Methods and compositions for modification of cells

By incubating HSPCs in a cell-compatible solution and mechanically permeabilizing them through a cell-deforming constriction, the method enhances the efficiency of cell modification to over 60% while preserving primitive HSCs, addressing the challenges of HSPC modification in cell therapy.

WO2026117865A1PCT designated stage Publication Date: 2026-06-11STEMCELL TECHNOLOGIES CANADA INC

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
STEMCELL TECHNOLOGIES CANADA INC
Filing Date
2025-12-03
Publication Date
2026-06-11

AI Technical Summary

Technical Problem

Challenges exist in achieving quick and efficient modification of hematopoietic stem and progenitor cells (HSPCs) due to their heterogeneous nature, leading to difficulties in targeting specific cell types and maintaining primitive subsets, which are crucial for cell therapy applications.

Method used

A method involving incubating HSPCs in a cell-compatible solution for a time-limited duration followed by mechanical permeabilization to deliver exogenous agents, such as nucleic acids or peptides, using a cell-deforming constriction or fluid shear, enhancing the efficiency of cell modification.

Benefits of technology

This approach significantly increases the efficiency of modifying HSPCs to over 60% with maintained CD34+ and CD90+ frequencies, preserving primitive HSCs and reducing pre-processing time, thus expediting cell therapy development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CA2025051628_11062026_PF_FP_ABST
    Figure CA2025051628_11062026_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure generally relates to mechanoporation methods for the intracellular delivery of various exogenous agent(s) into cells, and more specifically to delivery protocols (and arising cell populations) involving reduced incubation prior to delivery. Methods of the present disclosure may be used to achieve high levels / efficiencies of cell modification while retaining desired cellular subsets, which may be important for further downstream applications.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS AND COMPOSITIONS FOR MODIFICATION OF CELLSCROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of United States Provisional Patent Application No. 63 / 727,414 filed December 3, 2024, the entire contents of which is hereby incorporated by reference in its entirety.TECHNICAL FIELD

[0002] This disclosure relates to cell-related applications, and more specifically to modification of cells, and still more specifically to delivery of agents to cells.BACKGROUND

[0003] Precise targeted modification of cells is of great interest in the field of biology and medicine to enable basic research and clinical applications. Genome editing technologies permit the direct targeting and modification of desired genomic sequences of cells. In particular, clustered regularly interspaced short palindromic repeats (CRISPR)-Cas- associated nucleases have played a significant role in translating laboratory concepts into clinical use. Despite these advances, challenges remain in terms of achieving quicker and more efficient modification.

[0004] Hematopoietic stem and progenitor cells (HSPCs) are a heterogenous population of cells that are capable of self-renewal and differentiation into the multiple types of cells of the hematopoietic system. Thus, HSPCs have enormous potential in cell therapy applications. However, given their heterogenous nature, it may be difficult to achieve modifications of target cell types, such as by gene knock-in / knock-out or nucleic acid delivery. Particularly, the culture of primitive subsets of HSPCs may result in their differentiation, which may lead to insufficient maintenance or retention of such subsets and a corresponding reduction in genome / cell modification efficiency. As a result, primitive HSPCs that are modified and capable of repopulating the hematopoietic system may be in short supply.

[0005] Therefore, there remains a need for improvements to cell modification workflows, particularly for cell types that undergo differentiation. Desirably, such improvements are timeefficient, easy to set up, scalable and amenable to multiple modification approaches. The present disclosure provides methods and compositions for modifying one or more cells by delivering an exogenous agent thereto. Methods of this disclosure will greatly accelerate the development of cell and gene therapy applications.SUMMARY

[0006] In one aspect of this disclosure, methods of modifying one or more cells are provided. In related aspects, such methods may more specifically relate to methods of delivering an exogenous agent into one or more cells.

[0007] Methods of this disclosure may comprise providing one or more cells in a cellcompatible solution. One or more cells may have been cryopreserved and thawed prior to incubating the one or more cells in a cell-compatible solution. In one embodiment, a cell density of one or more cells before delivering an exogenous agent is between about 1 x 105cells / ml to about 1 .5 x 107cells / ml. As a specific example, one or more cells is a hematopoietic stem and progenitor cell (HSPC) and may express CD34+and CD45+. In a specific embodiment, an HSPC is CD34+, CD45RA- and / or CD90+.

[0008] Methods of this disclosure may further comprise delivering an exogenous agent into one or more cells to obtain one or more modified cells. An exogenous agent may comprise a nucleic acid or a (poly)peptide, or a combination of a nucleic acid and a (poly)peptide.

[0009] Methods of this disclosure may still further comprise incubating one or more cells in a cell-compatible solution for a time-limited duration, such as before delivering an exogenous agent thereto. One or more cells may be incubated in a cell-compatible solution for a timelimited duration of 24 hours or less before delivering the exogenous agent to the one or more cells. In some embodiments, the time-limited duration is between about 0 to about 24 hours, or between about 0.5 to about 24 hours, or about 12 hours or less, or about 4 hours or less.

[0010] Delivering an exogenous agent into one or more cells may be by mechanically permeabilizing one or more cells to cause permeabilizations to a membrane thereof large enough for the exogenous agent to pass into the one or more cells. One or cell may be mechanically permeabilized by deforming the cells, such as by passing the one or more cells through a cell-deforming constriction and / or subjecting the one or more cells to fluid shear.

[0011] An efficiency of obtaining one or more modified cells may be higher when mechanically permeabilizing one or more cells compared to electrically permeabilizing one or more cells, when each of the mechanically permeabilized one or more cells and the electrically permeabilized one or more cells were incubated in a cell-compatible solution for an equivalent time-limited duration. A time-limited duration may comprise 24 hours or less or may be between about 0 to about 24 hours or may be between about 0.5 to about 24 hours, or may be about 12 hours or less, or may be about 4 hours or less.

[0012] An efficiency of obtaining one or more modified cells may be greater than 60%.

[0013] An efficiency of obtaining one or more modified cells may increase as a time limited duration increases from about 1 hour to less than 12 hours.

[0014] An efficiency of obtaining one or more modified cells may be about 60% or higher after pre-incubating one or more cells in a cell-compatible solution for a time-limited duration of about 1 hour or 4 hours. In one embodiment, an efficiency of obtaining one or more modified cells is about 50%, 60%, 70%, 80% or higher after pre-incubating one or more cells in a cellcompatible solution for a time-limited duration of about 1 hour. In one embodiment, an efficiency of obtaining one or more modified cells is about 85%, 90%, 95% or higher after incubating one or more cells in a cell-compatible solution for a time-limited duration of about 1 hour.

[0015] An average frequency of CD34 among a plurality of modified cells may be maintained within ± 1%, ± 5%, ± 10%, ± 15%, ± 20%, ± 25%, or ± 30% as a time-limited duration increases from an initial timepoint to a subsequent timepoint during the time-limited duration.

[0016] An average frequency of i) CD34 or ii) CD34 and CD90 among a plurality of modified cells may be higher when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells.

[0017] An average frequency of CD34 among a plurality of modified cells may be equal to or greater than about 90-98% when mechanically permeabilizing one or more cells, wherein a time-limited duration comprises about 1 hour, about 4 hours or about 24 hours.

[0018] An average frequency of CD90 among a plurality of modified cells may range between about 25-70% when mechanically permeabilizing one or more cells, wherein a time-limited duration comprises about 1 hour, about 4 hours or about 24 hours.

[0019] In another aspect of this disclosure are provided compositions comprising hematopoietic stem and progenitor cells (HSPCs) and a cell-compatible solution. Such compositions may comprise an exogenous agent intracellularly, wherein about 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 85%, 90% or more of the HSPCs are CD34+CD45+, wherein about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65% or more of the HSPCs are CD34+CD45RA CD90+, and wherein about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or higher of the HSPCs are modified by the exogenous agent. In one embodiment, about 60-70% of HSPCs are CD34+CD45RACD90+.

[0020] In one embodiment, the HSPCs were pre-incubated in the same or a different cellcompatible solution for a time-limited duration of 24 hours or less before receiving the exogenous agent intracellularly.

[0021] An exogenous agent, whether used in methods of this disclosure or described in a separate aspect, comprises a nucleic acid or a (poly)peptide, or a combination of a nucleic acid and a (poly)peptide. In one embodiment, an exogenous agent is a genome editing complex and a modification of one or more cells is a modification to the genome of the one or more cells. In some embodiments, an exogenous agent is a messenger RNA (mRNA) or a self-amplifying RNA (saRNA) and delivering the mRNA or the saRNA leads to an overexpression of an encoded protein.

[0022] A cell-compatible solution, whether used in methods of this disclosure or described in a separate aspect, may comprise a cell culture medium.BRIEF DESCRIPTION OF THE DRAWINGS

[0023] For a better understanding of the various embodiments described herein, and to show more clearly how these various embodiments may be carried into effect, reference will be made, by way of example, to the accompanying drawings which show at least one example embodiment, and which are now described. The drawings are not intended to limit the scope of the teachings described herein.

[0024] Figures 1A and 1 B show line graphs quantifying percentage % editing efficiency (Figure 1A) and % frequencies (Figure 1 B) of cord blood-derived CD34+HSPCs or primitive progenitor CD90+HSCs modified with an RNP complex targeting the [32 microglobulin (B2M) locus for knockout. Flow cytometry was performed to assess gene editing efficiency based on surface expression of MHC-I and cell frequencies. HSPCs were pre-cultured for the indicated timepoints (1 h, 4h, 24h & 48h) prior to transfection by mechanoporation or electroporation. Data represents the mean ± SD of a number of experiments as follows: Mechanoporation: n=1 (1 h), n=4 (4h), n=4 (24h) and n=3 (48h); Electroporation: n=1 (1 h), n=4 (4h), n=6 (24h) and n=2 (48h).

[0025] Figures 2A-C shows line graphs quantifying % GFP Expression (Figure 2A), % frequencies (Figure 2B) and Relative Mean fluorescence Intensity (MFI) (Figure 2C) of cord blood-derived CD34+HSPCs or primitive progenitor CD90+HSCs modified with a green fluorescent protein (GFP)-encoding mRNA. Flow cytometry was performed to assess GFP expression. HSPCs were pre-cultured for the indicated timepoints shown (1h, 4h & 24h) prior to transfection by mechanoporation or electroporation. Data represents the values obtained from one experiment for each condition shown.DETAILED DESCRIPTION

[0026] This disclosure relates to methods of modifying one or more cells. This disclosure also relates to methods of delivering an exogenous agent into one or more cells. This disclosurefurther relates to a composition of HSPCs comprising an exogenous agent intracellularly. Methods of this disclosure may provide an improvement by reducing pre-processing time of a cell(s) before it is modified by delivery of an exogenous agent thereto, thereby expediting processes for generating cells modified by an intracellularly delivered exogenous agent.

[0027] Where used in this disclosure, the term “HSPC” refers to hematopoietic stem and / or progenitor cells, some of which may be capable of long-term and multipotent reconstitution of the entire hematopoietic system. The term may be used interchangeably with the term ‘hematopoietic stem cell’ or “HSC”, while each may relate to a distinct subset of cells. HSPC may be characterized by the presence / absence of one or more markers that distinguish over other non-HSPC cell types. A well-known marker of primary or PSC-derived HSPCs is the transmembrane phosphoglycoprotein CD34; thus, HSPC may be referred to as CD34+cells. Other markers of HSPCs may include CD38, CD90, CD45RA, CD45RO, CD10, CD109, CD166, HLA-DR, CD201 , CD49f, integrin-alpha3, EPCR (Endothelial protein C receptor), RET (RET proto-oncogene, GPRC5C (G-protein coupled receptor family group 5 member C), CD117, CD133, CD59, CD45, GPI-80, CD43, CD44, CD9, CD48, CD84 and CD244. HSPCs may lack expression, or have only low expression, of markers such as Glycophorin A, CD3, CD4, CD8, CD14, CD15, CD19, CD20 and CD56; which may characterize more mature hematopoietic cells. Human HSPCs may be defined by expression of CD45 and CD34. Where used in this disclosure, the term “primitive” or “primitive progenitor” used in the context of HSPCs may refer to long-term re-populating HSCs. A primitive HSPC subset may be characterized by a CD34+CD45RACD90+signature.

[0028] Where used in this disclosure, the term “exogenous” when used in reference to an agent refers to an agent that is external to the cell and / or is introduced from outside the cell. An exogenous agent may also encompass an agent that does not exist in nature and / or is not naturally found within a mammalian cell, and in particular within a cell of this disclosure.

[0029] Where used in this disclosure, the terms “modifying one or more cells” or “modified cell” refer to any modification to a cell that may change genotype, phenotype, cellular constituents, or function of the cell. Such modifications may include, without limitation, gene / genome editing, nucleic acid delivery / expression, RNA editing / silencing, and protein overexpression, degradation or knockdown.

[0030] Where used in this disclosure, the term “agent” refers to any molecule or compound, or complex of molecule(s) and / or compound(s). Thus, this term includes, but is not limited to DNA, RNA, DNA-RNA hybrids, proteins, peptides, polypeptides, fusion proteins, naturally occurring proteins, artificial / synthetic proteins, aptamers, synthetic molecules, smallmolecules, enzymes, molecular probes, toxins, or particles / beads. The term may be interchangeably used with terms such as payload or cargo.

[0031] Where used in this disclosure, the term “incubation” refers to any type of treatment of a cell, or population thereof, that elapses a period of time, which precedes delivery of an exogenous agent thereto. In the context of a cell modification workflow (e.g. editing process or nucleic acid delivery), incubation may refer to the period of time a cell is exposed to a cell culture medium and / or any cell-compatible solution prior to or before delivering an agent (e.g. an exogenous agent) thereto. Incubation may involve exposing one or more cells to a cellcompatible solution either at room temperature or at specific temperature ranges, such as within a cell incubator or a refrigerator. In the foregoing or any context, the term incubation may encompass pre-culture of one or more cells, such as in an appropriate cell-compatible solution.

[0032] Where used in this disclosure, the term “constriction” refers to a narrow passage. A constriction may be contained within a microfluidic chip, a microfluidic channel, or may be a pore or contained within a surface containing pores. Such a constriction may also be referred to as a cell-deforming constriction that transiently permeabilizes a cellular membrane thereof. The term may also refer to any other suitable constrictions available in the art. One or more cells-deforming constriction may comprise a narrow structure, space, or passageway reduced in at least one dimension (e.g. diameter) compared to at least one dimension (e.g. diameter) of a microfluidic chip, a microfluidic channel, or a surface comprising one or more pores within which the one or more cells-deforming constriction resides. A constriction may have a diameter or a pore size that is smaller than a diameter of a cell, such as about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 99% of the diameter of a cell passed therethrough.

[0033] Where used in this disclosure, the term “deform” refers to a physical change in the shape or conformation of a cell, as may be imparted by a mechanical deforming force and / or a shear force, such as when it passes through a constriction as described in the present disclosure. Such forces may cause perturbations or permeabilizations of the cell membrane. The term “deform” may also refer to a physical change in the shape or conformation of a cell, as may be imparted by a mechanical deforming force and / or a shear force, such as when pushed against a surface (e.g. a wall in a channel) by fluid flow, when entering and exiting through a notch or an indentation in a wall by fluid flow, or when positioned at an intersection between different fluid streams.

[0034] Where used in this disclosure, the term “permeabilization” refers to any disruption in a cell membrane that allows material from outside a cell to move into the cell. A disruption in acell membrane may include one or more of a transient pore, hole, gap, break, or any other change to cell membrane integrity.

[0035] Where used in this disclosure, the term “mechanically permeabilizing” refers to altering a permeability of a cell membrane through the application of a physical (e.g. mechanical) force, such as by passing one or more cells through a cell-deforming microfluidic constriction under pressure. One or more cells may be compressed / deformed under a physical (e.g. mechanical) force to cause pores in a membrane thereof, allowing one or more exogenous agents to pass therethrough. The term can refer to any other mechanoporation method known in the art including, but not limited to, exposing one or more cells to a jet of inert gas, seeding one or more cells onto a nanostructure (e.g. nanowire / nanosyringe), exposing one or more cells to high-frequency sound waves, exposing one or more cells to shear forces, compressing or directing one or more cells upon / onto a surface (e.g. a flat wall) by applying fluid flow, forcing one or more cells through a notch or an indentation in a wall directed by fluid flow, placing one or more cells at an intersection of two or more opposing fluid streams or exposing one or more cells to a combination of mechanical tension and electric pulses.

[0036] Where used in this disclosure, the term “electrically permeabilizing” refers to application of an external electric field to alter the permeability of a cell membrane. The term can refer to electroporation techniques commonly known in the art.

[0037] Where used in this disclosure, the term “marker” refers to a biomolecule or biocompound that can be used to distinguish one cell type from another. A marker may be a protein, lipid, glycosylation mark, or the like, and may be expressed extracellularly on the cell surface or inside a cell as an intracellular molecule or compound.Methods

[0038] In one aspect of this disclosure, methods are provided for modifying one or more cells, the method comprising: a) providing the one or more cells in a cell-compatible solution; b) incubating the one or more cell in the cell-compatible solution for a time-limited duration; and c) delivering an exogenous agent into the one or more cell to obtain one or more modified cells.

[0039] In another aspect of this disclosure, methods are provided for modifying one or more cells, comprising providing one or more cells having been (pre-)incubated in a cell-compatible solution, and delivering an exogenous agent into the one or more (pre-incubated) cell.

[0040] In another aspect of this disclosure, methods are provided for delivering an exogenous agent into one or more cells, comprising: a) providing one or more cells in a cell-compatible solution, b) incubating the one or more cells in the cell-compatible solution for a time-limitedduration, and c) delivering the exogenous agent into the one or more cells to obtain one or more modified cells.

[0041] In another aspect of this disclosure, methods are provided for delivering an exogenous agent into one or more cells, comprising providing one or more cells having been (pre- )incubated in a cell-compatible solution for a time-limited duration, and delivering the agent into the one or more (pre-incubated) cells.

[0042] Delivering an exogenous agent into one or more cells may be by any known method, but preferably by mechanically permeabilizing the one or more cells to cause permeabilizations (e.g. perturbations) to a membrane thereof that are large enough for an exogenous agent to pass into the one or more cells. One or more cells having received an exogenous agent may be considered one or more modified cells. An exogenous agent may be delivered into one or more cells by passing the one or more cells through a constriction, or by any other mechanical way of deforming a cell.

[0043] Delivering an exogenous agent into one or more cells by mechanically permeabilizing (or deforming) the one or more cells may be followed by exposing an arising cell to an electric field, as may be generated by at least one electrode. Exposure to an electric field may enhance delivery of an exogenous agent to one or more cells, such as by facilitating delivery to the nucleus.

[0044] In any aspect, one or more cells of this disclosure is not particularly limited and may comprise any known cell type of the ectodermal, mesodermal, or endodermal lineage. Exemplary cells may include but are not limited to adipose cells, gut cells, lung cells, liver cells, pancreatic cells, breast cells, heart cells, musculoskeletal cells, reproductive cells, immune cells, nervous system cells, skin cells, eye cells, kidney cells, oral and craniofacial cells, liver cells, stem cells, endothelial cells, blood cells, bone marrow cells or fibroblast cells.

[0045] Preferably, the one or more cells of any aspect is a blood cell or immune cell. Blood cells or immune cells may be obtained directly from peripheral blood, cord blood, bone marrow, or any other tissue or organ comprising blood cells or immune cells. Blood cells may comprise red blood cells (RBCs) / reticulocytes, platelets or immune cells such as white blood cells / leukocytes. Immune cells may comprise a T cell, a B cell, a natural killer (NK) cell, a dendritic cell (DC), an NKT cell, a mast cell, a monocyte, a macrophage, a granulocyte (e.g. a basophil, an eosinophil, a neutrophil) or a megakaryocyte. The one or more cells of any aspect described herein may be an HSPC or may comprise a plurality of HSPC.

[0046] Where the one or more cells is an HSPC or comprises HSPCs, it may be obtained (e.g. purified, enriched, isolated) from any source or sample, including but not limited to, cordblood, bone marrow, (mobilized) peripheral blood, or any other tissue or organ, such as lymph, heart, spleen, intestine, muscle, kidney, liver, lung, gingiva or brain. HSPCs may also be derived from PSCs that have been differentiated to HSPCs using published methods and / or commercially available reagents. Preferably, HSPCs are obtained (e.g. purified, enriched, isolated) from cord blood, bone marrow, (mobilized) peripheral blood or differentiated pluripotent stem cells (PSCs).

[0047] If purified, isolated, or enriched, from a sample, a desired / target one or more cells (or a population thereof) may be positively selected on the basis of a phenotypic marker, such as CD34 and / or CD45 in the case of HSPC. Or, a desired / target one or more cells (or population thereof) may be purified, isolated, or enriched from a sample by negative selection, such as by depleting undesired / non-target cells. In addition, or in the alternative, if starting from a sample comprising mixed blood cell types, one or more cells may be purified, isolated, or enriched by depleting undesirable cells, such as red blood cells (RBCs), using known reagents and methodologies.

[0048] One or more cells of this disclosure may be a normal cell comprising characteristics expected of a normally functioning cell at homeostasis, which may be purified / enriched / isolated from a healthy donor. Alternatively, one or more cells may comprise a non-normal cell, such as a diseased cell (e.g. cancer cell or cell line), an infected cell, or a cell having altered characteristics compared to a normal cell. If one or more cells is an HSPC or comprises an HSPC, it may thus be purified / enriched / isolated from a sample that is derived from a donor having a disease, infection, or otherwise unhealthy.

[0049] One or more cells of this disclosure may be derived fresh from an originating source or may have been cryopreserved and thawed prior to use.

[0050] One or more cells of this disclosure may be of human or non-human origin. Non-human origin cells may comprise those of bovine, porcine, feline, canine, ovine, leporine, caprine, equine, primate, rodent, plant, yeast, fungal, algal, or bacterial origin.

[0051] One or more cells may comprise an edit to its genome prior to introducing an exogenous agent thereto.

[0052] One or more cells may be in a mixture of two or more cell types. A mixture of cell types may be a co-culture of multiple cell types or a mixture of cell types that naturally occur together (e.g. lymph, whole blood, or peripheral blood mononuclear cells (PBMCs)).

[0053] A cell density of one or more cells (in a suspension that is subjected to mechanical and / or electrical permeabilization) may be one or more of about 1 x 104cells / ml_, about 2 x 104cells / mL, about 3 x 104cells / mL, about 4 x 104cells / mL, about 5 x 104cells / mL, about 6 x104cells / mL, about 7 x 104cells / mL, about 8 x 104cells / mL, about 9 x 104cells / mL, about 1 x105cells / mL, about 1 .25 x 105cells / mL, about 2 x 105cells / mL, about 2.5 x 105cells / mL, about3 x 105cells / mL, about 4 x 105cells / mL, about 5 x 105cells / mL, about 6 x 105cells / mL, about7 x 105cells / mL, about 8 x 105cells / mL, about 9 x 105cells / mL, about 1 x 106cells / mL, about2 x 106cells / mL, about 3 x 106cells / mL, about 4 x 106cells / mL, about 5 x 106cells / mL, about6 x 106cells / ml_, about 6.25 x 106cells / ml_, about 7 x 106cells / ml_, about 8 x 106cells / ml_, about 9 x 106cells / ml_, about 1 x 107cells / ml_, about 1.25 x 107cells / ml_, about 2 x 107cells / ml_, about 3 x 107cells / mL, about 4 x 107cells / mL, about 5 x 107cells / mL, about 6 x 107cells / mL, about 7 x 107cells / mL, about 8 x 107cells / mL, about 9 x 107cells / mL, about 1 x 108cells / mL, about 1.1 x 108cells / ml_, about 1.2 x 108cells / ml_, about 1.3 x 108cells / ml_, about 1.4 x 108cells / mL, about 1.5 x 108cells / ml_, about 2.0 x 108cells / ml_, about 3.0 x 108cells / ml_, about 4.0 x 108cells / mL, about 5.0 x 108cells / mL, about 6.0 x 108cells / mL, about 7.0 x 108cells / mL, about 8.0 x 108cells / mL, about 9.0 x 108cells / mL, or about 1 .0 x 109cells / mL or more. A cell density of one or more cells before delivering an exogenous agent may be between about 1 x 105cells / ml to about 1.5 x 107cells / ml. Use of the term “about” herein, such as with regard to cell density or any other instance where the term is used, may comprise a range of ±5%, ±10%, ±15%, ±20% or ±25% around a specifically indicated value. Cell concentration values as described above may also correspond to cells per reaction volume. In some embodiments, a cell density of one or more cells may be between about 1 x 104cells / reaction and about 5 x 105cells / reaction, between about 1.25 x 105cells / ml_ and about 6.25 x 106cells / ml, between about 2 x 104cells / reaction and about 1 x 106cells / reaction, or between about 2.5 x 105cells / mL and about 1 .25 x 107cells / ml.

[0054] In any aspect of this disclosure, an exogenous agent is not particularly limited. If an exogenous agent is or comprises a nucleic acid, exemplary nucleic acids include, without limitations, DNA, RNA, cDNA, mRNA, saRNA, siRNA, miRNA, IncRNA, tRNA and shRNA. If an exogenous agent is or comprises a protein or a (poly)peptide, exemplary proteins or (poly)peptides include, without limitations, enzymes, antibodies, therapeutic proteins, growth factors, fusion proteins, antigens, synthetic proteins, reporter markers or selectable markers.

[0055] An exogenous agent of this disclosure may comprise a nucleic acid or a polypeptide, or a combination of a nucleic acid and a polypeptide. In some cases, the exogenous agent may be or comprise a complex of one or more nucleic acids, (poly)peptides, proteins, RNP complexes, and combinations thereof. Exemplary complexes include, but are not limited to, a nucleosome, a ribosome, an RNA-induced silencing complex (RISC) or a transposase-target DNA complex, a CRISPR-Cas9 complex, a transcription-associated complex or an aptamerprotein complex.

[0056] A delivered exogenous agent of this disclosure may be transiently present or stably / permanently present in one or more cells. Where an exogenous agent is transiently present, it may be temporarily introduced into one or more cells, for example, in the form of a nucleic acid such as DNA or RNA or in the form of a (poly)peptide or a protein. Where an exogenous agent is stably or permanently present, it may be in the form of a nucleic acid such as a DNA or a vector (such as plasmid or viral vectors known in the art) and may be integrated into the genome of one or more cells such that the modification by the exogenous agent is passed on to progeny.

[0057] Methods of this disclosure may involve (pre-)incubating one or more cells in a cellcompatible solution prior to delivering an exogenous agent into the one or more cells. A duration of such incubation and a solution in which the incubation is performed are not particularly limited.

[0058] In any aspect, one or more cells may be or may have been (pre-)incubated in a cellcompatible solution for a time-limited duration before an exogenous agent is delivered thereto. While the time-limited duration is not particularly limited, preferably the time-limited duration is about 24 hours or less, or between about 0 to 24 hours. In some embodiments, the timelimited duration is between 0.5 to 24 hours. In some embodiments, the time-limited duration is about 12 hours or less. In some embodiments, the time-limited duration may be about 4 hours or less. In some embodiments, the time-limited duration may be about 48 hours or less. The time-limited duration may be about 0 hours, 0.5 hours, about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 13 hours, about 14 hours, about 15 hours, about 16 hours, about 17 hours, about 18 hours, about 19 hours, about 20 hours, about 21 hours, about 22 hours, about 23 hours or about 24 hours.

[0059] A duration of (pre-)incubation of the one or more cells before delivering an exogenous agent thereto may impact the preservation / maintenance of cell number and / or frequency (in the case of a population, such as among a subset of cells of the population). As an example, where the one or more cells is a HSPC (or a population thereof), the number of and / or frequency of one or more primitive HSCs within the HSPC population(s) may change as (pre- )incubation duration increases. Primitive HSCs may be in an active state (undergoing cell cycle) or a resting state (Go quiescent state, prior to entering cell cycle processes). HSCs may support hematopoiesis on entering the cell cycle and may preserve their stem cell-like or selfrenewal capabilities while in a resting state or across cell cycles.

[0060] As another example, once one or more cryopreserved HSPC (or a population thereof) are thawed, most cells may be in a resting state and slowly begin the cell cycle process asthey are (pre-)incubated or (pre-)cultured in a cell-compatible solution. As a duration of the (pre-)incubation increases, a number of primitive HSCs may progressively decrease in absolute numbers or at a reduced frequency within the total cellular fraction, as they begin to expand in number and differentiate into unipotent or multipotent progenitors that further differentiate into cells of the hematopoietic system. Typically, electroporation protocols known in the art may require one or more HSPCs to be pre-incubated in a cell-compatible solution for about 48 hours, by which point it would be expected that the HSPCs (and / or HSCs thereamong) will have progressed from the resting state and begun cell cycle processes with some completing one or more cells divisions. Therefore, a prolonged pre-incubation may result in reduction or loss of primitive HSCs, which are highly desirable for therapeutic or clinical applications. In contrast, mechanical permeabilization, as described in the methods of this disclosure, may enable shorter pre-incubation times thereby preserving higher levels of primitive HSCs while still achieving high levels of modification efficiency of HSPCs (and / or HSCs thereamong).

[0061] In any aspect, a solution in which one or more cells is (pre-)incubated before an exogenous agent is delivered thereto is not particularly limited, provided that such solution is a cell-compatible solution. A cell-compatible solution may be any solution that supports maintenance, survival or homeostasis of one or more cells. A cell-compatible solution may comprise a cell culture medium.

[0062] Cell culture media are well known in the art and any existing cell culture medium may be used to (pre-)incubate one or more cells before delivering an exogenous agent thereto, provided that it is compatible with the specific type of one or more cells. Cell culture media typically include one or more of: amino acids, vitamin(s), organic and / or inorganic salt(s), buffer(s), antioxidant(s), protein(s), energy (e.g., carbon) source(s), and the like for supporting the growth of cells. If cell culture media do not include one or more of the foregoing components, and if essential, they may be added by supplementation. Exemplary cell culture media include, without limitations, Dulbecco's Modified Eagle's Medium (DMEM), F12, Roswell Park Memorial Institute Medium (RPMI) 1640, Iscove's Modified Dulbecco's Medium (IMDM), Advanced DMEM, Advanced DMEM / F-12, Minimum Essential Medium (MEM), a- MEM, StemSpan™-branded basal media, MyeloCult™-branded media and various others marketed specifically for the culture of HSPCs. In one embodiment, the cell culture medium comprises StemSpan™ SFEM II culture medium (STEMCELL Technologies).

[0063] In any aspect of this disclosure, delivering an exogenous agent into one or more cells by mechanically permeabilizing the one or more cells may comprise passing the one or more cells through one or more cells-deforming constriction. One or more cells-deformingconstriction may be comprised within a microfluidic chip, a microfluidic channel, or within a surface comprising one or more pores. One or more cells-deforming constriction may deform one or more cells that are forced through the one or more cells-deforming constriction under pressure.

[0064] One or more cells may be contacted with an exogenous agent before, concurrently, or after passing through one or more cells-deforming constriction, or having been otherwise deformed. One or more cells may be suspended in a solution comprising an exogenous agent before the one or more cells passes through one or more cells-deforming constriction, or having been otherwise deformed. Or, an exogenous agent may be comprised in a suspension comprising one or more cells after the one or more cells passes through one or more cells- deforming constriction, or having been otherwise deformed. Or, an exogenous agent may be comprised in a suspension comprising one or more cells before, during, and after the one or more cells passes through one or more cells-deforming constriction, or having been otherwise deformed.

[0065] If comprised within a microfluidic channel, one or more cells-deforming constriction may comprise a length, a width, and a depth, each of which may be adjusted (e.g., increased or decreased) depending on the nature of an exogenous agent and / or one or more cells. If comprised within a surface comprising one or more pores, one or more cells-deforming constriction may comprise a diameter (e.g. opening width) or a cross-sectional length or depth.

[0066] In some embodiments, a microfluidic channel comprises a single cell-deforming constriction, and in other embodiments a microfluidic channel may comprise multiple constrictions, whether placed in parallel and / or in series. If comprising multiple constrictions, a microfluidic channel or surface comprising pores may comprise 2 to about 200 constrictions (e.g. about 150 constrictions), or greater than about 200 constrictions, 500 constrictions, 1000 constrictions, or 2000 constrictions.

[0067] One or more cells-deforming constrictions, as may be comprised within a microfluidic chip or a surface comprising pore(s), may comprise a cross-sectional width (of at least a subset of the one or more constrictions) that is less than a diameter of one or more cells in a cell suspension, such that a membrane of the one or more cells is deformed when passing therethrough to allow an exogenous agent to pass through the cell membrane. A cross- sectional width of one or more constrictions may be chosen depending on a diameter of one or more cells and may range from about 0.1 pm to about 150 pm. A cross-sectional width of one or more constrictions may comprise 1 pm, 2 pm, 3 pm, 4 pm, 5 pm, 6 pm, 7 pm, 8 pm, 9 pm, 10 pm, 11 pm, 12 pm, 13 pm, 14 pm, 15 pm, 16 pm, 17 pm, 18 pm, 19 pm, 20 pm, 21 pm, 22 pm, 23 pm, 24 pm or 25 pm. In some embodiments, a cross-sectional width of one ormore constrictions may be greater than or equal to about 30 m, 40 pm, 50 pm, 60 pm, 70 pm, 80 pm, 90 pm, 100 pm, or 110 pm or 120 pm. In some embodiments, a cross-sectional width of one or more constrictions may be greater than or equal to 1.4 pm, 1.6 pm, 1.8 pm, 2.0 pm, 3 pm, 4 pm, 5 pm, 6 pm, or 10 pm. In some embodiments, a cross-sectional width of one or more constrictions may be between about 0.1 and 30 pm. In some embodiments, a cross-sectional width of one or more constrictions may be between about 2-5 pm. In some embodiments, a cross-sectional width of one or more constrictions may be about 3.5-4 pm.

[0068] Delivery of an exogenous agent into one or more cells may be influenced by various parameters to optimize delivery of the agent. Examples of such parameters include, without limitation, a reaction volume, a density of one or more cells (as described above), a pressure for causing a cell to pass through a constriction, a concentration of an exogenous agent, a duration of incubation time of one or more cells before and / or after passing through a celldeforming constriction, a characteristic of the exogenous agent, a shear rate in or through a cell-deforming constriction, a viscosity of a suspension comprising one or more cells, a temperature of a cell-deforming constriction or a cell suspension, dimensions of a celldeforming constriction (e.g., length, width and / or depth), or any combination of the foregoing.

[0069] One or more cells may be urged or driven through one or more cells-deforming constriction under pressure, whether positive or negative. Pressure may be applied or generated via a vacuum, a syringe, or a pump (e.g., a peristaltic pump or a diaphragm pump) or by providing compressed air. In addition, fluid flow (under pressure as described above) may urge or drive one or more cells through a cell-deforming constriction, and may be turbulent or laminar. A pressure to urge or drive one or more cells through one or more cells- deforming constriction may be between about 1 psi and 200 psi. In some embodiments, a pressure may be about 1 psi, about 5 psi, about 10 psi, about 15 psi, about 20 psi, about 25 psi, about 30 psi, about 35 psi, about 40 psi, about 45 psi, about 50 psi, about 55 psi, about 60 psi, about 65 psi, about 70 psi, about 75 psi, about 80 psi, about 85 psi, about 90 psi, about 95 psi, about 100 psi, about 110 psi, about 120 psi, about 130 psi, about 140 psi, about 150 psi, about 160 psi, about 170 psi, about 180 psi, about 190 psi, or about 200 psi or more or any value or range of values therebetween. In some embodiments, a pressure may be between about 5 to 90 psi. In some embodiments, a pressure may be between about 15 and 60 psi. In one embodiment, the pressure may be 30 psi ± 10 psi.

[0070] A length of one or more constriction is not particularly limited, provided that the pressure along such length is sufficient to urge or drive one or more cells through one or more cells-deforming constriction. A length of one or more constriction may be equal to or greater than about 0.1 pm, 0.2 pm, 0.3 pm, 0.4 pm, 0.5 pm, 0.6 pm, 0.7 pm, 0.8 pm, 0.9 pm, 1 pm,2.5 pm, 5 pm, 7.5 pm, 10 pm, 12.5 pm, 15 pm, 20 pm, 30 pm, 40 pm, 50 pm, 60 pm, 70 pm, 80 pm, 90 pm, or 100 pm or any value or range of values therebetween. In some embodiments, a length of one or more constriction may be less than about 0.1 pm. In some embodiments, a length of one or more constriction may be between about 5 and about 40 pm. In some embodiments, a length of one or more constriction may be between about 25 and about 35 pm. In some embodiments, a length of one or more constriction may be about 30 pm.

[0071] A width of one or more constriction is not particularly limited, provided that it is smaller or less than a diameter of one or more cells passed therethrough. A width of one or more constriction may be as described elsewhere herein.

[0072] A depth of one or more constriction is not particularly limited, provided that it is suitable for one or more cells passed therethrough mechanically permeabilizing the one or more cells. The skilled person will be aware that references to width and depth are interchangeable simply by rotating a plane defining both the width and depth. Regardless, a depth of one or more constriction may be at least about 1 pm, at least about 2 pm, at least about 3 pm, at least about 4 pm, at least about 5 pm, at least about 6 pm, at least about 7 pm, at least about 8 pm, at least about 9 pm, at least about 10 pm, at least about 15 pm, at least about 20 pm, at least about 25 pm, at least about 30 pm, at least about 35 pm, at least about 40 pm, at least about 45 pm, at least about 50 pm, at least about 60 pm, at least about 70 pm, at least about 80 pm, at least about 90 pm, at least about 100 pm, at least about 110 pm, or at least about 120 pm or any value or range of values therebetween. In some embodiments, a depth of one or more constriction may be between about 5 pm to about 90 pm. In some embodiments, a depth of one or more constriction may be about 70 pm. In some embodiments, a depth of one or more constriction may be between about 15 pm and about 50 pm. In some embodiments, a depth of one or more constriction may be between about 20 pm and about 40 pm. In some embodiments, a depth of one or more constriction may be about 30 pm ± 5 pm. Preferably, a depth of the constriction accommodates a plurality of cells passing therethrough simultaneously.

[0073] A temperature used in the methods of this disclosure is not particularly limited, provided that it is conducive to one or more cells passed therethrough. A temperature as disclosed herein may refer to a temperature maintained within one or more constriction or of a cell suspension prior to, during and / or after passing through one or more constriction. A temperature may range from between about -5 °C and about 45 °C. As an example, methods of this disclosure can be carried out at room temperature (e.g between about 18 - 25 °C), physiological temperature (e.g., about 37 °C), higher than physiological temperature (e.g.,greater than about 37 °C to 45 °C or more), or reduced temperature (e.g., about -5 °C to about 4 °C), or temperatures between these exemplary temperatures.

[0074] A viscosity of a cell suspension comprising one or more cells at 25 °C may range from between about 7.5 x 1 o-4Pa.s to about 5 x 1 o-3Pa.s, or 8 x 1 o-4Pa.s to about 4.5 x 1 o-3Pa.s or any value or range of values therebetween. A viscosity of a cell suspension comprising one or more cells at 25 °C may range between any one of about 8.9 x 10-4Pa.s to about 5.0 x 10-3Pa.s, or 8.9 x 1 o-4Pa.s to about 4 x 1 o-3Pa.s, about 8.9 x 10-4Pa.s to about 3.0 x 10-3Pa.s, about 8.9 x 10-4Pa.s to about 2.0 x 10-3Pa.s, or about 8.9 x 10-3Pa.s to about 1.0 x 10-3Pa.s. A viscosity of a cell suspension comprising one or more cells at 25 °C may range between any one of about 5 x 10-4Pa.s to about 5.0 x 10-3Pa.s, or 6 x w4Pa.s to about 5 x w3Pa.s, about 7 x 10-4Pa.s to about 5.0 x 10-3Pa.s, about 8 x 10-4Pa.s to about 5.0 x 10-3Pa.s, or about 9 x 10-4Pa.s to about 5.0 x 10-3Pa.s. In some embodiments, a viscosity of a cell suspension within any of the ranges set forth herein, may be expressed in terms of cP units. In some embodiments, a viscosity of a cell suspension comprising one or more cells may range from between about 0.80 cP to about 4.5 cP (25°C). In some embodiments, a viscosity of a cell suspension comprising one or more cells may range from between about 0.89 cP to about 2 cP (25°C). In some embodiments, a viscosity of a cell suspension comprising one or more cells may be less than about 2 cP (25°C).

[0075] A parameter (as described above) used in the disclosed methods may have an effect on delivery efficiency of exogenous agents as well as viability of one or more cells.

[0076] Introducing or delivering an exogenous agent to one or more cells by mechanical permeabilization of a membrane thereof (such as by passing through a cell-deforming constriction) may be advantageous in comparison to delivery via electrical permeabilization (such as by electroporation). Advantages of mechanical permeabilization over electrical permeabilization may relate to one or more of: higher modification efficiency; maintenance / preservation of cell frequency; higher retention of primitive cell types; lower impact on transcriptional programs or viability; maintenance of functional potential; a shorter (pre-)incubation period prior to delivering / modifying with exogenous agent(s); a faster workflow; and reduced impact on quiescent / dormant one or more cells to be modified by delivery of an exogenous agent.

[0077] An efficiency of obtaining one or more modified cells may correspond to a number, a percentage, a fold-change, a level of expression of a nucleic acid / protein, a level of expression of a nucleic acid / protein per cell (as calculated by a relative mean fluorescence intensity), or any other measurable output of one or more modified cells, whether expressed as a relative value or an absolute value. For example, an efficiency of obtaining one or more modified cells(e.g. modified by / with an exogenous agent) may be expressed as the number, percentage, or fold-change of one or more modified cells among a plurality of cells exposed to the exogenous agent. A number and / or percentage of one or more modified cells may be higher when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells. An efficiency of obtaining one or more modified cells when mechanically permeabilizing one or more cells, in comparison to electrically permeabilizing one or more cells, may be impacted by or rely on a duration of pre-incubation in a cell-compatible solution prior to delivering an exogenous agent to the one or more cells. For example, an efficiency of obtaining one or more modified cells may be higher when mechanically permeabilizing one or more cells compared to electrically permeabilizing one or more cells when (pre-)incubated in a cell-compatible solution for an equivalent time-limited duration, such as of about 0 hour, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours or 24 hours. An equivalent time-limited duration may comprise about 1 hour, 4 hours, between about 0.5 to about 24 hours, about 24 hours or less, about 12 hours or less, and / or about 4 hours or less.

[0078] In any aspect, an efficiency of obtaining one or more modified cells may be higher when mechanically permeabilizing one or more cells compared to other methods of permeabilizing the one or more cells as described above (e.g. electrically permeabilizing one or more cells). An efficiency of obtaining one or more modified cells may be higher by at least about 1% - 99% (or 1-fold to about 99-fold) when mechanically permeabilizing the one or more cells compared to other methods of permeabilizing the one or more cells as described above (e.g. electrically permeabilizing the one or more cells). In some embodiments, an efficiency of obtaining one or more modified cells is higher by about 40%, 50%, 60%, 70%, 80%, 90%, 95% when mechanically permeabilizing the one or more cells compared to electrically permeabilizing the one or more cells. In some embodiments, an efficiency of obtaining one or more modified cells is higher by about 1-, 2-, 10-, 15-, 20-, 25-, 30-, 35-, 40-, 45-, 50-, 55-, 60- , 65-, 70-, 75-, 80-, 85-, 90-, 95-, 98- or 100-fold when mechanically permeabilizing the one or more cells compared to electrically permeabilizing the one or more cells. In some embodiments, an efficiency of obtaining one or more modified cells is greater than about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% when mechanically permeabilizing the one or more cells compared to electrically permeabilizing the one or more cells. In some embodiments, an efficiency of obtaining one or more modified cells is greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% when mechanically permeabilizing the one or more cells compared to electrically permeabilizing the one or more cells. An efficiency of obtaining one or more modified cells when mechanically permeabilizing one or more cells todeliver an exogenous agent thereto may be at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99% (or 1-, 2-, 10-, 15-, 20-, 25-, 30-, 35-, 40-, 45-, 50-, 55-, 60-, 65-, 70-, 75-, 80- , 85-, 90-, 95-, 98- or 100-fold) or higher in comparison to electrically permeabilizing one or more cells to deliver an exogenous agent thereto, after (pre-)incubating one or more cells in a cell-compatible solution for a time-limited duration of 24 hours or less (e.g. a time-limited duration of 0 hour, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, or up to 24 hours). An efficiency of obtaining one or more modified cells when mechanically permeabilizing one or more cells to deliver an exogenous agent thereto may be at least about 5%, 7%, 8%, 9%, 10%, 11 %, 12%, 13%, 14%, or about 15% or higher in comparison to electrically permeabilizing one or more cells to deliver an exogenous agent thereto, after (pre-)incubating one or more cells in a cell-compatible solution for a time-limited duration of 48 hours.

[0079] An efficiency of obtaining one or more modified cells (via delivery of an exogenous agent) may be about 30%, 40%, 50%, 60%, 70%, 80%, 90% or higher after (pre-)incubating one or more cells in a cell-compatible solution for a time-limited duration comprising about 1 hour when mechanically permeabilizing the one or more cells compared to electrically permeabilizing the one or more cells. An efficiency of obtaining one or more modified cells (via delivery of an exogenous agent) may be about 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or higher after (pre-)incubating one or more cells in a cell-compatible solution for a timelimited duration comprising about 4 hours when mechanically permeabilizing the one or more cells compared to electrically permeabilizing the one or more cells. An efficiency of obtaining one or more modified cells (via delivery of an exogenous agent) may be about 70%, 75%, 80%, 85%, 90%, 95% or higher after (pre-)incubating one or more cells in a cell-compatible solution for a time-limited duration comprising about 24 hours when mechanically permeabilizing the one or more cells compared to electrically permeabilizing the one or more cells. In some embodiments, an efficiency of obtaining one or more modified cells (via delivery of an exogenous agent) may be about 50%, 60%, 70%, 80%, 90%, 95% or higher after (pre- )incubating one or more cells in a cell-compatible solution for a time-limited duration comprising about 1 hour or 4 hours when mechanically permeabilizing the one or more cells compared to electrically permeabilizing the one or more cells.

[0080] Where an efficiency of obtaining one or more modified cells corresponds to a level of gene editing, the level of gene editing may be higher by at least about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% when mechanically permeabilizing one or more cells compared to electricallypermeabilizing the one or more cells. A level of gene editing may be higher by at least about 1-, 2-, 5-, 10-, 15-, 20-, 25-, 30-, 35-, 40-, 45-, 50-, 55-, 60-, 65-, 70-, 75-, 80-, 85-, 90-, 95-, 98- or 100-fold when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells. In some embodiments, an efficiency of obtaining one or more modified cells is higher by at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells, when (pre-)incubated in a cell-compatible solution for a time-limited duration of 1 hour. In some embodiments, an efficiency of obtaining one or more modified cells is higher by at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells, when (pre-)incubated in a cell-compatible solution for a time-limited duration of 4 hours. In some embodiments, an efficiency of obtaining one or more modified cells is higher by at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60% when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells when (pre-)incubated in a cell-compatible solution for a time-limited duration of 24 hours. In some embodiments, an efficiency of obtaining one or more modified cells is higher by at least about 5%, 10%, 15% or 20% when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells, when (pre- )incubated in a cell-compatible solution for a time-limited duration of 48 hours.

[0081] Where an efficiency of obtaining one or more modified cells corresponds to a level of expression of a nucleic acid / protein per cell, the level of expression of a nucleic acid / protein per cell may be higher by at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells. A level of expression of a nucleic acid / protein per cell may be higher by at least about 1-, 2-, 5-, 10-, 15-, 20-, 25-, 30-, 35-, 40-, 45-, 50-, 55- , 60-, 65-, 70-, 75-, 80-, 85-, 90-, 95-, 98- or 100-fold when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells. In some embodiments, an efficiency of obtaining one or more modified cells is higher by at least about 95-99% (about 95-99- fold) when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells, when (pre-)incubated in a cell-compatible solution for a time-limited duration of 1 hour. In some embodiments, an efficiency of obtaining one or more modified cells is higher by at least about 40-45% when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells, when (pre-)incubated in a cell-compatible solution for a time-limited duration of 4 hours.

[0082] Where an efficiency of obtaining one or more modified cells corresponds to a level of expression of a nucleic acid / protein per cell (as may be expressed as a relative meanfluorescence intensity), the level of expression of a nucleic acid / protein per cell may be higher by at least about 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, or 390 units when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells. A level of expression of a nucleic acid / protein per cell may be higher by at least about 20-, 25-, 30-, 35-, 40-, 45-, 50-, 60-, 70-, 80-, 90-, or 100-fold when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells. In some embodiments, a level of expression of a nucleic acid / protein per cell is higher by at least about 20, 30, 40, 50, 60, 70, or 80 units when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells, when (pre-)incubated in a cell-compatible solution for a time-limited duration of 1 hour. In some embodiments, a level of expression of a nucleic acid / protein per cell is higher by at least about 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 units when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells, when (pre-)incubated in a cell-compatible solution for a time-limited duration of 4 hours. In some embodiments, a level of expression of a nucleic acid / protein per cell is higher by at least about 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, or 400 units when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells, when (pre-)incubated in a cell-compatible solution for a time-limited duration of 24 hours.

[0083] In addition, or in the alternative, an efficiency of obtaining one or more modified cells may increase as a time-limited duration increases during a duration of 24 hours or less. An efficiency of obtaining one or more modified cells may increase as a time limited duration increases from about 1 hour to less than 12 hours. An efficiency of obtaining one or more modified cells may increase from about 60-65% to about 80% as a time limited duration increases from about 1 hour to 4 hours. An efficiency of obtaining one or more modified cells may increase from about 80% to about 90% as a time limited duration increases from about 4 hours to about 24 hours. In some embodiments, an efficiency of obtaining one or more modified cells increases from about 90-95% to about 100% as a time limited duration increases from about 1 hour to about 4 hours. In some embodiments, an efficiency of obtaining one or more modified cells increases from about 90-95% to about 100% as a time limited duration increases from about 4 hours to about 24 hours.

[0084] With specific regard to HSPC, an efficiency of obtaining one or more modified HSPCs comprising a desired phenotype (e.g., CD34+, CD34+and CD90+) may be equal to or greater than about 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% after (pre-)incubating the one or more HSPC in a cell-compatible solution for a time-limited duration of about 24 hours or less, when mechanically permeabilizing the one or more HSPC compared to electricallypermeabilizing the one or more HSPC. In some embodiments, an efficiency of obtaining one or more modified HSPC populations comprising i) CD34 or ii) CD34 and CD90 is about 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% after (pre-)incubating the one or more cells in a cell compatible solution for a time-limited duration of 1 hour when mechanically permeabilizing the one or more cells compared to electrically permeabilizing the one or more cells. In some embodiments, an efficiency of obtaining one or more modified HSPC populations comprising i) CD34 or ii) CD34 and CD90 is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or >95% after (pre-)incubating the one or more cells in a cell compatible solution for a time-limited duration of 4 hours when mechanically permeabilizing the one or more cells compared to electrically permeabilizing the one or more cells. In some embodiments, an efficiency of obtaining one or more modified HSPC populations comprising i) CD34 or ii) CD34 and CD90 is about 90%, or > 95% after (pre-)incubating the one or more cells in a cell compatible solution for a time-limited duration of 24 hours when mechanically permeabilizing the one or more cells compared to electrically permeabilizing the one or more cells. In some embodiments, an efficiency of obtaining one or more modified HSPC populations comprising i) CD34 or ii) CD34 and CD90 is at least 40%, 50%, 60%, 70%, 80%, 90% or higher after (pre-)incubating the one or more cells in a cell compatible solution for a time-limited duration of 0 hour, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours or up to 24 hours when mechanically permeabilizing the one or more cells compared to electrically permeabilizing the one or more cells.

[0085] In any aspect, methods of this disclosure may maintain / preserve a desired phenotype of one or more modified cells, as may be determined by assessing an average frequency of one or more phenotypic marker among a plurality of modified cells. An average frequency of one or more phenotypic marker among a plurality of modified cells may be maintained irrespective of a duration of a time-limited duration (such as 24 hours or less) of (pre- )incubating one or more cells, for example when mechanically permeabilizing versus electrically permeabilizing a cell.

[0086] Methods of this disclosure may maintain / preserve a desired phenotype of one or more modified cells, as may be determined by assessing an average frequency of one or more phenotypic marker among a plurality of modified cells, as a time-limited duration of preincubation increases from an initial timepoint to a subsequent timepoint during the time-limited duration. For example, an average frequency of CD34 or CD90 among a plurality of modified cells may be maintained within ±1%, ± 5%, ±10%, ±15%, ±20%, ±25%, ±30%, ±35%, or ±40% as a time-limited duration of pre-incubation increases from an initial timepoint (e.g. 1 h) to a subsequent timepoint during the time-limited duration (e.g. 4 h). In some embodiments, anaverage frequency of CD34 or CD90 among a plurality of modified cells is maintained within ± 1%, ± 2%, ± 3%, ± 4%, ± 5%, ± 6%, ± 7%, ± 8%, ± 9%, or ± 10% as a time-limited duration of pre-incubation increases from an initial timepoint (e.g. 1 h or 4 h) to a subsequent timepoint (e.g. 4 h or 12 h) during the time-limited duration. In some embodiments, an average frequency of CD34 or CD90 among a plurality of modified cells is maintained within ± 10% as a timelimited duration of pre-incubation increases from an initial timepoint (e.g. 1 h) to a subsequent timepoint (e.g. 4 h) during the time-limited duration.

[0087] In any aspect, methods of this disclosure may give rise to higher average frequencies of a desired phenotype (e.g. one or more phenotypic marker) among a plurality of modified cells when mechanically permeabilizing one or more cells and delivering an exogenous agent thereto, compared to other methods of permeabilizing (e.g. electrically) the one or more cells and delivering the exogenous agent thereto. Methods of permeabilizing one or more cells other than mechanical permeabilization are known in the art and may include, without limitation, chemical permeabilization methods (e.g. organic solvent- or detergent-based) and physical permeabilization methods (e.g. electroporation, sonication, high-pressure homogenization, bead beading / grinding). Specifically, methods of this disclosure may give rise to higher average frequencies of a desired phenotype (e.g. one or more phenotypic marker) among a plurality of modified cells when mechanically permeabilizing one or more cells and delivering an exogenous agent thereto compared to electrically permeabilizing the one or more cells and delivering an exogenous agent thereto.

[0088] With specific regard to HSPC, an average frequency of i) CD34 or ii) CD34 and CD90 among a plurality of modified cells may be higher when mechanically permeabilizing one or more cells compared to electrically permeabilizing the one or more cells, or stated in another way expression levels of such phenotypic marker may be preserved / maintained among mechanically permeabilized cells while reduced among electrically permeabilized cells.

[0089] With further specific regard to HSPC, an average frequency of a modified HSPC population comprising a desired phenotype (e.g., CD34+, CD34+CD45RACD90+) among a plurality of modified HSPCs may be higher when mechanically permeabilizing / deforming the HSPCs compared to electrically permeabilizing the HSPCs, when an input one or more HSPC is (pre-)incubated in a cell-compatible solution for a time-limited duration, such as for 24 hours or less. For example, an average frequency of CD34 among a plurality of modified cells may be equal to or greater than about 50%, 60%, 70%, 80%, 90%, or 95% when mechanically permeabilizing / deforming the HSPCs, when an input one or more HSPC is (pre-)incubated in a cell-compatible solution for a time-limited duration of i) between about 0.5 to about 24 hours; ii) about 12 hours or less; ii) about 4 hours or less; and / or iv) about 1 hour. In another example,an average frequency of CD90 among a plurality of modified cells may be equal to or greater than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%, when mechanically permeabilizing / deforming the HSPCs, when an input one or more HSPC is (pre- )incubated in a cell-compatible solution for a time-limited duration of i) between about 0.5 to about 24 hours; ii) about 12 hours or less; ii) about 4 hours or less; and / or iv) about 1 hour. In some embodiments, an average frequency of CD34 among a plurality of modified cells is equal to or greaterthan about 70%, 80%, 90%, or 95% when mechanically permeabilizing / deforming the HSPCs, when an input one or more HSPC is (pre-)incubated in a cell-compatible solution for a time-limited duration of about 1 hour, 4 hours or 24 hours. In some embodiments, an average frequency of CD34 among a plurality of modified cells is equal to or greater than about 90-98% when mechanically permeabilizing the HSPCs, when an input one or more HSPC is (pre-)incubated in a cell-compatible solution for a time-limited duration of about 1 hour, 4 hours or 24 hours. In some embodiments, an average frequency of CD34 among a plurality of modified cells is equal to or greater than about 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% when mechanically permeabilizing / deforming the HSPCs, when an input one or more HSPC is (pre-)incubated in a cell-compatible solution for a time-limited duration of about 48 hours. In some embodiments, an average frequency of CD34 among a plurality of modified cells is equal to or greater than about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% when mechanically permeabilizing / deforming the HSPCs, when an input one or more HSPC is (pre-)incubated in a cell-compatible solution for a time-limited duration of about 1 hour, 4 hours or 24 hours. In some embodiments, an average frequency of CD90 among a plurality of modified cells is equal to or greater than about 20%, 25%, 30%, 35%, 40%, 45% or 50% when mechanically permeabilizing / deforming the HSPCs, when an input one or more HSPC is (pre-)incubated in a cell-compatible solution for a timelimited duration of about 1 hour, 4 hours or 24 hours respectively. In some embodiments, an average frequency of CD90 among a plurality of modified cells is equal to or greater than about 10%, 15%, 20%, 25%, 30%, 35%, or 40% when mechanically permeabilizing / deforming the HSPCs, when an input one or more HSPC is (pre-)incubated in a cell-compatible solution for a time-limited duration of about 48 hours. In some embodiments, an average frequency of CD90 among a plurality of modified cells is equal to or greater than about 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% when mechanically permeabilizing / deforming the HSPCs, when an input one or more HSPC is (pre-)incubated in a cell-compatible solution for a time-limited duration of about 1 hour, 4 hours or 24 hours respectively. Such higher average frequencies of HSPCs or subsets thereof, particularly of long-term repopulating cells such as primitive progenitor HSCs (e.g., CD34+CD45RA CD90+), may be especially advantageous for applications of genome editing or otherwise modifying HSPC (e.g. with anucleic acid or (poly)peptide), such as to increase the likelihood of engraftment and / or persistence of one or more modified cells when introduced into an individual / subject in need.Compositions

[0090] In another aspect of this disclosure are provided compositions comprising hematopoietic stem and progenitor cells (HSPCs) in an appropriate liquid solution, such as a cryopreservation solution and / or a cell-compatible solution. HSPCs of such aspect may comprise an exogenous agent intracellularly. About 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the HSPCs may comprise the exogenous agent intracellularly.

[0091] HSPC compositions of this disclosure may comprise about 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more CD34+CD45+HSPCs. The same or different HSPC compositions may comprise about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, or more CD34+CD45RACD90+HSPCs.

[0092] In some embodiments, about 85-90% or higher of HSPCs in a composition are CD34+CD45+when pre-incubated in cell-compatible solution for a time-limited duration of 1 h, 4h, or 24h before receiving an exogenous agent intracellularly. In some embodiments, about 90-98% or higher of HSPCs in a composition are CD34+CD45+when pre-incubated in cellcompatible solution for a time-limited duration of 1h, 4h, or24h before receiving an exogenous agent intracellularly. In some embodiments, about 85-90% of HSPCs in a composition are CD34+CD45+when pre-incubated in cell-compatible solution for a time-limited duration of 48h before receiving an exogenous agent intracellularly. In some embodiments, about 25-40% of HSPCs in a composition are CD34+CD45RACD90+when pre-incubated in a cell-compatible solution for a time-limited duration of 1 h, 4h, or 24h before receiving an exogenous agent intracellularly. In some embodiments, about 20-30% of HSPCs in a composition are CD34+CD45RA CD90+when pre-incubated in a cell-compatible solution for a time-limited duration of 48h before receiving an exogenous agent intracellularly. In some embodiments, about 55-75% of HSPCs in a composition are CD34+CD45RA CD90+when pre-incubated in a cell-compatible solution for a time-limited duration of 1 h, 4h, or 24h before receiving an exogenous agent intracellularly. In some embodiments, about 60-70% of HSPCs in a composition are CD34+CD45RA CD90+when pre-incubated in a cell-compatible solution for a time-limited duration of 1h, 4h, or 24h before receiving an exogenous agent intracellularly.

[0093] HSPCs of this aspect may have been (pre-)incubated in the same or different cellcompatible solution (compared with as comprised in the composition of this aspect) for a timelimited duration of 24 hours or less (as described above) before receiving the exogenous agent intracellularly.

[0094] The nature of the cell-compatible solution may be as described above, and may be any solution known in the art that is compatible with HSPCs. Preferably, the solution comprises a cell culture medium.

[0095] An exogenous agent of this aspect may be as described above, and may comprise a nucleic acid or a polypeptide, or a combination of a nucleic acid and a polypeptide (as described above). In a specific embodiment, an exogenous agent intracellularly within one or more modified cells may be a genome editing complex, and a cell of this aspect may comprise a modification of its genome. In a specific embodiment, an exogenous agent intracellularly within one or more modified cells may be an expression construct (e.g. a nucleic acid), and a cell of this aspect may comprise the expression construct (and / or an expression product of the expression construct) in its nucleus and / or cytoplasm, as appropriate.

[0096] Compositions of this disclosure may be combined with a pharmaceutically acceptable carrier or excipients known in the art.

[0097] The following non-limiting examples are illustrative of the present disclosure.ExamplesExample 1: Delivery of exogenous agents to Human CD34+HSPCsI) Preparation and pre-incubation of HSPCs

[0098] CD34+HSPCs were isolated from either cord blood (CB) or adult mobilized peripheral blood (mPB) using immunomagnetic selection kits such as EasySep™ Human CD34 Positive Selection Kit II (STEMCELL Technologies) according to manufacturer’s instructions. A cryovial containing CD34+cells purified as described above was quickly thawed in a 37°C water bath. Cells were transferred to a conical tube containing 10 ml of pre-warmed wash medium, such as StemSpan™ SFEM II medium (STEMCELL Technologies) or IMDM + 2% FBS medium, and centrifuged at 250g for 10 min at room temperature (15 - 25°C). Cell pellets were resuspended in 1 ml of pre-warmed complete medium, such as StemSpan™ SFEM II culture medium supplemented with StemSpan™ CD34+Expansion supplement and 1 pM UM729 (each STEMCELL Technologies). Viable cell density was adjusted to about 1 x io5cells / ml in pre-warmed complete medium supplemented as above, transferred to an appropriate culture plate, and incubated in a humidified incubator at 37°C and 5% CO2for 1 h, 4h, 24h or 48h.II) Intracellular delivery of an RNP complex to HSPCs

[0099] To deliver an exogenous gene-editing agent, a CRISPR-Cas9 RNP complex to knockout the B2M gene was prepared by combining 40 pmol Cas9 nuclease (Alt-R™ S.p. Cas9 V3, glycerol-free, Integrated DNA Technologies) and 100 pmol B2M single guide RNA (sgRNA,GGCCGAGAUGUCUCGCUCCG) in a 1 :2.5 Cas9:sgRNA molar ratio in a solution as indicated below. The mixture was then incubated at room temperature for 15 minutes.

[0100] 5 x 104cord blood-derived CD34+HSPCs pre-incubated for 1 h, 4h, 24h or 48h as described in section 1-i) were used in delivery experiments. In the case of mechanoporation, cells were transferred to a sterile RNase-free microcentrifuge tube, centrifuged at 500g for 2 minutes at room temperature, and the pellet was re-suspended in 75 pL of CellPore™ Delivery medium (STEMCELL Technologies) and 5 pL of the prepared RNP complex before transferring to a new CellPore™ Delivery Cartridge 300 (STEMCELL Technologies). In the case of electroporation, cells were transferred to a 15 ml conical tube and centrifuged at 300g for 5 minutes, washed with sterile PBS, and centrifuged again at 300g for 5 minutes. Cell pellet was resuspended in 7.5 pL of Resuspension Buffer T and mixed with 7.5 pL of the prepared RNP complex before transfer to a cuvette.

[0101] The RNP complex was delivered to CD34+HSPCs by mechanoporation (CellPore™ Transfection System, STEMCELL Technologies) as per manufacturer’s instructions, using a pressure of ~30 psi and a run time of 5 seconds, or by electroporation (Neon Transfection System) as per manufacturer’s instructions, using a 10 pL tip, an electric potential of 1600 V, a pulse width of 10 ms, and 3 pulses. After mechanoporation or electroporation, the modified CD34+HSPCs were transferred to an appropriate culture plate containing complete medium, as described above. Cells were incubated in a humidified incubator at 37°C and 5% CO2 until further analysis or downstream applications.Hi) Intracellular delivery of mRN A to HSPCs

[0102] To deliver an exogenous mRNA by mechanoporation or electroporation, cells were prepared and delivery parameters were essentially as described above. In the case of mechanoporation, 6 x 104CD34+HSPCs were used per reaction in an 80 pL volume including CellPore™ Delivery medium (STEMCELL Technologies). In the case of electroporation, 6 x 104CD34+HSPCs were used per electroporation reaction in a 10 pL volume in Neon NxT Resuspension T Buffer (Thermo Fisher Scientific). In both cases, GFP mRNA (TriLink Biotechnologies) was included at a final concentration of 0.025 mg / ml.

[0103] Immediately after mechanoporation or electroporation, modified HSPCs were transferred to an appropriate culture plate containing complete medium, as described above in section 1-i). Cells were then incubated at 37°C and 5% CO2until further analysis. iv) Flow cytometry analysis

[0104] Genome-edited and mRNA-delivered CD34+HSPCs, prepared by either electroporation or mechanoporation as described above, were respectively analyzed by flowcytometry 4-6 days or 1 day post transfection using appropriate fluorochrome-conjugated antibodies recognizing CD45, CD34, CD45RA or CD90, and viability dyes (e.g. DRAQ7™, Invitrogen). Editing efficiency was assessed by surface expression of MHC-I which is not expressed following B2M knockout using an MHC-1 antibody (Anti-human HLA A,B,C Clone W6 / 32; Biolegend #311406). mRNA delivery efficiency was assessed by detecting GFP expression. The flow cytometry gating strategy is as follows. Cells initially gated based on granularity and size were then gated for single cells to exclude clumps of multiple cells. Single cells were further gated for viable cells based on DRAQ7™ staining. Live cells were further gated to identify CD34+cells using antibodies specific for CD45 and CD34 (CD34+CD45+) or to identify primitive progenitor populations using antibodies specific for CD34, CD45RA and CD90 (CD34+CD45RA- and CD34+CD45RA CD90+). Following the above, gene-edited cells were identified in each subset as cells no longer expressing MHC-I (MHC-1 (CD34+), MHC-1- (CD45RA) & MHC-1 (CD90+)), and mRNA-delivered cells were identified based on expression of GFP. Frequency of CD34+CD45RACD90+cells was calculated by multiplying % frequencies of CD34+, CD45RA- and CD90+populations. Relative MFI was calculated by dividing the absolute MFI (GFP) of a given condition by the absolute MFI (GFP) of an untreated control.Example 2: Pre-incubation and intracellular delivery of exogenous agents into CD34+HSPCsI) RNP complex

[0105] T o test the effect of pre-incubation on genome editing efficiencies, CD34+HSPCs were pre-incubated in complete culture medium as described above for 1 h, 4h, 24h or 48 h prior to introducing a CRISPR-Cas9 RNP complex to knock-out the B2M gene, as described above. Viability, editing efficiency, and frequency of specific subsets of cells were assessed between about 4-6 days after transfection. An approximately 80% or higher viability was observed for all pre-incubation timepoints for both mechanoporated and electroporated cells (data not shown). However, editing efficiency greater than 60% was observed when cells were preincubated for only 1 h prior to mechanoporation, with even higher editing efficiencies of 80%, 90% and 88% observed at the 4h, 24h and 48h pre-culture timepoints respectively (Figure 1A), while electroporated cells showed non-existent or negligible editing at the 1 h and 4h preculture timepoints, respectively. Only after pre-incubation at 24h or 48h could an editing efficiency of about 40% and about 80% be achieved using electroporation. Similar trends were observed when assessing editing efficiency by mechanoporation or electroporation of a primitive progenitor population (CD34+CD45RA CD90+) (Figure 1A, right panel).

[0106] Overall, editing levels by mechanoporation surpassed those of electroporation across all time points and cell subsets assessed. While editing efficiency increased with increasingpre-incubation times, but in contrast to electroporation, notable levels of gene editing were unexpectedly obtained when cells were pre-incubated for shorter periods of time prior to mechanoporation. These results demonstrate that mechanoporation with a reduced preculture time of 24 hrs or less prior to transfection can achieve >90% editing efficiency of the B2M gene among CD34+cell subsets, while maintaining high cell viability.

[0107] The frequency of CD34+HSPCs and the primitive progenitor populations (CD90+) was further assessed among cells arising after mechanoporation or electroporation. The % frequency of bulk CD34+HSPCs and the primitive progenitor populations were maintained within a range of ± 10% when pre-cultured for differing durations of 1 h, 4h or 24h, indicating that pre-culturing for differing time durations before transfection did not lead to a large variability in subpopulations of modified cells (Figure 1 B, left panel). There was a slight drop in % frequency of the populations assessed at 48 h compared to other timepoints, for both mechanoporation and electroporation.

[0108] As shown, the % frequency of edited CD34+HSPCs and a primitive progenitor population thereof is higher when pre-incubated for 1 h, 4h or 24h compared to when preincubated for 48h, for both mechanoporation and electroporation (Figure 1 B). When considering a pre-incubation duration of 24 hours or less, the % frequency of edited CD34+HSPCs is higher when pre-incubated for 1 h (about 98%) or 4h (about 98%) compared to when pre-incubated for 24h (about 90%) (Figure 1 B, left panel). While the % frequency of edited CD90+HSPCs is comparable when pre-incubated for 4h or 24h (about 38-40%), it drops further to about 25% when pre-incubated for 48h (Figure 1 B, right panel).

[0109] Yet, at timepoints where CD34+and CD90+HSPCS are higher (4h & 24h respectively as described above), editing efficiency with mechanoporation is much higher (about >80%) compared to electroporation (Figure 1A), indicating that mechanoporation achieves optimal gene editing when levels of CD34+cells and primitive progenitor CD90+cells are highest (e.g. at reduced pre-incubation). A >80% editing efficiency is not obtained among electroporated CD90+HSCs, at any pre-incubation timepoint assessed (Figure 1A), but by the time the positive effect of editing efficiency after an extended pre-incubation prior to electroporation arises, a marked reduction in frequency of CD90+HSCs is observed (Figure 1 B, right panel). In contrast, a >90% editing efficiency is achieved among mechanoporated CD90+HSCs after 24h pre-incubation (Figure 1A) when frequency of this subset is at its peak.

[0110] Therefore, these results demonstrate that the mechanoporation workflow described herein with a reduced pre-incubation time of24h or less prior to transfection ensures maximum retention of the primitive progenitor population. Accordingly, maximally efficient delivery of editing complexes by mechanoporation may be performed earlier than by electroporationthereby expediting processes and reducing labour and material costs, with the added benefit that such modification is performed when target cell frequencies are at their highest. ii) mRNA

[0111] To test the effect of pre-incubation on mRNA expression, CD34+HSPCs were preincubated as described above for 1 h, 4h or 24h prior to introducing an mRNA, as described above. % GFP expression, % frequency and relative MFI of specific subsets of cells were assessed 1 day after transfection (Figure 2).

[0112] Overall, the percentage of GFP expressing cells was consistent across all pre- incubation timepoints assessed, while trending toward a gradual increase over time, when performing transfection by mechanoporation (Figure 2A). In contrast, pre-incubation time and delivery efficiency were positively correlated when transfecting by electroporation (as with editing efficiency above). Most notably, percentage of GFP expressing cells is approximately 90% or higher when cells were pre-incubated for only 1 h or 4h prior to mechanoporation, but was non-existent at the 1 h timepoint when transfecting by electroporation and only roughly half of that of mechanoporation when cells were pre-incubated for 4h (Figure 2A). These results demonstrate that mechanoporation following a shortened pre-culture time of about 4h or less prior to transfection can achieve ~90% or higher mRNA expression among transfected CD34+HSPCs, which is significantly higher than can be achieved by electroporation.

[0113] When assessing relative MFI (rMFI) under the delivery conditions described above, in order to quantify an average level of fluorescence or GFP abundance, the same trends were observed. Notably, low MFI was observed among all electroporated conditions assessed, while MFI positively correlated with pre-incubation time among cells transfected by mechanoporation (Figure 2C). Further, at every time point assessed, relative MFI was higher among mechanoporated cells compared to electroporated cells. In particular, at the 1 h and 4h pre-incubation timepoints, relative MFI of about 50-60 and about 170-200 were surprisingly observed among mechanoporated cells, respectively, while absent or virtually absent among electroporated cells. These results demonstrate that mechanoporation with a reduced preculture time of 24h or less prior to transfection can result in high levels of mRNA expression per cell, compared to electroporation.

[0114] The frequency of modified CD34+HSPCs and primitive progenitor HSPCs (CD90+) was further assessed among cells arising after mechanoporation or electroporation. The % frequency of bulk CD34+HSPCs and CD90+HSPCs was maintained within a range of ± 10% when pre-cultured for differing durations of 1 h, 4h or 24h, indicating that pre-culturing for differing time durations before transfection did not lead to a large variability in subpopulations of modified cells (Figure 2B).

[0115] The % frequency of modified CD34+HSPCs is about 90-100% while the % frequency of modified CD90+HSPCs ranges between about 60-70%, when pre-incubated for 1 h, 4h or 24h, for both mechanoporated and electroporated conditions (Figure 2B). At timepoints where % frequencies of CD34+and CD90+HSPCS are at about 90-100% and 60-70% (at 1 h & 4h), GFP expression with mechanoporation is much higher (about >99%) compared to electroporation (Figure 2A), indicating that mechanoporation leads to appreciable GFP expression when levels of CD34+cells and primitive progenitor CD90+cells are high(est) (e.g. at reduced pre-incubation). A GFP expression comparable to mechanoporation is only achieved among electroporated CD90+HSCs or CD34+HSPCs pre-incubated for 24h (Figure 2A).

[0116] Therefore, these results demonstrate that efficient delivery of mRNA by mechanoporation may be performed earlier than by electroporation when considerably high levels of a primitive progenitor population are present.

[0117] While the present disclosure has been described with reference to what are presently considered to be the preferred examples, it is to be understood that the disclosure is not limited to the disclosed examples. To the contrary, the disclosure is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.

[0118] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.

Claims

CLAIMS:1 . A method of modifying one or more cells, the method comprising: a) providing the one or more cells in a cell-compatible solution; b) incubating the one or more cell in the cell-compatible solution for a time-limited duration; and c) delivering an exogenous agent into the one or more cell to obtain one or more modified cells.

2. The method of claim 1 , wherein delivering the exogenous agent comprises mechanically permeabilizing the one or more cells to cause permeabilizations to a membrane thereof large enough for the exogenous agent to pass into the one or more cell.

3. The method of claim 1 or 2, wherein an efficiency of obtaining the one or more modified cells is greater than 60%.

4. The method of claim 2 or 3, wherein an efficiency of obtaining the one or more modified cells is higher when mechanically permeabilizing the one or more cell compared to electrically permeabilizing the one or more cells when each of the mechanically permeabilized one or more cells and the electrically permeabilized one or more cells were incubated in the cellcompatible solution for an equivalent time-limited duration.

5. The method of any one of claims 1-4, wherein the time-limited duration comprises about 24 hours or less.

6. The method of claim 4 or 5, wherein the efficiency of obtaining the one or more modified cells: a) increases as the time limited duration increases from about 1 hour to less than 12 hours; and / or b) is about 60% or higher after pre-incubating the one or more cells in the cell-compatible solution for a time-limited duration of about 1 hour or 4 hours.

7. The method of any one of claims 1 to 5, wherein the time-limited duration is i) between about 0.5 to about 24 hours, ii) about 12 hours or less, and / or iii) about 4 hours or less.

8. The method of any one of claims 1 to 7, wherein the one or more cells is a hematopoietic stem and progenitor cell (HSPC), and wherein: i) the HSPC is CD34+and CD45+; or ii) the HSPC is CD34+, CD45RA' and / or CD90+.

9. The method of claim 8, wherein an average frequency of CD34 among a plurality of modified cells is maintained within ± 10% as the time-limited duration increases from an initial timepoint to a subsequent timepoint during the time-limited duration.

10. The method of claim 8 or 9, wherein an average frequency of i) CD34 or ii) CD34 and CD90 among a plurality of modified cells is higher when mechanically permeabilizing the one or more cell compared to electrically permeabilizing the one or more cell.11 . The method of any one of claims 8-10, wherein:i) an average frequency of CD34 among a plurality of modified cells is equal to or greater than about 90-98% when mechanically permeabilizing the one or more cells; or ii) an average frequency of CD90 among a plurality of modified cells ranges between about 25-70% when mechanically permeabilizing the one or more cells, wherein the time-limited duration comprises about 1 hour, about 4 hours or about 24 hours.

12. The method of any one of claims 1 to 11 , wherein the one or more cells are cryopreserved and is thawed prior to incubating the one or more cells in the cell-compatible solution.

13. The method of any one of claims 1 to 12, wherein the exogenous agent comprises a nucleic acid or a polypeptide, or a combination of a nucleic acid and a polypeptide.

14. The method of any one of claims 1 to 13, wherein a cell density of the one or more cells before delivering an exogenous agent is between about 1 x 105cells / ml to about 1.5 x 107cells / ml.

15. The method of any one of claims 1 to 14, wherein the cell-compatible solution comprises a cell culture medium.

16. A composition comprising hematopoietic stem and progenitor cells (HSPCs) and a cellcompatible solution, wherein the HSPCs comprise an exogenous agent intracellularly, wherein about 90% or more of the HSPCs are CD34+CD45+, wherein about 25% or more of the HSPCs are CD34+CD45RA CD90+, and wherein about 60% or higher of the HSPCs are modified by the exogenous agent.

17. The composition of claim 16, wherein the HSPCs were incubated in the same or a different cell-compatible solution for a time-limited duration of 24 hours or less before receiving the exogenous agent intracellularly.

18. The composition of claim 16 or 17, wherein the exogenous agent comprises a nucleic acid or a polypeptide, or a combination of a nucleic acid and a polypeptide.

19. The composition of any one of claims 16 to 18, wherein the cell-compatible solution comprises a cell culture medium.

20. The composition of claim 16, wherein about 60-70% of the HSPCs are CD34+CD45RA_CD90+.