Immobilized mutant spyfixer of spycatcher and use thereof
By mutating SpyCatcher into SpyFixer and utilizing its covalent bond connection with the vector surface, the problem of low immobilization efficiency of SpyCatcher was solved, achieving efficient protein immobilization and purification and expanding its application range.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SOUTH CHINA UNIV OF TECH
- Filing Date
- 2025-03-28
- Publication Date
- 2026-06-11
AI Technical Summary
The existing SpyCatcher exhibits low immobilization efficiency and low activity on various solid supports, limiting its applications and making it difficult to meet the needs of biosensors and protein immobilization.
A SpyCatcher immobilization mutant, SpyFixer, was developed by mutating its 77th amino acid to glutamic acid (E) to form a covalent bond with the epoxy or carboxylic acid groups on the carrier surface, thereby achieving efficient immobilization of the SpyTag fusion protein and applying it to AR2G sensors, epoxy agarose resin, and epoxy acrylate resin.
It improves the immobilization efficiency and activity of SpyCatcher on various vectors, expands its application range, and achieves highly selective and efficient protein immobilization, suitable for protein-protein interaction, antibody purification and enzyme immobilization.
Smart Images

Figure PCTCN2025085566-FTAPPB-I100001 
Figure PCTCN2025085566-FTAPPB-I100002 
Figure PCTCN2025085566-FTAPPB-I100003
Abstract
Description
A SpyCatcher immobilized mutant, SpyFixer, and its applications Technical Field
[0001] This invention relates to the field of bioengineering, specifically to a SpyCatcher immobilized mutant SpyFixer and its applications; particularly to the application of a SpyFir-SpyTag linker in the immobilization of an AR2G sensor, epoxy agarose resin, and epoxy acrylate resin. Background Technology
[0002] Protein immobilization on the surface of a solid support can create a unique microenvironment, enabling the protein to better perform its functions (Biomacromolecules, 2018, 19(10): 4098-112). Protein immobilization technology has wide applications in biopharmaceuticals, biosensors, immobilized enzymes, immunological research, and nanomaterial preparation (ACS Chemical Biology, 2018, 13(10): 2973-80, Environ Sci-Nano, 2023, 10(10): 2799-2809, Biotechnology Advances, 2018, 36(5): 1470-1480, Small, 2022, 18(19), Blood, 2016, 128(22), ACS Applied Nano Materials, 2018, 1(8): 4053-4063). However, traditional immobilization methods often randomly target nucleophilic amino acids (such as lysine, cysteine, and aspartic acid) on the protein surface, which can easily lead to undesirable loss of activity (Nature Protocols, 2007, (2) 5, 1022-1033; Bioconjugate Chemistry, 2013, 24(11), 1761-1777). In order to maximize the preservation of protein activity, some methods that can achieve uniform orientation for protein fixation have been developed in recent years. Directional immobilization methods based on bioaffinity interaction systems, such as the HisTag system, Protein A / Protein G system, and streptavidin-biotin system, can couple specific epitopes or tags on proteins to solid supports. However, these methods only provide non-covalent protein linkages, which may lead to the immobilized protein detaching from the support surface (Sensors and Actuators B: Chemical, 2017, 243, 104-113, The Analyst 2013, 138(7), 2023, Langmuir, 2015, 31(35), 9728-9736, Chemical Reviews, 2009, 109(9), 4025-4053). Bioorthogonal reactions such as cross-linking and azido-alkyne bonding can also provide covalently oriented protein immobilization, but azido groups and alkyne groups do not exist in natural proteins, requiring the introduction of non-natural amino acids (ACS Central Science, 2018, 4, 5, 614-623, Bioconjugate Chemistry, 2019, 30, 3, 531-535).Enzyme-catalyzed reactions can also mediate the directional covalent fixation of proteins. For example, Sortase A catalyzes the LPTG motif at the C-terminus of a protein to covalently and directionally link the protein to a carrier modified with oligoglycine. However, this process requires the addition of excessive enzymes and the mediated immobilization rate is low (~30%) (Macromolecular bioscience, 2015, 15(10): 1375-1380, Biochemistry, 2010, 49, 2604-2614).
[0003] The SpyTag / SpyCatcher self-linking system of fibronectin-binding protein (FbaB) from Streptococcus pyogenes (Proceedings of the National Academy of Sciences 2012, 109(12), E690-E697) can spontaneously and rapidly form heteropeptide bonds between its 117th aspartic acid (Asp117) and 31st lysine (Lys31) (Angewandte Chemie International Edition, 2010, 49, 8421-8425, Journal of the American Chemical Society, 2011, 133, 478-485). Due to its high specificity and the fact that no additional enzymes or chemical reagents are required for the reaction, SpyCatcher has been extensively studied in recent years for protein-directed immobilization (Analytical Chemistry, 2019, 91(15), 9424-9429; Biotechnology Letters, 2021, 43(5), 1075-1087; Biosensors and Bioelectronics, 2020, 154, 112052). However, in reality, immobilization of SpyCatcher on different solid supports is not always successful, and problems such as low immobilization efficiency or low binding activity after immobilization may occur. For example, recent studies have shown that SpyCatcher has low immobilization efficiency (~50%) on epoxy agarose and acetaldehyde agarose resins (Biotechnology Letters, 2021, 43(5), 1075-1087, Journal of Chromatography B, 2023, 1218, 123591); and SpyCatcher-modified epoxy magnetic microspheres have low capture capacity for SpyTag-EGFP (<40%) (Biochemical Engineering Journal, 2021, 176, 108182). Therefore, solving the immobilization problem of wild-type SpyCatcher has aroused our interest.SpyDock is a non-covalently binding mutant of SpyCatcher that can be linked to SpyTag via non-covalent bonds. Based on the fact that SpyDock has lower structural flexibility compared to the wild type, it is considered that SpyDock, with its lower structural flexibility, may be more resistant to the influence of the external environment, such as being more resistant to the interference of the immobilization process (Nature Communications, 2019, 10: 1734, Annals of the New York Academy of Sciences, 1998, 864(1), 1-8, Science Reports 2017, 7, 41212).
[0004] In view of this, the present invention is proposed. Summary of the Invention
[0005] To overcome the shortcomings and deficiencies of existing technologies, the present invention aims to provide a SpyCatcher immobilization mutant, SpyFixer, and its applications. This invention mutates alanine (A) at position 77 of SpyDock to glutamic acid (E), developing a SpyCatcher covalently bound mutant, SpyFixer, which is more conducive to immobilization. This mutant SpyFixer can be immobilized on various carrier surfaces. Different SpyFixer-modified carriers are obtained by covalently linking SpyFixer with epoxy or carboxylic acid groups on different carrier surfaces. Then, through Spy chemistry, the fusion protein of SpyTag and the target protein is immobilized onto the SpyFixer-modified carriers for applications such as interaction forces, antibody purification, and enzyme / protein immobilization. This addresses the problems of low immobilization efficiency and low activity of existing SpyCatcher on many carrier surfaces, limiting its applications. The present invention selects the fiber optic biosensor AR2G, hydrophilic epoxy agarose resin, and hydrophobic epoxy acrylate resin as three types of solid-phase carriers in the examples.
[0006] This invention leverages the specificity of the SpyFixer-SpyTag reaction. First, a SpyFixer-modified carrier is prepared. The SpyFixer is then immobilized on the carrier through a covalent reaction with the surface carboxyl or epoxy groups. Next, a Spy chemical reaction is used to specifically capture the target ligand expressed by the SpyTag onto the SpyFixer-modified AR2G sensor. The analyte and the SpyFixer-modified sensor bound to the target ligand are co-incubated to analyze the ligand-analyte interaction. Then, a Spy chemical reaction is used to specifically capture the Z domain of Protein A expressed by the SpyTag onto SpyFixer-modified epoxy agarose resin. Elution yields a high-purity target antibody. After washing and regeneration steps, the SpyFixer-modified resin bound to the Z domain can continue to bind antibodies, allowing for a new round of purification. The target enzyme expressed by SpyTag was specifically captured onto SpyFixer-modified epoxy agarose resin using a Spy chemical reaction, resulting in a reusable immobilized enzyme. The target protein expressed by SpyTag was specifically captured onto SpyFixer-modified epoxy acrylate resin for protein immobilization.
[0007] Unless otherwise stated, nucleic acids are written from left to right in the 5′ to 3′ direction; amino acid sequences are written from left to right in the direction from amino (N) to carboxyl (C).
[0008] As used herein, the terms “gene,” “nucleic acid,” “polynucleotide,” or “nucleotide sequence” refer to deoxyribonucleotides or ribonucleotides and their single-stranded or double-stranded polymers, which may be ribonucleotides, deoxyribonucleotides, or modified versions thereof, including single-stranded and double-stranded DNA, single-stranded and double-stranded RNA, and hybrid molecules having mixtures of single-stranded and double-stranded DNA and RNA.
[0009] As used herein, the terms “protein,” “peptide,” “polypeptide,” and “amino acid sequence” are used interchangeably to refer to polymers of any length, such as two or more amino acid residues. This article uses conventional single-letter or three-letter amino acid residue encoding.
[0010] As used herein, the term "amino acid" or "aa" refers to natural and synthetic amino acids, as well as amino acid analogs and amino acid simulants that function in a manner similar to that of natural amino acids. Natural amino acids are those encoded by the genetic code, as well as those that are subsequently modified, such as hydroxyproline, γ-carboxyglutamic acid, and O-phosphoserine. Amino acid analogs are compounds that have the same basic chemical structure as natural amino acids (i.e., the α-carbon bound to hydrogen, carboxyl, amino, and R groups). Amino acid simulants are chemical compounds whose structure differs from the general chemical structure of amino acids but function in a manner similar to that of natural amino acids.
[0011] The objective of this invention is achieved through the following technical solution:
[0012] A SpyCatcher immobilized mutant, SpyFixer, has the amino acid sequence shown in SEQ ID NO:1.
[0013] The encoding gene of SpyFixer, a SpyCatcher immobilized mutant.
[0014] In one embodiment of the present invention, the nucleotide sequence of the gene encoding the SpyCatcher immobilized mutant SpyFixer is shown in SEQ ID NO:2.
[0015] The aforementioned biological materials related to the SpyCatcher immobilized mutant SpyFixer are any one or more combinations of the following biological materials:
[0016] (a) An expression cassette containing the above-mentioned encoded genes;
[0017] (b) A recombinant expression vector containing the above-mentioned coding genes;
[0018] (c) A recombinant expression vector containing the expression cassette described in (a);
[0019] (d) Recombinant microorganisms containing the above-mentioned encoding genes;
[0020] (e) Recombinant microorganisms containing the expression cassette described in (a);
[0021] (f) Recombinant microorganisms containing the recombinant expression vector described in (b) or (c).
[0022] Furthermore, the starting vector for the recombinant expression vector described in (b) and (c) is a pET series vector, etc.; preferably a pET-30a(+) vector or a pET-32a(+) vector.
[0023] Furthermore, the host microorganisms corresponding to the recombinant microorganisms described in (d), (e), and (f) are selected from prokaryotes or yeast, etc.; the prokaryotes include bacteria such as Escherichia, Bacillus, Salmonella, Pseudomonas, and Streptomyces. More specifically, the prokaryote is Escherichia coli (E. coli), specifically Escherichia coli BL21(DE3).
[0024] An immobilized protein containing the SpyCatcher immobilization mutant SpyFixer described above.
[0025] Furthermore, the immobilized protein is prepared by immobilizing the SpyCatcher immobilized mutant SpyFixer on a solid support.
[0026] The solid support includes a solid support with epoxy groups or carboxylic acid groups on its surface;
[0027] Furthermore, the solid support includes sensors for protein-protein interactions, agarose resin for protein purification, epoxy resin for protein immobilization, etc.
[0028] In one aspect, the present invention provides a solid support for immobilizing proteins, wherein the solid support, when not modified by the SpyCatcher immobilization mutant SpyFixer peptide, contains an epoxy group or a carboxylic acid group capable of reacting with the amino (NH2) group of the SpyFixer peptide, the SpyFixer peptide being covalently attached to the solid support by reacting with the epoxy group or carboxylic acid group on the support, and the SpyFixer peptide linked to the solid support being capable of forming an isopeptide bond with the SpyTag peptide, wherein the amino acid sequence of the SpyFixer peptide is shown in SEQ ID NO:1.
[0029] As used herein, the carrier is any carrier that can be used to immobilize proteins, as long as it contains a group capable of reacting with amino (NH2) groups. The carrier can be made of a variety of materials, including but not limited to inorganic materials, organic materials, or composites of inorganic and organic materials. In one embodiment, the inorganic materials include, but are not limited to, diatomaceous earth, kaolinite, silica gel, porous glass, activated carbon, calcium carbonate, ceramics, silica, metal oxides, and clay materials. In one embodiment, the organic materials include, but are not limited to, agarose, chitosan, alginate, gelatin, polyacrylic acid, polyacrylate, polymethacrylic acid, polymethyl methacrylate, polystyrene, polyamide, and polyacrylonitrile.
[0030] In one embodiment, the carrier is an epoxy carrier, meaning that epoxy groups are present on the carrier, such as an epoxy resin. As used herein, epoxy resin refers to a resin containing epoxy groups, wherein the epoxy groups may be epoxy groups obtained by modification on the resin.
[0031] As used herein, epoxy resin refers to a polymer containing epoxy groups, which may include, for example, epoxy resins, amino epoxy resins, carboxyl epoxy resins, and mercapto-disulfide epoxy resins. Due to the chemical reactivity of epoxy groups, they can be ring-opened using a variety of compounds containing active hydrogen. Epoxy carriers react with proteins under very mild experimental conditions (e.g., pH 7.0). Epoxy resins include, but are not limited to, Lifetech. TM ECR8285, ECR8204, ECR8209, LX1000EA, LX1000EP, LX103B, EP200, LX1000HFA, HFA001, LX107S, LX1000SW, LX1000SD, C C250L, FP-EC3, EC-EP / M, EC-Ep, ES1, ES103, ES105, ES108 and ES109.
[0032] In one embodiment, the epoxy resin is selected from epoxy agarose resin and epoxy acrylate resin.
[0033] In one embodiment, the epoxy resin is hydrophilic.
[0034] In one embodiment, the epoxy resin is made of polyacrylate, such as polymethyl acrylate, ethyl acrylate, propyl acrylate, butyl acrylate, isobutyl acrylate, tert-butyl acrylate, etc. In one embodiment, the epoxy resin is made of polymethyl acrylate. In one embodiment, the epoxy resin is made of polyethyl acrylate. In one embodiment, the epoxy resin is made of polypropyl acrylate. In one embodiment, the epoxy resin is made of polybutyl acrylate. In one embodiment, the epoxy resin is made of polyisobutyl acrylate. In one embodiment, the epoxy resin is made of polytert-butyl acrylate.
[0035] In one embodiment, the group on the epoxy resin linked to the SpyFixer peptide is an epoxy group.
[0036] In one embodiment, the solid support is selected from: sensors, resins such as agarose resin or epoxy resin.
[0037] In one embodiment, the solid support is selected from: biosensors, such as AR2G sensors and CM5 chip sensors; epoxy agarose resins, such as hydrophilic epoxy agarose resins; and epoxy acrylate resins, such as hydrophobic epoxy acrylate resins.
[0038] The reaction conditions for reacting the SpyFixer peptide with epoxy or carboxylic acid groups on a solid support to covalently attach the SpyFixer peptide to the solid support are known in the art or can be readily determined according to techniques known in the art. For example, the SpyFixer peptide is contacted with the support in a liquid environment, optionally with the groups activated before contact, and / or the support blocked after contact.
[0039] As used herein, a liquid environment refers to a liquid environment suitable for the SpyFixer peptide to covalently attach to the carrier via the reaction of the amino groups on the peptide (e.g., N-terminal and side-chain amino groups, or side-chain amino groups) with the amino-reactive groups, such as a fixation solution (sodium phosphate solution of 250 mM Na2SO4, pH 10.0).
[0040] As used herein, activation refers to treating a group to enable it to react with an amino group on the SpyFixer peptide, for example, using glutaraldehyde as an activator to activate the amino group on the carrier. As used herein, the term "blocking" refers to reacting any remaining groups, such as epoxy groups, that have not reacted with SpyCatcher, with the aim of preventing these groups from reacting with the target protein again during the second immobilization step. Various suitable experimental conditions and reagents for such activation and blocking are known to those skilled in the art.
[0041] In one embodiment, the protein to be immobilized is a fusion protein of a target protein and a SpyTag peptide, preferably the target protein being selected from ligands, antibody-capturing peptides such as the Z domain of protein A, and enzymes. In one embodiment, the Z domain comprises or consists of an amino acid sequence encoded by nucleotides 1-174 of SEQ ID NO:6.
[0042] As used herein, the SpyTag peptide is any peptide known in the art capable of undergoing a Spy reaction. Various techniques and methods for producing fusion proteins are known in the art. In a fusion protein, the SpyTag peptide can be located at any position, such as the N-terminus, C-terminus, or the middle, as long as the resulting fusion protein possesses the desired functional activity. Those skilled in the art can readily detect the functional activity of proteins based on their technical knowledge; this is entirely within the scope of their expertise.
[0043] In one embodiment, the SpyTag peptide described herein comprises, or consists of, the amino acid sequence shown in SEQ ID NO:4 or 5.
[0044] In one embodiment, the SpyTag peptide is located at the N-terminus or C-terminus of the fusion protein, that is, the C-terminus of the SpyTag peptide is directly or indirectly connected to the N-terminus of the target protein, or the N-terminus of the SpyTag peptide is directly or indirectly connected to the C-terminus of the target protein through a linker.
[0045] In one embodiment, the SpyTag peptide and the target protein in the fusion protein of the present invention can be linked by a linker, such as SpyTag-linker-target protein or target protein-linker-SpyTag.
[0046] As used herein, the linker is a peptide or other molecule that connects the SpyTag peptide to the target protein. The connection can be made by any method known in the art for connecting the two parts, provided that the linker portion does not significantly impair the desired functional activity of the protein in the fusion protein and / or does not significantly impair the Spy reaction between the SpyTag peptide and the SpyCatcher peptide. Those skilled in the art can readily determine and select a suitable linker based on their knowledge in the art.
[0047] As used herein, a SpyTag peptide-target protein fusion protein comprises a SpyTag peptide and a target protein, and may also include a peptide linker and an affinity tag. In one embodiment, the peptide linker is located between the SpyTag and the target protein.
[0048] In one embodiment, the linker length is preferably not less than 5 amino acid residues, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 amino acid residues or longer. Any linker known to those skilled in the art can be used in this invention. The linker moiety can be a peptide. Typical amino acid residues used for the linker are glycine, serine, tyrosine, cysteine, lysine, glutamic acid, proline, threonine, and aspartic acid, etc. Examples of such known linker moiety include, but are not limited to, GGGGS (SEQ ID NO: 9), (GGGGS)3 (SEQ ID NO: 10), (PTPPTT)2PTP (SEQ ID NO: 11), and (G n S(G) n Where n = 4, 5, 6 or 7 (SEQ ID NO: 12-15). In one embodiment, the connector is GGGGS (SEQ ID NO: 9) or (GGGGS)3 (SEQ ID NO: 10).
[0049] In this document, the target protein linked to the SpyTag can be any protein that is desired to be immobilized on the vector, including, but not limited to, enzymes, cofactors, chaperone proteins, etc. In one embodiment, the target protein is an enzyme, such as any enzyme known in the art that can be immobilized on the vector described herein, and the enzyme can be from any suitable source, either isolated from a natural source such as bacteria or artificially synthesized, for example, expressed through recombinant technology.
[0050] In one embodiment, the target protein is selected from human growth hormone, the Z domain of Protein A (e.g., the amino acid sequence encoded by nucleotides 1-174 of SEQ ID NO:6), N-acetylglucosamine deacetylase (e.g., the amino acid sequence encoded by nucleotides 88-888 of SEQ ID NO:8), and red fluorescent protein.
[0051] The above-mentioned applications of the SpyCatcher immobilized mutant SpyFixer, encoding genes, SpyFixer-related biomaterials or immobilized proteins in the preparation of SpyCatcher immobilized mutants;
[0052] The above-mentioned SpyCatcher immobilized mutant SpyFixer, encoding genes, SpyFixer-related biological materials or immobilized proteins are used in the SpyFixer-SpyTag reaction to achieve protein interaction detection, protein immunoassay, protein purification and protein immobilization.
[0053] This invention addresses the limitations of existing SpyCatchers, which suffer from low immobilization efficiency and low activity on many carrier surfaces, thus restricting their applications. The invention selects the AR2G fiber optic biosensor, hydrophilic epoxy agarose resin, and hydrophobic epoxy acrylate resin as three types of solid-phase carriers in its examples.
[0054] In one embodiment of the present invention, the SpyCatcher immobilized mutant SpyFixer solves the problem of immobilization on AR2G sensors, epoxy agarose resin, and epoxy acrylate resin, enabling applications in protein-protein interactions, antibody purification, and enzyme immobilization. The method includes the following steps:
[0055] (1) SpyFixer was incubated with an AR2G sensor to obtain a SpyFixer-modified sensor; SpyFixer was incubated with agarose epoxy resin to obtain a SpyFixer-modified epoxy agarose resin; SpyFixer was incubated with epoxy acrylate resin to obtain a SpyFixer-modified epoxy acrylate resin.
[0056] (2) Treat the SpyFixer-modified AR2G sensor with blocking buffer; treat the SpyFixer-modified epoxy agarose resin with blocking buffer; treat the SpyFixer-modified epoxy acrylate resin with blocking buffer.
[0057] (3) Incubate SpyTag with the fusion protein of the target ligand and the SpyFixer modified AR2G sensor; incubate SpyTag with the fusion protein of the target protein and the SpyFixer modified epoxy agarose resin; incubate SpyTag with the fusion protein of the target protein and the SpyFixer modified epoxy acrylate resin.
[0058] (4) The interaction between ligand and analyte was detected using a SpyFixer-modified AR2G sensor; antibodies were purified and immobilized enzymes were prepared using SpyFixer-modified epoxy agarose resin; and target proteins were immobilized using SpyFixer-modified epoxy acrylate resin.
[0059] In one aspect, the present invention provides a method for immobilizing a target protein, comprising: (a) providing a solid support as described herein for immobilizing a protein; (b) providing a fusion protein of the target protein and a SpyTag peptide; (c) contacting the solid support and the fusion protein under conditions that allow the SpyFixer peptide to form heteropeptide bonds with the SpyTag peptide, thereby immobilizing the fusion protein on the solid support through SpyFixer-SpyTag specific interactions; optionally further comprising (d) separating the solid support on which the fusion protein is immobilized.
[0060] The solid support, SpyFixer peptide, SpyTag peptide, target protein, fusion protein, etc., are as described above.
[0061] In one embodiment, step (a) includes: incubating the SpyFixer peptide with an unmodified vector to obtain a SpyFixer peptide-modified vector; and optionally, treating the SpyFixer peptide-modified vector with a blocking buffer. After blocking, the modified vector can be isolated, for example, by centrifugation to remove the blocking buffer. Step (a) can be performed at any suitable temperature and pH. For example, the temperature can be about 20-37°C, such as about 20-35°C, 25-37°C, 25-35°C, 20-30°C, 25-35°C, particularly about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37°C. The pH value can be any suitable pH, such as about 4.0-10.0, like about 5.0-9.0, 6.0-8.0 or 6.0-7.0, especially about 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0.
[0062] The fusion protein of the target protein and the SpyTag peptide in step (b) can be a purified protein, such as a fusion protein purified by techniques known in the art; or it can be a cell lysate containing the fusion protein that has not been further purified, such as a cell lysate expressing the fusion protein.
[0063] Conditions that allow the SpyCatcher peptide to form isopeptide bonds with the SpyTag peptide (resulting in a Spy reaction) are known in the art. As used herein, contact is the physical association of the modified carrier and the protein, for example, by mixing the two substances in solution, or by adding another substance (e.g., a solid support) to a solution containing one substance (e.g., a fusion protein).
[0064] In one aspect, the present invention provides a solid support for immobilizing a protein, comprising a fusion protein of the protein and SpyTag immobilized on the solid support for immobilizing the protein described herein via a SpyFixer-SpyTag specific interaction.
[0065] In one embodiment, the immobilized protein solid support is used for protein interaction detection, protein immunoassay, protein purification, or protein immobilization.
[0066] In one embodiment, the immobilized protein solid support is obtained by the method for immobilizing the target protein described herein.
[0067] In one embodiment, the solid support can be any entity used for capturing and / or determining the proteins of interest described herein, such as sensors like fiber optic biosensors or chip sensors, or chromatography columns. In one embodiment, the solid support is selected from: sensors, resins such as agarose resin or epoxy resin.
[0068] In one embodiment, the solid support is selected from: biosensors, such as AR2G sensors and CM5 chip sensors; epoxy agarose resins, such as hydrophilic epoxy agarose resins; and epoxy acrylate resins, such as hydrophobic epoxy acrylate resins.
[0069] The sensor described in this invention is a commercially available sensor commonly used for detecting protein-protein interactions, such as the AR2G sensor from Sartorius (Germany) and the CM5 chip sensor from Cytiva (USA).
[0070] The epoxy agarose resin described in this invention is a commercially available agarose carrier commonly used for protein purification, such as the Epoxy-activated resin from Xi'an Lanxiao Technology New Materials Co., Ltd. FF, Cytiva Biotechnology's Epoxy-activated Sepharose TM Thermo Fisher Scientific, USA Plus Coupling Resin, etc.
[0071] The epoxy acrylate resin described in this invention is a commercially available epoxy resin commonly used for protein (enzyme) immobilization, such as LX-1000EP from Xi'an Lanxiao New Material Technology Co., Ltd., ECR8204 from Purolite Chemicals (USA), and Rem GmbH (Germany). C, etc.
[0072] The SpyFixer-modified sensor of this invention comprises an AR2G sensor and a SpyFixer, wherein the amino group of the SpyFixer is covalently linked to the carboxyl group on the surface of the AR2G sensor; the SpyFixer-modified agarose resin of this invention comprises an epoxy agarose resin and a SpyFixer, wherein the amino group of the SpyFixer is covalently linked to the epoxy group of the epoxy resin; the SpyFixer-modified acrylate resin of this invention comprises an epoxy acrylate resin and a SpyFixer, wherein the amino group of the SpyFixer is covalently linked to the epoxy group of the epoxy resin. The SpyFixer is a protein capable of reacting with SpyTag or its variants to form isopeptide bonds, and the amino acid sequence of the SpyFixer is shown in SEQ ID NO:1.
[0073] The blocking buffer described in this invention is a commonly used epoxy group blocking buffer in the art, such as Tris, glycine, ethanolamine, bovine serum albumin, etc. In this invention, the term "blocking" refers to the complete reaction of any remaining epoxy groups that have not reacted with SpyFixer, with the aim of preventing these epoxy groups from reacting with the target protein again during the second capture step. The blocking buffer includes, but is not limited to, ethanolamine (pH 8.5), glycine (pH 8.5), and Tris-HCl (pH 7.4).
[0074] The SpyTag fusion protein of this invention comprises SpyTag002 and a target protein, or SpyTag003 and a target protein, and may further comprise a polypeptide linker and an affinity tag. The polypeptide linker is located between the SpyTag and the target protein. The term "affinity tag" refers to an affinity tag added to the N-terminus or C-terminus of the fusion protein to facilitate subsequent purification of the target protein. The fusion protein of SpyTag and the target protein can be a purified fusion protein or an unpurified fusion protein, such as cell lysate. The amino acid sequences of SpyTag002 and SpyTag003 are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively. The SpyTag can be located at the C-terminus or N-terminus of the target protein. The fusion protein can be obtained by recombinant expression in prokaryotic, yeast, or higher eukaryotic cells. Exemplary prokaryotes include bacteria of the genera *Escherichia*, *Bacillus*, *Salmonella*, *Pseudomonas*, and *Streptomyces*. In a preferred embodiment, the recombinant cells are *Escherichia* cells, preferably *Escherichia coli*. In a specific embodiment of the invention, the recombinant cells used are *Escherichia coli* BL21(DE3) strain cells (Novagen).
[0075] The target protein described in this invention can be any protein, such as human growth hormone (hGH(G120R)) (the amino acid sequence of hGH is shown as 37-227aa in GenBank: QKG82153.1), the Z domain amino acid sequence of Protein A is shown as 16-73aa in GenBank: WCK11299.1, the amino acid sequence of N-acetylglucosamine deacetylase (TpDac) is shown as SEQ ID NO:2 in Chinese Patent Application Publication No. CN110951708A, and the amino acid sequence of red fluorescent protein (RFP) is shown as 2-236aa in GenBank: UFQ89828.1. The method for obtaining the cell lysate is selected from commonly used processing methods in the art. Methods for disrupting host cells used in this invention include, but are not limited to, the following: sonication, homogenization, high pressure (e.g., in a Freund's crusher), osmolysis, detergents, lysin, organic solvents, or combinations thereof. The disruption is carried out under a first pH condition (i.e., a weakly alkaline pH, such as pH 7.2-8.5, preferably pH 7.4), thereby disrupting the host cell membrane and releasing the protein supernatant from the disrupted cells while remaining soluble. The purified fusion protein can be obtained through affinity tagging or cSAT purification. In some embodiments, the affinity tag is a common 6×His tag located at the N-terminus or C-terminus of the target protein. The released protein supernatant is purified by protein affinity chromatography. After the recombinant cell membrane is disrupted, the supernatant is collected by centrifugation to remove insoluble precipitates, and then purified by affinity chromatography using the His tag of the fusion protein.
[0076] The washing buffer described in this invention is a commonly used protein washing buffer in the art, such as phosphate buffered saline (PBS), Tris-HCl buffer, etc.
[0077] The Z-domain-binding SpyFixer-modified resin described in this invention can be regenerated and reused multiple times. Its regeneration is achieved by eluting the target antibody with a pH 3.8, 0.5M arginine solution, and washing the resin with a pH 2.0, 6M guanidine hydrochloride solution and a 0.1M NaOH solution.
[0078] In this invention, the Spy reaction refers to the reaction between SpyFixer (SEQ ID NO:1) and SpyTag002 (SEQ ID NO:4) or SpyTag003 (SEQ ID NO:5) to form an isopeptide bond, which links SpyFixer and SpyTag002 or SpyTag003 into a protein.
[0079] The term "cleavage" as used in this invention refers to the process by which the Mtu ΔI-CM intrinates are induced to separate from the precursor protein and release the native N-terminal target protein when the pH changes to 6.2.
[0080] In one aspect, the present invention provides a method for capturing and / or determining a protein of interest, comprising: (a) providing a solid support as described herein for immobilizing a protein; (b) providing a fusion protein of a target protein that specifically interacts with the protein of interest and a SpyTag peptide; (c) contacting the solid support with the fusion protein to immobilize the fusion protein on the solid support via a SpyFixer-SpyTag specific interaction; and (d) contacting the solid support immobilized with the fusion protein with a sample containing the protein of interest to capture and / or determine the protein of interest.
[0081] In one embodiment, the present invention provides a method for capturing and / or determining a protein of interest, comprising:
[0082] This document provides a solid-phase support for immobilized proteins, wherein the immobilized protein is a fusion protein of a target protein and a SpyTag peptide, and wherein the target protein is a protein capable of specifically interacting with a protein of interest.
[0083] The protein is immobilized on a solid support and then contacted with a sample containing the protein of interest to capture and / or determine the protein of interest.
[0084] The present invention has the following advantages and effects compared with the prior art:
[0085] (1) The SpyFixer mutant of this invention is based on SpyDock and obtained by introducing the A77E mutation site. It can be obtained by expression in E. coli and can be produced on a large scale through standard fermentation process at low cost;
[0086] (2) The SpyFixer of the present invention was respectively fixed on the optical fiber biosensor AR2G, hydrophilic epoxy agarose resin and hydrophobic epoxy acrylate resin to obtain SpyFixer modified on different carriers. The preparation process is simple.
[0087] (3) The SpyFixer modified vector of the present invention does not require the addition of additional reagents or enzymes when binding to the target protein labeled by SpyTag, and the reaction is fast and highly selective.
[0088] (4) The method of the present invention can realize the immobilization and application of Spy chemistry on different carriers. The immobilization efficiency and binding activity after immobilization are superior to wild-type SpyCatcher and mutant SpyCatcher003, and the application range is wider.
[0089] (5) After completing the antibody purification step, the SpyFixer modified vector and the protein immobilized on the SpyFixer modified vector can be reused, which has potential industrial application value.
[0090] Unless the context otherwise indicates, the word "or" is intended to include "and".
[0091] As used herein, "optional" or "optionally" means that the event or situation subsequently described occurs or does not occur, including both the occurrence and non-occurrence of said event or situation. For example, an optional step means that the step is present or absent.
[0092] As used herein, the term "about" refers to a range of values that includes a specific value and that a person skilled in the art would reasonably consider similar to that specific value. In some embodiments, the term "about" refers to within a standard error using measurements generally accepted in the art. For example, in some embodiments, "about" refers to + / - 10% or 5% of a specific value.
[0093] As used in this article, when a specification lists specific values or proportions for a feature, it also covers any range of any two of those values or proportions. For example, listing the values 1, 2, 3, and 4 also covers 1-2, 1-3, 1-4, 2-3, 2-4, and 3-4. Attached Figure Description
[0094] Figure 1 is a schematic diagram of the process of modifying the AR2G sensor using the SpyFixer-SpyTag specific immobilization method for protein-protein interaction analysis and antibody purification using modified epoxy agarose resin.
[0095] Figure 2A shows the SDS-PAGE images of SpyFixer, SpyCatcher, SpyCatcher003, and SpyFixer (C49S) expression and purification. Lanes 1-5 contain protein quantification standards containing bovine serum albumin (BSA), with loading concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, and 0.03125 mg / mL, respectively. Lanes 6-8 represent the expression concentrations of SpyFixer. Lanes 9 and 11 show SpyFixer expression supernatant and purified SpyCatcher, respectively; lanes 10 and 12 show SpyCatcher003 expression supernatant and purified SpyCatcher003, respectively; lanes 13-15 show SpyFixer(C49S) expression supernatant, SpyFixer(C49S) expression precipitate and purified SpyFixer(C49S), respectively.
[0096] Figure 2B shows the SDS-PAGE images of hGH(G120R)-SpyTag003 and Z-domain-SpyTag003 expression and purification. Lanes 1-5 contain bovine serum albumin (BSA) protein quantitative standards at concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, and 0.03125 mg / mL, respectively. Lanes 6-10 represent the supernatant of L6KD-Mtu ΔI-CM-hGH(G120R)-SpyTag003 expression, the precipitate of L6KD-Mtu ΔI-CM-hGH(G120R)-SpyTag003 expression, the supernatant after cleavage of L6KD-Mtu ΔI-CM-hGH(G120R)-SpyTag003, and the supernatant after cleavage of L6KD-Mtu ΔI-CM-hGH(G120R)-SpyTag003, respectively. hGH(G120R)-SpyTag003 was precipitated and purified after ΔI-CM-hGH(G120R)-SpyTag003 was cleaved; lanes 11-13 were Z domain-SpyTag003 expression precipitate, Z domain-SpyTag003 expression supernatant, and purified Z domain-SpyTag003, respectively.
[0097] Figure 2C shows the SDS-PAGE images of Z domain-SpyTag002 and SpyTag002-TpDac expression and purification. Lanes 1-6 contain protein quantification standards containing bovine serum albumin (BSA) at concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL, and 0.0156 mg / mL, respectively. Lanes 7-9 contain Z domain-SpyTag002 expression supernatant, Z domain-SpyTag002 expression precipitate, and purified Z domain-SpyTag002, respectively. Lanes 10-12 contain SpyTag002-TpDac expression supernatant, SpyTag002-TpDac expression precipitate, and purified SpyTag002-TpDac, respectively.
[0098] Figure 2D is an SDS-PAGE image of SpyTag002-RFP expression; lanes 1-6 contain protein quantification standards containing bovine serum albumin (BSA), with loading concentrations of 1 mg / mL, 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, and 0.03125 mg / mL, respectively; lanes 7-8 contain the SpyTag002-RFP expression supernatant and SpyTag002-RFP expression precipitate, respectively.
[0099] Figure 3 shows the immobilization performance of SpyFixer, SpyCatcher, and SpyCatcher003 on the AR2G sensor; the raw BLI sensor images for each modification step are as follows: 1. Activation of carboxyl groups with EDC / s-NHS; 2. Coupling of the amino group of SpyFixer, SpyCatcher, or SpyCatcher003 with the activated carboxyl group; 3. Blocking of the remaining activated carboxyl groups with ethanolamine; 4. Baseline; 5. Coupling reaction of the SpyTagged ligand; 6. Dissociation after the reaction. A: Immobilization analysis of SpyFixer in immobilization solutions at pH 4, 5, or 6; B: Immobilization analysis of SpyCatcher in immobilization solutions at pH 4, 5, or 6; C: Immobilization analysis of SpyCatcher003 in immobilization solutions at pH 4, 5, or 6.
[0100] Figure 4 compares the sensing images and binding kinetics data of the SpyFixer-modified sensor and the unmodified SpyFixer sensor; where A: results of SpyFixer / SpyTagged-hGH capturing different concentrations of hGH receptor on the AR2G sensor; B: results of SpyTagged-hGH capturing different concentrations of hGH receptor on the AR2G sensor; C: results of SpyFixer / SpyTagged-Z domain capturing different concentrations of hIgG on the AR2G sensor; D: results of SpyTagged-Z domain capturing different concentrations of hIgG on the AR2G sensor. Each test was repeated three times.
[0101] Figure 5A shows SDS-PAGE images of proteins before and after SpyFixer immobilization on epoxy agarose resin. Lanes 1-4 contain quantitative protein standards containing bovine serum albumin (BSA) at concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, and 0.0625 mg / mL, respectively. Lane 6 contains the SpyFixer flow-through buffer after immobilization, diluted 30 times before loading. Lane 7 contains the supernatant of SpyFixer with 20 mg / mL resin added before immobilization, diluted 200 times before loading. Lanes 8-13 contain the washing buffer after SpyFixer immobilization.
[0102] Figure 5B shows SDS-PAGE images of proteins before and after SpyCatcher immobilization on epoxy agarose resin. Lanes 1-6 contain quantitative protein standards containing bovine serum albumin (BSA), with loading concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL, and 0.0156 mg / mL, respectively. Lane 7 contains the flow-through buffer of SpyCatcher before immobilization, diluted 100 times before loading. Lane 8 contains the flow-through buffer of SpyCatcher after immobilization, diluted 40 times before loading. Lanes 9-13 contain the washing buffer after SpyCatcher immobilization.
[0103] Figure 5C shows the SDS-PAGE images of proteins before and after SpyCatcher003 immobilization on epoxy agarose resin. Lanes 1-4 contain quantitative protein standards containing bovine serum albumin (BSA), with loading concentrations of 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL, and 0.0156 mg / mL, respectively. Lane 5 contains SpyCatcher003 supernatant with 20 mg / mL resin added before immobilization, diluted 30 times before loading. Lane 6 contains the immobilized SpyCatcher003 flow-through solution, diluted 10 times before loading. Lanes 7-12 contain the washing buffer after SpyCatcher003 immobilization.
[0104] Figure 5D shows the SDS-PAGE images of proteins before and after SpyFixer immobilization on epoxy agarose resin. Lanes 1-5: Protein quantitative standards containing bovine serum albumin (BSA), with loading concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL, and 0.0156 mg / mL, respectively. Lane 6: SpyFixer supernatant with 100 mg / mL resin added before immobilization, diluted 600 times before loading. Lane 7: Flow-through buffer of SpyFixer after immobilization, diluted 80 times before loading. Lanes 8-12: Wash buffer after SpyFixer immobilization.
[0105] Figure 6 shows the SDS-PAGE images of Z domain-SpyTag002 before and after purification using SpyFixer resin with modified epoxy agarose resin containing 100 mg / mL resin. Lanes 1-6 contain protein quantitative standards for bovine serum albumin (BSA) at concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL, and 0.0156 mg / mL, respectively. Lane 7 contains the supernatant of Z domain-SpyTag002 with 60 mg / mL resin before purification, diluted 400 times. Lane 8 contains the flow-through buffer of Z domain-SpyTag002 after purification, diluted 2 times. Lanes 9-13 contain the washing buffer after the Z domain-SpyTag002 reaction.
[0106] Figure 7A is an SDS-PAGE image of hIgG bound to and eluted by SpyFixer / Z domain modified resin; in which, lanes 1-5: protein quantitative standards containing bovine serum albumin (BSA), with loading concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, and 0.03125 mg / mL respectively; lane 6: supernatant of hIgG added to the resin at 240 mg / mL before the reaction; lane 7: flow-through buffer after the reaction; lanes 8-12: washing buffer after the reaction; lanes 13-20: elution supernatants from each step; lane 21: total elution supernatant.
[0107] Figure 7B is an SDS-PAGE image of hIgG bound to and eluted by SpyFixer / Z domain modified resin regeneration resin; in which, lanes 1-5: protein quantitative standards containing bovine serum albumin (BSA), with loading concentrations of 0.03125 mg / mL, 0.0625 mg / mL, 0.125 mg / mL, 0.25 mg / mL, and 0.5 mg / mL respectively; lane 6: supernatant of hIgG added to the resin at 240 mg / mL before the reaction; lane 7: flow-through buffer after the reaction; lanes 8-12: washing buffer after the reaction; lanes 13-21: elution supernatant from each step; lane 22: total elution supernatant.
[0108] Figure 7C shows the relative binding and elution efficiencies of hIgG after 20 repeated uses of the SpyFixer / Z domain modified resin.
[0109] Figure 8A shows the SDS-PAGE images of hIgG bound to SpyFixer / Z domain modified resin and eluted from cell lysates; lanes 1-5: protein quantification standards containing bovine serum albumin (BSA), with loading concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, and 0.03125 mg / mL, respectively; lane 6: hIgG before reaction; lane 7: E. coli lysate supernatant; lane 8: flow-through buffer after reaction; lane 9: hIgG added to E. coli lysate supernatant; lanes 10-14: washing buffer after reaction; lanes 15-22: elution supernatants from each step.
[0110] Figure 8B shows a pre-packed column prepared with SpyFixer / Z domain modified resin.
[0111] Figure 8C shows commercial HiTrap. TM SDS-PAGE images of IgG purified from human serum using rProtein A resin and SpyFixer pre-packed columns; lanes 1-6: protein quantification standards containing bovine serum albumin (BSA), with loading concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL, and 0.0156 mg / mL, respectively; lanes 7 and 10: human serum samples before reaction; lane 8: HiTrap TM rProtein AFF bound to the flow-through fluid; Lane 9: HiTrap TM rProtein AFF elution supernatant; Lane 11: SpyFixer pre-packed column binding flow-through fluid; Lane 12: SpyFixer pre-packed column elution supernatant.
[0112] Figure 8D is an SDS-PAGE image of IgG purified from industrial fermentation broth using a SpyFixer pre-packed column; lanes 1-5: protein quantification standards containing bovine serum albumin (BSA), with loading concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, and 0.03125 mg / mL, respectively. Lane 6: fermentation broth before reaction; lane 7: flow-through after reaction; lanes 8 and 9: elution supernatant from the SpyFixer pre-packed column.
[0113] Figure 9 shows the SDS-PAGE images of the supernatant before and after purification of the SpyTag002-TpDac immobilized resin;
[0114] A: SDS-PAGE image of SpyTag002-TpDac directionally bound to SpyFixer modified resin; Lanes 1-5: Protein quantitative standards containing bovine serum albumin (BSA), with loading concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, and 0.03125 mg / mL, respectively; Lane 6: SpyTag002-TpDac supernatant before binding; Lane 7: Flow-through buffer after SpyFixer modified resin binds SpyTag002-TpDac; Lanes 8-12: Wash buffer after reaction;
[0115] B: SDS-PAGE image of SpyTag002-TpDac randomly bound to unmodified epoxy agarose resin; Lane 1: Supernatant after SpyTag002-TpDac binding to unmodified epoxy agarose resin; Lanes 2-6: Wash buffer after reaction; Lane 7: SpyTag002-TpDac supernatant before binding; Lanes 8-12: Protein quantitative standards containing bovine serum albumin (BSA), with loading concentrations of 0.03125 mg / mL, 0.0625 mg / mL, 0.125 mg / mL, 0.25 mg / mL, and 0.5 mg / mL, respectively.
[0116] Figure 10 shows the results of repeated use of SpyTag002-TpDac immobilized with SpyFixer modified resin.
[0117] Figure 11A shows SDS-PAGE images of proteins before and after immobilization with SpyFixer using epoxy acrylate resin. Lanes 1-5 contain quantitative protein standards containing bovine serum albumin (BSA), with loading concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL, and 0.0156 mg / mL, respectively. Lane 6 contains protein supernatant with 20 mg / g resin added before immobilization. Lane 7 contains flow-through buffer after protein immobilization. Lanes 8-10 contain washing buffer after immobilization.
[0118] Figure 11B shows SDS-PAGE images of proteins before and after immobilization with SpyCatcher using epoxy acrylate resin. Lanes 1-5 contain quantitative protein standards containing bovine serum albumin (BSA), with loading concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL, and 0.0156 mg / mL, respectively. Lane 6 contains protein supernatant with 20 mg / g resin added before immobilization. Lane 7 contains flow-through buffer after protein immobilization. Lanes 8-10 contain washing buffer after immobilization.
[0119] Figure 11C shows the SDS-PAGE images of proteins before and after immobilization with SpyCatcher003 using epoxy acrylate resin. Lanes 1-5 contain quantitative protein standards for bovine serum albumin (BSA), with loading concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL, and 0.0156 mg / mL, respectively. Lane 6 contains the protein supernatant with 20 mg / g resin added before immobilization. Lane 7 contains the flow-through buffer after protein immobilization. Lanes 8-10 contain the washing buffer after immobilization.
[0120] Figure 12 is an SDS-PAGE image of SpyTag002-RFP immobilized directly from the supernatant of E. coli cell lysates; A: SpyTag002-RFP immobilized with SpyFixer modified resin; B: SpyTag002-RFP immobilized with SpyCatcher modified resin; C: SpyTag002-RFP immobilized with SpyCatcher003 modified resin. Lanes 1-5: Protein quantitative standards containing bovine serum albumin (BSA), with loading concentrations of 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, and 0.03125 mg / mL, respectively; Lane 6: SpyTag002-RFP cell lysate supernatant before immobilization; Lane 7: Cell lysate flow-through buffer after SpyTag002-RFP immobilization; Lanes 8-10: Wash buffer after immobilization. Detailed Implementation
[0121] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the methods used in the following embodiments are conventional methods, and specific steps can be found in, for example, *Molecular Cloning: A Laboratory Manual* (Sambrook, J., Russell, David W., *Molecular Cloning: A Laboratory Manual*, 3rd edition, 2001, NY, Cold Spring Harbor). The primers and sequencing used were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and Qingke Biotechnology (Beijing) Co., Ltd.
[0122] Example 1: Construction of fusion protein expression vector
[0123] The expression vectors used in the embodiments of this application are the expression vectors of nine different proteins required by the present invention (pET30a-SpyFixer, pET30a-SpyFixer(C49S), pET30a-SpyCatcher, pET32a-SpyCatcher003, pET32a-L6KD-Mtu ΔI-CM-hGH(G120R)-SpyTag003, pET32a-Z domain-SpyTag003, pET32a-Z domain-SpyTag002, pET32a-SpyTag002-TpDac, pET30a-SpyTag002-RFP).
[0124] 1.1 Constructing the expression plasmid for SpyFixer
[0125] The pET30a-SpyFixer expression plasmid constructed in this embodiment of the invention is used to express the SpyFixer protein. Homologous recombination, a method commonly used in molecular cloning, was employed to construct the SpyDock mutant. Site-directed mutagenesis (A77E) was performed using the pET30a-SpyDock plasmid as a template to obtain a plasmid containing the gene encoding the SpyDock (A77E) mutant. SpyDock (A77E) was designated as SpyFixer, hence the pET30a-SpyFixer expression plasmid. This plasmid was transformed into the *E. coli* expression strain BL21(DE3) (Novagen) for protein expression and subsequent experiments. The amino acid sequence of SpyDock is shown as 13-125 amino acids in GenBank: QCB19987.1; the amino acid sequence of SpyFixer is shown in SEQ ID NO:1, and its nucleotide sequence is shown in SEQ ID NO:2.
[0126] Among them, pET30a-SpyDock is disclosed in the literature "Yang X,Chen B,Lao Z,et al.A Spy Chemistry-Based Method for Purification of Proteins with Authentic N-Termini(J).Catalysts(2073-4344),2024,14(9).DOI:10.3390 / catal14090651."
[0127] 1.2 Constructing the expression plasmid for SpyFixer (C49S)
[0128] In this embodiment of the invention, the constructed pET30a-SpyFixer(C49S) expression plasmid is used to express the SpyFixer(C49S) protein (i.e., the cysteine C residue at the 49th amino acid residue of SpyFixer is replaced by serine S). Following the method in step 1.1, site-directed mutagenesis (C49S) was performed using the pET30a-SpyFixer expression plasmid as a template to obtain a plasmid containing the gene encoding the SpyFixer(C49S) mutant gene, namely the pET30a-SpyFixer(C49S) expression plasmid. This plasmid was transformed into the *E. coli* expression strain BL21(DE3) for protein expression and subsequent experiments. The codon for amino acid S in C49S is AGC.
[0129] 1.3 Constructing the expression plasmid for SpyCatcher
[0130] The pET30a-SpyCatcher expression plasmid constructed in this embodiment of the invention is used to express the SpyCatcher protein. Using homologous recombination, a method commonly used in molecular cloning, the SpyCatcher gene sequence was amplified using the pET30a(+)-PTlinker-SpyCatcher-6×His plasmid as a template. This sequence was then ligated between the NdeⅠ restriction site (CATATG) and the Xho I restriction site (CTCGAG) of the pET-30a(+)(Novagen) plasmid to obtain the pET30a-SpyCatcher expression plasmid. This plasmid was transformed into the *E. coli* expression strain BL21(DE3) for protein expression and subsequent experiments. The amino acid sequence of SpyCatcher is shown as 27-139 amino acids in GenBank: AFD50637.1.
[0131] Among them, pET30a(+)-PTlinker-SpyCatcher-6×His is disclosed in the literature "Lin Z,Lin Q,Li J,et al.Spy chemistry-enabled protein directional immobilization and protein purification(J).Biotechnology and Bioengineering(2923–2932),2020,117.DOI:10.1002 / bit.27460."
[0132] 1.4 Constructing the expression plasmid for SpyCatcher003
[0133] The pET32a-SpyCatcher003 expression plasmid constructed in this embodiment of the invention is used to express the SpyCatcher003 protein. Using homologous recombination, a method commonly used in molecular cloning, the nucleotide sequence of SpyCatcher003 was ligated between the NdeI and XhoI restriction sites of the plasmid pET-L6KD-PT linker-Mtu ΔI-CM-hGH to obtain the pET32a-SpyCatcher003 expression plasmid. This plasmid was transformed into the *E. coli* expression strain BL21(DE3) for protein expression and subsequent experiments. The amino acid sequence of SpyCatcher003 is shown as 27-139 aa in GenBank: QGX07219.1, and its nucleotide sequence is shown in SEQ ID NO:3.
[0134] 1.5 Construction of the expression plasmid hGH(G120R)-SpyTag003
[0135] In this embodiment of the invention, the pET32a-L6KD-Mtu ΔI-CM-hGH(G120R)-SpyTag003 expression plasmid was constructed to express the hGH(G120R)-SpyTag003 protein. Using homologous recombination, a method commonly used in molecular cloning, hGH was mutated at a specific point (G120R) using the pET-L6KD-PT linker-Mtu ΔI-CM-hGH plasmid as a template. Then, the 3' end of the mutant hGH(G120R) was linked to SpyTag003 via a GS linker peptide (GGCGGTGGCGGCAGCGGAGGAGGGGGAAGCGGTGGGGGAGGAAGC) to obtain the pET32a-L6KD-Mtu ΔI-CM-hGH(G120R)-SpyTag003 expression plasmid. The plasmid was transformed into E. coli expression strain BL21(DE3) for protein expression and subsequent experiments. The codon for amino acid R in G120R is CGT; the amino acid sequence of hGH is shown as 37-227aa in GenBank: QKG82153.1; the amino acid sequence of SpyTag003 is shown in SEQ ID NO:5, and its nucleotide sequence is shown as 190-237bp in SEQ ID NO:6.
[0136] Among them, pET-L6KD-PT linker-Mtu ΔI-CM-hGH is disclosed in the literature "Lin Z, Jing Y, Huang Y, et al. A cleavable self-aggregating tag scheme for the expression and purification of disulfide bonded proteins and peptides(J). Chemical Engineering Science(118052),2022,262.DOI:10.1016 / j.ces.2022.118052."
[0137] 1.6 Constructing the expression plasmid Z domain-SpyTag003
[0138] The pET32a-Z domain-SpyTag003 expression plasmid constructed in this embodiment of the invention is used to express the Z domain-SpyTag003 protein. Using homologous recombination, a method commonly used in molecular cloning, the nucleotide sequence of Z domain-SpyTag003 was ligated between the NdeI and XhoI restriction sites of the plasmid pET-L6KD-PT linker-Mtu ΔI-CM-hGH to obtain the pET32a-Z domain-SpyTag003 expression plasmid. This plasmid was transformed into the *E. coli* expression strain BL21(DE3) for protein expression and subsequent experiments. The amino acid sequence of the Z domain is shown as 16-73aa in GenBank: WCK11299.1; the nucleotide sequence of the Z domain-SpyTag003 is shown in SEQ ID NO:6 (1-174bp: Z domain; 175-189bp: GS linker peptide; 190-237bp: SpyTag003).
[0139] 1.7 Constructing the expression plasmid Z domain-SpyTag002
[0140] The pET32a-Z domain-SpyTag002 expression plasmid constructed in this embodiment of the invention is used to express the Z domain-SpyTag002 protein. Using homologous recombination, a method commonly used in molecular cloning, the nucleotide sequence of Z domain-SpyTag002 was ligated between the NdeI and XhoI restriction sites of the plasmid pET-L6KD-PT linker-Mtu ΔI-CM-hGH to obtain the pET32a-Z domain-SpyTag002 expression plasmid. This plasmid was transformed into the *E. coli* expression strain BL21(DE3) for protein expression and subsequent experiments. The amino acid sequence of SpyTag002 is shown in SEQ ID NO:4; the nucleotide sequence of Z domain-SpyTag002 is shown in SEQ ID NO:7 (1-174bp: Z domain; 175-189bp: GS linker peptide; 190-231bp: SpyTag002).
[0141] 1.8 Construction of the expression plasmid SpyTag002-TpDac
[0142] In this embodiment of the invention, the pET32a-SpyTag002-TpDac expression plasmid was constructed for expressing the SpyTag002-TpDac protein. Using homologous recombination, a method commonly used in molecular cloning, the nucleotide sequence of SpyTag002-TpDac was ligated between the NdeI and XhoI restriction sites of the plasmid pET-L6KD-PT linker-Mtu ΔI-CM-hGH to obtain the pET32a-SpyTag002-TpDac expression plasmid. This plasmid was transformed into the *E. coli* expression strain BL21(DE3) for protein expression and subsequent experiments. The amino acid sequence of TpDac is shown in SEQ ID NO:2 of Chinese Patent Application Publication No. CN110951708A; the nucleotide sequence of SpyTag002-TpDac is shown in SEQ ID NO:8 (1-42bp: SpyTag002; 43-87bp: GS linker peptide; 88-888bp: TpDac).
[0143] 1.9 Constructing the expression plasmid SpyTag002-RFP
[0144] The pET30a-SpyTag002-RFP expression plasmid constructed in this embodiment of the invention is used to express the SpyTag002-RFP protein. Using homologous recombination, a method commonly used in molecular cloning, the pET30a(+)-SpyTag-GSlinker-RFP-6×His plasmid was used as a template, and the SpyTag gene sequence was replaced with that of SpyTag002 to obtain the pET30a-SpyTag002-RFP expression plasmid. This plasmid was transformed into the *E. coli* expression strain BL21(DE3) for protein expression and subsequent experiments. The amino acid sequence of RFP is shown as 2-236 bp in GenBank: UFQ89828.1; the gene sequence of SpyTag002 is shown as 190-231 bp in SEQ ID NO:7.
[0145] Among them, pET30a(+)-SpyTag-GSlinker-RFP-6×His is disclosed in the literature "Lin Z,Lin Q,Li J,et al.Spy chemistry-enabled protein directional immobilization and protein purification(J).Biotechnology and Bioengineering(2923–2932),2020,117.DOI:10.1002 / bit.27460."
[0146] Example 2: Expression and purification of fusion protein
[0147] 2.1 Expression of fusion protein
[0148] The eight Escherichia coli BL21(DE3) strains obtained in Example 1 (containing pET30a-SpyFixer, pET30a-SpyFixer(C49S), pET30a-SpyCatcher, pET32a-SpyCatcher003, pET32a-L6KD-Mtu ΔI-CM-hGH(G120R)-SpyTag003, pET32a-Z domain-SpyTag003, pET32a-Z domain-SpyTag002, pET32a-SpyTag002-TpDac, and pET30a-SpyTag002-RFP, respectively) were inoculated into LB liquid medium containing 50 μg / mL kanamycin or 100 μg / mL ampicillin and cultured overnight at 37°C and 220 rpm until saturation. The resulting seed culture was transferred to fresh LB medium at a ratio of 1:50 (for strains containing the pET30a vector, kanamycin was added to a final concentration of 50 μg / mL; for strains containing the pET32a vector, ampicillin was added to a final concentration of 100 μg / mL), and cultured at 37°C and 220 rpm until the logarithmic growth phase (OD50). 600 =0.4-0.6). Bacterial cultures containing the expression plasmids pET30a-SpyFixer, pET30a-SpyFixer(C49S), pET30a-SpyCatcher, and pET32a-SpyCatcher003 were induced to express with IPTG at a final concentration of 0.42 mM for 4 hours at 30°C and 220 rpm. Bacterial cultures containing the expression plasmids pET32a-L6KD-Mtu ΔI-CM-hGH(G120R)-SpyTag003, pET32a-Z domain-SpyTag003, pET32a-Z domain-SpyTag002, pET32a-SpyTag002-TpDac, and pET30a-SpyTag002-RFP were incubated at 18°C for 30 min, and then IPTG at a final concentration of 0.2 mM was added. Expression was induced to express with IPTG at 18°C and 220 rpm for 24 hours. OD values of bacterial suspensions were measured separately. 600 Centrifuge at 4℃ and 4,000 rpm for 15 minutes, discard the supernatant, and collect the bacterial cells.
[0149] 2.2 SDS-PAGE Detection and Quantification
[0150] The bacterial cells obtained in step 2.1 were harvested and resuspended in PBS buffer (0.1M, pH 7.0) to a concentration of 20 OD / mL. Cells were disrupted by sonication on ice (disruption conditions: 200W power, 3-sec sonication time, 3-sec interval, 99 sonications). After sonication, the supernatant and precipitate were separated by centrifugation at 12,000 rpm for 20 minutes at 4°C. The supernatant and precipitate were diluted and boiled in 6× Protein Loading Buffer for SDS-PAGE analysis. Quantification was performed using ImageJ software (National Institutes of Health, USA) with gradient concentrations of BSA (31.25 μg / mL, 62.5 μg / mL, 125 μg / mL, 250 μg / mL, 500 μg / mL) as quantitative standards.
[0151] 2.3 Purification and dialysis of fusion proteins
[0152] Bacterial cells containing pET30a-SpyFixer, pET30a-SpyCatcher, pET32a-SpyCatcher003, pET32a-Z domain-SpyTag003, pET32a-Z domain-SpyTag002, and pET32a-SpyTag002-TpDac were resuspended in Binding Buffer (20 mM sodium phosphate, 0.5 M NaCl, 30 mM imizadole) to 20 OD / mL, and sonicated according to step 2.2, with the supernatant collected. The supernatant was filtered through a 0.22 μm filter and purified by nickel column affinity chromatography. Samples before and after purification, as well as flow-through samples, were collected, and the purification effect was analyzed by SDS-PAGE.
[0153] Bacterial cells containing pET32a-L6KD-Mtu ΔI-CM-hGH(G120R)-SpyTag003 were resuspended to 20 OD / mL using lysis buffer (2.4 g Tris, 29.22 g NaCl, and 0.37 g EDTA·Na2 dissolved in 800 mL of water, adjusted to pH 8.5, and then diluted to 1 L with water). The cells were then sonicated and the precipitate collected according to step 2.2. The precipitate was washed twice with an equal volume of lysis buffer and then fully resuspended in an equal volume of cleavage buffer (PBS supplemented with 40 mM Bis-Tris, pH 6.2, and 2 mM EDTA·Na2). The precipitate was incubated at 25 °C for 24 h to allow for complete self-cleavage of the peptides. Afterward, the cells were centrifuged at 15,000 g for 20 min at 4 °C, and the precipitate was resuspended in an equal volume of lysis buffer. The supernatant and precipitate were then analyzed by SDS-PAGE along with the supernatant and precipitate before cleavage.
[0154] The purified protein supernatant was dialyzed using PBS buffer (0.1 M, pH 7.0). The SDS-PAGE analysis results are shown in Figures 2A-2D. The results indicate that the target protein showed clear bands at the corresponding positions, indicating successful expression.
[0155] Example 3: Fabrication of SpyFixer-modified AR2G sensor
[0156] 3.1 Fabrication of AR2G sensors modified with SpyFixer, SpyCatcher, and SpyCatcher003
[0157] use The following steps were performed on the RED96e (ForteBio) intermolecular interaction detection system after program setup. The amino-coupled biosensor (AR2G) (Fortebio) was treated as follows: First, the sensor was equilibrated in deionized water for 10 minutes, then activated with 20 mM EDC and 10 mM s-NHS. 40 μg / mL SpyFixer, SpyCatcher, or SpyCatcher003 was dissolved in 10 mM acetate-sodium acetate buffer at pH 4, 5, and 6, respectively, and then co-incubated with the activated sensor for 10 minutes. Unbound sites were blocked by incubation with 1 M ethanolamine (pH 8.5) for 5 minutes, followed by incubation in Running Buffer (10 mM PBS, 0.02% Tween 20, 0.05% BSA, pH 7.4) for 5 minutes to wash away excess reagents from the conjugation process. The biosensor was co-incubated with SpyTag-labeled ligand proteins diluted to 2.5 μM with Running Buffer for 5–10 minutes. The immobilization results at each step were monitored in real-time by controlling the thickness of the biofilm layer on the biosensor during the experiment. Figure 1 illustrates the process of modifying the AR2G sensor using the SpyFixer-SpyTag specific immobilization method for protein-protein interaction analysis.
[0158] Figure 3 shows the immobilization results of SpyFixer, SpyCatcher, and SpyCatcher003 on the sensor. Real-time monitoring of the sensor signal response graph shows that SpyCatcher and SpyCatcher003 showed no significant response signal when further binding to the SpyTag fusion protein after immobilization, indicating low retention of Spy chemical binding activity after immobilization. In contrast, SpyFixer produced observable signal response values in pH ranges of 4, 5, and 6 after blocking, indicating that SpyFixer has lower structural flexibility and is less prone to conformational changes compared to SpyCatcher and SpyCatcher003, making it more resistant to immobilization effects. The significant signal response when further binding to the SpyTag fusion protein indicates that SpyFixer better preserved its binding activity after sensor immobilization.
[0159] 3.2 Interaction Detection Based on SpyFixer Modified Sensor
[0160] The SpyFixer-modified AR2G sensor was obtained using step 3.1. After equilibration in deionized water, the AR2G biosensor was activated using EDC / s-NHS. The probe was then immersed in an acetate-sodium acetate solution (10 mM, pH 5) containing dissolved SpyFixer. The SpyFixer in the solution bound to the biosensor surface via an amino coupling reaction. Unbound sites on the sensor were then blocked with ethanolamine (1 M, pH 8.5). The SpyFixer-modified sensor was then immersed in Running Buffer (10 mM PBS, 0.02% Tween 20, 0.05% BSA) to stabilize the baseline.
[0161] The detection of hGH(G120R)-hGH receptor interaction using a SpyFixer-modified sensor involved immersing the biosensor in a sample containing 2.5 μM hGH(G120R)-SpyTag003. The bound sensor was then immersed in running buffer for dissociation, followed by a second immersion in running buffer (10 mM PBS, 0.02% Tween 20, 0.05% BSA) to stabilize the baseline. The hGH(G120R)-SpyTag003-bound sensor was immersed in solutions of different concentrations (200 nM, 20 nM, 2 nM, 0.2 nM, 0 nM) containing hGH receptor (Abcam). Finally, the sensor bound to the test sample was immersed in running buffer for dissociation. The kinetic constants of the hGH(G120R)-hGH receptor were calculated by real-time monitoring of the biofilm thickness of the biosensor during the experiment.
[0162] The detection of Z-domain-hIgG interaction using a SpyFixer-modified sensor involved immersing the biosensor in a sample containing 2.5 μM Z-domain-SpyTag003, followed by dissociation in a running buffer, and then immersion in the running buffer again to stabilize the baseline. The Z-domain-SpyTag003-bound sensor was immersed in solutions of different concentrations (120 nM, 60 nM, 30 nM, 15 nM, 7.5 nM, and 0 nM) containing hIgG (Sigma-Aldrich) samples. Finally, the sensor bound to the test sample was immersed in the running buffer for dissociation. The kinetic constant of Z-domain-hIgG was calculated by real-time monitoring of the biofilm thickness of the biosensor during the experiment.
[0163] To compare with the unmodified SpyFixer sensor, hGH(G120R)-SpyTag003 or Z-domain-SpyTag003 was covalently linked to the carboxylic acid groups on the AR2G sensor surface. After equilibration in deionized water, the AR2G biosensor was activated using EDC / s-NHS. For the detection of hGH(G120R)-hGH receptor interaction, the probe was immersed in an acetate-sodium acetate solution (10 mM, pH 6) containing 40 μg / mL hGH(G120R)-SpyTag003. The hGH(G120R)-SpyTag003 in solution bound to the biosensor surface via an amino coupling reaction, and then unbound sites on the sensor were blocked with ethanolamine (1 M, pH 8.5). After curing hGH(G120R)-SpyTag003, the sensor was immersed in Running Buffer to stabilize the baseline. Then, the biosensor was immersed in solutions of different concentrations (200 nM, 20 nM, 2 nM, 0.2 nM, 0 nM) containing hGH receptor samples. Finally, the sensor with the bound sample was immersed in Running Buffer for dissociation. The kinetic constant of hGH(G120R)-hGH receptor was calculated by real-time monitoring of the biofilm thickness of the biosensor during the experiment. For the detection of the interaction between the Z domain from Protein A and its binding protein hIgG, the probe was immersed in an acetate-sodium acetate solution (10 mM, pH 6) containing 40 μg / mL Z domain-SpyTag003. The Z domain-SpyTag003 in the solution bound to the biosensor surface via an amino coupling reaction. Then, unbound sites on the sensor were blocked with ethanolamine at pH 8.5. After the Z-domain-SpyTag003 was cured, the sensor was immersed in Running Buffer (10mM PBS, 0.02% Tween 20, 0.05% BSA) to stabilize the baseline. Then, the biosensor was immersed in solutions containing different concentrations of hIgG samples (120nM, 60nM, 30nM, 15nM, 7.5nM, 0nM). Finally, the sensor bound to the test sample was immersed in Running Buffer for dissociation. The kinetic constant of Z-domain-hIgG was calculated by real-time monitoring of the biofilm thickness of the biosensor during the experiment.
[0164] Using ForteBio Data Analysis 11 to fit the sensor spectrum, the dynamic parameters of the interaction were calculated, including the binding rate constant (k). on ), dissociation rate constant (k off) and equilibrium dissociation constant (K D The values are shown in Figure 4, and the comparison between the sensor images and binding kinetic data is shown in Table 1. The average affinity constant (K0) of the hGH(G120R)-hGH receptor interaction was obtained from three independent experiments using the SpyFixer-based sensor method. D The mean K is 6.0 nM, with a standard deviation of 1.5 nM. The average K obtained by the traditional EDC / s-NHS coupling method... D The value was 9.4 nM, with a standard deviation of 3.0 nM. Although the Kd values for both SpyFixer-based directed and randomized immobilization methods were similar to previously obtained values, the kinetic data obtained using the SpyFixer-based detection method showed a relatively low coefficient of variation (CV) range, between 4.3% and 25.0%, compared to 31.7% to 61.7% obtained using the randomized immobilization method. The standard deviation was twice as low as that of conventional chemical coupling methods. The mean affinity constant (Kd) for Z domain-hIgG interaction was obtained from three independent experiments using the SpyFixer-based sensor method. D The mean K is 11.5 nM, and the standard deviation is 1.6 nM. The average K obtained by the traditional EDC / s-NHS coupling method... D The value was 23.8 nM, with a standard deviation of 8.7 nM, indicating that the directionally fixed Z domain exhibited a higher affinity for hIgG. Similarly, kinetic data obtained using the SpyFixer-based fixation method showed relatively low coefficients of variation (CVs), ranging from 7.1% to 20.4%, while those obtained using the random fixation method ranged from 11.1% to 45.5%. These results demonstrate that the SpyFixer-based detection method offers better repeatability and reliability compared to conventional methods.
[0165] Table 1. Interactions between SpyFixer modified and unmodified sensors.
[0166] Example 4: Preparation of Epoxy Agarose Resin Modified with SpyFixer, SpyCatcher, and SpyCatcher003
[0167] This invention first obtains SpyFixer-modified epoxide agarose resin, and then immobilizes the SpyTag fusion protein in one step using Spy chemistry. Figure 1 shows a schematic diagram of the antibody purification process based on the SpyFixer-SpyTag specific immobilization method to modify epoxide agarose resin.
[0168] 4.1 Preparation of SpyFixer-modified epoxy agarose resin
[0169] Epoxy agarose resin FF (Xi'an Lanxiao New Material Technology Co., Ltd.). The resin requires pretreatment before use. The specific procedure is as follows: Measure a certain amount of resin and remove the preservative solution; wash successively with 15 times the resin volume of ddH2O and 5 times the resin volume of fixative (250mM Na2SO4 sodium phosphate solution, pH 10.0), then remove and set aside for use.
[0170] After purification and dialyzing with a fixative solution (250 mM Na₂SO₄ sodium phosphate solution, pH 10.0), SpyFixer was added to a final concentration of 1 mM TCEP (trichloroethyl phosphate) and incubated at 25°C for 30 min to prevent the formation of disulfide bonds from cysteine residues. 250 μL of the pretreated resin was washed five times with 500 μL of fixative solution, and then 5 mg or 25 mg of TCEP-treated protein solution was added. The mixture was fixed at 25°C and 14 rpm for 12 h. Subsequently, the resin was washed five times with the fixative solution to remove unreacted protein, yielding SpyFixer-modified epoxide agarose resin (hereinafter referred to as SpyFixer). FF).
[0171] Following the same method, SpyCatcher-modified epoxy agarose resin (hereinafter referred to as...) was obtained. FF) and SpyCatcher003 modified epoxy agarose resin (hereinafter referred to as FF) FF).
[0172] The immobilization efficiency of SpyFixer, SpyCatcher, and SpyCatcher003 is calculated using the following formula:
[0173] The SDS-PAGE analysis results are shown in Figures 5A-5D. Based on the protein quantification standards, the target bands were analyzed using ImageJ gel quantification software, and the immobilization efficiencies of SpyFixer, SpyCatcher, and SpyCatcher003 were calculated (Table 2). As shown in the table, SpyFixer achieved the highest immobilization efficiency (99.5 ± 0.2%) when 20 mg / mL of resin was added; the immobilization efficiencies of SpyCatcher and SpyCatcher003 were lower than SpyFixer, at 34.7 ± 6.6% and 15.2 ± 0.7%, respectively. Selecting SpyFixer, which offers fast and high immobilization efficiency, and further increasing the protein concentration to 100 mg / mL, the immobilization efficiency reached 92.3 ± 0.2%. Therefore, the optimal SpyFixer concentration for antibody purification in this invention is determined to be 100 mg / mL of resin.
[0174] Table 2 Immobilization results
[0175] The obtained immobilization FF, FF and FF was added with ethanolamine (1M, pH 8.0) and reacted at 37°C and 100 rpm for 12 h. After blocking, the blocking solution was separated by centrifugation at 1,200 rpm at 4°C. The solution was washed three times alternately with 0.1M acetate buffer (pH 4.0) containing 0.5M NaCl and Tris-HCl buffer (pH 8.0) containing 0.5M NaCl. 20% ethanol was added and the solution was stored at 4°C.
[0176] 4.2 Preparation of SpyFixer / Z domain antibody purification resin based on SpyFixer-modified epoxide agarose resin
[0177] Take the SpyFixer immobilized resin (100 mg / mL) added in step 4.1, wash it 5 times with PBS (0.1 M, pH 7.0), add 15 mg of Z domain-SpyTag002 that has been dialyzed in 0.1 M PBS, and react in a micromixer at 25 °C and 14 rpm for 2 h. Then, centrifuge at 1,200 rpm at 4 °C to separate the first binding flow-through. Wash the resin 5 times with PBS (0.1 M, pH 7.0) to prepare the SpyFixer / Z domain modified resin, add 20% ethanol and store at 4 °C.
[0178] The efficiency of Z domain-SpyTag002 binding is calculated using the following formula:
[0179] The SDS-PAGE analysis results are shown in Figure 6. Based on the protein quantification standards, the target band was analyzed using ImageJ gel quantification software, and the immobilization efficiency of Z domain-SpyTag002 was calculated (Table 3). As shown in the table, with fusion protein bound to 60 mg / mL resin, the binding efficiency of the SpyFixer-modified resin reached 93.6 ± 0.5%.
[0180] Table 3 Results of Z domain-SpyTag002 binding to resin
[0181] The resin bound to Z domain-SpyTag002 was washed five times with PBS (0.1M, pH 7.0). hIgG was added at a molar ratio of Z:hIgG = 4:1. The mixture was micromixed at 25°C and 14 rpm for 2 hours, followed by centrifugation at 4°C and 1,200 rpm to separate the second binding flow-through. The resin was washed five times with PBS (0.1M, pH 7.0) buffer. The hIgG bound to the resin was eluted with 1.5 times the resin volume of elution buffer, repeated eight times.
[0182] hIgG binding efficiency and elution efficiency are calculated using the following formula:
[0183] The SDS-PAGE analysis results are shown in Figure 7A. Following the protein quantification standards, the target band was analyzed using ImageJ gel quantification software to calculate the binding efficiency and elution efficiency of hIgG (Table 4). As shown in the table, with 240 mg / mL hIgG added to the resin, the binding efficiency of the SpyFixer-modified resin (Z domain-SpyTag002) reached 94.0 ± 2.3%, and the elution efficiency was 79.5 ± 2.3%.
[0184] Table 4 Results of hIgG binding and elution from resin
[0185] The eluted resin was washed three times with guanidine hydrochloride (6M, pH 2.0) and once with PBS (0.1M, pH 7.0); then washed three times with 0.1M NaOH and once with PBS (0.1M, pH 7.0). The regenerated resin was then stored at 4°C with 20% ethanol. Before reuse, the resin was centrifuged at 1,200 rpm at 4°C. hIgG binding and elution were performed according to the above method. This process was repeated 20 times, and the binding and elution efficiencies were calculated using the formula.
[0186] The relative binding efficiency of hIgG is calculated using the following formula:
[0187] The SDS-PAGE analysis results are shown in Figures 7B-7C. Using the protein quantification standards, the target band was analyzed for optical density using ImageJ gel quantification software to calculate the relative binding efficiency and elution efficiency of hIgG. As shown in the figures, after 19 regeneration cycles and 20 uses of the SpyFixer-modified resin, the binding efficiency and elution efficiency remained largely unchanged from the initial values.
[0188] 4.3 Antibody purification based on SpyFixer-modified epoxy agarose resin
[0189] The SpyFixer / Z domain-modified resin from step 4.2 was used to test the purification performance of antibodies directly purified from cell lysates. hIgG was added to the supernatant of *E. coli* lysates containing the pET32a empty vector plasmid to prepare a lysate mixture containing hIgG and background proteins. The mixture was incubated with the SpyFixer / Z domain-modified resin at 25°C for 2 hours. The resulting flow-through and SpyFixer / Z domain-modified resin were then separated by centrifugation. The SDS-PAGE analysis results are shown in Figure 8A. Using ImageJ gel quantification software, the optical density of the target band was analyzed according to protein quantification standards, and the binding efficiency, elution efficiency, and purity of hIgG were calculated (Table 5). SpyFixer / Z domain modified resin can bind the vast majority of hIgG in the mixture, with an elution efficiency of 79.7±4.7% and a purity of 95.8±0.5%, demonstrating that even in the presence of background proteins, SpyFixer / Z domain modified resin can bind antibodies well, and elution with arginine solution has good elution efficiency.
[0190] SpyFixer / Z domain modified resin was packed into an empty chromatography column, connected to an AKTA system, for the purification of IgG (Solepro) from human serum. As shown in Figures 8B-8C and Table 5, even in the presence of background proteins such as human serum albumin, the pre-packed column successfully captured IgG from human serum with a binding efficiency of 96.5±0.4% and an elution efficiency of 86.7±9.1%, achieving a purity of 95.3±1.5%. This is higher in binding efficiency and purity than the commercially available Protein A column (Cytiva), although the elution efficiency is slightly lower (binding efficiency 91.4±4.2%, elution efficiency 92.2±6.7%, purity 87.7±4.7%). As shown in Figure 8D and Table 5, the pre-packed column was also able to successfully capture IgG from complex industrial fermentation broth (CHO cell fermentation broth for the production of recombinant human IgG4 provided by Guangdong Dongyangguang Biological Reagent Co., Ltd.), with a binding efficiency of 94.9±1.3%, an arginine elution efficiency of 84.0±2.5%, and a purity of 96.0±0.7%.
[0191] Table 5. Antibody purification results
[0192] 4.4 Enzyme Immobilization Based on SpyFixer-Modified Epoxy Agarose Resin
[0193] Take the resin immobilized with 20 mg / mL SpyFixer resin from step 4.1, wash it 5 times with PBS (0.1 M, pH 7.0) solution, add 3 mg of SpyTag002-TpDac that has been dialyzed in PBS (0.1 M, pH 7.0) solution, react in a micromixer at 25 °C and 14 rpm for 2 h, then centrifuge at 4 °C and 1,200 rpm to separate the binding flow-through to obtain the directionally immobilized TpDac enzyme (hereinafter referred to as SFTD for simplicity). Wash it 5 times with 0.1 M PBS solution, add 20% ethanol and store at 4 °C.
[0194] Simultaneously, an equal amount of SpyTag002-TpDac was added to unmodified epoxy agarose epoxy resin for binding, resulting in randomly immobilized TpDac enzymes (hereinafter referred to as STTD for simplicity).
[0195] The SpyTag002-TpDac binding efficiency is calculated using the following formula:
[0196] The SDS-PAGE analysis results are shown in Figure 9. Based on protein quantification standards, the target band was analyzed using ImageJ gel quantification software, and the binding efficiency of SpyTag002-TpDac was calculated (Table 6). As shown in the table, with 12 mg / mL of SpyTag002-TpDac added to the resin, the binding efficiency of the SpyFixer-modified resin reached 90.1 ± 0.4%, while the binding efficiency of the unmodified resin was 54.9 ± 4.4%. Through Spy chemically mediated directional immobilization, the enzyme immobilization capacity was increased by approximately 1.6 times, thus preparing SpyTag002-TpDac directional immobilized enzyme.
[0197] Table 6 Results of Immobilized Enzyme Preparation
[0198] 4.5 Activity detection of immobilized and free SpyTag002-TpDac and study on the reusability efficiency of immobilized enzymes
[0199] The principle of TpDac enzyme activity assay: N-acetylglucosamine deacetylase (TpDac) catalyzes the deacetylation of N-acetylglucosamine (GlcNAc) to generate ND-glucosamine (GlcN). The intermediate product binds to o-phthalaldehyde (OPA), exhibiting light absorption at 330 nm. Standard curves were established using different concentrations of GlcN, with different concentrations of GlcNAc used as background absorbance values. Ultrapure water was used as a blank control for enzyme activity assay. An activity unit is defined as the amount of enzyme that can convert 1 μmol of substrate GlcNAc into 1 μmol of product GlcN in 1 hour under PBS buffer conditions at 40℃ and pH 7.4. One unit of enzyme activity is defined as 1 U = 1 μmol / h.
[0200] Enzyme activity assay of immobilized enzymes: The immobilized enzymes from SpyFixer modified resin and unmodified epoxide agarose resin in step 4.4 were washed five times with PBS buffer at pH 7.4. 200 μL of GlcNAc substrate was added, and the reaction was carried out at 40°C and 100 rpm for 30 min. A 50 mg / mL solution of GlcNAc substrate prepared with PBS buffer at pH 7.4 was preheated in a 40°C metal bath for 5 min. After the reaction, the reaction solution was centrifuged at 1,000 rpm. 5 μL of the reaction solution was added to 100 μL of OPA detection reagent, and the solution was incubated in a 40°C metal bath for 2 min. 100 μL of the solution was then quickly added to a 96-well microplate, and the plate was inspected at 330 nm using a microplate reader.
[0201] Enzyme activity assay of the free enzyme: The purified free enzyme SpyTag002-TpDac from step 2.3 was dialyzed overnight with PBS buffer at pH 7.4, diluted to 5.5 mg / mL, and preheated in a 40°C metal bath for 5 min. 100 μL of the diluted free enzyme was added to 100 μL of 100 mg / mL GlcNAc, mixed well, and incubated at 40°C and 100 rpm for 30 min. After the reaction, the reaction was terminated by incubation in a 100°C metal bath for 5 min. After centrifugation at 12,000 rpm for 2 min, 5 μL of the supernatant was added to 100 μL of OPA detection reagent, incubated in a 40°C metal bath for 2 min, and 100 μL was quickly added to a 96-well microplate. The plate was then analyzed by absorbance at 330 nm using a microplate reader.
[0202] The specific enzyme activity and enzyme activity recovery rate of immobilized and free enzymes are calculated using the following formula:
[0203] Among them, enzyme activity—U / mL; GlcN concentration in reaction solution and blank solution—mg / mL; total reaction volume—0.2mL; molar mass of GlcN—175.17g / mol; reaction time—30min; substrate solution volume—0.1mL.
[0204] The specific activities and enzyme activity recoveries of free SpyTag002-TpDac and immobilized SpyTag002-TpDac were calculated according to the formula (Table 7). As shown in the table, the specific activity of directionally immobilized SpyTag002-TpDac on SpyFixer-modified resin was 29.8 ± 3.7 U / mg, while the specific activity of STTD enzyme on randomly immobilized SpyTag002-TpDac on unmodified epoxide agarose resin was 15.2 ± 1.2 U / mg. SpyFixer-mediated directional immobilization increased the specific activity of SpyTag002-TpDac by approximately twice that of the randomly immobilized enzyme. The enzyme activity recoveries of directionally immobilized SpyTag002-TpDac and randomly immobilized SpyTag002-TpDac were 79.4 ± 8.7% and 46.1 ± 5.3%, respectively. The activity recovery rate of the method of this invention was increased by approximately 1.7 times.
[0205] Table 7. Specific activities and enzyme activity recovery rates of immobilized and free enzymes.
[0206] a:
[0207] b:
[0208] Study on the reusability of immobilized enzyme: The enzyme activity of SFTD immobilized enzyme was tested according to the above method. After the reaction, the SFTD immobilized enzyme was washed three times with PBS buffer at pH 7.4 and reused 10 times to study the reusability of immobilized enzyme.
[0209] The relative catalytic efficiency of the immobilized enzyme for repeated use is calculated using the following formula:
[0210] As shown in Figure 10, the SpyTag002-TpDac enzyme immobilized on SpyFixer-modified resin still retained approximately 70% of its relative activity after 10 uses, indicating that the TpDac enzyme immobilized on SpyFixer-modified resin has good reusability.
[0211] Example 5: Preparation of epoxy acrylate resins modified with SpyFixer, SpyCatcher, and SpyCatcher003
[0212] This invention first obtains SpyFixer-modified epoxy acrylate resin, and then immobilizes the SpyTag fusion protein in one step using Spy chemistry.
[0213] 5.1 Preparation of acrylate resins modified with SpyFixer, SpyCatcher, and SpyCatcher003
[0214] 50 mg of epoxy resin LX-1000EP (Xi'an Lanxiao Technology New Material Co., Ltd.) was weighed out and washed three times with PBS (0.1 M, pH 7.0) buffer. 1 mg of purified SpyFixer was added, and the mixture was reacted for 12 h at 25 °C and 25 rpm using a Gilson Rotary Mixer (Gilson, Roto-Mini Plus). After the reaction was complete, the supernatant was removed by centrifugation, and the resin was washed three times with PBS (0.1 M, pH 7.0) buffer to obtain SpyFixer-modified epoxy acrylate resin (hereinafter referred to as SpyFixer-LX-1000EP for simplicity).
[0215] Following the same method, SpyCatcher-modified epoxy acrylate resin (hereinafter referred to as SpyCatcher-LX-1000EP for simplicity) and SpyCatcher003-modified epoxy acrylate resin (hereinafter referred to as SpyCatcher003-LX-1000EP for simplicity) were obtained. The immobilization efficiencies of SpyFixer, SpyCatcher, and SpyCatcher003 were calculated using the following formula:
[0216] Protein fixation amount (mg) = Total protein in supernatant before fixation (mg) - Total protein in supernatant after fixation (mg)
[0217] The SDS-PAGE analysis results are shown in Figures 11A-11C. Based on the protein quantification standards, the optical density of the target bands was analyzed using ImageJ gel quantification software, and the immobilization efficiencies of SpyFixer, SpyCatcher, and SpyCatcher003 were calculated (Table 8). As shown in the table, SpyFixer had the highest immobilization efficiency at 20 mg / g resin, reaching 99.5 ± 1.0%; the immobilization efficiencies of SpyCatcher and SpyCatcher003 were lower than those of SpyFixer, at 25.9 ± 5.3% and 28.4 ± 1.3%, respectively.
[0218] Table 8. Immobilization results of SpyFixer, SpyCatcher, and SpyCatcher003
[0219] The immobilized SpyFixer-LX-1000EP, SpyCatcher-LX-1000EP, and SpyCatcher003-LX-1000EP were each added to 12 volumes of blocking buffer (3M glycine, pH 8.5) and reacted for 24 h at 25 °C and 25 rpm using a micro-rotary mixer. After blocking, the blocking solution was removed by centrifugation, and the samples were washed three times with PBS buffer (0.1M, pH 7.0) and stored at 4 °C.
[0220] 5.2 Direct immobilization of SpyTag002-RFP from cell lysate
[0221] Weigh out 50 mg of SpyFixer-LX-1000EP, SpyCatcher-LX-1000EP and SpyCatcher003-LX-1000EP respectively, wash three times with PBS (0.1M, pH 7.0) buffer, add 0.2 mL of supernatant of E. coli cell lysate overexpressing SpyTag002-RFP, and react for 2 h at 25℃ and 25 rpm using a micro-rotary mixer.
[0222] After the reaction was complete, the immobilized RFP was separated by centrifugation. The amount of immobilized RFP and the immobilization efficiency were calculated using the following formulas:
[0223] RFP fixation amount (mg) = Total protein content in supernatant before fixation (mg) - Total protein content in supernatant after fixation (mg) - Total protein content in wash buffer supernatant (mg)
[0224] The SDS-PAGE analysis results are shown in Figure 12. Using ImageJ gel quantification software, the optical density of the target band was analyzed according to the protein quantification standards, and the immobilization efficiency of the SpyTag002-RFP fusion protein in the cell lysate was calculated. The results are shown in Table 9. The immobilization efficiency of SpyTag002-RFP using SpyCatcher-modified resin was 13.7±6.1%, and the immobilization efficiency using SpyCatcher003-modified resin was 20.8±6.1%. The immobilization efficiency of the method of this invention was improved to 49.3±4.7%.
[0225] Table 9 Results of immobilization of SpyTag002-RFP from cell lysates
[0226] a. The amount of fusion protein used was estimated using SDS-PAGE.
[0227] Example 6: The effect of C49S mutation on SpyFixer immobilization effect
[0228] 6.1 The effect of C49S mutation in SpyFixer on its immobilization on AR2G sensors
[0229] The purified SpyFixer and SpyFixer(C49S) were immobilized onto the AR2G sensor under the same immobilization conditions as in step 3.1, and the results are shown in Table 10. As can be seen from the table, the signal response values of SpyFixer and SpyFixer(C49S) binding to hGH(G120R)-SpyTag003 were 0.57±0.03 nm and 0.37±0.05 nm, respectively. The SpyFixer-modified sensor showed a higher binding signal response value than the SpyFixer(C49S)-modified sensor. The above-mentioned hGH(G120R)-SpyTag003-binding sensor was further tested by binding to 20, 40, and 80 nM hGH receptors. The results showed that the signal response values generated by the SpyFixer-modified sensor binding to different concentrations of hGH receptors were all higher than those generated by the SpyFixer(C49S)-modified sensor. This indicates that SpyFixer (C49S) has a slightly lower ability to bind SpyTag fusion protein after being immobilized on the AR2G sensor than SpyFixer.
[0230] Table 10 Results of SpyFixer and SpyFixer (C49S) Fixed AR2G Sensors
[0231] 6.2 Effect of C49S mutation in SpyFixer on its immobilization on epoxy agarose resin
[0232] The purified SpyFixer and SpyFixer (C49S) were immobilized on epoxide agarose resin. The immobilization conditions and the calculation method for immobilization efficiency were the same as in step 4.1, and the results are shown in Table 11. As can be seen from the table, when 20 mg / mL of resin was added, the immobilization efficiencies of SpyFixer and SpyFixer (C49S) were 99.5 ± 0.2% and 73.5 ± 15.0%, respectively, indicating that the immobilization effect of SpyFixer (C49S) on epoxide agarose resin was slightly lower than that of SpyFixer.
[0233] Table 11 Results of SpyFixer and SpyFixer (C49S) immobilized epoxy agarose resin
[0234] This invention provides an immobilization method based on the SpyFixer-SpyTag reaction. There are many methods and approaches to implement this technical solution. The above description is only a preferred embodiment of this invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of this invention. These improvements and modifications should also be considered to be within the protection scope of this invention. All components not explicitly stated in this embodiment can be implemented using existing technology.
Claims
1. A solid-phase support for immobilizing proteins, wherein the solid-phase support, when not modified by the SpyCatcher immobilization mutant SpyFixer peptide, contains an epoxy group or a carboxylic acid group capable of reacting with the amino (NH2) group of the SpyFixer peptide, the SpyFixer peptide being covalently attached to the solid-phase support by reacting with the epoxy group or carboxylic acid group on the solid-phase support, and the SpyFixer peptide linked to the solid-phase support being capable of forming an isopeptide bond with the SpyTag peptide, wherein the amino acid sequence of the SpyFixer peptide is shown in SEQ ID NO:
1.
2. The solid support of claim 1, wherein the solid support is selected from: sensors, such as biosensors like AR2G sensors or CM5 chip sensors; agarose resin; epoxy support, such as epoxy resin.
3. The solid support of claim 1 or 2, wherein the epoxy resin is selected from epoxy agarose resin and epoxy acrylate resin, particularly hydrophilic epoxy agarose resin followed by hydrophobic epoxy acrylate resin.
4. A method of immobilizing a target protein, comprising: (a) providing a solid support according to any one of claims 1-3, (b) providing a fusion protein of a target protein and a SpyTag peptide, (c) contacting the solid support and the fusion protein under conditions that allow the SpyFixer peptide and the SpyTag peptide to form heteropeptide bonds, thereby immobilizing the fusion protein on the solid support through SpyFixer-SpyTag specific interactions.
5. A solid-phase carrier for immobilizing a protein, which is obtained by immobilizing the protein and a SpyTag fusion protein on the solid-phase carrier according to any one of claims 1-3 through SpyFixer-SpyTag specific interaction, preferably the amino acid sequence of the SpyTag peptide is as shown in SEQ ID NO:4 or 5, and preferably the target protein is selected from ligands, antibody capture peptides such as the Z domain of protein A, and enzymes.
6. The immobilized protein solid support of claim 5, wherein the target protein is selected from human growth hormone, the Z domain of protein A, N-acetylglucosamine deacetylase, and red fluorescent protein.
7. The protein-immobilized solid support of claim 5 or 6, obtained by the method of claim 4.
8. A method of capturing and / or assaying a protein of interest, comprising: (a) providing a solid-phase support according to any one of claims 1-3, (b) providing a fusion protein of a target protein that specifically interacts with a protein of interest and a SpyTag peptide, (c) contacting the solid-phase support and the fusion protein under conditions that allow the SpyFixer peptide and the SpyTag peptide to form isopeptide bonds, thereby immobilizing the fusion protein on the solid-phase support through SpyFixer-SpyTag specific interaction, and (d) contacting the solid-phase support immobilized with the fusion protein with a sample containing the protein of interest, thereby capturing and / or measuring the protein of interest, preferably the protein of interest being a growth hormone receptor, immunoglobulin G, or N-acetylglucosamine.
9. The method of claim 8, comprising: A solid-phase support for immobilizing a protein, as described in any one of claims 5-7, is provided, and the solid-phase support for immobilizing the protein is contacted with a sample containing the protein of interest to capture and / or determine the protein of interest.
10. A SpyCatcher immobilization mutant, SpyFixer, characterized in that: The amino acid sequence of the mutant SpyFixer is shown in SEQ ID NO:
1.
11. A gene encoding the SpyFixer, the SpyCatcher immobilized mutant of claim 10.
12. The gene according to claim 11, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO:
2.
13. The SpyCatcher immobilization mutant SpyFixer related biomaterial of claim 10, characterized by: It can be any one or more combinations of the following biological materials: (a) An expression cassette containing the gene of claim 11 or 12; (b) A recombinant expression vector containing the gene of claim 11 or 12; (c) A recombinant expression vector containing the expression cassette described in (a); (d) Recombinant microorganisms containing the gene of claim 11 or 12; (e) Recombinant microorganisms containing the expression cassette described in (a); (f) Recombinant microorganisms containing the recombinant expression vector described in (b) or (c).
14. The biomaterial according to claim 13, characterized in that: The starting vectors for the recombinant expression vectors described in (b) and (c) are pET series vectors; The host microorganisms corresponding to the recombinant microorganisms described in (d), (e), and (f) are selected from prokaryotes or yeast.
15. An immobilized protein, characterized by: It contains the SpyFixer immobilized mutant of SpyCatcher as described in claim 10.
16. The immobilized protein of claim 15, wherein: The immobilized protein is prepared by immobilizing the SpyCatcher immobilized mutant SpyFixer as described in claim 10 on a solid support. The solid support includes a solid support with epoxy groups or carboxylic acid groups on its surface.
17. The immobilized protein of claim 16, wherein: The solid support includes a sensor for protein-protein interactions, an agarose resin for protein purification, or an epoxy resin for protein immobilization.
18. The use of the SpyCatcher immobilized mutant SpyFixer of claim 10, the gene of any one of claims 11-12, the biomaterial of any one of claims 13-14, or the immobilized protein of any one of claims 15-17 in the preparation of the SpyCatcher immobilized mutant.
19. The application of the solid-phase carrier of any one of claims 1-3 and 5-7, the SpyCatcher immobilized mutant SpyFixer of claim 10, the gene of any one of claims 11-12, the biomaterial of any one of claims 13-14, or the immobilized protein of any one of claims 15-17 in the application of protein interaction detection, protein immunoassay, protein purification, and protein immobilization based on the SpyFixer-SpyTag reaction.