Recombinant oncolytic virus expressing bispecific or trispecific single-chain antibody, and use thereof
By integrating the encoding genes of bispecific or trispecific single-chain antibodies into oncolytic viruses, targeting tumor cells and immune cells, the problems of poor pathogenicity and cure rate of oncolytic viruses have been solved, achieving more efficient tumor treatment.
Patent Information
- Application Number
- PCT/CN2025/103707
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-17
- Filing Date
- 2025-06-26
- Publication Date
- 2026-06-25
AI Technical Summary
Existing oncolytic viruses have problems with pathogenicity and poor cure rate in tumor immunotherapy. Modified oncolytic viruses may not be able to be packaged, which will affect their clinical application.
Integrating the encoding genes of bispecific or trispecific single-chain antibodies into oncolytic viruses allows for their expression in vivo, targeting tumor cells and immune cells and enhancing therapeutic efficacy.
It enhances the killing ability of tumor cells, reduces off-target toxicity, strengthens immune stimulation signals, and improves treatment efficacy.
Smart Images

Figure CN2025103707_25062026_PF_FP_ABST
Abstract
Description
Recombinant oncolytic viruses expressing bispecific or trispecific single-chain antibodies and their applications Technical Field
[0001] This application relates to the field of biomedicine, and more specifically, to recombinant oncolytic viruses expressing bispecific or trispecific single-chain antibodies and their applications. Background Technology
[0002] Oncolytic viruses are a class of tumor-killing viruses with replication capabilities, and are now widely accepted as an important branch of tumor immunotherapy. Oncolytic viruses can specifically target and infect tumor cells, for example, by utilizing the inactivation or defect of oncolytic virus genes in tumor cells, thereby selectively infecting tumor cells. After infecting tumor cells, oncolytic viruses replicate extensively within the tumor cells and ultimately destroy them, thus killing the tumor cells. Simultaneously, oncolytic viruses can also provide the immune stimulation signals necessary for the host's own anti-cancer response, thereby attracting more immune cells to continue killing residual tumor cells.
[0003] Although oncolytic viruses have promising applications in tumor immunotherapy, wild-type oncolytic viruses often cause damage and dysfunction to tissues and organs. There is also a significant risk of pathogenicity when using wild-type viruses to infect tumor cells.
[0004] Therefore, to further advance the clinical application of oncolytic viruses, it is necessary to modify wild-type oncolytic viruses to obtain attenuated oncolytic viruses. Using attenuated oncolytic viruses in clinical applications would reduce the pathogenic risk and improve the safety of oncolytic viruses. However, in the process of modifying oncolytic viruses, if only wild-type oncolytic viruses are randomly genetically modified, although their toxicity can be reduced, the modified oncolytic viruses may have poor cure rates, and may even be unable to be packaged, which is detrimental to advancing the clinical application of oncolytic viruses.
[0005] Therefore, it is necessary to conduct in-depth research on oncolytic viruses in order to further promote their clinical application. Summary of the Invention
[0006] To further improve the therapeutic effect on tumor cells, this application provides recombinant oncolytic viruses expressing bispecific or trispecific single-chain antibodies and their applications.
[0007] Oncolytic viruses are a class of tumor-killing viruses with replication capabilities, and are now widely accepted as an important branch of tumor immunotherapy. Oncolytic viruses can specifically target and infect tumor cells, for example, by utilizing the inactivation or defect of oncolytic virus genes in tumor cells, thereby selectively infecting tumor cells. After infecting tumor cells, oncolytic viruses replicate extensively within the tumor cells and ultimately destroy them, thus killing the tumor cells. Simultaneously, oncolytic viruses can also provide the immune stimulation signals necessary to enhance the host's own anti-cancer response, thereby attracting more immune cells to continue killing residual tumor cells. Therefore, oncolytic viruses have the ability to disrupt the tumor tissue microenvironment and transform "cold tumors" into "hot tumors."
[0008] Bispecific antibodies (BsAbs) can bind specifically to two antigens or two different epitopes of the same antigen simultaneously. Therefore, they can link effector cells such as immune cells to tumor cells, thereby enhancing the killing effect on target cells. They can also bind to different antigenic epitopes on the same tumor cell to enhance their binding specificity and reduce adverse reactions caused by off-target toxicity. Alternatively, they can bind to different immune checkpoints on the same immune cell to simultaneously block / activate downstream immune signaling pathways, thereby activating or inhibiting immune cells.
[0009] Trispecific antibodies (TsAbs) can target three different target antigens or biomarkers and can also recruit immune cells for tumor redirection, thereby enhancing anti-tumor immunity. Compared with bispecific antibodies, trispecific antibodies can also bind to another target on the surface of tumor cells or immune cells, or bridge immune cells and block dual signaling pathways. This makes it more effective in redirecting drugs or immune cells to the tumor site, enhancing binding specificity, improving targeting, reducing off-target toxicity, and thus improving anti-tumor efficacy.
[0010] In addition, BiTEs (bispecific T cell engagers) are bispecific single-chain antibodies that use T cells as effector cells. They possess two antigen-binding arms, allowing them to bind simultaneously to both T cells and target cells, activating T cells to kill diseased cells. Compared to other bispecific single-chain antibodies, BiTEs exhibit greater molecular flexibility, better facilitating the binding of the CD3 complex to tumor targets. Furthermore, they are not constrained by T cell receptors or MHC class I molecules on target cells and do not require the participation of co-stimulatory molecules, making them a highly promising antibody form.
[0011] BiKEs (bi-specific killer cell engagers) are bispecific single-chain antibodies created by fusing anti-CD16 single-chain antibodies with anti-tumor-associated antigens, using NK cells as effector cells. These molecules directly activate and amplify NK cells via CD16, producing cytokines. Activated NK cells can eliminate tumor cells through three direct or indirect strategies: (a) releasing granules, such as secretory lysosomes containing perforin and granzymes, to induce cell membrane lysis or apoptosis; (b) activating target cell caspases through the interaction of tumor necrosis factor-associated apoptosis-inducing ligands and Fas ligands on tumor cells; and (c) secreting various factors to regulate the function of other immune cells, indirectly killing tumor cells.
[0012] BiME (bi-specific macrophages engagers) can simultaneously activate M1 and M2 macrophages. On one hand, it targets macrophages through optimized screening of SIRPα antibodies; on the other hand, it targets tumor-associated antigens, employing a two-pronged approach. The bispecific antibody molecules block "anti-phagocytosis" signals while simultaneously activating "phagocytosis" signals by binding to Fc receptors, thereby transforming and activating the powerful phagocytic activity of tumor-associated myeloid cells.
[0013] This application integrates the encoding gene of bispecific or trispecific single-chain antibody into a modified oncolytic virus, enabling the gene to be expressed in vivo, thereby further improving the therapeutic effect on tumor cells.
[0014] The recombinant oncolytic virus expressing bispecific or trispecific single-chain antibodies and its application provided in this application adopt the following technical solution:
[0015] A recombinant oncolytic virus expressing bispecific or trispecific single-chain antibodies, wherein the recombinant oncolytic virus includes an antibody gene integrated into its viral backbone; the antibody gene includes a target antibody gene targeting tumor cells and at least one antibody gene targeting immune cells.
[0016] Furthermore, the immune cells are selected from any one or two of T cells, NK cells, and macrophages.
[0017] Furthermore, when the immune cell is a T cell, the antibody gene targeting the immune cell is selected from any one or two of the following (a)-(b):
[0018] (a) CD3 antibody gene;
[0019] (b) T cell-associated immune checkpoint antibody genes.
[0020] Furthermore, the T cell-related immune checkpoint antibody genes include inhibitor antibody genes and agonist antibody genes.
[0021] Furthermore, the inhibitor antibody gene is selected from any one or two of CTLA-4, PD-1, TIM3, BTLA, VISTA, and LAG3.
[0022] Furthermore, the agonist antibody gene is selected from any one or two of CD28, OX40, CD27, CD30, CD40, GITR, ICOS, 4-1BB, LIGHT, and CD28H.
[0023] Furthermore, when the immune cell is an NK cell, the antibody gene targeting the immune cell is selected from any one or two of CD16a, NKG2D, CD94 / NKG2C, NKp30, NKp44, and NKp46.
[0024] Furthermore, when the immune cell is a macrophage, the antibody gene targeting the immune cell is the SIRPα antibody gene.
[0025] Furthermore, the recombinant oncolytic virus includes any one or more of the following: rod-shaped virus, poxvirus, herpes simplex virus, measles virus, Semlikie Forest virus, poliovirus, reovirus, Seneca Valley virus, echovirus, Coxsackie virus, Newcastle disease virus, and Malaba virus.
[0026] Furthermore, the recombinant oncolytic virus is obtained by site-directed mutation of vesicular stomatitis virus (VSV).
[0027] In some specific implementations, the recombinant oncolytic virus is obtained by site-directed mutation based on VSV (Indiana MuddSummer subtype).
[0028] Furthermore, the vesicular stomatitis virus includes M protein, G protein, N protein, P protein, and L protein.
[0029] In this application, the wild-type VSV virus Indiana MuddSummer subtype M protein contains the amino acid sequence shown in SEQ ID NO 1.
[0030] Compared with the amino acid sequence shown in SEQ ID NO 1, 1) the amino acid substitutions of the M protein include G21E and N32S;
[0031] 2) The amino acid substitutions of the M protein include G21E, N32S, and M33A;
[0032] 3) The amino acid substitutions of the M protein include G21E, N32S, M33A, and N49D;
[0033] 4) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, and H54Y;
[0034] 5) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, H54Y, and L111A;
[0035] 6) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, H54Y, L111A, and A133T;
[0036] 7) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, H54Y, L111A, A133T, and V225I;
[0037] 8) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, and V225I;
[0038] 9) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, and V225I;
[0039] 10) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R;
[0040] 11) The amino acid substitutions of the M protein include N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R;
[0041] 12) The amino acid substitutions of the M protein include M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R;
[0042] 13) The amino acid substitutions of the M protein include N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R;
[0043] 14) The amino acid substitutions of the M protein include M51R, H54Y, L111A, A133T, V221F, V225I, and S226R;
[0044] 15) The amino acid substitutions of the M protein include H54Y, L111A, A133T, V221F, V225I, and S226R;
[0045] 16) The amino acid substitutions of the M protein include L111A, A133T, V221F, V225I, and S226R;
[0046] 17) The amino acid substitutions of the M protein include A133T, V221F, V225I, and S226R;
[0047] 18) The amino acid substitutions of the M protein include V221F, V225I, and S226R;
[0048] 19) The amino acid substitutions of the M protein include V225I and S226R;
[0049] 20) The amino acid substitutions of the M protein include S226R;
[0050] 21) The amino acid substitutions of the M protein include N32S, N49D, H54Y, and V225I;
[0051] 22) The amino acid substitutions of the M protein include N32S, N49D, H54Y, V225I, and S226G;
[0052] 23) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, V221F, V225I, and S226R;
[0053] 24) The amino acid substitutions of the M protein include N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R;
[0054] 25) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R;
[0055] 26) The amino acid substitutions of the M protein include N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R;
[0056] 27) The amino acid substitutions of the M protein include G21E, N32S, N49D, M51A, H54Y, L111A, V225I, and S226R;
[0057] 28) The amino acid substitutions of the M protein include M51R, V221F, and S226R;
[0058] 29) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, knocking out the base encoded by leucine at position 111, V221F, V225I, and S226R.
[0059] 30) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, L111A, V221F, V225I, and S226R;
[0060] 31) The amino acid substitutions of the M protein include G21E, N32S, N49D, M51R, H54Y, V221F, V225I, and S226R;
[0061] 32) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R;
[0062] 33) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R;
[0063] In one specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 2.
[0064] In one specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 3.
[0065] In this application, the wild-type VSV virus Indiana MuddSummer subtype G protein contains the amino acid sequence shown in SEQ ID NO 4.
[0066] Compared with the amino acid sequence shown in SEQ ID NO 4, the site mutations of the G protein include any one or more of H38Y, V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.
[0067] In one specific embodiment, the G protein has the amino acid sequence shown in SEQ ID NO 5.
[0068] In one specific embodiment, the G protein has the amino acid sequence shown in SEQ ID NO 6.
[0069] In this application, the N protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in SEQ ID NO 7.
[0070] Compared to the amino acid sequence shown in SEQ ID NO 7, the site mutations of the N protein include any one or more of I14V, R155K, and S353N.
[0071] In one specific embodiment, the N protein comprises the amino acid sequence shown in SEQ ID NO 8.
[0072] In this application, the wild-type VSV virus Indiana MuddSummer subtype P protein contains the amino acid sequence shown in SEQ ID NO 9.
[0073] Compared with the amino acid sequence shown in SEQ ID NO 9, the site mutations of the P protein include any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.
[0074] In one specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 10.
[0075] In this application, the wild-type VSV virus Indiana MuddSummer subtype L protein contains the amino acid sequence shown in SEQ ID NO 11.
[0076] Compared with the amino acid sequence shown in SEQ ID NO 11, the site mutations of the L protein include any one or more of S87P, I397T, I487T, and F873L.
[0077] In one specific embodiment, the L protein comprises the amino acid sequence shown in SEQ ID NO 12.
[0078] In one specific embodiment, the L protein comprises the amino acid sequence shown in SEQ ID NO 13.
[0079] In one specific embodiment, the L protein comprises the amino acid sequence shown in SEQ ID NO 14.
[0080] Further, the M protein comprises an amino acid sequence as shown in any one of SEQ ID NO 2-3; the G protein comprises an amino acid sequence as shown in any one of SEQ ID NO 5-6; the N protein comprises an amino acid sequence as shown in SEQ ID NO 8; the P protein comprises an amino acid sequence as shown in SEQ ID NO 10; and the L protein comprises an amino acid sequence as shown in any one of SEQ ID NO 12-14.
[0081] Furthermore, the injection methods for the recombinant oncolytic virus include, but are not limited to, any one or more of the following: intratumoral injection, intravenous injection, intraperitoneal injection, intrapleural injection, pelvic injection, subcutaneous injection, intrathecal injection, intramuscular injection, and intranasal administration.
[0082] Furthermore, the antibody expressed by the target antibody gene is the complete sequence or a partial sequence of the antibody.
[0083] Furthermore, the target antibody genes include genes for anti-hematologic tumor antigen antibodies and genes for anti-solid tumor antigen antibodies.
[0084] Furthermore, the solid tumor antigens include, but are not limited to, 5T4, ROR1, EGFR, FcγRI, FcγRIIa, FcγRIIb, CD24, CD28, CD137, CTLA-4, HER2, HER3, FAS, LGR5, C5aR1, A2AR, FGFR1, FGFR2, FGFR3, FGFR4, GITR, LTβR, TRAIL receptor 1, TRAIL receptor 2, PSMA, PSCA, CAIX, EGFR1, EGFRvIII, folate receptor, liver glycoprotein receptor, PDGFRa, ErbB2, ErbB3, CD2, CD40, CD74, CCAM5, CCAM6, p53, cMET, HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAG E-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, Cyp- B, hTERT, hTRT, iCE, MMC2, β-cadherin, GDF8, Cripto, MMC5AC, PRAME, P15, RM1, RM2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MMM-1, MMM-2, MMM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FΜT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, DR5, PD-1, PD-L1, IGF-1R, CXCR4, NRP-1, GPC2, GPC3, EphA2, B7-H3, B7-H4, gpA33, SSTR 2. GD2, VEGF-A, VEGFR-2, PDGFR-a, RANKL, MSLNTROP2, FOLR1, AXL, CLDN18.2, MMC1, TPBG, CEA, EpCAM, Nectin-4, CD39, CD73, CD44, DLL3, CLDN18.1. KAT6A / B, PI3K, c-Kit, TRBCI; CLDN6, TYRP1, Ras, MOSPD2, HLA-A, HLA-G, HLA class II, CDH3, CDH17, CDH19, ENPP3, LILRB4, STEAP1, TrkB, oxMIF, P95HER2, CD133, LRRC15, TMEFF2, Sμrvivin, KLK2, Siglec-6, Heme Oxygenase, DLK1, CACNA1G-AS1, TSPAN8, GC-C, ETA, LY6G6D, P53 R175H, NCR3LG1, ADAM17, DLL1, GCP2, CEACAM5, Mesothelin;
[0085] Furthermore, the hematologic tumor antigens include, but are not limited to, BCMA, CD5, CD7, CD10, FcγRIIIa, FcγRIIIb, CD19, CD20, CD22, CD30, CD33, CD34, CD37, CD38, CD47, CD56, CD70, CD123, CD138, CLL-1, ROR1, NKG2DL1 / 2, FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, SLAMF7, TCR B-chain, ITGB7, TACI, CD79b, and EBV.
[0086] Furthermore, the immune checkpoint antibody genes include, but are not limited to, SHP2, SLAMF3, PD-1, PD-L1, PD-L2, CTLA4, CD80, CD86, TIM-3, GAL9, HVEM, BTLA, CD160, KIR, TIGIT, NKG2A, B7-H3, VISTA, LAG3, 2B4, NECL, CD28, OX40, 4-1BB, CD27, ICOS, GITR, CD30, CD40, CD28H, CD4, LMTK3, IDO1, DNAM-1, CD226, PTA1, TLISA1, CD96, Vstm3, CD200R, KIRs, and CD94.
[0087] Furthermore, when the antibody gene includes a target antibody gene that targets tumor cells and an antibody gene that targets immune cells, the antibody gene is a bispecific antibody;
[0088] The arrangement of the target antibody gene targeting tumor cells and the antibody gene targeting immune cells is as follows:
[0089] N-target antibody gene-C+Linker+N-target immune cell antibody gene-C;
[0090] Alternatively, N-targeting immune cell antibody gene-C+Linker+N-targeting antibody gene-C.
[0091] In one specific embodiment, the antibody gene is aPD-L1-aCD3, the gene sequence of which includes the nucleotide sequence shown in SEQ ID NO 15, and the amino acid sequence of which includes the amino acid sequence shown in SEQ ID NO 16.
[0092] In one specific embodiment, the antibody gene is aPD-L1-aCD16, the gene sequence of which includes the nucleotide sequence shown in SEQ ID NO 17, and the amino acid sequence of which includes the amino acid sequence shown in SEQ ID NO 18.
[0093] Furthermore, when the antibody gene includes a target antibody gene targeting tumor cells and two antibody genes targeting immune cells, the antibody gene is a trispecific antibody;
[0094] The arrangement of the target antibody gene targeting tumor cells and the antibody gene targeting immune cells is selected from any of the following:
[0095] (1) N-target antibody gene-C+Linker+N-antibody gene-C+Linker+N-antibody gene-C targeting T cells;
[0096] (2) N-target antibody gene-C+Linker+N-target NK cell antibody gene-C+Linker+N-target T cell antibody gene-C;
[0097] (3) N-targeting T cell antibody gene-C+Linker+N-targeting NK cell antibody gene-C+Linker+N-target antibody gene-C;
[0098] (4) N-targeting T cell antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting NK cell antibody gene-C;
[0099] (5) N-targeting NK cell antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting T cell antibody gene-C;
[0100] (6) N-targeting NK cell antibody gene-C+Linker+N-targeting T cell antibody gene-C+Linker+N-targeting antibody gene-C;
[0101] (7) N-target antibody gene-C+Linker+N-antibody gene-C+Linker+N-antibody gene-C targeting T cells;
[0102] (8) N-target antibody gene-C+Linker+N-antibody gene-C+Linker+N-antibody gene-C targeting macrophages;
[0103] (9) N-targeting T cell antibody gene-C+Linker+N-targeting macrophage antibody gene-C+Linker+N-target antibody gene-C;
[0104] (10) N-targeting T cell antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting macrophage antibody gene-C;
[0105] (11) N-targeting macrophage antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting T cell antibody gene-C;
[0106] (12) N-targeting macrophage antibody gene-C+Linker+N-targeting T cell antibody gene-C+Linker+N-targeting antibody gene-C;
[0107] (13) N-target antibody gene-C+Linker+N-antibody gene-C+Linker+N-antibody gene-C targeting macrophages;
[0108] (14) N-target antibody gene-C+Linker+N-target NK cell antibody gene-C+Linker+N-target macrophage antibody gene-C;
[0109] (15) N-targeting macrophage antibody gene-C+Linker+N-targeting NK cell antibody gene-C+Linker+N-target antibody gene-C;
[0110] (16) N-targeting macrophage antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting NK cell antibody gene-C;
[0111] (17) N-targeting NK cell antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting macrophage antibody gene-C;
[0112] (18) N-targeting NK cell antibody gene-C+Linker+N-targeting macrophage antibody gene-C+Linker+N-targeting antibody gene-C.
[0113] In one specific embodiment, the antibody gene is aPD-L1-aCD3-aCD16, the gene sequence of which includes the nucleotide sequence shown in SEQ ID NO 19, and the amino acid sequence of which includes the amino acid sequence shown in SEQ ID NO 20.
[0114] In some specific embodiments, the recombinant oncolytic virus is used to continuously kill abnormally proliferating cells.
[0115] In some specific embodiments, the abnormally proliferating cells are selected from tumor cells or related cells of tumor tissue.
[0116] In some specific implementations, the tumor includes a solid tumor or a hematoma.
[0117] In some specific embodiments, the tumors include, but are not limited to, acute lymphoblastic leukemia, acute B-lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-Hodgkin's lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), sensory neuroblastoma, Ewing sarcoma, fallopian tube cancer, gallbladder cancer, and gastric cancer. Gastrointestinal carcinoid tumors, hepatocellular carcinoma, hypopharyngeal carcinoma, Kaposi's sarcoma, renal cancer, Langerhans cell carcinoma, laryngeal cancer, liver cancer, lung cancer, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary adenoma, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small bowel cancer, squamous neck cancer, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and vascular tumors.
[0118] This application also provides a composition comprising the above-described oncolytic virus vaccine and a macromolecular antibody anticancer drug.
[0119] In summary, this application has the following beneficial effects:
[0120] BiKEs are created by fusing anti-CD16 single-chain antibodies with anti-tumor-associated antigen single-chain antibodies. These molecules directly activate and amplify NK cells via CD16, producing cytokines. Activated NK cells can eliminate tumor cells through three direct or indirect strategies: (a) releasing granules, such as secretory lysosomes containing perforin and granzymes, to induce cell membrane lysis or apoptosis; (b) activating target cell caspases through the interaction of tumor necrosis factor-associated apoptosis-inducing ligands and Fas ligands on tumor cells; and (c) secreting various factors to regulate the function of other immune cells, indirectly killing tumor cells.
[0121] This application integrates the encoding gene of bispecific or trispecific single-chain antibody into a modified oncolytic virus, enabling the gene to be expressed in vivo, thereby further improving the therapeutic effect on tumor cells. Attached Figure Description
[0122] Figure 1 shows the JBS-M(3)-aPD-L1-aCD3 recombinant plasmid prepared in Example 3.
[0123] Figure 2 shows the JBS-M(42)-aPD-L1-aCD16 recombinant plasmid prepared in Example 4.
[0124] Figure 3 shows the JBS-M(42)-aPD-L1-aCD3-aCD16 recombinant plasmid prepared in Example 5.
[0125] Figure 4 shows the test results of the killing efficiency of VSV-M(3)-aPD-L1-aCD3 against A549 in Example 1.
[0126] Figure 5 shows the test results of the killing efficiency of VSV-M(3)-aPD-L1-aCD3 against A673 in Example 1.
[0127] Figure 6 shows the experimental results of the killing efficiency of VSV-M(3)-aPD-L1-aCD3 against HT29 in Example 1.
[0128] Figure 7 shows the test results of the killing efficiency of VSV-M(3)-aPD-L1-aCD3 against MC-38 in Example 1.
[0129] Figure 8 shows the experimental results of the killing efficiency of VSV-M(3)-aPD-L1-aCD3 against Hepa1-6 in Example 1.
[0130] Figure 9 shows the experimental results of the killing efficiency of VSV-M(3)-aPD-L1-aCD3 against LLC in Example 1.
[0131] Figure 10 shows the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD16 against A549 in Example 2.
[0132] Figure 11 shows the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD16 against A673 in Example 2.
[0133] Figure 12 shows the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD16 against HT29 in Example 2.
[0134] Figure 13 shows the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD16 against MC-38 in Example 2.
[0135] Figure 14 shows the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD16 against Hepa1-6 in Example 2.
[0136] Figure 15 shows the experimental results of the killing efficiency of VSV-M(42)-aPD-L1-aCD16 against LLC in Example 2.
[0137] Figure 16 shows the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD3-aCD16 against MC-38 in Example 3.
[0138] Figure 17 shows the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD3-aCD16 against Hepa1-6 in Example 3.
[0139] Figure 18 shows the experimental results of the killing efficiency of VSV-M(42)-aPD-L1-aCD3-aCD16 against LLC in Example 3.
[0140] Figure 19 shows the microscopic observation results of the tumor cell killing efficiency test of VSV-M(3)-aPD-L1-aCD3 combined with PBMC cells in Example 4.
[0141] Figure 20 shows the experimental results of the killing efficiency of VSV-M(3)-aPD-L1-aCD3 combined with PBMC cells against tumor cells in Example 4.
[0142] Figure 21 shows the experimental results of the tumor cell killing efficiency of VSV-M(42)-aPD-L1-aCD16 combined with NK510 cells in Example 5.
[0143] Other aspects and advantages of this application will readily be apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive. Detailed Implementation
[0144] The following specific embodiments illustrate the implementation of the invention. Those skilled in the art can easily understand other advantages and effects of the invention from the content disclosed in this specification.
[0145] Terminology Definition
[0146] In this application, the term "oncolytic virus" generally refers to a virus capable of replicating in and killing tumor cells. Oncolytic viruses include, but are not limited to: vesicular stomatitis virus (VSV), poxvirus, herpes simplex virus (HSV), measles virus, Semlikie forest virus, poliovirus, reovirus, Seneca Valley virus (SVV), echovirus, Coxsackie virus, Newcastle disease virus (NDV), and Malaba virus. In some embodiments, the oncolytic virus is modified to increase its selectivity for tumor cells. In some embodiments, the oncolytic virus is modified to reduce its immunogenicity.
[0147] In some implementations, the VSV virus is a mutant of the Indiana MuddSummer subtype of VSV virus, which can be used to treat tumors. This virus does not interact with endogenous IFN-β in normal cells and can only selectively amplify and grow in tumor cells.
[0148] VSV viruses can express a variety of cell surface molecules, including low-density lipoprotein receptors, phosphatidylserine, sialolipids, and heparan sulfate, and can attach to the cell surface through these molecules. Compared with other oncolytic cell virus platforms currently under development, VSV viruses have the following advantages: (1) small genome, short replication time, and fast transsynaptic speed; (2) extremely high expression of exogenous genes, thus allowing for high titers and large-scale production; (3) independent cell cycle and no risk of transformation in the host cell cytoplasm. This oncolytic virus does not integrate into DNA, and after attenuation, it can avoid the neurological inflammation caused by wild-type viruses. Given the above characteristics, VSV has great potential in tumor immunotherapy.
[0149] In some implementations, site-directed gene mutations can be performed on the M protein, and / or G protein, and / or N protein, and / or P protein, and / or L protein of the VSV virus.
[0150] In some embodiments, the recombinant oncolytic virus described in this application may be a genetically modified oncolytic virus, such as one or more modified genes to enhance its tumor selectivity and / or preferentially replicate in dividing cells. The genetic modification may involve modifying genes involved in DNA / RNA replication, nucleic acid metabolism, host orientation, surface attachment, virulence, lysis, and diffusion processes, or it may involve integrating exogenous genes. The exogenous genes may include exogenous immune regulatory genes, exogenous selection genes, exogenous reporter genes, etc. The modified oncolytic virus may also be an amino acid-modified oncolytic virus, such as through the insertion, deletion, or substitution of one or more amino acids.
[0151] In this application, the term "M protein" generally refers to the VSV viral matrix protein. The M protein is an important virulence factor of VSV and is also a known VSV protein that can interfere with the innate immune response in mice. The term "M protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the wild-type VSV virus Indiana MuddSummer subtype M protein may contain the amino acid sequence shown in SEQ ID NO 1. In this application, the oncolytic virus M protein may contain the amino acid sequences shown in SEQ ID NO 2-3.
[0152] In this application, the term "G protein" generally refers to the glycoprotein of VSV virus, also known as the envelope protein. The term "G protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the G protein of the wild-type VSV virus Indiana MuddSummer subtype may contain the amino acid sequence shown in SEQ ID NO 4. In this application, the G protein of the oncolytic virus may contain the amino acid sequence shown in any one of SEQ ID NO 5-6.
[0153] In this application, the term "N protein" generally refers to the nucleocapsid protein of VSV virus. The term "N protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the N protein of the wild-type VSV virus Indiana MuddSummer subtype may contain the amino acid sequence shown in SEQ ID NO 7. In this application, the N protein of the oncolytic virus may contain the amino acid sequence shown in SEQ ID NO 8.
[0154] In this application, the term "P protein" generally refers to a phosphoprotein of VSV virus. The term "P protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the P protein of the wild-type VSV virus Indiana MuddSummer subtype may contain the amino acid sequence shown in SEQ ID NO 9. In this application, the P protein of the oncolytic virus may contain the amino acid sequence shown in SEQ ID NO 10.
[0155] In this application, the term "L protein" generally refers to the VSV viral RNA polymerase protein. The L gene of VSV virus encodes an RNA polyE protein. The term "L protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the L protein of the wild-type VSV virus Indiana MuddSummer subtype may contain the amino acid sequence shown in SEQ ID NO 11. In this application, the L protein of the oncolytic virus may contain the amino acid sequence shown in any one of SEQ ID NO 12-14.
[0156] In this application, protein mutation sites are typically described as "amino acid + amino acid position + mutated amino acid". In this application, the mutation may include, but is not limited to, the addition, substitution, deletion, and / or removal of amino acids. For example, the term "M51R" typically refers to a mutation at position 51, where methionine M is replaced by arginine R.
[0157] In this application, the term "amino acid substitution" generally refers to replacing an amino acid residue present in the parental sequence with another amino acid residue. The amino acid in the parental sequence can be substituted, for example, via chemical synthesis or by recombination methods known in the art. Therefore, "substitution at position xx" generally means replacing the amino acid present at position xx with an alternative amino acid residue. In this application, the amino acid substitution may include amino acid mutations.
[0158] In this application, the term "mutation" generally refers to an alteration of the nucleotide or amino acid sequence of a wild-type molecule. Amino acid changes can include substitution, deletion, omission, insertion, addition, truncation, or protein processing or cleavage.
[0159] In this application, the recombinant oncolytic virus is synthesized by site-directed gene mutation of the M, and / or G, and / or N, and / or P, and / or L proteins of VSV virus, while integrating exogenous genes. Specifically, the exogenous genes are CD3 antibody genes and / or CD16 antibody genes combined with target antibody genes.
[0160] In some specific embodiments, the bispecific antibody may include, but is not limited to: BCMA-CD3, CD3-GPRC5D, CD20-CD3, CD19-CD3, CD3-DLL3, CD3-EpCAM, CD16a-CD30, CD123-CD3, CD3-MMC16, CD3-PSMA, CD3-MMC17, CD3-FAP, and CD3-PDL1.
[0161] In this application, the term "prevention" generally refers to preventing the occurrence, onset, recurrence, and / or spread of a disease or one or more symptoms thereof by taking certain measures in advance. In this application, the term "treatment" generally refers to eliminating or improving a disease, or one or more symptoms associated with a disease. In some embodiments, treatment generally refers to administering one or more drugs to a patient suffering from the disease so that the disease is eliminated or alleviated. In some embodiments, "treatment" may be the administration of the drug combination and / or pharmaceutical product after the onset of symptoms of a specific disease, in the presence or absence of other drugs. For example, using the drug combination and / or pharmaceutical product described in this application to prevent the occurrence, development, recurrence, and / or metastasis of a tumor.
[0162] In this application, the term "tumor" generally refers to any new pathological tissue growth. Tumors may be benign or malignant. In this application, the tumor may be a solid tumor and / or a hematoma. When used for research purposes, these tissues can be isolated from readily available resources using methods well known to those skilled in the art.
[0163] In some specific embodiments, the tumors include, but are not limited to, acute lymphoblastic leukemia, acute B-lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-Hodgkin's lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, breast cancer (BRCA), cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), sensory neuroblastoma, Ewing sarcoma, fallopian tube cancer, gallbladder cancer, etc. Stomach cancer, gastrointestinal carcinoid tumors, hepatocellular carcinoma, hypopharyngeal cancer, Kaposi's sarcoma, kidney cancer, Langerhans cell carcinoma, laryngeal cancer, liver cancer, lung cancer, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary adenoma, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small bowel cancer, squamous neck cancer, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and vascular tumors.
[0164] Invention Details
[0165] A wild-type VSV virus, specifically the Indiana strain of VSV virus, specifically the Indiana MuddSummer subtype of VSV virus. The amino acid sequence of its M protein is shown in SEQ ID NO 1; the amino acid sequence of its G protein is shown in SEQ ID NO 4; the amino acid sequence of its N protein is shown in SEQ ID NO 7; the amino acid sequence of its P protein is shown in SEQ ID NO 9; and the amino acid sequence of its L protein is shown in SEQ ID NO 11. In this application, the M, G, N, P, and L proteins can all be modified.
[0166] A recombinant oncolytic virus, which is obtained by mutating sites on the amino acid sequences of the above-mentioned wild-type VSV virus, namely the M, G, N, P and L proteins.
[0167] This application provides a recombinant oncolytic virus, specifically comprising: the recombinant oncolytic virus including M protein, G protein, N protein, P protein, L protein, and a bispecific single-chain antibody gene or a trispecific single-chain antibody gene integrated into the backbone of the recombinant oncolytic virus; the bispecific single-chain antibody gene is obtained by recombining a CD3 antibody gene or a CD16 antibody gene with a target antibody gene; the trispecific single-chain antibody gene is obtained by recombining a CD3 antibody gene and a CD16 antibody gene with a target antibody gene.
[0168] Compared with the amino acid sequence shown in SEQ ID NO 1, the site mutation of the M protein includes any one or more of M51R, V221F, and S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; or the site mutation of the M protein includes N32S, N49D, M51R, H54Y, knockout of the leucine-encoded base at position 111, V221F, and V225I. 25I, S226R, or any one or more of the following: or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes G21 E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R. Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, S226R.
[0169] Compared with the amino acid sequence shown in SEQ ID NO 4, the site mutations of the G protein include any one or more of H38Y, V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.
[0170] Compared to the amino acid sequence shown in SEQ ID NO 7, the site mutations of the N protein include any one or more of I14V, R155K, and S353N.
[0171] Compared with the amino acid sequence shown in SEQ ID NO 9, the site mutations of the P protein include any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.
[0172] Compared with the amino acid sequence shown in SEQ ID NO 11, the site mutations of the L protein include any one or more of S87P, I397T, I487T, and F873L.
[0173] Furthermore, the recombinant oncolytic virus is obtained by introducing exogenous genes encoding CD3 antibody and / or CD16 antibody and target antibody into the above-mentioned recombinant oncolytic virus.
[0174] In this application, the recombinant oncolytic virus described herein can be obtained through a viral packaging process and a viral rescue process. Specifically, the process may include infecting BSR-T7 cells with vaccinia virus vTF7-3 expressing T7 RNA polymerase, followed by lipofectamine transfection using expression plasmids and backbone plasmids that respectively clone the VSV N, VSV P, and VSV L genes to obtain the target oncolytic virus.
[0175] This application provides a composition comprising the above-described recombinant oncolytic virus.
[0176] In some embodiments, the composition may include suitable formulations of one or more (pharmaceutically effective) adjuvants, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers, and / or preservatives. The acceptable components of the composition are preferably non-toxic to the recipient at the dosage and concentration used. The compositions of this application include, but are not limited to, liquid, freeze-dried, and lyophilized compositions.
[0177] In some embodiments, the pharmaceutically acceptable carrier may include any and all solvents, dispersion media, coatings, isotonic agents, and absorption delay agents that are compatible with drug administration and are generally safe and non-toxic.
[0178] In some embodiments, the composition may be administered parenterally, subcutaneously, intracavitarily, intra-arterially, intravenously, intrathecally, and / or intranasally, or directly injected into tissues. For example, the composition may be administered to a patient or subject by infusion or injection. In some embodiments, the composition may be administered in various ways, such as intravenously, intraperitoneally, subcutaneously, intramuscularly, intradermally, or intratissuely. In some embodiments, the composition may be administered continuously. This continuous (or uninterrupted) administration may be achieved using a small pump system worn by the patient to measure the amount of therapeutic agent flowing into the patient, as described in WO2015 / 036583.
[0179] The present application will be further described in detail below with reference to preparation examples and embodiments.
[0180] Preparation Example
[0181] Preparation Example 1
[0182] This preparation example provides a recombinant oncolytic virus.
[0183] This recombinant oncolytic virus comprises M, G, N, P, and L proteins. The M, G, N, P, and L proteins were all obtained through point mutations from wild-type VSV (Indiana MuddSummer subtype). Specifically, the M protein contains the amino acid sequence shown in SEQ ID NO 2, the G protein contains the amino acid sequence shown in SEQ ID NO 5, the N protein contains the amino acid sequence shown in SEQ ID NO 8, the P protein contains the amino acid sequence shown in SEQ ID NO 10, and the L protein contains the amino acid sequence shown in SEQ ID NO 12. See Table 1 for details.
[0184] The method for constructing the above-mentioned recombinant oncolytic virus is as follows:
[0185] (1) Using the genome of the Indiana MuddSummer subtype of VSV virus as the main component, protein mutations were performed.
[0186] The core plasmid JBS-M(3) and auxiliary plasmids pN, pP, pL and pG of the artificially synthesized VSV-M(3) attenuated strain packaging system include the mutation combinations shown in Table 1. Then, the VSV-M(3) attenuated strain with the required mutation sites is rescued using reverse genetics technology. The virus rescue process is as follows.
[0187] Table 1. Recombinant oncolytic virus prepared in Example 1
[0188] (2) Virus rescue
[0189] 1) Seed BSR-T7 cells into 6-well plates to achieve a cell density of 7 × 10⁶ cells / well. 5 Each well contains one cell, and the cells are incubated in an incubator for approximately 16-20 hours.
[0190] 2) Discard the supernatant in the six-well plate, add 1 ml of Opti-MEM, add 10 μl of poxvirus per well (MOI approximately 1), and incubate for 4 h.
[0191] 3) Preparation of transfection complex: core plasmid: JBS-M(3) 3μg; helper plasmid: pP 1.5μg, pN 1.2μg, pL 0.3μg, pG 0.2μg.
[0192] pN, pP, pL, and pG refer to plasmids that clone the genes corresponding to the N, P, L, and G proteins listed in Table 1, respectively, and express the mutant N, P, L, and G proteins required for virus rescue. Plasmid transfection was performed according to the instructions in the Lipofectamine LTX user manual.
[0193] Take two 1.5 ml tubes, labeled A and B respectively, and add 200 μl of Opti-MEM to each. In tube A, add 1.5 μg pP, 1.2 μg pN, 0.3 μg pL, 0.2 μg pG plasmid, and 3 μg JBS-M(3) plasmid sequentially, mix well, and then add 10 μl / tube of transfection enhancement reagent. In tube B, add 12 μl of transfection reagent (LTX) and mix well. Add the mixture from tube B to tube A, mix gently, and let stand at room temperature for 10 min.
[0194] 4) After incubating poxvirus for 4 hours, discard the virus supernatant, add 600 μl of Opti-MEM medium to each well, add the plasmid transfection reagent mixture from 3) dropwise to the 6-well plate of cultured cells, gently shake the 6-well plate to distribute it evenly in the 6-well plate, and then place it in an incubator for culture.
[0195] 5) 6 hours after transfection, add 2 ml of 3% FBSDMEM medium to each well.
[0196] 6) After 48 hours of transfection, cytopathic effects were observed. Virus solution and cells were collected, centrifuged at 2500xg, and the supernatant was collected. 200 μl of the supernatant was retained to resuspend the cell pellet. The pellet was frozen and thawed three times at -80℃, centrifuged at 2500xg, and the supernatant was collected. The supernatant was mixed with the unfrozen supernatant and filtered twice through a 0.22 μm filter to remove poxvirus. The resulting pellet was named VSV-M(3)P1.
[0197] 7) Take 1.5 × 10 6 Each cell was diluted to a volume of 2 ml with 10% FBSDMEM medium and seeded into a six-well plate.
[0198] 8) After 16-20 hours, 500 μl of VSV-M(3)P1 virus dilution was used to infect 293 cells in a 6-well plate.
[0199] 9) After 24 hours, collect the virus solution and cells, centrifuge at 2500xg, collect the supernatant, retain 200μl of supernatant to resuspend the cell pellet, freeze and thaw three times at -80℃, centrifuge at 2500xg, collect the supernatant, mix it with the unfrozen supernatant, filter it once with a 0.22μm filter to remove poxvirus, and name it VSV-M(3)P2.
[0200] 10) Virus single-spot screening and amplification
[0201] Take 1.5 × 10 6 Each cell was diluted to a volume of 2 ml with 10% FBSDMEM medium and seeded into a six-well plate.
[0202] After 16-20 hours, the virus was serially diluted 10-fold (E6, E7, E8, E9, E10), and 1 ml of the diluted virus solution was used to infect 293 cells in 6-well plates.
[0203] Two hours after infection, the virus solution was discarded. After washing once with incomplete culture medium, 2.5 ml of a cover layer (2% soft agar and 4% FBS mixed in 2X DMEM 1 and incubated at 40°C) was added. After the agar layer solidified, the culture was inverted for further incubation.
[0204] The day after viral infection, 1.5 × 10 6 One cell was seeded into a six-well culture plate.
[0205] Seventy-two hours after infection, four single spots were picked up with a 1 ml pipette tip and resuspended in 2.5 ml of 2% FBSDMEM to infect HEK 293 cells. Single spot screening was performed after 48 hours of complete cytopathic effect on all cells. Virus solution and cells were collected, centrifuged at 2500 x g, and the supernatant was collected. 200 μl of the supernatant was retained to resuspend the cell pellet. The pellet was frozen and thawed three times at -80°C, centrifuged at 2500 x g, and the supernatant was collected. The supernatant was mixed with the unfrozen supernatant and filtered through a 0.22 μm filter. The resulting pellet was named VSV-M(3)P3.
[0206] Repeat the above steps to perform a second single-spot screening, named VSV-M(3)P4.
[0207] 11) Take 1.5 × 10 7 Each cell was diluted to a volume of 10 ml with 10% FBSDMEM medium and placed in a T75 culture flask.
[0208] 12) After 16-20 hours, take 1 μl of VSV-MP4 dilution to infect HEK 293 cells in T75 culture flasks.
[0209] 13) After 48 hours, collect the virus solution and cells, centrifuge at 2500xg, collect the supernatant, retain 200μl of supernatant to resuspend the cell pellet, freeze and thaw three times at -80℃, centrifuge at 2500xg, collect the supernatant, mix with the unfrozen supernatant, filter once with a 0.22μm filter to remove poxvirus, name it VSV-M(3)P5, and obtain the desired recombinant oncolytic virus attenuated strain.
[0210] (3) Gene sequencing. Viral genomic RNA was extracted using the Trizol kit, and reverse transcription was performed using random primers. PCR was performed on the reverse-transcribed cDNA using primers designed for the M protein gene sequence, the G protein gene sequence, the N protein gene sequence, the P protein gene sequence, the L protein gene sequence, and the antigen-encoding gene sequence.
[0211] The primer sequences designed for the M protein gene sequence are as follows:
[0212] PF:ATGAGTTCCTAAAGAA(SEQ ID NO 21);
[0213] PR:TCATTTGAAGTGG (SEQ ID NO 22).
[0214] The primer sequences designed for the G protein gene sequence are as follows:
[0215] PF: ATGAAGTGCCTTTTGTACTTAG (SEQ ID NO 23);
[0216] PR:TTACTTTCCAAGTCGGTTCATCT (SEQ ID NO 24).
[0217] The primer sequences designed for the N protein gene sequence are as follows:
[0218] PF: ATGTCTGTTACAGTCAAGAG (SEQ ID NO 25);
[0219] PR:TCATTTGTCAAATTCTGACTT (SEQ ID NO 26).
[0220] The primer sequences designed for the P protein gene sequence are as follows:
[0221] PF:ATGGATAATCTCACAAAAGTTCG (SEQ ID NO 27);
[0222] PR: CTACAGAGAATATTTGACTCTCG (SEQ ID NO 28).
[0223] The primer sequences designed for the L protein gene sequence are as follows:
[0224] PF:ATGGAAGTCCACGATTTTGAGA (SEQ ID NO 29);
[0225] PR:TTAATCTCTCCAAGAGTTTTCCT (SEQ ID NO 30).
[0226] The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 1.
[0227] Preparation Example 2
[0228] This preparation example provides a recombinant oncolytic virus.
[0229] This recombinant oncolytic virus comprises M, G, N, P, and L proteins. The M, G, N, P, and L proteins were all obtained through point mutations from wild-type VSV (Indiana MuddSummer subtype). Specifically, the M protein contains the amino acid sequence shown in SEQ ID NO 3, the G protein contains the amino acid sequence shown in SEQ ID NO 5, the N protein contains the amino acid sequence shown in SEQ ID NO 8, the P protein contains the amino acid sequence shown in SEQ ID NO 10, and the L protein contains the amino acid sequence shown in SEQ ID NO 12. See Table 2 for details.
[0230] The method for constructing the above-mentioned recombinant oncolytic virus is as follows:
[0231] (1) Using the genome of the Indiana MuddSummer subtype of VSV virus as the main component, protein mutations were performed.
[0232] The core plasmid JBS-M(42) and auxiliary plasmids pN, pP, pL and pG of the artificially synthesized VSV-M(42) attenuated strain packaging system were included in the mutation combinations shown in Table 2. Then, the VSV-M(42) attenuated strain with the required mutation site was rescued by reverse genetics technology. The virus rescue process was the same as in Preparation Example 1, and VSV-M(42)P5 virus was obtained.
[0233] Table 2. Recombinant oncolytic virus prepared in Example 2
[0234] Preparation Example 3
[0235] This preparation example provides a recombinant oncolytic virus carrying an aPD-L1-aCD3 single-chain antibody.
[0236] Specifically, based on the recombinant oncolytic virus provided in Example 1, a gene encoding aPD-L1-aCD3 single-chain antibody was inserted. The method for preparing the gene encoding aPD-L1-aCD3 single-chain antibody is a conventional technique in this field.
[0237] The specific method for preparing the gene encoding the aPD-L1-aCD3 single-chain antibody is as follows:
[0238] (1) Insertion of the gene encoding aPD-L1-aCD3 single-chain antibody
[0239] 1) Insertion of a gene encoding aPD-L1-aCD3 single-chain antibody
[0240] The gene encoding the aPD-L1-aCD3 single-chain antibody was synthesized by a gene synthesis company using primers with homologous arms containing the JBS-M(3) plasmid insertion site. The primers used were:
[0241] F: ctaacagatatcacgctcgagATGAATTTCGGCCTGAGCCT (SEQ ID NO 31);
[0242] R:aacatgaagaatctggctagcTCAGTGGTGATGATGATGATGTTTC (SEQ ID NO 32).
[0243] The fragments were amplified using a PCR instrument, followed by 1% gel electrophoresis, and then the fragments were recovered by gel excision.
[0244] 2) The JBS-M(3) plasmid was double-digested with XhoI and NheI, and the long fragment was recovered by gel electrophoresis after 1% gel electrophoresis.
[0245] 3) Subsequently, the gene fragment encoding the aPD-L1-aCD3 single-chain antibody and the linear plasmid were recombined, transformed, plated, and cultured overnight at 37°C.
[0246] 4) After selecting multiple monoclonal strains, they were cultured and sent to a sequencing company for sequencing. The strains with the correct inserted sequence were selected to extract plasmids, thereby obtaining recombinant plasmids carrying the gene encoding the aPD-L1-aCD3 single-chain antibody, named JBS-M(3)-aPD-L1-aCD3, as shown in Figure 1. The sequence information involved is shown in Table 2.
[0247] (2) Virus rescue
[0248] 1) Seed BSR-T7 cells into 6-well plates to achieve a cell density of 7 × 10⁶ cells / well. 5 Each well contains one cell, and the cells are incubated in an incubator for approximately 16-20 hours.
[0249] 2) Discard the supernatant in the six-well plate, add 1 ml of Opti-MEM, add 10 μl of poxvirus per well (MOI approximately 1), and incubate for 4 h.
[0250] 3) Preparation of transfection complex: Core plasmid: JBS-M(3)-aPD-L1-aCD3 3μg; Auxiliary plasmids: pP 1.5μg, pN 1.2μg, pL 0.3μg, pG 0.2μg.
[0251] pN, pP, pL, and pG refer to plasmids that clone the genes corresponding to the N, P, L, and G proteins listed in Table 1, respectively, and express the mutant N, P, L, and G proteins required for virus rescue. Plasmid transfection was performed according to the instructions in the Lipofectamine LTX user manual.
[0252] Take two 1.5 ml tubes, labeled A and B respectively, and add 200 μl of Opti-MEM to each. In tube A, add 1.5 μg pP, 1.2 μg pN, 0.3 μg pL, 0.2 μg pG plasmid, and 3 μg JBS-M(3)-aPD-L1-aCD3 plasmid sequentially, mix well, and then add 10 μl / tube of transfection enhancement reagent. In tube B, add 12 μl of transfection reagent (LTX) and mix well. Add the mixture from tube B to tube A, mix gently, and let stand at room temperature for 10 min.
[0253] 4) After incubating poxvirus for 4 hours, discard the virus supernatant, add 600 μl of Opti-MEM medium to each well, add the plasmid transfection reagent mixture from 3) dropwise to the 6-well plate of cultured cells, gently shake the 6-well plate to distribute it evenly in the 6-well plate, and then place it in an incubator for culture.
[0254] 5) 6 hours after transfection, add 2 ml of 3% FBSDMEM medium to each well.
[0255] 6) After 48 hours of transfection, cytopathic effects were observed. Virus solution and cells were collected, centrifuged at 2500xg, and the supernatant was collected. 200 μl of the supernatant was retained to resuspend the cell pellet. The cells were frozen and thawed three times at -80℃, centrifuged at 2500xg, and the supernatant was collected. The mixture was then mixed with the unfrozen supernatant and filtered twice through a 0.22 μm filter to remove poxvirus. The resulting virus was named VSV-M(3)-aPD-L1-aCD3 P1.
[0256] 7) Take 1.5 × 10 6 Each cell was diluted to a volume of 2 ml with 10% FBSDMEM medium and seeded into a six-well plate.
[0257] 8) After 16-20 hours, 500 μl of VSV-MP1 virus dilution was used to infect 293 cells in a 6-well plate.
[0258] 9) After 24 hours, collect the virus solution and cells, centrifuge at 2500xg, collect the supernatant, retain 200μl of supernatant to resuspend the cell pellet, freeze and thaw three times at -80℃, centrifuge at 2500xg, collect the supernatant, mix with the unfrozen supernatant, filter once with a 0.22μm filter to remove poxvirus, and name it VSV-M(3)-aPD-L1-aCD3 P2.
[0259] 10) Virus single-spot screening and amplification
[0260] Take 1.5 × 10 6 Each cell was diluted to a volume of 2 ml with 10% FBSDMEM medium and seeded into a six-well plate.
[0261] After 16-20 hours, the virus was serially diluted 10-fold (E6, E7, E8, E9, E10), and 1 ml of the diluted virus solution was used to infect 293 cells in 6-well plates.
[0262] Two hours after infection, the virus solution was discarded. After washing once with incomplete culture medium, 2.5 ml of a cover layer (2% soft agar and 4% FBS mixed in 2X DMEM 1 and incubated at 40°C) was added. After the agar layer solidified, the culture was inverted for further incubation.
[0263] The day after viral infection, 1.5 × 10 6 One cell was seeded into a six-well culture plate.
[0264] Seventy-two hours after infection, four single spots were picked up with a 1 ml pipette tip and resuspended in 2.5 ml of 2% FBSDMEM to infect HEK 293 cells. Single spot screening was performed after 48 hours of complete cytopathic effect on all cells. The virus solution and cells were collected, centrifuged at 2500 x g, and the supernatant was collected. 200 μl of the supernatant was retained to resuspend the cell pellet. The pellet was frozen and thawed three times at -80°C, centrifuged at 2500 x g, and the supernatant was collected. The supernatant was mixed with the unfrozen supernatant and filtered through a 0.22 μm filter. The resulting product was named VSV-M(3)-aPD-L1-aCD3 P3.
[0265] Repeat the above steps to perform a second single-spot screening, named VSV-M(3)-aPD-L1-aCD3 P4.
[0266] 11) Take 1.5 × 10 7 Each cell was diluted to a volume of 10 ml with 10% FBSDMEM medium and placed in a T75 culture flask.
[0267] 12) After 16-20 hours, take 1 μl of VSV-MP4 dilution to infect HEK 293 cells in T75 culture flasks.
[0268] 13) After 48 hours, collect the virus solution and cells, centrifuge at 2500xg, collect the supernatant, retain 200μl of supernatant to resuspend the cell pellet, freeze and thaw three times at -80℃, centrifuge at 2500xg, collect the supernatant, mix with the unfrozen supernatant, filter once with a 0.22μm filter to remove poxvirus, and name it VSV-M(3)-aPD-L1-aCD3 P5, thus obtaining the desired recombinant oncolytic virus attenuated strain.
[0269] (3) Gene sequencing. Viral genomic RNA was extracted using a Trizol kit and reverse transcription was performed using random primers. The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 2.
[0270] Table 3 Recombinant oncolytic viruses prepared in Examples 2-4
[0271] Preparation Example 4
[0272] This preparation example provides a recombinant oncolytic virus carrying aPD-L1-aCD16 single-chain antibody.
[0273] Specifically, based on the recombinant oncolytic virus provided in Example 2, a gene encoding aPD-L1-aCD16 single-chain antibody was inserted. The method for preparing the gene encoding aPD-L1-aCD16 single-chain antibody is a conventional technique in this field.
[0274] The specific method for preparing the gene encoding the aPD-L1-aCD16 single-chain antibody is as follows:
[0275] (1) Insertion of the gene encoding aPD-L1-aCD16 single-chain antibody
[0276] 1) Insertion of a gene encoding aPD-L1-aCD16 single-chain antibody
[0277] The gene encoding the aPD-L1-aCD16 single-chain antibody was synthesized by a gene synthesis company using primers containing homologous arms of the JBS-M(42) plasmid insertion site. The primers used were:
[0278] F: ctaacagatatcacgctcgagATGAATTTCGGCCTGAGCCT (SEQ ID NO 33);
[0279] R:aacatgaagaatctggctagcTCAGCTGCTCACGGTCACCA (SEQ ID NO 34).
[0280] The fragments were amplified using a PCR instrument, followed by 1% gel electrophoresis, and then the fragments were recovered by gel excision.
[0281] 2) The JBS-M(42) plasmid was double-digested with XhoI and NheI, and the long fragment was recovered by gel electrophoresis after 1% gel electrophoresis.
[0282] 3) Subsequently, the gene fragment encoding the aPD-L1-aCD16 single-chain antibody and the linear plasmid were recombined, transformed, plated, and cultured overnight at 37°C.
[0283] 4) After selecting multiple monoclonal strains, they were sent to a sequencing company for sequencing. The strains with the correct inserted sequence were selected to extract plasmids, thereby obtaining recombinant plasmids carrying the gene encoding the aPD-L1-aCD16 single-chain antibody, named JBS-M(42)-aPD-L1-aCD16, as shown in Figure 2. The sequence information involved is shown in Table 2.
[0284] (2) Virus rescue
[0285] 1) Seed BSR-T7 cells into 6-well plates to achieve a cell density of 7 × 10⁶ cells / well. 5 Each well contains one cell, and the cells are incubated in an incubator for approximately 16-20 hours.
[0286] 2) Discard the supernatant in the six-well plate, add 1 ml of Opti-MEM, add 10 μl of poxvirus per well (MOI approximately 1), and incubate for 4 h.
[0287] 3) Preparation of transfection complex: Core plasmid: JBS-M(42)-aPD-L1-aCD16 3μg; Auxiliary plasmids: pP 1.5μg, pN 1.2μg, pL 0.3μg, pG 0.2μg.
[0288] pN, pP, pL, and pG refer to plasmids that clone the genes corresponding to the N, P, L, and G proteins listed in Table 1, respectively, and express the mutant N, P, L, and G proteins required for virus rescue. Plasmid transfection was performed according to the instructions in the Lipofectamine LTX user manual.
[0289] Take two 1.5 ml tubes, labeled A and B respectively, and add 200 μl of Opti-MEM to each. In tube A, add 1.5 μg pP, 1.2 μg pN, 0.3 μg pL, 0.2 μg pG plasmid, and 3 μg JBS-M(42)-aPD-L1-aCD16 plasmid sequentially, mix well, and then add 10 μl of transfection enhancement reagent per tube. In tube B, add 12 μl of transfection reagent (LTX) and mix well. Add the mixture from tube B to tube A, mix gently, and let stand at room temperature for 10 min.
[0290] 4) After incubating poxvirus for 4 hours, discard the virus supernatant, add 600 μl of Opti-MEM medium to each well, add the plasmid transfection reagent mixture from 3) dropwise to the 6-well plate of cultured cells, gently shake the 6-well plate to distribute it evenly in the 6-well plate, and then place it in an incubator for culture.
[0291] 5) 6 hours after transfection, add 2 ml of 3% FBSDMEM medium to each well.
[0292] 6) Cytopathic effect was observed 48 h after transfection. Virus solution and cells were collected, centrifuged at 2500xg, and the supernatant was collected. 200 μl of the supernatant was retained to resuspend the cell pellet. The cells were frozen and thawed three times at -80℃, centrifuged at 2500xg, and the supernatant was collected. The supernatant was mixed with the unfrozen supernatant and filtered twice through a 0.22 μm filter to remove poxvirus. The resulting virus was named VSV-M(42)-aPD-L1-aCD16 P1.
[0293] 7) Take 1.5 × 10 6 Each cell was diluted to a volume of 2 ml with 10% FBSDMEM medium and seeded into a six-well plate.
[0294] 8) After 16-20 hours, 500 μl of VSV-MP1 virus dilution was used to infect 293 cells in a 6-well plate.
[0295] 9) After 24 hours, collect the virus solution and cells, centrifuge at 2500xg, collect the supernatant, retain 200μl of supernatant to resuspend the cell pellet, freeze and thaw three times at -80℃, centrifuge at 2500xg, collect the supernatant, mix with the unfrozen supernatant, filter once with a 0.22μm filter to remove poxvirus, and name it VSV-M(42)-aPD-L1-aCD16 P2.
[0296] 10) Virus single-spot screening and amplification
[0297] Take 1.5 × 10 6 Each cell was diluted to a volume of 2 ml with 10% FBSDMEM medium and seeded into a six-well plate.
[0298] After 16-20 hours, the virus was serially diluted 10-fold (E6, E7, E8, E9, E10), and 1 ml of the diluted virus solution was used to infect 293 cells in 6-well plates.
[0299] Two hours after infection, the virus solution was discarded. After washing once with incomplete culture medium, 2.5 ml of a cover layer (2% soft agar and 4% FBS mixed in 2X DMEM 1 and incubated at 40°C) was added. After the agar layer solidified, the culture was inverted for further incubation.
[0300] The day after viral infection, 1.5 × 10 6 One cell was seeded into a six-well culture plate.
[0301] Seventy-two hours after infection, four single spots were picked up with a 1 ml pipette tip and resuspended in 2.5 ml of 2% FBSDMEM to infect HEK 293 cells. Single spot screening was performed after 48 hours of complete cytopathic effect on all cells. The virus solution and cells were collected, centrifuged at 2500 x g, and the supernatant was collected. 200 μl of the supernatant was retained to resuspend the cell pellet. The pellet was frozen and thawed three times at -80°C, centrifuged at 2500 x g, and the supernatant was collected. The supernatant was mixed with the unfrozen supernatant and filtered through a 0.22 μm filter. The resulting product was named VSV-M(42)-aPD-L1-aCD16 P3.
[0302] Repeat the above steps to perform a second single-spot screening, named VSV-M(42)-aPD-L1-aCD16 P4.
[0303] 11) Take 1.5 × 10 7 Each cell was diluted to a volume of 10 ml with 10% FBSDMEM medium and placed in a T75 culture flask.
[0304] 12) After 16-20 hours, take 1 μl of VSV-MP4 dilution to infect HEK 293 cells in T75 culture flasks.
[0305] 13) After 48 hours, collect the virus solution and cells, centrifuge at 2500xg, collect the supernatant, retain 200μl of supernatant to resuspend the cell pellet, freeze and thaw three times at -80℃, centrifuge at 2500xg, collect the supernatant, mix with the unfrozen supernatant, filter once with a 0.22μm filter to remove poxvirus, and name it VSV-M(42)-aPD-L1-aCD16 P5, thus obtaining the desired recombinant oncolytic virus attenuated strain.
[0306] (3) Gene sequencing. Viral genomic RNA was extracted using a Trizol kit and reverse transcription was performed using random primers. The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 2.
[0307] Preparation Example 5
[0308] This preparation example provides a recombinant oncolytic virus carrying aPD-L1-aCD3-aCD16 single-chain antibody.
[0309] Specifically, based on the recombinant oncolytic virus provided in Example 2, a gene encoding aPD-L1-aCD3-aCD16 single-chain antibody was inserted. The method for preparing the gene encoding aPD-L1-aCD3-aCD16 single-chain antibody is a conventional technique in this field.
[0310] The specific method for preparing the gene encoding the aPD-L1-aCD3-aCD16 single-chain antibody is as follows:
[0311] (1) Insertion of the gene encoding the aPD-L1-aCD3-aCD16 single-chain antibody
[0312] 1) Insertion of the gene encoding the aPD-L1-aCD3-aCD16 single-chain antibody
[0313] The gene encoding the aPD-L1-aCD3-aCD16 single-chain antibody was synthesized by a gene synthesis company using primers with homologous arms containing the JBS-M(42) plasmid insertion site. The primers used were:
[0314] F: ctaacagatatcacgctcgagATGAATTTCGGCCTGAGCCT (SEQ ID NO 35);
[0315] R:aacatgaagaatctggctagcTCAGCTGCTCACGGTCACCA (SEQ ID NO 36).
[0316] The fragments were amplified using a PCR instrument, followed by 1% gel electrophoresis, and then the fragments were recovered by gel excision.
[0317] 2) The JBS-M(42) plasmid was double-digested with XhoI and NheI, and the long fragment was recovered by gel electrophoresis after 1% gel electrophoresis.
[0318] 3) Subsequently, the gene fragment encoding the aPD-L1-aCD3-aCD16 single-chain antibody and the linear plasmid were recombined, transformed, plated, and cultured overnight at 37°C.
[0319] 4) After selecting multiple monoclonal strains and shaking them, they were sent to a sequencing company for sequencing. The strains with the correct inserted sequence were selected to extract plasmids, thereby obtaining recombinant plasmids carrying the gene encoding the aPD-L1-aCD3-aCD16 single-chain antibody, named JBS-M(42)-aPD-L1-aCD3-aCD16, as shown in Figure 3. The sequence information involved is shown in Table 2.
[0320] (2) Virus rescue
[0321] 1) Seed BSR-T7 cells into 6-well plates to achieve a cell density of 7 × 10⁶ cells / well. 5 Each well contains one cell, and the cells are incubated in an incubator for approximately 16-20 hours.
[0322] 2) Discard the supernatant in the six-well plate, add 1 ml of Opti-MEM, add 10 μl of poxvirus per well (MOI approximately 1), and incubate for 4 h.
[0323] 3) Preparation of transfection complex: Core plasmid: JBS-M(42)-aPD-L1-aCD3-aCD16 3μg; Auxiliary plasmids: pP 1.5μg, pN 1.2μg, pL 0.3μg, pG 0.2μg.
[0324] pN, pP, pL, and pG refer to plasmids that clone the genes corresponding to the N, P, L, and G proteins listed in Table 1, respectively, and express the mutant N, P, L, and G proteins required for virus rescue. Plasmid transfection was performed according to the instructions in the Lipofectamine LTX user manual.
[0325] Take two 1.5 ml tubes, labeled A and B respectively, and add 200 μl of Opti-MEM to each. In tube A, add 1.5 μg pP, 1.2 μg pN, 0.3 μg pL, 0.2 μg pG plasmid, and 3 μg JBS-M(42)-aPD-L1-aCD3-aCD16 plasmid sequentially, mix well, and then add 10 μl of transfection enhancement reagent per tube. In tube B, add 12 μl of transfection reagent (LTX) and mix well. Add the mixture from tube B to tube A, mix gently, and let stand at room temperature for 10 min.
[0326] 4) After incubating poxvirus for 4 hours, discard the virus supernatant, add 600 μl of Opti-MEM medium to each well, add the plasmid transfection reagent mixture from 3) dropwise to the 6-well plate of cultured cells, gently shake the 6-well plate to distribute it evenly in the 6-well plate, and then place it in an incubator for culture.
[0327] 5) 6 hours after transfection, add 2 ml of 3% FBSDMEM medium to each well.
[0328] 6) Cytopathic effect was observed 48 h after transfection. Virus solution and cells were collected, centrifuged at 2500xg, and the supernatant was collected. 200 μl of the supernatant was retained to resuspend the cell pellet. The cells were frozen and thawed three times at -80℃, centrifuged at 2500xg, and the supernatant was collected. The supernatant was mixed with the unfrozen supernatant and filtered twice through a 0.22 μm filter to remove poxvirus. The resulting virus was named VSV-M(42)-aPD-L1-aCD3-aCD16 P1.
[0329] 7) Take 1.5 × 10 6 Each cell was diluted to a volume of 2 ml with 10% FBSDMEM medium and seeded into a six-well plate.
[0330] 8) After 16-20 hours, 500 μl of VSV-MP1 virus dilution was used to infect 293 cells in a 6-well plate.
[0331] 9) After 24 hours, collect the virus solution and cells, centrifuge at 2500xg, collect the supernatant, retain 200μl of supernatant to resuspend the cell pellet, freeze and thaw three times at -80℃, centrifuge at 2500xg, collect the supernatant, mix with the unfrozen supernatant, filter once with a 0.22μm filter to remove poxvirus, and name it VSV-M(42)-aPD-L1-aCD3-aCD16 P2.
[0332] 10) Virus single-spot screening and amplification
[0333] Take 1.5 × 10 6 Each cell was diluted to a volume of 2 ml with 10% FBSDMEM medium and seeded into a six-well plate.
[0334] After 16-20 hours, the virus was serially diluted 10-fold (E6, E7, E8, E9, E10), and 1 ml of the diluted virus solution was used to infect 293 cells in 6-well plates.
[0335] Two hours after infection, the virus solution was discarded. After washing once with incomplete culture medium, 2.5 ml of a cover layer (2% soft agar and 4% FBS mixed in 2X DMEM 1 and incubated at 40°C) was added. After the agar layer solidified, the culture was inverted for further incubation.
[0336] The day after viral infection, 1.5 × 10 6 One cell was seeded into a six-well culture plate.
[0337] Seventy-two hours after infection, four single spots were picked up with a 1 ml pipette tip and resuspended in 2.5 ml of 2% FBSDMEM to infect HEK 293 cells. Single spot screening was performed after 48 hours of complete cytopathic effect on all cells. The virus solution and cells were collected, centrifuged at 2500 x g, and the supernatant was collected. 200 μl of the supernatant was retained to resuspend the cell pellet. The pellet was frozen and thawed three times at -80°C, centrifuged at 2500 x g, and the supernatant was collected. The supernatant was mixed with the unfrozen supernatant and filtered through a 0.22 μm filter. The resulting product was named VSV-M(42)-aPD-L1-aCD3-aCD16 P3.
[0338] Repeat the above steps to perform a second single-spot screening, named VSV-M(42)-aPD-L1-aCD3-aCD16 P4.
[0339] 11) Take 1.5 × 10 7 Each cell was diluted to a volume of 10 ml with 10% FBSDMEM medium and placed in a T75 culture flask.
[0340] 12) After 16-20 hours, take 1 μl of VSV-MP4 dilution to infect HEK 293 cells in T75 culture flasks.
[0341] 13) After 48 hours, collect the virus solution and cells, centrifuge at 2500xg, collect the supernatant, retain 200μl of supernatant to resuspend the cell pellet, freeze and thaw three times at -80℃, centrifuge at 2500xg, collect the supernatant, mix with the unfrozen supernatant, filter once with a 0.22μm filter to remove poxvirus, and name it VSV-M(42)-aPD-L1-aCD3-aCD16 P5, thus obtaining the desired recombinant oncolytic virus attenuated strain.
[0342] (3) Gene sequencing. Viral genomic RNA was extracted using a Trizol kit and reverse transcription was performed using random primers. The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 2.
[0343] Example 1
[0344] In this embodiment, the recombinant oncolytic virus (VSV-M(3)-aPD-L1-aCD3 monotherapy) carrying the aPD-L1-aCD3 single-chain antibody provided in Preparation Example 3 was used to conduct a killing efficiency test on different types of tumor cells.
[0345] The detection method was the CCK-8 assay, which involved adding VSV-M(3)-aPD-L1-aCD3 recombinant oncolytic virus to the culture medium of different cells, and then detecting cell viability using the CCK-8 assay after 48 hours. The cells tested included: human cells—A549, A673, HT29; and mouse cells—MC-38, Hepa1-6, LLC.
[0346] The specific testing method is as follows:
[0347] 1. Cell plating: After digestion and counting of cells, adjust the concentration to 1×10⁻⁶. 5 Cells / mL were seeded at 100 μL / well in a 96-well plate to achieve a cell density of 1 × 10⁻⁶ cells / mL. 4 One hole / hole.
[0348] 2. Virus dilution: Calculate the virus dilution rate to infect 1×10⁻⁶ cells with an MOI of 100. 4 The required amount of virus per cell was determined. Then, ten times the required amount of virus stock solution was mixed into 2% FBS medium to make the total volume of the dilution 1 ml. Then, 100 μL of the dilution was added to 900 μL of 2% FBS medium and mixed well. This process was repeated 10-fold serially, resulting in eight serial dilutions, corresponding to eight MOIs: 100, 10, 1, 0.1, 0.01, 0.001, 0.0001, and 0.00001.
[0349] 3. Viral infection: Add 100 μL of culture medium to each blank control well and cell control well. Add 100 μL of virus dilution to each corresponding experimental well, for a total of 6 replicates. Add 200 μL of PBS to each well at the plate edge.
[0350] 4. CCK8 assay: After culturing the cells in the above-mentioned cell plates for 48 hours, add 10 μl of CCK8 reagent (from YEASEN 40203ES80) to each well, shake the 96-well plate to mix gently, and incubate at 37°C for 1 hour.
[0351] 5. Plate reading: Use an ELISA reader to detect the absorbance value of each well at 450nm, and record and analyze the experimental results.
[0352] 6. The experiment was repeated twice. The results are shown in Table 4 and Figure 4-9.
[0353] Table 4. Experimental results of the killing efficiency of the recombinant oncolytic virus provided in this application against different types of tumor cells.
[0354] As shown in Table 4, when the recombinant oncolytic virus infects tumor cells with an MOI greater than 0.1, the killing efficiency of the tumor cells can reach more than 50%. When the tumor cells are infected with an MOI of 0.01, the killing efficiency of the virus against other tumor cells, except for A549 cells, can still reach more than 50%. It can be seen that the recombinant oncolytic virus alone has a good killing effect on most tumor cells.
[0355] Example 2
[0356] In this embodiment, the recombinant oncolytic virus (VSV-M(42)-aPD-L1-aCD16 monotherapy) carrying the aPD-L1-aCD16 single-chain antibody provided in Preparation Example 4 was used to conduct a killing efficiency test on different types of tumor cells.
[0357] The detection method was the CCK-8 assay, which involved adding VSV-M(42)-aPD-L1-aCD16 recombinant oncolytic virus to the culture medium of different cells, and then detecting cell viability using the CCK-8 assay after 48 hours. The cells tested included: human cells—A549, A673, HT29; and mouse cells—MC-38, Hepa1-6, LLC.
[0358] The specific detection method is the same as that in Example 1, and will not be repeated here. The results are shown in Table 4 and Figures 10-15.
[0359] As shown in Table 4, when the above-mentioned recombinant oncolytic virus infects tumor cells with an MOI greater than 0.1, its inhibitory effect on HT29 cells and Hepa1-6 cells is weak, while its killing efficiency on other tumor cells can reach more than 50%. This indicates that the above-mentioned recombinant oncolytic virus alone has a good killing effect on most tumor cells.
[0360] Example 3
[0361] In this embodiment, the recombinant oncolytic virus (VSV-M(42)-aPD-L1-aCD3-aCD16 monotherapy) carrying the single-chain antibody aPD-L1-aCD3-aCD16 provided in Preparation Example 5 was used to conduct a killing efficiency test on different types of tumor cells.
[0362] The detection method was the CCK-8 assay, which involved adding VSV-M(42)-aPD-L1-aCD3-aCD16 recombinant oncolytic virus to the culture medium of different cells, and then detecting cell viability using the CCK-8 assay after 48 hours. The cells tested included: mouse cells—MC-38, Hepa1-6, and LLC.
[0363] The specific detection method is the same as that in Example 1, and will not be repeated here. The results are shown in Table 4 and Figures 16-18.
[0364] As shown in Table 4, when the above-mentioned recombinant oncolytic virus infects tumor cells with an MOI greater than 0.1, its inhibitory effect on Hepa1-6 cells is weak, but its killing efficiency on other tumor cells can reach more than 50%. This shows that the above-mentioned recombinant oncolytic virus alone has a good killing effect on most tumor cells.
[0365] Example 4
[0366] In this embodiment, the recombinant oncolytic virus (VSV-M(3)-aPD-L1-aCD3 monotherapy) carrying the aPD-L1-aCD3 single-chain antibody provided in Preparation Example 3 was used in combination with PBMC cells to conduct a tumor cell killing efficiency test.
[0367] The specific method is as follows:
[0368] (1) 2×10 4 A549 cells were seeded in 96-well plates and cultured overnight in a cell culture incubator at 37°C and 5% CO2.
[0369] (2) Infect and add PBMC cells according to the grouping in Table 5.
[0370] (3) Recombinant oncolytic virus was used to infect PBMC cells at an MOI of 0.1. The ratio of effector cells to target cells was 5:1. The corresponding recombinant oncolytic virus and PBMC cells were diluted together to a final volume of 100 μl of 2% FBS F12K medium. The corresponding 96-well A549 cells were then added. The remaining wells were supplemented with 100 μl of 2% FBS F12K medium. Microscopic observation was performed every 4 hours starting from the 14th hour after infection.
[0371] (4) CCK-8 reagent was added 25 h after infection, and the tumor cell killing efficiency was detected. The results are shown in Table 5 and Figures 19-20.
[0372] Table 5. Experimental results of the killing efficiency of the recombinant oncolytic virus combined with other cells against tumor cells provided in this application.
[0373] Example 5
[0374] In this embodiment, the recombinant oncolytic virus (VSV-M(42)-aPD-L1-aCD16 monotherapy) carrying the aPD-L1-aCD16 single-chain antibody provided in Preparation Example 4 was used in combination with NK510 cells to test the killing efficiency of tumor cells.
[0375] The specific method is as follows:
[0376] (1) Resuscitate A549-EGFP and NK cells, culture them for two generations, and then conduct experiments.
[0377] (2) Cell plating: When the confluence of A549-EGFP cells was observed to be 80-90% and the cells were in good growth condition under a microscope, the cells were digested and counted, and the cell density was adjusted to 1×10⁶. 5 Cells / ml, 100μl / well, add the cell suspension to the 96-well plate using a pipette, and incubate overnight at 37°C for 16-24 hours in a CO2 incubator.
[0378] (3) Virus dilution: In a 1.5 ml EP tube, take 100 μl of the virus stock solution and add it to 900 μl of 2% FBSDMEM medium and mix well. Perform 10-fold serial dilutions in a total of 6 gradients (MOIs corresponding to infected cells are 100, 10, 1, 0.1, 0.01, and 0.001).
[0379] (4) Group experiments were conducted according to Table 4, with effector cells: target cells = 5:1. NK cells and recombinant oncolytic virus were added to incubate A549 cells.
[0380] (5) Virus inoculation: Discard the cell supernatant in the 96-well plate and inoculate the virus dilution into the 96-well cell culture plate. Inoculate one column of 8 wells for each dilution, and inoculate 100 μl in each well. Set up one column of normal cells as a control group.
[0381] (6) NK510 cell seeding: Resuspend 10 times the required number of NK510 cells in 1 ml of 2% FBSDMEM medium and seed them into the 96-well cell culture plates corresponding to the table. Seed 100 μl per well. If no NK cells are needed, add 100 μl of medium to supplement.
[0382] (7) Cell fluorescence intensity was detected at 24h and 48h. The cell growth inhibition rate was calculated as 1 - (fluorescence intensity of the drug-treated group ÷ fluorescence intensity of the control group). The results are shown in Table 5 and Figure 21.
[0383] As shown in Table 5 and related figures, the killing effect of VSV-M(42)-aPD-L1-aCD16 on tumor cells is positively dose-dependent. At the same time, the combined effect of VSV-M(42)-aPD-L1-aCD16 and NK cells is much higher than the effect of VSV-M(42)-aPD-L1-aCD16 alone, and also higher than the effect of NK cells alone. This indicates that the bispecific antibody expressed by VSV-M(42)-aPD-L1-aCD16 can promote the bridging between tumor cells and NK cells and activate the tumor killing activity of NK cells.
[0384] The above results demonstrate that the recombinant oncolytic virus carrying a bispecific single-chain antibody gene or a trispecific single-chain antibody gene provided in this application has a significant inhibitory effect on tumor growth. Furthermore, by expressing bispecific or trispecific single-chain antibody genes, the recombinant oncolytic virus not only promotes the contact between tumor cells and effector cells but also stimulates the activity of effector cells, thereby enhancing the tumor-killing effect of immune cells. Its efficacy is far superior to that of oncolytic viruses or immune cells used alone.
[0385] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.
Claims
A recombinant oncolytic virus expressing bispecific or trispecific single-chain antibodies, characterized in that, The recombinant oncolytic virus includes an antibody gene integrated into its viral backbone; The antibody gene includes a target antibody gene that targets tumor cells and at least one antibody gene that targets immune cells. The recombinant oncolytic virus according to claim 1 is characterized in that, The immune cells are selected from any one or two of T cells, NK cells, and macrophages. The recombinant oncolytic virus according to claim 1 is characterized in that, When the immune cell is a T cell, the antibody gene targeting the immune cell is selected from any one or two of the following (a)-(b): (a) CD3 antibody gene; (b) T cell-associated immune checkpoint antibody genes. The recombinant oncolytic virus according to claim 3 is characterized in that, The T-cell-related immune checkpoint antibody genes include inhibitor antibody genes and agonist antibody genes; The inhibitor antibody gene is selected from any one or two of CTLA-4, PD-1, TIM3, BTLA, VISTA, and LAG3; The agonist antibody gene is selected from any one or two of CD28, OX40, CD27, CD30, CD40, GITR, ICOS, 4-1BB, LIGHT, and CD28H. The recombinant oncolytic virus according to claim 1 is characterized in that, When the immune cell is an NK cell, the antibody gene targeting the immune cell is selected from any one or two of CD16a, NKG2D, CD94 / NKG2C, NKp30, NKp44, and NKp46. The recombinant oncolytic virus according to claim 1 is characterized in that, When the immune cell is a macrophage, the antibody gene targeting the immune cell is the SIRPα antibody gene. The recombinant oncolytic virus according to claim 1 is characterized in that, The recombinant oncolytic virus includes any one or more of the following: rod-shaped virus, poxvirus, herpes simplex virus, measles virus, Semlikie Forest virus, poliovirus, reovirus, Seneca Valley virus, echovirus, Coxsackie virus, Newcastle disease virus, and Malaba virus. The recombinant oncolytic virus according to claim 1 is characterized in that, The recombinant oncolytic virus is a vesicular stomatitis virus. The recombinant oncolytic virus according to claim 8 is characterized in that, The vesicular stomatitis virus includes M protein, G protein, N protein, P protein, and L protein; Compared with the amino acid sequence shown in SEQ ID NO 1, 1) The amino acid substitutions of the M protein include G21E and N32S; 2) The amino acid substitutions of the M protein include G21E, N32S, and M33A; 3) The amino acid substitutions of the M protein include G21E, N32S, M33A, and N49D; 4) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, and H54Y; 5) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, H54Y, and L111A; 6) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, H54Y, L111A, and A133T; 7) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, H54Y, L111A, A133T, and V225I; 8) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, and V225I; 9) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, and V225I; 10) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 11) The amino acid substitutions of the M protein include N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 12) The amino acid substitutions of the M protein include M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 13) The amino acid substitutions of the M protein include N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 14) The amino acid substitutions of the M protein include M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 15) The amino acid substitutions of the M protein include H54Y, L111A, A133T, V221F, V225I, and S226R; 16) The amino acid substitutions of the M protein include L111A, A133T, V221F, V225I, and S226R; 17) The amino acid substitutions of the M protein include A133T, V221F, V225I, and S226R; 18) The amino acid substitutions of the M protein include V221F, V225I, and S226R; 19) The amino acid substitutions of the M protein include V225I and S226R; 20) The amino acid substitutions of the M protein include S226R; 21) The amino acid substitutions of the M protein include N32S, N49D, H54Y, and V225I; 22) The amino acid substitutions of the M protein include N32S, N49D, H54Y, V225I, and S226G; 23) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; 24) The amino acid substitutions of the M protein include N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; 25) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; 26) The amino acid substitutions of the M protein include N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; 27) The amino acid substitutions of the M protein include G21E, N32S, N49D, M51A, H54Y, L111A, V225I, and S226R; 28) The amino acid substitutions of the M protein include M51R, V221F, and S226R; 29) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, knocking out the base encoded by leucine at position 111, V221F, V225I, and S226R. 30) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, L111A, V221F, V225I, and S226R; 31) The amino acid substitutions of the M protein include G21E, N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; 32) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; 33) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; Compared with the amino acid sequence shown in SEQ ID NO 4, the site mutations of the G protein include any one or more of H38Y, V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; Compared with the amino acid sequence shown in SEQ ID NO 7, the site mutation of the N protein includes any one or more of I14V, R155K, and S353N; Compared with the amino acid sequence shown in SEQ ID NO 9, the site mutations of the P protein include any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D; Compared with the amino acid sequence shown in SEQ ID NO 11, the site mutations of the L protein include any one or more of S87P, I397T, I487T, and F873L. The recombinant oncolytic virus according to claim 1 is characterized in that, The recombinant oncolytic virus includes M protein, G protein, N protein, P protein and L protein; The M protein comprises an amino acid sequence as shown in any one of SEQ ID NO 2-3; The G protein comprises an amino acid sequence as shown in any one of SEQ ID NO 5-6; The N protein contains the amino acid sequence shown in SEQ ID NO 8; The P protein contains the amino acid sequence shown in SEQ ID NO 10; The L protein comprises an amino acid sequence as shown in any one of SEQ ID NO 12-14. The recombinant oncolytic virus according to claim 1 is characterized in that, The injection methods for the recombinant oncolytic virus include, but are not limited to, any one or more of the following: intratumoral injection, intravenous injection, intraperitoneal injection, intrapleural injection, pelvic injection, subcutaneous injection, intrathecal injection, intramuscular injection, and intranasal administration. The recombinant oncolytic virus according to claim 1 is characterized in that, The antibody expressed by the target antibody gene targeting tumor cells or the antibody gene targeting immune cells is the complete sequence or a partial sequence of the antibody. The recombinant oncolytic virus according to claim 1 is characterized in that, The target antibody genes targeting tumor cells include genes for anti-hematologic tumor antigens and antibodies and genes for anti-solid tumor antigens and antibodies. The recombinant oncolytic virus according to claim 13 is characterized in that, The solid tumor antigens mentioned include, but are not limited to, 5T4, ROR1, EGFR, FcγRI, FcγRIIa, FcγRIIb, CD24, CD28, CD137, CTLA-4, HER2, HER3, FAS, LGR5, C5aR1, A2AR, FGFR1, FGFR2, FGFR3, FGFR4, GITR, LTβR, TRAIL receptor 1, TRAIL receptor 2, PSMA, PSCA, CAIX, EGFR1, EGFRvIII, folate receptor, liver glycoprotein receptor, PDGFRa, ErbB2, ErbB3, CD2, CD40, CD74, CCAM5, CCA M6, p53, cMET, HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE- 3. GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MMC2, β-cadherin, GDF8, Cripto, MMC5AC, PRAME, P15, RM1, RM2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MMM-1, MMM-2, MMM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / A ML, LDLR / FΜT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, DR5, PD-1, PD-L1, IGF-1R, CXCR4, NRP-1, GPC2, GPC3, EphA2, B7-H3, B7-H4, gpA33, SSTR 2. GD2, VEGF-A, VEGFR-2, PDGFR-a, RANKL, MSLNTROP2, FOLR1, AXL, CLDN18.2, MMC1, TPBG, CEA, EpCAM, Nectin-4, CD39, CD73, CD44, DLL3, CLDN18.
1. KAT6A / B, PI3K, c-Kit, TRBCI; CLDN6, TYRP1, Ras, MOSPD2, HLA-A, HLA-G, HLA class II, CDH3, CDH17, CDH19, ENPP3, LILRB4, STEAP1, TrkB, oxMIF, P95HER2, CD133, LRRC15, TMEFF2, Sμrvivin, KLK2, Siglec-6, Heme Oxygenase, DLK1, CACNA1G-AS1, TSPAN8, GC-C, ETA, LY6G6D, P53 R175H, NCR3LG1, ADAM17, DLL1, GCP2, CEACAM5, mesothelin; the hematologic tumor antigens include, but are not limited to, BCMA, CD5, CD7, CD10, FcγRIIIa, FcγRIIIb, CD19, CD20, CD22, CD30, CD33, CD34, CD37, CD38, CD47, CD56, CD70, CD123, CD138, CLL-1, ROR1, NKG2DL1 / 2, FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, SLAMF7, TCR B-chain, ITGB7, TACI, CD79b, EBV. The recombinant oncolytic virus according to claim 1 is characterized in that, When the antibody gene includes a target antibody gene that targets tumor cells and an antibody gene that targets immune cells, the antibody gene is a bispecific antibody; The arrangement of the target antibody gene targeting tumor cells and the antibody gene targeting immune cells is as follows: N-target antibody gene-C+Linker+N-target immune cell antibody gene-C; Alternatively, N-targeting immune cell antibody gene-C+Linker+N-targeting antibody gene-C. The recombinant oncolytic virus according to claim 15 is characterized in that, The antibody gene is aPD-L1-aCD3, the gene sequence of which includes the nucleotide sequence shown in SEQ ID NO 15, and the amino acid sequence of which includes the amino acid sequence shown in SEQ ID NO 16. The recombinant oncolytic virus according to claim 15 is characterized in that, The antibody gene is aPD-L1-aCD16, the gene sequence of which includes the nucleotide sequence shown in SEQ ID NO 17, and the amino acid sequence of which includes the amino acid sequence shown in SEQ ID NO 18. The recombinant oncolytic virus according to claim 1 is characterized in that, When the antibody gene includes a target antibody gene that targets tumor cells and two antibody genes that target immune cells, the antibody gene is a trispecific antibody; The arrangement of the target antibody gene targeting tumor cells and the antibody gene targeting immune cells is selected from any of the following: (1) N-target antibody gene-C+Linker+N-antibody gene-C+Linker+N-antibody gene-C targeting T cells; (2) N-target antibody gene-C+Linker+N-target NK cell antibody gene-C+Linker+N-target T cell antibody gene-C; (3) N-targeting T cell antibody gene-C+Linker+N-targeting NK cell antibody gene-C+Linker+N-target antibody gene-C; (4) N-targeting T cell antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting NK cell antibody gene-C; (5) N-targeting NK cell antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting T cell antibody gene-C; (6) N-targeting NK cell antibody gene-C+Linker+N-targeting T cell antibody gene-C+Linker+N-targeting antibody gene-C; (7) N-target antibody gene-C+Linker+N-antibody gene-C+Linker+N-antibody gene-C targeting T cells; (8) N-target antibody gene-C+Linker+N-antibody gene-C+Linker+N-antibody gene-C targeting macrophages; (9) N-targeting T cell antibody gene-C+Linker+N-targeting macrophage antibody gene-C+Linker+N-target antibody gene-C; (10) N-targeting T cell antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting macrophage antibody gene-C; (11) N-targeting macrophage antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting T cell antibody gene-C; (12) N-targeting macrophage antibody gene-C+Linker+N-targeting T cell antibody gene-C+Linker+N-targeting antibody gene-C; (13) N-target antibody gene-C+Linker+N-antibody gene-C+Linker+N-antibody gene-C targeting macrophages; (14) N-target antibody gene-C+Linker+N-target NK cell antibody gene-C+Linker+N-target macrophage antibody gene-C; (15) N-targeting macrophage antibody gene-C+Linker+N-targeting NK cell antibody gene-C+Linker+N-target antibody gene-C; (16) N-targeting macrophage antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting NK cell antibody gene-C; (17) N-targeting NK cell antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting macrophage antibody gene-C; (18) N-targeting NK cell antibody gene-C+Linker+N-targeting macrophage antibody gene-C+Linker+N-targeting antibody gene-C. The recombinant oncolytic virus according to claim 18 is characterized in that, The antibody gene is aPD-L1-aCD3-aCD16, the gene sequence of which includes the nucleotide sequence shown in SEQ ID NO 19, and the amino acid sequence of which includes the amino acid sequence shown in SEQ ID NO 20. The recombinant oncolytic virus according to claim 1 is characterized in that, The recombinant oncolytic virus is used to continuously kill abnormal cells. The recombinant oncolytic virus according to claim 20 is characterized in that, The abnormal cells are selected from tumor cells or related cells of tumor tissue. The recombinant oncolytic virus according to claim 21 is characterized in that, The tumors include solid tumors or hematologic malignancies. The recombinant oncolytic virus according to claim 21 is characterized in that, The tumors mentioned include, but are not limited to, acute lymphoblastic leukemia, acute B-lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-Hodgkin's lymphoma, anal cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma, sensory neuroblastoma, Ewing sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumors, and hepatocellular carcinoma. Cancer, hypopharyngeal cancer, Kaposi's sarcoma, kidney cancer, Langerhans cell carcinoma, laryngeal cancer, liver cancer, lung cancer, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary adenoma, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous neck cancer, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and vascular tumors. A composition, characterized in that, The composition comprises the recombinant oncolytic virus of claim 1.