Short interfering nucleic acid molecule for the treatment of timothy syndrome type 1 associated with mutations in the alpha subunit of the l-type calcium channel gene
A cardiac gene therapy using RNA interference selectively suppresses mutant CACNA1C mRNA to treat Timothy syndrome type 1, effectively shortening QT interval and normalizing electrophysiological behavior in affected cells.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- INSTI CLINICI SCII MAUGERI S P A S B
- Filing Date
- 2025-12-11
- Publication Date
- 2026-06-18
AI Technical Summary
Current therapies are inadequate in reducing sudden death in individuals with Timothy syndrome type 1 (TS1), a severe inherited disease characterized by QT interval prolongation, functional conduction blocks, and predisposition to life-threatening arrhythmias, due to mutations in the alpha subunit of the L-type calcium channel (LTCC) gene.
A cardiac gene therapy using an RNA interference pathway with an artificial miRNA-expressing vector to selectively suppress the expression of the mutant CACNA1C mRNA, while leaving the expression of the wild-type transcript unchanged, achieved through the use of carefully selected interfering RNA sequences and an appropriate AAV serotype.
The therapy effectively reduces the duration of ventricular repolarization time, as indicated by the QT interval, and restores normal electrophysiological behavior in cardiomyocytes, demonstrating a therapeutic effect in both a swine model and human-induced pluripotent stem cell-derived cardiomyocytes.
Smart Images

Figure IT2025050291_18062026_PF_FP_ABST
Abstract
Description
[0001] SHORT INTERFERING NUCLEIC ACID MOLECULE FOR THE TREATMENT OF TIMOTHY SYNDROME TYPE 1 ASSOCIATED WITH MUTATIONS IN THE ALPHA SUBUNIT OF THE L-TYPE CALCIUM CHANNEL GENE
[0002] The present invention concerns a short interfering nucleic acid (siNA) molecule for the treatment of Timothy syndrome type 1 associated with mutations in the alpha subunit of the L-type calcium channel (LTCC) gene (CACNA1 C). In particular, the present invention concerns a siNA molecule, preferably an RNA interference molecule, designed to induce allele-specific silencing of the mutant mRNA for the treatment of autosomal dominant Timothy syndrome type 1 associated with mutations in the alpha subunit of the L-type calcium channel (LTCC), or the L-type calcium channel CaV1.2, gene (CACNA1 C).
[0003] It is known that Timothy syndrome type 1 (TS1 ) is a severe inherited disease, belonging to the spectrum of Long QT Syndrome (LOTS), affecting the heart and other organ systems. From an electrophysiological perspective, it is characterized by a triad of
[0004] 1 ) extreme prolongation and instability of ventricular repolarization, represented by the marked QT interval prolongation on the surface electrocardiogram (ECG);
[0005] 2) functional conduction blocks; and
[0006] 3) predisposition to the development of life-threatening arrhythmias as early as the first months of life.
[0007] Congenital heart defects and cardiac hypertrophy complete the spectrum of cardiac features.
[0008] Clinical observations have shown that patients with TS1 develop lifethreatening ventricular arrhythmias in the first months of life, with most patients dying by the second year of life.
[0009] However, current therapies are unable to reduce sudden death in affected individuals.
[0010] In 2004, Splawski and colleagues found that patients with TS1 carry the same de novo mutation p.Gly406Arg in the alternatively spliced exon 8A of the CACNA1C gene, which encodes the alpha subunit of the L-Type Calcium Channel (LTCC) (Splawski I, et al. 2004). The p.Gly406Arg mutation is located in the distal part of the sixth transmembrane segment of domain I, which plays a critical role in the voltage-dependent inactivation (VDI) of LTCC.
[0011] Patch clamp studies in Chinese hamster cells (CHO) have shown a nearcomplete loss of voltage-dependent inactivation (VDI) in mutant channels (Splawski I, et al. 2004). Since the LTCC conducts the inward calcium current (ICa++) that maintains the plateau phase of the cardiac action potential, the gain-of-function effect substantially prolongs the action potential duration (APD). Studies in induced pluripotent stem cell (iPSC)-derived cardiomyocytes (Yazawa M, et al. 2011 ) and in a transgenic mouse model (Cheng EP, et al. 2011 ) of TS1 have also demonstrated a state of Ca2+ overload leading to spontaneous Ca2+ release from the sarcoplasmic reticulum and generation of delayed afterdepolarizations (DADs).
[0012] In the light of the above, it is therefore apparent the need to provide new effective therapies for the treatment of TS1 able to overcome the limits of known therapies.
[0013] According to the present invention has now been developed a cardiac gene therapy that reduces the levels of the mutant protein encoded by the mutant allele of the CACNA1 C gene and is able to restore the wild-type phenotype.
[0014] In particular, according to the present invention it was found that by using the endogenous RNA interference (RNAi) pathway (Elbashir et al., 2001 ) by introducing an artificial miRNA-expressing vector into a cardiac cell, it is possible to selectively suppress the expression of the mutant CACNA1 C mRNA and leave the expression of the wild-type CACNA1 C transcript virtually unchanged to correct functional disorders observed in CACNA1 C p.Gly406Arg heterozygous individuals. In fact, the short interfering nucleic acid according to the invention is advantageously able to achieve a high knockdown rate of the mutant mRNA through sequence complementarity while leaving the expression of the wild-type CACNA1 C transcript virtually unchanged.
[0015] Therefore, the present invention advantageously provides a short interfering nucleic acid (siNA) for treating autosomal dominant TS1 by post-transcriptional gene silencing and, in particular, by silencing sequences that allow differentiation of the normal allele from the diseased allele of the CACNA 1C gene.
[0016] More in detail, according to the present invention, it was surprisingly shown that by a careful selection of interfering RNA sequences and the use of an appropriate AAV serotype, promoter, and vector dose, it is possible to achieve a degree of gene silencing of the mutant allele sufficient to achieve the desired effect of reducing the duration of ventricular repolarization time (expressed by the duration of the QT interval on the surface ECG) but not affecting cardiac function.
[0017] As shown in the experimental data reported below, according to the present invention siRNAs carrying nucleotide variations characterizing the target disease allele were designed and most siRNA duplexes effectively suppressed CACNA1 C mRNA expression, with some demonstrating selectivity for the mutant allele.
[0018] Moreover, one of the designed siRNA was into an artificial miRNA viral expression vector (AAV8) and was tested in vivo by administration to heterozygous CACNA1 C p.Gly406Arg+ / WT piglets. Considering that the cardiac action potential in mice has different electrophysiological properties than those in humans, the experimental data reported below were conducted on a swine model of LQT8 previously developed by the inventors (Porta-Sanchez A, et al. 2023), i.e. a knock- in porcine model of TS1 with the p.Gly406Arg mutation in the exon 8A of the CACNA1C gene that presents electrophysiological properties more closely related to those present in humans. In fact, the sequence of exon 8A in swine has 100% homology with the human sequence of the same exon. According to the present invention, it has been demonstrated that TS1 porcine model recapitulates the clinical manifestations of the arrhythmogenic substrate seen in patients, such as the QT interval prolongation and the spontaneous development of life-threatening ventricular arrhythmias in 30% of the mutant animals (Figure 1 ) and, subsequently, the gene therapy was tested in such model by perfecting an intravenous method for the successful delivery, infection, and transduction of cardiomyocytes. Therefore, the TS1 swine model was used as a proof of concept for the efficacy of the gene therapy according to the present invention.
[0019] As a result of the treatment with the siRNA expression vector, treated TS1 piglets demonstrated a remarkable shortening of the QT interval on the surface ECG, as compared to untreated TS1 animals. Moreover, electrophysiological studies carried out on left ventricular myocytes from adult TS1 pigs, treated or not with the siRNA of the invention, showed that the electrophysiological behaviour was recovered in treated cells and it was comparable to the electrophysiological behaviour of a healthy cell.
[0020] Therefore, the present invention provides a siRNA for the treatment of autosomal dominant TS1 associated with CACNA1 C (NG_008801 .2) mutations in human patients with TS1 and in a swine model. In particular, as mentioned above, siRNAs according to the present invention effectively suppressed CACNA1 C mRNA expression. Moreover, a siRNA according to the present invention showed a therapeutic effect both in a knock-in pig model of TS1 carrying the heterozygous p.Gly406Arg mutation in the CACNA1 C gene and in TS1 CACNA1 C p.G406R+ / wrhuman induced pluripotent stem cell-derived cardiomyocytes.
[0021] The siNA according to the present invention specifically targets the mature mRNA of mutated CACNA1 C gene, carrying the mutation G406R in exone 8A. Therefore, the siNA according to the present invention is advantageously able to selectively bind and suppress only the mRNA transcript of the CACNA1 C mutant allele, therefore allowing the wild type allele mRNA transcript to be maintained. This approach allows an efficient and specific therapy for Timothy syndrome type 1 patients carrying G406R mutation.
[0022] It is therefore specific object of the present invention a short interfering nucleic acid (siNA) molecule that inhibits the expression of a mutant allele of the human CACNA1 C gene (NG_008801 .2), which encodes the alpha subunit of the L- type calcium channel, said mutant allele comprising the mutation p.Gly406Arg in the exon 8A of the CACNA1 C gene, wherein said short interfering nucleic acid (siNA) molecule comprises or consists of a binding sequence that is complementary to at least a part of an RNA, such as an mRNA, associated with the expression of said mutant allele.
[0023] According to the present invention, said RNA is preferably an mRNA, more preferably a mature mRNA, i.e. an RNA transcript that has been spliced and processed and is ready for the translation process. According to a preferred embodiment of the present invention, said RNA is not a pre-mRNA, i.e. is not the primary RNA obtained by DNA transcription which still has to be processed (through the addition of a 5' cap, the addition of a 3' polyadenylated tail, and RNA splicing) into mature RNA.
[0024] According to the present invention, the binding sequence of said siNA selectively binds the mRNA transcript of a CACNA1 C mutant allele, suppressing its expression. In fact, the siNA of the invention targets the CACNA1 C region containing the nucleotide mutation.
[0025] According to the present invention, said siNA molecule can be a DNA molecule, an RNA molecule or can comprise both DNA and RNA.
[0026] According to the present invention, said siNA molecule according to claim 1 , wherein said siNA molecule is single-stranded or double-stranded (duplex), preferably double-stranded. When the siNA is double stranded, the siNA molecule comprises a sense strand and an antisense strand, the sense strand being complementary to the antisense strand, and the antisense strand comprises or consists of said binding sequence that is complementary to at least a part of an RNA, such as an mRNA, associated with the expression of said mutant allele.
[0027] According to the present invention, said siNA molecule can be a doublestranded RNA (dsRNA), such as a dsRNA chosen from the group consisting of short interfering RNA (siRNA), micro-RNA (miRNA), short hairpin RNA (shRNA)and circular RNA molecule, or a single-stranded antisense oligonucleotide (ASO).
[0028] According to the present invention, said binding sequence of said siNA can have a length from 17 to 25 nucleotides, preferably at least 21 nucleotides, more preferably 21 nucleotides.
[0029] According to the present invention, said binding sequence can be complementary to at least part of the sequence 5’- GGUUCUCGGUGUCCUUAGCAGAGAGUUUUCCAAAGAGA-3’ (SEQ ID NO:1 ), wherein said at least part of SEQ ID NO:1 comprises the mutated nucleotide A highlighted in bold. Therefore, the siNA according to the present invention can specifically bind the above-mentioned region SEQ ID NO:1 of the mature mRNA transcript of the CACNA1 C mutant allele, which is a portion of exon 8A comprising the G406R mutation.
[0030] According to a preferred embodiment of the present invention, the binding sequence of said siNA is complementary to 5’-UUAGCAGAGAGUUUUCCAAAG-3’ (SEQ ID NO:2) or to 5’-UCCUUAGCAGAGAGUUUUCCA-3’ (SEQ ID NO:3). In particular, according to a preferred embodiment of the present invention, said siNA is an RNA molecule and the binding sequence of said siNA comprises or consists of a nucleotide sequence selected from the group consisting of 5’ — CUUUGGAAAACUCUCUGCUAA- 3’(SEQ ID NO:29) and 5’- UGGAAAACUCUCUGCUAAGGA-3’ (SEQ ID NQ:30)
[0031] Therefore, according to the present invention, when said siNA molecule is single-stranded, said siNA molecule can comprise or consists of SEQ ID NQ:20 or SEQ ID NQ:30 as binding sequences complementary to the target mRNA sequence, whereas when said siNA molecule is double-stranded, said siNA molecule can comprise or consists of i) 5’-UUAGCAGAGAGUUUUCCAAAG-3’ (SEQ ID NO:2)(siCACNA1 C-A6) as sense strand and SEQ ID NO:29 as anti-sense strand (which is the binding sequence) or of ii) 5’-UCCUUAGCAGAGAGUUUUCCA-3’ (SEQ ID NO:3) (siCACNAI C-A9) as sense strand and SEQ ID NQ:30 as anti-sense strand (which is the binding sequence).
[0032] According to the present invention, said siNA preferably further comprises, at 3’ end, a 3’-overhang, such as a two-base 3’-overhang, for example the sequence TT. A person skilled in the art is able to choose a suitable 3’-overhang sequence, which is known to be functional to the correct loading of the siNA in the interference mechanism.
[0033] Therefore, according to the present invention, said siNA can comprise or consist of a nucleotide binding sequence as defined above fused to a 3’ -overhang sequence. For example, when said siNA is double-stranded, the sense strand can comprise or consists of a sequence chosen from 5’- UUAGCAGAGAGUUUUCCAAAGTT-3’ (SEQ ID NO:4)(siCACNA1 C-A6), and 5’- UCCUUAGCAGAGAGUUUUCCATT-3’ (SEQ ID NO:5) (siCACNAI C-A9).
[0034] According to the present invention, one or more nucleotides of said siNA molecule can comprise modifications. In particular, said modifications can be chosen from the group consisting of 2’0-methyl modification, 2’fluoro modification.
[0035] Moreover, according to the present invention, said siNA molecule can comprise one or more phosphorothioate internucleotide linkage.
[0036] The present invention concerns also an expression vector comprising a siNA molecule as defined above. Said expression vector expresses the siNA molecule as defined above when delivered to target cells or tissues. According to an embodiment of the present invention, the siRNA molecule as defined above, which can be expressed through said expression vector, is delivered to cardiomyocytes as target cells.
[0037] According to the invention, the expression vector can be chosen from the group consisting of a plasmid, such as a recombinant plasmid, or a viral vector. In particular, the viral vector can be chosen from the group consisting of a serotype 9 adeno-associated viral (AAV2 / 9) vector, a serotype 6 adeno-associated viral (AAV2 / 6) vector or a serotype 8 adeno-associated viral (AAV2 / 8) vector, preferably a serotype 8 adeno-associated viral (AAV2 / 8) vector.
[0038] According to the present invention, said expression vector can comprise an expression cassette containing a promoter operably linked to the sequence encoding said double-stranded siNA molecule.
[0039] In particular, according to the present invention, the expression of the siNA interfering molecule could be under the control of different promoter sequence. More in detail, said promoter can be chosen from the group consisting of CMV promoter, alpha-MHC promoter, cTnT promoter, Desmin promoter.
[0040] A further object of the invention is a pharmaceutical composition comprising a siNA molecule as defined above or an expression vector as defined above, together with one or more pharmaceutically acceptable excipients and / or adjuvants.
[0041] According to the present invention, said pharmaceutical composition can further comprise a pharmaceutical carrier or diluent, such as a cationic lipid or liposome or nanoparticles.
[0042] The present invention also concerns a combination or kit of parts comprising or consisting of
[0043] A) a siNA molecule as defined above, an expression vector as defined above or a pharmaceutical composition as defined above and
[0044] B) a non-selective beta blocker, such as nadolol or propranolol.
[0045] The present invention also concerns a siNA molecule as defined above, expression vector as defined above, pharmaceutical composition as defined above or combination as defined above for medical use.
[0046] Moreover, the present invention concerns a siNA molecule as defined above, expression vector as defined above or pharmaceutical composition as defined above for use in the treatment of Timothy syndrome type 1 . In addition, the present invention also concerns a combination or kit as defined above for separate or sequential use in the treatment of Timothy syndrome type 1 .
[0047] “Separate use” is understood as meaning the administration, at the same time, of the two compounds of the kit according to the invention in distinct pharmaceutical forms. “Sequential use” is understood as meaning the successive administration of the two compounds of the kit according to the invention, each in a distinct pharmaceutical form.
[0048] The present invention also concerns a method for treating Timothy syndrome type 1 , said method comprising administering to a subject in need thereof a siNA molecule, a vector, a pharmaceutical composition or a combination as defined above, thereby treating Timothy syndrome type 1 .
[0049] The present invention now will be described by an illustrative, but not limitative way, according to preferred embodiments thereof, with particular reference to the examples and the enclosed drawings, wherein:
[0050] - Figure 1 shows the Electrophysiologic Characterization of TS1 pigs. PANEL A. Electrocardiographic assessment: QTc interval is significantly longer in TS1 pigs compared to their WT counterparts. PANEL B. Implantable loop recorder documentation of an episode of ventricular fibrillation causing sudden cardiac death in a TS1 mutant pig.
[0051] - Figure 2 shows the in vitro system to screen multiple siRNAs for allelespecific silencing. Two plasmids were generated as reporter alleles for the experiment. The first plasmid contains a CMV promoter followed by a reporter gene (red fluorescent protein, RFP) in-frame linked to the porcine cDNA sequence corresponding to WT-pCACNA1 C (exons 7 to 10, including exon 8A) and a tag sequence (3xHA). The second plasmid contains a CMV promoter followed by a reporter gene (Green Fluorescent Protein, GFP) in-frame linked to the porcine cDNA sequence corresponding to p.Gly406Arg pCACNAI C (exons 7 to 10, including exon 8A) and a tag sequence (3xFLAG). The two reporter alleles and siRNA duplexes are co-transfected into cultured HEK-293 cells to examine, under heterozygous conditions, the effects of a series of siRNA duplexes on inducing specific silencing on the mutant allele as well as off-target silencing against wildtype allele.
[0052] - Figure 3 shows siRNAs effect evaluation by RealTime PCR analysis of reporter alleles expression. The expression of both the wild-type and mutant alleles was assessed through Real-Time PCR analysis in transiently transfected HEK293 cells. The CACNA1 C partial cDNA and FLAG or HA specific primers were selectively amplified to quantify the mRNA expression of the mutated or wild-type alleles, respectively. The expression data were analyzed using the 2_AActmethod, normalized on GAPDH expression, and relative to the cells transfected with only the reporter alleles and no siRNA.
[0053] - Figure 4 shows siRNAs effect evaluation by Western Blot analysis of reporter alleles expression. Four siRNAs (A6, A9, A14, and A15) were selected to be analyzed by Western Blot, using specific antibodies against the HA and FLAG epitopes to assess the protein expression of the mutated and wild-type alleles relative to the cells transfected only with the reporter alleles and no siRNA.
[0054] - Figure 5 shows Cloning and validation of the candidate siRNA into an artificial miRNA-Expressing AAV backbone plasmid. A) The siRNA-A6 was selected from the previous step to be converted into an artificial miRNA and cloned into an expression vector, which allows for continuous and long-term expression of the silencing molecule. The BLOCK-iT™ Pol II miR RNAi Expression Vector (Life Technologies) was used as an intermediate vector. Subsequently, a fragment consisting of the CMV promoter, EmGFP, pre-miRNA sequence, and TKpolyA, was amplified from the BLOCK-iT™ Pol II miR RNAi Expression Vector (Life Technologies) and sub-cloned into the adeno-associated viral backbone vector pAAV2.1. B) The resulting plasmid was validated via Real-Time analysis in the HEK293 cellular system, with heterozygous conditions created through the transfection of the two reporter alleles. It was demonstrated that miR-A6 retained the capacity of siRNA-A6 in substantially suppressing mutant allele expression over wild-type. The pAAV2.1 -GFPmiR-A6 plasmid was used to produce AAV9_miR-A6 particles to infect CACNA1C p.Gly406Arg + / wt heterozygous piglets to study in vivo the functional effects of the therapy.
[0055] - Figure 6 shows examples of ECG traces before and after treatment. The corrected QT interval measured at baseline in non-treated animals was of 580ms and is reduced to 457 ms in animals subjected to injection of AAV8 vectors encoding miCACNA1 C-A6 one month after infection.
[0056] - Figure 7 shows electrophysiological studies on TS1 isolated cardiomyocytes. (A) Left ventricular myocytes from adult TS1 pigs, infected and non-infected with AAV8-miCACNA1 C-A6 gene therapy, were isolated and plated for electrophysiological studies and confocal measurements of GFP levels to distinguish between infected (GFP+, white cells in the image) and non-infected cells (GFP-, grey cells in the image). (B-C) ICa recordings was measured in the wholecell voltage-clamp configuration demonstrating faster rates of ICa inactivation in the GFP+ infected cells compared to the non-infected GFP- TS ventricular myocytes, despite equivalent ICa peak density between infected and non-infected cardiomyocytes.
[0057] - Figure 8 illustrates the effects of AAV8-miCACNA1C-A6 administration in human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) obtained from a Timothy Syndrome type 1 (TS1) subject carrying the heterozygous CACNA1C p.G406R mutation. (A) Image of a 45-day-old monolayer culture of TS1 hiPSC-CMs, captured 15 days following infection with AAV8-miCACNA1 C-A6 at a multiplicity of infection (MOI) of 400,000. The vector encodes miCACNA1 C-A6 and GFP. The presence of green fluorescence corresponds to successful viral transduction (white arrows). (B) Quantitative RT- PCR analysis demonstrating that AAV8-miCACNA1 C-A6 treatment reduces the fraction of transcripts containing the target G406R mutant Exon8A in infected cells (TS-GT) relative to untreated TS1 hiPSC-CMs (TS). (C) Whole-cell patch-clamp recordings showing that exposure to AAV8-miCACNA1 C-A6 results in an action potential waveform in TS1 hiPSC-CMs that approximates that observed in wild-type (WT) control hiPSC-CMs. (D) Electrophysiological analysis indicating that AAV8- miCACNA1 C-A6 treatment reduces multiple pathological action potential parameters in TS1 hiPSC-CMs — including peak-to-peak interval, time to 90% repolarization, and the ratio of early- to late-repolarization durations — returning these parameters to values consistent with WT cells.
[0058] EXAMPLE 1: Production of siRNA-A6 duplex sequences targeting mutant p. Gly406Arg CACNA 1C mRNA according to the invention and evaluation of efficacy thereof in swine model.
[0059] MATERIALS AND METHODS
[0060] Animal Use
[0061] The animals used in this study were bred and maintained at the CNIC Laboratories in Madrid, Spain, and transferred to the CNIC Laboratories for phenotype characterization. All animal experiments complied with the protocols approved by the CNIC's Animal Care and Use facility. 5e1013vg / Kg of purified adeno-associated virus were delivered via intra-jugular vein injection in 45-day-old piglets.
[0062] Quantitative Real-Time PCR
[0063] Real-time PCR was conducted using the Bio-Rad CFX96 Real-Time PCR Detection System and analyzed using the Bio-Rad CFX Manager software package (Bio-Rad Laboratories, Inc., USA). Total RNA was purified from HEK293 cells (available at Maugeri Institute, Italy) transiently transfected with reporter alleles and siRNA duplexes or with reporter alleles and pAAV2.1 -miR-A6 using the Rneasy mini kit (Qiagen). The absorbance at 260 nm (A260) was measured for each RNA sample using the NanoDrop (ND-1000) spectrophotometer (NanoDrop Technologies, Wilmington, Del., USA). A total of 1 pg template RNA was used for retrotranscription, which was performed with the iScript cDNA Synthesis kit (Bio-Rad Laboratories, Inc., USA). Quantitative real-time PCR analysis was performed in optical 96-well plates using the CFX96 detection module (BioRad Laboratories, Inc.) in triplicate with SsoFast EvaGreen Supermix and a specific primer mix to selectively amplify CACNA1 C partial cDNA and FLAG or HA, to quantify the mutated allele or wild-type mRNA, respectively:
[0064] Forward: 5’_CCATGGAGGGCTGGACCG _3’ (SEQ ID NO:6);
[0065] Reverse: 5’_CTGGTACCCTATTAAGCGTAGTCAGGTAC_3’ (SEQ ID NO:7) and
[0066] 5’_CTGGTACCCTTGTCATCGTCATCCTTGTAATCG_3’ (SEQ ID NO:8) and 20 ng of cDNA template.
[0067] Values for threshold cycle (Ct) determination were generated automatically by the Bio-Rad CFX Manager software 1 .5. GAPDH was used as internal reference using the following primers:
[0068] Forward: 5’_AAATCCCATCACCATCTTCC_3’ (SEQ ID NO:9), and Reverse: 5’_GGTTCACACCCATGACGAAC_3’ (SEQ ID NO: 10).
[0069] Immunoblotting
[0070] HEK293 cells transiently transfected with reporter alleles and siRNA duplexes or with reporter alleles, and pAAV2.l-miR-A6 have been lysed in RIPA buffer and total proteins extracted. Total proteins (30 pg / sample, quantified by the BCA assay) were resolved by SDS-gel electrophoresis, Mini PROTEAN TGX Stain- Free 4-15% gradient Gels (BioRad Laboratories, Inc.) using Tris / Glycine / SDS buffer (BioRad Laboratories, Inc.), and blotted on 0.2 pm nitrocellulose using Trans-Blot Turbo Transfer System (BioRad Laboratories, Inc.). The membranes were probed with different antibodies: anti-FLAG (F3165, SIGMA), anti-HA (H3663, SIGMA) and anti-GAPDH (G8795, SIGMA) as reference proteins. Secondary antibodies were conjugated with HRP (1 :5000, Promega). Specific signals were developed using the Clarity Western ECL substrate (BioRad Laboratories, Inc.) and detected using ChemiDoc MP Imaging System (BioRad Laboratories, Inc.).
[0071] Vector Design and Production
[0072] The siRNA-A6 duplex sequence, designed to target CACNA1 C mRNA containing the p.Gly406Arg mutation, was cloned into an artificial miRNA expression vector, BLOCK-iT Pol II miR RNAi Expression vector (Life Technologies, Cat. No: K4936-00), that allows continuous and long-term expression of the silencing molecule. The cloning procedure was based on ligation of annealed oligonucleotides 5'-TGCTGCTTTGGAAAACTCTCTGCTAAGTTTTG-3’ (SEQ ID NO:11 ), 5'-GCCACTGACTGACTTAGCAGAGTTTTCCAAAG-3’ (SEQ ID NO: 12), 5'-CCTGCTTTGGAAAACTCTGCTAAGTCAGTCAG-3’ (SEQ ID NO: 13), 5'-TGGCCAAAACTTAGCAGAGAGTTTTCCAAAGC-3’ (SEQ ID NO: 14) with the linearized vector pcDNATM6.2-GW / EmGFPmiR (Life Technologies, Cat. No: K4936-00).
[0073] From the obtained plasmid, a fragment consisting in CMV promoter, EmGFP, premiRNA sequence and TKpolyA was amplified by PCR with specific primers (Forward: 5' TAGCTAGCTGCTTCGCGATGTACGG 3' (SEQ ID NO: 15) and Reverse 5' GTGAATTCGAACAAACGACCCAACACCCG 3' (SEQ ID NO: 16) including the Nhel (Forward) and EcoRI (Reverse) cloning sites. The amplified fragment was then inserted into the pre-digested Nhel-EcoRI sites of an adeno- associated viral backbone vector pAAV-2.1. All plasmids used in the study were sequenced to ensure their accuracy and integrity.
[0074] The AAV production was outsourced to a company. The resulting viral preparation was suspended in PBS containing 0.001 % pluronic F68 at pH 7.4 and had a concentration of 5e13 GC / ml. All AAV stocks were frozen at -80° C. in single vials and thawed during the surgical procedure.
[0075] 12-lead ECG recording
[0076] The surface ECG was recorded at 1 kHz for at least 5 min (Mortara Instruments) (paper speed 25 mm s -1 and voltage settings 10 mm mV -1 ) in both TS1 and WT animals. The ECG parameters of interest (PR interval, QRS interval, QT interval and RR interval) were measured using manual calipers at a 25 mm s-1 sweep speed. The QT interval duration was measured at a stable heart rate between 50 and 100 beats per minute in lead Dll or V5 and corrected (QTc) using the Bazett formula (Bazett H, 1920) (Rautaharju PM, et al. 2009).
[0077] ICa measurements in isolated cardiomyocytes
[0078] Left ventricular myocytes from adult TS1 pigs, infected and non-infected with AAV8-miCACNA1 C-A6 gene therapy, were isolated using the Langendorff heart perfusion system. Subsequently, the isolated cells were plated for electrophysiological studies and confocal measurements of GFP levels, using a Zeiss LSM 880 confocal microscope, to distinguish between infected and noninfected TS cardiomyocytes. ICa recordings was performed in the whole-cell voltage-clamp configuration at 36 °C. For the ICa peak l-V curve, a protocol from a holding potential of -50 mV was used, 1 -s test pulses were applied to -50 mV to +50 mV in 10-mV increments.
[0079] EXPERIMENTAL SETTING AND RESULTS
[0080] The present study focuses on the porcine CACNA 1C gene (NC_010447.5), where the targeted nucleotide variant is c.1216G>A, leading to the amino acid substitution p.Gly406Arg in the porcine CaV1.2 protein.
[0081] The experiment aimed to perform allele-specific targeting to silence the allele carrying the mutation in the CACNA 1C gene.
[0082] The experiment used an AAV-mediated RNA interference approach to induce allele-specific silencing of the mutant gene in a knock-in CACNA1C p.Gly406Arg+ / wtporcine model of TS1 .
[0083] Screening multiple siRNAs in a transient expression system using reporter alleles.
[0084] In the first step of the experiment, several potential siRNAs were screened using a transient expression system with reporter alleles. Cellular models were used to test the possibility of targeting the mutant allele in a transient expression system. In vitro mRNA- and protein-based assays were performed to screen multiple potential siRNAs, to identify siRNAs that would preferentially recognize and efficiently silence the mutant allele over the wild-type allele.
[0085] Under heterozygous conditions, the effects of a series of siRNA duplexes on the mutant allele-specific silencing and off-target silencing against wild-type allele were examined. For this purpose, two reporter alleles and siRNA duplexes were cotransfected into cultured HEK-293 cells (Figure 2).
[0086] Two plasmids were generated as reporter alleles for the experiment. The first plasmid contained a CMV followed by a reporter gene (red fluorescent protein, RFP) linked in-frame to the porcine cDNA sequence corresponding to WT-pCACNA1 C (exons 7 to 10, including exon 8A) and a tag sequence (3xHA) (Figure 2). The second plasmid contained a CMV promoter followed by a reporter gene (Green Fluorescent Protein, GFP) linked in-frame to the porcine cDNA sequence corresponding to p.Gly406Arg pCACNAI C (exons 7 to 10, including exon 8A) and a tag sequence (3xFLAG) (Figure 2).
[0087] To induce allele-specific RNAi, siRNAs carrying nucleotide variations characterizing the target disease allele were designed to distinguish it from the corresponding wild-type allele.
[0088] The nucleotide sequences of a portion of the wild-type and mutant porcine CACNA1 C mRNAs and designed siRNAs are shown in Table 1.
[0089] The sequences are based on the sequence of the 5' --> 3'-sense strand (passenger) siRNA element, with the mutant recognition site (MRS) underlined in Table 1.
[0090] Portion of the wild type CACNA1C mRNA:
[0091] 5’- GGUUCUCGGUGUCCUUAGCGGAGAGUUUUCCAAAGAGA-3’ (SEQ ID NO:17) Portion of the mutant (p.Gly406Arg) CACNA1 C mRNA:
[0092] 5’- GGUUCUCGGUGUCCUUAGCAGAGAGUUUUCCAAA GAGA-3’ (SEQ ID NO:1 ).
[0093] Table 1
[0094] Table 1 : Sequences of portion of the wild type and mutant CACNA1 C cDNA and of the sense strand of tested siRNA duplexes.
[0095] Assessment of wild-type and mutant allele expression by Real-Time PCR and Western Blot in transiently transfected HEK293 cells. The expression of both the wild-type and mutant alleles was assessed through Real-Time PCR analysis in transiently transfected HEK293 cells. The CACNA1 C partial cDNA and FLAG or HA-specific primers were selectively amplified to quantify the mRNA expression of the mutated or wild-type alleles, respectively. The expression data were analyzed using the 2-AActmethod normalized on GAPDH expression, and relative to the cells transfected with only the reporter alleles and no siRNA (Figure 3).
[0096] Most siRNA duplexes effectively suppressed CACNA1 C mRNA expression, with some demonstrating selectivity for the mutant allele. From this step, four siRNAs were selected (A6, A9, as promising candidate for efficient allele specific silencing, A14 and A15, as examples of bad performing sequences for poor specificity and poor silencing power, respectively) for deeper analysis by Western Blot, using specific antibodies against the HA and FLAG epitopes to assess the relative protein expression of the mutated and wild-type alleles (Figure 4).
[0097] Cloning and validation of the candidate siRNA into an artificial miRNA- Expressing AAV backbone plasmid.
[0098] The siCACNA1 C-A6 was selected from the previous step to be cloned into an artificial miRNA expression vector, allowing continuous and long-term expression of the silencing molecule.
[0099] This siRNA was promising since it weakly suppressed the wild-type allele but strongly silenced the mutant allele.
[0100] The BLOCK-iT™ Pol II miR RNAi Expression Vector (Life Technologies) was used as an intermediate vector, which has a triple advantage over the conventional Pol IH-shRNA expression plasmids:
[0101] 1. Pol Il-transcribed artificial miRNAs are expressed at tolerable levels while maintaining potent gene silencing capacities compared to shRNA, which can induce toxicity due to unregulated and massive expression from Pol III promoters;
[0102] 2. Co-cistronic expression of Emerald GFP (EmGFP) results in the correlation of EmGFP expression with a knockdown from the mi-RNAi;
[0103] 3. Strong expression from the CMV immediate early promoter, with the option to use tissue-specific or other regulated promoters.
[0104] Subsequently, a fragment consisting of the CMV promoter, EmGFP, pre- miRNA sequence, and TKpolyA, was amplified from the BLOCK-iT™ Pol II miR RNAi Expression Vector (Life Technologies) and sub-cloned into the adeno- associated viral backbone vector pAAV2.1 (Figure 5A).
[0105] The resulting plasmid was validated via Real-Time analysis in the HEK293 cellular system, with heterozygous conditions created through the transfection of the two reporter alleles. It was demonstrated that miCACNAI C-A6 retained the capacity of siCACNA1 C-A6 in substantially suppressing mutant allele expression over wildtype. Expression data were compared to results obtained in cells transfected with only reporter alleles (Figure 5B).
[0106] Treatment of TS1 pigs (CACNA1C p.Gly406Arg+ / WT) with AAV mediated allele specific silencing
[0107] Heterozygous CACNA1 C p.Gly406Arg+ / WT piglets (P45 after birth) were injected with 5e1013vg / Kg of a serotype 8 adeno-associated viral (AAV8) vector containing a miCACNA1 C-A6-expressing cassette in the jugular vein. The piglets were monitored for body weight, echocardiogram, and behavioral changes during their subsequent development, and no clinical differences were observed compared to non-infected littermates.
[0108] Treated TS1 piglets demonstrated a remarkable shortening of the QT interval on the surface ECG (Figure 6), as compared to untreated TS1 animals.
[0109] Left ventricular myocytes from adult TS1 pigs, infected (GFP+) and noninfected (GFP-) with AAV8- miCACNA1 C-A6 gene therapy, were used for electrophysiological studies. ICa recording was performed and faster rates of ICa inactivation in TS ventricular myocytes in the GFP-infected cells (GFP+) were demonstrated compared to the non-infected (GFP-) TS ventricular myocytes, despite equivalent ICa peak density between infected and non-infected cells (Figure 7).
[0110] EXAMPLE 2: Therapeutic efficacy of AA V8-miCA CNA 1 C-A 6 infection of TS 1 CACNA1C p.G406R+ / wrhuman induced pluripotent stem cell-derived cardiomyocytes (IPSC-CMs).
[0111] MATERIALS AND METHODS
[0112] Generation and maintenance of Human Induced Pluripotent Stem Cell- Derived Cardiomyocytes (hiPSC-CMs)
[0113] The human induced pluripotent stem cell (hiPSC) line employed in the present disclosure was generated from a subject diagnosed with Timothy Syndrome type 1 (TS1 ) and carrying a heterozygous CACNA1 C p.G406R mutation in exon 8A. Dermal fibroblasts were obtained by skin biopsy following informed consent at ICS Maugeri. Reprogramming was performed using the CytoTune™-iPS Sendai Reprogramming Kit (Invitrogen), according to the manufacturer’s instructions. The resulting iPSC clones were cryopreserved in liquid nitrogen. Upon thawing, the clones were directly plated to initiate differentiation. Differentiation into cardiomyocytes spans eight (8) days, designated as day 0 through day 8. Spontaneous contractile activity typically appears at approximately day 7. Following differentiation, the cells underwent a three-day metabolic selection procedure from day 10 to day 13 in order to eliminate non-differentiated cells and obtain an enriched cardiomyocyte population. After the selection phase, the cardiomyocytes were maintained as a monolayer culture and allowed to mature until day 35. At day 35, the cells were subjected to viral transduction using AAV8-miCACNA1 C-A6, as described in the corresponding sections of this disclosure.
[0114] AAV8-miCACNA1C-A6 Infection of hiPSC-CMs
[0115] At day 35 TS1 iPSC-CMs cultured in 12-well plates were infected with AAV8- miCACNA1 C-A6 at a multiplicity of infection (MOI) of 4 x 105. No significant cell death was observed. Media changes were performed every two days as per standard maintenance. Fifteen days post-infection, GFP expression — indicating successful internalization and expression of the AAV8-delivered construct — was assessed using an inverted fluorescence microscope. Cells were subsequently dissociated and processed either for RNA expression analysis or for electrophysiological recordings.
[0116] Quantitative Real-Time PCR
[0117] For RNA expression analysis, cells were dissociated after media removal and washing with Hanks' Balanced Salt Solution (HBSS). Cell pellets were stored at -80 °C until RNA extraction using the RNeasy Micro Kit (Qiagen). RNA concentration and purity were assessed prior to reverse transcription into cDNA using the iScript™ cDNA Synthesis Kit (Biorad). Quantitative real-time PCR (qPCR) was performed on a QuantStudio system (Life Technologies) using TaqMan SNP assays (Thermo Scientific) to quantify CACNA1 C exon 8A transcript levels, distinguishing between WT exon 8A and the G406R mutant mRNA.
[0118] Electrophysiological analysis of treated hiPSC-CMs
[0119] At day 50 ventricular-like cardiomyocytes derived from hiPSCs, both infected and non-infected with the AAV8-miCACNA1 C-A6 construct, were dissociated using a gentle trypsinization protocol. The isolated cells were plated onto IBIDI glassbottom dishes for electrophysiological studies and allowed to recover for three days before analysis. GFP fluorescence was assessed using a Zeiss LSM 880 confocal microscope in order to distinguish between infected and non-infected TS1 hiPSC- CMs. The action potential of individual cells was analyzed before and after inducing an external electrical stimulation.
[0120] RESULTS
[0121] Silencing efficacy of AAV8-miCACNA1C-A6 infection of TS1 CACNA1C p.G406R+ / WThuman induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs)
[0122] TS1 hiPSC-CMs were successfully transfected with AAV8-miCACNA1 C-A6, encoding miCACNA1 C-A6 and GFP, as demonstrated by green fluorescent signal (Figure 8A). AAV8-miCACNA1 C-A6 induced a significant reduction in the fraction of transcripts containing the target G406R mutant Exon8A in infected cells (TS-GT) compared to untreated TS1 cells (TS), as assessed via qPCR (Figure 8B). Treatment with AAV8-miCACNA1 C-A6 normalized the action potential profile of TS1 cells to WT levels, as assessed by whole-cell patch-clamp (Figure 8C). Transfection of AAV8-miCACNA1 C-A6 significantly ameliorated the electrophysiological profile of TS1 IPS-CMs, as demonstrated by reduction to WT levels of peak-to-peak AP interval, time to 90% repolarization from the peak and the ratio between time to 40- 30% repolarization (indicating duration of early repolarization) and time to 80-70% repolarization (indicating duration of late repolarization) (Figure 8D).
[0123] The following abbreviations have been used in the present specification: AP, Action Potential;
[0124] TS1 , Timothy Syndrome type 1 ;
[0125] EAD, Early afterdepolarization;
[0126] ECG, electrocardiogram;
[0127] CMV, Cytomegalovirus;
[0128] GFP, green fluorescent protein;
[0129] RFP, red fluorescent protein;
[0130] AAV, Adeno Associated Virus;
[0131] EP, electrophysiology;
[0132] CACNA1 C, calcium voltage-gated channel subunit alphal C; siNA, small interfering nucleic acid siRNA, small interfering RNA; miRNA, microRNA;
[0133] HA, Human influenza hemagglutinin;
[0134] MRS, Mutant Recognition Site;
[0135] RNAi, RNA interference;
[0136] TK polyA, HSY thymidine kinase (TK) polyadenylation signal sequence; iCa, Ca2+current; hiPSC-CM, Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes; MOI, Multiplicity of infection.
[0137] References
[0138] 1. Cheng EP, Yuan C, Navedo MF, Dixon RE, Nieves-Cintron M, Scott JD, Santana LF. Restoration of normal L-type Ca2+ channel function during Timothy syndrome by ablation of an anchoring protein. Circ Res. 2011 Jul 22; 109(3): 255-61.
[0139] 2. Splawski I, Timothy KW, Sharpe LM, Decher N, Kumar P, Bloise R, Napolitano C, Schwartz PJ, Joseph RM, Condouris K, Tager-Flusberg H, Priori SG, Sanguinetti MC, Keating MT. Ca(V)1.2 calcium channel dysfunction causes a multisystem disorder including arrhythmia and autism. Cell. 2004 Oct 1 ;119(1 ):19-31.
[0140] 3. Thiel WH, Chen B, Hund TJ, Koval OM, Purohit A, Song LS, Mohler PJ, Anderson ME. Proarrhythmic defects in Timothy syndrome require calmodulin kinase II. Circulation. 2008 Nov 25; 118(22):2225-34.
[0141] 4. Yazawa M, Hsueh B, Jia X, Pasca AM, Bernstein JA, Hallmayer J, Dolmetsch RE. Using induced pluripotent stem cells to investigate cardiac phenotypes in Timothy syndrome. Nature. 2011 Mar 10;471 (7337):230-4.
[0142] 5. Porta-Sanchez A, Mazzanti A, Tarifa C, Kukavica D, Trancuccio A, Mohsin M, Zanfrini E, Perota A, Duchi R, Hernandez-Lopez K, Jauregui-Abularach ME, Pergola V, Fernandez E, Bongianino R, Tavazzani E, Gambelli P, Memmi M, Scacchi S, Pavarino L, Franzone PC, Lentini G, Filgueiras- Rama D, Galli C, Santiago DJ, Priori SG. Unexpected impairment of INa current underpins reentrant arrhythmias in a knock-in swine model of Timothy syndrome. Nat Cardiovasc Res 2023;2: 1291-1309.
[0143] 6. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21 -nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 2001 May 24;411 (6836):494-8
[0144] 7. Bongianino R, Denegri M, Mazzanti A, Lodola F, Vollero A, Boncompagni S, Fasciano S, Rizzo G, Mangione D, Barbara S, Di Fonso A, Napolitano C, Auricchio A, Protasi F, Priori SG. Allele-Specific Silencing of Mutant mRNA Rescues Ultrastructural and Arrhythmic Phenotype in Mice Carriers of the R4496C Mutation in the Ryanodine Receptor Gene (RYR2). Circ Res. 2017 Aug 18; 121 (5):525-536.
[0145] 8. Bazett, H. An analysis of the time-relations of the electrocardiograms. Heart 7, 353-370 (1920) autaharju, P. M. et al. AHA / ACCF / HRS recommendations for the standardization and interpretation of the electrocardiogram: part IV: the ST segment, T and U waves, and the QT interval. J. Am. Coll. Cardiol. 53, 982-991 (2009)
Claims
CLAIMS1 ) Short interfering nucleic acid (siNA) molecule that inhibits the expression of a mutant allele of the human CACNA1 C gene, said mutant allele comprising the mutation p.Gly406Arg in the CACNA1 C gene, wherein said short interfering nucleic acid (siNA) molecule comprises or consists of a binding sequence that is complementary to at least a part of an RNA, such as an mRNA, associated with the expression of said mutant allele.2) siNA molecule according to claim 1 , wherein said siNA molecule is singlestranded or double-stranded, preferably double-stranded.3) siNA molecule according to any one of the preceding claims, wherein said siNA molecule is a double-stranded RNA (dsRNA), such as a dsRNA chosen from the group consisting of short interfering RNA (siRNA), micro-RNA (miRNA), short hairpin RNA (shRNA)and circular RNA molecule, or a single-stranded antisense oligonucleotide (ASO).4) siNA molecule according to any one of the preceding claims, wherein said binding sequence has a length from 17 to 25 nucleotides, preferably at least 21 nucleotides, more preferably 21 nucleotides.5) siNA molecule according to any one of the preceding claims, wherein said binding sequence is complementary to at least part of the sequence 5’- GGUUCUCGGUGUCCUUAGCAGAGAGUUUUCCAAAGAGA-3’ (SEQ ID NO:1 ).6) siNA molecule according to any one of the preceding claims, wherein said binding sequence comprises or consists of a nucleotide sequence selected from the group consisting of 5’— CUUUGGAAAACUCUCUGCUAA- 3’ (SEQ ID NO:29) and 5’-UGGAAAACUCUCUGCUAAGGA-3’ (SEQ ID NQ:30).7) siNA molecule according to any one of the preceding claims, wherein one or more nucleotides of said siNA molecule comprise modifications.8) siNA molecule according to claim 7, wherein said modifications are chosen from the group consisting of 2’0-methyl modification, 2’fluoro modification.9) siNA molecule according to any one of the preceding claims, wherein said siNA molecule comprises one or more phosphorothioate linkage.10) Expression vector comprising a siNA molecule as defined in any one of claims 1 -9.11 ) Expression vector according to claim 10, wherein the expression vector is chosen from the group consisting of a plasmid, such as a recombinant plasmid,or a viral vector.12) Expression vector according to claim 11 , wherein the viral vector is chosen from the group consisting of a serotype 9 adeno-associated viral (AAV2 / 9) vector, a serotype 6 adeno-associated viral (AAV2 / 6) vector or a serotype 8 adeno- associated viral (AAV2 / 8) vector.13) Expression vector according to any one of claims 10-12, said expression vector comprising a promoter operably linked to the sequence encoding said double-stranded siNA molecule.14) Expression vector according to claim 13, wherein said promoter is chosen from the group consisting of CMV promoter, alpha-MHC promoter, cTnT promoter, Desmin promoter.15) Pharmaceutical composition comprising a siNA molecule as defined in any one of claims 1 -9 or an expression vector as defined in any one of claims I Q- 14, together with one or more excipients and / or adjuvants.16) Pharmaceutical composition according to claim 15, said pharmaceutical composition further comprising a pharmaceutical carrier or diluent, such as a cationic lipid or liposome or nanoparticles.17) Combination comprisingA) a siNA molecule as defined in any one of claims 1 -9, an expression vector as defined in any one of claims 10-14 or a pharmaceutical composition as defined in any one of claims 15-16 andB) a non-selective beta blocker, such as nadolol or propranolol.18) siNA molecule as defined in any one of claims 1 -9, expression vector as defined in any one od claims 10-14, pharmaceutical composition as defined in any one of claims 15-16 or combination as defined in claim 17 for medical use.19) siNA molecule as defined in any one of claims 1 -9, expression vector as defined in any one of claims 10-14 or pharmaceutical composition as defined in any one of claims 15-16 for use in the treatment of Timothy syndrome type 1 .20) Combination as defined in claim 17 for separate or sequential use in the treatment of Timothy syndrome type 1 .