grant from Louisiana Cancer Research Center. The government has certain rights in the invention.FIELD

[0003] The present disclosure relates to methods of mediating ERa mRNA expression, methods of mediating the activity of the ESRI transcriptional repression, and methods of treatment of cancers including breast cancer, estrogen receptor positive or “ER(+)” breast cancer, resistant breast cancer, breast cancer with ESRI mutations, ER positive breast cancer with ESRI mutations, ER positive resistant breast cancer with mutations in ESRI, and metastatic cancer. The disclosure also relates to compounds and pharmaceutical compositions useful for modulating ERa mRNA expression, compounds useful for modulating the activity of the ESRI transcriptional repressor (MERARs) and pharmaceutical compositions thereof, and to treatment of cancers including breast cancer, ER(+) breast cancer, resistant breast cancer, breast cancer with ESRI mutations, ER positive breast cancer with ESRI mutations, ER positive resistant breast cancer with ESRI mutations, and metastatic cancer with said compounds and compositions.BACKGROUND

[0004] It is estimated that in 2019, 20% (174,650 out of 870,970) of newly diagnosed male cancer patients were diagnosed with prostate cancer and 30% (268,600 out of 891,490) of newly diagnosed female cancer patients were diagnosed with breast cancer (1). In the same year (2019), it is estimated that 10% (31,620 out of 321,670) of deaths in male cancer patients were due to prostate cancer and 15% (41,760 out of 285,210) of deaths in female cancer patients were due to breast cancer. While the survival rates have improved over the last decade, and can be attributed to early detection and new treatment methods, the diagnosis of these cancers is stillAtty. Docket No. 2920571-025977devastating for patients because the outcome cannot be predicted, and because survival varies by stage and age at diagnosis.

[0005] There are three major molecular subtypes of breast cancer based upon the presence or absence of two receptors. Accordingly, tumors expressing estrogen receptor (ER) are referred to as “ER(+)” breast cancers. These types of cancers are treated with targeted therapies that block / inhibit growth of the cancer by interfering with the activity of a specific receptor that is responsible for the disease condition. In estrogen receptor positive (ER(+)) breast cancer, tamoxifen is the most common treatment, but 20-30% of patients are resistant to tamoxifen. Therefore, there is an urgent need for novel and effective therapies.

[0006] Over 70% breast cancer (BCa) occurrences are estrogen receptor alpha positive (“ERa (+)”). ERa encoded by the ESRI gene, transcriptionally promotes tumor cell proliferation, invasion, migration and metastasis in breast cancer. The current first line of therapies include endocrine therapy drugs such as aromatase inhibitors, selective estrogen receptor modulators (SERM), and selective estrogen receptor degrader / down regulators (SERD). About 50% of patients see a relapse in ER(+) breast cancers and development of resistance to the first line of therapies. Most tumors that exhibit resistance to anti-estrogen therapy remain ERa(+), demonstrating that refractory tumors have developed dysregulated ERa(+) signaling. Two major mechanisms of resistance development are prevalent: 1) ESRI mutations (Y537S and D538G) which lead to agonist-independent receptor activity and lowered affinity for SERDs / SERMs, and 2) upregulated mitogenic kinases which provide an alternate mechanism for activation of ER(+). The substitution of tyrosine with serine at residue 537 causes a functionally critical change to the ERa active conformation similar to that of an E2 -bound ERa. This renders the mutant resistant to the drugs that target the activation of ERa such as aromatase inhibitors, SERMs and some SERDs. Drugs that impact ERa stability indirectly by targeting parallel cellular pathways that subsequently affect ERa have shown some efficacy to inhibit the growth of Y537S mutant ERa variants. The transcriptional repression of the ESRI gene that expresses ERa has not been established for therapeutic purposes.

[0007] Given the prominent role that ESRI plays in several types of cancer, there is a market and clinical need for more potent cancer drugs which modulate the ESRI transcriptional repressor (MERARs) and suppress ERa mRNA expression.BRIEF SUMMARY

[0008] The present disclosure relates to the use of MERAR compounds and pharmaceutical compositions comprising MERAR compounds in modulating ERa mRNA expression, mediating the activity of the ESRI transcriptional repression (MERARs), and treatment of cancersAtty. Docket No. 2920571-025977including breast cancer, estrogen receptor positive or “ER(+)” breast cancer, resistant breast cancer with ESRI mutations, non-small cell lung cancer, and metastatic cancer. Certain MERAR compounds were previously disclosed in US Patent No. 11,912,660, the contents of which are incorporated herein in their entirety for the disclosure of said MERAR compounds. These compounds were previously shown to have potent activity as S6K1 protein kinase inhibitors.

[0009] The inventors have now surprisingly and unexpectedly found that these compounds show potent activity in modulating the ERa mRNA expression, as well as mediating the activity of the ESRI transcriptional repression. This disclosure provides methods of modulating ERa mRNA expression, and methods of mediating the activity of the ESRI transcriptional repression using the MERAR compounds. The disclosure further demonstrates the therapeutic potential for treatment of cell proliferative diseases and disorders such as cancer by transcriptional repression of the ESRI gene that expresses ERa.

[0010] In some embodiments, the present disclosure relates to methods of treating cancers, including breast cancer, estrogen receptor positive or “ER(+)” breast cancer, resistant breast cancer with ESRI mutations, non-small cell lung cancer, and metastatic cancer, using MERAR compounds or pharmaceutical compositions comprising the MERAR compounds, and these features can also be implemented in any other embodiment presented herein.

[0011] In some embodiments, the MERAR compounds are represented by compounds of Formula (I) or stereoisomers or pharmaceutically acceptable salts thereof:Formula (I);whereinR is H, alkyl, aryl, substituted aryl, heterocyclyl, or substituted heterocyclyl;X is -NHR4, -NR5COR5, OH, or SH;R1, and R3are each independently selected from the group consisting of H, -NHR4, OR4, Br, Cl, I, -NH-CR4=CR4-, -NR5-, -NR5CH2-, - CH2NR5-,- NR5CO-, -NR5COR5, -Atty. Docket No. 2920571-025977CONR5-,-N=N-, -NH-CO-NH-, -NH-CS-NH-, -C0-0-, CO-O-CH2-, -SO2NH-, -NH- SO2-, -C=C-, -O-CH2-CO-, -OCH2CH2O-, -CH(OH)-, and -NO2bridging groups;R2is independently selected from the group consisting of-NHR4, OR4, Br, Cl, I, -NH- CR4=CR4-, -NR5-, -NR5CH2-, - CH2NR5-,- NR5CO-, -NR5COR5, -CONR5-,-N=N-, -NH- CO-NH-, -NH-CS-NH-, -CO-O-, CO-O-CH2-, -SO2NH-, -NH-SO2-, -C=C-, -O-CH2- CO-, -OCH2CH2O-, -CH(OH)-, and -NO2 bridging groups;R4is selected from the group consisting of H, halogen, C1-6 alkyl, C1-6 alkenyl, C1-6 alkoxy, Ci-ehaloalkyl, haloCi-6 alkoxy, -COOH, -CONH2, -COC1-6 alkyl, O- C1-6 alkyl, NH- C1-6 alkyl, -S C1-6 alkyl groups, -CN, -NH2, and -NO2; andeach R5is independently selected from the group consisting of H, C1-6 alkyl, aryl, C3-8 cycloalkyl, monocyclic or bicyclic heterocyclyl, and monocyclic or bicyclic heteroaryl, wherein the aryl, heteroaryl or heterocyclyl groups may be optionally substituted by one or more R4groups, and these features can also be implemented in any other embodiment presented herein.

[0012] In some embodiments, X is -NH2, -NR5COR5, OH, or SH, and these features can also be implemented in any other embodiment presented herein.

[0013] In some embodiments,R is H or alkyl;X is NH2;R1, and R3are each independently selected from the group consisting of H, -NHR4, and -NR5COR5;R2is independently selected from the group consisting of NHR4, and -NR5COR5; R4is selected from the group consisting of hydrogen, halogen, C1-6 alkyl, O- C1-6 alkyl, -CN, -NH2, and -NO2; andeach R5independently represents hydrogen, heteroaryl, or aryl, wherein the heteroaryl or aryl group may be optionally substituted by one or more R4groups, and these features can also be implemented in any other embodiment presented herein.

[0014] In some embodiments, R is H, and this feature can also be implemented in any other embodiment presented herein.

[0015] In some embodiments, R1and R3are H, and these features can also be implemented in any other embodiment presented herein.Atty. Docket No. 2920571-025977

[0016] In some embodiments, R2is -NR5COR5, and this feature can also be implemented in any other embodiment presented herein.

[0017] In some embodiments, X is -NR5COR5and R2is -NR5COR5, and these features can also be implemented in any other embodiment presented herein.

[0018] In some embodiments, X is -NR5COR5and R2is -NH2, and these features can also be implemented in any other embodiment presented herein.

[0019] In some embodiments, X is -NH2 and R2is -NR5COR5, and these features can also be implemented in any other embodiment presented herein.

[0020] In some embodiments, R4is selected from the group consisting of hydrogen, halogen, C1-6 alkyl, O- C1-6 alkyl, -CN, -NH2, and -NO2. In a further embodiment, R4is selected from the group consisting of hydrogen, halogen, -OCH3, -CN, -NH2, and -NO2. In a further embodiment, R4is selected from the group consisting of hydrogen, halogen, and -NO2. These features can also be implemented in any other embodiment presented herein.

[0021] In some embodiments, each R5independently represents hydrogen, thiophene, phenyl or naphthyl, wherein the thiophene, phenyl or naphthyl group may be optionally substituted by one or more R4groups, and these features can also be implemented in any other embodiment presented herein.

[0022] In a further embodiment, each R5independently represents hydrogen, phenyl or naphthyl, wherein the phenyl or naphthyl group may be optionally substituted by one or more R4groups, and these features can also be implemented in any other embodiment presented herein.

[0023] In some embodiments, the MERAR compound is selected from the group consisting of:oAtty. Docket No. 2920571-025977Atty. Docket No. 2920571-025977Atty. Docket No. 2920571-025977RJ-32RJ-33RJ-34 RJ-35BrNH2O NH2O NH2O RJ-38 RJ-36 RJ-37RJ-40 AT-13GSH-3-100Atty. Docket No. 2920571-025977or a pharmaceutically acceptable salt thereof.

[0024] In some embodiments, the MERAR compound is a compound selected from the group consisting of:RJ-1RJ-25Atty. Docket No. 2920571-025977GSH-3-99GSH-4-15or a pharmaceutically acceptable salt thereof.Atty. Docket No. 2920571-025977

[0025] In some embodiments, the MERAR compound is(RJ-7), or a pharmaceutically acceptable salt thereof.

[0026] In some embodiments, the MERAR compound is:HN(RJ-19), or a pharmaceutically acceptable salt thereof.

[0027] In some embodiments, the MERAR compound is(RJ-22), or a pharmaceutically acceptable salt thereof.

[0028] In some embodiments, the MERAR compound isor a pharmaceutically acceptable salt thereof.

[0029] In some embodiments, the MERAR compound is(AT-13), or a pharmaceutically acceptable salt thereof.

[0030] In some embodiments, the MERAR compound isAtty. Docket No. 2920571-025977GSH-4-3or a pharmaceutically acceptable salt thereof.

[0031] In some embodiments, the disclosure provides a pharmaceutical composition comprising at least one compound of formula (I) or a pharmaceutically acceptable salt or solvate thereof, and these features can also be implemented in any other embodiment presented herein.

[0032] In some embodiments, the pharmaceutical compound is for use in (or useful for) treatment of a proliferative disease.

[0033] In some embodiments, the proliferative disease or disorder is a cell proliferative disease or disorder.

[0034] In some embodiments, the proliferative disease is a cancer, for example, breast cancer, prostate cancer, lung cancer, metastatic cancer, endometrial cancer, neuroendocrine tumor, pancreatic ductal adenocarcinoma and diseases including diabetes, obesity and hemangioma, etc.

[0035] In some embodiments, the disclosure provides a method of modulating ERa mRNA expression, the method comprising exposing cells to a compound of formula (I). In some embodiments, the disclosure provides a method of suppressing ERa mRNA expression, the method comprising exposing cells to a compound of formula (I). These features can also be implemented in any other embodiment presented herein.

[0036] In some embodiments, the disclosure provides a method of modulating the activity of the ESRI transcriptional repressor, the method comprising exposing cells to a compound of formula (I). In some embodiments, the disclosure provides a method of suppressing the activity of the ESRI transcriptional repressor, the method comprising exposing cells to a compound of formula (I). These features can also be implemented in any other embodiment presented herein.

[0037] In some embodiments, the disclosure provides a method of treating cancer.Atty. Docket No. 2920571-025977

[0038] In some embodiments, the cancer is breast cancer, prostate cancer, lung cancer (nonsmall cell lung cancer), metastatic cancer, or solid tumors.

[0039] In some embodiments, the disclosure provides a method of treating breast cancer.

[0040] In some embodiments, the cancer is ER positive cancer.

[0041] In some embodiments, the cancer is ER positive breast cancer.

[0042] In some embodiments, the cancer is ERa positive cancer.

[0043] In some embodiments, the cancer is ER positive breast cancer with ESRI mutations

[0044] In some embodiments, the cancer is ER positive resistant breast cancer with ESRI mutations.

[0045] In some embodiments, the method comprises administering to a subject in need thereof, a compound according to any one of the preceding embodiments.

[0046] In some embodiments, the method comprises administering to a subject in need thereof, a pharmaceutical composition comprising a compound according to any one of the preceding embodiments.

[0047] In some embodiments, the subject is a mammal.

[0048] In some embodiments, the subject is human.

[0049] In some embodiments, the present disclosure provides a use of a compound of Formula (I) in the manufacture of a medicament for treatment of cancer.

[0050] In some embodiments, the present disclosure provides a kit, comprising a composition comprising at least one MERAR compound of any one of the preceding embodiments, for treatment and prevention of cancer and cancer related morbidities.

[0051] In some embodiments, the kit comprises at least one carrier, at least one binder, at least one diluent, at least one excipient, at least one other therapeutic agent, or mixtures thereof.

[0052] While certain features of this invention shown and described below are pointed out in the annexed claims, the invention is not intended to be limited to the details specified, since a person of ordinary skill in the relevant art will understand that various omissions, modifications, substitutions, and changes in the forms and details of the invention illustrated and in its operation may be made without departing in any way from the spirit of the present invention. No feature of the invention is critical or essential unless it is expressly stated as being “critical” or “essential.”Atty. Docket No. 2920571-025977

[0053] These and other features, aspects, and advantages of embodiments of the present disclosure will become better understood with regard to the following descriptions, claims, and accompanying drawings explained below.BRIEF DESCRIPTION OF THE DRAWINGS

[0054] FIG. 1 Summary model of the significance of MERAR compounds in ER(+) breast cancer models.

[0055] FIG. 2 shows: (A) Structures of the compounds that showed >60 % growth inhibition of MCF7 cells; (B) X-ray crystal structure of RJ22; (C) Treatment of MCF7 cells with RJ22, RJ23 and AT 13 under withdrawal conditions and upon addition of lOnM estradiol (E2); and (D) Treatment of MCF7 cells with GSH-3-99, GH-3-100, GSH 4-3, and GSH-4-15 under withdrawal conditions and upon addition of lOnM estradiol (E2).

[0056] FIG. 3 shows (A) in-vitro 3D spheroid model of MCF7 cells used to observe the growth inhibition upon treatment with RJ22; and (B) Effect of varying concentrations of RJ22 on growth of MCF7 cells.

[0057] FIG. 4 shows: (A) Western blot of MCF7 cells treated with RJ22 for 24 hours and 48 hours, probed with ERa antibody and the normalization with GADPH; and (B) T47D-ERE-luc treatment with RJ22, RJ23 and AT13. The percent luminescence levels of compound treated cells in comparison to the 10 nM E2 treated cells is shown.

[0058] FIG. 5 shows: (A) Effect of Proteasome Inhibitor MG132, Protein Synthesis Inhibitor Cycloheximide, RJ22 and RET inhibitor, Selpercatinib, in MCF7 cells; (B) Western blot of (top panel) MCF7 cells treated with MG132, RJ22, and Selpercatinib; (bottom panel) MCF7 cells treated with cycloheximide, MG132, RJ22, and Selpercatinib; probed with ERa antibody and the normalization with GADPH; and (C) ERa mRNA Levels in MCF7 cells Treated with RJ22 in the presence and absence of E2.

[0059] FIG. 6 shows Western blots on the MCF7-ES cells withdrawn from estrogen for 7 days followed by treatment with RJ22, a derivative KPI, inhibitors of RET (Selpercatinib) and MAP4K4 (DMX5086) dilutions in the presence or absence of E2 for: (A) 24 hours; and (B) 48 hours. ERa levels probed with ERa66 (SC-787, Santa Cruz Biotech) were calculated by normalization with WT-ERa / GAPDH levels.

[0060] FIG. 7 shows: (A) the effect of treatment of MCF7 Y537S mutant cells with the three compounds RJ22, RJ23, ATI 3, ICI (Fulvestrant) and E2; and (B) the effect of treatment of MCF7 D538G mutant cells with the three compounds RJ22, RJ23, AT13, ICI (Fulvestrant) and E2.Atty. Docket No. 2920571-025977

[0061] FIG. 8 Western blot of MCF7 Y537S cells treated with lOpM concentrations of RJ22, RJ23, and AT13 for 24 hours and probed with ERa66 (SC-787, Santa Cruz Biotech) and calculated by normalization with WT-ERa / Actin levels.

[0062] FIG. 9 Western blot of MCF7 Y537S cells treated with lOpM concentrations of RJ22, RJ23, and AT13 for 24 hours and probed with GREB1 (65171S, Cell Signaling) and PGR (8757s, Cell Signaling) and calculated by normalization with WT-ERa / Actin levels.DETAILED DESCRIPTION

[0063] Before the subject disclosure is further described, it is to be understood that the disclosure is not limited to the particular embodiments of the disclosure described below, as variations of the particular embodiments may be made and still fall within the scope of the appended claims. It is also to be understood that the terminology employed is for the purpose of describing particular embodiments, and is not intended to be limiting. Instead, the scope of the present disclosure will be established by the appended claims.

[0064] In this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs.

[0065] As used herein, the term “alkyl” refers to a group derived from a straight or branched chain saturated aliphatic hydrocarbon having the specified number of carbon atoms and having a valence of one, optionally substituted with one or more substituents where indicated, provided that the valence of the alkyl group is not exceeded. Non-limiting examples of the alkyl group include methyl, ethyl, propyl, iso-propyl, etc. The alkyl group may optionally be substituted with halo, or haloalkyl groups.

[0066] As used herein, the term “aryl” refers to a cyclic group in which all ring members are carbon and all rings are aromatic, the group having the specified number of carbon atoms, and having a valence of one, optionally substituted with one or more substituents where indicated, provided that the valence of the aryl group is not exceeded. More than one ring can be present, and any additional rings can be fused, pendant, spirocyclic, or a combination thereof. Nonlimiting examples of the aryl group include phenyl, naphthyl, anthryl, etc. The aryl group may optionally be substituted with alkyl, alkoxy, amino, nitro, halo, or haloalkyl groups.

[0067] As used herein, the term “heteroaryl” means a monovalent carbocyclic ring group that includes one or more aromatic rings, in which at least one ring member (for example, one,Atty. Docket No. 2920571-025977two or three ring members) is a heteroatom selected from nitrogen (N), oxygen (O), sulfur (S), and phosphorus (P), the group having the specified number of carbon atoms.

[0068] As used herein, the term “cycloalkyl” refers to a group that comprises one or more saturated and / or partially saturated rings in which all ring members are carbon, the group having the specified number of carbon atoms. Cycloalkyl groups do not include an aromatic ring or a heterocyclic ring. “Heterocyclic”, “heterocyclyl” or “heterocycloalkyl” refers to a cycloalkyl group in which at least one carbon atom is replaced by N, O, P, S or an atom other than carbon.

[0069] As used herein, the term “halogen” or “halo” means fluoro, chloro, bromo, or iodo, and is defined herein to include all isotopes of the same, including heavy isotopes and radioactive isotopes. Examples of useful halo isotopes include18F,76Br, and131I. Additional isotopes will be readily appreciated by one of skill in the art.

[0070] As used herein, the term “pharmaceutical composition” means a composition comprising at least one active agent, such as a compound or salt of Formula (I), and at least one other substance, such as a carrier. Pharmaceutical compositions can meet the U. S. FDA’s GMP (good manufacturing practice) standards for human or non-human drugs.

[0071] As used herein, “pharmaceutically acceptable salts” refers to derivatives of the compounds disclosed herein wherein the parent compound is modified by making acid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines, alkali or organic salts of acidic residues such as carboxylic acids, and the like. The pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, such conventional nontoxic salts include, but are not limited to, those derived from inorganic and organic acids selected from 2-acetoxybenzoic, 2-hydroxyethane sulfonic, acetic, ascorbic, benzene sulfonic, benzoic, bicarbonic, carbonic, citric, edetic, ethane disulfonic, 1,2-ethane sulfonic, fumaric, glucoheptonic, gluconic, glutamic, glycolic, glycollyarsanilic, hexylresorcinic, hydrabamic, hydrobromic, hydrochloric, hydroiodic, hydroxymaleic, hydroxynaphthoic, isethionic, lactic, lactobionic, lauryl sulfonic, maleic, malic, mandelic, methane sulfonic, napsylic, nitric, oxalic, pamoic, pantothenic, phenylacetic, phosphoric, polygalacturonic, propionic, salicylic, stearic, subacetic, succinic, sulfamic, sulfanilic, sulfuric, tannic, tartaric, toluene sulfonic, and the commonly occurring amine acids, e.g., glycine, alanine, phenylalanine, arginine, etc.

[0072] Other examples of pharmaceutically acceptable salts include hexanoic acid, cyclopentane propionic acid, pyruvic acid, malonic acid, 3-(4-hydroxybenzoyl)benzoic acid,Atty. Docket No. 2920571-025977cinnamic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo-[2.2.2]-oct-2-ene-l -carboxylic acid, 3-phenylpropionic acid, trimethylacetic acid, tertiary butylacetic acid, muconic acid, and the like. The present disclosure also encompasses salts formed when an acidic proton present in the parent compound either is replaced by a metal ion, e.g., an alkali metal ion, an alkaline earth ion, or an aluminum ion; or coordinates with an organic base such as ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucamine, and the like. In the salt form, it is understood that the ratio of the compound to the cation or anion of the salt may be 1: 1, or any ratio other than 1:1, e.g., 3:1, 2:1, 1:2, or 1:3.

[0073] It should be understood that all references to pharmaceutically acceptable salts include solvent addition forms (solvates) or crystal forms (polymorphs) as defined herein, of the same salt.

[0074] As used herein, the term “minimize” or “reduce”, or derivatives thereof, include a complete or partial inhibition of a specified biological effect (which is apparent from the context in which the terms “minimize” or “reduce” are used).

[0075] As used herein the term “mediating” means increasing, enhancing, decreasing, suppressing, or otherwise altering the activity or level of expression of a gene or a protein. The modulation of activity or level of expression may be achieved in vivo or in vitro. The modulation of activity or level of expression may be effectuated by exposing the cells expressing said gene or protein to a therapeutically effective amount of one or more MERAR compound.

[0076] As used herein, the term “therapeutically effective amount” means the amount of compound required to achieve a change in the activity or level of expression by at least 5%, more preferably by at least 10%, more preferably by at least 20%, more preferably by at least 30%, more preferably by at least 40%.

[0077] As used herein, “subject” or “subjects” refers to any animal, such as a warm-blooded animal, i.e., mammals including rodents (e.g., mice or rats), dogs, primates, lemurs or humans.

[0078] As used herein, “treating” means administering to a subject a pharmaceutical composition to ameliorate, reduce or lessen the symptoms of a disease. As used herein, “treating” or “treat” describes the management and care of a subject for the purpose of combating a disease, condition, or disorder and includes the administration of a compound disclosed herein, or a pharmaceutically acceptable salt, polymorph or solvate thereof, to alleviate the symptoms or complications of a disease, condition or disorder, or to eliminate the disease,77Atty. Docket No. 2920571-025977condition or disorder. The term “treat” may also include treatment of a cell in vitro or an animal model. As used herein, “subject” or “subjects” refers to any animal, such as mammals including rodents (e.g., mice or rats), dogs, primates, lemurs or humans.

[0079] Treating cancer may result in a reduction in size of a tumor. A reduction in size of a tumor may also be referred to as “tumor regression.” Preferably, after treatment, tumor size is reduced by 5% or greater relative to its size prior to treatment; more preferably, tumor size is reduced by 10% or greater; more preferably, reduced by 20% or greater; more preferably, reduced by 30% or greater; more preferably, reduced by 40% or greater; even more preferably, reduced by 50% or greater; and most preferably, reduced by greater than 75% or greater. Size of a tumor may be measured by any reproducible means of measurement. The size of a tumor may be measured as a diameter of the tumor.

[0080] Treating cancer may result in a reduction in tumor volume. Preferably, after treatment, tumor volume is reduced by 5% or greater relative to its size prior to treatment; more preferably, tumor volume is reduced by 10% or greater; more preferably, reduced by 20% or greater; more preferably, reduced by 30% or greater; more preferably, reduced by 40% or greater; even more preferably, reduced by 50% or greater; and most preferably, reduced by greater than 75% or greater. Tumor volume may be measured by any reproducible means of measurement.

[0081] Treating cancer may result in a decrease in number of tumors. Preferably, after treatment, tumor number is reduced by 5% or greater relative to number prior to treatment; more preferably, tumor number is reduced by 10% or greater; more preferably, reduced by 20% or greater; more preferably, reduced by 30% or greater; more preferably, reduced by 40% or greater; even more preferably, reduced by 50% or greater; and most preferably, reduced by greater than 75%. Number of tumors may be measured by any reproducible means of measurement. The number of tumors may be measured by counting tumors visible to the naked eye or at a specified magnification. Preferably, the specified magnification is 2*, 3*, 4*, 5*, 10x, or 50*.

[0082] Treating cancer may result in a decrease in number of metastatic lesions in other tissues or organs distant from the primary tumor site. Preferably, after treatment, the number of metastatic lesions is reduced by 5% or greater relative to number prior to treatment; more preferably, the number of metastatic lesions is reduced by 10% or greater; more preferably, reduced by 20% or greater; more preferably, reduced by 30% or greater; more preferably, reduced by 40% or greater; even more preferably, reduced by 50% or greater; and most preferably, reduced by greater than 75%. The number of metastatic lesions may be measured byAtty. Docket No. 2920571-025977any reproducible means of measurement. The number of metastatic lesions may be measured by counting metastatic lesions visible to the naked eye or at a specified magnification. Preferably, the specified magnification is 2*, 3x, 4*, 5*, 10*, or 50*.

[0083] Treating cancer may result in an increase in average survival time of a population of treated subjects in comparison to a population receiving carrier alone. Preferably, the average survival time is increased by more than 30 days; more preferably, by more than 60 days; more preferably, by more than 90 days; and most preferably, by more than 120 days. An increase in average survival time of a population may be measured by any reproducible means. An increase in average survival time of a population may be measured, for example, by calculating for a population the average length of survival following initiation of treatment with an active compound. An increase in average survival time of a population may also be measured, for example, by calculating for a population the average length of survival following completion of a first round of treatment with an active compound.

[0084] Treating cancer may result in an increase in average survival time of a population of treated subjects in comparison to a population of untreated subjects. Preferably, the average survival time is increased by more than 30 days; more preferably, by more than 60 days; more preferably, by more than 90 days; and most preferably, by more than 120 days. An increase in average survival time of a population may be measured by any reproducible means. An increase in average survival time of a population may be measured, for example, by calculating for a population the average length of survival following initiation of treatment with an active compound. An increase in average survival time of a population may also be measured, for example, by calculating for a population the average length of survival following completion of a first round of treatment with an active compound.

[0085] Treating cancer may result in increase in average survival time of a population of treated subjects in comparison to a population receiving monotherapy with a drug that is not a compound disclosed herein, or a pharmaceutically acceptable salt thereof. Preferably, the average survival time is increased by more than 30 days; more preferably, by more than 60 days; more preferably, by more than 90 days; and most preferably, by more than 120 days. An increase in average survival time of a population may be measured by any reproducible means. An increase in average survival time of a population may be measured, for example, by calculating for a population the average length of survival following initiation of treatment with an active compound. An increase in average survival time of a population may also be measured, for example, by calculating for a population the average length of survival following completion of a first round of treatment with an active compound.Atty. Docket No. 2920571-025977

[0086] Treating cancer may result in a decrease in the mortality rate of a population of treated subjects in comparison to a population receiving carrier alone. Treating cancer may result in a decrease in the mortality rate of a population of treated subjects in comparison to an untreated population. Treating cancer may result in a decrease in the mortality rate of a population of treated subjects in comparison to a population receiving monotherapy with a drug that is not a compound disclosed herein, or a pharmaceutically acceptable salt, prodrug, metabolite, analog or derivative thereof. Preferably, the mortality rate is decreased by more than 2%; more preferably, by more than 5%; more preferably, by more than 10%; and most preferably, by more than 25%. A decrease in the mortality rate of a population of treated subjects may be measured by any reproducible means. A decrease in the mortality rate of a population may be measured, for example, by calculating for a population the average number of disease-related deaths per unit time following initiation of treatment with an active compound. A decrease in the mortality rate of a population may also be measured, for example, by calculating for a population the average number of disease-related deaths per unit time following completion of a first round of treatment with an active compound.

[0087] Treating cancer may result in a decrease in tumor growth rate. Preferably, after treatment, tumor growth rate is reduced by at least 5% relative to number prior to treatment; more preferably, tumor growth rate is reduced by at least 10%; more preferably, reduced by at least 20%; more preferably, reduced by at least 30%; more preferably, reduced by at least 40%; more preferably, reduced by at least 50%; even more preferably, reduced by at least 50%; and most preferably, reduced by at least 75%. Tumor growth rate may be measured by any reproducible means of measurement. Tumor growth rate may be measured according to a change in tumor diameter per unit time.

[0088] Treating cancer may result in a decrease in tumor regrowth, for example, following attempts to remove it surgically. Preferably, after treatment, tumor regrowth is less than 5%; more preferably, tumor regrowth is less than 10%; more preferably, less than 20%; more preferably, less than 30%; more preferably, less than 40%; more preferably, less than 50%; even more preferably, less than 50%; and most preferably, less than 75%. Tumor regrowth may be measured by any reproducible means of measurement. Tumor regrowth is measured, for example, by measuring an increase in the diameter of a tumor after a prior tumor shrinkage that followed treatment. A decrease in tumor regrowth is indicated by failure of tumors to reoccur after treatment has stopped.

[0089] Treating or preventing a cell proliferative disorder may result in a reduction in the rate of cellular proliferation. Preferably, after treatment, the rate of cellular proliferation isAtty. Docket No. 2920571-025977reduced by at least 5%; more preferably, by at least 10%; more preferably, by at least 20%; more preferably, by at least 30%; more preferably, by at least 40%; more preferably, by at least 50%; even more preferably, by at least 50%; and most preferably, by at least 75%. The rate of cellular proliferation may be measured by any reproducible means of measurement. The rate of cellular proliferation is measured, for example, by measuring the number of dividing cells in a tissue sample per unit time.

[0090] Treating or preventing a cell proliferative disorder may result in a reduction in the proportion of proliferating cells. Preferably, after treatment, the proportion of proliferating cells is reduced by at least 5%; more preferably, by at least 10%; more preferably, by at least 20%; more preferably, by at least 30%; more preferably, by at least 40%; more preferably, by at least 50%; even more preferably, by at least 50%; and most preferably, by at least 75%. The proportion of proliferating cells may be measured by any reproducible means of measurement. Preferably, the proportion of proliferating cells is measured, for example, by quantifying the number of dividing cells relative to the number of nondividing cells in a tissue sample. The proportion of proliferating cells may be equivalent to the mitotic index.

[0091] Treating or preventing a cell proliferative disorder may result in a decrease in size of an area or zone of cellular proliferation. Preferably, after treatment, size of an area or zone of cellular proliferation is reduced by at least 5% relative to its size prior to treatment; more preferably, reduced by at least 10%; more preferably, reduced by at least 20%; more preferably, reduced by at least 30%; more preferably, reduced by at least 40%; more preferably, reduced by at least 50%; even more preferably, reduced by at least 50%; and most preferably, reduced by at least 75%. Size of an area or zone of cellular proliferation may be measured by any reproducible means of measurement. The size of an area or zone of cellular proliferation may be measured as a diameter or width of an area or zone of cellular proliferation.

[0092] Treating or preventing a cell proliferative disorder may result in a decrease in the number or proportion of cells having an abnormal appearance or morphology. Preferably, after treatment, the number of cells having an abnormal morphology is reduced by at least 5% relative to its size prior to treatment; more preferably, reduced by at least 10%; more preferably, reduced by at least 20%; more preferably, reduced by at least 30%; more preferably, reduced by at least 40%; more preferably, reduced by at least 50%; even more preferably, reduced by at least 50%; and most preferably, reduced by at least 75%. An abnormal cellular appearance or morphology may be measured by any reproducible means of measurement. An abnormal cellular morphology may be measured by microscopy, e.g., using an inverted tissue culture microscope. An abnormal cellular morphology may take the form of nuclear pleiomorphism.27Atty. Docket No. 2920571-025977

[0093] In some embodiments, the disclosure provides a method of mediating decrease in ERa mRNA expression. In some embodiments, the modulating ERa mRNA expression is suppressing the ERa mRNA expression.

[0094] In some embodiments, the disclosure provides a method of suppressing ERa mRNA expression, the method comprising exposing cells to a compound of formula (I).

[0095] In some embodiments, the disclosure provides a method of modulating the activity of the ESRI transcriptional repressor. In some embodiments, the mediating the activity of the ESRI transcriptional repressor is suppression of the ESRI transcription. In some embodiments, the disclosure provides a method of suppressing the activity of the ESRI transcription, the method comprising exposing cells to a compound of formula (I).

[0096] In some embodiments, the disclosure provides a method of treating cancer.

[0097] In some embodiments, the cancer is breast cancer, prostate cancer, lung cancer (nonsmall cell lung cancer), metastatic cancer, or solid tumors.

[0098] In some embodiments, the cancer is ER positive cancer.

[0099] In some embodiments, the cancer is ER positive breast cancer.

[0100] In some embodiments, the cancer is ER positive breast cancer with ESRI mutations

[0101] In some embodiments, the cancer is ER positive resistant breast cancer with ESRI mutations.

[0102] In some embodiments, the cancer is ERa positive cancer.

[0103] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a compound according to any one of the preceding embodiments.

[0104] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a compound selected from the group consisting ofRJ-2Atty. Docket No. 2920571-025977Atty. Docket No. 2920571-025977Atty. Docket No. 2920571-025977RJ-32NH2O RJ-33RJ-34 RJ-35NH2O NH2O NH2O RJ-38 RJ-36 RJ-37RJ-40 AT-13GSH-3-100Atty. Docket No. 2920571-025977or a pharmaceutically acceptable salt thereof,wherein the cancer is breast cancer, resistant breast cancer, breast cancer with ESRI mutations, prostate cancer, lung cancer (non-small cell lung cancer), metastatic cancer, solid tumors, ER positive cancer, ERa positive cancer, ER positive breast cancer, ER positive breast cancer with ESRI mutations, or ER positive resistant breast cancer with ESRI mutations.

[0105] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a compound selected from the group consisting ofRJ-22 RJ-20Atty. Docket No. 2920571-025977RJ-27 RJ-285AT-13 GSH-3-99and GSH-4-15or a pharmaceutically acceptable salt thereof,Atty. Docket No. 2920571-025977wherein the cancer is breast cancer, resistant breast cancer, breast cancer with ESRI mutations, prostate cancer, lung cancer (non-small cell lung cancer), metastatic cancer, solid tumors, ER positive cancer, ERa positive cancer, ER positive breast cancer, ER positive breast cancer with ESRI mutations, or ER positive resistant breast cancer with ESRI mutations.

[0106] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, the compoundH3COH3CO(RJ-7),or a pharmaceutically acceptable salt thereof.

[0107] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, the compound(RJ-19),or a pharmaceutically acceptable salt thereof.

[0108] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, the compoundRJ-22or a pharmaceutically acceptable salt thereof.

[0109] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, the compoundor a pharmaceutically acceptable salt thereof.Atty. Docket No. 2920571-025977

[0110] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, the compound(SVv NH2?0" AT-13,or a pharmaceutically acceptable salt thereof.

[0111] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, the compoundor a pharmaceutically acceptable salt thereof.wherein the cancer is breast cancer, prostate cancer, lung cancer (non-small cell lung cancer), metastatic cancer, solid tumors, ER positive cancer, ERa positive cancer or ER positive breast cancer.

[0112] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, the compoundor a pharmaceutically acceptable salt thereof,wherein the cancer is breast cancer, prostate cancer, lung cancer (non-small cell lung cancer), metastatic cancer, solid tumors, ER positive cancer, ERa positive cancer or ER positive breast cancer.

[0113] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, the compoundAtty. Docket No. 2920571-025977AT-13,or a pharmaceutically acceptable salt thereof,wherein the cancer is breast cancer, prostate cancer, lung cancer (non-small cell lung cancer), metastatic cancer, solid tumors, ER positive cancer, ERa positive cancer or ER positive breast cancer.

[0114] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, the compoundGSH-4-3or a pharmaceutically acceptable salt thereof,wherein the cancer is breast cancer, prostate cancer, lung cancer (non-small cell lung cancer), metastatic cancer, solid tumors, ER positive cancer, ERa positive cancer or ER positive breast cancer.

[0115] In some embodiments, the method of treating ER positive breast cancer comprises administering to a subject in need thereof, a compound selected from the group consisting ofAT-13,Atty. Docket No. 2920571-025977and GSH-4-3,or apharmaceutically acceptable salt thereof.

[0116] In some embodiments, the method of treating ER positive breast cancer comprises administering to a subject in need thereof, the compoundor a pharmaceutically acceptable salt thereof.

[0117] In some embodiments, the method of treating ER positive breast cancer comprises administering to a subject in need thereof, the compoundor a pharmaceutically acceptable salt thereof.

[0118] In some embodiments, the method of treating ER positive breast cancer comprises administering to a subject in need thereof, the compoundAT-13,or a pharmaceutically acceptable salt thereof.

[0119] In some embodiments, the method of treating ER positive breast cancer comprises administering to a subject in need thereof, the compoundAtty. Docket No. 2920571-025977GSH-4-3or a pharmaceutically acceptable salt thereof.

[0120] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising a compound according to any one of the preceding embodiments.

[0121] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising a compound selected from the group consisting ofAtty. Docket No. 2920571-025977Atty. Docket No. 2920571-025977RJ-32NCO2N NH2ORJ-33 RJ-35RJ-34Atty. Docket No. 2920571-025977RJ-38 RJ-37RJ-40 AT-13or a pharmaceutically acceptable salt thereof.

[0122] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising a compound selected from the group consisting ofAtty. Docket No. 2920571-025977RJ-1RJ-7 RJ-19RJ-20 ’RJ'22Atty. Docket No. 2920571-025977or a pharmaceutically acceptable salt thereof.

[0123] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising the compoundH3COH3CO(RJ-7),or a pharmaceutically acceptable salt thereof.

[0124] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising the compound(RJ-19),or a pharmaceutically acceptable salt thereof.Atty. Docket No. 2920571-025977

[0125] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising the compoundor a pharmaceutically acceptable salt thereof.

[0126] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising the compoundor a pharmaceutically acceptable salt thereof.

[0127] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising the compoundAT-13,or a pharmaceutically acceptable salt thereof.

[0128] In some embodiments, the method of treating ER positive breast cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising the compoundGSH-4-3Atty. Docket No. 2920571-025977or a pharmaceutically acceptable salt thereof.

[0129] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising the compoundRJ-22or a pharmaceutically acceptable salt thereof,wherein the cancer is breast cancer, prostate cancer, lung cancer (non-small cell lung cancer), metastatic cancer, solid tumors, ER positive cancer, ERa positive cancer or ER positive breast cancer.

[0130] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising the compoundor a pharmaceutically acceptable salt thereof,wherein the cancer is breast cancer, resistant breast cancer, breast cancer with ESRI mutations, prostate cancer, lung cancer (non-small cell lung cancer), metastatic cancer, solid tumors, ER positive cancer, ERa positive cancer, ER positive breast cancer, ER positive breast cancer with ESRI mutations, or ER positive resistant breast cancer with ESRI mutations.

[0131] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising the compoundAT-13,or a pharmaceutically acceptable salt thereof,wherein the cancer is breast cancer, resistant breast cancer, breast cancer with ESRI mutations, prostate cancer, lung cancer (non-small cell lung cancer), metastatic cancer, solid tumors, ERAtty. Docket No. 2920571-025977positive cancer, ERa positive cancer, ER positive breast cancer, ER positive breast cancer with ESRI mutations, or ER positive resistant breast cancer with ESRI mutations.

[0132] In some embodiments, the method of treating cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising the compoundGSH-4-3or a pharmaceutically acceptable salt thereof,wherein the cancer is breast cancer, resistant breast cancer, breast cancer with ESRI mutations, prostate cancer, lung cancer (non-small cell lung cancer), metastatic cancer, solid tumors, ER positive cancer, ERa positive cancer, ER positive breast cancer, ER positive breast cancer with ESRI mutations, or ER positive resistant breast cancer with ESRI mutations.

[0133] In some embodiments, the method of treating ER positive breast cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising at least one compound selected from the group consisting ofand GSH-4-3,or apharmaceutically acceptable salt thereof.Atty. Docket No. 2920571-025977

[0134] In some embodiments, the method of treating ER positive breast cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising the compoundRJ-22or a pharmaceutically acceptable salt thereof.

[0135] In some embodiments, the method of treating ER positive breast cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising the compoundor a pharmaceutically acceptable salt thereof.

[0136] In some embodiments, the method of treating ER positive breast cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising the compoundAT-13,or a pharmaceutically acceptable salt thereof.

[0137] In some embodiments, the method of treating ER positive breast cancer comprises administering to a subject in need thereof, a pharmaceutical composition comprising the compoundAtty. Docket No. 2920571-025977GSH-4-3or a pharmaceutically acceptable salt thereof.

[0138] The pharmaceutical compositions of the present disclosure can be in any form known to those of skill in the art. For instance, in some embodiments the pharmaceutical compositions are in a form of a product for oral delivery, said product form being selected from a group consisting of a concentrate, dried powder, liquid, capsule, pellet, and pill. In other embodiments, the pharmaceutical compositions of the disclosure are in the form of a product for parenteral administration including intravascular (intraarterial, intravenous), intraparenchymal, intradermal, subdermal, intramuscular, intratumor, intraperitoneal, intralymphatic, intrathecal, subdural, epidural, and subcutaneous administration. The pharmaceutical compositions disclosed herein may also further comprise carriers, binders, diluents, and excipients. These features can also be implemented in any other embodiment presented herein

[0139] In some embodiments, the method comprises administration of one or more compounds of Formula (I), their derivatives, and pharmaceutically acceptable salts (salt forms such as Chloride, Acetate, Aspartate, Benzenesulfonate, Benzoate, Besylate, Bicarbonate, Bitartrate, Bromide, Camsylate, Carbonate, Citrate, Decanoate, Edetate, Esylate, Fumarate, Gluceptate, Gluconate, Glutamate, Glycolate, Hexanoate, Hydroxynaphthoate, Iodide, Isethionate, Lactate, Lactobionate, Malate, Maleate, Mandelate, Mesylate, Methyl sulfate, Mucate, Napsylate, Nitrate, Octanoate, Oleate, Pamoate, Pantothenate, Phosphate, Polygalacturonate, Propionate, Salicylate, Stearate, Succinate, Sulfate, Tartrate, Teoclate, Tosylate, etc.) and solvates (hydrates and other solvates) thereof. These features can also be implemented in any other embodiment presented herein

[0140] The methods for treating a clinical indication by the MERAR compounds disclosed herein, may be effectuated by administering a therapeutically effective amount of the MERAR compound to a patient in need thereof. The therapeutically effective amount may compriseAtty. Docket No. 2920571-025977administration of the compound or a prodrug to the patient at 1 mg / kg / day, 2 mg / kg / day, 3 mg / kg / day, 4 mg / kg / day, 5 mg / kg / day, 10 mg / kg / day and 20 mg / kg / day. Alternatively, amounts ranging from about 0.001 mg / kg / day to about 0.01 mg / kg / day, or about 0.01 mg / kg / day to about 0.1 mg / kg / day, or about 0.1 mg / kg / day to about 1 mg / kg / day, or about 1 mg / kg / day to 10 mg / kg / day, or about 10 mg / kg / day to about 100 mg / kg / day are also contemplated.Administration to a patient in need thereof may occur once, twice, three times, or four times per day.

[0141] In some embodiments, the present disclosure provides MERAR compounds of any one of the preceding embodiments for use in the manufacture of a medicament for the treatment and / or prevention of cancer and cancer related morbidities.

[0142] In some embodiments, the present disclosure provides MERAR compounds of any one of the preceding embodiments for use in the manufacture of a medicament for the treatment of cancer and cancer related morbidities.

[0143] In some embodiments, the present disclosure provides MERAR compounds for use in the manufacture of a medicament for the treatment and / or prevention of cancer and cancer related morbidities, wherein the MERAR compound is selected from the group consisting ofRJ-4Atty. Docket No. 2920571-025977Atty. Docket No. 2920571-025977oo RJ-18 RJ-19RJ-32Atty. Docket No. 2920571-025977RJ-33 RJ-35 RJ-34RJ-38 RJ-36 RJ-37or a pharmaceutically acceptable salt thereof.Atty. Docket No. 2920571-025977

[0144] In some embodiments, the present disclosure provides MERAR compounds for use in the manufacture of a medicament for the treatment and / or prevention of cancer and cancer related morbidities, wherein the MERAR compound is selected from the group consisting ofRJ-1RJ-20Atty. Docket No. 2920571-025977GSH-4-3GSH-4-15or a pharmaceutically acceptable salt thereof.

[0145] In some embodiments, the present disclosure provides MERAR compounds for use in the manufacture of a medicament for the treatment and / or prevention of cancer and cancer related morbidities, wherein the MERAR compound is selected from the group consisting ofAtty. Docket No. 2920571-025977GSH-4-3, or a pharmaceutically acceptable salt thereof.

[0146] In some embodiments, the present disclosure provides MERAR compounds for use in the manufacture of a medicament for the treatment and / or prevention of cancer and cancer related morbidities, wherein the MERAR compound isRJ-22or a pharmaceutically acceptable salt thereof.

[0147] In some embodiments, the present disclosure provides MERAR compounds for use in the manufacture of a medicament for the treatment and / or prevention of cancer and cancer related morbidities, wherein the MERAR compound isor a pharmaceutically acceptable salt thereof.

[0148] In some embodiments, the present disclosure provides MERAR compounds for use in the manufacture of a medicament for the treatment and / or prevention of cancer and cancer related morbidities, wherein the MERAR compound isAtty. Docket No. 2920571-025977(AT-13),or a pharmaceutically acceptable salt thereof.

[0149] In some embodiments, the present disclosure provides MERAR compounds for use in the manufacture of a medicament for the treatment and / or prevention of cancer and cancer related morbidities, wherein the MERAR compound isGSH-4-3or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure provides a kit, comprising a composition comprising at least one MERAR compound of any one of the preceding embodiments, for treatment and / or prevention of cancer and cancer related morbidities.

[0150] In some embodiments, the kit comprises at least one MERAR compound of any one of the preceding embodiments.

[0151] In some embodiments, the kit comprises at least one compound selected from the group consisting of:Atty. Docket No. 2920571-025977Atty. Docket No. 2920571-025977RJ-17NH2° ‘W NH2O- RJ-18RJ'19RJ-20Atty. Docket No. 2920571-025977RJ-32RJ-33, RJ-35 RJ-34NH20NH2O NH2uRJ-38 RJ-36 RJ-37RJ-40 AT-13GSH-3-100Atty. Docket No. 2920571-025977or a pharmaceutically acceptable salt thereof.

[0152] In some embodiments, the kit comprises at least one compound selected from the group consisting ofRJ-1RJ-20Atty. Docket No. 2920571-025977or a pharmaceutically acceptable salt thereof.

[0153] In some embodiments, the kit comprises at least one compound selected from the group consisting ofAtty. Docket No. 2920571-025977GSH-4-3, or a pharmaceutically acceptable salt thereof.

[0154] In some embodiments, the kit comprises the compoundor a pharmaceutically acceptable salt thereof.

[0155] In some embodiments, the kit comprises the compoundor a pharmaceutically acceptable salt thereof.

[0156] In some embodiments, the kit comprises the compound(AT-13),or a pharmaceutically acceptable salt thereof.

[0157] In some embodiments, the kit comprises the compoundAtty. Docket No. 2920571-025977GSH-4-3or a pharmaceutically acceptable salt thereof.

[0158] In some embodiments, the kit is for use in for treatment and / or prevention of cancer and cancer related morbidities.

[0159] In some embodiments, the kit of any of the preceding embodiments comprises at least one carrier, at least one binder, at least one diluent, at least one excipient, at least one other therapeutic agent, or mixtures thereof.EXAMPLES

[0160] Hereby are provided non-limiting examples of embodiments of compounds disclosed herein.

[0161] Example 1 - Synthesis of 3,5-Dinitrophthalic acid:

[0162] To a stirring solution of 2-methyl-3,5-dinitrobenzoic acid (25 g, 0.111 mol) in 200 mL of sulfuric acid at 90 °C was added potassium dichromate (65.01g, 0.222 mol) slowly (one spatula for 2-3- min). During the addition the temperature was maintained at <90 °C. After completion of the addition the resulting reaction mixture was stirred at 90 °C for 48 hours. Upon completion, the reaction mixture was cooled to room temperature, poured into the ice+water mixture and extracted with diethyl ether. Combined organic layers were washed with water (one time) and dried over sodium sulfate. Solvent was removed under reduced pressure to get slightly yellowish solid, which contained both product and unreacted starting material. The mixture was refluxed with 100 mL of toluene for 15 min, and decanted while hot to obtain the product (Usually 7-10 washes were required).

[0163] Example 2 - Synthesis of 4, 6-dinitroisoindoline-l, 3-dione:

[0164] To a stirring solution of 3,5- dinitro phthalic acid (2.56 g, 10.0 mmol) in 20 mL of acetic acid, urea was added (1.20 g, 20 mmol). The resulting solution was stirred under refluxingAtty. Docket No. 2920571-025977conditions for 4 h. The reaction mixture was cooled to room temperature, poured in a beaker containing the ice and stirred for a while. The obtained precipitate was filtered off, washed with water and dried under vacuum to get the product 4, 6-dinitroisoindoline-l, 3-dione in 76% yield.

[0165] Example 3 - Synthesis of 4, 6-diaminoisoindoline-l, 3-dione:

[0166] 4, 6-dinitroisoindoline-l, 3-dione was dissolved in the required amount of methanol, transferred to hydrogenation flask and add a five weight percent of Pd / C. The flask was mounted on the parrshaker instrument and shaken for 70 min at 40 Psi pressure of EE. After 70 min, the reaction mixture was filtered through celite. The obtained solution was transferred to a round bottom flask and the solvent using rotavapor to get the pure product 4, 6-diaminoisoindoline-l, 3-dione as a dirty green solid at over 90% yield.

[0167] Example 4 - General Procedure for the synthesis of -substituted amido phthalimide derivatives:

[0168] To a stirred solution of 4, 6-diaminoisoindoline-l, 3-dione (4) (0.089 g, 0.5 mmol) in 3.0 ml of N-methyl- 2-pyrrollidone at 0 °C, was added a solution of the corresponding acyl halide (0.5 mmol) in 5 ml of acetonitrile dropwise, and was stirred at 0 °C. The reaction was monitored by TLC. After completion, pouring the reaction mixture onto ice resulted in precipitate formation. The precipitate was filtered off, washed with water for several times, and dried under vacuum to get the coupled product.

[0169] Example 5 - Synthesis of N-(7-amino-l,3-dioxoisoindolin-5-yl)benzamide: Yield: 81.6 %. H'-NMR: 5 10.79(s, 1H), 10.45 (s, 1 H), 7.92 (d, 2 H), 7.59-7.50 (m, 7H), 7.34 (s, 1 H), 6.40(b, 2 H). C13-NMR: 5 170.9, 169.7, 166.5, 147.6, 145.7, 134.9, 132.3, 128.9, 128.3, 110.2, 106.2, 106.4, 104.23. HRMS: (M+Na+) Calculated 304.0693, observed 304.0685.

[0170] Example 6 - Synthesis of N-(7-amino-l,3-dioxoisoindolin-4-yl)-4-cyanobenzamide: Yield: 86.4 %. H'-NMR: 5 10.82(s, 1 H), 10.66(s, 1 H), 8.07(d, 2 H, J=12mHz), 8.01(d, 2 H, J=8mHz), 7.52(s, 1 H), 7.32(s, 1 H), 6.44(b, 2 H). C13-NMR: 5 170.85, 169.61, 165.14, 147.56, 145.27, 138.99, 134.91, 132.94, 129.12, 118.71, 114.53, 110.41, 106.70, 104.10. HRMS:(M+Na+) Calculated 329.0645, observed 329.0650.

[0171] Example 7 - Synthesis of N-(7-amino-l,3-dioxoisoindolin-4-yl)-5-chlorothiophene-2-carboxamide. Yield: 91.7 %. H'-NMR: 5 10.8 l(s, 1H), 10.45(s, 1H), 7.93(d, 1 H, J=4mHZ), 7.40(d, 1 H, J=4MHZ), 7.27 (d, 2 H, J=8MHZ), 6.43 (b, 2 H). C13-NMR: 5 170.84, 169.59,159.55, 147.51, 144.97, 138.96, 135.07, 134.95, 130.23, 128.79, 110.22, 106.64, 103.96.Atty. Docket No. 2920571-025977HRMS: (M+Na+) Cl35- Calculated 343.9867, observed 343.9854; Cl37- Calculated 345.9840, observed 345.9830

[0172] Example 8 - Synthesis of N-(7-amino-l,3-dioxoisoindolin-4-yl)-2-bromobenzamide: Yield: 80.6 %. H'-NMR: 5 10.8 l(s, 1 H), 10.45(s, 1 H), 7.93 (d, 1 H, J=4MHZ), 7.40 (d, 1 H, J=4MHZ), 7.279 (d, 2 H, 8 MHZ), 6.43 (b, 2 H). C13-NMR: 5 170.84, 169.59, 159.55, 147.51, 144.97, 138.96, 135.07, 134.95, 130.23, 128.79, 110.22, 106.64, 103.96. HRMS: (M+Na)+Recalculated 381.9798, observed 381.9795; Br81- Calculated 383.9779, observed 383.9776

[0173] Example 9 - Synthesis of N-(7-amino-l,3-dioxoisoindolin-4-yl)-3-bromobenzamide: Yield: 87.5 %. H'-NMR: 5 10.82 (s, 1H), 10.53 (s, 1 H), 8.099s, 1 H), 7.91 (d, 1 H, 8MHZ), 7.79 (d, 1 H, 8MHZ), 7.49 (d, 2 H, 8MHZ), 7.30 (s, 1 H), 6.409b, 2 H). C13-NMR: 5 170.88, 169.64, 164,89, 147.54, 145.42, 137.08, 135.02, 134.86, 131.10, 130.79, 127.46, 122.12, 110.37, 106.59, 104.21. HRMS: (M+Na)+Br79- Calculated 381.9798, observed 381.9797; Recalculated 383.9779, observed 383.9779

[0174] Example 10 - Synthesis of N-(7-amino-l,3-dioxoisoindolin-4-yl)-4-bromobenzamide: Yield: 83.4 %. H'-NMR: 5 10.80 (s, 1H), 10.50 (s, 1H), 7.87 (d, 2 H, J=12 MHZ), 7.73 (d, 2 H, J=8MHZ), 7.51 9s, 1 H), 7.31 (S, 1 H), 6.41 (b, 2 H). C13-NMR: 5 170.88, 169.65, 165.49, 147.55, 145.52, 134.87, 133.99, 131.88, 130.38, 126.16, 110.30, 106.52, 104.18.

[0175] Example 11 - Synthesis of N-(7-amino-l,3-dioxoisoindolin-4-yl)-2,6-difluorobenzamide: Yield: 68.9 %. H'-NMR: 5 11.04 (s, 1 H), 10.84 (s, 1 H), 7.41 (s, 1 H), 7.25(t, 3 H, J=8MHZ), 7.16 (s, 1H), 6.46 (b, 2H). C13-NMR: 5 170.81, 169.48, 160.43, 160.36, 159.0, 157.96, 157.88, 147.71, 144.70, 135.2, 132.88, 115.67, 115.45, 115.23, 112.73, 112.49, 109.66, 106.96, 103.03. HRMS: (M+Na)+Calculated 340.1000, observed 340.1000

[0176] Example 12 - Synthesis of N-(7-amino-l,3-dioxoisoindolin-4-yl)-3-nitrobenzamide: Yield: 98.3 %. H'-NMR: 6 10.82(s, 1H), 10.53 (s, 1H), 8.09(s, 1H), 7.91(d, 1 H, J=8MHZ0, 7.79 (d, 1 H, J=8MHZ), 7.49(d, 2 H, J=8MHZ)6.60 (b, 2H). C13-NMR: 5 170.86, 169.61, 164.25, 148.13, 147.54, 145.22, 136.28, 134.90, 134.77, 130.66, 126.87, 123.00, 110.54, 106.74, 104.20. HRMS: (M+H)+Calculated 327.0724, Observed 327.0716

[0177] Example 13 - Synthesis of N-(7-amino-l,3-dioxoisoindolin-4-yl)-4-nitrobenzamide: Yield: 97.5 %. H'-NMR: 6 10.83(s, 1H), 10.74(s, 1H), 8.35(d, 2H, J=8MHZ), 8.15 (d, 2 H, J=8MHZ), 7.52 (s, 1 H), 7.32 (s, 1 H), 6.45 (b, 2 H). C13-NMR: 5 170.85, 169.59, 164.84, 149.70, 147.54, 145.21, 140.57, 134.91, 129.80, 123.99, 110.46, 106.76, 104.11. HRMS:(M+H)+Calculated 327.0724, observed 327.0714.Atty. Docket No. 2920571-025977

[0178] Example 14 - Synthesis of N-(7-amino-l,3-dioxoisoindolin-4-yl)-3,5-dinitrobenzamide: Yield: 63.5 %. H'-NMR: 5 10.98 (s, 1 H), 10.86 (s, 1 H), 9.13 (s, 1H), 9.00 (s, 1 H), 7.51 (s, 1 H), 7.34 (s, 1 H), 6.49 (b, 2H). C13-NMR: 5 170.78, 169.50, 162.09, 148.45, 147.48, 144.76, 137.38, 134.87, 128.57, 121.72, 110.69, 106.95, 104.13. HRMS: (M+Na)+Calculated 394.0394, observed 394.0407.

[0179] Example 15 - Synthesis of 3-amino-N-(7-amino-l,3-dioxoisoindolin-4-yl)benzamide: Pd / C (10 mg) is added to N-(7-amino-l,3-dioxoisoindolin-5-yl)-3-nitrobenzamide (5h) (0.033 g, 0.1 mmol) in methanol and subjected to hydrogenation in a Parr Shaker at a Hz pressure of 40 psi for 1 h. Upon completion, the reaction is filtered through celite and concentrated to obtain the product 3-amino-N-(7-amino-l,3-dioxoisoindolin-5-yl)benzamide (6a) with an isolated yield 93.2%. H'-NMR: 5 10.76 (b, 1 H), 10.30 (s, 1 H), 7.53 (s, 1 H), 7.30 (s, 1 H), 7.13 (t, 2 H, J=8MHZ), 7.02 (d, 1 H, J= 12 MHZ), 6.73 (d, 2 H, J= 4MHZ), 6.37 (s, 1 H), 5.33 (b, 2 H). C13-NMR: 5 170.91, 169.72, 167.32, 149.25, 147.56, 145.95, 135.93, 134.81, 129.27, 117.53, 115.27, 113.40, 110.05, 106.18, 104.20. HRMS: (M+H)+Calculated 297.0982, observed 297.0975.

[0180] Example 16 - Synthesis of 4-amino-N-(7-amino-l,3-dioxoisoindolin-4-yl)benzamide: Yield: 91.7%. H'-NMR: 5 10.72 (b, 1H), 9.97 (s, 1H), 7.69 (d, 2 H, J=8MHZ), 7.52 (s, 1 H), 7.32 (s, 1 H), 6.57 (d, 2 H, J=8MHZ), 6.33 (s, 2 H), 5.83 (s, 2 H). C13-NMR: 5 170.92, 169.79, 166.06, 152.97, 147.55, 146.45, 134.75, 130.08, 120.83, 112.94, 104.70, 105.74, 104.20. HRMS: (M+Na)+Calculated 319.0802, observed 319.0797.

[0181] Example 17 - 3,5-diamino-N-(7-amino-l,3-dioxoisoindolin-4-yl)benzamide: Yield: 94.5%. H'-NMR: 5 10.74 (b, 1 H), 10.20 (s, 1 H), 7.52 (s, 1 H), 7.26 (s, 1 H), 6.34 (s, 2 H), 6.24 (s, 2 H), 5.98 (s, 1 H), 4.96 (s, 4 H). C13-NMR: 5 170.91, 169.74, 168.23, 149.63, 147.56, 146.18, 144.50, 136.80, 134.78, 109.81, 105.96, 104.13, 102.87, 102.73. HRMS: (M+Na)+Calculated 334.0911, observed 334.0903

[0182] Example 18 - N-(7-amino-l,3-dioxoisoindolin-5-yl)-2-phenylacetamide: Yield: 80.4%. H'NMR: 5 10.76 (bs, 1H), 10.41 (bs, 1H), 7.32 (m, 3H), 7.28 (d, 1H, J-1.2 Hz), 7.20 (m, 2H), 7.16 (d, 1H, J=1.2 Hz), 6.37 (bs, 2H), 3.66 (s, 2H). C13NMR: 5 170.98, 170.23, 169.47, 147.55, 145.45, 136.01, 135.12, 129.80, 128.85, 127.15, 108.93, 106.46, 103.05, 43.65. HRMS (M+H)+Calculated 234.0879, observed 234.0876.

[0183] Example 19 - N-(7-amino-l,3-dioxoisoindolin-5-yl)-2-(4-(trifluoromethyl)phenyl)acetamide: Yield: %. H'NMR: 6 10.76 (bs, 1H), 10.47 (bs, 1H), 7.70 (d, 2H, J=6.15 Hz), 7.55 (d, 2H, J=6.15 Hz), 7.27 (d, 1H, J=0.96 Hz), 7.16 (d, 1H, J=0.96 Hz),Atty. Docket No. 2920571-0259776.37 (bs, 2H), 3.80 (s, 2H). C13NMR: 5 170.86, 169.55, 147.72, 145.54, 141.03, 135.35, 131.13, 130.48, 125.67, 109.23, 106.46, 103.04, 43.44. HRMS (M+H)+Calculated 364.0909, observed 364.0904.

[0184] Example 20 - N-(7-amino-l,3-dioxoisoindolin-5-yl)-2-(3-(trifluoromethyl)phenyl)acetamide: Yield: %. H1NMR: 6 10.77 (bs, 1H), 10.48 (bs, 1H), 7.57-7.69 (m, 4H), 7.29 (d, 1H, J=1.68 Hz), 7.15 (d, 1H, J=1.68 Hz), 6.36 (bs, 2H), 3.81 (s, 2H). C13NMR: 5 171.86, 169.69, 147.72, 145.54, 137.39, 135.21, 134.04, 129.96, 123.42, 109.15, 106.39, 103.19, 43.08. HRMS (M+H)+Calculated 364.0909 observed 364.0909.

[0185] Example 21 - N-(7-amino-l,3-dioxoisoindolin-5-yl)adamantane-l-carboxamide: Yield: 86.1%. H'NMR: 5 10.74 (bs, 1H), 9.34 (bs, 1H), 7.40 (d, 1H, J=1.3 Hz), 7.23 (d, 1H, J=1.3 Hz), 6.25 (bs, 2H), 1.80 (m, 15H). C13NMR: 5 177.33, 171.22, 169.97, 147.75, 146.18, 110.49, 106.11, 104.55, 42.17, 41.97, 41.77, 41.55, 41.34, 38.49, 36.31, 28.02.

[0186] Example 22 - N-(7-amino-l,3-dioxoisoindolin-5-yl)-2-(4-bromophenyl)acetamide: Yield: %. H'NMR: 5 10.76, (bs, 1H), 10.43 (bs, 1H), 7.52 (DD, 2H, J=4.86 Hz & 1.71 Hz), 7.28 (m, 3H), 7.14 (d, 1H, J=1.14 Hz), 6.36 (bs, 2H), 3.65 (s, 2H). C13NMR: 5 171.10, 169.89, 147.87, 145.85, 145.86, 135.51, 131.89, 120.34, 109.32, 106.50, 103.41, 43.11. HRMS (M+H)+Br79- Calculated 374.0140, observed 374.0140; Br81- Calculated 376.0120, observed 376.0119.

[0187] Example 23 - N-(7-amino-l,3-dioxoisoindolin-5-yl)-2-(4-chlorophenyl)acetamide: Yield: %. H'NMR: 5 10.76 (s, 1H), 10.44 (s, 1H), 7.39 (d, 2 H, J=6.4 Hz), 7.35 (d, 2H, J=6.4 Hz), 7.27 (d, 1H, J=l.1 Hz), 7.15 (d, 1H, J=l.1 Hz), 3.68 (s, 2H). C13NMR: 5 171.07, 169.70, 168.53, 147.72, 145.54, 143.21, 139.57, 135.21, 131.86, 128.66, 110.03, 106.68, 103.77, 94.16, 60.11. HRMS (M+H)+C135- Calculated 330.0645, observed 330.0649; Cl37- Calculated 332.0616, observed 332.0610.

[0188] Example 24 - Kinase Assays: Information from ThermoFisher - SelectScreen Services

[0189] The high throughput and dose response curve assays against kinases were performed using the services of SelectScreen™ Biochemical Kinase Profiling Service’ by Thermo Fisher Scientific. “The Z'-LYTE biochemical assay employs a fluorescence-based, coupled-enzyme format and is based on the differential sensitivity of phosphorylated and non-phosphorylated peptides to proteolytic cleavage. The peptide substrate is labeled with two fluorophores — one at each end — that make up a FRET pair. In the primary reaction, the kinase transfers the gammaphosphate of ATP to a single tyrosine, serine or threonine residue in a synthetic FRET-peptide. In the secondary reaction, a site-specific protease recognizes and cleaves non-phosphorylatedAtty. Docket No. 2920571-025977FRET-peptides. Phosphorylation of FRET-peptides suppresses cleavage by the Development Reagent. Cleavage disrupts FRET between the donor (i.e., coumarin) and acceptor (i.e., fluorescein) fluorophores on the FRET-peptide, whereas uncleaved, phosphorylated FRET-peptides maintain FRET. A ratiometric method, which calculates the ratio (the Emission Ratio) of donor emission to acceptor emission after excitation of the donor fluorophore at 400 nm, is used to quantitate reaction progress, as shown in the equation below.”Coumarin emission (445 nm]Emission ratio ™Hourescein emission (520 nm)

[0190] Example 25 - Z ' -LYTE Assay Conditions

[0191] Test Compounds: The Test Compounds are screened in 1% DMSO (final) in the well. For 10 point titrations, 3-fold serial dilutions are conducted from the starting concentration of the customer’s choosing.

[0192] Peptide / Kinase Mixtures: All Peptide / Kinase Mixtures are diluted to a 2X working concentration in the appropriate Kinase Buffer. The 2X RPS6KB1 (p70S6K) / Ser / Thr 07 mixture is prepared in 50 mM HEPES pH 7.5, 0.01% BRIJ-35, 10 mM MgC12, 1 mM EGTA. The final 10 pL Kinase Reaction consists of 2.87 - 17.7 ng RPS6KB1 (p70S6K) and 2 pM Ser / Thr 07 in 50 mM HEPES pH 7.5, 0.01% BRIJ-35, 10 mM MgCl2, 1 mM EGTA. After the 1 hour Kinase Reaction incubation, 5 pL of a 1:45000 dilution of Development Reagent A is added.

[0193] ATP Solution: All ATP Solutions are diluted to a 4X working concentration in Kinase Buffer (50 mM HEPES pH 7.5, 0.01% BRIJ-35, 10 mM MgCl2, 1 mM EGTA). ATP Km apparent is previously determined using a Z'-LYTE assay.

[0194] Development Reagent Solution: The Development Reagent is diluted in Development Buffer IPX Novel PKC Lipid Mix: 2 mg / ml Phosphatidyl Serine, 0.2 mg / ml DAG in 20 mM HEPES, pH 7.4, 0.3% CHAPS

[0195] For 5 mL 10X Novel PKC Lipid Mix:1. Add 10 mg Phosphatidyl Serine (Avanti Polar Lipids Part# 8400032C or 840039C) and 1 mg DAG (Avanti Polar Lipids Part# 800811C) to a glass tube.2. Remove the chloroform from lipid mixture by evaporating to a clear, thin film under a stream of nitrogen. Continuous rotation of the tube, at an angle to ensure maximum surface area of the lipid solution, will promote the thinnest film.3. Add 5 mLs resuspension buffer, 20 mM HEPES, 0.3% CHAPS, pH 7.4, to the dried lipid mixAtty. Docket No. 2920571-0259774. Heat gently to 50-60°C for 1-2 minutes and vortex in short intervals until the lipids are dissolved to a clear or slightly hazy solution. The lipids are typically in solution after 2-3 heat / vortex cycles.5. Cool to room temperature, aliquot into single use volumes and store at -20°C.Z’-LYTE Assay Protocol:Bar-coded Coming, low volume NBS, black 384-well plate (Coming Cat. #4514)1. 100 nL - 100X Test Compound in 100% DMSO2. 2.4 pL - Kinase buffer3. 5 pL - 2X Peptide / Kinase Mixture4. 2.5 pL - 4X ATP Solution5. 30-second plate shake6. 60-minute Kinase Reaction incubation at room temperature7. 5 pL - Development Reagent Solution8. 30-second plate shake9. 60-minute Development Reaction incubation at room temperature10. Read on fluorescence plate reader and analyze the data

[0196] Example 26 - Cell proliferation assay

[0197] Human breast tumor cells (MCF-7 sub clone E3, MCF-7 cells bearing CRISPR-mediated mutations at the ESRI locus, resulting in MCF7 Y537S and MCF7 D538G cells lines, as developed and characterized by Simak Ali’s team1) were routinely maintained in DMEM medium (Mediatech) supplemented with non-essential amino acid (Gibco), sodium pyruvate (Gibco), L-glutamine (Gibco), gentamicin (Gibco) and 10% fetal bovine serum (FBS) (Hyclone). For proliferation experiment, MCF-7 monolayer was dispersed into suspension in DMEM medium with 10% FBS and 5xl05cells were seeded into T-25 flask. The medium was aspirated from the cells, washed with phosphate buffer saline, cultured with DMEM medium containing dextran coated charcoal (DCC) FBS for six days. After six days, the cells were dispersed into suspension, counted, and 1.8 xlO4per well in a 100 pL DCC medium was subcultured into 96 well plates. After 24 h incubation, the medium was aspirated and replaced with test compound at 10'5M. The cells were dosed again after three days and grown for another three days. Measurement for cell proliferation was performed with Alamar Blue (Biorad) on a plate reader (BioTek Synergy Neo2) with 560 nm excitation and 590 nm emission. The experiments were performed in quadruplets.

[0198] Example 27 - Western BlottingAtty. Docket No. 2920571-025977

[0199] Total proteins were isolated, using standard protocols as previously described2'3. In brief, phosphatase and protease inhibitors containing ice-cold RIPA lysis buffer (Santa Cruz Biotechnology, Dallas, TX, USA) was used to lyse cells. The clarified lysate protein concentration was measured by Bradford reagent (Thermo Scientific, Waltham, MA, USA). The proteins were separated using a 4-20% SDS-PAGE gradient gel and transferred onto a PVDF membrane (Bio-Rad, Hercules, CA, USA). A IX blocking buffer was used to block the nonspecific binding sites. The membranes were washed with Tris-buffered saline (Bio-Rad) containing 0.1% Tween-20 (Sigma- Aldrich, St. Louis, MO, USA). Membranes were incubated overnight with primary antibodies at 4 °C. Protein extracts were subjected to immunoblot analysis using antibodies against ERa 66kDa (Cell Signaling), GREB1 (Cell Signaling), PGR (Cell Signaling), Actin (Cell Signaling) or GAPDH (Santa Cruz Biotechnology, Dallas, TX). Immune complexes were detected with appropriate secondary antibodies from Invitrogen (Camarillo, CA, USA) and Clarity Western ECL Substrate (Bio-Rad) as we described2.Immunoblot signals were captured using the Bio-Rad Imager Bio-Rad ChemiDoc Touch Imaging System (Bio-Rad) system. Immune band densitometry was performed using ImageJ Software (NIH, Bethesda, MD, USA, http: / / imagej.nih.gov / ij / accessed on 4 November 2021). Results were expressed as the standard error of mean (± SEM). Significant changes from controls or E2 treated group were determined by a two-tailed Student's t-test and P-values of <0.05 were considered significant.

[0200] Example 28 - Organoid Assay

[0201] MCF-7 breast Carcinoma cells were grown in monolayer until 80% confluence. Following detachment with trypsin, cells were collected at 800g for 5 minutes to obtain cell pellet. Pellets were resuspended RPMI media, containing 10% fetal bovine serum, and cell density adjusted to 20,000 cell / ml. lOOpL of cell suspension (2000 cells) were added to each well of 96 well, round bottom ultra-low attachment plates. 132pL of Obavate® was added to each well, and the plates were centrifuged 290 g for 3 minutes. After incubation at 37°C for 24-28 hrs to allow for spheroid formation in the Incucyte® instrument. RJ22 was added to each well at the indicated concentrations, and the single cell spheroid protocol was used to monitor spheroid growth and the indicated time intervals, for a total of 15 days. All study groups performed in quadruplicate, and the diameter of single spheroid reported using Incucyte® software.

[0202] Example 29 - qRT-PCR

[0203] Total RNA for qRT-PCR was extracted using QIAGEN RNeasy Plus Micro Kit (Valencia, CA, USA) according to the manufacturer’s manual. RNA concentration wasAtty. Docket No. 2920571-025977measured with a Nanodrop at a wave length of 260 nm and280 nm. The total RNA (I pg) was reverse transcribed to cDNA using the Bio-Rad iScript™ cDNA synthesis kit (Bio-Rad Laboratories) following the manufacturer’s instructions. The specific transcripts were quantified by quantitative real-time PCR using iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories) and analyzed with an CFX96™ Real-Time System (Bio-Rad Laboratories). Genespecific primers were designed by DNAMAN 7.0 and used for WT-ERa (forward, 5'-GGTGCCCTACTACCTGGAGA-3'; reverse, 5'-TCTGAATTTGGCCTGTAGAATG-3')], and GADPH (forward, 5'- GACAGTCAGCCGCATCTTCT -3'; reverse, 5'-TTAAAAGCAGCCCTGGTGAC -3'). The mRNA levels of WT-ERa were normalized to GADPH mRNA levels. PCR was performed as 94°C for 3 min, followed by 45 cycles of 30 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C. Ct values were then compared between groups after being normalized to GAPDH. Samples were run in triplicate.

[0204] Example 30 - Disruption of estrogen induced mitogenic activity in breast cancer cells

[0205] The purpose of this experiment was to test the ability of the MERAR compounds RJ22, RJ23, GSH-4-3 and AT13 to disrupt estrogen induced mitogenic activity in breast cancer (BCa) cells. The chemical structure of these compounds and the X-ray crystallography structure of compound RJ22 are as shown in Figure 2. The compound RJ22 was subjected to oncogenic cross kinase panel of 123 kinase inhibition assay (FRET based by Life Technologies) at a 10 pM concentration. Eight kinases were found to be targeted, namely, p70S6Kl (ICso=2.3 pM), AXL (IC5o=l. OO pM), GSK3b (IC5o=L95 pM), MAP4K4 (IC5o=O.18 pM), PIM1 (IC5o=O.86 pM), RET (IC5O=L 14 pM) and SGK1 (ICso=O.86 pM). To assess the effect of the compounds on breast cancer cells, we performed AlamarBlue cell viability assays using MCF7 BCa cells. MCF7 cells grown under estrogen withdrawal conditions were treated with 10 pM concentrations of the test compounds in the absence and presence of 10 nM estradiol (E2). Four of the tested compounds inhibited E2-induced increases in cell proliferation by >60 % (figure 2C). These finding show that RJ22, RJ23,, GSH-4-3 and AT13 each can disrupt estrogen-induced mitogenic activity in BCa cells.

[0206] Example 31 - Efficacy of MERAR compounds in a physiologically relevant context

[0207] The purpose of this experiment was to determine the efficacy of MERAR compounds in a physiologically relevant context. Accordingly, the efficacy was tested in a 3D spheroid model for MCF7 cells, using IncuCyte live cell imaging to assess spheroid growth (Figure 3 A). MCF7 cells in a 96-well ultra-low attachment, round bottom plate were incubated in the IncuCyte Live Cell Imaging System at 37°C for 2 days to establish spheroids. On day 3Atty. Docket No. 2920571-025977spheroids were exposed to RJ22 or vehicle and imaged and area measured for 14 days at 12 hr intervals under control conditions. The growth was significantly attenuated in the presence of 2.5, 5, and lOpM RJ22 in a dose responsive manner (Figure 3B). This confirmed the antiproliferative effect of RJ22 under conditions more closely mimicking tumor environment. This confirms that RJ22 blocked Estradiol induced cell growth.

[0208] Example 32 - Impact of RJ22 on ERa protein levels in MCF-7 cells

[0209] The purpose of this experiment was to determine the impact of RJ22 on ERa protein levels in MCF-7 cells. MCF7 cells were withdrawn from estrogen for 7 days followed by treatment with RJ22 dilutions of 5 pM and 10 pM in the presence and absence of E2 for 48 hrs. ERa levels probed with ERa 66 (SC-787, Santa Cruz Biotech) were calculated by normalization with WT-ERa / GAPDH levels. RJ22 elicited greater than 90% reduction in ERa protein expression at 5 and lOpM, within 24 hrs, as shown in Figure 4A. To confirm this reduction in ERa levels, the ER+ T47D breast cancer cells stably transfected with ERE (estrogen response element) driven luciferase reporter gene were treated with RJ22, RJ23, and AT 13 (Figure 4B). In single exposures, RJ22, RJ23, and AT13 failed to cause changes in the basal ERE activity. However, each reduced estradiol induced reporter activity by approximately 80%. The low levels of ERa could be the result of one of the three possible mechanisms - transcriptional repression, post-transcriptional regulation or post- translational ERa degradation events.

[0210] Example 33 - Effect of RJ22 on translation

[0211] The effect of RJ22 on translation and any post-translational degradation mechanisms were explored by measuring the ERa levels in MCF7 cells treated with RJ22 in the presence and absence of the proteasome inhibitor MG132 (FIG. 5, panel A) and the protein synthesis inhibitor cycloheximide (CHX) (FIG. 5, panel B). MG132 exposure failed to reverse the effects of RJ22, suggesting that the mechanism of RJ22-mediated ERa downregulation is independent of the 26S proteosome. To determine the impact of RJ22 on ESRI transcription, we performed qRT-PCR assay. Indeed, MCF7 cells exposed to 5 pM and 10 pM of RJ22 for 24 hours demonstrated a robust decrease of ESRI gene expression compared to control GADPH (FIG. 5, panel C).Together, these findings support a model in which RJ22 alters ERa expression through regulation of mRNA transcription, and independent of post-translational modifications of ERa or receptor proteolysis.

[0212] Example 34 - Comparison of RJ-22 with commercially available p70S6Kl inhibitors

[0213] From among the kinases inhibited by RJ22, p70S6Kl, and RET kinases are known to influence the propagation ER(+) breast cancers. Literature review of the role of these kinases inAtty. Docket No. 2920571-025977ER(+) breast cancer revealed that p70S6Kl phosphorylates ERa at Serl67 leading to transcriptional activation of ERa resulting in cell proliferation. RET is a key downstream target gene of BRD4-regulated SEs that in turn are responsible for ERa-induced gene transcriptional activation and malignancy in breast cancer24-26. MAP4K4 is the kinase best inhibited by RJ22. Commercially available selective potent inhibitors of p70S6Kl (PF-470861), RET (Selpercatinib) and MAP4K4 (DMX5086) were purchased and tested for their effect on ERa expressions levels in MCF7 cell line. These kinase inhibitors did not show decrease in ERa levels similar to those of RJ22, as shown in FIG. 6.

[0214] Example 35 - Effects of the MERAR compounds on ESRI mutant BCa cell lines

[0215] The purpose of this experiment was to determine the effects of the compounds on ESRI mutant BCa cell lines MCF7 Y537S and MCF7 D538G. With the target mechanism of transcriptional repression yet to be deciphered, ESRI in a constitutively active conformation might not respond to the MERARs in the same way that the compounds repressed transcription in estrogen dependent MCF7 cells. To assess the efficacy of the compounds on ESRI mutant cells MCF7 Y537S and MCF7 D538G cells were treated with 10 pM concentrations of the compounds RJ22, RJ23 and AT13 (FIG. 7). All three of the compounds show 40-60% growth inhibition for the mutant cells.

[0216] Example 36 - Effect of the compounds RJ22, RJ23 and AT13 on translation

[0217] The effect of the compounds RJ22, RJ23 and AT 13 on translation and any post-translational degradation mechanisms were explored by measuring the ERa levels in MCF7 Y537S and MCF7 D538G mutant cells treated with RJ22, RJ23, AT13 and ICI (Fulvestrant) in the presence and absence of E2 (Figure 8). The ERa levels were markedly decreased for the cells treated with the compound RJ22, RJ23 and AT13 as can be seen in Figure 8. Ligand bound ERa plays critical role as a transcription factor upregulation of proteins such as GREB1 (Growth regulation by estrogen in breast cancer 1) and PGR (Progesterone Receptor) involved in cellular growth. A decrease in ERa levels should result in a concomitant decrease in these protein levels supporting the results of reduced ERa levels. Figure 9 shows the effect of the treatment of the MCF7 Y537S cells by the compounds RJ22, RJ23 and AT13 indeed shows a reduction in the levels of GREB1 and PGR.

[0218] These results confirm the efficacy of the compounds RJ22, RJ23 and AT 13 as MERARs in both ER(+) BCa cells and endocrine therapy resistant ESRI BCa mutant cells. A new therapeutic strategy has emerged for the treatment of endocrine resistant ESRI mutant breast cancer and in any ER(+) breast cancer.

Claims

Atty. Docket No. 2920571-025977CLAIMSWhat is claimed is:

1. A method of treating a cell proliferative disorder, the method comprising administering to a subject in need thereof, a compound of formula (I), and / or a stereoisomer and / or pharmaceutically acceptable salt and / or solvate thereof:Formula (I)whereinR is H, alkyl, aryl, substituted aryl, heterocyclyl, or substituted heterocyclyl;X is -NHR4, -NR5COR5, OH, or SH;R1, and R3are each independently selected from the group consisting of H, -NHR4, OR4, Br, Cl, I, -NH-CR4=CR4-, -NR5-, -NR5CH2-, - CH2NR5-,- NR5CO-, -NR5COR5, - CONR5-,-N=N-, -NH-CO-NH-, -NH-CS-NH-, -CO-O-, CO-O-CH2-, -SO2NH-, -NH- SO2-, -C=C-, -O-CH2-CO-, -OCH2CH2O-, -CH(OH)-, and -NO2bridging groups;R2is independently selected from the group consisting of -NHR4, OR4, Br, Cl, I, -NH- CR4=CR4-, -NR5-, -NR5CH2-, - CH2NR5-,- NR5CO-, -NR5COR5, -CONR5-,-N=N-, -NH- CO-NH-, -NH-CS-NH-, -CO-O-, CO-O-CH2-, -SO2NH-, -NH-SO2-, -C=C-, -O-CH2- CO-, -OCH2CH2O-, -CH(OH)-, and -NO2 bridging groups;R4is selected from the group consisting of H, halogen, C1-6 alkyl, C1-6 alkenyl, C1-6 alkoxy, Ci-ehaloalkyl, halo-C 1-6 alkoxy, -COOH, -CONH2, -COC1-6 alkyl, O- C1-6 alkyl, NH- C1-6 alkyl, -S C1-6 alkyl groups, -CN, -NH2, and -NO2; andeach R5is independently selected from the group consisting of H, C1-6 alkyl, aryl, C3-8 cycloalkyl, monocyclic or bicyclic heterocyclyl, and monocyclic or bicyclic heteroaryl, wherein the aryl, heteroaryl or heterocyclyl groups may be optionally substituted by one or more R4groups.Atty. Docket No. 2920571-0259772. The method of claim 1, wherein the cell proliferative disease is a cancer selected from the group consisting of ER positive cancer, ERa positive cancer, breast cancer, ER positive breast cancer, ER positive breast cancer with ESRI mutations, ER positive resistant breast cancer with ESRI mutations, prostate cancer, lung cancer (non-small cell lung cancer), metastatic cancer and solid tumors.

3. The method of claim 2, wherein the cancer is ER positive cancer.

4. The method of claim 2, wherein the cancer is ERa positive cancer.

5. The method of claim 3, wherein the cancer is ER positive breast cancer.

6. A method of suppressing the ERa mRNA expression, the method comprising exposing cells to a compound of formula (I), and / or a stereoisomer and / or pharmaceutically acceptable salt and / or solvate thereof:Formula (I)whereinR is H, alkyl, aryl, substituted aryl, heterocyclyl, or substituted heterocyclyl;X is -NHR4, -NR5COR5, OH, or SH;R1, and R3are each independently selected from the group consisting of H, -NHR4, OR4, Br, Cl, I, -NH-CR4=CR4-, -NR5-, -NR5CH2-, - CH2NR5-,- NR5CO-, -NR5COR5, - CONR5-,-N=N-, -NH-CO-NH-, -NH-CS-NH-, -CO-O-, CO-O-CH2-, -SO2NH-, -NH- SO2-, -C=C-, -O-CH2-CO-, -OCH2CH2O-, -CH(OH)-, and -NO2bridging groups;R2is independently selected from the group consisting of -NHR4, OR4, Br, Cl, I, -NH- CR4=CR4-, -NR5-, -NR5CH2-, - CH2NR5-,- NR5CO-, -NR5COR5, -CONR5-,-N=N-, -NH- CO-NH-, -NH-CS-NH-, -CO-O-, CO-O-CH2-, -SO2NH-, -NH-SO2-, -C=C-, -O-CH2- CO-, -OCH2CH2O-, -CH(OH)-, and -NO2 bridging groups;Atty. Docket No. 2920571-025977R4is selected from the group consisting of H, halogen, Ci-6 alkyl, Ci-6 alkenyl, Ci-6 alkoxy, Ci-ehaloalkyl, halo-Ci-6 alkoxy, -COOH, -CONH2, -COC1-6 alkyl, O- C1-6 alkyl, NH- C1-6 alkyl, -S C1-6 alkyl groups, -CN, -NH2, and -NO2; andeach R5is independently selected from the group consisting of H, C1-6 alkyl, aryl, C3-8 cycloalkyl, monocyclic or bicyclic heterocyclyl, and monocyclic or bicyclic heteroaryl, wherein the aryl, heteroaryl or heterocyclyl groups may be optionally substituted by one or more R4groups.

7. A method of suppressing the activity of the ESRI transcription, the method comprising exposing cells to a compound of formula (I), and / or a stereoisomer and / or pharmaceutically acceptable salt and / or solvate thereof:Formula (I)whereinR is H, alkyl, aryl, substituted aryl, heterocyclyl, or substituted heterocyclyl;X is -NHR4, -NR5COR5, OH, or SH;R1, and R3are each independently selected from the group consisting of H, -NHR4, OR4, Br, Cl, I, -NH-CR4=CR4-, -NR5-, -NR5CH2-, - CH2NR5-,- NR5CO-, -NR5COR5, - CONR5-,-N=N-, -NH-CO-NH-, -NH-CS-NH-, -CO-O-, CO-O-CH2-, -SO2NH-, -NH- SO2-, -C=C-, -O-CH2-CO-, -OCH2CH2O-, -CH(OH)-, and -NO2bridging groups;R2is independently selected from the group consisting of -NHR4, OR4, Br, Cl, I, -NH- CR4=CR4-, -NR5-, -NR5CH2-, - CH2NR5-,- NR5CO-, -NR5COR5, -CONR5-,-N=N-, -NH- CO-NH-, -NH-CS-NH-, -CO-O-, CO-O-CH2-, -SO2NH-, -NH-SO2-, -C=C-, -O-CH2- CO-, -OCH2CH2O-, -CH(OH)-, and -NO2 bridging groups;R4is selected from the group consisting of H, halogen, C1-6 alkyl, C1-6 alkenyl, C1-6 alkoxy, Ci-ehaloalkyl, halo-C 1-6 alkoxy, -COOH, -CONH2, -COC1-6 alkyl, O- C1-6 alkyl, NH- C1-6 alkyl, -S C1-6 alkyl groups, -CN, -NH2, and -NO2; andAtty. Docket No. 2920571-025977each R5is independently selected from the group consisting of H, Ci-6 alkyl, aryl, C3-8 cycloalkyl, monocyclic or bicyclic heterocyclyl, and monocyclic or bicyclic heteroaryl, wherein the aryl, heteroaryl or heterocyclyl groups may be optionally substituted by one or more R4groups.

8. The method of any one of claims 1 to 7, whereinX is -NH2, -NRSCOR5, OH, or SH.

9. The method of any one of claims 1 to 7, whereinR is H or alkyl;X is NH2;R1, and R3are each independently selected from the group consisting of H, -NHR4, and - NR5COR5;R2is independently selected from the group consisting of NHR4, and -NR5COR5;R4is selected from the group consisting of hydrogen, halogen, C1-6 alkyl, O- C1-6 alkyl, - CN, -NH2, and -NO2; andeach R5independently represents hydrogen, heteroaryl, or aryl, wherein the heteroaryl or aryl group may be optionally substituted by one or more R4groups.

10. The method of any one of claims 1 to 7, whereinRis H;R1and R3are H;R2is -NR5COR5;R4is selected from the group consisting of hydrogen, halogen, Ci-e alkyl, O- Ci-e alkyl, -CN, -NH2, and -NO2; andeach R5independently represents hydrogen, thiophene, phenyl, or naphthyl, wherein the thiophene, phenyl, or naphthyl group may be optionally substituted by one or more R4groups.

11. The method of any one of claims 1 to 7, whereinRis H;Ri and R3 are H;R2is -NR5COR5;R4is selected from the group consisting of hydrogen, halogen, and -NO2; and77Atty. Docket No. 2920571-025977each R5independently represents hydrogen, phenyl, or naphthyl, wherein the phenyl or naphthyl group may be optionally substituted by one or more R4groups.

12. The method of any one of claims 1 to 7, whereinR is H or alkyl;X is NH2or -NR5COR5;R1, and R3are each independently selected from the group consisting of H, — NHR4, and - NR5COR5;R2is independently selected from the group consisting of NHR4, and -NR5COR5;R4is selected from the group consisting of hydrogen, halogen, Ci-e alkyl, O- Ci-e alkyl, -CN, -NH2, and -NO2; andeach R5independently represents hydrogen, Ci-e alkyl, heteroaryl, or aryl, wherein the heteroaryl or aryl group may be optionally substituted by one or more R4groups.

13. The method of any one of claims 1 to 7, whereinR is H or methyl;R3is H;R1and R2are independently NH2or -NR5COR5;R4is selected from the group consisting of hydrogen, halogen, Ci-e alkyl, O- Ci-e alkyl, -CN, -NH2, and -NO2. In a further embodiment, R4is selected from the group consisting of hydrogen, halogen, -OCH3, -CN, -NH2, and -NO2; andeach R5independently represents hydrogen, methyl, thiophene, phenyl, or naphthyl, wherein the thiophene or phenyl group may be optionally substituted by one or more R4groups. In a further embodiment, R5represents hydrogen or phenyl, wherein the phenyl group may be optionally substituted by one or more R4groups.

14. The method of any one of claims 1 to 7, wherein the compound is selected from the group consisting of:ORJ-3Atty. Docket No. 2920571-025977RJ-6RJ-7aAtty. Docket No. 2920571-025977Atty. Docket No. 2920571-025977RJ-32RJ-33, RJ-35 RJ-34Br- '3 NH2O NH NH2U20RJ-38 RJ-36 RJ-37RJ-40 AT-13GSH-3-100GSH-4-3 GSH-4-15andAtty. Docket No. 2920571-025977or a pharmaceutically acceptable salt thereof.

15. The method of any one of claims 1 to 7, wherein the compound is selected from the group consisting ofRJ-20Atty. Docket No. 2920571-025977GSH-4-3GSH-4-15or a pharmaceutically acceptable salt thereof.

16. The method of any one of claims 1 to 7, wherein the compound is selected from the group consisting ofAtty. Docket No. 2920571-025977AT-13,and GSH-4-3 or a pharmaceutically acceptable salt thereof.

17. The method of any one of claims 1 to 7, wherein the compound isRJ-22 or a pharmaceutically acceptable salt thereof.

18. The method of any one of claims 1 to 7, wherein the compound is, or a pharmaceutically acceptable salt thereof.

19. The method of any one of claims 1 to 7, wherein the compound is, or a pharmaceutically acceptable salt thereof.

20. Use of a compound of Formula I, and / or a stereoisomer and / or pharmaceutically acceptable salt and / or solvate thereof:Atty. Docket No. 2920571-025977Formula (I)whereinR is H, alkyl, aryl, substituted aryl, heterocyclyl, or substituted heterocyclyl;X is -NHR4, -NR5COR5, OH, or SH;R1, and R3are each independently selected from the group consisting of H, —NHR4, OR4, Br, Cl, I, -NH-CR4=CR4-, -NR5-, -NR5CH2-, - CH2NR5-,- NR5CO-, -NR5COR5, -CONR5-,- N=N-, -NH-CO-NH-, -NH-CS-NH-, -CO-O-, CO-O-CH2-, -SO2NH-, -NH-SO2-, -C=C-, -O-CH2-CO-, -OCH2CH2O-, -CH(OH)-, and -NO2bridging groups;R2is independently selected from the group consisting of —NHR4, OR4, Br, Cl, I, -NH- CR4=CR4-, -NR5-, -NR5CH2-, - CH2NR5-,- NR5CO-, -NR5COR5, -CONR5-,-N=N-, -NH- CO-NH-, -NH-CS-NH-, -CO-O-, CO-O-CH2-, -SO2NH-, -NH-SO2-, -C=C-, -O-CH2- CO-, -OCH2CH2O-, -CH(OH)-, and -NO2bridging groups;R4is selected from the group consisting of H, halogen, Ci-e alkyl, Ci-e alkenyl, Ci-e alkoxy, Ci-e haloalkyl, halo-Ci-e alkoxy, -COOH, -CONH2, -COCi-e alkyl, O- Ci-e alkyl, NH- Ci-e alkyl, -S Ci-e alkyl groups, -CN, -NH2, and -NO2; andeach R5is independently selected from the group consisting of H, Ci-e alkyl, aryl, C3-8 cycloalkyl, monocyclic or bicyclic heterocyclyl, and monocyclic or bicyclic heteroaryl, wherein the aryl, heteroaryl or heterocyclyl groups may be optionally substituted by one or more R4groups,for suppressing the ERa mRNA expression.

21. Use of a compound of Formula I, and / or a stereoisomer and / or pharmaceutically acceptable salt and / or solvate thereof:Atty. Docket No. 2920571-025977Formula (I)whereinR is H, alkyl, aryl, substituted aryl, heterocyclyl, or substituted heterocyclyl;X is -NHR4, -NR5COR5, OH, or SH;R1, and R3are each independently selected from the group consisting of H, —NHR4, OR4, Br, Cl, I, -NH-CR4=CR4-, -NR5-, -NR5CH2-, - CH2NR5-,- NR5CO-, -NR5COR5, -CONR5-,- N=N-, -NH-CO-NH-, -NH-CS-NH-, -CO-O-, CO-O-CH2-, -SO2NH-, -NH-SO2-, -C=C-, -O-CH2-CO-, -OCH2CH2O-, -CH(OH)-, and -NO2bridging groups;R2is independently selected from the group consisting of —NHR4, OR4, Br, Cl, I, -NH- CR4=CR4-, -NR5-, -NR5CH2-, - CH2NR5-,- NR5CO-, -NR5COR5, -CONR5-,-N=N-, -NH- CO-NH-, -NH-CS-NH-, -CO-O-, CO-O-CH2-, -SO2NH-, -NH-SO2-, -C=C-, -O-CH2- CO-, -OCH2CH2O-, -CH(OH)-, and -NO2bridging groups;R4is selected from the group consisting of H, halogen, Ci-e alkyl, Ci-e alkenyl, Ci-e alkoxy, Ci-e haloalkyl, halo-Ci-e alkoxy, -COOH, -CONH2, -COCi-e alkyl, O- Ci-e alkyl, NH- Ci-e alkyl, -S Ci-e alkyl groups, -CN, -NH2, and -NO2; andeach R5is independently selected from the group consisting of H, Ci-e alkyl, aryl, C3-8 cycloalkyl, monocyclic or bicyclic heterocyclyl, and monocyclic or bicyclic heteroaryl, wherein the aryl, heteroaryl or heterocyclyl groups may be optionally substituted by one or more R4groups,for suppressing the activity of the ESRI transcriptional repressor.

22. Use of a compound of Formula I, and / or a stereoisomer and / or pharmaceutically acceptable salt and / or solvate thereof:Atty. Docket No. 2920571-025977Formula (I)whereinR is H, alkyl, aryl, substituted aryl, heterocyclyl, or substituted heterocyclyl;X is -NHR4, -NR5COR5, OH, or SH;R1, and R3are each independently selected from the group consisting of H, —NHR4, OR4, Br, Cl, I, -NH-CR4=CR4-, -NR5-, -NR5CH2-, - CH2NR5-,- NR5CO-, -NR5COR5, -CONR5-,- N=N-, -NH-CO-NH-, -NH-CS-NH-, -CO-O-, CO-O-CH2-, -SO2NH-, -NH-SO2-, -C=C-, -O-CH2-CO-, -OCH2CH2O-, -CH(OH)-, and -NO2bridging groups;R2is independently selected from the group consisting of —NHR4, OR4, Br, Cl, I, -NH- CR4=CR4-, -NR5-, -NR5CH2-, - CH2NR5-,- NR5CO-, -NR5COR5, -CONR5-,-N=N-, -NH- CO-NH-, -NH-CS-NH-, -CO-O-, CO-O-CH2-, -SO2NH-, -NH-SO2-, -C=C-, -O-CH2- CO-, -OCH2CH2O-, -CH(OH)-, and -NO2bridging groups;R4is selected from the group consisting of H, halogen, Ci-e alkyl, Ci-e alkenyl, Ci-e alkoxy, Ci-e haloalkyl, halo-Ci-e alkoxy, -COOH, -CONH2, -COCi-e alkyl, O- Ci-e alkyl, NH- Ci-e alkyl, -S Ci-e alkyl groups, -CN, -NH2, and -NO2; andeach R5is independently selected from the group consisting of H, Ci-e alkyl, aryl, C3-8 cycloalkyl, monocyclic or bicyclic heterocyclyl, and monocyclic or bicyclic heteroaryl, wherein the aryl, heteroaryl or heterocyclyl groups may be optionally substituted by one or more R4groups,for manufacture of a medicament for the treatment of a cell proliferative disorder.

23. The use of claim 22, wherein the cell proliferative disease is a cancer selected from the group consisting of ER positive cancer, ERa positive cancer, breast cancer, ER positive breast cancer, resistant breast cancer, breast cancer with ESRI mutations, ER positive breast cancer with ESRI mutations, ER positive resistant breast cancer with ESRI mutations, prostate cancer, lung cancer (non-small cell lung cancer), metastatic cancer and solid tumors.

24. The use of claim 22 or 23, wherein the cancer is ER positive cancer.Atty. Docket No. 2920571-02597725. The use of claim 22 or 23, wherein the cancer is ERa positive cancer.

26. The use of claim 22 or 23, wherein the cancer is ER positive breast cancer.

27. The use of any one of claims 20 to 26, wherein X is — NH2, -NR5COR3OH, or SH.

28. The use of any one of claims 20 to 26, whereinR is H or alkyl;X is NH2;R1, and R3are each independently selected from the group consisting of H, — NHR4, and - NR5COR5;R2is independently selected from the group consisting of NHR4, and -NR5COR5;R4is selected from the group consisting of hydrogen, halogen, Ci-e alkyl, O- Ci-e alkyl, -CN, -NH2, and -NO2; andeach R5independently represents hydrogen, heteroaryl, or aryl, wherein the heteroaryl or aryl group may be optionally substituted by one or more R4groups.

29. The use of any one of claims 20 to 26, whereinRis H;R1and R3are H;R2is -NR5COR5;R4is selected from the group consisting of hydrogen, halogen, Ci-6 alkyl, O- Ci-6 alkyl, - CN, -NH2, and -NO2; andeach R5independently represents hydrogen, thiophene, phenyl, or naphthyl, wherein the thiophene, phenyl, or naphthyl group may be optionally substituted by one or more R4groups.

30. The use of any one of claims 20 to 26, whereinRis H;Ri and R3 are H;R2is -NR5COR5;R4is selected from the group consisting of hydrogen, halogen, and -NO2; and each R5represents hydrogen, phenyl, or naphthyl, wherein the phenyl or naphthyl group may be optionally substituted by one or more R4groups.Atty. Docket No. 2920571-02597731. The use of any one of claims 20 to 26, whereinR is H or alkyl;X is NH2or -NR5COR5;R1, and R3are each independently selected from the group consisting of H, -NHR4, and - NR5COR5;R2is independently selected from the group consisting of NHR4, and -NR5COR5;R4is selected from the group consisting of hydrogen, halogen, Ci-6 alkyl, O- Ci-6 alkyl, - CN, -NH2, and -NO2; andeach R5independently represents hydrogen, Ci-6 alkyl, heteroaryl, or aryl, wherein the heteroaryl or aryl group may be optionally substituted by one or more R4groups.

32. The use of any one of claims 20 to 26, whereinR is H or methyl;R3is H;R1and R2are independently NH2or -NR5COR5;R4is selected from the group consisting of hydrogen, halogen, Ci-6 alkyl, O- Ci-6 alkyl, - CN, -NH2, and -NO2. In a further embodiment, R4is selected from the group consisting of hydrogen, halogen, -OCH3, -CN, -NH2, and -NO2; andeach R5independently represents hydrogen, methyl, thiophene, phenyl, or naphthyl, wherein the thiophene or phenyl group may be optionally substituted by one or more R4groups. In a further embodiment, R5represents hydrogen or phenyl, wherein the phenyl group may be optionally substituted by one or more R4groups.

33. The use of any one of claims 20 to 26, wherein the compound is selected from the group consisting ofT NH2O RJ-1RJ-2RJ-3Atty. Docket No. 2920571-025977RJ-7aAtty. Docket No. 2920571-025977Atty. Docket No. 2920571-025977RJ-32O2N N-CH3NH2RJ-33 RJ-34 RJ-35NH2URJ-37 RJ-38 RJ-36RJ-40 AT-13GSH-3-100Atty. Docket No. 2920571-025977or a pharmaceutically acceptable salt thereof.

34. The use of any one of claims 20 to 26, wherein the compound is selected from the group consisting ofRJ-19RJ-25Atty. Docket No. 2920571-025977and GSH-4-15or a pharmaceutically acceptable salt thereof.Atty. Docket No. 2920571-02597735. The use of any one of claims 20 to 26, wherein the compound is selected from the group consisting ofand GSH-4-3, or a pharmaceutically acceptable salt thereof.

36. The use of any one of claims 20 to 26, wherein the compound isRJ-22or a pharmaceutically acceptable salt thereof.

37. The use of any one of claims 20 to 26, wherein the compound isor a pharmaceutically acceptable salt thereof.

38. The use of any one of claims 20 to 26, wherein the compound isor a pharmaceutically acceptable salt thereof.

Images