Small-fragment RNA derived from circular RNA and use thereof in treatment of diabetic vascular diseases
Patent Information
- Application Number
- PCT/CN2025/142652
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-16
- Filing Date
- 2025-12-15
- Publication Date
- 2026-06-25
Smart Images

Figure CN2025142652_25062026_PF_FP_ABST
Abstract
Description
A small fragment RNA derived from circular RNA and its application in the treatment of diabetic vascular diseases. Technical Field
[0001] This invention relates to the field of nucleic acid drug technology, and in particular to a small fragment RNA derived from circular RNA and its application in the treatment of diabetic vascular diseases. Background Technology
[0002] Diabetes mellitus is a metabolic syndrome characterized by hyperglycemia caused by various etiologies. Its chronic complications involve large and small blood vessels throughout the body, affecting the function of multiple organs such as the heart, kidneys, and eyes. Diabetic vascular disease is a common complication and a leading cause of death in diabetic patients. It includes two types of progressive vascular complications, which can occur simultaneously or individually. Diabetic macrovascular disease is characterized by atherosclerotic lesions in the coronary and peripheral arterial circulation, such as coronary artery disease (CAD), cerebrovascular disease, and peripheral vascular disease (PAD). Reducing cardiovascular events is an important goal in preventing and treating complications in diabetic patients. However, current treatments for diabetic vascular complications are not entirely effective. In-depth research into the molecular regulatory mechanisms of diabetic vascular complications and the development of novel diagnostic and therapeutic targets and drugs are urgent clinical needs.
[0003] The vascular endothelium is the continuous intima within the vascular system, responsible for maintaining vascular tone, angiogenesis, and hemostasis, and providing an antioxidant, anti-inflammatory, and antithrombotic surface. Studies have shown that in diabetes, high glucose and inflammatory responses stimulate endothelial cells to release a series of growth factors and cytokines. Under the stimulation of these cytokines and metabolic factors, vascular endothelial cells exhibit a characteristic transformation into mesenchymal cells, known as endothelial-mesenchymal transition (EndoMT). This transition leads to significant changes in endothelial cell polarity, morphology, and function, ultimately resulting in endothelial dysfunction and participating in the occurrence and development of diabetic vascular complications. EndoMT may be an early event in diabetic vascular complications and plays a crucial role in the development and progression of diabetic vascular diseases, suggesting that EndoMT may be a promising target for the prevention and treatment of macrovascular complications in diabetes.
[0004] Small RNA fragments (ncRNAs) are a type of endogenous noncoding RNA, widely and abundantly present in organisms in various forms. ncRNA drugs have inherent advantages in the treatment of chronic diseases: 1) ncRNA drugs directly regulate upstream gene expression, making them relatively less prone to drug resistance; 2) ncRNA drugs have relatively long-lasting effects, significantly reducing the frequency of administration, which has great clinical value for the treatment of many chronic diseases. A study analyzing a large health insurance company database explored the relationship between medication adherence and cardiovascular disease, showing that the incidence of all-cause mortality, myocardial infarction, stroke, or coronary revascularization surgery was closely related to medication adherence. Therefore, the long-lasting effects and low risk of drug resistance associated with ncRNA drugs have led the industry to gradually recognize that ncRNA and other nucleic acid drugs represent a new direction for future cardiovascular disease treatment research.
[0005] Previous studies in this project have demonstrated that a circular RNA derived from the Ube3a gene inhibits EndoMT, making it a promising candidate drug for treating diabetic vascular complications. However, the main bottleneck in the application of this circRNA nucleic acid drug lies in the high technical barrier of its artificial transcriptional synthesis and amplification, as well as the difficulty in degradation of long fragments. Therefore, optimizing its sequence to achieve more effective vascular protection and greater stability holds promise for opening up new avenues for the treatment of diabetic vascular diseases and providing patients with more effective treatment options. This is of great significance for reducing the incidence of diabetic vascular diseases, significantly improving patients' quality of life, and prolonging their lifespan. Summary of the Invention
[0006] To address the aforementioned problems in the prior art, this invention provides a small fragment RNA derived from circular RNA, which has a good effect on protecting and maintaining the biological function of vascular endothelial cells, and has good structural stability, a long half-life in vivo, and advantages such as low effective concentration and high biosafety. It has good application potential in the field of clinical nucleic acid drug development and provides a new approach for the treatment of chronic progressive vascular disease caused by diabetes.
[0007] To achieve the above objectives, the present invention is specifically implemented through the following technical solutions:
[0008] This invention provides a small fragment RNA derived from circular RNA, with the nucleotide sequence CUAGCCGAAUGUUAAAAAAU.
[0009] A second aspect of the present invention provides a DNA molecule that encodes a small fragment of RNA derived from circular RNA as described above.
[0010] A third aspect of the present invention provides a recombinant expression vector containing the DNA molecule described above.
[0011] A fourth aspect of the present invention provides a host cell containing a small fragment of RNA derived from a circular RNA as described above, a DNA molecule as described above, or a recombinant expression vector as described above.
[0012] The host cell can be an endothelial cell, specifically a human umbilical vein endothelial cell.
[0013] The fifth aspect of the present invention provides the use of the small RNA fragments described above in the preparation of medicaments for the prevention and / or treatment of diabetic vascular diseases.
[0014] The sixth aspect of the present invention provides a medicament for the prevention and / or treatment of diabetic vascular disease, wherein the active ingredient of the medicament is a small fragment RNA derived from circular RNA as described above.
[0015] Furthermore, the drug also includes a delivery vector for delivering small fragments of RNA into cells or the body, including viral vectors or nanoliposomes.
[0016] Furthermore, the diabetic vascular diseases include, but are not limited to: 1) diabetic microvascular diseases, such as diabetic nephropathy and diabetic cardiac microvascular diseases; 2) diabetic macrovascular diseases, such as diabetic coronary artery disease, diabetic cerebrovascular disease and diabetic peripheral artery disease.
[0017] Furthermore, the concentration of the small RNA fragment in the drug is 1-50 nM.
[0018] The advantages and positive effects of this invention are as follows:
[0019] 1. The novel circular RNA-derived short fragment RNA provided by this invention has convenient synthesis and enhanced pharmacodynamic activity. It can significantly reduce the damage of AGEs to endothelial cells, enhance cell vitality, and significantly inhibit the transformation of endothelial cells into mesenchymal cells. This is beneficial for protecting and maintaining the biological function of vascular endothelial cells, thereby playing a cardiovascular protective role and preventing and / or treating diabetic vascular diseases.
[0020] 2. The novel circular RNA-derived small fragment RNA provided by this invention has a significant effect within 24 hours and can last for at least 48 hours. It has a long half-life in vivo and also has the advantages of low effective concentration and high biosafety. It has good application potential in the field of clinical nucleic acid drug development and provides a new approach for the treatment of chronic progressive vascular disease caused by diabetes. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below.
[0022] Figure 1 is a schematic diagram of the secondary structure of a functional small fragment RNA according to an embodiment of the present invention;
[0023] Figure 2 shows the relative survival rate of endothelial cells after AGEs treatment 24h / 48h after transfection with hsa_circ_0103211-JP(1-5) in the embodiment of the present invention.
[0024] Figure 3 shows the effect of hsa_circ_0103211-JP (1-5) transfection for 24 h followed by AGEs treatment for 24 h on the expression levels of relevant marker proteins during endothelial cell mesenchymal transition. In Figure 3, Figure A is an electrophoresis gel image of the expression of relevant markers, and Figure B is a bar chart of the relative levels of the expression of relevant markers.
[0025] Figure 4 shows the effect of hsa_circ_0103211-JP(1-5) transfection for 24 h followed by AGEs treatment for 48 h on the expression levels of relevant marker proteins during endothelial cell mesenchymal transition. In Figure 4, Figure A is an electrophoresis gel image of the expression of relevant markers, and Figure B is a bar chart of the relative levels of the expression of relevant markers. Detailed Implementation
[0026] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.
[0027] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.
[0028] To better understand the invention and not to limit its scope, all figures and other numerical values used herein to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "about." The term "about" has its usual meaning as indicating that a value includes the inherent variation in error of the equipment or method used to determine that value, or contains a value close to said value, for example, within 10% of said value (or a range of values). Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values and may vary depending on the desired properties being sought.
[0029] The terms “comprising,” “including,” “containing,” “having,” and similar words are non-restrictive and can include other steps and other components that do not affect the result. The term “and / or” should be considered as a specific disclosure of each of the two specified features or components, with or without the other. For example, “A and / or B” would be considered to include (i) A, (ii) B, and (iii) A and B.
[0030] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the present invention will be described in detail below with reference to the accompanying drawings.
[0031] Under high glucose and inflammatory conditions, diabetic patients typically accumulate high levels of advanced glycation end products (AGEs). The effects of AGEs on vascular health are mainly manifested in the following ways: (1) AGEs can bind to their receptors (such as RAGE), activating oxidative stress and inflammatory responses. This leads to endothelial cell damage and dysfunction, promoting the occurrence and development of atherosclerosis; (2) The accumulation of AGEs leads to cross-linking and stiffening of vascular wall proteins, increasing vascular stiffness and reducing vascular elasticity. This is an important reason why diabetic patients are prone to atherosclerosis and hypertension; (3) AGEs can directly damage vascular endothelial cells, reducing their ability to resist coagulation and regulate vascular tone, which increases the risk of thrombosis, leading to cardiovascular events such as myocardial infarction and stroke; (4) AGEs can alter the structure of the extracellular matrix, promoting smooth muscle cell proliferation and migration, leading to vascular remodeling. This vascular remodeling is an important factor leading to peripheral artery disease in diabetic patients; (5) The accumulation of AGEs in microvessels leads to microvascular complications, such as diabetic retinopathy and diabetic nephropathy. These microvascular complications are the main cause of serious complications of diabetes; (6) AGEs can activate monocytes and macrophages, increase the production of inflammatory factors, and this persistent inflammatory state can further damage blood vessels, increasing the risk of atherosclerosis and thrombosis. Therefore, AGEs play a crucial role in diabetic vascular diseases, damaging vascular health through multiple mechanisms and increasing the risk of cardiovascular events and microvascular complications.
[0032] The interaction between AGEs and their receptor RAGE induces EndoMT, a significant factor contributing to the aforementioned risks. EndoMT refers to the process by which endothelial cells lose their original characteristics and transform into mesenchymal cells under the influence of various stimuli. To acquire the mesenchymal phenotype, endothelial cells suppress the expression of endothelial-specific markers, such as downregulation of vascular endothelial cadherin (E-Cadherin), platelet-endothelial cell adhesion molecule (Pecam-1 / CD31), and vascular endothelial growth factor (VEGFR), and upregulate the expression of mesenchymal markers, such as upregulation of α-smooth muscle actin (α-SMA), type I and type III collagen, and fibroblast-specific protein 1 (FSP1). This transformation leads to significant changes in endothelial cell polarity, morphology, and function. When endothelial cells undergo EndoMT (Endotransformation Metastasis), these cells, after transforming into mesenchymal cells, gain stronger migration and proliferation capabilities. They can migrate to the subendothelial layer of blood vessels, secreting extracellular matrix components (ECM). The resulting fibrous basement membrane thickens and hardens the vessel wall, narrows the lumen, reduces vascular elasticity, and weakens diastolic function, leading to arteriosclerosis and exacerbating hemodynamic changes. Furthermore, the disruption of tight junctions and adhesion junctions in endothelial cells loosens the connections between them, increasing vascular permeability and impairing barrier function. This allows plasma components and inflammatory cells to more easily leak out of the blood vessels, triggering an inflammatory response and worsening the disease. Simultaneously, EndoMT alters the anticoagulant and fibrinolytic properties of endothelial cells, enhancing platelet adhesion and increasing the likelihood of thrombosis. The EndoMT process also triggers vascular inflammation; the transformed cells can secrete various inflammatory factors, such as IL-1β and TNF-α. The inflammatory activation of endothelial cells further exacerbates the aforementioned processes, creating a vicious cycle.
[0033] Numerous studies have confirmed that EndoMT is a key initiating factor in the development of various cardiovascular diseases (CVDs) and an early event in diabetic vascular complications, closely linked to the occurrence and progression of diabetes-related cardiovascular diseases. Therefore, inhibiting the progression of EndoMT may have potential therapeutic effects in the treatment of diabetic vascular diseases, and is of great significance for the prevention and treatment of diabetic vascular diseases.
[0034] Our previous research (see: Zhou Weiping. Effects and Mechanisms of mm9_circ_010056 on Diabetes-Induced Endostromal Transformation [D]. Hubei: Wuhan University of Science and Technology, 2019.) also confirmed the occurrence of EndoMT in the aorta of diabetic mice. This literature also observed downregulation of mm9_circ_010056 expression in the aortic endothelial layer of type 2 diabetes mellitus (T2DM) mouse models at different ages. Furthermore, by treating mouse aortic endothelial cells (MAEC cells) with exogenous AGEs to establish a T2DM cell model, the results showed that AGEs inhibited mm9_circ_010056 expression in a concentration- and time-dependent manner. Interference with mm9_circ_010056 levels promoted the occurrence of EndoMT in cells, while overexpression inhibited AGEs-induced EndoMT, thus potentially inhibiting the progression of diabetic vascular disease. These results suggest that mm9_circ_010056 participates in regulating the diabetes-induced EndoMT process and is a candidate drug and intervention target for the treatment of diabetic vascular diseases. mm9_circ_010056 originates from the murine Ube3a gene, with a genomic location of chr7:66496336-66502587 and a length of 6252 bp. Its nucleotide sequence can be found in the circBase database ID: mmu_circ_0001572. In humans, there is an RNA molecule highly homologous to mm9_circ_010056—CircUBE3a (hsa_circ_0103211), which shares the same parental gene Ube3a as mm9_circ_010056. Human hsa_circ_0103211 possesses the same biological and pathological functions as murine mm9-circ-010056 in humans. hsa_circ_0103211 is located at chr15:25599499-25657118 in the genome, with a length of 57620bp. The nucleotide sequence can be found in the circBase database ID: hsa_circ_0103211.
[0035] Due to the large length of hsa_circ_0103211, its in vivo delivery efficiency is low and its stability is insufficient, making it difficult to use clinically for treatment. Therefore, this invention synthesizes multiple small RNA fragments based on the junction part (JP) sequence of hsa_circ_0103211, named hsa_circ_0103211-JP. The screening and evaluation methods are described in the literature "Yuan, Q., Sun, Y., Yang, F. et al. CircRNA DICAR as a novel endogenous regulator for diabetic cardiomyopathy and diabetic pyroptosis of cardiomyocytes. Sig Transduct Target Ther 8, 99 (2023). https: / / doi.org / 10.1038 / s41392-022-01306-2". hsa_circ_0103211-JP possesses a unique stem-loop structure and is the core functional fragment for hsa_circ_0103211 to exert its function.
[0036] To verify the biological function of hsa_circ_0103211-JP in inhibiting EndoMT and its therapeutic effect on diabetic vascular diseases, this invention first used the RNAfold software tool for predicting RNA secondary structure to analyze the secondary structure and structural stability of sequences, eliminated sequences with unreasonable spatial conformations, and screened out 5 novel small RNA fragments containing "CUAGCCGAAUGUUAAAAAAU". Then, the pharmacodynamics of these 5 sequences were evaluated. Specifically, advanced glycation end products (AGEs) were used to treat damaged endothelial cells to simulate the vascular damage process induced by diabetes. AGEs-treated endothelial cells were treated with hsa_circ_0103211-JP (1-5), and endothelial cell viability was tested by CCK8 assay. It was found that hsa_circ_0103211-JP (1) could reduce the damage of AGEs to endothelial cells and enhance cell viability, which is beneficial for protecting endothelial cells. Furthermore, treatment with hsa_circ_0103211-JP(1) significantly enhanced the expression of endothelial markers E-cadherin and CD31, and inhibited the expression of mesenchymal cell markers SNAIL and SLUG, demonstrating a good inhibitory effect on EndoMT.
[0037] The above results indicate that the novel small RNA fragment hsa_circ_0103211-JP(1) provided after screening and optimizing the junction site sequence of hsa_circ_0103211 has enhanced pharmacodynamic activity. It can maintain the biological function of vascular endothelial cells by protecting endothelial cells and inhibiting endothelial-mesenchymal transition, thereby exerting a cardiovascular protective effect and playing a role in the prevention and / or treatment of diabetic vascular diseases. In addition, the hsa_circ_0103211-JP(1) provided by this invention has a small molecular weight, which can be efficiently transfected into cells using conventional nanoliposomes. Moreover, hsa_circ_0103211-JP(1) has good structural stability, and its efficacy is obvious at 24 hours and can last for at least 48 hours. It has a long half-life in vivo and also has the advantages of low effective concentration and high biosafety. It has good application potential in the field of clinical nucleic acid drug development and provides a new idea for the treatment of chronic progressive vascular diseases caused by diabetes.
[0038] Based on this, embodiments of the present invention provide a small RNA fragment, the nucleotide sequence of which is shown below:
[0039] CUAGCCGAAUGUUAAAAAAU (see SEQ ID NO.1).
[0040] In practical applications, when the small RNA fragment of the present invention or DNA molecules or recombinant expression vectors capable of expressing the small RNA fragment are used as active ingredients in drugs for the treatment of diabetic vascular diseases, and when the drug is formulated into a liquid preparation or an intravenous injection formulation, the concentration of the small RNA fragment is 1-50 nM, preferably 30-50 nM.
[0041] Drugs typically also include delivery vectors, such as viral vectors and nanoliposomes, for delivering small RNA fragments into cells or the body. Of course, microinjection or gene gun targeting techniques can also be used to directly deliver small RNA fragments into cells or the body. This invention does not impose any particular limitations on these methods.
[0042] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments, unless otherwise specified, are generally performed according to the conditions recommended by the manufacturer. Unless otherwise specified, the materials, reagents, etc., used in the following embodiments are commercially available.
[0043] Example
[0044] Based on the junction part (JP) sequence in the full-length hsa_circ_0103211 sequence, this embodiment synthesized several structurally optimized small fragment RNAs—hsa_circ_0103211-JP. The optimized sequences were screened using the software tool RNAfold, which predicts RNA secondary structure. Based on the stability of the secondary structure and nucleic acid sequence structure, sequences with unreasonable spatial conformations were eliminated, and five candidate sequences were selected: hsa_circ_0103211-JP (1), hsa_circ_0103211-JP (2), hsa_circ_0103211-JP (3), hsa_circ_0103211-JP (4), and hsa_circ_0103211-JP (5). The specific nucleotide sequences are shown in Table 1. Figure 1 shows the secondary structure of hsa_circ_0103211-JP (1-5).
[0045] Table 1. Nucleotide sequences of candidate sequences in this embodiment.
[0046]
[0047] In diabetic patients, the persistent hyperglycemia leads to the accelerated accumulation of advanced endothelial cells (AGEs), which are also a clinical biomarker for diagnosing diabetes. AGEs can bind to receptors on the surface of endothelial cells (RAGEs), activating a series of intracellular signaling pathways, resulting in inflammatory responses and oxidative stress, damaging endothelial cells, and causing endothromboembolism (EndoMT). Therefore, this embodiment uses exogenous administration of AGEs to human umbilical vein endothelial cells to establish a diabetic vascular endothelial injury model to simulate the process of diabetes-induced vascular lesions.
[0048] Human umbilical vein endothelial cells (HUVECs) (purchased from Zhejiang Meisen Cell Technology Co., Ltd., sourced from CTCC) were cultured in ECM endothelial cell culture medium (containing ECGS, FBS and P / S solution, purchased from ScienCell, catalog number ScienCell-1001) at 37°C in an incubator containing 5% CO2.
[0049] The optimal concentration and duration of endothelial cell-to-mesenchymal transition (EMT) were determined by adding different concentrations (100 μg / mL, 200 μg / mL, and 200 μg / mL) of advanced glycolysis end products (AGEs, purchased from Bioss, catalog number bs-1158P) to the culture medium. The control group received no treatment. EndoMT is characterized by decreased expression of endothelial markers (such as E-Cadherin and CD31) and increased expression of mesenchymal markers (including SNAIL and SLUG).
[0050] The protein expression activity of relevant biomarkers was detected using Western blotting (WB). The WB experimental procedure was as follows: cells were washed twice with PBS, then lysed, centrifuged, and the supernatant protein was collected. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). After protein electrophoresis, the membrane was transferred at a constant current of 360 mA for 90 min. The membrane was then placed in an antibody incubation chamber, washed three times with TBST for 5 min each time, and blocked with rapid blocking buffer for 90 min. Afterwards, the membrane was incubated overnight at 4°C with SLUG primary antibodies against CD31, E-Cadherin, and SNAIL, respectively. The membrane was washed three times with TBST for 10 min each time. Then, the membrane was incubated with secondary antibody at room temperature for 50 min, followed by four times with TBST for 10 min each time. Signal detection was performed using enhanced chemiluminescence reagents, and the Western blot bands were quantitatively analyzed using ImageJ software. The mouse anti-CD31 antibody was purchased from Abcam, the rabbit anti-E-Cadherin antibody from CST (catalog number 3195S, catalog number ab9484), the rabbit anti-SNAIL antibody from Abcam (catalog number ab216347), and the rabbit anti-SLUG antibody from CST (catalog number 9585T). β-actin was used as an internal control protein, and its antibody was purchased from Proteintech (catalog number 66009-1-Ig). The secondary antibody was selected based on the species of the primary antibody: when the primary antibody was mouse, the secondary antibody was HRP-conjugated affinipure goat anti-mouse IgG (H+L) (purchased from Proteintech, catalog number SA00001-1); when the primary antibody was rabbit, the secondary antibody was HRP-conjugated affinipure goat Anti-Rabbit IgG (H+L) (Proteintech, catalog number SA00001-2).
[0051] The results showed that endothelial cells treated with AGEs (200 μg / mL, 48 h) exhibited a significant EndoMT phenomenon, with a significant decrease in the expression of endothelial markers E-Cadherin and CD31 compared to the control group, and a significant increase in mesenchymal markers SNAIL and SLUG. Therefore, in subsequent embodiments of the present invention, endothelial cells were treated with 200 μg / mL AGEs.
[0052] Experimental groups: (1) Control group without any treatment; (2) AGEs treatment group, treated with 200 μg / mL AGEs for 24 h or 48 h; (3) Negative control group (NC), HUVEC cells were transfected with 20 nM nonsense RNA, followed by treatment with 200 μg / mL AGEs for 24 h or 48 h; (4) Drug treatment group: HUVEC cells were transfected with 20 nM hsa_circ_0103211-JP (1-5), followed by treatment with AGEs (200 μg / mL, 24 h, 48 h). The nucleotide sequence of the nonsense RNA in the NC control group was: UUGUACUACACAAAAGUACUG.
[0053] Nucleic acid transfection methods: using Opti-MEM respectively ® Medium (25 μL) diluted with 2 μL cationic liposomes (Lipofectamine) ® RNAi MAX (purchased from Thermo Fisher Scientific, catalog number 13778-500) and hsa_circ_0103211-JP (1-5) and NC-RNA were mixed thoroughly and incubated at room temperature for 5 min. Lipofectamine was then added. ® The RNAi MAX and hsa_circ_0103211-JP complex was added at a rate of 25 μL / well to HUVEC cell culture medium in 96-well plates and cultured for 24 h. The complete culture medium was then replaced with serum-free ECM medium, and the cell cycle was synchronized for 2 h. Subsequently, HUVEC cells were treated with 200 μg / mL AGEs for 24 h and 48 h, and cell viability was measured.
[0054] The protective activity of different sequence treatments on endothelial cells was evaluated using the CCK8 assay. The steps included: washing cells twice with PBS under light-protected conditions, adding serum-free ECM medium containing CCK8 (CCK8:ECM = 1:9); incubating the wells in a cell culture incubator for 1 h, and then measuring the absorbance at 450 nm using a microplate reader. Cell viability (%) was calculated using the following formula:
[0055] Cell viability = [(A 450nm Experiment-A 450nm Blank)] / [(A 450nm Comparison-A 450nm [Blank], where blank refers to serum-free ECM culture medium.
[0056] Figure 2 shows the relative survival of endothelial cells in different treatment groups. The results showed that at 24 h, cells transfected with hsa_circ_0103211-JP(1) showed less loss of cell viability after AGEs treatment, with relative cell viability significantly higher than other groups, even approaching that of the untreated group, and still exhibited some protective effect at 48 h. hsa_circ_0103211-JP(1) showed better resistance to AGEs-induced endothelial cell damage than hsa_circ_0103211-JP(2-5).
[0057] The hsa_circ_0103211-JP(1-5) sequence was transfected into HUVEC cell models and treated for 24 h or 48 h, respectively. Cells were then starved for 2 h in serum-free medium, followed by treatment with 200 μg / mL AGEs for 48 h. After cell treatment, the expression of EndoMT-related proteins CD31, E-Cadherin, SNAIL, and SLUG was detected by Western blotting (WB), with β-actin as the internal control protein. The detection method was the same as above.
[0058] Endothelial cells undergo extensive gene expression reprogramming during EndoMT, with downregulation of endothelial markers E-Cadherin and CD31, and upregulation of stromal markers SNAIL and SLUG. Ultimately, endothelial cells acquire stromal cell characteristics through EndoMT: morphologically, they change from a flat, tightly connected morphology to a fibrous, migratory morphology; functionally, they transform from vascular endothelial barrier function to invasive and migratory stromal cells, thereby impairing endothelial cell function.
[0059] Figures 3-4 show the effects of hsa_circ_0103211-JP(1-5) transfection for 24 hours followed by AGEs treatment for 24 hours and 48 hours on the expression levels of CD31, E-Cadherin, SNAIL, and SLUG proteins, which are related markers in the mesenchymal transition of endothelial cells. (Figure A is an electrophoresis gel image of the expression of related markers, where "+" indicates corresponding treatment and "-" indicates no corresponding treatment. Figure B is a bar chart of the relative levels of related marker expression based on the gray values of the electrophoresis gel image in Figure A.) The aforementioned results show that human endothelial cells HUVECs treated with has_circ_0103211-JP(1) can significantly inhibit the expression of EndoMT-related proteins SNAIL and SLUG; indicating that hsa_circ_0103211-JP(1) has the ability to protect against vascular damage caused by diabetes by inhibiting EndoMT, and its effect is better than that of hsa_circ_0103211-JP(2-5).
[0060] In the above embodiments of the present invention, the statistical data were processed using Graphpad software and a one-way ANOVA was performed. ++++ p<0.0001, +++ p<0.0005 vs. Control; * p<0.05, ** p<0.01, *** p<0.005, **** p<0.0001 vs. AGEs+ NC.
[0061] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A small fragment RNA derived from circular RNA, characterized in that, The nucleotide sequence of the small RNA fragment is CUAGCCGAAUGUUAAAAAAU.
2. A DNA molecule, characterized in that, The DNA molecule encodes a small fragment of RNA derived from the circular RNA as described in claim 1.
3. A recombinant expression vector, characterized in that, The recombinant expression vector contains the DNA molecule as described in claim 2.
4. A host cell, characterized in that, The host cell contains a small fragment of RNA derived from the circular RNA as described in claim 1, a DNA molecule as described in claim 2, or a recombinant expression vector as described in claim 3.
5. The host cell according to claim 4, characterized in that, The host cell is an endothelial cell.