MSLN-specific chimeric antigen receptor, car-t cell and use thereof
By designing MSLN-specific chimeric antigen receptors and constructing CAR-T cells, the problem of insufficient application of MSLN in cancer treatment was solved, and effective killing and tumor suppression effects on MSLN-overexpressing cancer cells were achieved.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SHANGHAI YIHAO BIOTECH CO LTD
- Filing Date
- 2025-10-29
- Publication Date
- 2026-06-11
AI Technical Summary
The application of MSLN as a target in cancer treatment is limited in current technologies, and the effective treatment of tumors and cancers using chimeric antigen receptors, in particular, requires further development.
An MSLN-specific chimeric antigen receptor was designed and constructed, comprising an MSLN antigen-binding domain, a transmembrane domain, and an intracellular signal transduction domain. Using anti-MSLN antibodies or their antigen-binding fragments, CAR-T cells were expressed on the surface of T cells through genetic engineering, thereby achieving specific killing of MSLN-overexpressing cancer cells.
The constructed CAR-T cells killed MSLN-overexpressing HGC-27 cells and SKOV3 tumor cells in vitro and effectively inhibited tumor growth in animal tumor models, demonstrating significant anti-tumor activity.
Smart Images

Figure CN2025130943_11062026_PF_FP_ABST
Abstract
Description
An MSLN-specific chimeric antigen receptor, CAR-T cells and their applications
[0001] priority
[0002] This application claims priority to Chinese invention patent application No. 202411779653.4, filed on December 5, 2024, entitled "An MSLN-specific chimeric antigen receptor, CAR-T cells and their applications". Technical Field
[0003] This invention relates to the fields of biotechnology and medicine, and in particular to an MSLN-specific chimeric antigen receptor, CAR-T cells, and their applications. Background Technology
[0004] Using autologous T cells expressing chimeric antigen receptors (CARs) for tumor cell immunotherapy is a promising strategy, as demonstrated by CD19-targeted CAR-T cell therapy for B-cell malignancies. A CAR is a synthetic receptor composed of an antigen-binding domain, typically a single-chain fragment variable (scFv) derived from a monoclonal antibody, which is hinged or spacer-linked to a transmembrane domain and an intracellular signaling domain from the T cell receptor complex, containing CD3 zeta (CD3ζ) and a co-stimulatory signaling domain. CAR-T cells mediate tumor cell killing by binding to specific target antigens on the surface of cancer cells via the CAR-T single-chain antibody, without presenting antigens at the major histocompatibility complex (MHC). Upon direct binding to a specific target antigen, CAR-T cells are activated through the function of their intracellular signaling domains. The scFv, acting as the antigen recognition domain, initiates and determines the intensity of T cell activation, providing specificity in a manner independent of the MHC. Generally, CAR-T cells with high-affinity scFv exhibit stronger anti-tumor activity. Therefore, the preparation of high-affinity scFv is fundamental to the construction of CAR-T cells.
[0005] Mesothelin (MSLN) is a glycoprotein found on cell surfaces and in serum. Its gene encodes a 69 kDa precursor protein, which is enzymatically hydrolyzed during maturation into a membrane-bound protein retaining approximately 40 kDa at the C-terminus, becoming mature mesothelin. The remaining approximately 30 kDa N-terminus fragment is shed and released extracellularly into blood and urine. Under normal conditions, MSLN expression is confined to mesothelial cells (peritoneum, pericardium, and pleural cavity) at low levels, and is essentially absent in other tissues and cells. However, MSLN has been found to be significantly overexpressed in various tumor types, including gastric cancer, mesothelioma, pancreatic cancer, non-small cell lung cancer, lung adenocarcinoma, fallopian tube cancer, head and neck cancer, cervical cancer, and ovarian cancer. Studies have shown that abnormal MSLN expression promotes tumor cell proliferation, invasion, and metastasis. This lack of expression or low expression of MSLN in normal cells suggests its potential as a specific target for targeted cancer therapy.
[0006] Currently, research and application of MSLN as a target in cancer treatment are still limited, especially the application of combining it with chimeric antigen receptors, and whether and how it can be effectively used to treat tumors and cancers more efficiently. Summary of the Invention
[0007] To address the aforementioned technical problems, this invention provides anti-MSLN antibodies, MSLN-specific chimeric antigen receptors, and their uses. The MSLN-specific chimeric antigen receptor may include an MSLN antigen-binding domain, a transmembrane domain, and an intracellular signal transduction domain.
[0008] On one hand, an anti-MSLN antibody or its antigen-binding fragment is provided, comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises CDR-H1, CDR-H2, and CDR-H3 of SEQ ID NO: 10 (EVQLQESGPE LVKPGASVKI SCKASALNWS DHQCTWVKQS HGKSLEWIGR IYEYTFLQCF LQCFTCFVPW FDKATLTVNK SSSTAHMELR SLTSEDSAVY YCARFGYYCV NYWGQGTTVT VSS, SEQ ID NO: 10); and the light chain variable region comprises SEQ ID NO: 17 (DI VLTQSTASLA VSLGQRATIS CNAICSVDTP WKNISRWYQQ KPGQSPKLLI YAGALNESTG IPARFSGSGS RTDFTLTINP VEADDVATYY CQSEKEVWKR FGGGTKLEIK, SEQ ID NO: 10). CDR-L1, CDR-L2 and CDR-L3 in NO:17).
[0009] In one embodiment, CDR-H1 contains the amino acid sequence of SEQ ID NO: 11 (DHQCT); CDR-H2 contains the amino acid sequence of SEQ ID NO: 12 (RIYEYTFLQC FLQCFTCFVP WFD); and CDR-H3 contains the amino acid sequence of SEQ ID NO: 13 (FGYYCVNY).
[0010] In one embodiment, CDR-L1 contains the amino acid sequence of SEQ ID NO: 14 (NAICSVDTPW KNISR); CDR-L2 contains the amino acid sequence of SEQ ID NO: 15 (AGALNES T); and CDR-L3 contains the amino acid sequence of SEQ ID NO: 16 (QSEKEVWKR).
[0011] In one embodiment, the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 96% sequence identity with SEQ ID NO: 10. In one embodiment, the light chain variable region comprises SEQ ID NO: 17 or an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 96% sequence identity with SEQ ID NO: 17.
[0012] In one embodiment, the antigen-binding fragment is one or more of Fab', Fab, F(ab')2, Fd fragment, dAb fragment, camel antibody, nanobody, and single-chain Fv.
[0013] In one embodiment, the single-chain Fv comprises the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 96% sequence identity with the amino acid sequence shown in SEQ ID NO: 1.
[0014] The amino acid sequence of SEQ ID NO: 1 is: EVQLQESGPE LVKPGASVKI SCKASALNWS DHQCTWVKQS HGKSLEWIGR IYEYTFLQCF LQCFTCFVPW FDKATLTVNK SSSTAHMELR SLTSEDSAVY YCARFGYYCV NYWGQGTTVT VSSGGGGSGG GGSGGGGSDI VLTQSTASLA VSLGQRATIS CNAICSVDTP WKNISRWYQQ KPGQSPKLLI YAGALNESTG IPARFSGSGS RTDFTLTINP VEADDVATYY CQSEKEVWKR FGGGTKLEIK (SEQ ID NO: 1, the underlined part is the linker).
[0015] In one aspect, an MSLN-specific chimeric antigen receptor is provided, comprising an MSLN antigen-binding domain, which is an anti-MSLN antibody or its antigen-binding fragment as described herein. In one embodiment, the MSLN-specific chimeric antigen receptor further comprises a transmembrane domain and an intracellular signaling domain.
[0016] In one embodiment, the transmembrane domain has an amino acid sequence as shown in SEQ ID NO: 3 (IYIWAPLAGT CGVLLLSLVI TLYC, SEQ ID NO: 3) or an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 96% sequence identity with the amino acid sequence shown in SEQ ID NO: 3.
[0017] In one embodiment, the intracellular signal transduction domain comprises a 4-1BB co-stimulatory signaling molecule and a human CD3ζ signaling domain. In one embodiment, the 4-1BB co-stimulatory signaling molecule has an amino acid sequence as shown in SEQ ID NO: 4 (KRGRKKLLYI FKQPFMRPVQ TTQEEDGCSC RFPEEEEGGC EL, SEQ ID NO: 4) or an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 96% sequence identity with the amino acid sequence shown in SEQ ID NO: 4. In one embodiment, the human CD3ζ signaling domain has an amino acid sequence as shown in SEQ ID NO: 5 (RVKFSRSADA PAYKQGQNQL YNELNLGRRE EYDVLDKRRG RDPEMGGKPR RKNPQEGLYN ELQKDKMAEA YSEIGMKGER RRGKGHDGLY QGLSTATKDT YDALHMQALP PR, SEQ ID NO: 5) or an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 96% sequence identity with the amino acid sequence shown in SEQ ID NO: 5.
[0018] In one embodiment, the MSLN-specific chimeric antigen receptor further comprises a hinge region connecting the MSLN antigen-binding domain and the transmembrane domain. In one embodiment, the hinge region has an amino acid sequence as shown in SEQ ID NO: 6 (TTTPAPRPPT PAPTIASQPL SLRPEACRPAAGGAVHTRGL DFACD, SEQ ID NO: 6) or an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 96% sequence identity with the amino acid sequence shown in SEQ ID NO: 6.
[0019] In one embodiment, the MSLN-specific chimeric antigen receptor further comprises a signal peptide at its N-terminus, the signal peptide having an amino acid sequence as shown in SEQ ID NO: 7 (MYRMQLLSCI ALSLALVTNS, SEQ ID NO: 7) or an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 96% sequence identity with the amino acid sequence shown in SEQ ID NO: 7.
[0020] In one embodiment, the MSLN-specific chimeric antigen receptor has the amino acid sequence shown in SEQ ID NO: 8 (MYRMQLLSCI ALSLALVTNS DYKDDDDKEF EVQLQESGPE LVKPGASVKI SCKASALNWS DHQCTWVKQS HGKSLEWIGR IYEYTFLQCF LQCFTCFVPW FDKATLTVNK SSSTAHMELR SLTSEDSAVY YCARFGYYCV NYWGQGTTVT VSSGGGGSGG GGSGGGGGSDI VLTQSTASLA VSLGQRATIS CNAICSVDTP WKNISRWYQQ KPGQSPKLLI YAGALNESTG IPARFSGSGS RTDFTLTINP VEADDVATYY CQSEKEVWKR FGGGTKLEIK RGSTTTPAPR PPTPAPTIAS QPLSLRPEAC RPAAGGAVHT RGLDFACDIY). IWAPLAGTCG VLLLSLVITL YCKRGRKKLL YIFKQPFMRP VQTTQEEDGC SCRFPEEEEG GCELRVKFSR SADAPAYKQG QNQLYNELNL GRREEYDVLD KRRGRDPEMG GKPRRKNPQE GLYNELQKDK MAEAYSEIGM KGERRRGKGH DGLYQGLSTA TKDTYDALHM QALPPR, SEQ ID NO: 8) or an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 96% sequence identity with the amino acid sequence shown in SEQ ID NO: 8.
[0021] In another aspect, the present invention provides a first isolated nucleic acid molecule that encodes an anti-MSLN antibody or an antigen-binding fragment thereof as described herein.
[0022] In another aspect, the present invention provides a second isolated nucleic acid molecule that encodes an MSLN-specific chimeric antigen receptor as described herein.
[0023] In another aspect, the present invention provides an expression vector comprising a first or second isolated nucleic acid molecule as described herein.
[0024] In another aspect, the present invention provides a host cell comprising an expression vector as described herein. In one embodiment, the host cell comprises an immune cell, and in another embodiment, the immune cell comprises T cells, B cells, NK cells, monocytes, macrophages, or dendritic cells, or any combination thereof.
[0025] In another aspect, the present invention provides pharmaceutical compositions or kits comprising an anti-MSLN antibody or an antigen-binding fragment thereof as described herein, an MSLN-specific chimeric antigen receptor, a first or second isolated nucleic acid molecule, an expression vector, or a host cell.
[0026] In another aspect, the present invention provides the use of anti-MSLN antibodies or antigen-binding fragments thereof as described herein, MSLN-specific chimeric antigen receptors, first or second isolated nucleic acid molecules, expression vectors, host cells, pharmaceutical compositions, or kits in the preparation of medicaments for the prevention and / or treatment of cancers overexpressing MSLN. In one embodiment, cancers overexpressing MSLN include one or more of gastric cancer, mesothelioma, pancreatic cancer, non-small cell lung cancer, lung adenocarcinoma, fallopian tube cancer, head and neck cancer, cervical cancer, and ovarian cancer.
[0027] In another aspect, the present invention provides a method for preventing and / or treating cancers that overexpress MSLN, comprising administering to a subject an anti-MSLN antibody or its antigen-binding fragment as described herein, an MSLN-specific chimeric antigen receptor, a first or second isolated nucleic acid molecule, an expression vector, or a pharmaceutical composition. Further, the cancers overexpressing MSLN include one or more of mesothelioma, pancreatic cancer, non-small cell lung cancer, lung adenocarcinoma, fallopian tube cancer, head and neck cancer, cervical cancer, and ovarian cancer.
[0028] In another aspect, the present invention provides an MSLN-specific chimeric antigen receptor, isolated nucleic acid molecules, expression vectors, or pharmaceutical compositions as described herein for use in methods of preventing and / or treating cancers overexpressing MSLN, including administering to a subject an anti-MSLN antibody or its antigen-binding fragment as described herein, an MSLN-specific chimeric antigen receptor, a first or second isolated nucleic acid molecule, an expression vector, or a pharmaceutical composition. Further, the cancers overexpressing MSLN include one or more of mesothelioma, pancreatic cancer, non-small cell lung cancer, lung adenocarcinoma, fallopian tube cancer, head and neck cancer, cervical cancer, and ovarian cancer.
[0029] In another aspect, the present invention provides a nucleic acid encoding the scFv antibody described herein. In one embodiment, the nucleic acid comprises the nucleotide sequence of SEQ ID NO: 2 or a degenerate sequence thereof. The sequence of SEQ ID NO: 2 is as follows:
[0030] The beneficial technical effects of this invention include:
[0031] 1. This study screened a novel anti-MSLN antibody with an affinity constant of approximately 1.28E+9L / mol (Kaff).
[0032] 2. This paper utilizes a novel anti-MSLN antibody to construct a chimeric antigen receptor and T cells containing the chimeric antigen receptor. The constructed CAR-T cells can kill MSLN-overexpressing HGC-27 cells and SKOV3 tumor cells in vitro.
[0033] 3. The CAR-T cells constructed in this paper can inhibit tumor growth in animal tumor models. Attached Figure Description
[0034] Figure 1 shows a schematic diagram of the structure of a chimeric antigen receptor (CAR) plasmid targeting MSLN.
[0035] Figure 2 shows the expression efficiency of CAR targeting MSLN on the surface of T cells in Example 3 of the present invention.
[0036] Figure 3 shows the results of the CAR-T cell killing experiment on cancer cells.
[0037] Figure 4 shows the antitumor activity of MSLN-CAR-T in a mouse model of ovarian cancer.
[0038] Figure 5 shows the MSLN scFv antibody affinity results. Detailed Implementation
[0039] definition
[0040] As used herein, the term "chimeric antigen receptor" or "CAR" generally refers to a group of peptides, typically two in the simplest embodiments, that, when in immune effector cells, provide cell-to-target cell specificity (typically cancer cells) and generate intracellular signaling. In some embodiments, the CAR comprises at least one extracellular antigen-binding domain (such as VHH, scFv, or a portion thereof), a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain") containing functional signaling domains derived from stimulatory and / or costimulatory molecules.
[0041] As used herein, the transmembrane domains used in chimeric antigen receptors are not limited, and can be any transmembrane domain well known in the art for constructing chimeric antigen receptors. As an example, the transmembrane domain may have the amino acid sequence shown in SEQ ID NO: 3. As used herein, the intracellular signaling domains used in chimeric antigen receptors are not limited, and can be any intracellular signaling domain well known in the art for constructing chimeric antigen receptors. As an example, the intracellular signaling domain may comprise a 4-1BB co-stimulatory signaling molecule and a human CD3ζ signaling domain. Further, the 4-1BB co-stimulatory signaling molecule may have the amino acid sequence shown in SEQ ID NO: 4. Further, the human CD3ζ signaling domain may have the amino acid sequence shown in SEQ ID NO: 5. Further, the chimeric antigen receptor may also include a hinge region connecting the extracellular antigen-binding domain and the transmembrane domain. As used herein, the hinge region used in chimeric antigen receptors is not limited, and can be any hinge region well known in the art for connecting the extracellular antigen-binding domain and the transmembrane domain in a chimeric antigen receptor. As an example, the hinge region may have an amino acid sequence as shown in SEQ ID NO: 6. Further, the chimeric antigen receptor also includes a signal peptide at its N-terminus. As used herein, the signal peptide used in the chimeric antigen receptor is not limited and may be any signal peptide well known in the art for use in chimeric antigen receptors. As an example, the signal peptide may have an amino acid sequence as shown in SEQ ID NO: 7.
[0042] As used herein, the term "complementarity-determining region" or "CDR" refers to the amino acid residues in the variable region of an antibody responsible for antigen binding. An antibody contains three CDRs, designated CDR1, CDR2, and CDR3. The precise boundaries of these CDRs can be defined according to various numbering systems known in the art, such as the Kabat numbering system, the Chothia numbering system, or the IMGT numbering system. For a given antibody, those skilled in the art will readily identify the CDRs as defined by each numbering system. Furthermore, the correspondence between different numbering systems is well known to those skilled in the art.
[0043] As used herein, the term "specific binding" refers to a non-random binding reaction between two molecules, such as the reaction between an antibody and its target antigen. The strength or affinity of a specific binding interaction can be determined by the equilibrium dissociation constant (K0) of that interaction. D () indicates. In this invention, the term "K" is used. D"" refers to the dissociation equilibrium constant of a specific antibody-antigen interaction, which describes the binding affinity between the antibody and the antigen. The smaller the equilibrium dissociation constant, the tighter the antibody-antigen binding and the higher the affinity between the antibody and the antigen.
[0044] As used herein, the term "vector" refers to a nucleic acid delivery vehicle into which polynucleotides can be inserted. When a vector enables the expression of a protein encoded by the inserted polynucleotide, it is called an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material elements they carry to be expressed in the host cells. Vectors are well-known to those skilled in the art and include, but are not limited to: plasmids; phage particles; Cos plasmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage; and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retrotranscriptoviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomaviruses (such as SV40). A vector may contain multiple elements controlling expression, including but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, a vector may contain a replication initiation site.
[0045] As used herein, the term "host cell" refers to a cell that can be used to introduce a vector, including but not limited to prokaryotic cells such as *Escherichia coli* or *Bacillus subtilis*, fungal cells such as yeast cells or *Aspergillus*, insect cells such as S2 *Drosophila* cells or Sf9 cells, or animal cells such as fibroblasts, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK293 cells, or other human cells. Host cells can include single cells or populations of cells. Host cells can include immune cells. Immune cells include T cells, B cells, NK cells, monocytes, macrophages, or dendritic cells, or any combination thereof.
[0046] Vector introduction into host cells can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as *E. coli*, competent cells capable of uptake DNA can be harvested after the exponential growth phase and treated with CaCl2, the steps of which are well known in the art. Another method is to use MgCl2. If desired, transformation can also be performed using electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
[0047] As used herein, the term “pharmaceuticalally acceptable carrier and / or excipient” means a carrier and / or excipient that is pharmacologically and / or physiologically compatible with the subject and the active ingredient, which is well known in the art and includes, but is not limited to: pH adjusters, surfactants, adjuvants, ionic strength enhancers, diluents, agents for maintaining osmotic pressure, agents for delaying absorption, and preservatives.
[0048] As used herein, the term "prevention" refers to a method implemented to prevent or delay the occurrence of a disease or condition or symptom (e.g., a disease associated with high MSLN expression) in a subject. As used herein, the term "treatment" refers to a method implemented to obtain a beneficial or desired clinical outcome. For the purposes of this invention, beneficial or desired clinical outcomes include, but are not limited to, alleviating symptoms, reducing the extent of the disease, stabilizing (i.e., no longer worsening) the state of the disease, delaying or slowing the progression of the disease, improving or alleviating the state of the disease, and relieving symptoms (whether partial or complete), whether detectable or undetectable. Furthermore, "treatment" can also refer to prolonged survival compared to expected survival (if no treatment was received).
[0049] As used herein, the term "subject" refers to a mammal, such as a primate mammal, like a human. In some embodiments, the subject (e.g., a human) suffers from a disease associated with high MSLN expression.
[0050] As used herein, the terms "cancers overexpressing MSLN" and "diseases associated with high MSLN expression" refer to a condition in a subject's diseased cells, such as cancer cells, where MSLN expression levels are higher than in the same subject's normal healthy cells. In some cases, "cancers overexpressing MSLN" and "diseases associated with high MSLN expression" may be used interchangeably. In specific implementations, for example, cancers overexpressing MSLN may include gastric cancer, ovarian cancer, etc.
[0051] Chimeric antigen receptor
[0052] Chimeric Antigen Receptor T-Cell Immunotherapy (CAR-T Immunotherapy) is a novel cellular immunotherapy technology that has rapidly developed in recent years. Based on the theory of immune system recognition and activation, it uses genetic engineering to artificially overexpress single-chain antibody variable region gene fragments on the surface of T cells that recognize specific tumor surface antigens. This allows T cells to recognize specific antigens and kill target cells expressing those antigens. The core theoretical basis of CAR-T immunotherapy is the recognition and activation of T lymphocytes. It primarily involves different scFvs recognizing different specific antigens on tumor cells, and then transmitting signals through the hinge and transmembrane region of the CD8 molecule to the CD28 or 4-1BB and TCR co-stimulatory activation region within the T lymphocyte membrane. This activates the body's own T lymphocytes, allowing them to specifically attack and kill the recognized tumor cells. Furthermore, because CAR-T cells use an antibody-based antigen recognition model, they are not subject to MHC restrictions.
[0053] The chimeric antigen receptor described herein comprises at least an extracellular ligand-binding domain or portion thereof, a transmembrane domain, and an intracellular domain comprising one or more signal transduction domains and / or co-stimulatory domains. The extracellular ligand-binding domain or portion thereof may be an antibody or an antibody fragment. In this paper, the antibody fragment may be an scFv antibody fragment targeting MSLN. The chimeric antigen receptor described herein may also include a signal peptide.
[0054] carrier
[0055] Constructs or expression cassettes can be delivered using known transfection and / or transduction vectors, including but not limited to lentiviral vectors, adeno-associated viruses, etc. Lentiviral vectors are a preferred vector type, capable of delivering large amounts of viral nucleic acid into host cells. Lentivirals are characterized by their unique ability to infect / transduce non-dividing cells, and after transduction, lentiviruses integrate their nucleic acid into the host cell's chromosome, but they themselves are not replicable. Lentivirals have three major genes encoding packaging proteins: gag, pol, and vsv-g, as well as one regulatory gene, rev.
[0056] Lentiviral vector systems or lentivirus particles
[0057] Lentiviral virions (particles) are expressed by a vector system encoding essential viral proteins to produce non-replicating lentiviral virions (viral particles). At least one vector exists containing a nucleic acid sequence encoding a lentiviral pol protein essential for reverse transcription and integration, operatively linked to a promoter. For example, the pol protein is expressed by multiple vectors. Vectors containing a nucleic acid sequence encoding a lentiviral gag protein, essential for forming a viral capsid operatively linked to a promoter, may also exist. This gag nucleic acid sequence may be located on a vector different from at least some of the pol nucleic acid sequences. The gag nucleic acid may be located on a vector separate from all the pol nucleic acid sequences encoding the pol protein.
[0058] The gag-pol, rev, and vsv-g vectors contain nucleotides of the lentiviral genome that package lentiviral RNA, called the lentiviral packaging sequence. As described above, lentiviral vector systems typically include at least two to three helper plasmids containing at least one of the gag, pol, or rev genes. Each of the gag, pol, and rev genes can be provided on a separate plasmid, or one or more genes can be provided together on the same plasmid. The gag, pol, and rev genes are provided on the same or separate plasmids, while vsv-g is provided on a single plasmid.
[0059] T cells
[0060] The T cells of the present invention can be prepared by the following method, which includes introducing the polynucleotide molecules, vectors, or viral particles described herein into the T cells. Specifically, the method includes one or more of the following steps: 1) viral vector construction; 2) lentiviral packaging using 293T cells; 3) PBMC isolation; 4) T cell sorting and activation; 5) lentiviral transfection of sorted and activated T cells; 6) culture, expansion, and flow cytometry detection of CAR-T cell positivity and CD3 positivity after infection; 7) cell killing assay of CAR-T cells obtained after infection; and 8) detection of the inhibitory effect of CAR-T cells on solid tumors in a mouse CDX model.
[0061] Methods and uses
[0062] The T cells of this invention can be used to treat various cancers. Those skilled in the art can readily determine the type of cancer for CAR-T cell therapy based on the chimeric antigen receptor expressed by the T cells. Cancers include, but are not limited to, one or more of gastric cancer, mesothelioma, pancreatic cancer, non-small cell lung cancer, lung adenocarcinoma, fallopian tube cancer, head and neck cancer, cervical cancer, and ovarian cancer. The treatment methods of this invention may include administering CAR-T cells to cancer patients. This invention also provides the use of CAR-T cells in the preparation of pharmaceuticals or kits for treating cancers, such as one or more of the cancers listed above.
[0063] Example
[0064] The present invention will be further illustrated below with reference to specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field.
[0065] Example 1: Preparation of antibodies that specifically bind to MSLN
[0066] 1.1 Carrier Construction
[0067] Using a plasmid containing the full-length MSLN gene (GenBank: NM_0058 23.6) as a template, primers were designed (F: 5'TCCTGTTCCTGCTCTTCAGC 3', SEQ ID NO: 18; R: 5'AACGTGGCCAAGTCCATG 3', SEQ ID NO: 18). NO: 19) The extracellular domain (ECD) gene of MSLN was amplified and ligated into the pcDNA3.1-His (ZY8024, Shanghai Zeye Biotechnology) vector by homologous recombination after double digestion with restriction endonucleases HindIII (R3104S, NEB) and KpnI (R3142V, BioLabs). The vector was transformed into DH5α (18258012, Thermo) competent cells, plated on ampicillin-resistant plates, and incubated overnight at 37°C. Single clones were picked and sequenced for identification. Successful clones were expanded and cultured, and plasmids were extracted using an endotoxin-free plasmid extraction kit (MN, 740424.50).
[0068] MSLN extracellular region (ECD) gene:
[0069] 1.2 Expression and purification of MSLN recombinant protein
[0070] The successfully constructed recombinant plasmid pcDNA3.1-MSLN-His was transfected into HEK 293T (SCSP-502, Chinese Academy of Sciences Cell Bank) cells. After transient transfection for 8 hours, the medium was replaced with 293 freestyle medium (91166, Irvine Scientific) and cultured for 5 days. The cell culture supernatant was collected and purified using an NTA-Ni affinity chromatography column (C600332-0001, Sangon Biotech) to obtain high-purity recombinant protein MSLN-His.
[0071] 1.3 Animal Immunization
[0072] 1.3.1 Camel-derived antibodies: 1 mg of purified MSLN-His recombinant protein was emulsified with an equal volume of Freund's complete adjuvant and administered subcutaneously to Alashan Bactrian camels via the neck for the first immunization. Subsequently, 1 mg of protein was emulsified with incomplete Freund's adjuvant for three consecutive immunizations every two weeks. Peripheral blood was collected on day 7 after the initial immunization. The MSLN-His recombinant protein was coated onto 96-well ELISA plates, and antibody titers were detected by indirect ELISA. The serum titer of anti-MSLN-His recombinant protein in camel peripheral blood was 1:512000, indicating good immunization efficacy and suitable for subsequent VHH antibody library construction.
[0073] 1.3.2 Mouse Antibody: Purified MSLN-His recombinant protein was used as the immunogen to immunize mice. Specifically, an MSLN protein emulsion was prepared by dissolving 0.1 mg of protein in 350 μL of PBS buffer and adding the solution to a 1 mL syringe. An equal volume of Freund's adjuvant was added to another 1 mL syringe. Air was expelled, and the two syringes were connected using a Luer connector. The syringes were repeatedly injected for 15–30 minutes until complete emulsification. A drop of the emulsion was gently dropped onto the surface of water; if it remained intact for more than 10 minutes, emulsification was considered successful. Three 6–8 week old BALB / c female mice were marked and immunized using a subcutaneous multi-point injection method. The initial immunization was performed with 30 μg of MSLN protein (200 μL emulsion) per mouse. Fourteen days later, a booster immunization was performed by thoroughly emulsifying the MSLN protein PBS solution and Freund's incomplete adjuvant at a 1:1 (v / v) ratio, using the same dose. A booster immunization was performed 14 days later, for a total of three immunizations, which resulted in the production of anti-human MSLN antibodies in mice, which were then used to construct the scFv antibody library.
[0074] 1.4 Construction and panning of VHH phage antibody library
[0075] 1.4.1 Isolation of peripheral blood lymphocytes
[0076] 200 mL of peripherally anticoagulated blood was aseptically collected from the jugular vein of a camel. The blood was first diluted with an equal volume of sterile PBS, and then separated into 8 × 10⁸ cells using Ficoll-Paque Plus lymphocyte separation medium (catalog 17144002, Cytiva) and lymphocyte separation tubes by centrifugation. 8 Peripheral blood lymphocytes were collected, and the obtained lymphocytes can be directly used to extract total RNA or frozen at -80℃ for later use.
[0077] 1.4.2 VHH gene amplification
[0078] First, total RNA was extracted from lymphocytes according to the instructions (catalog 74134, RNeasy Plus Mini Kit, QIAGEN). Then, cDNA was obtained by reverse transcription using RNA as a template using a reverse transcription kit (catalog 18080051, SuperScriptⅢ First-Strand Synthesis System, Invitrogen). Finally, the VHH gene was amplified by nested PCR using cDNA as a template.
[0079] 1.4.3 Construction of VHH phage display vector
[0080] The amplified products from 1.4.2 and the phage display vector pMECS were both digested with PstI (R3140V, NEB) and NotI (R3189V, NEB) and then recovered. They were then ligated using T4 DNA ligase.
[0081] 1.4.4 Harvesting of ligation products from electroporation of TG1 competent cells and phage antibody libraries
[0082] The ligation product from step 1.4.3 was added to E. coli TG1 competent cells (60502-2, Lucigen) and electroporated to transfer the cells into TG1. Immediately after electroporation, SOC medium was added and cultured at 37°C and 200 rpm for 1 h. The cells were then plated on LB / AMP-GLU plates and cultured at 37°C for 6–8 h. The bacterial colony was collected, and 1 / 3 volume of 50% glycerol was added to obtain the prepared phage library.
[0083] 1.4.5 Determination of phage library diversity and library capacity
[0084] The electroconversion products were serially diluted 10-fold and plated on LB / Amp-Glu plates. After incubation at 37°C for 12 h, the number of transformants was counted, yielding a library capacity of 3.92 × 10⁻⁶. 9 Phage library.
[0085] 1.4.6 Screening for nanobodies specifically targeting MSLN protein
[0086] Using the prepared phage library as the antibody source, three rounds of screening were conducted using phage display technology. First, purified MSLN-His recombinant protein (2 μg / mL) was coated onto a 96-well microplate. The next day, the plate was blocked with 3% skim milk powder at 37°C for 1 hour. 1×10⁻⁶ ppm of the protein was added to each well. 10Recombinant phages containing nanobodies were incubated at 37°C for 1 hour, washed five times with PBST, and then eluted with 0.1M glycine (pH 1.5) to remove phages bound to MSLN-His. The elution was neutralized with 1M Tris-HCl (pH 8.0). The elution buffer was then used to infect the host bacterium TG1 and cultured on a large scale. Three rounds of screening were performed. From the plates selected in the third round of screening, 96 clones were randomly selected for further culture. Single-clone ELISA was used to identify nanobodies that specifically bind to the MSLN protein. The results showed that 85 of the 96 clones were positive (P / N > 3.0, where P represents the OD450 value of the MSLN well and N represents the OD450 value of the control well). Sequencing analysis of the positive clones yielded one specific anti-MSLN nanobody.
[0087] Construction and panning of 1.5 scFv phage antibody library
[0088] 1.5.1 Screening process for anti-MSLN scFv: Mouse spleen cells were collected, and an antibody cDNA library was generated through RNA isolation, PCR amplification, and cloning into a phage display vector. Specifically, RNA was extracted from spleen cells using Trizol (15596026, Thermo), and the RNA was reverse transcribed using a reverse transcription kit (RR086A, Takara) to obtain the cRNA sequence. The cDNA was then subjected to PCR using library construction primers (primer synthesis company: Sangon Biotech) to obtain the library fragment. This fragment was then double-digested with sfiI (R0123V, NEB) and NotI-HF (R3189V, NEB), and the backbone of pCANTAB5E (PMV13001-SN, Bio-ViewShine) was double-digested with sfiI and NotI. The fragment was then ligated and integrated into TG1 competent cells (60502-2, Lucigen) via electroporation. The library was then subjected to multiple rounds of panning. Specifically, the process involved: A phage infection library was used to harvest phage solutions. Phages were pan-coated with purified MSLN-His protein in ELISA plates at a concentration of 100 μL per well. Three pan-coatings were performed with purified MSLN-His protein PBS solutions at concentrations of 50 μg / mL, 20 μg / mL, and 10 μg / mL. MSLN-His protein-positive phages were obtained and sequenced (by Sangon Biotech) to obtain the nucleotide and amino acid sequences of the anti-MSLN scFv. A plasmid expressing the anti-MSLN scFv sequence (containing a human Fc tag, directly linked to the C-terminus of the scFv) was synthesized (by Sangon Biotech). The protein was then manufactured by a protein production company (Nearshore Protein) to obtain human Fc-anti-MSLN scFv for subsequent validation experiments.
[0089] The human Fc amino acid sequence (A233-K449) used in this patent is an intrinsic sequence, derived from GenBank: XTI96198.1. The human Fc amino acid sequence (A233-K449) used in this patent is as follows:
[0090] The corresponding nucleotide sequences are as follows:
[0091] 1.5.2 ELISA method for measuring the binding affinity between human Fc-MSLN scFv and human MSLN:
[0092] Antigen coating reagent: The purified human MSLN-His protein was diluted with PBS to 6 concentrations (5 μg / mL to 0.156 μg / mL, see Table 1 for details) and added sequentially to microplates, 100 μL per well, one group per concentration, 30 wells per group, 100 μL per well. Controls were set up with 1% BSA and 1×PBS. The plates were incubated overnight at 4°C.
[0093] Blocking and washing: Pour out the MSLN-His protein working solution from the microplate, add washing buffer (PBST > 250 μL) to each well, gently shake, discard the liquid, pat dry on absorbent paper, and wash at least 4 times. Then add 100 μL of 1x blocking buffer for blocking and incubate at 37°C for one hour. The blocking buffer is prepared as follows: First, prepare 1x buffer (PM5090-50x2L, Coolaber) using ddH2O; then prepare 1x buffer (i.e., 1x blocking buffer) containing 1% BSA using BSA (36101ES60, Yisheng Biotechnology).
[0094] Preparation and incubation of human Fc-MSLN scFv working solution: Wash the microplate four times. Dilute the human Fc-MSLN scFv obtained by screening with PBS to 5 μg / mL, 2.5 μg / mL, 1.25 μg / mL, 0.625 μg / mL, 0.313 μg / mL, and 0.156 μg / mL respectively. Then, add 100 μL of human Fc-MSLN scFv working solution to the coated MSLN-His at a volume of 200 rpm for 2 h at room temperature.
[0095] Secondary antibody (goat anti-human IgG1 Fc antibody, HRP-labeled, specifically recognizing human Fc tags) incubation: Pour out human Fc-MSLN scFv (with human Fc tag) working solution, wash the ELISA plate 4 times, dilute the secondary antibody (10702-MM01T-H, Sino) to the working concentration (1:5000) with PBS, then add the secondary antibody working solution to the ELISA plate at a volume of 100 μL / well, and incubate at room temperature for 1 h.
[0096] Color development and detection: Discard the secondary antibody working solution, wash the microplate four times, and use the TMB colorimetric kit (C520026-0500, Sangon) to add 100 μL of TMB solution to each well. Incubate at room temperature in the dark for 10–15 minutes, then add 50 μL of stop solution to each well. Read the data from the microplate at 450 nm using a microplate reader and perform calculations and analysis.
[0097] 1.5.3 Results
[0098] Sequencing results: The MSLN scFv gene sequence obtained by sequencing company (Sangon Biotech) is shown in SEQ ID NO: 2, and the amino acid sequence is shown in SEQ ID NO: 1.
[0099] The amino acid sequence of SEQ ID NO: 1 is: EVQLQESGPE LVKPGASVKI SCKASALNWS DHQCTWVKQS HGKSLEWIGR IYEYTFLQCF LQCFTCFVPW FDKATLTVNK SSSTAHMELR SLTSEDSAVY YCARFGYYCV NYWGQGTTVT VSSGGGGSGG GGSGGGGSDI VLTQSTASLA VSLGQRATIS CNAICSVDTP WKNISRWYQQ KPGQSPKLLI YAGALNESTG IPARFSGSGS RTDFTLTINP VEADDVATYY CQSEKEVWKR FGGGTKLEIK (SEQ ID NO: 1, the underlined part is the linker).
[0100] CDR-H1 is the amino acid sequence of SEQ ID NO: 11 (DHQCT); CDR-H2 is the amino acid sequence of SEQ ID NO: 12 (RIYEYTFLQC FLQCFTCFVP WFD); CDR-H3 is the amino acid sequence of SEQ ID NO: 13 (FGYYCVNY); CDR-L1 is the amino acid sequence of SEQ ID NO: 14 (NAICSVDTPW KNISR); CDR-L2 is the amino acid sequence of SEQ ID NO: 15 (AGALNES T); CDR-L3 is the amino acid sequence of SEQ ID NO: 16 (QSEKEVWKR).
[0101] Binding activity results: Table 1 shows the binding affinity assay data of the screened MSLN scFv, and Table 2 shows that the antibody affinity constant Kaff of MSLN scFv is approximately 1.28E+9L / mol.
[0102] Table 1
[0103] Table 2
[0104] Example 2: Construction of CAR plasmid targeting MSLN
[0105] Using the plasmid containing the scFv antibody gene in 1.5.3 of Example 1 as a template, the scFv antibody gene targeting MSLN was amplified and cloned into the lentiviral vector pSLCAR-BBz (0135992, BioVector) by homologous recombination to construct a second-generation CAR (amino acid sequence shown in SEQ ID NO: 8). This CAR mainly contains the following elements: CD8α signal peptide, MSLN scFv antigen-binding domain, CD8α hinge region, transmembrane domain of human CD8, 4-1BB co-stimulatory signaling molecule and human CD3ζ signal transduction domain (Figure 1). The plasmid containing the MSLN scFv sequence was transformed into competent DH5α cells (18258012, Thermo). The bacterial culture was plated onto agar plates containing ampicillin and cultured. Multiple clones were picked from the agar plates and inoculated into 5 mL of liquid LB medium (containing ampicillin) and cultured on a shaker at 37°C and 250 rpm for 12–16 h. Plasmid extraction was performed according to the instructions of the plasmid miniprep kit (catalog number: DP103-03) purchased from Tiangen Biotech Co., Ltd. The cloned plasmid (pSLCAR-BBz plasmid containing the MSLN-CAR polynucleotide sequence) was sent to Shanghai Sangon Biotech Co., Ltd. for Sanger sequencing to verify the accuracy of the inserted sequence. Based on the sequencing data provided by Shanghai Sangon Biotech Co., Ltd., the bacterial cultures of the clones with the correct sequence were selected for mass inoculation and shake-flask culture.
[0106] CAR nucleotide sequence:
[0107] The expression vector plasmid pSLCAR-BBz (with the MSLN-CAR nucleotide sequence inserted, product number 0135992, BioVector) and two packaging plasmids psPAX2 and pMD2.G (JY03027, Jiangyuan Biotechnology) were extracted using an endotoxin-free plasmid extraction kit (MN, 740424.50). Concentration and purity were measured using a spectrophotometer. The lentivirus packaging cells were 293T cells (SCSP-502, Chinese Academy of Sciences Cell Bank). The specific implementation steps are as follows:
[0108] 1) Plating within 24 hours before transfection: Generally, 293T cells with a passage number of no more than 3 are selected. The cell density is adjusted according to the cell growth density and state. 293T cells with a growth density of 80% are plated. When the growth density reaches 60-90% and the cells are in good condition, virus packaging can be performed.
[0109] 2) Use lentiviral expression vector plasmid, packaging plasmid psPAX2, and packaging plasmid pMD2.G in a plasmid ratio of 4:3:1. Use lipofectamine 2000 (stored at 4℃) as the transfection reagent and add 2 μL / μg of plasmid.
[0110] 3) Mix the plasmid mixture and the transfection reagent mixture in one tube, let it stand at room temperature for 20 min, then add it to the cells in the medium and continue culturing. Collect the culture supernatant after 48 h and 72 h, respectively, and filter it through a 0.45 μm filter membrane (54513-RC, Thermo).
[0111] 4) The collected viral fluid was concentrated using the PEG8000 (89510-1kg, SIGMA) concentration method, and the viral titer was determined by infecting 293T cells and by subsequent flow cytometry detection of CAR positivity in infected 293T cells. The virus was stored at -80℃ for later use.
[0112] Example 3: Preparation of CAR-T cells targeting MSLN
[0113] The specific procedures for collecting peripheral blood from healthy donors and isolating lymphocytes are as follows:
[0114] Take 6 mL of human peripheral blood (for research use), add an equal volume of PBS at room temperature, and gently mix by pipetting. Take a 50 mL centrifuge tube, and add 6 mL of sample density separation buffer (LTS10770125, TBD) to the tube. The volume ratio of sample density separation buffer to undiluted blood is 1:1. Tilt the centrifuge tube at 45° and slowly add the diluted blood about 1 cm above the sample density separation buffer along the tube wall. Centrifuge at 18–20°C, 2000 rpm for 30 min. After centrifugation, the blood will separate into four layers from the bottom to the surface: a layer of red blood cells and granulocytes, a layer of stratified liquid, and a layer of stratified liquid. Mononuclear cell layer, plasma layer; insert the pipette directly into the cloud layer (or first aspirate the upper plasma layer), gently aspirate the cloud layer, and place it into a new centrifuge tube; add at least 3 times the volume of PBMCs (peripheral blood mononuclear cells) in PBS, incubate at 18-20℃, 2000 rpm, 10 min, twice; discard the supernatant, add 1 mL of lymphocyte culture medium (BEBP02-054Q, Lonza), mix well by pipetting, and prepare a PBMC cell suspension; take one drop of PBMC suspension, mix with one drop of 2% trypan blue staining solution, add it to a hemocytometer, and count the total number of cells in 4 large squares under a microscope. Cell count / mL = total number of cells in 4 squares / 4 × 10 4 ×2 (dilution factor).
[0115] High-purity T cells were obtained by stimulating the cells with CD3 / CD28 magnetic beads (GMP-TL601-1000, Tongli Haiyuan) for 48 hours. The specific operation is as follows:
[0116] PBMCs were centrifuged and resuspended. T cells were sorted and activated using CD3 / CD28 magnetic beads (GMP-TL601-1000, Tongli Haiyuan) according to the kit instructions. After centrifugation, the supernatant was discarded, and the cells were washed twice with PBS. PBS was then added for later use. The sorted T cells were counted, and the final concentration was adjusted to 5 × 10⁻⁶. 6 Add 400 μL of cell suspension to each well, i.e., add 2 × 10⁶ cells / mL. 6 Cells were infected with an MOI of 5. 1 mL of virus culture medium suspension was prepared and added to the cell suspension. The cells were centrifuged at 1000g for 30 min, and the centrifuge temperature was adjusted to 32℃. Cells were then transferred to a 75cm³ culture medium containing 20 mL of culture medium, depending on their condition. 2 Expand the culture in culture flasks; on the 9th day after sorting and activation, observe the cell status and cell number, and collect the cells.
[0117] After MSLN-CAR-T cells are collected, MSLN identification and detection are required. The specific procedures are as follows:
[0118] The obtained negative control (NC) group T cells (not infected with the virus) and sample group cells (CAR constructed according to Example 2 and CAR-T cells targeting MSLN prepared according to Example 3) were gently washed twice with PBS + 2% BSA at 1500 rpm / 6 min, and the waste liquid was discarded. 200 μL of PBS was added to the NC tubes for resuspending. 100 μL of PBS was added to the sample tubes for resuspending, and then 100 μL of Biotinylated Human MSLN Protein (MSN-H82E9-200ug, purchased from Acro, 3 μg / mL) working solution was added and mixed. The mixture was incubated at room temperature for 1 h at 1500 rpm / 3 min, and the waste liquid was discarded. 200 μL of PBS was added, and the mixture was gently mixed and resuspended at 1500 rpm / 3 min, and the waste liquid was discarded. 200 μL of PBS was added to the NC tubes for resuspending, and 200 μL of PBS was added to the sample tubes for resuspending, and then 5 μL of APC-conjugated... Steptavidin (brand: Biolegend, catalog number: 405207) working solution was mixed thoroughly; after incubation at room temperature in the dark for 1 hour, the mixture was centrifuged at 1500 rpm for 3 minutes, and the waste liquid was discarded. The cells were then gently washed three times with PBS + 2% BSA, centrifuged at 1500 rpm for 3 minutes, and the waste liquid was discarded. 100 μL of PBS was added, and the cells were gently mixed and resuspended before being analyzed by an instrument (brand: ACEA, model: NovoCyte D3000). The results are shown in Figure 2, which indicates that the expression efficiency of CAR was 79.67%.
[0119] Example 4: CAR-T cell killing experiment on gastric cancer cells
[0120] To detect the MSLN targeting of MSLN-CAR-T cells in killing gastric cancer cells, HGC-27 (Chinese Academy of Sciences, SCSP-5263) cell line was infected with an MSLN-overexpressing lentivirus, and MSLN-overexpressing HGC-27 cells were obtained using puromycin (A610593-0025, Sangon Biotech). The specific procedures are as follows:
[0121] The MSLN extracellular region gene (GenBank: NM_0058 23.6) from section 1.1 of Example 1 was compared with the P2A, PGK promoter, and puromycin resistance gene puro. r The sequence was tandemly linked and synthesized (sequence synthesis company: Sangon Biotech), and restriction endonucleases HindIII (R3104S, NEB) and KpnI (R3142V, BioLabs) were added to both ends before insertion into the pSLCAR-BBz plasmid (0135992, BioVector) vector to construct the MSLN overexpression plasmid. The plasmid was transformed into DH5α (18258012, Thermo) competent cells, plated on ampicillin-resistant plates, and incubated overnight at 37°C. Single clones were picked and sequenced for identification. Successfully constructed clones were expanded. The reconstructed plasmid and two packaging plasmids, psPAX2 and pMD2.G (JY03027, Jiangyuan Biotechnology), were extracted using an endotoxin-free plasmid large-scale extraction kit (MN, 740424.50). Concentration and purity were measured using a spectrophotometer for subsequent MSLN overexpression lentivirus packaging.
[0122] P2A nucleotide sequence:
[0123] PGK promoter nucleotide sequence:
[0124] Puromycin resistance gene puro r Nucleotide sequence:
[0125] MSLN overexpression lentivirus was packaged in 293T cells (SCSP-502, Chinese Academy of Sciences Cell Bank). The specific packaging steps are as follows:
[0126] 1) Plating within 24 hours before transfection: Generally, 293T cells with a passage number of no more than 3 are selected. The cell density is adjusted according to the cell growth density and state. 293T cells with a growth density of 80% are plated. When the growth density reaches 60-90% and the cells are in good condition, virus packaging can be performed.
[0127] 2) Use MSLN overexpression vector plasmid, packaging plasmid psPAX2, and packaging plasmid pMD2.G in a plasmid ratio of 4:3:1. Use lipofectamine 2000 (stored at 4℃) as the transfection reagent and add 2 μL / μg of plasmid.
[0128] 3) Mix the plasmid mixture and the transfection reagent mixture in one tube, let it stand at room temperature for 20 min, then add it to the cells in the medium and continue culturing. Collect the culture supernatant after 48 h and 72 h, respectively, and filter it through a 0.45 μm filter membrane (54513-RC, Thermo).
[0129] 4) The collected viral fluid was concentrated using the PEG8000 (89510-1kg, SIGMA) concentration method, and the viral titer was determined by infecting 293T cells and by subsequent flow cytometry detection of the MSLN positivity rate of infected 293T cells. The virus was stored at -80℃ for later use.
[0130] 5) HGC-27 (Chinese Academy of Sciences, SCSP-5263) cells were revived and passaged, cell counts were performed, and the final concentration was adjusted to 5 × 10⁻⁶. 6 Add 400 μL of cell suspension to each well, i.e., add 2 × 10⁶ cells / mL. 6 Cells were infected with an MOI of 5. 1 mL of MSLN overexpression lentivirus culture medium suspension was prepared and added to the cell suspension. The cells were centrifuged at 1000g for 30 min, and the centrifuge temperature was adjusted to 32℃. Cells were then transferred to a 75 cm⁻¹ container containing 20 mL of culture medium, depending on their condition. 2 The cells were expanded in culture flasks. During the expansion culture, puromycin (A610593-0025, Sangon Biotech) was added to the culture medium at a concentration of μg / mL, and the concentration was maintained at 1.5 μg / mL. After 4-5 passages, MSLN-positive HGC-27 cells were obtained. MSLN-overexpressing HGC-27 cells were then analyzed by flow cytometry.
[0131] The HGC-27 cells and HGC-27 cells overexpressing MSLN were subjected to an MSLN-CAR-T experiment. The results showed that the extracellular MSLN expression of HGC-27-OE cells was significantly increased compared with that of HGC-27 cells (1.59% vs 84.8%), indicating that the constructed MSLN-overexpressing HGC-27 cells can be used to verify the tumor killing targeting of the above-mentioned CAR-T cells.
[0132] The anti-tumor effect of CAR-T cells was detected by in vitro co-culture assays. HGC-27 cells overexpressing MSLN in logarithmic growth phase and SKOV3 tumor cells naturally overexpressing MSLN (2 × 10⁻⁶ cells) were used. 4CAR-T cells (or CD19-targeted CAR-CD19) were seeded in 96-well cell culture plates at an effector-to-target ratio of 10:1. After co-culturing for 24 h, 3 μL of fluorescein potassium salt (15 mg / mL) was added to each well, and the cells were incubated for 5 min. The absorbance at 562 nm was then measured using a multi-mode microplate reader. The killing efficiency of CAR-T cells was calculated based on the absorbance values of different treatment groups. The killing efficiency was calculated as follows: Killing efficiency % = (1 - Fluorescence value of experimental group / Fluorescence value of negative control group) × 100%. The negative control group consisted of normally growing MSLN-overexpressing HGC-27 cells without CAR-T cells. CD19 was used as a control sequence, and its amino acid sequence is as follows:
[0133] Its nucleotide sequence is as follows:
[0134] As shown in Figure 3, the killing efficiencies of MSLN-CAR targeting MSLN and CD19-CAR targeting CD19 (an unrelated control) against MSLN-overexpressing HGC-27 cells and SKOV3 tumor cells were 74.20% and 5.06%, and 82.34% and 6.21%, respectively, indicating that the MSLN-targeting CAR-T cells prepared in this invention have good specific killing activity against MSLN-positive tumor cells (P<0.0001).
[0135] Example 5: In vivo tumor-killing activity of MSLN-CAR-T
[0136] Male C57BL6 mice aged 6–8 weeks (purchased from Nanjing Junke Biotechnology Co., Ltd.) were housed in the animal room (room temperature 23±2℃, humidity 50%±10%) and administered the drugs via routine subcutaneous injection (injection volume 2×10⁻⁶). 6 Tumor modeling was performed in mice using SKOV3 cells (cells / mouse). The appearance of a hard nodule the size of a grain of rice in the armpit was considered a successful modeling.
[0137] C57BL6 ovarian cancer model mice, tumor tissue blocks 100 mm 3 At approximately 10:00 AM, participants were randomly divided into two groups (regular-T and MSLN-CAR-T), and received two consecutive tail vein injections of 5 × 10⁻⁶ cells on days 0 and 7, respectively. 6 Effector cells. Tumor volume was measured in tumor-forming mice on days 0, 7, 14, 21, 28, and 35. The results are shown in Figure 4. Tumor growth in the MSLN-CAR-T treatment group was significantly inhibited.
[0138] The above description is merely an example and illustration of the present invention. Those skilled in the art can make various modifications or additions to the specific embodiments described, or use similar methods to replace them, as long as they do not deviate from the invention or exceed the scope defined in the claims, they should all fall within the protection scope of the present invention.
Claims
1. An anti-MSLN antibody or its antigen-binding fragment, comprising CDR-H1, CDR-H2 and CDR-H3 of SEQ ID NO: 10 and CDR-L1, CDR-L2 and CDR-L3 of SEQ ID NO:
17.
2. The anti-MSLN antibody or its antigen-binding fragment according to claim 1, wherein CDR-H1 comprises the amino acid sequence of SEQ ID NO: 11; CDR-H2 comprises the amino acid sequence of SEQ ID NO: 12; and CDR-H3 comprises the amino acid sequence of SEQ ID NO: 13; CDR-L1 comprises the amino acid sequence of SEQ ID NO: 14; CDR-L2 comprises the amino acid sequence of SEQ ID NO: 15; and CDR-L3 comprises the amino acid sequence of SEQ ID NO:
16.
3. The anti-MSLN antibody or its antigen-binding fragment according to claim 1 or 2, wherein the anti-MSLN antibody comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 96% sequence identity with SEQ ID NO: 10, and the light chain variable region comprising SEQ ID NO: 17 or an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 96% sequence identity with SEQ ID NO:
17.
4. The anti-MSLN antibody or its antigen-binding fragment according to any one of claims 1-3, wherein the antigen-binding fragment is one or more of Fab', Fab, F(ab')2, Fd fragment, dAb fragment, camel antibody, nanobody and single-chain Fv; optionally, the single-chain Fv comprises the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence having at least 80%, at least 90%, at least 95% or at least 96% sequence identity with the amino acid sequence shown in SEQ ID NO:
1.
5. An MSLN-specific chimeric antigen receptor comprising an MSLN antigen-binding domain, a transmembrane domain, and an intracellular signal transduction domain, wherein the MSLN antigen-binding domain comprises an anti-MSLN antibody or its antigen-binding fragment according to any one of claims 1-4, preferably the MSLN antigen-binding domain comprising the amino acid sequence shown in SEQ ID NO:
1.
6. The MSLN-specific chimeric antigen receptor according to claim 5, wherein the transmembrane domain has the amino acid sequence shown in SEQ ID NO:
3.
7. The MSLN-specific chimeric antigen receptor according to claim 5 or 6, wherein the intracellular signal transduction domain comprises a 4-1BB co-stimulatory signaling molecule and a human CD3ζ signal transduction domain, optionally, the 4-1BB co-stimulatory signaling molecule has the amino acid sequence shown in SEQ ID NO: 4, and optionally, the human CD3ζ signal transduction domain has the amino acid sequence shown in SEQ ID NO:
5.
8. The MSLN-specific chimeric antigen receptor according to any one of claims 5-7, wherein the chimeric antigen receptor further comprises a hinge region connecting the MSLN antigen-binding domain and the transmembrane domain, optionally the hinge region having an amino acid sequence as shown in SEQ ID NO: 6, optionally the chimeric antigen receptor further comprises a signal peptide at its N-terminus, optionally the signal peptide having an amino acid sequence as shown in SEQ ID NO:
7.
9. The MSLN-specific chimeric antigen receptor according to any one of claims 5-8, wherein the chimeric antigen receptor has an amino acid sequence as shown in SEQ ID NO:
8.
10. An isolated nucleic acid molecule encoding an anti-MSLN antibody according to any one of claims 1-4 or an MSLN-specific chimeric antigen receptor according to any one of claims 5-9; optionally, the nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID NO: 2 or SEQ ID NO:
9.
11. An expression vector comprising the nucleic acid molecule according to claim 10.
12. A host cell comprising the isolated nucleic acid molecule according to claim 10 or the expression vector according to claim 11.
13. The host cell of claim 12, wherein the host cell comprises immune cells, optionally including one or more of T cells, B cells, NK cells, monocytes, macrophages, and dendritic cells.
14. Use of the anti-MSLN antibody according to any one of claims 1-4, the MSLN-specific chimeric antigen receptor according to any one of claims 5-9, the isolated nucleic acid molecule according to claim 10, the expression vector according to claim 11, or the host cell according to claim 12 or 13 in the preparation of a medicament for the prevention and / or treatment of cancers overexpressing MSLN, preferably, the cancer being one or more of gastric cancer, mesothelioma, pancreatic cancer, non-small cell lung cancer, lung adenocarcinoma, fallopian tube cancer, head and neck cancer, cervical cancer, and ovarian cancer.
15. A method for preventing and / or treating cancers overexpressing MSLN in a subject, comprising administering to the subject an anti-MSLN antibody according to any one of claims 1-4, an MSLN-specific chimeric antigen receptor according to any one of claims 5-9, an isolated nucleic acid molecule according to claim 10, an expression vector according to claim 11, or a host cell according to claim 13, preferably, the cancer being one or more of gastric cancer, mesothelioma, pancreatic cancer, non-small cell lung cancer, lung adenocarcinoma, fallopian tube cancer, head and neck cancer, cervical cancer, and ovarian cancer.