Molecular marker for saline-alkali tolerance in maize and use thereof

Abstract

Provided are a molecular marker for saline-alkali tolerance in maize and the use thereof. The molecular marker is located on chr2:11471394 of maize chromosome 2, and the nucleotide sequence thereof is SEQ ID NO. 6. The molecular marker and a detection reagent thereof can be used for saline-alkali-resistant maize breeding, allowing identification during the seed stage or early cotyledon sprouting stage of maize, thereby accelerating the breeding process of saline-alkali-resistant maize varieties.

Description

A molecular marker for salt and alkali tolerance in maize and its application Technical Field

[0001] This invention belongs to the fields of genetic engineering technology and agricultural breeding. Specifically, this application relates to a molecular marker for salt and alkali tolerance in maize and its application. Background Technology

[0002] Salt-alkali stress is one of the most common abiotic stresses in nature. Due to its widespread distribution, it has a significant negative impact on agricultural production (Munns & Tester, 2008; Zhu, 2016). In recent years, the continuous deterioration of global arable land salinization has further exacerbated the threat of salt and alkali to agricultural production. Nearly 9.3 million hectares of arable land in my country are affected by salinization, and this phenomenon is intensifying, seriously restricting the sustainable development of agriculture in my country (Zhao et al., 2001). Therefore, in-depth research into the molecular mechanisms by which major crops adapt to salt-stress environments, identification of genes that can be used to improve crop salt-alkali tolerance, and breeding salt-alkali tolerant crop varieties are necessary measures to ensure the sustainable development of agriculture and national food security in my country.

[0003] The salt-alkali tolerance response mainly involves two aspects: deionization toxicity and osmotic regulation. When growing under salt stress conditions, plant roots will absorb excessive sodium. + At the same time, suppress K + Absorption leads to K in the tissue + / Na + An imbalance in the ratio leads to ion poisoning, which in turn causes osmotic stress. Therefore, maintaining Na+ is crucial. + K + Homeostasis plays a crucial role in the formation of salt and alkali tolerance in plants (Munns and Tester, 2008; Yang and Guo, 2018). Maize is the most widely planted crop in my country and is sensitive to salt stress (Wang, 2005). Existing studies have shown that natural maize populations possess rich genetic diversity, and the salt and alkali tolerance varies among different maize inbred lines, indicating abundant genetic variation within natural maize populations that can be applied to the genetic improvement of salt and alkali tolerance (Zhang et al., 2019; Luo et al., 2019). With the continuous application of genome-wide association analysis (GWAS) and quantitative trait genomics (QTL) analysis methods in the discovery of maize salt and alkali tolerance genes, a series of genetic loci associated with salt and alkali tolerance variations have been identified. However, to date, only a small number of maize salt and alkali tolerance QTL genes have been cloned, and the development and application of maize salt and alkali tolerance molecular markers are also relatively limited. Therefore, discovering and cloning salt-tolerant QTL genes and elucidating their salt-tolerant mechanisms, developing new salt-tolerant molecular markers and applying them to salt-tolerant maize breeding, has important genetic resource support and application value for salt-tolerant maize breeding. Summary of the Invention

[0004] On the one hand, this application provides a corn salt-alkali tolerant molecular marker, the nucleotide sequence of which is SEQ ID NO.6.

[0005] Furthermore, the maize salt-alkali tolerance molecular marker is located on maize chromosome 2.

[0006] Furthermore, the maize salt-alkali tolerance molecular marker was obtained by amplifying maize genomic DNA using the following primer pair:

[0007] ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT;

[0008] ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC.

[0009] On the other hand, this application provides primer pairs for detecting the aforementioned salt-alkali tolerance molecular markers in maize, the nucleotide sequences of which are as follows:

[0010] ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT;

[0011] ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC.

[0012] On the other hand, this application provides a kit for identifying whether corn is salt-tolerant, the kit containing the above-mentioned primer pair.

[0013] On the other hand, this application provides a method for identifying whether corn is salt-tolerant, the method comprising:

[0014] (1) Extract genomic DNA from the maize to be tested;

[0015] (2) Amplify maize genomic DNA using the following primer pairs:

[0016] ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT;

[0017] ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC;

[0018] (3) Determine whether the corn to be tested is salt-tolerant based on the amplification results: if a 100bp fragment is obtained, the corn to be tested is salt-tolerant; if a 121bp fragment is obtained, the corn to be tested is salt-sensitive.

[0019] Step (2) can be performed using the kit described above.

[0020] Furthermore, the PCR system used for amplification in step (2) is a 20 μl system, including 10 μl of 2×Super Multiplex PCR Mix, 1 μl of 10 μM Primer ZmNC3-N-Marker-F1, 1 μl of 10 μM Primer ZmNC3-N-Marker-R1, 1 μl of maize genomic DNA, and 7 μl of ddH2O.

[0021] Further, the PCR program used for amplification in step (2) is as follows: first, pre-denaturation at 95℃ for 5 min; then, 34 cycles are performed: denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s; and finally extension at 72℃ for 5 min.

[0022] Furthermore, in step (3), the amplification results are observed by electrophoresis.

[0023] Further, in step (1), genomic DNA of the maize to be tested is extracted from the maize to be tested.

[0024] On the other hand, this application provides the application of the above-mentioned molecular markers, kits, and methods in salt-tolerant maize breeding.

[0025] Furthermore, salt-tolerant corn plants or seeds are selected for breeding in the application.

[0026] Genomic DNA can be extracted from maize using methods such as the CTAB method or commercially available kits. Samples can be seeds, stems, leaves, fruits, or other parts at different growth stages.

[0027] This invention discovers a nucleic acid sequence that can be used as a molecular marker to determine whether maize is salt-tolerant. Since maize salt tolerance is a quantitative trait, phenotypic analysis is time-consuming and labor-intensive. The maize salt tolerance molecular marker, primer pairs, and kit in this invention can all be applied to maize salt tolerance breeding. Identification can be performed during the seed stage or early cotyledon emergence, saving time and increasing accuracy, thus accelerating the breeding process of salt-tolerant maize varieties. Attached Figure Description

[0028] Figure 1 shows the functional SNP sites and molecular marker sites in Yu82, W966, Shen137, LH38, Dan598, and Su75.

[0029] Figure 2 shows the results of PCR amplification of genomic DNA from Yu82, W966, Shen137, LH38, Dan598, and Su75 using primers ZmNC3-N-Marker-F1 / ZmNC3-N-Marker-R1.

[0030] Figure 3 shows the PCR bands of 121 bp and 100 bp in 100 maize inbred lines. + Content difference graph.

[0031] Figure 4 shows the linkage disequilibrium analysis of the functional variant site SNP947 in Del1213 and ZmNC3. Part A represents the natural variation of the ZmNC3 gene region and the aboveground Na + The results of the content association analysis; Part B is a schematic diagram of the ZmNC3 gene structure; Part C is the linkage disequilibrium analysis results of natural variations in the ZmNC3 gene region. Detailed Implementation

[0032] Example 1: Development of molecular markers linked to the salt tolerance QTL gene ZmNC3

[0033] ZmNC3 is a salt-tolerant QTL gene identified in maize that encodes an HKT family transporter protein and positively regulates maize salt tolerance. Subsequent analysis showed that the superior allelic variant of ZmNC3 exists only in 6% of modern maize inbred lines, and its parents in major maize varieties such as Zhengdan 958 do not contain this superior allelic variant. Since its functional variant site SNP947(A / G) is a single nucleotide variant, there are currently no suitable molecular markers for molecular selection breeding based on PCR product size. Therefore, the inventors identified an insertion / deletion molecular marker highly linked to the ZmNC3 functional variant site for molecular breeding of maize with salt tolerance.

[0034] Based on the ZmNC3 functional variant site SNP947 (A / G), 116 maize inbred lines were divided into haplotype G (salt-tolerant) and haplotype A (salt-sensitive). Three lines were randomly selected from each haplotype. A 21-bp insertion / deletion was found at chr2:11471394, where the sequence AATTCTTTCTCTCTCACTCACTCCGTCGCCTCTGTCTCTG (SEQ ID NO.1) was replaced by GTCTCTCTCTCTCTCTCAC (SEQ ID NO.2), and this was named Del1213. The salt-tolerant inbred lines Yu82, LH38, and Su75 have SNP947 site G and contain Del1213; the salt-sensitive inbred lines W966, Shen137, and Dan598 have SNP947 site A and do not contain Del1213. (See Figure 1.)

[0035] Using the Del1213 site as a molecular marker, the inventors designed a pair of primers:

[0036] ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT (SEQ ID NO.3);

[0037] ZmNC3-N-Marker-R1: CATAACGTGAACTGCGATGC (SEQ ID NO. 4).

[0038] The genomic DNA of Yu82, W966, Shen137, LH38, Dan598, and Su75 was used as templates for PCR amplification.

[0039] PCR system 20μl: 2×Super Multiplex PCR Mix 10μl, 10μM Primer ZmNC3-N-Marker-F1 1μl, 10μM Primer ZmNC3-N-Marker-R1 1μl, DNA 1μl, ddH2O 7μl.

[0040] PCR program: pre-denaturation at 95℃ for 2 min, denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, 34 cycles from denaturation to extension, and a final extension at 72℃ for 5 min.

[0041] The results showed that PCR amplification using total DNA from salt-tolerant maize inbred lines Yu82, LH38, and Su75 as templates yielded a 100bp band; PCR amplification using total DNA from salt-sensitive maize inbred lines W966, Shen137, and Dan598 as templates yielded a 121bp band, as shown in Figure 2.

[0042] 121bp band sequence (SEQ ID NO.5)

[0043] 100bp band sequence (SEQ ID NO.6)

[0044] Example 2: Detecting salt and alkali tolerance in maize using salt and alkali tolerant molecular markers

[0045] One hundred maize inbred lines (including some core maize inbred lines) were further selected, and the Del1213 locus was identified using primer pair ZmNC3-N-Marker-F1 / ZmNC3-N-Marker-R1. The detection method was as described in Example 1, using the maize genomic DNA to be tested as a template for PCR amplification. The results showed that 89 inbred lines produced large fragments of PCR product (121 bp in length), including 89 salt-sensitive inbred lines SNP947-A; the other 11 inbred lines produced small fragments of PCR product (100 bp in length), including 10 salt-tolerant inbred lines SNP947-G and 1 salt-sensitive inbred line SNP947-A. The names of the inbred lines used and the identification results are shown in the table below:

[0046] Under salt stress conditions, the Na+ content in the leaves of the material with a PCR band of 121 bp was... + The content is significantly higher than that of materials with a stripe length of 100bp, as shown in Figure 3.

[0047] Example 3: Linkage disequilibrium analysis of Del1213 and ZmNC3 functional variant site SNP947

[0048] Genomic DNA from 513 maize inbred lines of ZmNC3 was amplified by PCR and resequencing. The resequencing regions included the promoter region, CDS region, and 3′-UTR region of ZmNC3 (sequencing was performed at Beijing Huada Genomics Co., Ltd.). Sequencing results were aligned and differentially expressed sites were obtained using Codoncode Aligner software. All genotype data were analyzed for candidate gene association using Tassle5 software. Linkage disequilibrium analysis of naturally occurring variant sites was performed using Hapview software. The results showed that Del1213 is linked to the functional site SNP947 of ZmNC3 (r...). 2 =0.8) and with the aboveground Na + The content was significantly correlated, as shown in Figure 4.

[0049] Therefore, the primer pair ZmNC3-N-Marker-F1 / ZmNC3-N-Marker-R1 can be used for molecularly assisted breeding of maize tolerable salt and alkali, and the salt-alkali tolerant molecular marker based on this primer pair is named J-Del1213. The sequences of each primer are as follows:

[0050] Primer ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT (SEQ ID NO.3);

[0051] Primer ZmNC3-N-Marker-R1: CATAACGTGAACTGCGATGC (SEQ ID NO.4).

Claims

1. A corn salt-alkali tolerant molecular marker, wherein the nucleotide sequence of the corn salt-alkali tolerant molecular marker is SEQ ID NO.

6.

2. The maize salt-alkali tolerance molecular marker according to claim 1, wherein the maize salt-alkali tolerance molecular marker is located on maize chromosome 2.

3. The maize salt-alkali tolerance molecular marker according to claim 1, wherein the maize salt-alkali tolerance molecular marker is obtained by amplifying maize genomic DNA using the following primer pair: ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT; ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC.

4. The primer pair for detecting the maize salt-alkali tolerant molecular marker according to claim 1, characterized in that, The nucleotide sequences of the primer pair are as follows: ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT; ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC.

5. A reagent kit for identifying whether corn is salt-alkali tolerant, characterized in that, The kit contains the primer pair as described in claim 4.

6. A method for determining whether corn is salt-alkali tolerant, characterized in that, The method includes: (1) Extract genomic DNA from the maize to be tested; (2) Amplify maize genomic DNA using the following primer pairs: ZmNC3-N-Marker-F1: CCTCGACCTCTCCACACT; ZmNC3-N-Marker-R1:CATAACGTGAACTGCGATGC; (3) Determine whether the corn to be tested is salt-tolerant based on the amplification results: if a 100bp fragment is obtained, the corn to be tested is salt-tolerant; if a 121bp fragment is obtained, the corn to be tested is salt-sensitive.

7. The method according to claim 4, wherein the PCR system used for amplification in step (2) is a 20 μl system, comprising 10 μl of 2×Super Multiplex PCR Mix, 1 μl of 10 μM Primer ZmNC3-N-Marker-F1, 1 μl of 10 μM Primer ZmNC3-N-Marker-R1, 1 μl of maize genomic DNA, and 7 μl of ddH2O.

8. The method according to claim 6, wherein the amplification results are observed by electrophoresis in step (3).

9. The application of the maize salt-alkali tolerant molecular marker according to any one of claims 1-3, the kit according to claim 4, or the method according to any one of claims 5-8 in salt-alkali tolerant maize breeding.

10. The application according to claim 9, wherein salt-tolerant maize plants or seeds are selected for breeding.

Images