NAV1.8 targeting antisense oligonucleotides and uses thereof

Abstract

Provided are modified NAV1.8 targeting antisense oligonucleotides, comprising compositions of the modified oligonucleotides, methods of regulating NAV1.8 expression, and methods of treating, alleviating, or preventing NAV1.8-related diseases or symptoms.

Description

NAV1.8 TARGETING ANTISENSE OLIGONUCLEOTIDES AND USES THEREOFFIELD OF THE INVENTION

[0001] The present invention relates to the field of biomedicine and pharmaceutical chemistry. More specifically, the present invention relates to modified NAV1.8 targeting antisense oligonucleotides, compositions comprising the modified oligonucleotides, methods of regulating NAV1.8 expression, and methods of treating, alleviating, or preventing NAV1.8-related diseases or symptoms.BACKGROUND

[0002] Voltage-gated sodium channels (VGSCs / Navs) are essential components in the generation of action potentials and current conduction in neurons, serving as key ion channels for action potentials in excitable cells, and play significant physiological roles. VGSC is associated with various diseases, such as epilepsy, arrhythmia, and neuropathic pain.

[0003] VGSC is a transmembrane protein composed of one α subunit and one or more different β subunits. The α subunit of mammalian VGSC contains approximately 2000 amino acid residues and is divided into 10 subtypes (Nav1.1～Nav1.9 and Nax) . Each α subunit is composed of four highly similar but not completely identical homologous domains (DI～DIV) , with each domain containing 6 transmembrane segments (S1～S6) with α-helices, of which S1～S4 constitute the voltage-sensing domain (VSD) , and S5～S6 and extracellular loop (P-loop) constitute the pore domain (PD) .

[0004] VGSC-mediated selective transmembrane flow of sodium ions plays a critical role in the initiation, conduction, and transmission of action potentials in excitable cells such as neurons (Catterall et al., Pharmacol Rev. 2005, 57 (4) : 397-409) . The Nav family includes nine subtypes, namely Nav1.1 to Nav1.9, which regulate a variety of important physiological and pathological processes in the human body by acting on Nav (Black et al., Neuron. 2013, 80 (2) : 280-91; Catterall et al., Annu Rev Pharmacol Toxicol. 2014, 54: 317-38; Bennett et al., Physiol Rev. 2019, 99 (2) : 1079-1151) . Nav1.1, Nav1.2, Nav1.3, and Nav1.6 are expressed in both the central and peripheral nervous systems, Nav1.4 is primarily expressed in skeletal muscle, Nav1.5 is mainly expressed in cardiomyocytes, while Nav1.7, NAV1.8, and Nav1.9 are predominantly expressed in the peripheral nervous system. The functional behaviors of these nine subtypes are similar, but they differ in specific aspects of voltage dependence and kinetic behavior.

[0005] NAV1.8 (encoded by SCN10A gene) is essential for the transmitting electrical signals associated with nociceptive stimuli, particularly in chronic pain, where its role is especially prominent. Due to the critical role of NAV1.8 in pain transduction, NAV1.8 is an important target for the development of novel analgesic drugs. Recent studies have shown that inhibiting the function of NAV1.8 channels can effectively alleviate symptoms of chronic pain, including inflammatory and neuropathic pain. Although therapies targeting NAV1.8 have shown great potential, further clinical studies are needed to verify their safety and efficacy, as well as to explore possible side effects.

[0006] Antisense oligonucleotides (ASOs) are short single-stranded oligonucleotides that can exert effects on their target sequences by specifically targeting them. For example, ASOs are known to bind to target gene mRNA through base complementary pairing mechanism, leading to mRNA degradation under the action of ribonuclease H1 (RNase H1) , thereby inhibiting the expression of the target gene. Oligonucleotide technology not only possesses gene targeting capabilities but also allows for entry of cells without the need for a delivery system (Crooke ST, Baker BF, Crooke RM, Liang XH. Antisense technology: an overview and prospectus. Nat Rev Drug Discov. 2019; 20 (6) : 427-453. doi: 10.1038 / s41573-021-00162-z) , thus making it simple to operate, cost-effective, and convenient to large-scale production. Therefore, the use of ASO technology to develop therapies targeting NAV1.8 holds great practical prospects.SUMMARY OF THE INVENTION

[0007] In one aspect, the present disclosure provides an oligonucleotide, wherein the oligonucleotide:

[0008] (a) comprises any one of nucleotide sequence of SEQ ID NOs: 1-45 or a variant sequence with at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%identity to any one of SEQ ID NOs: 1-45;

[0009] (b) is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%complementary to any one of nucleotide sequence of SEQ ID NO: 46-90;

[0010] (c) comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 contiguous nucleotides that are complementary to a target region spanning from positions 167 to 184, 3821 to 3838, 1201 to 1218, 3171 to 3186, 2365 to 2382, 3777 to 3794, 4240 to 4257, 3937 to 3954, 1281 to 1298, 5948 to 5965, 5923 to 5940, 4269 to 4286, 3906 to 3923, 5773 to 5790, 3800 to 3817, 4170 to 4187, 5968 to 5985, 4136 to 4153, 4001 to 4018, 4135 to 4152, 4154 to 4171, 1113 to 1130, 1646 to 1663, 2196 to 2213, 1764 to 1781, 4441 to 4458, 2207 to 2224, 1134 to 1151, 3911 to 3928, 3216 to 3233, 3807 to 3824, 2801 to 2818, 1598 to 1615, 3156 to 3173, 2187 to 2204, 5452 to 5469, 5989 to 6006, 2034 to 2051, 2303 to 2320, 3765 to 3782, 3876 to 3893, 3404 to 3421, 1541 to 1558, 3831 to 3848, 2727 to 2744 of mRNA sequence of a NAV1.8 encoding gene; and / or

[0011] (d) comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleotides that are complementary to a target region spanning from positions 167 to 184, 3821 to 3838, 1201 to 1218, 3171 to 3186, 2365 to 2382, 3777 to 3794, 4240 to 4257, 3937 to 3954, 1281 to 1298, 5948 to 5965, 5923 to 5940, 4269 to 4286, 3906 to 3923, 5773 to 5790, 3800 to 3817, 4170 to 4187, 5968 to 5985, 4136 to 4153, 4001 to 4018, 4135 to 4152, 4154 to 4171, 1113 to 1130, 1646 to 1663, 2196 to 2213, 1764 to 1781, 4441 to 4458, 2207 to 2224, 1134 to 1151, 3911 to 3928, 3216 to 3233, 3807 to 3824, 2801 to 2818, 1598 to 1615, 3156 to 3173, 2187 to 2204, 5452 to 5469, 5989 to 6006, 2034 to 2051, 2303 to 2320, 3765 to 3782, 3876 to 3893, 3404 to 3421, 1541 to 1558, 3831 to 3848, 2727 to 2744 of SEQ ID NO: 91.

[0012] In some embodiments, the oligonucleotide optionally comprises one or more modifications.

[0013] In some embodiments, the modification of the oligonucleotide comprises one or more base modifications, sugar modifications, and / or internucleoside linkage modifications.

[0014] In some embodiments, (a) the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, and / or 10th nucleosides from the 5' end of the oligonucleotide comprise a modification; and / or (b) the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, and / or 10 nucleosides from the 3' end of the oligonucleotide comprise a modification.

[0015] In some embodiments, (a) 1, 2, 3, 4, 5, 6, 7, 8, 9 and / or 10 contiguous nucleosides from the 5' end of the oligonucleotide comprise a modification; and / or (b) 1, 2, 3, 4, 5, 6, 7, 8, 9 and / or 10 contiguous nucleosides from the 3' end of the oligonucleotide comprise a modification.

[0016] In some embodiments, (a) the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, and / or 10th nucleosides from the 5' end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise a modification; and / or (b) the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, and / or 10th nucleosides from the 3' end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise a modification.

[0017] In some embodiments, (a) 1, 2, 3, 4, 5, 6, 7, 8, 9 and / or 10 contiguous nucleosides from the 5' end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise a modification; and / or (b) 1, 2, 3, 4, 5, 6, 7, 8, 9 and / or 10 contiguous nucleosides from the 3' end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise a modification.

[0018] In some embodiments, the base modification of the oligonucleotide is selected from the group consisting of: pseudouracil (ψ) , N1-methylpseudouracil (N1Mψ) , 1-ethylpseudouracil, 2-thiouracil (s2U) , 4-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil and a combination thereof.

[0019] In some embodiments, the sugar modification of the oligonucleotide comprises a 2' sugar modification.

[0020] In some embodiments, the sugar modification of the oligonucleotide is selected from the group consisting of: Locked Nucleic Acid (LNA) modification, 2'-O-methyl (Me) modification, 2'-O-ethyl modification, 2'-O-methoxyethyl (MOE) modification, 2'-F modification and a combination thereof.

[0021] In some embodiments, (a) 1, 2, 3, 4, 5, 6, 7, 8, 9 and / or 10 contiguous nucleosides from the 5' end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise LNA modification for each nucleoside and / or 5-methylcytosine substitution for each cytosine present; and / or (b) 1, 2, 3, 4, 5, 6, 7, 8, 9 and / or 10 contiguous nucleosides from the 3' end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise LNA modification for each nucleoside and / or 5-methylcytosine substitution for each cytosine present.

[0022] In some embodiments, (a) 4 contiguous nucleosides from the 5’ end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise LNA modification for each nucleoside and 5-methylcytosine substitution for each cytosine present, optionally, the LNA modification is methyleneoxy (4’-CH2-O-2’) LNA modification; and / or (b) the 4 contiguous nucleosides from the 3’ end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise LNA modification for each nucleoside and 5-methylcytosine substitution for each cytosine present, optionally, the LNA modification is methyleneoxy (4’-CH2-O-2’ ) LNA modification.

[0023] In some embodiments, at least one internucleoside linkage between two adjacent nucleosides of the oligonucleotide is a phosphorothioate linkage.

[0024] In some embodiments, each internucleoside linkage within any nucleotide sequence of SEQ ID NOs: 1-45 or the variant sequence thereof is a phosphorothioate linkage.

[0025] In some embodiments, (a) 4 contiguous nucleosides from the 5’ end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise LNA modification for each nucleoside and 5-methylcytosine substitution for each cytosine present, optionally, the LNA modification is methyleneoxy (4’-CH2-O-2’) LNA modification; and / or (b) the 4 contiguous nucleosides from the 3’ end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise LNA modification for each nucleoside and 5-methylcytosine substitution for each cytosine present, optionally, the LNA modification is methyleneoxy (4’-CH2-O-2’) LNA modification; and (c) each internucleoside linkage within any nucleotide sequence of SEQ ID NOs: 1-45 or the variant sequence thereof is a phosphorothioate linkage.

[0026] In some embodiments, the oligonucleotide is capable of lowering mRNA transcription of NAV1.8 gene and / or promoting mRNA degradation of NAV1.8 gene.

[0027] In some embodiments, the oligonucleotide lowers mRNA transcription of NAV1.8 gene and / or promotes mRNA degradation of NAV1.8 gene by recruiting ribonuclease (RNase) .

[0028] In some embodiments, the ribonuclease is RNase H.

[0029] In some embodiments, the ribonuclease is RNase H1.

[0030] In some embodiments, the oligonucleotide is single-stranded.

[0031] In some embodiments, the oligonucleotide is a gapmer motif.

[0032] In some embodiments, the gapmer motif comprises an internal gap region flanked by a 3' flanking region and a 5' flanking region.

[0033] In some embodiments, the gapmer motif is represented by the formula X-Y-Z, wherein X represents the 5' flanking region, Y represents the internal gap region, and Z represents the 3' flanking region, wherein X and Z are each independently composed of 3, 4 or 5 contiguous nucleotides, Y is composed of 10, 11, 12, 13, 14 or 15 contiguous nucleotides.

[0034] In some embodiments, the gapmer motif is a 5-10-5, 4-10-4, 4-10-4, 2-14-3, 4-12-3, 4-13-2, 3-12-4, 2-13-4, 3-10-3, 3-11-3, 3-12-3 or 3-13-3 gapmer motif, wherein the numbers represent the number of contiguous nucleotides in X, Y, and Z, respectively.

[0035] In some embodiments, the gapmer motif is 1_1-13-3, 3-13-1_1, 4-12-1_1, or 1_1-12-4 gapmer, wherein the numbers represent the number of contiguous nucleotides in X, Y, and Z, respectively, except that “1_1” indicates a nucleotide triplet wherein the first nucleotide and the third nucleotide of the triplet comprise a sugar modification, and the second nucleotide comprises an unmodified sugar.

[0036] In some embodiments, the second nucleotide comprising an unmodified sugar is a ribonucleotide.

[0037] In some embodiments, the 5’ flanking region and / or the 3’ flanking region consists of contiguous nucleotides and the internal gap region consists of contiguous deoxynucleosides.

[0038] In some embodiments, each nucleotide in the 5’ flanking region and / or in the 3’ flanking region comprise 2'-O-methoxyethyl (MOE) modification or Locked Nucleic Acid (LNA) modification.

[0039] In some embodiments, each cytosine in the 5’ flanking region and / or in the 3’ flanking region is 5-methylcytosine.

[0040] In some embodiments, each internucleoside linkage within the gapmer motif or within the oligonucleotide is a phosphorothioate linkage.

[0041] In some embodiments, the chemical structure of the oligonucleotide is according to Table 1.

[0042] In some embodiments, the oligonucleotide is covalently linked to a conjugate portion.

[0043] In some embodiments, the conjugate portion is capable of specifically targeting to target cells.

[0044] In some embodiments, the conjugate portion comprises N-acetylgalactosamine (GalNAc) , antibody or antigen-binding fragment.

[0045] In some embodiments, the oligonucleotide is a pharmaceutically acceptable salt.

[0046] In one aspect, the present disclosure provides a composition comprising the oligonucleotide provided herein.

[0047] In some embodiments, the composition is a pharmaceutical composition, and the pharmaceutical composition optionally comprises a pharmaceutically acceptable carrier.

[0048] In one aspect, the present disclosure provides a vector comprising the oligonucleotide provided herein.

[0049] In one aspect, the present disclosure provides a method of regulating the expression of NAV1.8 in NAV1.8 expressing target cells, comprising exposing the target cells to the oligonucleotide, the composition, and / or the vector provided herein.

[0050] In one aspect, the present disclosure provides a method of downregulating NAV1.8 expression in NAV1.8 expressing target cells, comprising exposing the target cells to the oligonucleotide, the composition, and / or the vector provided herein.

[0051] In some embodiments, the target cells are neural cells.

[0052] In some embodiments, the target cells are dorsal root ganglion (DRG) neurons.

[0053] In one aspect, the present disclosure provides a method of treating, alleviating, or preventing a disease or symptom, comprising administering an effective amount of the oligonucleotide, the composition, and / or the vector provided herein to a subject in need thereof.

[0054] In some embodiments, the disease or symptom is a NAV1.8-mediated disease or symptom.

[0055] In some embodiments, the disease or symptom is a NAV1.8-mediated disease or symptom is selected from chronic pain, neuropathic pain, inflammatory pain, musculoskeletal pain, gut pain, spontaneous pain, nociceptive pain, cancer pain, idiopathic pain, postsurgical pain, visceral pain, multiple sclerosis, Charcot-Marie-Tooth syndrome, incontinence, pathological cough, or cardiac arrhythmia. In certain embodiments, the disease or symptom comprises inflammatory pain, musculoskeletal pain and / or neuropathic pain.

[0056] In some embodiments, the disease or symptom is neuropathic pain, the neuropathic pain comprises post-herpetic neuralgia, diabetic neuralgia, small fiber neuropathy, idiopathic small-fiber neuropathy, painful HIV-associated sensory neuropathy, trigeminal neuralgia, burning mouth syndrome, post-amputation pain, phantom pain, painful neuroma, traumatic neuroma, Morton's neuroma, nerve entrapment injury, spinal stenosis, carpal tunnel syndrome, radicular pain, sciatica pain, nerve avulsion injury, brachial plexus avulsion injury, complex regional pain syndrome, drug therapy induced neuralgia, cancer chemotherapy induced neuralgia, anti-retroviral therapy induced neuralgia, post spinal cord injury pain, idiopathic small-fiber neuropathy, idiopathic sensory neuropathy and / or trigeminal autonomic cephalalgia.

[0057] In some embodiments, the disease or symptom is musculoskeletal pain.

[0058] In some embodiments, the musculoskeletal pain comprises osteoarthritis pain, back pain, cold pain, burn pain or dental pain.

[0059] In some embodiments, the disease or symptom is inflammatory pain.

[0060] In some embodiments, the inflammatory pain is rheumatoid arthritis pain.

[0061] In some embodiments, the subject is a mammal (e.g., human) .

[0062] In one aspect, the present disclosure provides a kit for implementing the method.BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1. The effect of SCN10A-specific ASO on human Nav1.8 protein expression in hNav1.8 / HEK293 cells.

[0064] Figure 2. Current-density-voltage curve of hNav1.8 / CHO cells treated with exemplary SCN10A-specific ASOs.

[0065] Figure 3. Inhibition of action potential firing in monkey DRG neurons by exemplary SCN10A-specific ASO. A) Example traces. B) Summary data (unpaired t-test, **p<0.01) .

[0066] Figure 4. In vitro knockdown activity of SCN10A-specific ASO on endogenous Nav1.8 mRNA and protein expression in rat primary DRG neurons. A) Relative Nav1.8 mRNA expression measured by qPCR. B) Nav1.8 protein expression level measured by Western blotting.

[0067] Figure 5. In vivo knockdown activity of SCN10A-specific ASO on Nav1.8 mRNA and protein expression in rats. A) Relative Nav1.8 mRNA expression measured by qPCR. B) Nav1.8 protein expression level measured by Western blotting.DETAILED DESCRIPTION OF THE INVENTION

[0068] Although this application will disclose various aspects and embodiments, it is obvious that, without deviating from the main purpose and scope of the present invention, those skilled in the art may make various equivalent changes and modifications to these aspects and embodiments. The various aspects and embodiments disclosed in this application are for illustrative purposes only and are not intended to limit the true scope as defined by the appended claims. All publications, patents, or patent applications cited in this application are incorporated by reference in their entirety into this application. Unless otherwise indicated, all technical terms used in this application have the same meaning as understood by those skilled in the art to which this invention pertains. I. Definitions

[0069] As used herein and in the appended claims, the singular forms “a” , “an” , “one” , and “the” include plural references unless the context clearly dictates otherwise. The terms “a” (or “an” ) , “one or more” , and “at least one” may be used interchangeably in this application.

[0070] As used in this application, the term “comprises, ” “contains” , “includes” and “having” and the like means to include the stated elements, integers, or steps, but does not exclude any other elements, integers, or steps. In this application, when the terms “comprises, ” “contains” , “includes” and “having” are used, unless otherwise indicated, they also comprise situations being consisted of the stated elements, integers, or steps. For example, when referring to “comprises” a specific sequence, it is intended to cover not only situations where other elements (e.g., nucleotides or amino acids) are present at both ends of the specific sequence, but also situations being consisted solely of that specific sequence. It should also be noted that the terms “comprises, ” “contains” , “includes” and “having” can be used interchangeably.

[0071] In this application, the term “approximately” generally refers to a variation of 0.5%-10%above or below the specified value, for example, a variation of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10%above or below the specified value. For example, “approximately 80%” refers to any value within the range of 72%-88%.

[0072] The term “NAV1.8” as used in this application refers to the voltage-gated sodium channel protein (Voltage-gated sodium channels) NAV1.8, and includes any variants, conformations, isoforms, and species homologs of NAV1.8 expressed through natural cellular expression or through cells transfected with the NAV1.8 encoding gene. For example, the NAV1.8 described herein can refer to NAV1.8 derived from any vertebrate source, including mammals such as primates (e.g., humans, monkeys) and rodents (e.g., mice and rats) . An exemplary amino acid sequence of human NAV1.8 is shown as GenBank Accession Number NP_006505.4, the exemplary amino acid coding sequence (i.e., mRNA sequence) of human NAV1.8 is shown as GenBank Accession Number NM_006514.4 (SEQ ID NO: 91) . An exemplary amino acid sequence of Macaca fascicularis NAV1.8 is shown as GenBank Accession Number XP_005546741.3, and the exemplary amino acid coding sequence (i.e., mRNA sequence) of Macaca fascicularis NAV1.8 is shown as GenBank Accession Number XM_005546684.5. An exemplary amino acid sequence of rat NAV1.8 is shown as GenBank Accession Number NP_058943.2, and the exemplary amino acid coding sequence (i.e., mRNA sequence) of rat NAV1.8 is shown as GenBank Accession Number NM_017247.2. An exemplary amino acid sequence of mouse NAV1.8 is shown as GenBank Accession Number NP_001192250.1, and the exemplary amino acid coding sequence (i.e., mRNA sequence) of mouse NAV1.8 is shown as GenBank Accession Number NM_001205321.1. Those skilled in the art can also obtain other exemplary amino acid sequences and mRNA sequences of NAV1.8 from publicly available databases (e.g., GenBank, UniProt, OMIM, etc. ) .

[0073] The term "NAV1.8" used in this application is intended to cover any form of NAV1.8, for example 1) naturally unprocessed NAV1.8 molecules, "full-length" NAV1.8 chains, or naturally occurring variants of NAV1.8, including, for example, splice variants or allele variants; 2) any form of NAV1.8 produced by cellular processing; or 3) full-length, fragments (e.g., truncated forms, extracellular / transmembrane domain) or modified form (e.g., mutant form, glycosylated / pegylated, His-tag / immunofluorescent fusion form) of NAV1.8 subunits produced by recombinant methods.

[0074] The term "NAV1.8 encoding gene" or "SCN10A" used in this application also includes naturally occurring DNA sequence variants of the NAV1.8 encoding gene, such as single nucleotide polymorphism (SNP) of the NAV1.8 encoding gene. Exemplary SNPs for the NAV1.8 encoding gene can be found in the dbSNP database (https:  / / www. ncbi. nlm. nih. gov / variation / view / ) . Non-limiting examples of variants of the NAV1.8 encoding gene sequence include, for example, Reference SNP (refSNP) Cluster Report: XXX, etc. (which can be queried at the following website www. ncbi. nlm. nih. gov / SNP) .

[0075] The term “targeting” as used in this application refers to the ability to specifically bind to a target nucleic acid (DNA or RNA, such as mRNA) . For example, a “NAV1.8 targeting” oligonucleotide refers to an oligonucleotide capable of specifically binding to the NAV1.8 encoding gene or its regions or segments, or to NAV1.8 encoding mRNA or its regions or segments that encode NAV1.8 product. In some embodiments, the NAV1.8 targeting oligonucleotides provided herein specifically hybridize with the target nucleic acid (DNA or RNA, such as mRNA) . In some embodiments, the NAV1.8 targeting oligonucleotides provided herein specifically hybridize with the target nucleic acid (DNA or RNA, such as mRNA) through complementary base pairing.

[0076] The term "specific hybridization" or "specifically hybridize" as used in this application refers to a degree of complementarity between an antisense oligonucleotide and a target nucleic acid being sufficient to produce a desired effect under physiological conditions for in vitro or in vivo analytical or therapeutic treatment, while not substantially binding to non-target nucleic acids or their regions or segments, or only minimally binding to non-target nucleic acids or their regions or segments.

[0077] In this application, the terms “G” , “C” , “A” , “T” and “U” typically refer to nucleotides containing guanine, cytosine, adenine, thymine, and uracil as bases, respectively. It is understood by those skilled in the art that the terms “deoxyribonucleotide, ” “ribonucleotide, ” and “nucleotide” can refer to both unmodified and modified nucleotides, such as those modified by Locked Nucleic Acid (LNA) , 2'-O-methyl (Me) modification, 2'-O-ethyl modification, 2'-O-methoxyethyl (MOE) modification, and / or 2'-fluoro (F) modification. Those skilled in the art will also understand that guanine, cytosine, adenine, thymine, and uracil can be replaced by other moieties without substantially altering the base-pairing properties of the oligonucleotides containing nucleotides with these substitutions. For example, a nucleotide with hypoxanthine as the base can base-pair with nucleotides containing adenine, cytosine, or uracil. Therefore, nucleotides containing thymine, guanine, or adenine can be replaced by nucleotides with hypoxanthine in the oligonucleotide sequences provided by this invention. Additionally, adenine and cytosine in the oligonucleotides can be replaced by guanine and uracil, respectively, to form G-U Wobble base pairing with the target mRNA.

[0078] The term “oligonucleotide” as used in this application refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA) .

[0079] The term “antisense oligonucleotide” as used in this application refers to an oligonucleotide that has a nucleotide sequence complementary to a target nucleic acid (such as a target gene, an mRNA molecule being capable of encoding a target protein, etc. ) or its region or segment thereof. For example, a “NAV1.8 targeting antisense oligonucleotide” is capable of being complementary to an mRNA molecule or its region or segment being capable of encoding the NAV1.8 protein. An antisense oligonucleotide can specifically hybridize with a target nucleic acid or its region or segment, thereby interfering with the normal function of the target nucleic acid, for example, by causing RNase H-mediated cleavage of the target nucleic acid, hindering ribosomal translation of the target protein, or regulating RNA splicing, etc. Typically, most of the nucleotides in an antisense oligonucleotide are ribonucleotides; however, as described in this application, the antisense oligonucleotides provided herein may also include one or more nucleotides that are not ribonucleotides, such as one or more deoxyribonucleotides. Moreover, the antisense oligonucleotides provided herein may include chemically modified nucleotides (for example, ribonucleotides or deoxyribonucleotides) and can have substantial modifications at multiple nucleotides.

[0080] The term “complementary” or “complementarity” as used in this application, when describing a first nucleotide sequence relative to a second nucleotide sequence, refers to the ability of the first nucleotide sequence to hybridize with the second nucleotide sequence under certain conditions and form a double-stranded structure. The hybridization conditions can be stringent, meaning that under these conditions, the nucleotide sequence will hybridize with its target sequence but not with other non-complementary sequences. Stringent conditions depend on the sequence and can vary in different situations. Those skilled in the art can determine the conditions for testing the degree of complementarity between two sequences based on the actual situation.

[0081] Complementary sequences include a first nucleotide sequence that base pairs with a second nucleotide sequence over the entire length of one or both nucleotide sequences. In this application, such two nucleotide sequences can be referred to as “fully complementary” to each other. If the first nucleotide sequence is “substantially complementary” to the second nucleotide sequence, the two sequences may be fully complementary, or they may have one or more (but usually no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) mismatched base pairs when hybridizing to form a double-stranded structure up to 50 base pairs, yet still retain the ability to hybridize under certain conditions. If, when the nucleotide of the first nucleotide sequence in the manner of optimally aligned, compared, and appropriately inserted or deleted, is at least about 80% (typically at least about 90%to 95%, and more preferably about 98%to 100%) complementary to the nucleotide of the second nucleotide sequence, then these two nucleotide sequences are referred to be complementary. As used herein, the term “complementary” refers to complementary in equal length portion. The term “fully complementary” refers to 100%complementarity in equal length portion.

[0082] Complementary nucleotides are usually A and T (or A and U) , or C and G. The “complementary” sequences as used in this application can also include non-Watson-Crick base pairing and / or base pairs formed by non-natural and modified nucleotides, as long as they meet the aforementioned requirements regarding to the hybridization capabilities. Such non-Watson-Crick base pairings include, but are not limited to, G-U Wobble base pairing or Hoogsteen base pairing.

[0083] The term “target nucleic acid” as used in this application refers to a nucleic acid molecule that specifically hybridizes with the oligonucleotides (such as antisense oligonucleotides) provided herein. The length of target nucleic acid can be from 10 to 50 nucleotides (for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nucleotides) . For example, target nucleic acid of NAV1.8 targeting oligonucleotides provided herein can be a sequence of 10 to 50 (for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50) contiguous nucleotides of mRNA molecule formed during transcription of NAV1.8 encoding gene. Ranges and lengths between the above ranges and lengths are also considered part of the present invention.

[0084] The term “nucleoside” as used in this application refers to the combination of a base and a sugar. The “nucleobase” (also referred to as “base” ) part of a nucleoside generally refers to the heterocyclic base component. A “nucleotide” is a nucleoside further comprising a phosphate group that is covalently linked to the sugar moiety of the nucleoside. For nucleosides containing a pentose sugar, the phosphate group can be attached to the 2', 3', or 5'hydroxyl group of the sugar. An “oligonucleotide” also referred to as a “polynucleotide” or “nucleotide polymers” is formed by the covalent linkage with adjacent nucleosides, forming a linear polymeric oligonucleotide. In the polynucleotide structure, the phosphate group is typically used to form the internucleoside linkage between the nucleosides of the polynucleotide.

[0085] The term “nucleobase” refers to the heterocyclic base portion of a nucleoside. Nucleobases may be naturally occurring or may be modified. In certain embodiments, a nucleobase may comprise any atom or group of atoms capable of hydrogen bonding to a base of another nucleic acid.

[0086] The percentage of “sequence identity” as used in this application refers to the percentage of identical nucleotides (or amino acids) when a candidate sequence and a reference sequence are aligned, wherein gaps may be introduced if necessary to maximize the number of same nucleotides (or amino acids) . In other words, the percentage of sequence identity for a nucleic acid (or amino acid) sequence can be calculated by dividing the number of bases (or amino acid residues) that are the same as those in the reference sequence by the total number of bases (or amino acid residues) of the candidate sequence or the reference sequence (whichever is shorter) . Conservative substitutions of amino acid residues may or may not be considered as identical residues. The percentage of nucleotide (or amino acid) sequence identity can be determined using various methods, for example, by using publicly available tools such as BLASTN, BLASTp (available on the website of the National Center for Biotechnology Information (NCBI) , see also Altschul S.F. et al., J. Mol. Biol., 215: 403-410 (1990) ; Stephen F. et al., Nucleic Acids Res., 25: 3389-3402 (1997) ) , ClustalW2 (available on the European Bioinformatics Institute's website, see also Higgins D. G. et al., Methods in Enzymology, 266: 383-402 (1996) ; Larkin M.A. et al., Bioinformatics (Oxford, England) , 23 (21) : 2947-8 (2007) ) , and ALIGN or Megalign (DNASTAR) software. Those skilled in the art can use default parameters provided by these tools or customize alignment parameters suitable for the comparison (for example, by selecting appropriate algorithms) .

[0087] The terms “subject” or “individual” as used in this application refer to humans and non-human animals. Non-human animals include all vertebrates, such as mammals and non-mammals. Subjects or individuals can also be livestock, such as cattle, pigs, sheep, poultry, and horses, or pets, such as dogs and cats. A subject or individual can be male (e.g., male) or female (e.g., female) , and can be elderly, adult, adolescent, child, or infant. Humans can be of Caucasian, African, Asian, Semitic, or other ethnic backgrounds, or a mixture of these ethnic backgrounds.

[0088] The term “administration” as used in this application refers to the delivery of a substance to a subject in need thereof. Routes of administration can be topical, oral, intranasal, parenteral, enteral, rectal, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, buccal, sublingual, or ocular. In some embodiments, the substance can be administered to the subject via intravenous, intraperitoneal, or subcutaneous injection using peripheral systemic delivery.

[0089] The term “effective amount” as used in this application refers to the drug dosage that achieves a therapeutic or preventive effect by inhibiting or alleviating a disease, condition, or disorder in a subject, or by preventively inhibiting or preventing the onset of diseases, disorders, or symptoms. An effective amount can be a dosage that relieves one or more symptoms of diseases or disorders to some extent in the subject; partially or completely normalizes one or more physiological or biochemical parameters associated with or leading to the diseases or disorders; and / or reduces the likelihood of the onset of the diseases or disorders. A skilled clinician in the art can determine the effective amount of the agent to treat or prevent a specific disease or disorder upon administration. The precise effective dose will depend on many factors, such as the specific activity of the active substance, the delivery device used, the physical characteristics of the substance, the purpose of administration, and many specific considerations of the patient. Determining the effective amount of dosage that must be administered is a routine practice in the field and falls within the scope of skills of an ordinarily skilled clinician.

[0090] As used in this application, “treatment” of diseases, disorders, or conditions includes prevention or alleviation of the diseases, disorders, or conditions, slowing the onset rate or progression of the diseases, disorders, or conditions, reducing the risk of developing the diseases, disorders, or conditions, preventing or delaying the development of symptoms associated with the diseases, disorders, or conditions, reducing or ending symptoms associated with the diseases, disorders, or conditions, causing complete or partial remission of the diseases, disorders, or conditions, curing the diseases, disorders, or conditions, or some combination thereof.

[0091] In this application, the term “prevention” refers to reducing the probability of a subject to develop a disease, disorder, or condition, where the subject has not yet developed the disease, disorder, or condition but is at risk or prone to developing it.

[0092] Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of the skilled in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar moiety (2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of a uracil of RNA) . Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleotide sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleotide sequence, no matter whether the nucleobases comprised therein are modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases. II. NAV1.8 targeting compounds and uses thereof 1. NAV1.8 targeting compounds

[0093] In one aspect, the present invention provides compounds (such as oligonucleotides, e.g., antisense oligonucleotides) and compositions comprising said compounds, wherein the compounds target NAV1.8 encoding nucleic acids (for example, at least a portion of the region of NAV1.8 encoding mRNA molecules) . In some embodiments, the compounds provided herein is a NAV1.8 targeting compounds.

[0094] In some embodiments, the compounds can be any compound capable of targeting NAV1.8 encoding nucleic acids. In some embodiments, the compounds can be any compound capable of targeting NAV1.8 encoding mRNA. In some embodiments, non-limiting examples of the compound may include: oligonucleotides, oligosaccharides, oligonucleotide analogs, oligonucleotide mimics, small molecule compounds, conjugates thereof, etc.

[0095] In some embodiments, the compound comprises an oligonucleotide. In some embodiments, the compound comprises a double-stranded oligonucleotide. In some embodiments, the compound comprises a single-stranded oligonucleotide. In some embodiments, the compound comprises a single-stranded antisense oligonucleotide. In some embodiments, the compound consists of an oligonucleotide. In some embodiments, the compound consists of a double-stranded oligonucleotide. In some embodiments, the compound consists of a single-stranded oligonucleotide. In some embodiments, the compound consists of a single-stranded antisense oligonucleotide.

[0096] The oligonucleotides provided herein bind to the NAV1.8 encoding nucleic acids, for example, through base pairing (such as Watson-Crick base pairing) and interfere with the normal function of the targeted nucleic acids. The use of these oligonucleotides results in targeted inhibition of RNA expression from the NAV1.8 encoding gene and / or activity of the NAV1.8 protein in a subject (such as a mammal) . For example, as compared to the absence of the antisense oligonucleotide, the levels of NAV1.8 nucleic acids and / or NAV1.8 protein are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, etc. in the presence of the antisense oligonucleotide. In some embodiments, the compounds are capable of downregulating the mRNA expression level of NAV1.8. The mRNA expression level of NAV1.8 can be measured using techniques well known in the art, for example, by quantitative determination using quantitative reverse transcription PCR (RT-qPCR) . In some embodiments, the oligonucleotides provided herein is a NAV1.8 targeting antisense oligonucleotide.

[0097] In some embodiments, the oligonucleotides provided herein comprise nucleotide sequences that specifically hybridize and / or are complementary (e.g., fully complementary, partially complementary) to at least a portion of the mRNA sequence of the NAV1.8 encoding gene (including its variants, exemplary mRNA sequences of the NAV1.8 encoding gene are shown in GenBank Accession Number NM_006514.4, and exemplary mRNA sequences of the NAV1.8 encoding gene are shown as SEQ ID NO: 91) . In some embodiments, the oligonucleotides provided herein comprise nucleotide sequences that specifically hybridize and / or are complementary (e.g., fully complementary) to at least a portion of a target region spanning from positions 167 to 184, 3821 to 3838, 1201 to 1218, 3171 to 3186, 2365 to 2382, 3777 to 3794, 4240 to 4257, 3937 to 3954, 1281 to 1298, 5948 to 5965, 5923 to 5940, 4269 to 4286, 3906 to 3923, 5773 to 5790, 3800 to 3817, 4170 to 4187, 5968 to 5985, 4136 to 4153, 4001 to 4018, 4135 to 4152, 4154 to 4171, 1113 to 1130, 1646 to 1663, 2196 to 2213, 1764 to 1781, 4441 to 4458, 2207 to 2224, 1134 to 1151, 3911 to 3928, 3216 to 3233, 3807 to 3824, 2801 to 2818, 1598 to 1615, 3156 to 3173, 2187 to 2204, 5452 to 5469, 5989 to 6006, 2034 to 2051, 2303 to 2320, 3765 to 3782, 3876 to 3893, 3404 to 3421, 1541 to 1558, 3831 to 3848, 2727 to 2744 of a mRNA sequence of NAV1.8 encoding gene (such as a mRNA sequence of SEQ ID NO: 91) . In some embodiments, the mRNA is a mature mRNA. In some embodiments, the oligonucleotides provided herein comprise nucleotide sequences that specifically hybridize and / or are complementary (e.g., fully complementary, partially complementary) to at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, etc. ) of any 10 to 30 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30) contiguous nucleotides of a target region spanning from positions 167 to 184, 3821 to 3838, 1201 to 1218, 3171 to 3186, 2365 to 2382, 3777 to 3794, 4240 to 4257, 3937 to 3954, 1281 to 1298, 5948 to 5965, 5923 to 5940, 4269 to 4286, 3906 to 3923, 5773 to 5790, 3800 to 3817, 4170 to 4187, 5968 to 5985, 4136 to 4153, 4001 to 4018, 4135 to 4152, 4154 to 4171, 1113 to 1130, 1646 to 1663, 2196 to 2213, 1764 to 1781, 4441 to 4458, 2207 to 2224, 1134 to 1151, 3911 to 3928, 3216 to 3233, 3807 to 3824, 2801 to 2818, 1598 to 1615, 3156 to 3173, 2187 to 2204, 5452 to 5469, 5989 to 6006, 2034 to 2051, 2303 to 2320, 3765 to 3782, 3876 to 3893, 3404 to 3421, 1541 to 1558, 3831 to 3848, 2727 to 2744 of a mRNA sequence of NAV1.8 encoding gene (such as an mRNA sequence of SEQ ID NO: 91) . In some embodiments, the oligonucleotides provided herein comprise nucleotide sequences that are fully complementary to a target region spanning from positions 167 to 184, 3821 to 3838, 1201 to 1218, 3171 to 3186, 2365 to 2382, 3777 to 3794, 4240 to 4257, 3937 to 3954, 1281 to 1298, 5948 to 5965, 5923 to 5940, 4269 to 4286, 3906 to 3923, 5773 to 5790, 3800 to 3817, 4170 to 4187, 5968 to 5985, 4136 to 4153, 4001 to 4018, 4135 to 4152, 4154 to 4171, 1113 to 1130, 1646 to 1663, 2196 to 2213, 1764 to 1781, 4441 to 4458, 2207 to 2224, 1134 to 1151, 3911 to 3928, 3216 to 3233, 3807 to 3824, 2801 to 2818, 1598 to 1615, 3156 to 3173, 2187 to 2204, 5452 to 5469, 5989 to 6006, 2034 to 2051, 2303 to 2320, 3765 to 3782, 3876 to 3893, 3404 to 3421, 1541 to 1558, 3831 to 3848, 2727 to 2744 of a mRNA sequence of NAV1.8 encoding gene (such as an mRNA sequence of SEQ ID NO: 91) . In some embodiments, the oligonucleotides provided herein consist of nucleotide sequences that are fully complementary to a target region spanning from positions 167 to 184, 3821 to 3838, 1201 to 1218, 3171 to 3186, 2365 to 2382, 3777 to 3794, 4240 to 4257, 3937 to 3954, 1281 to 1298, 5948 to 5965, 5923 to 5940, 4269 to 4286, 3906 to 3923, 5773 to 5790, 3800 to 3817, 4170 to 4187, 5968 to 5985, 4136 to 4153, 4001 to 4018, 4135 to 4152, 4154 to 4171, 1113 to 1130, 1646 to 1663, 2196 to 2213, 1764 to 1781, 4441 to 4458, 2207 to 2224, 1134 to 1151, 3911 to 3928, 3216 to 3233, 3807 to 3824, 2801 to 2818, 1598 to 1615, 3156 to 3173, 2187 to 2204, 5452 to 5469, 5989 to 6006, 2034 to 2051, 2303 to 2320, 3765 to 3782, 3876 to 3893, 3404 to 3421, 1541 to 1558, 3831 to 3848, 2727 to 2744 of a mRNA sequence of NAV1.8 encoding gene (such as an mRNA sequence of SEQ ID NO: 91) .

[0098] In some embodiments, the compound provided herein comprises an oligonucleotide comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleotides that specifically hybridize and / or are complementary to a target region spanning from positions 167 to 184, 3821 to 3838, 1201 to 1218, 3171 to 3186, 2365 to 2382, 3777 to 3794, 4240 to 4257, 3937 to 3954, 1281 to 1298, 5948 to 5965, 5923 to 5940, 4269 to 4286, 3906 to 3923, 5773 to 5790, 3800 to 3817, 4170 to 4187, 5968 to 5985, 4136 to 4153, 4001 to 4018, 4135 to 4152, 4154 to 4171, 1113 to 1130, 1646 to 1663, 2196 to 2213, 1764 to 1781, 4441 to 4458, 2207 to 2224, 1134 to 1151, 3911 to 3928, 3216 to 3233, 3807 to 3824, 2801 to 2818, 1598 to 1615, 3156 to 3173, 2187 to 2204, 5452 to 5469, 5989 to 6006, 2034 to 2051, 2303 to 2320, 3765 to 3782, 3876 to 3893, 3404 to 3421, 1541 to 1558, 3831 to 3848, 2727 to 2744 of an mRNA sequence of SEQ ID NO: 91.

[0099] In some embodiments, the oligonucleotides provided herein comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleotides that specifically hybridize and / or are complementary to a target region spanning from positions 167 to 184, 3821 to 3838, 1201 to 1218, 3171 to 3186, 2365 to 2382, 3777 to 3794, 4240 to 4257, 3937 to 3954, 1281 to 1298, 5948 to 5965, 5923 to 5940, 4269 to 4286, 3906 to 3923, 5773 to 5790, 3800 to 3817, 4170 to 4187, 5968 to 5985, 4136 to 4153, 4001 to 4018, 4135 to 4152, 4154 to 4171, 1113 to 1130, 1646 to 1663, 2196 to 2213, 1764 to 1781, 4441 to 4458, 2207 to 2224, 1134 to 1151, 3911 to 3928, 3216 to 3233, 3807 to 3824, 2801 to 2818, 1598 to 1615, 3156 to 3173, 2187 to 2204, 5452 to 5469, 5989 to 6006, 2034 to 2051, 2303 to 2320, 3765 to 3782, 3876 to 3893, 3404 to 3421, 1541 to 1558, 3831 to 3848, 2727 to 2744 of an mRNA sequence of SEQ ID NO: 91.

[0100] In some embodiments, the oligonucleotides provided herein comprise nucleotide sequences that specifically hybridize and / or are complementary (e.g., fully complementary) to at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, etc. ) of any 10 to 30 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30) contiguous nucleotides of any of the nucleotide sequences as shown in SEQ ID NO: 46-90. In some embodiments, the oligonucleotides provided herein comprise nucleotide sequences that are fully complementary to any of the nucleotide sequences shown in SEQ ID NO: 46-90. In some embodiments, the oligonucleotides provided herein consist of nucleotide sequences that are fully complementary to any of the nucleotide sequences shown in SEQ ID NO: 46-90.

[0101] In some embodiments, the oligonucleotides provided herein comprise nucleotide sequences that have at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, etc. ) sequence identity or are completely identical to any 12 to 30 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30) contiguous nucleotides of any of the nucleotide sequences as shown in SEQ ID NO: 1-45. In some embodiments, the oligonucleotides provided herein comprise nucleotide sequences that have at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, etc. ) sequence identity or are completely identical to any 12 to 30 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30) contiguous nucleotides of any of the nucleotide sequences as shown in SEQ ID NO: 1-45, and still maintain similar function or activity (e.g., downregulating the expression of the NAV1.8 encoding gene or promoting the degradation of NAV1.8 mRNA) . For example, the oligonucleotides provided herein, compared to the nucleotide sequences shown in SEQ ID NO: 1-45, may add or remove one or more nucleotides at the 5' end and / or 3' end (e.g., no more than 3 nucleotides, no more than 2 nucleotides, no more than 1 nucleotide, etc. ) , but still maintain similar function or activity (e.g., downregulating the expression of the NAV1.8 encoding gene or promoting the degradation of NAV1.8 mRNA) . “Maintaining... similar function or activity” means that the function or activity differs by no more than 30% (e.g., no more than 5%, no more than 10%, no more than 15%, no more than 20%, no more than 25%, etc. ) . In some embodiments, the oligonucleotides provided herein comprise nucleotide sequences as shown in any one of SEQ ID NO: 1-45. In some embodiments, the oligonucleotides provided herein consist of nucleotide sequences as shown in any one of SEQ ID NO: 1-45.

[0102] In some embodiments, The length of oligonucleotides can be from 10 to 80 nucleotides (for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 nucleotides) . the oligonucleotides provided herein have a length of no more than 23 nucleotides, no more than 22 nucleotides, no more than 21 nucleotides, no more than 20 nucleotides, no more than 19 nucleotides, or no more than 18 nucleotides. In some embodiments, the oligonucleotides provided herein have a length of 18 nucleotides. In some embodiments, the oligonucleotides provided herein have a length of 19 nucleotides. In some embodiments, the oligonucleotides provided herein have a length of 20 nucleotides.

[0103] In some embodiments, the oligonucleotides provided herein are capable of recruiting ribonuclease. In some embodiments, the ribonuclease is ribonuclease H (RNase H) . In some embodiments, the ribonuclease is ribonuclease H1 (RNase H1) .

[0104] It can be understood that the nucleotides in the nucleotide sequences shown in SEQ ID NO: 1-45 or their variants can be modified, unmodified, or modified differently from the modifications described in following examples. 2. Oligonucleotides modification

[0105] The oligonucleotides provided herein can comprise ribonucleotides (e.g., modified or unmodified ribonucleotides) , deoxyribonucleotides (e.g., modified or unmodified deoxyribonucleotides) and / or other nucleoside analogs. Typically, the oligonucleotides provided herein may optionally have modifications. In some embodiments, the oligonucleotides provided herein can have any modification at any nucleotide.

[0106] In some embodiments, at least one nucleotide from the 5' end and / or at least one nucleotide from the 3' end of the oligonucleotides provided herein comprise modifications.

[0107] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides from the 5' end and / or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides from the 3' end of the oligonucleotides provided herein comprise modifications. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides from the 5' end or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides from the 3' end of the oligonucleotides provided herein comprise modifications. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides from the 5' end and 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides from the 3' end of the oligonucleotides provided herein comprise modifications. In some embodiments, each of the 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides from the 5' end and each of the 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides from the 3' end of the oligonucleotides provided herein comprise modifications.

[0108] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 5' end and / or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 3' end of the oligonucleotides provided herein comprise modifications. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 5' end or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 3' end of the oligonucleotides provided herein comprise modifications. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 5' end and 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 3' end of the oligonucleotides provided herein comprise modifications. In some embodiments, each of the 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 5' end and each of the 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides from the 3' end of the oligonucleotides provided herein comprise modifications.

[0109] In some embodiments, the 1st, 2nd, 3rd, and 4th nucleotides from the 5' end and the 1st, 2nd, 3rd, and 4th nucleotides from the 3' end of the oligonucleotides provided herein comprise modifications. In some embodiments, the oligonucleotides provided herein comprise a nucleotide sequence as shown in any one of SEQ ID NO: 1-45, and the 1st, 2nd, 3rd, and 4th nucleotides from the 5' end and the 1st, 2nd, 3rd, and 4th nucleotides from the 3' end of the nucleotide sequence as shown in SEQ ID NO: 1-45 comprise modifications.

[0110] In some embodiments, the oligonucleotides provided herein consist of a nucleotide sequence as shown in any one of SEQ ID NO: 1-45, and the 1st, 2nd, 3rd, and 4th nucleotides from the 5' end and the 1st, 2nd, 3rd, and 4th nucleotides from the 3' end of the nucleotide sequence as shown in SEQ ID NO: 1-45 comprise modifications.

[0111] In some embodiments, “comprising modifications” or “having modifications” in nucleosides, nucleotides, or oligonucleotides refers to modifications of the nucleobase part (base modifications) , the sugar part (sugar modifications) , and / or the internucleoside linkage (internucleoside linkage modifications) independently at any nucleotide position. In some embodiments, “comprising modifications” or “having modifications” in nucleosides, nucleotides, or oligonucleotides refers to having one or more modified nucleobase, modified sugar, modified phosphate, and / or modified internucleoside linkage independently at any nucleotide position. Therefore, “modified nucleotides” or “modified oligonucleotides” mentioned in this application include the replacement, addition, or removal of functional groups or atoms in the nucleobase part, sugar part, phosphate part, and / or internucleoside linkage of nucleotides (e.g., ribonucleotides or deoxyribonucleotides) . Modifications applicable to the nucleotides (e.g., antisense oligonucleotides) provided herein include any modifications known in the art.

[0112] In some embodiments, the modifications of the oligonucleotides provided herein comprise one or more base modifications. For example, changing a purine or pyrimidine to a modified purine or modified pyrimidine (e.g., substituted purine or substituted pyrimidine) . In some embodiments, the base modifications in the oligonucleotides provided herein are selected from the group consisting of: isocytidine, pseudouridine, 5-thiazolo-cytidine, 5-propynyl-cytidine, 5-propynyl-uridine, 5-bromouridine, 5-thiazolo-uridine, 2-thiouridine, 2-thiothymidine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2, 6-diaminopurine, and 2-chloro-6-aminopurine. In some embodiments, the base modifications in the oligonucleotides provided herein are selected from the group consisting of: pseudouridine (ψ) , N1-methylpseudouridine (N1Mψ) , 1-ethylpseudouridine, 2-thiouridine (s2U) , 4-thiouridine, 5-methylcytosine, 5-methyluridine, 5-methoxyuridine, and combinations thereof.

[0113] In some embodiments, the modifications in the oligonucleotides provided herein comprise one or more sugar (ribose) modifications. Various sugar modifications are known in the art, primarily aimed at improving certain properties of the oligonucleotides, such as stability. In some embodiments, the sugar modification of the oligonucleotide comprises a 2's ugar modification.

[0114] In some embodiments, the sugar part can have any stereochemistry, not limited to the stereochemistry of the sugar part in natural DNA or RNA, for example, the sugar can be either D-sugar or L-sugar. In some embodiments, the sugar part is modified or substituted with another ring structure, such as in morpholino oligonucleotides (PMO) , where the sugar part is modified or substituted with a morpholine ring.

[0115] In some embodiments, sugar modifications also comprise altering substituents on the ribose ring to groups other than hydrogen or modifying the naturally occurring 2′-OH group in DNA and RNA nucleosides. For example, substituents can be introduced at the 2’ , 3’ , 4’ , or 5’ positions of the ribose. In some embodiments, the sugar modification involves introducing a substituent at the 2’ position of the ribose (also known as “2’-sugar modification” ) . Nucleosides with 2’-sugar modifications comprise nucleosides that have a substituent other than H or -OH at the 2’ position.

[0116] In some embodiments, the sugar modifications in the oligonucleotides provided herein are selected from the group consisting of: LNA modification, 2'-O-methyl (Me) modification, 2'-O-ethyl modification, 2'-O-methoxyethyl (MOE) modification, 2'-fluoro (F) modification, and combinations thereof. In some embodiments, the sugar modifications in the oligonucleotides provided herein comprise LNA modification. In some embodiments, the sugar modifications in the oligonucleotides provided herein are LNA modifications.

[0117] The term “locked nucleic acid” or “LNA” as used in this application refers to a nucleotide with a modified sugar part, where the ribose comprises a bridge connecting two carbon atoms between the 4' and 2' positions of the ribose, thereby forming a nucleotide with a bicyclic sugar. This structure effectively “locks” the ribose into a 3'-endo conformation. Accordingly, the term “LNA modification” as used in this application refers to the sugar part of the mentioned nucleoside or nucleotide compriseing a bridge connecting two carbon atoms between the 4' and 2'positions of the ribose, thereby forming a nucleoside or nucleotide with a bicyclic sugar. Known LNA oligonucleotides in the art can be found in PCT patent applications WO9914226A2, WO0056746A2, WO0056748A1, and others, all of which are incorporated herein by reference.

[0118] In this application, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4' and 2' positions of the sugar, where each bridge independently comprises 1, 2, 3, or 4 linking groups independently selected from the group consisting of: - [C (R1) (R2) ] n-, - [C (R1) (R2) ] n-O-, -C (R1R2) -N (R1) -O-, -C (R1R2) -O-N (R1) -, -C (R1) =C (R2) -, -C (R1) =N-, -C (=NR1) -, -C (=O) -, -C (=S) -, -O-, -Si (R1) 2-, -S (=O) x-, and -N (R1) -; where x is independently 0, 1, or 2; n is independently 1, 2, 3, or 4; and each R1 and R2 is independently H, a protecting group, hydroxy, C1-12 alkyl, substituted C1-12 alkyl, C2-12 alkenyl, substituted C2-12 alkenyl, C2-12 alkynyl, substituted C2-12 alkynyl, C5-20 aryl, substituted C5-20 aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C5-7 cycloalkyl, substituted C5-7 cycloalkyl, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C (=O) -H) , substituted acyl, CN, sulfonyl (S (=O) 2-J1) , or sulfinyl (S (=O) -J1) ; and each J1 and J2 is independently H, C1-12 alkyl, substituted C1-12 alkyl, C2-12 alkenyl, substituted C2-12 alkenyl, C2-12 alkynyl, substituted C2-12 alkynyl, C5-20 aryl, substituted C5-20 aryl, acyl (C (=O) -H) , substituted acyl, heterocyclic group, substituted heterocyclic group, amino-C1-12 alkyl, substituted amino-C1-12 alkyl, or a protecting group. In certain embodiments, LNA is a nucleotide compriseing a bicyclic sugar moiety, which includes a 4'-CH2-O-2' bridge, a 4'-CH2-O-N (R) -2' bridge, or a 4'-CH2-N (R) -O-2' bridge.

[0119] In some embodiments, examples of LNA include, but are not limited to, the following LNAs: (A) α-L-methyleneoxy (4'-CH2-O-2') LNA, (B) β-D-methyleneoxy (4'-CH2-O-2') LNA, (C) ethyleneoxy (4'- (CH2) 2-O-2') LNA, (D) methyleneoxyamino (4'-CH2-O-N (R) -2') LNA, and (E) methyleneaminooxy (4'-CH2-N (R) -O-2') LNA.

[0120] In some embodiments, the LNA modification described in this application is a 4'-CH2-O-2'LNA modification. In some embodiments, the LNA modification described in this application is an α-L-methyleneoxy (4'-CH2-O-2') LNA modification or a β-D-methyleneoxy (4'-CH2-O-2') LNA modification. In some embodiments, the LNA modification described in this application is an α-L-methyleneoxy (4'-CH2-O-2') LNA modification. In certain embodiments, the LNA modification described in this application is a β-D-methyleneoxy (4'-CH2-O-2') LNA modification.

[0121] In some embodiments, the LNA modification is one or more modifications selected from the group consisting of: methyleneoxy (4'-CH2-O-2') LNA modification (e.g., α-L-methyleneoxy (4'-CH2-O-2') LNA modification, β-D-methyleneoxy (4'-CH2-O-2') LNA modification) , ethyleneoxy (4'- (CH2) 2-O-2') LNA modification, methyleneoxyamino (4'-CH2-O-N (R) -2') LNA modification, and methyleneaminooxy (4'-CH2-N (R) -O-2') LNA modification.

[0122] In some embodiments, the oligonucleotides provided herein are gapmer motifs. In this application, a gapmer motif is also referred to as a “gapmer motif oligonucleotide” . A gapmer motif typically comprises at least three different structural regions, namely the 5' flanking region, the internal gap region, and the 3' flanking region in the 5' to 3' direction. Among them, the internal gap region comprises a stretch of contiguous nucleotides that enable the oligonucleotide to recruit ribonuclease H, flanked by the 5' flanking region and the 3' flanking region which comprising one or more modified nucleosides, respectively.

[0123] In some embodiments, the flanking region comprises one or more nucleotides comprising a sugar modification. In one embodiment, the sugar modification comprises a 2'-sugar modification. In some embodiments, the nucleotide modification is selected from the group consisting of: LNA modification, 2'-O-methyl (Me) modification, 2'-O-ethyl modification, 2'-O-methoxyethyl (MOE) modification, 2'-F modification, and a combination thereof. In some embodiments, the flanking region comprises one or more nucleotide comprising an unmodified sugar.

[0124] In some embodiments, the base modification is selected from the group consisting of: pseudouridine (ψ) , N1-methylpseudouridine (N1Mψ) , 1-ethylpseudouridine, 2-thiouridine (s2U) , 4-thiouridine, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil, and a combination thereof.

[0125] In one embodiment, the 5' flanking region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the 3' flanking region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the 5' flanking region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides; and / or, the 3' flanking region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the flanking regions comprise or do not comprise nucleotide comprising an unmodified sugar. In one embodiment, the flanking regions may comprise one or more nucleotide comprising an unmodified sugar. In one embodiment, the last nucleotide from the 3' end of the 3' flanking region at least comprises a modification. In one embodiment, the last nucleotide from the 5' end of the 5' flanking region at least comprises a modification. In one embodiment, the first and last nucleotides from the 3' end of the 3' flanking region at least comprises modifications. In one embodiment, the first and last nucleotides from the 5' end of the 5' flanking region at least comprises modifications. In one embodiment, the last nucleotide from the 3' end of the 3' flanking region at least comprises a sugar modification. In one embodiment, the last nucleotide from the 5' end of the 5' flanking region at least comprises a sugar modification. In one embodiment, the first and last nucleotides from the 3' end of the 3' flanking region at least comprise sugar modifications. In one embodiment, the first and last nucleotides from the 5' end of the 5' flanking region at least comprise sugar modifications.

[0126] In some embodiment, the internal gap region does not comprise a sugar modification and / or base modification. In some embodiment, the internal gap region does not comprise a sugar modification and base modification. In some embodiment, the internal gap regions comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 continuous nucleotides. In some embodiments, the internal gap region is capable of recruiting ribonuclease H. In some embodiments, the internal gap region is capable of recruiting ribonuclease H1. In some embodiment, the internal gap region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 continuous deoxyribonucleotides. In some embodiments, the internal gap region consists of 10, 11, 12, 13, 14, or 15 continuous deoxyribonucleotides.

[0127] In some embodiments, the gapmer motif comprise modified internucleoside linkages. In some embodiments, the gapmer motif comprise at least 1 (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20) internucleoside linkage that is a phosphorothioate linkage. In some embodiments, all internucleoside linkages within the gapmer motif are phosphorothioate linkages.

[0128] In some embodiments, the gamer comprises an internal gap region flanked by a 3' flanking region and a 5' flanking region, wherein the 3' flanking region comprises 3, 4 or 5 nucleotides, the 5' flanking region comprises 3, 4 or 5 nucleotides, and the internal gap region comprises 10, 11, 12, 13, 14 or 15 nucleotides. In some embodiments, the 5’ flanking region and / or the 3’ flanking region comprises MOE modification, LNA modification and / or 5-methylcytosine modification. In some embodiments, each cytosine in the 5’ flanking region and / or in the 3’ flanking region is 5-methylcytosine. In some embodiments, the 5’ flanking region and / or the 3’ flanking region comprises one or more nucleotide comprising an unmodified sugar. In some embodiments, the nucleotide comprising an unmodified sugar is a ribonucleotide and / or deoxyribonucleotide. In some embodiments, nucleotide comprising an unmodified sugar is a ribonucleotide comprising an unmodified sugar. In some embodiments, the 5’ flanking region and / or the 3’ flanking region comprises MOE-modified nucleotide. In some embodiments, the 5’ flanking region and / or the 3’ flanking region is consisted of MOE-modified nucleotide. In some embodiments, the 5’ flanking region and / or the 3’ flanking region comprises LNA-modified nucleotide. In some embodiments, the 5’ flanking region and / or the 3’ flanking region is consisted of LNA-modified nucleotide. In some embodiments, the internal gap region consists of 10, 11, 12, 13, 14, or 15 continuous deoxyribonucleotides.

[0129] In some embodiments, structures of gapmer motifs arerepresented by formula X-Y-Z, internal gap regionwherein X represents the 5’ flanking region, Y represents the internal gap region, and Z represents the 3’ flanking region. structures of exemplary gapmer motifs comprise: 5-10-5 or 4-10-4, wherein the numbers represent the number of contiguous nucleotides in X, Y, and Z, respectively. In some embodiments, the flanking region comprises MOE-modified nucleotide. In some embodiments, each cytosine in the 5’ flanking region and / or in the 3’ flanking region is 5-methylcytosine. In some embodiments, all internucleoside linkages within the gapmer motif are phosphorothioate linkages.

[0130] In some embodiments, structures of gapmer motifs are represented by formula X-Y-Z, internal gap region wherein X represents the 5’ flanking region, Y represents the internal gap region, and Z represents the 3’ flanking region. Structures of exemplary gapmer motifs comprise: 4-10-4, 2-14-3, 1_1-13-3, 3-13-1_1, 4-12-3, 4-13-2, 3-12-4, 2-13-4, 4-12-1_1, 1_1-12-4, 3-10-3, 3-11-3, 3-12-3 and 3-13-3, wherein the numbers represent the number of contiguous nucleotides in X, Y, and Z, respectively, except that “1_1” indicates a nucleotide triplet wherein the first nucleotide and the third nucleotide of the triplet comprise a sugar modification, and the second nucleotide comprises an unmodified sugar. In some embodiments, the second nucleotide comprising an unmodified sugar is a ribonucleotide. In some embodiments, the sugar modification is LNA modification. In some embodiments, each cytosine in the 5’ flanking region and / or in the 3’ flanking region is 5-methylcytosine. In some embodiments, all internucleoside linkages within the gapmer motif are phosphorothioate linkages.

[0131] In some embodiments, exemplary structures of the gapmer motifs are shown as follows:

[0132] Formula 1 shows an exemplary structure of 1_1-n-3 LNA gapmer motif. Formula 2 shows an exemplary structure of 3-n-1_1 LNA gapmer motif. Formula 3 shows an exemplary structure of 3-n-3 LNA gapmer motif. Formula 4 shows an exemplary structure of 4-n-4 MOE gapmer motif. Formula 5 shows an exemplary structure of 5-n-5 MOE gapmer motif.

[0133] In some embodiments, structures of exemplary gapmer motifs are shown in Table 1, wherein a gapmer structure is represented by formula X-Y-Z, internal gap region wherein X represents the 5’ flanking region, Y represents the internal gap region, and Z represents the 3’ flanking region, wherein the numbers represent the number of contiguous nucleotides in X, Y, and Z, respectively, expect that “1_1” indicates a nucleotide triplet wherein the first nucleotide and the third nucleotide of the triplet comprise a sugar modification, and the second nucleotide comprises an unmodified sugar. Each cytosine in the 5’ flanking region and in the 3’ flanking region is 5-methylcytosine. All internucleoside linkages within the gapmer motif are phosphorothioate linkages. Table 1

[0134] In some embodiments, the oligonucleotides provided herein are mixmers. In this application, a mixmer is also referred to as a “mixed oligonucleotide” , which typically comprises nucleotide modifications with various arrangements and combinations to avoid contiguous deoxyribonucleotides in the molecule.

[0135] In some embodiments, the modifications of the oligonucleotides provided herein comprise one or more linkage modifications. In some embodiments, the linkage modifications occur in the internucleoside linkages.

[0136] In some embodiments, the oligonucleotides provided herein comprise modified internucleoside linkages. In some embodiments, the oligonucleotides provided herein comprise at least 1 (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20) internucleoside linkage between two adjacent nucleosides that is a phosphorothioate linkage. In some embodiments, all internucleoside linkages within the oligonucleotides provided herein are phosphorothioate linkages.

[0137] In some embodiments, the oligonucleotides provided herein comprise LNA modifications in 1, 2, 3, 4, 5, 6, 7, 8, 9, and / or 10 contiguous nucleosides from the 5' end and / or 1, 2, 3, 4, 5, 6, 7, 8, 9, and / or 10 contiguous nucleosides from the 3'end of the nucleotide sequences shown in SEQ ID NO: 1-45 or the variants thereof; and / or 5-methylcytosine substitution for each cytosine present in the contiguous nucleotide.

[0138] In some embodiments, the oligonucleotides provided herein comprise LNA modifications in 3, 4, or 5 contiguous nucleosides from the 5' end and / or 3, 4, or 5 contiguous nucleosides from the 3' end of the nucleotide sequences shown in SEQ ID NO: 1-45 or the variants thereof; and / or 5-methylcytosine substitution for each cytosine present in the contiguous nucleotide. Optionally, the LNA modification is a methyleneoxy (4'-CH2-O-2') LNA modification. Optionally, the LNA modification is a β-D-methyleneoxy (4'-CH2-O-2') LNA modification. Optionally, the nucleosides outside of these contiguous nucleosides of the oligonucleotide do not comprise the LNA modification and / or the 5-methylcytosine modification.

[0139] In some embodiments, the oligonucleotides provided herein comprise LNA modifications in 4 contiguous nucleosides from the 5' end and / or 4 contiguous nucleosides starting from the 3' end of the nucleotide sequences shown in SEQ ID NO: 1-45 or the variants thereof; 5-methylcytosine substitution for each cytosine present in the contiguous nucleotide; and all internucleoside linkages within the nucleotide sequences shown in SEQ ID NO: 1-45 or the variants thereof are phosphorothioate linkages. Optionally, the LNA modification is a methyleneoxy (4'-CH2-O-2') LNA modification. Optionally, the LNA modification is a β-D-methyleneoxy (4'-CH2-O-2') LNA modification. Optionally, the nucleosides outside of these contiguous nucleosides of the oligonucleotide do not include the LNA modification and the 5-methylcytosine modification.

[0140] In some embodiments, the oligonucleotides provided herein are single-stranded. In some embodiments, the oligonucleotides provided herein are single-stranded antisense oligonucleotides. 3. Conjugates

[0141] In certain embodiments, the oligonucleotide provided in the present invention is further modified into a conjugate form, thereby achieving one or more additional effects, for example, improved tissue specificity. In certain embodiments, the oligonucleotide modified into a conjugate form is a prodrug, wherein the conjugate portion is capable of cleaving from the oligonucleotide after the prodrug is delivered to an active site such as a target cell.

[0142] In certain embodiments, the oligonucleotide is covalently or non-covalently linked to a conjugated portion. In certain embodiments, the oligonucleotide is covalently linked to a conjugated portion.

[0143] In certain embodiments, the oligonucleotide is linked to a conjugate portion by a linker, or directly linked to the conjugated portion without a linker.

[0144] As used herein, the term “linker” refers to a molecule or portion that covalently connects the oligonucleotide to a conjugate portion. Linkers include functional groups that link at least one oligonucleotide to at least one conjugate. In certain embodiments, the functional group comprises two reaction moieties that one connects to the oligonucleotide and the other connects to a conjugate portion. In certain embodiments, the functional groups are different from each other. In certain embodiments, linkers herein are cleavable or non-cleavable linkers. Cleavable linkers may be cleaved by hydrolysis, enzymatic reactions, reductions, or by pH changes. Non-cleavable linkers are those that remain largely intact during intracellular metabolism.

[0145] In certain embodiments, a conjugate portion can be a small molecule compound, a biological macromolecule or its derivative, or a combination thereof. In certain embodiments, the conjugate portion can be selected from: antibodies or their antigen-binding fragments (e.g., Fv fragments, Fab, Fab’, F (ab’) 2, Fd, diabody, dsFv, (dsFv) 2, scFv, scFv dimers, etc. ) , lipid derivatives, galactose derivatives, cellular transmembrane peptides or combinations thereof. In certain embodiments, lipid derivatives are selected from the following group: sterols, phospholipids and their derivatives. In certain embodiments, the conjugate portion is capable of binding to a asialoglycoprotein receptor (ASGPR) . In certain embodiments, the conjugate portion specifically targets an asialoglycoprotein receptor.

[0146] In certain embodiments, the conjugate portion is N-acetylgalactosamine (GalNAc) . In certain embodiments, GalNAc is multivalent GalNAc, e.g. GalNAc2, GalNAc3 (as used herein, GalNAc and multivalent GalNAc are collectively referred to as "GalNAc conjugates" ) . In certain embodiments, the oligonucleotides provided herein are conjugated with one or more GalNAc by linkers of univalent, bivalent or trivalent branches. The exemplary structures of GalNAc are shown below:

[0147] 4. Pharmaceutically acceptable salts

[0148] In certain embodiments, the compounds and / or oligonucleotides described herein are present in pharmaceutically acceptable salt forms.

[0149] As used herein, the term “pharmaceutically acceptable” refers to suitable for use in contact with the cells of humans and animals without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit / risk ratio, and effective for their intended use within the scope of sound medical judgment.

[0150] As used herein, the term “pharmaceutically acceptable salts” includes the relatively non-toxic, inorganic and organic acid addition salts, and base addition salts of the compound or oligonucleotides provided herein.

[0151] Typical acid addition salts include: bromhydrate, chlorhydrate, sulphate, bisulphate, phosphate, nitrate, acetate, oxalate, valerate, oleate, palmitate, stearate, laurate, borate, benzoate, lactate, phosphate, toluenesulfonate, citrate, maleate, fumarate, succinate, tartrate, naphthylate, mesylate, glucoheptanate, lactobionate, sulfamate, malonate, salicylate, propionate, methylenebis-b-hydroxynaphthoate, gentisic acid salt, isethionate, di-p-toluoyltartrate, methanesulfonate, ethanesulfonate, benzene sulfonate, p-toluenesulfonate, cyclohexyl sulfamate, quinateslaurylsulfonate, and the like.

[0152] Base addition salts include pharmaceutically acceptable metal salts and amine salts. Suitable metal salts include sodium, potassium, calcium, barium, zinc, magnesium, and aluminum salts. In certain embodiments, sodium and potassium salts are more preferable. Suitable inorganic base addition salts are prepared from metal bases including, e.g., sodium hydroxide, sodium hydroxide, potassium hydroxide, calcium hydroxide, aluminum hydroxide, lithium hydroxide, magnesium hydroxide and zinc hydroxide, etc. Suitable amine base addition salts are prepared from amines with sufficient basicity to form stable salts, and preferably include the following amines commonly used in medicinal chemistry for their less toxicity and being acceptable for medical use: amine, ethylenediamine, N-methylglucosamine, lysine, arginine, ornithine, choline, N, N'-dibenzylethylenediamine, chloroprocaine, diethanolamine, procaine, N-benzylphenylethylamine, diethylamine, piperazine, trimethylol aminomethane, tetramethylammonium hydroxide, triethylamine, dibenzylamine, diphenylethylamine, dehydroabietylamine, N-ethylpiperidine, benzylamine, tetramethylammonium, tetraethyl ammonium, methylamine, dimethylamine, trimethylamine, ethylamine, basic amino acids (e.g., lysine and arginine) , dicyclohexylamine, and the like. 5. Compositions

[0153] In another respect of the present invention, a composition is provided, comprising the compounds and / or oligonucleotides described herein, optionally, and a pharmaceutically acceptable carrier.

[0154] As used herein, the term "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable solvent, suspension or any other pharmaceutically inert carrier for administering to a subject, without interfering with the structure and properties of the oligonucleotide. Some such carriers are capable of formulating the oligonucleotides as, e.g., tablets, pills, capsules, liquids, gels, syrups, pastes, suspensions and lozenges for the oral ingestion by the subject. Some such carriers are capable of making the oligonucleotide as a preparation for injection, infusion, or for topical use.

[0155] Pharmaceutically acceptable carriers used in pharmaceutical compositions provided herein include, but are not limited to, such as pharmaceutically acceptable liquids, gels or solid carriers, water-based carriers (e.g., sodium chloride injections, Ringer's injections, isotonic dextrose injections, sterile water injections, or Ringer's injections of dextrose and lactate, non-water-based carriers (e.g., fixed oils, cottonseed oils, corn oils, sesame oils or peanut oils of plant origin) , antimicrobial agents, isotonic agents (e.g., sodium chloride or dextrose) , buffers (e.g., phosphoric acid or citric acid buffers) , antioxidants (e.g., sodium bisulphate) , anesthetics (e.g., procaine hydrochloride) , suspensions / dispersants (e.g., sodium carboxymethyl cellulose, hydroxypropyl methyl cellulose or polyvinylpyrrolidone) , chelators (e.g., EDTA (ethylenediamine tetraacetic acid) or EGTA (ethylene glycol tetraacetic acid) ) , emulsifiers (e.g., polyssorbitan 80 (Tween-80) ) , diluents, adjuvants, excipients, or non-toxic adjuncts, other ingredients known in the field or combinations thereof. Suitable ingredients are capable of including, e.g., fillers, adhesives, buffers, preservatives, lubricants, flavorings, thickeners, colorants or emulsifiers.

[0156] In certain embodiments, a composition is an injectable preparation. Injectable preparations may take the form of sterile aqueous solutions or dispersants, suspensions or emulsions. In all cases, the injection preparation should be sterile and should be fluid for easy injection. Injectable preparations should remain stable during production and storage and must be protected against contamination by microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium including, e.g., water, ethanol, polyols (e.g., glycerin, propylene glycol, liquid polyethylene glycol, etc. ) and suitable mixtures and / or vegetable oils. Injectable formulations should maintain appropriate fluidity. The effect of microorganisms can be prevented by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbate, thiomersal, etc.

[0157] In certain embodiments, a composition is an oral preparation. Oral preparations include, but are not limited to, capsules, flat capsules, pills, tablets, lozenges (using a flavoring base, usually sucrose and acacia or tragacanth) , powders, granules, or solutions or suspensions in aqueous or non-aqueous liquids, or as oil in water or liquid emulsion in oil in water, or as elixirs or syrups, or as lozenges (using inert substrates such as gelatin and glycerin, or sucrose and gum Arabic) and / or as mouthwashes, etc.

[0158] In solid dosage forms intended for oral administration (e.g., capsules, tablets, pills, sugar-coated pills, powder, granules, etc. ) , the compound or oligonucleotides provided herein are mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium hydrogen phosphate, and / or any of the following: (1) fillers or increments, e.g., starch, lactose, sucrose, glucose, mannitol and / or silicic acid; (2) adhesives, e.g., carboxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose and / or gum Arabic; (3) humectants, e.g., glycerin; (4) disintegrating agents, e.g., AGAR, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates and sodium carbonate; (5) solution blockers, e.g., paraffin; (6) absorption enhancers, e.g., quaternary ammonium compounds; (7) wetting agents, e.g., acetyl alcohols and glycerols monostearate; (8) absorbers, e.g., kaolin and bentonite; (9) lubricants, e.g., talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate and mixtures thereof; And (10) colorants.

[0159] In liquid dosage forms intended for oral administration, compounds or oligonucleotides provided herein are mixed with any of the following: pharmaceutically acceptable emulsions, microemulsions, solutions, suspension, syrups, and elixirs. In addition to the compounds or oligonucleotides provided herein, liquid dosage forms may include inert diluents commonly used in the field, such as water or other solvents, solubilizers and emulsifiers, e.g., ethanol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, isopropyl alcohol, 1, 3-butanediol, oil (in particular, cottonseed oil, peanut oil, corn oil, olive oil, castor oil and sesame oil) , glycerin, tetrahydrofurfuryl alcohol, polyethylene glycol and dehydrated sorbitan fatty acid esters and mixtures thereof. In addition to inert diluents, oral compositions may also include adjuvants, e.g., wetting agents, emulsifiers and suspensions, sweeteners, flavorings, colorants, flavorings and preservatives.

[0160] In certain embodiments, the composition is an oral spray preparation or a nasal spray preparation. Spray preparations include, but are not limited to, aqueous aerosols, non-aqueous suspensions, lipid-based formulations or solid particle formulations, among others. Aqueous aerosols are prepared by mixing a liquid-water solution or suspension of a therapeutic agent with a conventional pharmaceutically acceptable carrier and stabilizer. Carriers and stabilizers are adjusted according to the specific requirements of the compound, but in general they include non-ionic surfactants (Tween or polyethylene glycol) , oleic acid, lecithin, amino acids such as glycine, buffer solutions, salts, sugars or sugar alcohols. Aerosols are typically prepared from isotonic solutions and allow for delivery via spray.

[0161] Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligonucleotide, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono-or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of Compounds or oligonucleotides provided herein to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of Compounds or oligonucleotides provided herein to liver.

[0162] The compounds and / or oligonucleotides described herein are capable of being encapsulated in a lipid preparation (e.g., LNP) or other nucleic acid-lipid particles.

[0163] As used herein, the term “LNP” refers to a lipid nanoparticle, which is a stable nucleic acid-lipid particle, comprising a lipid layer coating with pharmaceutically active molecules. LNPs typically contain cationic lipids, non-cationic lipids, and lipids that prevent particle aggregation (e.g., PEG-lipid conjugates) . LNPs are very useful in systemic administration, as for exhibition of a longer cycle life after intravenous (i.v. ) administration and accumulation at a distal site (e.g., a site that is physically separated from the administration site) . A variety of nucleic acid-lipid particles and their preparation methods are disclosed in this field, e.g., US Pat. Nos. 5,976,567, 5,981,501, 6,534,484, US Patent Publication No. 2010 / 0324120 and PCT Publication No. WO 96 / 40964 and other patents and patent applications.

[0164] In certain embodiments, the compound, oligonucleotide and / or their compositions provided herein may be used in combination. Combination therapy reduces NAV1.8 levels in a subject by targeting NAV1.8 mRNA using the compound, oligonucleotide and / or their compositions provided herein (e.g., decreasing at least approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%or approximately 99%) , and / or reduces NAV1.8 levels in subjects by using the compound, oligonucleotide and / or their compositions provided herein (e.g., decreasing at least approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%or approximately 99%) , and correspondingly reduces therapeutic effective dose of additional therapeutic agents required to treat a subject, and allow for simpler and more convenient use of certain drugs, or reduce the side effects of certain drugs.

[0165] In certain embodiments, the compositions provided herein may be used in combination with one or more additional drugs. In certain embodiments, additional drugs are antineoplastic drugs, cardiovascular drugs, anti-inflammatory drugs, antiviral drugs, digestive system drugs, nervous system drugs, respiratory system drugs, immune system drugs, dermatological drugs, metabolic drugs, etc. 6. Vectors

[0166] In a further aspect, there is provided a vector, comprising the oligonucleotide.

[0167] Examples of vectors include plasmids; bacteriophage granules; clay particles; artificial chromosomes, e.g., yeast artificial chromosome (YAC) , bacterial artificial chromosome (BAC) or P1-derived artificial chromosomes (PAC) ; bacteriophages, e.g., λ or M13; and animal viruses. The categories of animal viruses used as vectors include retroviruses (including lentiviruses) , adenoviruses, adeno-associated viruses, herpesviruses (e.g., herpes simplex virus) , poxviruses, baculoviruses, papillomaviruses, and milk void viruses (e.g., SV40) .

[0168] In certain embodiments, a vector provided herein is a kind of expression vector. In certain embodiments, the vector is used to express the oligonucleotide within the cell. In certain embodiments, the vector is used for the preparation of the oligonucleotide. 7. Application

[0169] In a further aspect, the present invention provides a method for modulating (e.g., down-regulating) NAV1.8 expression in a target cell. In certain embodiments, the method includes the following steps: exposing a target cell to the compound, oligonucleotide, composition thereof and / or vector thereof (for specific descriptions of compositions, vectors, see Parts 5 and 6 of this context) .

[0170] The method may be implemented in vivo or in vitro.

[0171] In certain embodiments, exposing a cell in vivo to the compound, oligonucleotide, composition thereof and / or vector thereof comprises exposing the cells or cell populations of a subject (e.g., a human subject) to the compound, oligonucleotide, composition thereof and / or vector thereof. In addition, cell exposing in vivo may be achieved via a targeting ligand, including any described herein or known in the field. In certain embodiments, a targeting ligand is a carbohydrate-oligonucleotide moiety, for example, the GalNAc3 ligand, or any other ligand (e.g., an antibody or its antigen-binding fragment) that can guide the compounds or oligonucleotides to a site of interest (for example, the liver of the subject) .

[0172] In certain embodiments, exposing a cell in vitro to the compound, oligonucleotide, composition thereof and / or vector thereof can be achieved by incubating cells with the compound, oligonucleotide, composition thereof and / or vector thereof.

[0173] In certain embodiments, combining in vitro exposure and in vivo exposure is also possible. For example, cells may also be exposed in vitro to the compound, oligonucleotide, composition thereof and / or vector thereof, and then transplanted into a subject.

[0174] In certain embodiments, after exposing NAV1.8-expressing target cells to the compound, oligonucleotide, composition thereof and / or vector thereof, the level of NAV1.8 expression in a target cell is reduced by, e.g., at least approximately 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or about 99%or more.

[0175] In certain embodiments, after exposing NAV1.8-expressing target cells to the compound, oligonucleotide, composition thereof and / or vector thereof, the level of NAV1.8 mRNA expression in a target cell is reduced by, e.g., at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or approximately 99%or more.

[0176] In certain embodiments, after exposing NAV1.8-expressing target cells to the compound, oligonucleotide, composition thereof and / or vector thereof, the level of NAV1.8 protein in a target cell is reduced by, e.g., at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or approximately 99%or more.

[0177] Changes in the level of gene expression can be evaluated by any method known in the field. For example, changes in NAV1.8 expression can be determined by measuring the mRNA expression level of NAV1.8 using conventional methods skilled in the field, such as Northern imprinting, qRT-PCR; and measuring the protein expression level of NAV1.8 using conventional methods skilled in the field, e.g., western blotting, immunological techniques, flow cytometry methods, ELISA and / or by measuring the biological activity of NAV1.8.

[0178] The decrease in the expression level of NAV1.8 in a target cell can be evaluated by comparing the absolute or relative levels of one or more variables associated with NAV1.8 expression with a control level. The control level can be any type of control level utilized in this field, for instance, the baseline level before administration, or the level determined from untreated or similarly treated subjects, cells, or samples (for example, only buffer control or inactive agent control.

[0179] In certain embodiments, after exposing NAV1.8-expressing target cells to the compound, oligonucleotide, composition thereof and / or vector thereof, the NaV1.8 current density of the target cells are reduced by, e.g., at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or approximately 99%or more, compared to the result without applying such compound, oligonucleotide, composition thereof and / or vector thereof. In certain embodiments, the membrane potential can be obtained by regular means known in the art.

[0180] In certain embodiments, the compound, oligonucleotide, composition thereof and / or vector can reduce the TTX-R current in DRG neurons by, e.g., at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or approximately 99%or more, compared to the result without applying such compound, oligonucleotide, composition thereof and / or vector thereof. In certain embodiments, the TTX-R current can be obtained by regular means known in the art.

[0181] In certain embodiments, the compound, oligonucleotide, composition thereof and / or vector thereof can reduce the inflammation-induced spontaneous activity in human DRG neutrons by, e.g., at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or approximately 99%or more, compared to the result without applying such compound, oligonucleotide, composition thereof and / or vector thereof. In certain embodiments, the membrane potential can be obtained by regular means known in the art.

[0182] In certain embodiments, after administering the compound, oligonucleotide, composition thereof and / or vector thereof to a subject, pain phenotype of the subject is improved by, e.g., at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or approximately 99%or more, compared to the result without applying such compound, oligonucleotide, composition thereof and / or vector thereof. In certain embodiments, the pain phenotype can be obtained by regular means known in the art.

[0183] In certain embodiments, the NAV1.8-expressing target cells may be in vivo cells or ex vivo cells. In certain embodiments, with respect to in vivo embodiments, NAV1.8-expressing target cells may be derived from human and non-human animals. In certain embodiments, nonhuman animals include all vertebrates, such as mammals and non-mammals. In certain embodiments, non-human animals can also be domestic animals, for example, cattle, pigs, sheep, poultry, and horses, or domestic animals, for example, dogs and cats. In certain embodiments, the NAV1.8-expressing target cells may be derived from males (e.g., men) or females (e.g., women) , and may be derived from older adults, adults, adolescents, children, or infants.

[0184] In certain embodiments, the NAV1.8-expressing target cells are hematopoietic stem cells, neural stem cells, cancer cells, dendritic cells, monocytes, macrophages, B cells, Treg, neutrophils, basophils, platelets, progenitor mast cells, endothelial cells, neuronal cells, osteoclasts, or antigen-presenting cells. In certain embodiments, the NAV1.8-expressing target cells are neuronal cells. In certain embodiments, the NAV1.8-expressing target cells are dorsal root ganglion (DRG) neurons.

[0185] In one aspect, the present invention provides a method for down-regulating NAV1.8 encoding gene expression, wherein an effective dose of the compound, oligonucleotide, composition thereof and / or vector thereof is administered to a subject in need.

[0186] In one aspect, the present invention provides an application of the compound, oligonucleotide, composition thereof and / or vector thereof for the preparation of a drug to down-regulating NAV1.8 encoding gene expression of a subject in need.

[0187] In one aspect, the present invention provides the compound, oligonucleotide, composition thereof and / or vector thereof for down-regulating NAV1.8 encoding gene expression of a subject in need.

[0188] In one aspect, the present invention provides a method for treating, alleviating or preventing disease, wherein an effective dose of the compound, oligonucleotide, composition thereof and / or vector thereof is administered to a subject in need.

[0189] In another aspect, the present invention provides the use of the compound, oligonucleotide, composition thereof and / or vector thereof in the preparation of medicines for treating, alleviating or preventing disease or symptom.

[0190] In another aspect, the present invention provides the compound, oligonucleotide, composition thereof and / or vector thereof for treating or preventing disease or symptom.

[0191] In certain embodiments, the disease or symptom is a NAV1.8-mediated disease or symptom. "NAV1.8-mediated disease or symptom" refers to a disease or symptom, condition, or disorder that is associated with abnormal levels and / or activity of NAV1.8 due to abnormal expression of NAV1.8 in a subject, resulting in abnormally high or low levels and / or activity of NAV1.8 and causing or promoting the disease or symptom. In certain embodiments, the NAV1.8-mediated disease or symptom is associated with a reduction in the level and / or activity of NAV1.8. In certain embodiments, the disease or symptom is selected from chronic pain, neuropathic pain, inflammatory pain, musculoskeletal pain, gut pain, pontaneous pain, nociceptive pain, cancer pain, idiopathic pain, postsurgical pain, visceral pain, multiple sclerosis, Charcot-Marie-Tooth syndrome, incontinence, pathological cough, or cardiac arrhythmia. In certain embodiments, the disease or symptom comprises inflammatory pain, musculoskeletal pain and / or neuropathic pain.

[0192] In certain embodiments, the disease or symptom comprises neuropathic pain. In certain embodiments, the neuropathic pain comprises post-herpetic neuralgia, diabetic neuralgia, small fiber neuropathy, idiopathic small-fiber neuropathy, painful HIV-associated sensory neuropathy, trigeminal neuralgia, burning mouth syndrome, post-amputation pain, phantom pain, painful neuroma, traumatic neuroma, Morton's neuroma, nerve entrapment injury, spinal stenosis, carpal tunnel syndrome, radicular pain, sciatica pain, nerve avulsion injury, brachial plexus avulsion injury, complex regional pain syndrome, drug therapy induced neuralgia, cancer chemotherapy induced neuralgia, anti-retroviral therapy induced neuralgia, post spinal cord injury pain, idiopathic small-fiber neuropathy, idiopathic sensory neuropathy and / or trigeminal autonomic cephalalgia.

[0193] In certain embodiments, the disease or symptom comprises musculoskeletal pain. In certain embodiments, the musculoskeletal pain comprises osteoarthritis pain, back pain, cold pain, burn pain or dental pain.

[0194] In certain embodiments, the disease or symptom comprises inflammatory pain. In certain embodiments, the inflammatory pain comprises rheumatoid arthritis pain.

[0195] In certain embodiments, the subject is a mammal (e.g., human) , for example, the subject has a disease or symptom that has been treated or evaluated for potentially benefiting from a decrease in NAV1.8 expression; The subject is at risk of having a disease or symptom that may benefit from reduced NAV1.8 expression; The subject has a disease or symptom that may benefit from reduced NAV1.8 expression.

[0196] In certain embodiments, the health condition of a subject is improved upon receiving the compound, oligonucleotide, composition thereof and / or vector thereof. The term "improved” means that at least one indicator of the condition or severity of the disease is reduced, slowed, stopped or reversed. The severity of indicators may be determined by subjective or objective measures known to those skilled in the field. For example, the reduction in the condition or severity of the disease can be at least approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or approximately 100%. A therapeutic or preventive effect is evident when one or more parameters of the disease state are statistically significant improved, or when symptoms that would otherwise have been expected occur due to failure to worsen. For example, a favorable change of at least 10%in a measurable disease parameter, preferably at least 20%, 30%, 40%, 50%, or more, can indicate an effective treatment. The efficacy of a given oligonucleotide (e.g., oligonucleotide) drug or preparation of that drug targeting NAV1.8 may also be judged using experimental animal models of a given disease known in the field. When experimental animal models are used, the efficacy of treatment can be demonstrated when a statistically significant reduction in markers or symptoms is observed.

[0197] The compound, oligonucleotide, composition thereof and / or vector thereof provided herein can be administered to a subject at an effective dose. The compound, oligonucleotide, composition thereof and / or vector thereof, can be administered toa subject at a dose of 0.01 to 50 mg / kg. The values and ranges between the above values are also part of the present invention. The compound, oligonucleotide, composition thereof and / or vector thereof is capable of being administered to a subject through various routes, e.g., local, oral, intranasal, parenteral, enteral, rectal, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, buccal, sublingual or ocular routes.

[0198] Examples

[0199] In a plurality of embodiments of the present invention, their different applications are elaborated, but these embodiments are not limitations of the present invention. In view of the insurmountable obstacles in the transformation of artificial systems constructed with transfection agents into clinical treatments, and the fact that no transfection preparation has been approved by regulatory authorities for the delivery of oligonucleotides to date, therefore the in vitro experimental part of the present invention adopts a method that does not rely on transfection agents, i.e., implements gymnotic delivery. The core of this approach is the intracellular delivery and action of the antisense oligonucleotide through its own properties without the use of transfection agents.

[0200] Example 1: Design of Human SCN10A Antisense Oligonucleotide (ASO) .

[0201] In one or more embodiments of the present invention, ASOs for the human SCN10A (NAV1.8) are provided, which is available from the NCBI gene database (http:  / / www. ncbi. nlm. nih. gov / gene / ) , specifically the SCN10A mRNA reference sequence of SEQ ID NO. 91 (GENBANK accession number NM_006514.4) . The invention designs ASOs of different lengths, including 16, 18 and 19 mer, according to internal standards to achieve efficient regulation of this gene.

[0202] The chimeric ASO of the new design in the table below is designed as 3-10-3, 4-11-4, 4-10-4 LNA notched bodies. The center notch segments of the chimeric ASO thereof consist of ten or eleven 2'-deoxynucleosides, and are flanked in the 5'and 3' directions wherein each flanking region containing three or four nucleotides. Each nucleotide in the 5' flanking region and each nucleotide in the 3' flanking region are LNA (locked nucleotide) modifications to enhance the stability and affinity of the ASO. The nucleotide linkages of all chimeric ASOs are phosphorothioate (P=S) linkages. All cytosine residues in the 5' and 3' flanking regions of each chimeric ASO are 5-methylcytosine.

[0203] Example 2: ASO Synthesis and Purification

[0204] ASO synthesis was performed by DNA / RNA synthesizer (LK-192) , purification by high-performance liquid chromatography (HPLC) (Waters2695) , and finally mass spectrometry (MS) was used to further confirm the molecular weight.

[0205] The synthesis of ASO by solid-phase phosphoramidite chemistry was carried out in the following steps: firstly, a nucleotide is ligated through four steps including deprotection, condensation, oxidation and capping. The entire sequence was synthesized through repeated runs using nucleotides including DNA-A, DNA-G, DNA-C, DNA-T, LNA-5-methyl-C, LNA-A, LNA-G, and LNA-T.

[0206] Deprotection: 4, 4'-dimethoxytriphenyl was removed from the synthesis column using trichloroacetic acid, thereby exposing the 5' active hydroxyl group.

[0207] Condensation: In the synthesis plate, phosphoramidite monomer and tetrazolium were injected according to the ASO sequence (to improve the condensation efficiency) , and the newly injected monomer was attached to the hydroxyl group.

[0208] Oxidation: Iodine solution was used to oxidize phosphorus to a more stable pentavalent phosphorus.

[0209] Capping: Capping agent A and capping agent B were injected at the same time as the monomer was injected to block the hydroxyl group.

[0210] After ASO synthesis was complete, the sample was dissolved in ultrapure water and filtered to remove impurities. Subsequently, gradient purification was performed using HPLC and mass spectrometry detection was performed to confirm the molecular weight of the desired sample. Finally, the purity of the samples was evaluated by HPLC analytical instruments.

[0211] Example 3: The Effect Screening of Human SCN10A ASO in Cells

[0212] 3.1 Construction of stably transfected cell strain

[0213] The SH-SY5Y and HEK293 cells are purchased from Stem Cell Bank, Chinese Academy of Sciences (directory number: SCSP-5014, SCSP-5209) . The formula of the cell culture medium was prepared according to the guide provided by the supplier. Cells were cultured at 37 ℃, 5%CO2, and 95%humidity in CO2 incubator.

[0214] Through the Lipofectamine 2000 transfection reagent, the expression vector containing human SCN10A gene was transfected to SH-SY5Y or HEK293cells. After transfection, cells were treated with 300–400 μg / mL of G418 antibiotic for 2–3 weeks to screen for stably transfected cells. Monoclonal cells were further isolated by extreme limiting dilution analysis, and cell lines stably expressing human Nav1.8 were screened by qRT-PCR.

[0215] 3.2 Cell treatment

[0216] Human Nav1.8 / SH-SY5Y stable cells (hNav1.8 / SH-SY5Y) were seeded into 96-well plates at a density of 2x104 cells per well and cultured in a cell culture incubator for 24 hour to promote cell adhesion and growth. 1 mM ASO was diluted with cell culture water to the desired concentration and was add to the cell culture wells in a 96-well plate to bring the final concentration of ASO in the medium to 10 μM.The treated cell culture plates were placed in an incubator and incubated for 72 hours to assess the effect of ASO on Nav1.8 expression in cells.

[0217] 3.3 RNA extraction and reverse transcription

[0218] Following the manufacturer's protocol, remove the cell culture medium and proceed to cell lysis and RNA purification using the EZ-Press 96 RNA Purification Kit PLUS (EZBioscience, Cat. No. EZ4002-L) to harvest the total RNA in the cells.

[0219] Reverse transcription reaction preparation: 10 μL of RNA sample, 5 μL of DEPC water, and 5 μL of 4×EZscript Reverse Transcription Mix II (EZBioscience, Cat. No. EZB-RT2) were mixed to initiate a reverse transcription reaction.

[0220] Reverse transcription conditions: Hold the reaction at 42 ℃ for 15 min, then 95 ℃ for 30 sec to extinguish the reverse transcriptase, and finally cool down to 4 ℃.

[0221] 3.4 qRT-PCR

[0222] A 10 μL qRT-PCR reaction was prepared by mixing the reverse transcription cDNA, 2×SYBR Green qPCR Master Mix (ROX2) (EZBioscience, Cat. No. A0001-R2) , Primer (Forward / Reverse 5 μM) , and ddH2O. Add the reaction mixture to a qPCR plate (LightCycler 480 Multiwell Plate 384) , then transfer the qPCR plate to the Roche 480 system and perform the qPCR reaction. The specificity of the PCR product was determined by analyzing the melt curve generated by qRT-PCR, and the standard curve method was used to analyze the expression level of the target gene. The GUSB gene was used as the housekeeping gene, and the expression level of Nav1.8 was normalized to the housekeeping gene to correct for differences between samples. Human SCN10A primer: Forward‐GTGGCCTATGGCTTCAAAAA (SEQ ID NO: 116) , Reverse-TTCCAGAATCTTCGCTGTGA (SEQ ID NO: 117) ; Human GUSB primer: Forward‐GCCCATTATTCAGAGCGAGTA (SEQ ID NO: 118) , Reverse-GTTTTTGATCCAGACCCAGATG (SEQ ID NO: 119) .

[0223] The modification pattern for Product Nos. : 1 to 55 is 4-n-4, with the flanking regions consisting of LNA modified nucleotides and all C nucleosides are methylated, the internal gap region consists of unmodified DNA, and all internucleoside linkages are phosphorothioate linkages. Product Nos. : 56 and 57 are ASOs disclosed in US Pub. No. US2022 / 0112496A1 (5 / 8 and 5 / 18 disclosed in US2022 / 0112496A1) with a modification pattern of 4-12-4, wherein the flanking regions are MOE modified, the internal gap region consists of unmodified DNA, and all internucleoside linkages are phosphorothioate linkages. The start site / stop site is based on the first nucleotide of human SCN10A (GENBANK accession number NM_006514.4, SEQ ID NO: 91) . Product Nos. : 1 to 55 are also used in following Examples.

[0224] The Screening results are shown in Table 2 as percent inhibition (%inhibition) of the Nav1.8 mRNA expression (%inhibition = (1-Nav1.8 mRNA expression level in ASO treated cells / Nav1.8 mRNA expression level in mock control cells) *100%) . ASOs Product No. 1 to 45 can downregulate the Nav1.8 mRNA level by more than 68%at 10 μM.

[0225] Example 4: Evaluation of Dose-Dependent Target Knockdown Activity of Human SCN10A ASO in hNav1.8 / SH-SY5Y Cells

[0226] Chimeric ASOs capable of significantly inhibiting Nav1.8 mRNA expression were screened from previous embodiments, and these ASOs were tested at different doses in hNav1.8 / SH-SY5Y cells to determine their inhibition effects on Nav1.8 mRNA expression.

[0227] Human Nav1.8 / SH-SY5Y cells were seeded in 96-well cell culture plates and tested on these ASOs in a series of experiments with similar culture conditions. Cells were treated at concentrations of 0.1 μM, 0.3 μM, 1 μM, 3 μM, and 10 μM for 72 hours, respectively. After treatment, cells were collected and lysed. qRT-PCR was used to analyze the expression level of Nav1.8 mRNA in the lysate. The Nav1.8 mRNA level in cells was normalized to the level of GUSB mRNA. The relative expression of Nav1.8 mRNA at different ASO concentrations was obtained by comparing to mock control. Based on the data obtained, a dose-response curve was plotted, and IC50 values were calculated.

[0228] The IC50 values for ASO Product Nos. 1 to 45 are summarized in Table 3. Table 3

[0229] Example 5: Reduction of NaV1.8 Protein Expression by SCN10A ASO in hNav1.8 / HEK293 Cells

[0230] The effect of SCN10A-specific ASOs on the expression level of Nav1.8 protein was investigated in HEK293 cells stably expressing Nav1.8 (hNav1.8 / HEK293 cells) .

[0231] hNav1.8 / HEK293 cells were seeded at a density of 0.3×106 cells / well in 12-well plates. Next day cells were treated with the selected ASOs at final concentrations of 10 μM for 72 hours. After treatment, cells were collected and the protein was extracted using pre-chilled RIPA buffer. Subsequently, equal amounts of protein samples were loaded and subjected to gel electrophoresis. Following this, the proteins were transferred from the gel onto the membrane. Western blotting was performed with the human Nav1.8 specific antibody (Antibodiesinc, Cat#75-166) . β-tubulin was used as a housekeeping protein for loading control.

[0232] Figure 1 shows that the selected ASOs can significantly knockdown Nav1.8 protein expression in the cells compared to the control treatment.

[0233] Example 6: Inhibition of Nav1.8 Current by SCN10A ASO in hNav1.8 / CHO Cells

[0234] CHO cells stably expressing the human Nav1.8 α subunit plus two βsubunits (SCN10A, NM_006514.4; SCN1B, NM_199037.5; SCN3B, NM_018400.4) (hNav1.8 / CHO cells) were cultured in Ham's F-12 medium containing 10%fetal bovine serum and 10 μg / mL Blasticidin, 200 μg / mL Hygromycin B, 0.8 mg / mL G418, and 100 μg / mL Zeocin at 37℃ in 5%CO2. Cells were seeded onto coverslips in 24-well plates with a density of 6.5×103 cells / well. ASOs were evenly added to the medium to achieve a final concentration of 1 μM and cells were incubated for 72 hours before patch clamp recordings.

[0235] Whole-cell patch-clamp recording data was acquired by an EPC 10 amplifier (HEKA) and stored in PatchMaster (HEKA) software. To establish a whole-cell patch clamp, the electrode first formed a giga-ohm (GΩ) high-resistance seal on the cell surface while performing fast capacitance compensation. Then the cell membrane was broken by sudden application of negative pressure. Slow capacitance compensation was followed and the experimental parameters such as series resistance (Rs) were recorded. All recordings were performed at room temperature.

[0236] To obtain the current-voltage relationship (I-V curve) of each cell, the membrane potential was initially maintained at -120 mV. Then depolarization pulses were given in 10 mV increments from -120 mV to +90 mV for 100 ms, while recording the current amplitude.

[0237] The raw current data was exported and stored in an Excel sheet. The capacitance of each cell was analyzed. Current density (pA / pF) was calculated to plot the curve. Figure plotting and statistical analysis were performed in GraphPad Prism 8. All data represented as Mean ± SE.

[0238] Figure 2 shows that ASO Product No. 3 and No. 5 at 1 μM resulted in significant reduction of Nav1.8 current density compared to the mock control group, suggesting functional downregulation of Nav1.8 channels.

[0239] Example 7: Inhibition of Action Potential (AP) Firing by SCN10A ASO in Monkey DRG Neurons

[0240] Dorsal root ganglions (DRGs) were isolated from lumber (L) 3-5 segments of 3-year-old male and female cynomolgus monkeys (Macaca fascicularis) . Isolated DRGs, with excessive connective tissue and nerve fibers removed, were cut into small fragments and went through enzymatic digestion (Papain + DNAse I +TrypLE + Collagenase / Dispase) at 37℃. Dissociated DRG neurons were then seeded onto poly-L-lysine pre-coated coverslips in 24-well plates, incubated at 37℃ for 2 hours to allow the cells to adhere. ASOs were evenly added to the culture medium to achieve a final concentration of 3 μM and cells were further incubated for 72 hours before patch clamp recordings.

[0241] Whole-cell patch clamp was then performed. The cells were initially maintained at 0 pA in current clamp mode. Current injections were applied starting from -50 pA with 20 pA increments. The current strength at which the first action potential was elicited was denoted as the rheobase. Then a 1 second continuous current injection of 2-3 times the rheobase was used for action potential stimulation. The number of spikes (AP over 0 mV) were recorded for each cell.

[0242] The raw traces were processed with Clampfit 10.6 for data handling. Figure plotting and statistical analysis were performed in GraphPad Prism 8. All data represented as Mean ± SE.

[0243] As shown in Figure 3, ASO Product No. 3, whose target sequence is identical to that of monkey SCN10A gene (GENBANK accession number XM_005546684.5) , at 3 μM resulted in significant reduction of spike number compared to the mock control group, suggesting functional inhibition of DRG neuronal excitability.

[0244] Example 8: Downregulation of Nav1.8 mRNA Level by SCN10A ASO Leads to Reduction in Nav1.8 Protein Expression in Rat Primary DRG Neurons

[0245] The target sequence of ASO Product No. 3 is identical to the rat SCN10A gene (GENBANK accession number NM_017247.2) , so the activity of this ASO in rat DRG neurons was evaluated.

[0246] Fresh primary rat dorsal root ganglion (DRG) neurons isolated from ～E18 Sprague Dawley (SD) rats were purchased from ChemPartner (Shanghai, China) . The cells were plated as a certain density in poly-D-lysine-coated plates with corresponded volume culture medium (97%Neurobasal-A, 2%B27, 1%Glutamax, 20 ng / mL NGF) per well at 37℃, 5%CO2 in a CO2 incubator.

[0247] To evaluate the effect of the ASO on rat Nav1.8 mRNA level, primary rat DRG neurons were seeded in 96-well plates at a density of 2x104 cells per well and were treated with selected ASO at concentrations of 0.01 μM, 0.03 μM, 0.1 μM, 0.3 μM, and 1 μM for 72 hours, respectively. After treatment, cells were collected and RNA was purified. qRT-PCR was used to analyze the level of rat Nav1.8 mRNA. The GAPDH gene was used as the housekeeping gene for normalization. The relative Nav1.8 mRNA expression at different ASO concentrations was obtained by comparing to mock control treatment. Rat SCN10A primer: Forward-GCCGGGAAATTTTCGAAGTG Reverse-GCTGACTGTTGATCTCTCCG; rat GAPDH primer: Forward-CCGCATCTTCTTGTGCAGTG Reverse-CGATACGGCCAAATCCGTTC

[0248] To evaluate the effect of ASO on rat Nav1.8 protein level, primary rat DRG neurons were seeded in 12-well plates at a density of 0.3×106 cells per well and were treated with the selected ASO at concentrations of 0.1 μM and 1 μM for 96 hours, respectively. After treatment, cells were collected and the protein was extracted using pre-chilled RIPA buffer. Subsequently, equal amounts of protein samples were loaded and subjected to gel electrophoresis. Following this, the proteins were transferred from the gel onto the membrane. Western blotting was performed using the rat Nav1.8 specific antibody (Alomone, Cat#ASC-016) . β-tubulin was used as a housekeeping protein for loading control.

[0249] The results show that ASO Product No. 3 reduced the rat Nav1.8 mRNA level (Figure 4A) and the rat Nav1.8 protein expression level (Figure 4B) by more than 80%in primary rat DRG neurons as compared to the control treatment.

[0250] Example 9: Downregulation of in vivo Nav1.8 mRNA Level and Protein Level by SCN10A ASO in Wildtype Rats

[0251] Adult male Sprague Dawley (SD) rats were maintained in a controlled environment with a 12-h light-dark cycle and allowed to freely ingest standard rat diet. Animals are acclimatized in the experimental facility for at least 7 days prior to the start of the experiment to ensure that their physiological state is stable.

[0252] ASO Product No. 3 was dissolved in sterile nuclease-free PBS (phosphate buffered) and delivered directly to the dorsal root ganglion (DRG) of rats at the L4-L5 level via the intervertebral foramen route. SD rats were anesthetized, and the lumbar area was shaved and disinfected. A midline incision over L3-L6 was made to expose the surgical field. The L4-L5 intervertebral foramen was identified. The Hamilton microsyringe was placed ～30° from the sagittal plane. The needle was advanced slowly until just inside the foramen and the ASO was slowly injected into the intervertebral foramen. Each rat received 1 mg ASO in 7.5 μL total volume. After the needle was withdrawn, the muscle and skin were sutured. The rats were then placed individually in a heated recovery cage cages for recovery, and their condition was monitored. On Day 7 and Day 14 after injection, the animals were euthanized, and the DRGs (between L4-L5) at the injection site were collected. The tissues were immediately placed into pre-chilled cryovials and snap-frozen in liquid nitrogen.

[0253] qRT-PCR was used to evaluate the effect of ASO Product No. 3 on the rat Nav1.8 mRNA level in DRG tissue. RNA from DRG tissues collected 7 days after injection was purified by EZ-press 96 Tissue RNA Purification Kit (EZBioscience, Cat. No. EZ4004-L) , then qRT-PCR was performed to analyze the rat Nav1.8 mRNA level. The GAPDH gene was used as the housekeeping gene for normalization. The relative Nav1.8 mRNA expression was obtained by comparing to the vehicle treated group. The primers used here are same as Example 8.

[0254] Western blotting was used to evaluate the effect of ASO product No. 3 on rat Nav1.8 protein level in DRG tissue. Protein from DRG tissues collected 14 days after injection was extracted using pre-chilled RIPA buffer. Subsequently, equal amounts of protein samples were loaded and subjected to gel electrophoresis. Following this, the proteins were transferred from the gel onto the membrane. Western blotting was performed using the rat Nav1.8 specific antibody. β-tubulin was used as a housekeeping protein for loading control.

[0255] Results show that ASO Product No. 3 reduced in vivo rat Nav1.8 mRNA level with more than 50%in DRG 7 days after injection (Figure 5A) , and the in vivo protein level of rat Nav1.8 in DRG is also decreased by more than 70%14 days after injection (Figure 5B) as compared to the vehicle control group.

[0256] Example 10: Inhibition of Nav1.8 Expression in Transgenic Rats by Human SCN10A ASO

[0257] A transgenic rat model is used to evaluate the effect of selected ASOs that don’t match to rat SCN10A gene on the inhibition of Nav1.8 expression in vivo. The transgenic rat model is a human Nav1.8 transgenic rat.

[0258] 10.1 Construction of hNav1.8 transgenic rats

[0259] In the transgenic rat model, part of the coding region in exon 2 of the rat SCN10A gene is replaced with the coding sequence of the human SCN10A gene, and a vector containing "Kozak sequence-human SCN10A CDS region-rat SCN10A gene 3'UTR-WPRE-BGH polyA" is constructed. The constructed vector is co-injected with Cas9 protein and guide RNA into rat zygotes for gene editing. Genotype identification of born rats is performed by PCR and sequencing analysis to screen individuals who successfully integrated human genes. The selected gene-edited rats are bred to establish a stable homozygous humanized rat model. qRT-PCR and Western blotting are used to confirm that human Nav1.8, but not rat Nav1.8, is expressed in the humanized rat.

[0260] 10.2 ASO injection to hNav1.8 transgenic rats

[0261] Genetically modified rats are housed in a similar way to wild-type rats.

[0262] Selected SCN10A ASOs are used to further evaluate their effectiveness in hNav1.8 transgenic rats. Specifically, selected ASO or the conjugate form of selected ASO is administered at a dose of no more than 2 mg per transgenic rat. The mode of administration can be varied, including but not limited to intrathecal administration, intravenous administration, subcutaneous injection, intervertebral foramina administration, etc. qRT-PCR, Western blotting or Immunofluorescence staining, are used to evaluate the effect of ASO on the in vivo mRNA level or protein level of human Nav1.8 in DRG from hNaV1.8 transgenic rats.

[0263] The ASOs provided herein exhibit 20-80%Nav1.8 knockdown compared to the control group.

[0264] Example 11: Inhibition of Tetrodotoxin-Resistant (TTX-R) Current in Human DRG Neurons

[0265] Human DRG tissues are collected from post-mortem healthy adults without a history of pain-related disorders. The DRGs are enzymatically digested and the isolated neurons are cultured in DMEM F-12 supplemented with 2 mM Glutamine, 10%FBS, 10 ng / ml hNGF, 10 ng / ml GDNF and 1%penicillin-streptomycin and maintained at 37℃ in 5%CO2. After 2 to 4 days of culture, various concentrations of ASOs are evenly added to the medium and cells are further incubated before patch clamp recordings.

[0266] Whole-cell patch-clamp recordings are conducted under voltage-clamp mode at room temperature using a HEKA EPC-10 amplifier. 500 nM TTX are added to the external solution to isolate TTX-R current. The currents of control and ASO treated human DRG cells are measured by 50 ms pulses to 0 mV from a holding potential of -80 mV every 2 seconds.

[0267] ASOs provided herein significantly reduce the TTX-R current in human DRG neurons.

[0268] Example 12: Inhibition of Inflammation-Induced Spontaneous Activity in Human DRG Neurons

[0269] Dissociated human DRG neuron culture is obtained as previously described. After 2 to 4 days of culture, various concentrations of ASOs are evenly added to the medium and cells are further incubated before measuring inflammation-induced spontaneous activity by the fluorescent calcium imaging method.

[0270] For fluorescent calcium imaging, human DRG neurons are loaded with Fluo-8AM and are excited at 480nm while emission is collected at 100Hz at 520nm with a high-speed camera mounted on an inverted microscope. 5 to 10 minutes of baseline calcium signals are recorded before addition of 200 nM bradykinin and 2 μM PGE2, then 10 to 20 minutes of calcium signals are further recorded, which reflects inflammation-induced spontaneous activity of the neurons. Fluorescent calcium signals are quantified for each cell and an averaged spontaneous events per active neuron per 5 min is analyzed for comparison across different wells or groups.

[0271] ASOs provided herein significantly reduce the spontaneous activity of the neurons after applying inflammatory agents as compared to the control group.

[0272] Example 13: Study on the Analgesic Effect of human SCN10A ASO in Rat Pain Model

[0273] To assess the efficacy of selected ASOs in the treatment / prevention of neuropathic pain or inflammatory pain, particularly in spinal nerve ligation (SNL) model or complete Freund's adjuvant (CFA) model, selected ASO or the conjugate form of selected ASO is administered to SD rats or hNav1.8 transgenic rats. The mode of administration can be varied, including but not limited to intrathecal administration, intravenous administration, subcutaneous injection, intervertebral foramina administration, etc.

[0274] 13.1 Spinal Nerve Ligation (SNL) model of neuropathic pain

[0275] Adult male SD rats or hNav1.8 transgenic rats undergo unilateral ligation of L5 and / or L6 spinal nerves. Rats are anesthetized, and an incision of about 1.5-2 cm is made dorsal to the lumbosacral plexus. The paraspinal muscles are separated from the spinous processes. The L5 and / or L6 spinal nerves are carefully isolated and ligated with 3-0 silk threads. After the surgery is completed, the muscles and skin are carefully sutured and sterilized. The rats are allowed to recover and then placed in a clean rearing cage with appropriate postoperative care, including warmth and free drinking water. ASO is administered to the rats before or after SNL surgery. Tactile and / or thermal hyperalgesia are assessed before SNL surgery to measure baseline responses, and at selected time points between 3 and 28 days after SNL surgery to evaluate the analgesic effect of ASO.

[0276] Tactile hyperalgesia is measured using calibrated von Frey filaments. Rats are placed into individual Plexiglas containers, and the filament is applied to the plantar surface of the paw. Paw withdrawal threshold (PWT) is determined by increasing and decreasing the filament strength and calculated using a Dixon nonparametric test.

[0277] Thermal hyperalgesia is measured by assessing paw withdrawal latency to a noxious thermal stimulus. A thermal stimulus, in the form of radiant heat, is applied to the plantar surface of a hind paw and its withdrawal latency is determined.

[0278] 13.2 Complete Freund's Adjuvant (CFA) model of inflammatory pain

[0279] Adult male SD rats or hNav1.8 transgenic rats receive an injection of 150 μL of CFA into the plantar surface of a hind paw. ASO is administered to the rats before or after CFA injection. Tactile and / or thermal hyperalgesia are assessed before CFA injection to measure baseline responses, and at selected time points between 1 and 7 days after CFA injection to evaluate the analgesic effect of ASO, using the methods as described above.

[0280] Compared to the vehicle control group, the ASOs provided herein can significantly improve the pain phenotype in rat pain models.

[0281] Example 14: Tolerability of SCN10A ASO in animals

[0282] Selected doses of ASO are injected into the intervertebral foramina or intrathecal of rat, mouse, or cynomolgus monkeys, while control animals are injected with PBS. Animals are assessed for acute tolerability using a Functional Observational Test Panel (FOB) after a period of dosing, where lower scores indicate better tolerability. Control animals usually have a score of "0" or "1" .

[0283] In addition, after ASO treatment of animals, DRG tissues are collected for fixation and pathological section staining to observe cell morphology, neuronal damage, glial cell activation and inflammatory cell infiltration, in order to evaluate the possible toxicity of drugs to DRG tissues.

[0284] The ASO shows good in vivo tolerability, with no significant increase in FOB score, and a small impact on DRG tissues, suggesting that ASO has a lower risk of toxicity in the treatment of related diseases.

[0285] The foregoing description is considered as illustrative only of the principles of the present disclosure. Further, since numerous modifications and changes will be readily apparent to those skilled in the art, it is not desired to limit the invention to the exact construction and process shown as described above. Accordingly, all suitable modifications and equivalents may be considered to fall within the scope of the invention as defined by the claims that follow.

[0286] The words "comprise" , "comprising" , "include" , "including" , and "includes" when used in this specification and in the following claims are intended to specify the presence of stated features, integers, components, or steps, but they do not preclude the presence or addition of one or more other features, integers, components, steps, or groups thereof.

Claims

A oligonucleotide, wherein the oligonucleotide:(a) comprises any one of nucleotide sequence of SEQ ID NOs: 1-45 or a variant sequence with at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%identity to any one of SEQ ID NOs: 1-45;(b) is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%complementary to any one of nucleotide sequence of SEQ ID NO: 46-90;(c) comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 contiguous nucleotides that are complementary to a target region spanning from positions 167 to 184, 3821 to 3838, 1201 to 1218, 3171 to 3186, 2365 to 2382, 3777 to 3794, 4240 to 4257, 3937 to 3954, 1281 to 1298, 5948 to 5965, 5923 to 5940, 4269 to 4286, 3906 to 3923, 5773 to 5790, 3800 to 3817, 4170 to 4187, 5968 to 5985, 4136 to 4153, 4001 to 4018, 4135 to 4152, 4154 to 4171, 1113 to 1130, 1646 to 1663, 2196 to 2213, 1764 to 1781, 4441 to 4458, 2207 to 2224, 1134 to 1151, 3911 to 3928, 3216 to 3233, 3807 to 3824, 2801 to 2818, 1598 to 1615, 3156 to 3173, 2187 to 2204, 5452 to 5469, 5989 to 6006, 2034 to 2051, 2303 to 2320, 3765 to 3782, 3876 to 3893, 3404 to 3421, 1541 to 1558, 3831 to 3848, 2727 to 2744 of mRNA sequence of a NAV1.8 encoding gene; and / or(d) comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleotides that are complementary to a target region spanning from positions 167 to 184, 3821 to 3838, 1201 to 1218, 3171 to 3186, 2365 to 2382, 3777 to 3794, 4240 to 4257, 3937 to 3954, 1281 to 1298, 5948 to 5965, 5923 to 5940, 4269 to 4286, 3906 to 3923, 5773 to 5790, 3800 to 3817, 4170 to 4187, 5968 to 5985, 4136 to 4153, 4001 to 4018, 4135 to 4152, 4154 to 4171, 1113 to 1130, 1646 to 1663, 2196 to 2213, 1764 to 1781, 4441 to 4458, 2207 to 2224, 1134 to 1151, 3911 to 3928, 3216 to 3233, 3807 to 3824, 2801 to 2818, 1598 to 1615, 3156 to 3173, 2187 to 2204, 5452 to 5469, 5989 to 6006, 2034 to 2051, 2303 to 2320, 3765 to 3782, 3876 to 3893, 3404 to 3421, 1541 to 1558, 3831 to 3848, 2727 to 2744 of SEQ ID NO: 91.The oligonucleotide of claim 1, wherein the oligonucleotide optionally comprises one or more modifications.The oligonucleotide of claim 1 or 2, wherein the modification of the oligonucleotide comprises one or more base modifications, sugar modifications, and / or internucleoside linkage modifications.The oligonucleotide of any one of claims 1-3, wherein:(a) the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, and / or 10th nucleosides from the 5' end of the oligonucleotide comprise a modification; and / or(b) the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, and / or 10 nucleosides from the 3' end of the oligonucleotide comprise a modification.The oligonucleotide of any one of claims 1-4, wherein:(a) 1, 2, 3, 4, 5, 6, 7, 8, 9 and / or 10 contiguous nucleosides from the 5' end of the oligonucleotide comprise a modification; and / or(b) 1, 2, 3, 4, 5, 6, 7, 8, 9 and / or 10 contiguous nucleosides from the 3' end of the oligonucleotide comprise a modification.The oligonucleotide of any one of the claims 1-5 wherein:(a) the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, and / or 10th nucleosides from the 5' end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise a modification; and / or(b) the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, and / or 10th nucleosides from the 3' end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise a modification.The oligonucleotide of any of the claims 1-6, wherein:(a) 1, 2, 3, 4, 5, 6, 7, 8, 9 and / or 10 contiguous nucleosides from the 5' end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise a modification; and / or(b) 1, 2, 3, 4, 5, 6, 7, 8, 9 and / or 10 contiguous nucleosides from the 3' end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise a modification.The oligonucleotide of any one of claims 3-7, wherein the base modification of the oligonucleotide is selected from the group consisting of: pseudouracil (ψ) , N1-methylpseudouracil (N1Mψ) , 1-ethylpseudouracil, 2-thiouracil (s2U) , 4-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil and a combination thereof.The oligonucleotide of any one of claims 3-8, wherein the sugar modification of the oligonucleotide comprises a 2' sugar modification.The oligonucleotide of any one of claims 3-9, wherein the sugar modification of the oligonucleotide is selected from the group consisting of: Locked Nucleic Acid (LNA) modification, 2'-O-methyl (Me) modification, 2'-O-ethyl modification, 2'-O-methoxyethyl (MOE) modification, 2'-F modification and a combination thereof.The oligonucleotide of any one of claims 1-10, wherein:(a) 1, 2, 3, 4, 5, 6, 7, 8, 9 and / or 10 contiguous nucleosides from the 5' end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise LNA modification for each nucleoside and / or 5-methylcytosine substitution for each cytosine present; and / or(b) 1, 2, 3, 4, 5, 6, 7, 8, 9 and / or 10 contiguous nucleosides from the 3' end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise LNA modification for each nucleoside and / or 5-methylcytosine substitution for each cytosine present.The oligonucleotide of any one of claims 1-11, wherein:(a) 4 contiguous nucleosides from the 5’ end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise LNA modification for each nucleoside and 5-methylcytosine substitution for each cytosine present, optionally, the LNA modification is methyleneoxy (4’ -CH2-O-2’ ) LNA modification; and / or(b) the 4 contiguous nucleosides from the 3’ end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise LNA modification for each nucleoside and 5-methylcytosine substitution for each cytosine present, optionally, the LNA modification is methyleneoxy (4’ -CH2-O-2’ ) LNA modification.The oligonucleotide of any one of claims 1-12, wherein at least one internucleoside linkage between two adjacent nucleosides is a phosphorothioate linkage.The oligonucleotide of any one of claims 1-13, wherein each internucleoside linkage within any nucleotide sequence of SEQ ID NOs: 1-45 or the variant sequence thereof is a phosphorothioate linkage.The oligonucleotide of any one of claims 1-14, wherein:(a) 4 contiguous nucleosides from the 5’ end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise LNA modification for each nucleoside and 5-methylcytosine substitution for each cytosine present, optionally, the LNA modification is methyleneoxy (4’ -CH2-O-2’ ) LNA modification; and / or(b) the 4 contiguous nucleosides from the 3’ end of any nucleotide sequence in SEQ ID NOs: 1-45 or the variant sequence thereof comprise LNA modification for each nucleoside and 5-methylcytosine substitution for each cytosine present, optionally, the LNA modification is methyleneoxy (4’ -CH2-O-2’ ) LNA modification; and(c) each internucleoside linkage within any nucleotide sequence of SEQ ID NOs: 1-45 or the variant sequence thereof is a phosphorothioate linkage.The oligonucleotide of any one of claims 1-15, which is capable of lowering mRNA transcription of NAV1.8 gene and / or promoting mRNA degradation of NAV1.8 gene.The oligonucleotide of any one of claims 1-16, which lowers mRNA transcription of NAV1.8 gene and / or promotes mRNA degradation of NAV1.8 gene by recruiting ribonuclease (RNase) .The oligonucleotide of claim 17, wherein the ribonuclease is RNase H.The oligonucleotide of claim 18, wherein the ribonuclease is RNase H1.The oligonucleotide of claims 1-19, which is single-stranded.The oligonucleotide of any one of claims 1-20, wherein the oligonucleotide is a gapmer motif.The oligonucleotide of any one of claim 21, wherein the gapmer motif comprises an internal gap region flanked by a 3' flanking region and a 5' flanking region.The oligonucleotide of claim 22, wherein the gapmer motif is represented by the formula X-Y-Z, wherein X represents the 5' flanking region, Y represents the internal gap region, and Z represents the 3' flanking region, wherein X and Z are each independently composed of 3, 4 or 5 contiguous nucleotides, Y is composed of 10, 11, 12, 13, 14 or 15 contiguous nucleotides.The oligonucleotide claim 23, wherein the gapmer motif is a 5-10-5, 4-10-4, 4-10-4, 2-14-3, 4-12-3, 4-13-2, 3-12-4, 2-13-4, 3-10-3, 3-11-3, 3-12-3 or 3-13-3 gapmer motif, wherein the numbers represent the number of contiguous nucleotides in X, Y, and Z, respectively.The oligonucleotide claim 24, wherein the gapmer motif is 1_1-13-3, 3-13-1_1, 4-12-1_1, or 1_1-12-4 gapmer, wherein the numbers represent the number of contiguous nucleotides in X, Y, and Z, respectively, except that “1_1” indicates a nucleotide triplet wherein the first nucleotide and the third nucleotide of the triplet comprise a sugar modification, and the second nucleotide comprises an unmodified sugar.The oligonucleotide claim 25, wherein the second nucleotide comprising an unmodified sugar is a ribonucleotide.The oligonucleotide of any one of claims 21-26, wherein the 5’ flanking region and / or the 3’ flanking region consists of contiguous nucleotides and the internal gap region consists of contiguous deoxynucleosides.The oligonucleotide of any one of claims 21-27, wherein each nucleotide in the 5’ flanking region and / or in the 3’ flanking region comprise 2'-O-methoxyethyl (MOE) modification or Locked Nucleic Acid (LNA) modification.The oligonucleotide of any one of claims 21-28, wherein each cytosine in the 5’ flanking region and / or in the 3’ flanking region is 5-methylcytosine.The oligonucleotide of any one of claims 14-20, wherein each internucleoside linkage within the gapmer motif or within the oligonucleotide is a phosphorothioate linkage.The oligonucleotide of any one of claims 1-30, wherein chemical structure of the oligonucleotide is according to Table 1.The oligonucleotide of any one of claims 1-31, which is covalently linked to a conjugate portion.The oligonucleotide of claim 32, wherein the conjugate portion is capable of specifically targeting to target cells.The oligonucleotide of claim 32 or 33, wherein the conjugate portion comprises N-acetylgalactosamine (GalNAc) , antibody or antigen-binding fragment.The oligonucleotide of any one of claims 1-34, which is a pharmaceutically acceptable salt.A composition comprising the oligonucleotide of any of claims 1-35.The composition of claim 36, wherein the composition is a pharmaceutical composition, and the pharmaceutical composition optionally comprises a pharmaceutically acceptable carrier.A vector comprising the oligonucleotide of any of claims 1-35.A method of regulating the expression of NAV1.8 in NAV1.8 expressing target cells, comprising exposing the target cells to the oligonucleotide of any of claims 1-35, the composition of claim 36 or 37, and / or the vector of claim 38.A method of downregulating NAV1.8 expression in NAV1.8 expressing target cells, comprising exposing the target cells to the oligonucleotide of any of claims 1-35, the composition of claim 36 or 37, and / or the vector of claim 38.The method of claim 39 or 40, wherein the target cells are neural cells.The method of any one of claims 39-41 wherein the target cells are dorsal root ganglion (DRG) neurons.A method of treating, alleviating, or preventing a disease or symptom, comprising administering an effective amount of the oligonucleotide of any one of claims 1-35, the composition of claim 36 or 37, and / or the vector of claim 38 to a subject in need.The method of claim 43, wherein the disease or symptom is a NAV1.8-mediated disease or symptom.The method of claim 43, wherein the disease or symptom is a NAV1.8-mediated disease or symptom is selected from chronic pain, neuropathic pain, inflammatory pain, musculoskeletal pain, gut pain, spontaneous pain, nociceptive pain, cancer pain, idiopathic pain, postsurgical pain, visceral pain, multiple sclerosis, Charcot-Marie-Tooth syndrome, incontinence, pathological cough, or cardiac arrhythmia. In certain embodiments, the disease or symptom comprises inflammatory pain, musculoskeletal pain and / or neuropathic pain.The method of claim 43, wherein the disease or symptom is neuropathic pain, the neuropathic pain comprises post-herpetic neuralgia, diabetic neuralgia, small fiber neuropathy, idiopathic small-fiber neuropathy, painful HIV-associated sensory neuropathy, trigeminal neuralgia, burning mouth syndrome, post-amputation pain, phantom pain, painful neuroma, traumatic neuroma, Morton's neuroma, nerve entrapment injury, spinal stenosis, carpal tunnel syndrome, radicular pain, sciatica pain, nerve avulsion injury, brachial plexus avulsion injury, complex regional pain syndrome, drug therapy induced neuralgia, cancer chemotherapy induced neuralgia, anti-retroviral therapy induced neuralgia, post spinal cord injury pain, idiopathic small-fiber neuropathy, idiopathic sensory neuropathy and / or trigeminal autonomic cephalalgia.The method of claim 43, wherein the disease or symptom is musculoskeletal pain.The method of claim 43, wherein the musculoskeletal pain comprises osteoarthritis pain, back pain, cold pain, burn pain or dental pain.The method of claim 43, wherein the disease or symptom is inflammatory pain.The method of claim 43, wherein the inflammatory pain is rheumatoid arthritis pain.The method of any one of claims 39-50, wherein the subject is a mammal (e.g., human) .A kit for implementing the method of any one of claims 39-51.

Images