Piperidine alcohol derivatives modulating a nuclease

Piperidine alcohol derivatives are developed to inhibit TREX1, addressing autoinflammatory processes and chromosomal instability in diseases like Aicardi-Goutieres syndrome and cancers, offering therapeutic benefits.

WO2026132097A1PCT designated stage Publication Date: 2026-06-25MERCK PATENT GMBH +1

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
MERCK PATENT GMBH
Filing Date
2025-12-17
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

Current treatments for diseases associated with TREX1 gene mutations, such as Aicardi-Goutieres syndrome and certain cancers, lack effective modulators that can inhibit TREX1 activity to manage autoinflammatory processes and chromosomal instability.

Method used

Development of piperidine alcohol derivatives that act as modulators, particularly inhibitors, of TREX1 to treat diseases like Aicardi-Goutieres syndrome and cancers by regulating TREX1 expression.

Benefits of technology

The piperidine alcohol derivatives effectively inhibit TREX1, reducing autoinflammatory processes and chromosomal instability, providing therapeutic benefits for conditions like Aicardi-Goutieres syndrome and cancers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000004_0001
    Figure IMGF000004_0001
  • Figure IMGF000004_0002
    Figure IMGF000004_0002
  • Figure IMGF000006_0001
    Figure IMGF000006_0001
Patent Text Reader

Abstract

The present invention relates to compounds of formula (I) and stereoisomers, tautomers, N- oxides, and pharmaceutically acceptable salts thereof that are useful for modulating, preferably inhibiting three-prime repair exonuclease 1 (TREX1).
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Foreignfiling_text P24-264

[0002] 1

[0003] Piperidine alcohol derivatives modulating a nuclease

[0004] Field of the Invention

[0005] The present invention relates to compounds of formula (I), and stereoisomers, tautomers, N- oxides, and pharmaceutically acceptable salts thereof that are useful for modulating, preferably inhibiting three-prime repair exonuclease 1 (TREX1). The present invention further relates to compounds of the formula (I) for use as a medicament and to pharmaceutical compositions comprising said compounds. Further, the present invention relates to compounds of formula (I) and pharmaceutical compositions comprising said compounds for use in the treatment of cancer, such as breast, small cell lung cancer and colorectal cancer, in particular cancers with chromosomal instability, TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0006] Background of the Invention

[0007] The DNA exonuclease three-prime repair exonuclease 1 (TREX1) is involved in the metabolism of DNA. TREX1 has been shown to play a critical role in preventing autoimmunity in mice and humans by degrading endogenous cytosolic DNA that otherwise triggers activation of the innate cGAS / STING signalling pathway, leading to the production of type I interferons (IFN). [Hemphill, W. O., Simpson, S. R., Liu, M., Salsbury Jr, F. R., Hollis, T., Grayson, J. M., & Perrino, F. W. (2021). TREX1 as a novel immunotherapeutic target. Frontiers in Immunology, 12, 660184.]

[0008] Mutations in the TREX1 gene can lead to an accumulation of non-degraded DNA fragments in the cell, which triggers autoinflammatory processes via activation of the immune system. The common pathomechanism of the diseases associated with changes in the TREX1 gene is a systemic autoimmune process. This can lead to the development of the associated clinical conditions, particularly through damage to the blood vessels, but also to other tissues. These highly diverse diseases include severe early childhood diseases such as Aicardi-Goutieres syndrome (AGS), but also diseases that manifest in adulthood, such as Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy (CADASIL), chilblain lupus erythematosus (CHBL1) and retinal small vessel vasculopathy with cerebral leukodystrophy (RVCL).

[0009] The progression of cancer is known to be i.a. promoted by chromosomal instability (CIN) through numerous genomic, epigenetic and transcriptional changes that are both cancer cell intrinsic and cell non-autonomous. TREX1 induction has been shown to protect chromosomally unstable tumours from immune surveillance by attenuating type I IFN production. [Toufektchan, E., Dananberg, A., Striepen, J., Hickling, J. H., Shim, A., Chen, Y., ... & Maciejowski, J. (2024). Intratumoral TREX1 induction promotes immune evasion by limiting type I IFN. Cancer Immunology Research, 12(3), 673-686.]

[0010] Overexpression of TREX1 has further been shown to reduce the immunogenicity of chromosomally unstable cells, which promotes their transformation into cancer cells. [ Fang, L., Ying, S., Xu, X., & Wu, D. (2023). TREX1 cytosolic DNA degradation correlates with autoimmune disease and cancer immunity. Clinical and Experimental Immunology, 211(3), 193- 207.] The expression of TREX1 was also found to be highly pronounced in chemoresistant small-cell lung cancers (SCLCs) [Murayama, T., Mahadevan, N. R., Meador, C. B., Ivanova, E. Foreignfiling_text P24-264

[0011] 2

[0012] V., Pan, Y., Knelson, E. H., ... & Canadas, I. (2024). Targeting TREX1 Induces Innate Immune Response in Drug-Resistant Small-Cell Lung Cancer. Cancer Research Communications, 4(9), 2399-2414.]. By adaptively regulating the expression of TREX1 in cancer immunity to promote tumor proliferation, TREX1 represents a promising therapeutic target.

[0013] Therefore, TREX1 is considered to be an important therapeutic target for cancer treatment. In other words, compounds modulating TREX1 may be useful for treating cancer, preferably a cancer selected from breast cancer, small cell lung cancer and colorectal cancer. In particular, compounds modulating TREX1 may be useful for treating cancers exhibiting chromosomal instability. Further, compounds modulating TREX1 may be useful for treating TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0014] Objects and Summary of the Invention

[0015] It is therefore an object of the present invention to provide compounds, which act as modulators of TREX1, in particular compounds acting as inhibitors of TREX1. In particular, it is an object to provide compounds that inhibit TREX1 with high activity.

[0016] It is another object of the present invention to provide compounds, which are suitable for use as a medicament. It is another object of the present invention to provide compounds, which are suitable for use in the treatment of one or more diseases, in which the modulation of TREX1, in particular the inhibition, of TREX1 is beneficial. It is yet another object to provide compounds, which are suitable for use in the treatment of cancer, preferably a cancer selected from breast cancer, small cell lung cancer and colorectal cancer. It is yet another object to provide compounds, which are suitable for use in the treatment of TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0017] The above objects can be achieved by the compounds of formula (I), including stereoisomers, tautomers, N-oxides, or pharmaceutically acceptable salts thereof, as defined herein as well as pharmaceutical compositions comprising the same, and by the medical uses thereof. The inventors of the present invention inter alia surprisingly found that the compounds of formula (I) as defined herein act as modulators, in particular as inhibitors, of TREX1. Accordingly, the compounds of formula (I) can be used as a medicament, in particular for the treatment of cancer.

[0018] The invention provides compounds, i.e. compounds of formula (I), including stereoisomers, tautomers, N-oxides, or pharmaceutically acceptable salts thereof, along with their pharmaceutically acceptable salts, pharmaceutical compositions, and combinations, all of which act as modulators of TREX1, in particular as inhibitors of TREX1. Furthermore, the invention relates to the compound of formula (I) for use in the treatment, prevention, or improvement of a disease or condition, involving the administration of the compound of formula (I) as a modulator of TREX1, in particular as an inhibitor of TREX1 in an effective amount to individuals in need of such treatment. Additionally, the invention relates to compounds of formula (I) or their pharmaceutically acceptable salts, and pharmaceutical compositions comprising the same, specifically designed for the treatment of cancer, in particular breast cancer, small cell lung Foreignfiling_text P24-264

[0019] 3 cancer and colorectal cancer. Further, the invention relates to compounds of formula (I) or their pharmaceutically acceptable salts, and pharmaceutical compositions comprising the same, specifically designed for the treatment of cancer, in particular cancer with chromosomal instability. Furthermore, the invention relates to compounds of formula (I) or their pharmaceutically acceptable salts, and pharmaceutical compositions comprising the same, specifically designed for the treatment of TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) or retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0020] Various aspects of the invention are detailed in this document, including compounds represented by formula (I) or stereoisomers, tautomers, N-oxides, pharmaceutically acceptable salts, or hydrates thereof.

[0021] In a first aspect, the present invention therefore relates to a compound of formula (I) or a stereoisomer, tautomer, N-oxide, or pharmaceutically acceptable salt thereof; wherein

[0022] R1is 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rx;

[0023] A is O, S, NR1A, or CH2; wherein R1Ais H, or R1Atogether with R1and the nitrogen atom to which they are attached form wherein the dashed line marks the connection to the carbon atom, to which A is attached; and wherein B is a 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclic or heterocyclic ring; wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents Rx;

[0024] R1Bis H;

[0025] R2is 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl; wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the Foreignfiling_text P24-264

[0026] 4 aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; and

[0027] R3is C(=O)R33, wherein

[0028] R33is Ci-C2-alkyl, or 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl; wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; or

[0029] R3is 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; and wherein

[0030] Rxis halogen, CN, NO2, NRN1RN2, OR°, C(=O)NRN1RN2, C(=O)OR°, Ci-C4-aminoalkyl, C1-C4- hydroxyalkyl, Ci-C4-alkyl, or Ci-C4-haloalkyl; wherein RN1is H or Ci-C2-alkyl;

[0031] RN2is H or Ci-C2-alkyl; and

[0032] R° is H or Ci-C4-alkyl; or two Rxtogether form =0;

[0033] RYis halogen, CN, Ci-C2-alkyl, or Ci-C2-alkoxy; and

[0034] Rzis halogen, CN, NO2, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, or Ci- C4-haloalkoxy; or a group

[0035] H

[0036] — O— (CH2)m— N— RN. wherein the dashed line marks the connection to R3; and wherein m is 1 or 2; and

[0037] RNis H or C(=O)RC; wherein Rcis -CH3, -CH2CH3, or -CH2-(O-CH2CH2)n-O-CH3, wherein n is 0, 1 , or 2; or two Rztogether form =0.

[0038] In one preferred embodiment,

[0039] R1is pyrazolyl, phenyl, pyrazolyl, pyridinyl, pyrimidinyl, quinolinyl, isochinolinyl, indazolyl, pyrazolopyridinyl, imidazopyridinyl, 1-oxoisoindolinyl, or 1 ,3-dioxoindolinyl; wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rx.

[0040] In another preferred embodiment,

[0041] R1is Foreignfiling_text P24-264

[0042] 5

[0043] In another preferred embodiment,

[0044] A is O.

[0045] In another preferred embodiment, R1Bis H.

[0046] In another preferred embodiment,

[0047] R2is phenyl, wherein each substitutable atom is independently unsubstituted or substituted with one or more, same or different substituents RY.

[0048] In another preferred embodiment,

[0049] In another preferred embodiment,

[0050] R3is C(=O)R33, wherein

[0051] R33is Ci-C2-alkyl, or 5-membered aromatic heterocyclyl; wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or nonoxidized, and wherein each substitutable atom in the aforementioned groups is Foreignfiling_text P24-264

[0052] 6 independently unsubstituted or substituted with one or more, same or different substituents Rz; or

[0053] R3is 5- or 6-membered partially or fully unsaturated, or aromatic heterocyclyl, or 9- or 10- membered partially or fully unsaturated, or aromatic heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein at least one nitrogen atom is present in ortho position to the point of attachment to the remainder of the molecule, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz.

[0054] In another preferred embodiment,

[0055] R3is C(=O)R33, wherein

[0056] R33is pyrazolyl, imidazolyl, oxazolyl, or isoxazolyl, wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; or

[0057] R3is thiazolyl, pyridinyl, pyrimidinyl, pyridazinyl, 6-oxo-1 ,6-dihydropyrimidinyl, pyrazolopyrimidinyl, or imidazopyridinyl, wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz.

[0058] In another preferred embodiment,

[0059] In another preferred embodiment, the compound is a compound of formula (IA) or (IB): Foreignfiling_text P24-264

[0060] 7

[0061] In another preferred embodiment, the compound is a compound of formula (IB):

[0062] In another preferred embodiment, the compound is selected from the group consisting of 4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0063] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0064] (3S,4R)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0065] 4-(3,5-difluorophenyl)-1-(2-methylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0066] (3R,4S)-4-(3,5-difluorophenyl)-1-(2-methylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0067] (3S,4R)-4-(3,5-difluorophenyl)-1-(2-methylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0068] 6-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-2-methyl-2,3- dihydropyridazin-3-one;

[0069] 6-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-2-methyl-2,3- dihydropyridazin-3-one;

[0070] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-2-methyl-2,3- dihydropyridazin-3-one;

[0071] 4-(3,5-difluorophenyl)-1-(5-ethoxypyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0072] (3S,4R)-4-(3,5-difluorophenyl)-1-(5-ethoxypyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0073] (3R,4S)-4-(3,5-difluorophenyl)-1-(5-ethoxypyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0074] 4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[6-(trifluoromethyl)pyridazin-3-yl]piperidin-4-ol;

[0075] (3S,4R)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[6-(trifluoromethyl)pyridazin-3-yl]piperidin-4- ol;

[0076] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[6-(trifluoromethyl)pyridazin-3-yl]piperidin-4- ol;

[0077] 1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0078] (3R,4S)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4- ol;

[0079] (3S,4R)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4- ol;

[0080] N-[2-({2-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]acetamide;

[0081] N-[2-({2-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]acetamide;

[0082] N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]acetamide;

[0083] 3-[(5-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0084] (3R,4S)-3-[(5-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol; Foreignfiling_text P24-264

[0085] 8

[0086] (3S,4R)-3-[(5-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0087] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2-carboxamide;

[0088] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxamide;

[0089] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxamide;

[0090] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-N-methylpyridine-2- carboxamide;

[0091] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-N- methylpyridine-2-carboxamide;

[0092] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-N- methylpyridine-2-carboxamide;

[0093] 4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(pyrimidin-5-yloxy)piperidin-4-ol;

[0094] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(pyrimidin-5-yloxy)piperidin-4-ol;

[0095] (3S,4R)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(pyrimidin-5-yloxy)piperidin-4-ol;

[0096] 4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-{[6-(trifluoromethyl)pyridin-3-yl]oxy}piperidin-4-ol;

[0097] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-{[6-(trifluoromethyl)pyridin-3-yl]oxy}piperidin-

[0098] 4-ol;

[0099] (3S,4R)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-{[6-(trifluoromethyl)pyridin-3-yl]oxy}piperidin-

[0100] 4-ol;

[0101] 4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-3-yloxy)piperidin-4-ol;

[0102] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-3-yloxy)piperidin-4-ol;

[0103] (3S,4R)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-3-yloxy)piperidin-4-ol;

[0104] 3-[(6-aminopyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0105] (3R,4S)-3-[(6-aminopyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0106] (3S,4R)-3-[(6-aminopyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0107] N-[2-({2-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]-2-[2-(2-methoxyethoxy)ethoxy]acetamide;

[0108] N-[2-({2-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]-2-[2-(2-methoxyethoxy)ethoxy]acetamide;

[0109] N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]-2-[2-(2-methoxyethoxy)ethoxy]acetamide;

[0110] 4-(3,5-difluorophenyl)-3-(4-fluorophenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0111] (3R,4S)-4-(3,5-difluorophenyl)-3-(4-fluorophenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0112] (3S,4R)-4-(3,5-difluorophenyl)-3-(4-fluorophenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0113] 4-(3,5-difluorophenyl)-3-{pyrazolo[1,5-a]pyridin-6-yloxy}-1-(pyrimidin-2-yl)piperidin-4-ol;

[0114] (3R,4S)-4-(3,5-difluorophenyl)-3-{pyrazolo[1,5-a]pyridin-6-yloxy}-1-(pyrimidin-2-yl)piperidin-4-ol;

[0115] (3S,4R)-4-(3,5-difluorophenyl)-3-{pyrazolo[1,5-a]pyridin-6-yloxy}-1-(pyrimidin-2-yl)piperidin-4-ol; ethyl 6-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}imidazo[1,2- a]pyridine-2-carboxylate; ethyl 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3- yl]oxy}imidazo[1,2-a]pyridine-2-carboxylate; ethyl 6-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3- yl]oxy}imidazo[1,2-a]pyridine-2-carboxylate;

[0116] 4-(3,5-difluorophenyl)-3-[(1-methyl-1H-indazol-5-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0117] (3R,4S)-4-(3,5-difluorophenyl)-3-[(1-methyl-1H-indazol-5-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0118] (3S,4R)-4-(3,5-difluorophenyl)-3-[(1-methyl-1H-indazol-5-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0119] 4-(3,5-difluorophenyl)-1-{pyrazolo[1,5-a]pyrimidin-5-yl}-3-(pyridin-3-yloxy)piperidin-4-ol;

[0120] (3S,4R)-4-(3,5-difluorophenyl)-1-{pyrazolo[1,5-a]pyrimidin-5-yl}-3-(pyridin-3-yloxy)piperidin-4-ol; Foreignfiling_text P24-264

[0121] 9

[0122] (3R,4S)-4-(3,5-difluorophenyl)-1-{pyrazolo[1 ,5-a]pyrimidin-5-yl}-3-(pyridin-3-yloxy)piperidin-4-ol;

[0123] 4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-7-yloxy)piperidin-4-ol;

[0124] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-7-yloxy)piperidin-4-ol;

[0125] (3S,4R)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-7-yloxy)piperidin-4-ol;

[0126] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol- 1-one;

[0127] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0128] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0129] 6-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3,4-dihydropyrimidin-4-one;

[0130] 6-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3,4- dihydropyrimidin-4-one;

[0131] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3,4- dihydropyrimidin-4-one;

[0132] 4-(3,5-difluorophenyl)-1-(2,6-dimethylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0133] (3S,4R)-4-(3,5-difluorophenyl)-1-(2,6-dimethylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0134] (3R,4S)-4-(3,5-difluorophenyl)-1-(2,6-dimethylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0135] 3-[3-(aminomethyl)phenoxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0136] (3R,4S)-3-[3-(aminomethyl)phenoxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0137] (3S,4R)-3-[3-(aminomethyl)phenoxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0138] 4-(3,5-difluorophenyl)-3-(4-hydroxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0139] (3R,4S)-4-(3,5-difluorophenyl)-3-(4-hydroxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0140] (3S,4R)-4-(3,5-difluorophenyl)-3-(4-hydroxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0141] 4-(3,5-difluorophenyl)-1-{3-methyl-3H-imidazo[4,5-b]pyridin-5-yl}-3-(pyridin-3-yloxy)piperidin-4- ol;

[0142] (3S,4R)-4-(3,5-difluorophenyl)-1-{3-methyl-3H-imidazo[4,5-b]pyridin-5-yl}-3-(pyridin-3- yloxy)piperidin-4-ol;

[0143] (3R,4S)-4-(3,5-difluorophenyl)-1-{3-methyl-3H-imidazo[4,5-b]pyridin-5-yl}-3-(pyridin-3- yloxy)piperidin-4-ol;

[0144] 6-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0145] 6-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0146] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0147] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0148] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0149] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0150] 3-(3-aminophenoxy)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0151] (3R,4S)-3-(3-aminophenoxy)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0152] (3S,4R)-3-(3-aminophenoxy)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0153] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindole-1 ,3-dione;

[0154] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl) piperidin-3-yl]oxy}-2, 3-dihydro- 1 H-isoindole-1 ,3-dione; Foreignfiling_text P24-264

[0155] 10

[0156] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl) piperidin-3-yl]oxy}-2, 3-dihydro- 1 H-isoindole-1 ,3-dione;

[0157] 1-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]ethan-1-one;

[0158] 1-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]ethan-1-one;

[0159] 1-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]ethan-1-one;

[0160] 4-(3,5-difluorophenyl)-1-[1-(2-methoxyethyl)-1 H-pyrazole-4-carbonyl]-3-(pyridin-3- yloxy)piperidin-4-ol;

[0161] (3R,4S)-4-(3,5-difluorophenyl)-1-[1-(2-methoxyethyl)-1 H-pyrazole-4-carbonyl]-3-(pyridin-3- yloxy)piperidin-4-ol;

[0162] (3S,4R)-4-(3,5-difluorophenyl)-1-[1-(2-methoxyethyl)-1 H-pyrazole-4-carbonyl]-3-(pyridin-3- yloxy)piperidin-4-ol;

[0163] 4-(3,5-difluorophenyl)-1-(5-fluoropyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0164] (3S,4R)-4-(3,5-difluorophenyl)-1-(5-fluoropyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0165] (3R,4S)-4-(3,5-difluorophenyl)-1-(5-fluoropyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0166] 4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[5-(trifluoromethyl)pyrimidin-2-yl]piperidin-4-ol;

[0167] (3S,4R)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[5-(trifluoromethyl)pyrimidin-2-yl]piperidin-4- ol;

[0168] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[5-(trifluoromethyl)pyrimidin-2-yl]piperidin-4- ol;

[0169] 4-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0170] 4-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0171] 4-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0172] 4-(3,5-difluorophenyl)-3-(3-methoxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0173] (3R,4S)-4-(3,5-difluorophenyl)-3-(3-methoxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0174] (3S,4R)-4-(3,5-difluorophenyl)-3-(3-methoxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0175] 6-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3-methyl-3,4- dihydropyrimidin-4-one;

[0176] 6-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3-methyl-3,4- dihydropyrimidin-4-one;

[0177] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3-methyl-3,4- dihydropyrimidin-4-one;

[0178] 4-(3,5-difluorophenyl)-1-(6-ethoxypyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0179] (3S,4R)-4-(3,5-difluorophenyl)-1-(6-ethoxypyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0180] (3R,4S)-4-(3,5-difluorophenyl)-1-(6-ethoxypyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0181] 4-(3,5-difluorophenyl)-3-phenoxy-1-(pyrimidin-2-yl)piperidin-4-ol;

[0182] (3R,4S)-4-(3,5-difluorophenyl)-3-phenoxy-1-(pyrimidin-2-yl)piperidin-4-ol;

[0183] (3S,4R)-4-(3,5-difluorophenyl)-3-phenoxy-1-(pyrimidin-2-yl)piperidin-4-ol;

[0184] 3-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzoic acid;

[0185] 3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzoic acid;

[0186] 3-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzoic acid;

[0187] 4-(3,5-difluorophenyl)-1-(pyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0188] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0189] (3S,4R)-4-(3,5-difluorophenyl)-1-(pyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0190] 5-{[(4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3-carboxamide;

[0191] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxamide;

[0192] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxamide;

[0193] 4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol; Foreignfiling_text P24-264

[0194] 11

[0195] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0196] (3S,4R)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0197] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3-carbonitrile;

[0198] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carbonitrile;

[0199] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carbonitrile;

[0200] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3-carboxylic acid;

[0201] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxylic acid;

[0202] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxylic acid;

[0203] 4-(3,5-difluorophenyl)-3-(isoquinolin-8-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0204] (3R,4S)-4-(3,5-difluorophenyl)-3-(isoquinolin-8-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0205] (3S,4R)-4-(3,5-difluorophenyl)-3-(isoquinolin-8-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0206] 3-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0207] 3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0208] 3-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0209] 3-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzamide;

[0210] 3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzamide;

[0211] 3-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzamide;

[0212] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2-carboxylic acid;

[0213] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxylic acid;

[0214] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxylic acid;

[0215] 4-(3,5-difluorophenyl)-3-(isoquinolin-7-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0216] (3R,4S)-4-(3,5-difluorophenyl)-3-(isoquinolin-7-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0217] (3S,4R)-4-(3,5-difluorophenyl)-3-(isoquinolin-7-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0218] 6-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol- 1-one;

[0219] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0220] 6-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0221] 6-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-

[0222] 1-one;

[0223] 6-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0224] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0225] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0226] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0227] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one; Foreignfiling_text P24-264

[0228] 12

[0229] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0230] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1H-isoindol-1-one;

[0231] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1H-isoindol-1-one;

[0232] 3-[(4-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0233] (3R,4S)-3-[(4-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0234] (3S,4R)-3-[(4-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0235] 4-(3,5-difluorophenyl)-3-[(5-fluoropyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0236] (3R,4S)-4-(3,5-difluorophenyl)-3-[(5-fluoropyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0237] (3S,4R)-4-(3,5-difluorophenyl)-3-[(5-fluoropyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0238] 4-(3,5-difluorophenyl)-3-[(6-methoxypyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0239] (3R,4S)-4-(3,5-difluorophenyl)-3-[(6-methoxypyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0240] (3S,4R)-4-(3,5-difluorophenyl)-3-[(6-methoxypyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol; 3-

[0241] [4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1-olate;

[0242] 3-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1- olate and

[0243] 3-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1- olate.

[0244] In another preferred embodiment, the compound is selected from the group consisting of

[0245] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0246] (3R,4S)-4-(3,5-difluorophenyl)-1-(2-methylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0247] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-2-methyl-2,3- dihydropyridazin-3-one;

[0248] (3R,4S)-4-(3,5-difluorophenyl)-1-(5-ethoxypyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0249] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[6-(trifluoromethyl)pyridazin-3-yl]piperidin-4- ol;

[0250] (3R,4S)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4- ol;

[0251] N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]acetamide;

[0252] (3R,4S)-3-[(5-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0253] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxamide;

[0254] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-N- methylpyridine-2-carboxamide;

[0255] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(pyrimidin-5-yloxy)piperidin-4-ol;

[0256] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-{[6-(trifluoromethyl)pyridin-3-yl]oxy}piperidin-

[0257] 4-ol;

[0258] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-3-yloxy)piperidin-4-ol;

[0259] (3R,4S)-3-[(6-aminopyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0260] N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]-2-[2-(2-methoxyethoxy)ethoxy]acetamide;

[0261] (3R,4S)-4-(3,5-difluorophenyl)-3-(4-fluorophenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0262] (3R,4S)-4-(3,5-difluorophenyl)-3-{pyrazolo[1,5-a]pyridin-6-yloxy}-1-(pyrimidin-2-yl)piperidin-4-ol; ethyl 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3- yl]oxy}imidazo[1,2-a]pyridine-2-carboxylate; Foreignfiling_text P24-264

[0263] 13

[0264] (3R,4S)-4-(3,5-difluorophenyl)-3-[(1-methyl-1 H-indazol-5-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0265] (3R,4S)-4-(3,5-difluorophenyl)-1-{pyrazolo[1 ,5-a]pyrimidin-5-yl}-3-(pyridin-3-yloxy)piperidin-4- ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-7-yloxy)piperidin-4-ol;

[0266] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0267] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3,4- dihydropyrimidin-4-one;

[0268] (3R,4S)-4-(3,5-difluorophenyl)-1-(2,6-dimethylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0269] (3R,4S)-3-[3-(aminomethyl)phenoxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0270] (3R,4S)-4-(3,5-difluorophenyl)-3-(4-hydroxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0271] (3R,4S)-4-(3,5-difluorophenyl)-1-{3-methyl-3H-imidazo[4,5-b]pyridin-5-yl}-3-(pyridin-3- yloxy)piperidin-4-ol;

[0272] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0273] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0274] (3R,4S)-3-(3-aminophenoxy)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0275] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl) piperidin-3-yl]oxy}-2, 3-dihydro- 1 H-isoindole-1 ,3-dione;

[0276] 1-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]ethan-1-one;

[0277] (3R,4S)-4-(3,5-difluorophenyl)-1-[1-(2-methoxyethyl)-1 H-pyrazole-4-carbonyl]-3-(pyridin-3- yloxy)piperidin-4-ol;

[0278] (3R,4S)-4-(3,5-difluorophenyl)-1-(5-fluoropyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0279] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[5-(trifluoromethyl)pyrimidin-2-yl]piperidin-4- ol;

[0280] 4-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0281] (3R,4S)-4-(3,5-difluorophenyl)-3-(3-methoxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0282] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3-methyl-3,4- dihydropyrimidin-4-one;

[0283] (3R,4S)-4-(3,5-difluorophenyl)-1-(6-ethoxypyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0284] (3R,4S)-4-(3,5-difluorophenyl)-3-phenoxy-1-(pyrimidin-2-yl)piperidin-4-ol;

[0285] 3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzoic acid;

[0286] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0287] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxamide;

[0288] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0289] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carbonitrile;

[0290] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxylic acid;

[0291] (3R,4S)-4-(3,5-difluorophenyl)-3-(isoquinolin-8-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0292] 3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0293] 3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzamide;

[0294] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxylic acid;

[0295] (3R,4S)-4-(3,5-difluorophenyl)-3-(isoquinolin-7-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0296] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one; Foreignfiling_text P24-264

[0297] 14

[0298] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1H- isoindol-1-one;

[0299] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1H-isoindol-1-one;

[0300] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1H-isoindol-1-one;

[0301] (3R,4S)-3-[(4-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol; (3R,4S)-4-(3,5-difluorophenyl)-3-[(5-fluoropyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol; (3R,4S)-4-(3,5-difluorophenyl)-3-[(6-methoxypyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol; 3-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1- olate; and 3-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1- olate.

[0302] In a further aspect, the present invention relates to a pharmaceutical composition comprising a pharmaceutically acceptable amount of the compound of formula (I) as defined herein, and optionally a pharmaceutically acceptable carrier, diluent or excipient.

[0303] In yet another aspect, the present invention relates to a compound of formula (I) as defined herein or a pharmaceutical composition comprising the same as defined herein for use in medicine.

[0304] In yet another aspect, the present invention relates to a compound of formula (I) as defined herein or a pharmaceutical composition comprising the same as defined herein for use in the treatment of disease selected from the group consisting of cancer, such as breast cancer, small cell lung cancer and colorectal cancer, in particular cancers with chromosomal instability, TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0305] Moreover, the present invention relates to the compound of formula (I) or a pharmaceutical salt thereof, or a pharmaceutical composition comprising the same for use in the following contexts: therapy; the manufacture of a medicament; the manufacture of a medicament specifically for the treatment of cancer, such as breast, small cell lung cancer and colorectal cancer, in particular cancers with chromosomal instability, TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0306] In another embodiment, the present invention relates to the compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the same, for use in the treatment of cancers exhibiting chromosomal instability.

[0307] In another embodiment, the present invention relates to the compound of formula (I) or its pharmaceutically acceptable salt, or a pharmaceutical composition comprising the same, for use in the treatment of a disorder or disease that can be addressed by the modulation of TREX1 , in particular the inhibition of TREX1, in a subject by administering a therapeutically effective amount of the compound of formula (I) or its pharmaceutically acceptable salt. In another embodiment, the present invention relates to the compound of formula (I) or its pharmaceutically acceptable salt, or a pharmaceutical composition comprising the same, for Foreignfiling_text P24-264

[0308] 15 use in the treatment of cancer in a subject by administering a therapeutically effective amount of the compound of formula (I) or its pharmaceutically acceptable salt. In another embodiment, the present invention relates to the compound of formula (I) or its pharmaceutically acceptable salt, or a pharmaceutical composition comprising the same, for use in the treatment of a disease in a subject by administering a therapeutically effective amount of the compound described by formula (I) or its pharmaceutically acceptable salt, wherein the disease is selected from the group consisting of TREX1-mediated autoimmune diseases, inflammatory myocarditis, Aicardi- Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0309] Detailed Description of the Invention

[0310] In the following disclosure, preferred embodiments of the substituents in the above formula (I) are described in further detail. It is to be understood that each preferred embodiment is relevant on its own as well as in combination with other preferred embodiments. Furthermore, it is to be understood that the preferences in each case also apply to the stereoisomers, tautomers, N- oxides, or pharmaceutically acceptable salts of the compounds of the invention

[0311] As indicated above, the present invention relates to a compound of formula (I) or a stereoisomer, tautomer, N-oxide, or pharmaceutically acceptable salt thereof; wherein

[0312] R1is 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rx;

[0313] A is O, S, NR1A, or CH2; wherein R1Ais H, or R1Atogether with R1and the nitrogen atom to which they are attached form wherein the dashed line marks the connection to the carbon atom, to which A is attached; and wherein B is a 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclic or heterocyclic ring; wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents Rx; Foreignfiling_text P24-264

[0314] 16

[0315] R1Bis H;

[0316] R2is 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl; wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; and

[0317] R3is C(=O)R33, wherein

[0318] R33is Ci-C2-alkyl, or 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl; wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; or

[0319] R3is 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; and wherein

[0320] Rxis halogen, CN, NO2, NRN1RN2, OR°, C(=O)NRN1RN2, C(=O)OR°, Ci-C4-aminoalkyl, C1-C4- hydroxyalkyl, Ci-C4-alkyl, or Ci-C4-haloalkyl; wherein RN1is H or Ci-C2-alkyl;

[0321] RN2is H or Ci-C2-alkyl; and

[0322] R° is H or Ci-C4-alkyl; or two Rxtogether form =0;

[0323] RYis halogen, CN, Ci-C2-alkyl, or Ci-C2-alkoxy; and

[0324] Rzis halogen, CN, NO2, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, or Ci- C4-haloalkoxy; or a group

[0325] H

[0326] — O— (CH2)m— N— RN. wherein the dashed line marks the connection to R3; and wherein m is 1 or 2; and

[0327] RNis H or C(=O)RC; wherein Rcis -CH3, -CH2CH3, or -CH2-(O-CH2CH2)n-O-CH3, wherein n is 0, 1 , or 2; or two Rztogether form =0.

[0328] In one embodiment,

[0329] A is O, S, NR1A, or CH2; wherein R1Ais H, or R1Atogether with R1and the nitrogen atom to which they are attached form Foreignfiling text P24-264 wherein the dashed line marks the connection to the carbon atom, to which A is attached; and wherein B is a 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclic or heterocyclic ring; wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents Rx;

[0330] In one preferred embodiment,

[0331] A is O.

[0332] Thus, the compound of formula (I) is preferably a compound of formula (I. a) as depicted below.

[0333] In one embodiment,

[0334] R1Bis H.

[0335] Thus, the compound of formula (I) is preferably a compound of formula (1.1) as depicted below.

[0336] In a particularly preferred embodiment, the compound of formula (I) is a compound of formula (1.1), wherein A is O. Such compounds are referred to as compounds of formula (l.a.1).

[0337] Depending on the configuration of the two substituents -A-R1and -O-R1Bof the piperidine ring, the compound of formula (I) may be a compound of formula (IA) or (IB):

[0338] In one preferred embodiment, the compound of formula (I) is a compound of formula (IA). In another preferred embodiment, the compound of formula (I) is a compound of formula (IB). In one embodiment, the compound of formula (I) is a racemic mixture of (IA) and (IB). Foreignfiling_text P24-264

[0339] 18

[0340] In one embodiment, the compound of formula (I) is a compound of formula (I. A), wherein A is O. Such compounds are referred to as compounds of formula (I. A. a). In another embodiment, the compound of formula (I) is a compound of formula (I .A), wherein R1Bis H. Such compounds are referred to as compounds of formula (I.A.1). In a preferred embodiment, the compound of formula (I) is a compound of formula (I. A), wherein A is O and R1Bis H. Such compounds are referred to as compounds of formula (I.A.a.1).

[0341] It is particularly preferred that compound of formula (I) is a compound of formula (IB). In one embodiment, the compound of formula (I) is a compound of formula (I.B), wherein A is O. Such compounds are referred to as compounds of formula (I.B. a). In another embodiment, the compound of formula (I) is a compound of formula (I.B), wherein R1Bis H. Such compounds are referred to as compounds of formula (I.B.1). In a preferred embodiment, the compound of formula (I) is a compound of formula (I.B), wherein A is O and R1Bis H. Such compounds are referred to as compounds of formula (I.B.a.1).

[0342] In a particularly preferred embodiment of the invention, the compound of formula (I) is a compound of formula (I.B.a.1).

[0343] In connection with the compounds of formula (I), and in particular in connection with the compounds of formulae (I. a), (1.1), (l.a.1), (IA), (IB), (I.A.a), (I.A.1), (I.A.a.1), (I.B.a), (I.B.1), (I.B.a.1), the substituents R1, R2and R3as well as R33, Rx, RY, Rz, R1A, Rc, RN, RN1, RN2, and R° and as well as variables n and m are as defined in the following:

[0344] In one embodiment,

[0345] R1is 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rx; wherein Rxis defined as above.

[0346] In a more preferred embodiment,

[0347] R1is pyrazolyl, phenyl, pyrazolyl, pyridinyl, pyrimidinyl, quinolinyl, isochinolinyl, indazolyl, pyrazolopyridinyl, imidazopyridinyl, 1-oxoisoindolinyl, or 1 ,3-dioxoindolinyl; wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rx; wherein

[0348] Rxis F, Cl, CN, NRN1RN2, 0R°, C(=O)NRN1RN2, C(=O)OR°, Ci-C4-aminoalkyl, C1-C4- hydroxyalkyl, Ci-C4-alkyl, or Ci-C4-haloalkyl; wherein RN1is H or Ci-C2-alkyl; RN2is H or Ci-C2-alkyl; and R° is H or Ci-C4-alkyl; or two Rxtogether form =0.

[0349] In an even more preferred embodiment,

[0350] R1is Foreignfiling_text P24-264

[0351] 19 wherein the wavy line in each case marks the connection to the remainder of the molecule.

[0352] In an even more preferred embodiment, Foreignfiling_text P24-264

[0353] 20 wherein the wavy line in each case marks the connection to the remainder of the molecule.

[0354] In an even more preferred embodiment, wherein the wavy line in each case marks the connection to the remainder of the molecule.

[0355] In a particularly preferred embodiment,

[0356] R1is Foreignfiling_text P24-264

[0357] 21 wherein the wavy line in each case marks the connection to the remainder of the molecule.

[0358] In one embodiment,

[0359] R2is 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl; wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein

[0360] RYis halogen, CN, Ci-C2-alkyl, or Ci-C2-alkoxy.

[0361] In another preferred embodiment,

[0362] R2is phenyl, wherein each substitutable atom is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein RYis as defined above.

[0363] In another preferred embodiment, RYis F.

[0364] In an even more preferred embodiment,

[0365] R2is phenyl, wherein each substitutable atom is independently unsubstituted or substituted with one or more, same or different substituents RY; wherein RYis F.

[0366] In a particularly preferred embodiment,

[0367] In one embodiment,

[0368] R3is C(=O)R33, wherein

[0369] R33is Ci-C2-alkyl, or 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl; wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each Foreignfiling_text P24-264

[0370] 22 substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; or

[0371] R3is 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; wherein

[0372] Rzis halogen, CN, NO2, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, or Ci-C4-haloalkoxy; or a group

[0373] — O— (CH2)m— N— RN. wherein the dashed line marks the connection to R3; and wherein m is 1 or 2; and

[0374] RNis H or C(=O)RC; wherein Rcis -CH3, -CH2CH3, or -CH2-(O-CH2CH2)n-O-CH3, wherein n is 0, 1 , or 2; or two Rztogether form =0.

[0375] In a preferred embodiment,

[0376] R3is C(=O)R33, wherein R33is Ci-C2-alkyl, or 5-membered aromatic heterocyclyl; wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or nonoxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; or

[0377] R3is 5-or 6-membered partially or fully unsaturated, or aromatic heterocyclyl, or 9- or 10- membered partially or fully unsaturated, or aromatic heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein at least one nitrogen atom is present in ortho position to the point of attachment to the remainder of the molecule, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; wherein

[0378] Rzis halogen, CN, NO2, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, or Ci-C4-haloalkoxy; or a group

[0379] — O— (CH2)m— N— RN. wherein the dashed line marks the connection to R3; and wherein m is 1 or 2; and Foreignfiling_text P24-264

[0380] 23

[0381] RNis H or C(=O)Rc; wherein Rcis -CH3, -CH2CH3, or -CH2-(O-CH2CH2)n-O-CH3, wherein n is 0, 1 , or 2; or two Rxtogether form =0.

[0382] In a more preferred embodiment,

[0383] R3is C(=O)R33, wherein

[0384] R33is CH3, pyrazolyl, imidazolyl, oxazolyl, or isoxazolyl, wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; or

[0385] R3is thiazolyl, pyridinyl, pyrimidinyl, pyridazinyl, 6-oxo-1 ,6-dihydropyrimidinyl, pyrazolopyrimidinyl, or imidazopyridinyl, wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; wherein

[0386] Rzis halogen, CN, NO2, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, or Ci-C4-haloalkoxy; or a group

[0387] H

[0388] -O-(CH2)m— N-RN. wherein the dashed line marks the connection to R3; and wherein m is 1 or 2; and

[0389] RNis H or C(=O)Rc; wherein Rcis -CH3, -CH2CH3, or -CH2-(O-CH2CH2)n-O-CH3, wherein n is 0, 1 , or 2; or two Rztogether form =0.

[0390] In an even more preferred embodiment, Foreignfiling_text P24-264

[0391] 24 wherein the wavy line in each case marks the connection to the remainder of the molecule.

[0392] In a particularly preferred embodiment, wherein the wavy line in each case marks the connection to the remainder of the molecule.

[0393] In one embodiment, the compound according to formula (I) is selected from the group consisting of:

[0394] 4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0395] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0396] (3S,4R)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0397] 4-(3,5-difluorophenyl)-1-(2-methylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0398] (3R,4S)-4-(3,5-difluorophenyl)-1-(2-methylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0399] (3S,4R)-4-(3,5-difluorophenyl)-1-(2-methylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0400] 6-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-2-methyl-2,3- dihydropyridazin-3-one; Foreignfiling_text P24-264

[0401] 25

[0402] 6-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-2-methyl-2,3- dihydropyridazin-3-one;

[0403] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-2-methyl-2,3- dihydropyridazin-3-one;

[0404] 4-(3,5-difluorophenyl)-1-(5-ethoxypyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0405] (3S,4R)-4-(3,5-difluorophenyl)-1-(5-ethoxypyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0406] (3R,4S)-4-(3,5-difluorophenyl)-1-(5-ethoxypyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0407] 4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[6-(trifluoromethyl)pyridazin-3-yl]piperidin-4-ol;

[0408] (3S,4R)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[6-(trifluoromethyl)pyridazin-3-yl]piperidin-4- ol;

[0409] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[6-(trifluoromethyl)pyridazin-3-yl]piperidin-4- ol;

[0410] 1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0411] (3R,4S)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4- ol;

[0412] (3S,4R)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4- ol;

[0413] N-[2-({2-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]acetamide;

[0414] N-[2-({2-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]acetamide;

[0415] N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]acetamide;

[0416] 3-[(5-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0417] (3R,4S)-3-[(5-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0418] (3S,4R)-3-[(5-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0419] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2-carboxamide;

[0420] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxamide;

[0421] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxamide;

[0422] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-N-methylpyridine-2- carboxamide;

[0423] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-N- methylpyridine-2-carboxamide;

[0424] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-N- methylpyridine-2-carboxamide;

[0425] 4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(pyrimidin-5-yloxy)piperidin-4-ol;

[0426] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(pyrimidin-5-yloxy)piperidin-4-ol;

[0427] (3S,4R)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(pyrimidin-5-yloxy)piperidin-4-ol;

[0428] 4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-{[6-(trifluoromethyl)pyridin-3-yl]oxy}piperidin-4-ol;

[0429] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-{[6-(trifluoromethyl)pyridin-3-yl]oxy}piperidin- 4-ol;

[0430] (3S,4R)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-{[6-(trifluoromethyl)pyridin-3-yl]oxy}piperidin- 4-ol;

[0431] 4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-3-yloxy)piperidin-4-ol;

[0432] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-3-yloxy)piperidin-4-ol;

[0433] (3S,4R)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-3-yloxy)piperidin-4-ol;

[0434] 3-[(6-aminopyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol; Foreignfiling_text P24-264

[0435] 26

[0436] (3R,4S)-3-[(6-aminopyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0437] (3S,4R)-3-[(6-aminopyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0438] N-[2-({2-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]-2-[2-(2-methoxyethoxy)ethoxy]acetamide;

[0439] N-[2-({2-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]-2-[2-(2-methoxyethoxy)ethoxy]acetamide;

[0440] N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]-2-[2-(2-methoxyethoxy)ethoxy]acetamide;

[0441] 4-(3,5-difluorophenyl)-3-(4-fluorophenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0442] (3R,4S)-4-(3,5-difluorophenyl)-3-(4-fluorophenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0443] (3S,4R)-4-(3,5-difluorophenyl)-3-(4-fluorophenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0444] 4-(3,5-difluorophenyl)-3-{pyrazolo[1 ,5-a]pyridin-6-yloxy}-1-(pyrimidin-2-yl)piperidin-4-ol;

[0445] (3R,4S)-4-(3,5-difluorophenyl)-3-{pyrazolo[1 ,5-a]pyridin-6-yloxy}-1-(pyrimidin-2-yl)piperidin-4-ol;

[0446] (3S,4R)-4-(3,5-difluorophenyl)-3-{pyrazolo[1 ,5-a]pyridin-6-yloxy}-1-(pyrimidin-2-yl)piperidin-4-ol; ethyl 6-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}imidazo[1 ,2- a]pyridine-2-carboxylate; ethyl 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3- yl]oxy}imidazo[1 ,2-a]pyridine-2-carboxylate; ethyl 6-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3- yl]oxy}imidazo[1 ,2-a]pyridine-2-carboxylate;

[0447] 4-(3,5-difluorophenyl)-3-[(1-methyl-1 H-indazol-5-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0448] (3R,4S)-4-(3,5-difluorophenyl)-3-[(1-methyl-1 H-indazol-5-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0449] (3S,4R)-4-(3,5-difluorophenyl)-3-[(1-methyl-1 H-indazol-5-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0450] 4-(3,5-difluorophenyl)-1-{pyrazolo[1 ,5-a]pyrimidin-5-yl}-3-(pyridin-3-yloxy)piperidin-4-ol;

[0451] (3S,4R)-4-(3,5-difluorophenyl)-1-{pyrazolo[1 ,5-a]pyrimidin-5-yl}-3-(pyridin-3-yloxy)piperidin-4-ol;

[0452] (3R,4S)-4-(3,5-difluorophenyl)-1-{pyrazolo[1 ,5-a]pyrimidin-5-yl}-3-(pyridin-3-yloxy)piperidin-4-ol;

[0453] 4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-7-yloxy)piperidin-4-ol;

[0454] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-7-yloxy)piperidin-4-ol;

[0455] (3S,4R)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-7-yloxy)piperidin-4-ol;

[0456] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol- 1-one;

[0457] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0458] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0459] 6-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3,4-dihydropyrimidin-4-one;

[0460] 6-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3,4- dihydropyrimidin-4-one;

[0461] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3,4- dihydropyrimidin-4-one;

[0462] 4-(3,5-difluorophenyl)-1-(2,6-dimethylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0463] (3S,4R)-4-(3,5-difluorophenyl)-1-(2,6-dimethylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0464] (3R,4S)-4-(3,5-difluorophenyl)-1-(2,6-dimethylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0465] 3-[3-(aminomethyl)phenoxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0466] (3R,4S)-3-[3-(aminomethyl)phenoxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0467] (3S,4R)-3-[3-(aminomethyl)phenoxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0468] 4-(3,5-difluorophenyl)-3-(4-hydroxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0469] (3R,4S)-4-(3,5-difluorophenyl)-3-(4-hydroxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0470] (3S,4R)-4-(3,5-difluorophenyl)-3-(4-hydroxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol; Foreignfiling_text P24-264

[0471] 27

[0472] 4-(3,5-difluorophenyl)-1-{3-methyl-3H-imidazo[4,5-b]pyridin-5-yl}-3-(pyridin-3-yloxy)piperidin-4- ol;

[0473] (3S,4R)-4-(3,5-difluorophenyl)-1-{3-methyl-3H-imidazo[4,5-b]pyridin-5-yl}-3-(pyridin-3- yloxy)piperidin-4-ol;

[0474] (3R,4S)-4-(3,5-difluorophenyl)-1-{3-methyl-3H-imidazo[4,5-b]pyridin-5-yl}-3-(pyridin-3- yloxy)piperidin-4-ol;

[0475] 6-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0476] 6-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1H-isoindol-1-one;

[0477] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1H-isoindol-1-one;

[0478] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0479] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1H-isoindol-1-one;

[0480] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1H-isoindol-1-one;

[0481] 3-(3-aminophenoxy)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0482] (3R,4S)-3-(3-aminophenoxy)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0483] (3S,4R)-3-(3-aminophenoxy)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0484] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindole-1 ,3-dione;

[0485] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl) piperidin-3-yl]oxy}-2, 3-dihydro- 1 H-isoindole-1 ,3-dione;

[0486] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl) piperidin-3-yl]oxy}-2, 3-dihydro- 1 H-isoindole-1 ,3-dione;

[0487] 1-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]ethan-1-one;

[0488] 1-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]ethan-1-one;

[0489] 1-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]ethan-1-one;

[0490] 4-(3,5-difluorophenyl)-1-[1-(2-methoxyethyl)-1H-pyrazole-4-carbonyl]-3-(pyridin-3- yloxy)piperidin-4-ol;

[0491] (3R,4S)-4-(3,5-difluorophenyl)-1-[1-(2-methoxyethyl)-1H-pyrazole-4-carbonyl]-3-(pyridin-3- yloxy)piperidin-4-ol;

[0492] (3S,4R)-4-(3,5-difluorophenyl)-1-[1-(2-methoxyethyl)-1H-pyrazole-4-carbonyl]-3-(pyridin-3- yloxy)piperidin-4-ol;

[0493] 4-(3,5-difluorophenyl)-1-(5-fluoropyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0494] (3S,4R)-4-(3,5-difluorophenyl)-1-(5-fluoropyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0495] (3R,4S)-4-(3,5-difluorophenyl)-1-(5-fluoropyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0496] 4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[5-(trifluoromethyl)pyrimidin-2-yl]piperidin-4-ol;

[0497] (3S,4R)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[5-(trifluoromethyl)pyrimidin-2-yl]piperidin-4- ol;

[0498] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[5-(trifluoromethyl)pyrimidin-2-yl]piperidin-4- ol;

[0499] 4-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0500] 4-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0501] 4-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0502] 4-(3,5-difluorophenyl)-3-(3-methoxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0503] (3R,4S)-4-(3,5-difluorophenyl)-3-(3-methoxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol; Foreignfiling_text P24-264

[0504] 28

[0505] (3S,4R)-4-(3,5-difluorophenyl)-3-(3-methoxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0506] 6-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3-methyl-3,4- dihydropyrimidin-4-one;

[0507] 6-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3-methyl-3,4- dihydropyrimidin-4-one;

[0508] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3-methyl-3,4- dihydropyrimidin-4-one;

[0509] 4-(3,5-difluorophenyl)-1-(6-ethoxypyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0510] (3S,4R)-4-(3,5-difluorophenyl)-1-(6-ethoxypyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0511] (3R,4S)-4-(3,5-difluorophenyl)-1-(6-ethoxypyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0512] 4-(3,5-difluorophenyl)-3-phenoxy-1-(pyrimidin-2-yl)piperidin-4-ol;

[0513] (3R,4S)-4-(3,5-difluorophenyl)-3-phenoxy-1-(pyrimidin-2-yl)piperidin-4-ol;

[0514] (3S,4R)-4-(3,5-difluorophenyl)-3-phenoxy-1-(pyrimidin-2-yl)piperidin-4-ol;

[0515] 3-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzoic acid;

[0516] 3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzoic acid;

[0517] 3-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzoic acid;

[0518] 4-(3,5-difluorophenyl)-1-(pyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0519] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0520] (3S,4R)-4-(3,5-difluorophenyl)-1-(pyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0521] 5-{[(4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3-carboxamide;

[0522] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxamide;

[0523] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxamide;

[0524] 4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0525] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0526] (3S,4R)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0527] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3-carbonitrile;

[0528] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carbonitrile;

[0529] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carbonitrile;

[0530] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3-carboxylic acid;

[0531] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxylic acid;

[0532] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxylic acid;

[0533] 4-(3,5-difluorophenyl)-3-(isoquinolin-8-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0534] (3R,4S)-4-(3,5-difluorophenyl)-3-(isoquinolin-8-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0535] (3S,4R)-4-(3,5-difluorophenyl)-3-(isoquinolin-8-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0536] 3-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0537] 3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0538] 3-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0539] 3-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzamide;

[0540] 3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzamide;

[0541] 3-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzamide;

[0542] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2-carboxylic acid; Foreignfiling_text P24-264

[0543] 29

[0544] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxylic acid;

[0545] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxylic acid;

[0546] 4-(3,5-difluorophenyl)-3-(isoquinolin-7-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0547] (3R,4S)-4-(3,5-difluorophenyl)-3-(isoquinolin-7-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0548] (3S,4R)-4-(3,5-difluorophenyl)-3-(isoquinolin-7-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0549] 6-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol- 1-one;

[0550] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0551] 6-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0552] 6-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol- 1-one;

[0553] 6-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0554] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0555] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0556] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0557] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0558] 5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0559] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0560] 5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0561] 3-[(4-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0562] (3R,4S)-3-[(4-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0563] (3S,4R)-3-[(4-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0564] 4-(3,5-difluorophenyl)-3-[(5-fluoropyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0565] (3R,4S)-4-(3,5-difluorophenyl)-3-[(5-fluoropyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0566] (3S,4R)-4-(3,5-difluorophenyl)-3-[(5-fluoropyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0567] 4-(3,5-difluorophenyl)-3-[(6-methoxypyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0568] (3R,4S)-4-(3,5-difluorophenyl)-3-[(6-methoxypyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0569] (3S,4R)-4-(3,5-difluorophenyl)-3-[(6-methoxypyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol; 3-

[0570] [4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1-olate;

[0571] 3-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1- olate and

[0572] 3-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1- olate.

[0573] In one preferred embodiment, the compound according to formula (I) is selected from the group consisting of: Foreignfiling_text P24-264

[0574] 30

[0575] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0576] (3R,4S)-4-(3,5-difluorophenyl)-1-(2-methylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0577] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-2-methyl-2,3- dihydropyridazin-3-one;

[0578] (3R,4S)-4-(3,5-difluorophenyl)-1-(5-ethoxypyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0579] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[6-(trifluoromethyl)pyridazin-3-yl]piperidin-4- ol;

[0580] (3R,4S)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4- ol;

[0581] N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]acetamide;

[0582] (3R,4S)-3-[(5-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0583] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxamide;

[0584] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-N- methylpyridine-2-carboxamide;

[0585] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(pyrimidin-5-yloxy)piperidin-4-ol;

[0586] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-{[6-(trifluoromethyl)pyridin-3-yl]oxy}piperidin-

[0587] 4-ol;

[0588] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-3-yloxy)piperidin-4-ol;

[0589] (3R,4S)-3-[(6-aminopyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0590] N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]-2-[2-(2-methoxyethoxy)ethoxy]acetamide;

[0591] (3R,4S)-4-(3,5-difluorophenyl)-3-(4-fluorophenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0592] (3R,4S)-4-(3,5-difluorophenyl)-3-{pyrazolo[1 ,5-a]pyridin-6-yloxy}-1-(pyrimidin-2-yl)piperidin-4-ol; ethyl 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3- yl]oxy}imidazo[1 ,2-a]pyridine-2-carboxylate;

[0593] (3R,4S)-4-(3,5-difluorophenyl)-3-[(1-methyl-1 H-indazol-5-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0594] (3R,4S)-4-(3,5-difluorophenyl)-1-{pyrazolo[1 ,5-a]pyrimidin-5-yl}-3-(pyridin-3-yloxy)piperidin-4- ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-7-yloxy)piperidin-4-ol;

[0595] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0596] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3,4- dihydropyrimidin-4-one;

[0597] (3R,4S)-4-(3,5-difluorophenyl)-1-(2,6-dimethylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0598] (3R,4S)-3-[3-(aminomethyl)phenoxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0599] (3R,4S)-4-(3,5-difluorophenyl)-3-(4-hydroxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0600] (3R,4S)-4-(3,5-difluorophenyl)-1-{3-methyl-3H-imidazo[4,5-b]pyridin-5-yl}-3-(pyridin-3- yloxy)piperidin-4-ol;

[0601] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0602] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0603] (3R,4S)-3-(3-aminophenoxy)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0604] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl) piperidin-3-yl]oxy}-2, 3-dihydro- 1 H-isoindole-1 ,3-dione;

[0605] 1-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]ethan-1-one;

[0606] (3R,4S)-4-(3,5-difluorophenyl)-1-[1-(2-methoxyethyl)-1 H-pyrazole-4-carbonyl]-3-(pyridin-3- yloxy)piperidin-4-ol; Foreignfiling_text P24-264

[0607] 31

[0608] (3R,4S)-4-(3,5-difluorophenyl)-1-(5-fluoropyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0609] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[5-(trifluoromethyl)pyrimidin-2-yl]piperidin-4- ol;

[0610] 4-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0611] (3R,4S)-4-(3,5-difluorophenyl)-3-(3-methoxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0612] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3-methyl-3,4- dihydropyrimidin-4-one;

[0613] (3R,4S)-4-(3,5-difluorophenyl)-1-(6-ethoxypyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0614] (3R,4S)-4-(3,5-difluorophenyl)-3-phenoxy-1-(pyrimidin-2-yl)piperidin-4-ol;

[0615] 3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzoic acid;

[0616] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0617] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxamide;

[0618] (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0619] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carbonitrile;

[0620] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxylic acid;

[0621] (3R,4S)-4-(3,5-difluorophenyl)-3-(isoquinolin-8-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0622] 3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;

[0623] 3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzamide;

[0624] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxylic acid;

[0625] (3R,4S)-4-(3,5-difluorophenyl)-3-(isoquinolin-7-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0626] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0627] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0628] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0629] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0630] (3R,4S)-3-[(4-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0631] (3R,4S)-4-(3,5-difluorophenyl)-3-[(5-fluoropyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0632] (3R,4S)-4-(3,5-difluorophenyl)-3-[(6-methoxypyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0633] 3-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1- date; and

[0634] 3-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1- date.

[0635] In an even more preferred embodiment, the compound according to formula (I) is selected from the group consisting of: (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;

[0636] (3R,4S)-4-(3,5-difluorophenyl)-1-(2-methylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0637] (3R,4S)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4- ol;

[0638] N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]acetamide;

[0639] (3R,4S)-3-[(5-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol; Foreignfiling_text P24-264

[0640] 32

[0641] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxamide;

[0642] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-N- methylpyridine-2-carboxamide;

[0643] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(pyrimidin-5-yloxy)piperidin-4-ol;

[0644] (3R,4S)-3-[(6-aminopyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol; (3R,4S)-4-(3,5-difluorophenyl)-3-{pyrazolo[1 ,5-a]pyridin-6-yloxy}-1-(pyrimidin-2-yl)piperidin-4-ol; ethyl 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3- yl]oxy}imidazo[1 ,2-a]pyridine-2-carboxylate;

[0645] (3S,4R)-4-(3,5-difluorophenyl)-1-{pyrazolo[1 ,5-a]pyrimidin-5-yl}-3-(pyridin-3-yloxy)piperidin-4-ol;

[0646] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0647] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3,4- dihydropyrimidin-4-one;

[0648] (3R,4S)-4-(3,5-difluorophenyl)-1-{3-methyl-3H-imidazo[4,5-b]pyridin-5-yl}-3-(pyridin-3- yloxy)piperidin-4-ol;

[0649] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0650] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0651] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl) piperidin-3-yl]oxy}-2, 3-dihydro- 1 H-isoindole-1 ,3-dione;

[0652] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3-methyl-3,4- dihydropyrimidin-4-one;

[0653] (3R,4S)-4-(3,5-difluorophenyl)-1-(pyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;

[0654] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxylic acid;

[0655] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxylic acid;

[0656] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0657] 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;

[0658] 5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;

[0659] (3R,4S)-4-(3,5-difluorophenyl)-3-[(5-fluoropyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol; (3R,4S)-4-(3,5-difluorophenyl)-3-[(6-methoxypyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;

[0660] 6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-[(1-methyl-1 H-pyrazol-4-yl)oxy]piperidin-1-yl]-3- methyl-3,4-dihydropyrimidin-4-one; and 4-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-1-methyl-1 ,2- dihydropyrimidin-2-one.

[0661] Definitions

[0662] The term “compound(s) of the present invention” is to be understood as equivalent to the term "compound(s) according to the invention" and relates to the compounds of formula (I), preferably to compounds of formula (I. a), (1.1), (l.a.1), (IA), (IB), (I. A. a), (I.A.1), (I.A.a.1), (I.B.a), (I.B.1), or (I.B.a.1), and also covers a stereoisomer, tautomer, N-oxide, or pharmaceutically acceptable salt thereof. Foreignfiling_text P24-264

[0663] 33

[0664] The compounds according to the invention may be amorphous or may exist in one or more different crystalline states (polymorphs), which may have different macroscopic properties such as stability or show different biological properties such as activities. The present invention relates to amorphous and crystalline forms of compounds of formula (I), mixtures of different crystalline states of the compounds of formula (I), as well as amorphous or crystalline salts thereof.

[0665] The compounds according to the invention also include solvates, in particular hydrates of the compounds of formula (I). The term “hydrate” in connection with the compounds of formula (I) refers to a compound of formula (I), which contains water or its constituent elements (i.e. H and OH). Preferably, a hydrate of the compounds of formula (I) is a compound of formula (I), which incorporates water molecules in the crystalline structure but does not alter the chemical structure of formula (I). It is to be understood that such hydrates of the compounds provided herein, particularly the compounds of the present invention, also include hydrates of pharmaceutically acceptable salts of the corresponding compounds.

[0666] Salts of the compounds according to the invention are preferably pharmaceutically acceptable salts, such as those containing counterions present in drug products listed in the US FDA Orange Book database. They can be formed in a customary manner, e.g., by reacting the compound with an acid of the anion in question, if the compounds according to the invention have a basic functionality, or by reacting acidic compounds according to the invention with a suitable base.

[0667] Suitable cationic counterions are in particular the ions of the alkali metals, preferably lithium, sodium and potassium, of the alkaline earth metals, preferably calcium, magnesium and barium, and of the transition metals, preferably manganese, copper, silver, zinc and iron, and also ammonium (NH4+) and substituted ammonium in which one to four of the hydrogen atoms are replaced by Ci-C4-alkyl, Ci-C4-hydroxyalkyl, Ci-C4-alkoxy, Ci-C4-alkoxy-Ci-C4-alkyl, hydroxy-Ci- C4-alkoxy-Ci-C4-alkyl, phenyl or benzyl. Examples of substituted ammonium ions comprise methylammonium, isopropylammonium, dimethylammonium, diisopropylammonium, trimethylammonium, tetramethylammonium, tetraethylammonium, tetrabutylammonium, 2- hydroxyethylammonium, 2-(2-hydroxyethoxy)ethyl-ammonium, bis(2-hydroxyethyl)ammonium, benzyltrimethylammonium and benzyltriethylammonium, furthermore the cations of 1 ,4- piperazine, meglumine, benzathine and lysine.

[0668] Suitable anionic counterions are in particular chloride, bromide, hydrogensulfate, sulfate, dihydrogenphosphate, hydrogenphosphate, phosphate, nitrate, bicarbonate, carbonate, hexafluorosilicate, hexafluorophosphate, benzoate, and the anions of Ci-C4-alkanoic acids, preferably formate, acetate, propionate and butyrate, furthermore lactate, gluconate, and the anions of poly acids such as succinate, oxalate, maleate, fumarate, malate, tartrate and citrate, furthermore sulfonate anions such as besylate (benzenesulfonate), tosylate (p- toluenesulfonate), napsylate (naphthalene-2-sulfonate), mesylate (methanesulfonate), esylate (ethanesulfonate), and ethanedisulfonate. They can be formed by reacting compounds according to the invention that have a basic functionality with an acid of the corresponding anion. Foreignfiling_text P24-264

[0669] 34

[0670] Tautomers may be formed, if a substituent is present at the compound of formula (I), which allows for the formation of tautomers such as keto-enol tautomers, imine-enamine tautomers, amide-imidic acid tautomers or the like.

[0671] The term " / V-oxide" includes any compound of the present invention which has at least one tertiary nitrogen atom that is oxidized to an / V-oxide moiety.

[0672] Depending on the substitution pattern, the compounds according to the invention may have one or more centres of chirality. The invention provides both, pure enantiomers or pure diastereomers, of the compounds according to the invention, and their mixtures, including racemic mixtures. Suitable compounds according to the invention also include all possible geometrical stereoisomers (cis / trans isomers or E / Z isomers) and mixtures thereof. E / Z- isomers may be present with respect to, e.g., an alkene, carbon-nitrogen double-bond or amide group.

[0673] Any formula or structure given herein, including compounds of formula (I), is also intended to represent unlabeled forms as well as isotopically labeled forms of the compounds. I sotopically labeled compounds have structures depicted by the formulas given herein except that one or more atoms are replaced by an atom having a selected atomic mass or mass number. Examples of isotopes that can be incorporated into compounds of the disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine and chlorine, such as, but not limited to2H (deuterium, D),3H (tritium),11C,13C,14C,15N,18F,31P,32P,35S,36CI and125l. For example, radioactive isotopes such as3H,13C and14C provide isotopically labelled compounds useful in metabolic studies, reaction kinetic studies, detection or imaging techniques, such as positron emission tomography (PET) or single-photon emission computed tomography (SPECT) including drug or substrate tissue distribution assays or in radioactive treatment of patients. Further, the disclosure includes compounds of formula (I) in which from 1 to n hydrogens attached to a carbon atom is / are replaced by deuterium, in which n is the number of hydrogens in the molecule. Deuterium labeled or substituted therapeutic compounds of the disclosure may have improved DMPK (drug metabolism and pharmacokinetics) properties, relating to distribution, metabolism and excretion (ADME). Substitution with heavier isotopes such as deuterium may afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life, reduced dosage requirements and / or an improvement in therapeutic index. See, for example, Poster, "Deuterium Isotope Effects in Studies of Drug Metabolism", Trends Pharmacol. Sei. 5(12):524- 527 (1984). Such compounds are synthesized by means well known in the art, for example by employing starting materials in which one or more hydrogens have been replaced by deuterium. The concentration of such a heavier isotope, specifically deuterium, may be defined by an isotopic enrichment factor. Unless otherwise stated, when a position is designated specifically as "H" or "hydrogen", the position is understood to have hydrogen at its natural abundance isotopic composition. Accordingly, in the compounds of this disclosure any atom specifically designated as a deuterium (D) is meant to represent deuterium.

[0674] The term "substituted", as used herein, means that a hydrogen atom bonded to a designated atom is replaced with a specified substituent, provided that the substitution results in a stable or chemically feasible compound. Unless otherwise indicated, a substituted atom may have one or more substituents, and each substituent is independently selected. The term "substitutable atom" means that attached to the atom is a hydrogen, which can be replaced with a suitable Foreignfiling_text P24-264

[0675] 35 substituent. The term "substitutable", when used in reference to a designated atom, means that attached to the atom is a hydrogen, which can be replaced with a suitable substituent. When it is referred to certain atoms or moieties being substituted with “one or more” substituents, the term “one or more” is intended to cover at least one substituent, e.g., 1 to 10 substituents, preferably 1 , 2, 3, 4, or 5 substituents, more preferably 1, 2, or 3 substituents, most preferably 1, or 2 substituents. When neither the term “unsubstituted” nor “substituted” is explicitly mentioned concerning a moiety, said moiety is to be considered as unsubstituted.

[0676] The organic moieties mentioned in the above definitions of the variables are - like the term halogen - collective terms for individual listings of the individual group members. The prefix Cn- Cmindicates in each case the possible number of carbon atoms in the group.

[0677] The term “halo” refers to fluoro, chloro, or bromo, particularly fluoro or chloro. The term “halogen” denotes in each case fluorine, bromine, chlorine or iodine, in particular fluorine or chlorine.

[0678] The term "alkyl" as used herein denotes in each case a straight-chain or branched alkyl group having usually from 1 to 6 carbon atoms, preferably 1 to 5 or 1 to 4 carbon atoms, more preferably 1 to 3 or 1 or 2 carbon atoms. Examples of an alkyl group are methyl, ethyl, n-propyl, / so-propyl, n-butyl, 2-butyl, / so-butyl, tert-butyl, n-pentyl, 1-methylbutyl, 2- methylbutyl, 3- methylbutyl, 2,2-dimethylpropyl, 1-ethylpropyl, n-hexyl, 1,1 -dimethylpropyl, 1,2-dimethylpropyl, 1- methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1 , 1-dimethylbutyl, 1,2- dimethylbutyl, 1 ,3-dimethylbutyl, 2,2-dimethylbutyl, 2,3-dimethylbutyl, 3,3-dimethylbutyl, 1- ethylbutyl, 2-ethylbutyl, 1 , 1 ,2-trimethylpropyl, 1 ,2,2- trimethylpropyl, 1-ethyl1-methylpropyl, and 1-ethyl-2-methylpropyl.

[0679] The term "haloalkyl" as used herein denotes in each case a straight-chain or branched alkyl group having usually from 1 to 4 carbon atoms, preferably 1 to 3 or 1 or 2 carbon atoms, wherein the hydrogen atoms of this group are partially or totally replaced with halogen atoms. Preferred haloalkyl moieties are selected from Ci-C4-haloalkyl, more preferably from C1-C3- haloalkyl or Ci-C2-haloalkyl, in particular from Ci-C2-fluoroalkyl such as fluoromethyl, difluoromethyl, trifluoromethyl, 1-fluoroethyl, 2-fluoroethyl, 2,2-difluoroethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, and the like.

[0680] The term "alkoxy" as used herein denotes in each case a straight-chain or branched alkyl group which is bonded via an oxygen atom to the remainder of the molecule and has usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom. Examples of an alkoxy group are methoxy, ethoxy, n-propoxy, / so-propoxy, n-butyloxy, 2-butyloxy, / so- butyloxy, ferf-butyloxy, and the like. An alkoxy group as defined herein having usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom, which is bonded via an alkyl group as defined herein having usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom, to the remainder of the molecule, is referred to as an “alkoxyalkyl”. Thus, it refers to an alkyl group, which is bonded via oxygen to a further alkyl group, which is then bonded to the remainder of the molecule. Examples of alkoxyalkyl groups are methoxymethyl, methoxyethyl, ethoxymethyl, ethoxyethyl, and the like. Alkyl and alkoxy groups can be unbranched or branched, and examples of alkyl include but are not limited to methyl, ethyl, n-propyl, / so -propyl, n-butyl, / so -butyl, sec-butyl, and tert-butyl. Foreignfiling_text P24-264

[0681] 36

[0682] Examples of alkoxy include methoxy, ethoxy, n-propoxy, / so -propoxy, n-butoxy, / so -butoxy, sec-butoxy, and te / Y-butoxy.

[0683] The term "haloalkoxy" as used herein denotes in each case a straight-chain or branched alkoxy group having from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom, wherein the hydrogen atoms of this group are partially or totally replaced with halogen atoms, in particular fluorine atoms. Preferred haloalkoxy moieties include Ci- haloalkoxy, in particular Ci-fluoroalkoxy, such as trifluoromethoxy and the like.

[0684] The term “hydroxyalkyl” as used herein denotes in each case a straight-chain or branched alkyl group having usually from 1 to 6 carbon atoms, preferably from 1 to 4 carbon atoms, more preferably 1 to 2 carbon atoms, and being further substituted with 1 to 5, preferably with 1 to 2 hydroxy groups, in particular with 1 hydroxy group, wherein a hydroxy group is a OH group. Preferably, the one hydroxy group is terminating the straight-chain or branched alkyl group so that the hydroxy group is bonded to an alkyl bridge, which is bonded to the remainder of the molecule. Examples of an hydroxyalkyl group are hydroxymethyl, hydroxyethyl, n- hydroxypropyl, 2-hydroxypropyl, n-hydroxybutyl, 2-hydroxybutyl, 2-hydroxy-2-methylpropyl, and n-hydroxypentyl. Hydroxymethyl, hydroxyethyl, hydroxypropyl, and hydroxybutyl, are preferred, in particular hydroxymethyl and hydroxyethyl.

[0685] The term “aminoalkyl” as used herein denotes in each case a straight-chain or branched alkyl group having usually from 1 to 6 carbon atoms, preferably from 1 to 4 carbon atoms, more preferably 1 to 2 carbon atoms, and being further substituted with 1 to 5, preferably with 1 to 2 amino groups, in particular with 1 amino group, wherein an amino group is a NH2 group. Preferably, the one amino group is terminating the straight-chain or branched alkyl group so that the amino group is bonded to an alkyl bridge, which is bonded to the remainder of the molecule.

[0686] “=O” represents an oxo substituent.

[0687] The term “carbocyclic”, “carbocyclyl”, or “carbocycle” includes, unless otherwise indicated, in general a 3- to 10- membered monocyclic ring, preferably a 4- to 8-membered or a 3- to 6- membered or a 5- to 7-membered monocyclic, more preferably a 3-, 4-, 5- or 6-membered monocyclic ring, comprising 3 to 10, preferably 4 to 8 or 3 to 6 or 5 to 7, more preferably 3, 4, 5 or 6 carbon atoms. The carbocycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled, whereas aromatic means that the Huckel (4n + 2) rule is fulfilled. Also “aryls” are covered by the term “carbocycles”. The term “aromatic carbocyclyl “, “aryl” or “aromatic carbocycle” refers to aromatic carbocyclic rings based on carbon atoms as ring members, preferably 6-membered aromatic carbocyclic rings based on carbon atoms as ring members. A preferred example is phenyl. Unless otherwise indicated, the term “aryl” further covers “aromatic carbobicycles” as defined herein. The term “carbocyclic” or “carbocyclyl”, unless otherwise indicated, may therefore cover inter alia cycloalkyl, cycloalkenyl, as well as phenyl. Preferably, the term “carbocyclic” or “carbocyclyl” covers phenyl and cycloalkyl, for example phenyl, cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl. The term “cycloalkyl” as used herein denotes in each case a monocyclic cycloaliphatic radical having usually from 3 to 10 or from 3 to 6 carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, Foreignfiling_text P24-264

[0688] 37 cycloheptyl, cyclooctyl, cyclononyl and cyclodecyl or cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl. Cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl are preferred.

[0689] The term "carbobicyclic" or “carbobicyclyl” includes in general 6 to 14-membered, preferably 7- to 12-membered or 8- to 10-membered, more preferably 9- or 10-membered bicyclic rings comprising 6 to 14, preferably 7 to 12 or 8 to 10, more preferably 9 or 10 carbon atoms. The carbobicycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled, whereas aromatic means that the Huckel (4n + 2) rule is fulfilled. For being “aromatic”, it is sufficient if one of the two rings of the bicyclic moieties is aromatic, while the other is non-aromatic. Preferably, the term “aromatic” in connection with the carbobicyclic ring means that both rings of the bicylic moiety are aromatic, so that, e.g., 8 TT electrons are present in case of a 10-membered aromatic carbobicyclic ring. The term “carbobicylce” or “carbobicyclyl”, unless otherwise indicated, may therefore cover inter alia bicycloalkyl, bicycloalkenyl, as well as bicyclic aromatic groups, for example bicyclohexane (decalin), bicycloheptane (such as norbornane), bicyclooctane (such as bicyclo[2.2.2]octane, bicyclo[3.2.1]octane or bicyclo[4.2.0]octane), bicyclononane (such as bicyclo[3.3.1]nonane or bicyclo[4.3.0]nonane ), bicyclodecane (such as bicyclo[4.4.0]decane), bicycloundecane (such as bicyclo[3.3.3]undecane), norbornene, naphthalene and the like. Preferably, the carbobicycle is a fused carbobicycle, which is preferably aromatic, for example naphthalene.

[0690] The term “carbocyclylalkyl” as used herein, refers to carbocyclyl as defined herein, which is bonded to the remainder of the molecule via an alkyl group having usually from 1 to 2 carbon atoms, preferably 1 carbon atom. Preferably, the term “carbocyclylalkyl” refers to phenylalkyl or cycloalkylalkyl, which refers to the corresponding groups being bonded to the remainder of the molecule via an alkyl group. Preferred examples of carbocyclylalkyl include benzyl (i.e. , phenylmethyl), phenylethyl, cyclopropylmethyl, cyclopropylethyl, cyclobutylmethyl, cyclobutylethyl, cyclopentylmethyl, cyclopentylethyl, cyclohexylmethyl, cyclohexylethyl.

[0691] The term “carbocyclyloxy” as used herein denotes in each case a carbocyclyl as defined herein, which is bonded via an oxygen atom to the remainder of the molecule. Examples of carbocyclyloxy include phenyloxy or cyclopropyloxy. The same applies to the terms “aryloxy” and “benzyloxy” referring to the corresponding groups, which are bonded to the remainder of the molecule via an oxygen atom. As used herein, the terms “aryloxy” and “benzyloxy” refer to the corresponding groups, which are bonded to the remainder of the molecule via an oxygen atom. Preferred examples include phenyloxy and phenylmethyloxy (i.e. benzyloxy).

[0692] The term “heterocyclic” or “heterocyclyl” includes, unless otherwise indicated, in general a 3- to 10-membered, preferably a 4- to 8-membered or 5- to 7-membered, more preferably 5- or 6- membered, in particular 6-membered monocyclic ring. The heterocycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled, whereas aromatic means that the Huckel (4n + 2) rule is fulfilled. The heterocycle typically comprises one or more, e.g. 1 , 2, 3, or 4, preferably 1 , 2, or 3 heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2. The remaining ring members are carbon atoms. In a preferred embodiment, the heterocycle is an aromatic heterocycle, Foreignfiling_text P24-264

[0693] 38 preferably a 5- or 6-membered aromatic heterocycle comprising one or more, e.g. 1 , 2, 3, or 4, preferably 1 , 2, or 3 heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2. Examples of aromatic heterocycles are provided below in connection with the definition of “hetaryl”. “Hetaryls” or “heteroaryls” are covered by the term “heterocycles”. The saturated or partially or fully unsaturated heterocycles usually comprise 1 , 2, 3, 4 or 5, preferably 1 , 2 or 3 heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2.

[0694] The skilled person is aware that S, SO or SO2 is to be understood as follows:

[0695] XsASX XSX

[0696] 0 °z'°

[0697] Further, a skilled person is aware that resonance structures of the oxidized forms may be possible. Saturated heterocycles include, unless otherwise indicated, in general 3- to 10- membered, preferably 4- to 8-membered or 5- to 7-membered, more preferably 5- or 6- membered monocyclic rings comprising 3 to 10, preferably 4 to 8 or 5 to 7, more preferably 5 or 6 atoms comprising at least one heteroatom, such as pyrrolidine, tetrahydrothiophene, tetrahydrofuran, piperidine, tetrahydropyran, dioxane, morpholine or piperazine.

[0698] The term “heterobicyclic” or “heterobicyclyl” includes, unless otherwise indicated, in general 6 to 14-membered, preferably 7- to 12-membered or 8- to 10-membered, more preferably 8- or 9- membered bicyclic rings. The heterobicycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and 5 partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled, whereas aromatic means that the Huckel (4n + 2) rule is fulfilled. For being “aromatic”, it is sufficient if one of the two rings of the bicyclic moieties is aromatic, while the other is non-aromatic. The heterobicycle typically comprises one or more, e.g., 1 , 2, 3, or 4, preferably 1 , 2, or 3 heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2. The remaining ring members are carbon atoms. Examples of heterobicycles include but are not limited to: benzofuranyl, benzothienyl, indolyl, indazolyl, benzimidazolyl, benzoxathiazolyl, benzoxadiazolyl, benzothiadiazolyl, benzoxazinyl, quinolinyl, isoquinolinyl, purinyl, 1 ,8-naphthyridyl, pteridyl, pyrido[3,2-d]pyrim idyl, pyridoimidazolyl, triethylenediamine or quinuclidine and the like.

[0699] The term “heteroaryl” or “aromatic heterocycle” or “aromatic heterocyclic ring” or "hetaryl" or “heterocyclyl” includes monocyclic 5- or 6-membered aromatic heterocycles comprising as ring members 1 , 2, 3 or 4 heteroatoms selected from N, O and S, where S-atoms as ring members may be present as S, SO or SO2. Examples of 5- or 6-membered aromatic heterocycles include pyridyl (also referred to as pyridinyl), i.e. 2-, 3-, or 4-pyridyl, pyrimidinyl, i.e. 2-, 4- or 5- pyrimidinyl, pyrazinyl, pyridazinyl, i.e. 3- or 4-pyridazinyl, thienyl, i.e. 2- or 3-thienyl, furyl, i.e. 2- or 3-furyl, pyrrolyl, i.e. 2- or 3-pyrrolyl, oxazolyl, i.e. 2-, 3- or 5-oxazolyl, isoxazolyl, i.e. 3-, 4- or 5-isoxazolyl, thiazolyl, i.e. 2-, 3- or 5- thiazolyl, isothiazolyl, i.e. 3-, 4- or 5-isothiazolyl, pyrazolyl, i.e. 1-, 3-, 4- or 5-pyrazolyl, i.e. 1-, 2-, 4- or 5-imidazolyl, oxadiazolyl, e.g. 2- or 5- [1 ,3,4]oxadiazolyl, 4- or 5-(1 ,2,3-oxadiazol)yl, 3- or 5-(1 ,2,4-oxadiazol)yl, 2- or 5-(1 ,3,4- thiadiazol)yl, thiadiazolyl, e.g. 2- or 5-(1 ,3,4-thiadiazol)yl, 4- or 5-(1 ,2,3-thiadiazol)yl, 3- or 5- (1 ,2,4-thiadiazol)yl, triazolyl, e.g. 1 H-, 2H- or 3H-1 ,2,3-triazol-4-yl, 2H-triazol-3-yl, 1 H-, 2H-, or 4H-1 ,2,4-triazolyl and tetrazolyl, i.e. 1 H- or 2H-tetrazolyl. Unless otherwise indicated, the term “hetaryl” further covers “aromatic heterobicycles” as defined above. Foreignfiling_text P24-264

[0700] 39

[0701] The term “heterocyclylalkyl” as used herein, refers to heterocyclyl as defined herein, which is bonded to the remainder of the molecule via an alkyl group having usually from 1 to 2 carbon atoms, preferably 1 carbon atom.

[0702] The term “heterocyclyloxy” as used herein denotes in each case a heterocyclyl as defined herein, which is bonded via an oxygen atom to the remainder of the molecule.

[0703] The term “racemic mixture of O-O-trans isomers” as used herein refers to a racemic mixture of the two possible O-O-trans isomers of the compounds of formula (I), i.e. the isomers of formula (IA) and (IB):

[0704] The term "cancer" pertains to a disease characterized by the rapid and uncontrolled growth of abnormal cells that can spread locally or through the bloodstream and lymphatic system. Various cancers, including colorectal, gastric, endometrial, prostate, adrenocortical, uterine, cervical, oesophageal, breast, kidney, and ovarian cancer, among others, are described herein. The terms "tumour", “tumor” and "cancer" are used interchangeably and encompass both solid and liquid tumours, including diffuse or circulating tumours. As used herein, the terms "tumour" and "cancer" include premalignant, as well as malignant cancers and tumours.

[0705] A “TREX1 modulator” or " TREX1 inhibitor" refers to a compound that modulates or inhibits TREX1.

[0706] The term "medicine" as used herein is intended to be a generic term inclusive of prescription and non-prescription medications. The compound for use in medicine should be understood as being useful in maintaining health or promoting recovery from a disease, preferably cancer. Further, the term "medicine" includes medicine in any form, including, without limitation, e.g., pills, salves, creams, powders, ointments, capsules, injectable medications, drops, vitamins and suppositories. The scope of this invention is not limited by the type, form or dosage of the medicine.

[0707] A "pharmaceutical composition" is a compound of the invention or a pharmaceutically acceptable salt thereof, along with at least one pharmaceutically acceptable carrier, prepared for oral or parenteral administration. A "pharmaceutically acceptable carrier" includes substances used in the preparation or use of pharmaceutical compositions, such as diluents, solvents, dispersion media, surfactants, antioxidants, preservatives, isotonic agents, buffering agents, emulsifiers, and more. The term “pharmaceutically acceptable excipient” as used herein refers to compounds commonly comprised in pharmaceutical compositions, which are known to the skilled person. Typically, a pharmaceutically acceptable excipient can be defined as being pharmaceutically inactive.

[0708] A "therapeutically effective amount" of a compound refers to an amount that, when administered to a subject, achieves a biological or medical response, such as the reduction of enzyme or Foreignfiling_text P24-264

[0709] 40 protein activity or the alleviation, mitigation, or prevention of symptoms, disease progression, or the disease itself.

[0710] A "subject" can be a human, primate, dog, rabbit, guinea pig, pig, rat, or mouse, depending on the context.

[0711] "Treat," "treating," or "treatment" refers to alleviating or mitigating a disease or disorder or reducing symptoms. The term “treatment” is to be understood as also including the option of “prophylaxis”. Thus, whenever reference is made herein to a “treatment” or “treating”, this is to be understood as “treatment and / or prophylaxis” or “treating and / or preventing”. "Prevent," "preventing," or "prevention" involves prophylactic treatment or delaying the onset or progression of a disease. A subject is "in need of" treatment if they would benefit from it biologically, medically, or in terms of quality of life.

[0712] It needs to be understood that the term “comprising” is not limiting. For the purposes of the present invention, the term “consisting of” is considered to be a preferred embodiment of the term “comprising of”. If hereinafter a group is defined to comprise at least a certain number of embodiments, this is also meant to encompass a group which preferably consists of these embodiments only.

[0713] The terms “about” and “approximately” in the context of the present invention denotes an interval of accuracy that a person skilled in the art will understand to still ensure the technical effect of the feature in question. The term typically indicates a deviation from the indicated numerical value of ±10% and preferably ±5%.

[0714] Finally, terms such as “a”, “an”, “the”, and similar terms encompass both singular and plural forms unless otherwise indicated or contradicted by the context. The use of examples or exemplary language serves to clarify the invention but does not limit the scope of the claimed invention.

[0715] Routes of Administration and Formulations

[0716] A pharmaceutical composition according to the present invention may be formulated for oral, buccal, nasal, rectal, topical, transdermal or parenteral application. Preferred non-parenteral routes include mucosal (e.g., oral, vaginal, nasal, cervical, etc.) routes, of which the oral application may be preferred. Preferred parenteral routes include but are not limited to, one or more of subcutaneous, intravenous, intra-muscular, intraarterial, intradermal, intrathecal and epidural administrations. Preferably administration is by non-parenteral routes. Particularly preferred is oral administration. The compound according to formula (I) should be applied in pharmaceutically effective amounts, for example in the amounts as set out herein below.

[0717] A pharmaceutical composition of the present invention may also be designated as formulation or dosage form. A compound of formula (I) may also be designated in the following as (pharmaceutically) active agent or active compound.

[0718] Pharmaceutical compositions may be solid or liquid dosage forms or may have an intermediate, e.g. gel-like character depending inter alia on the route of administration. Foreignfiling_text P24-264

[0719] 41

[0720] In general, the inventive dosage forms can comprise various pharmaceutically acceptable excipients which will be selected depending on which functionality is to be achieved for the dosage form. A “pharmaceutically acceptable excipient” in the meaning of the present invention can be any substance used for the preparation of pharmaceutical dosage forms, including coating materials, film-forming materials, fillers, disintegrating agents, release-modifying materials, carrier materials, diluents, binding agents and other adjuvants. Typical pharmaceutically acceptable excipients include substances like sucrose, mannitol, sorbitol, starch and starch derivatives, lactose, and lubricating agents such as magnesium stearate, disintegrants and buffering agents.

[0721] The term “carrier” denotes pharmaceutically acceptable organic or inorganic carrier substances with which the active ingredient is combined to facilitate the application. Suitable pharmaceutically acceptable carriers include, for instance, water, aqueous salt solutions, alcohols, oils, preferably vegetable oils, propylene glycol, polyoxyethelene sorbitans, polyethylene-polypropylene block co-polymers such as poloxamer 188 or poloxamer 407, polyethylene glycols such as polyethylene glycol 200, 300, 400, 600, etc., gelatine, lactose, amylose, magnesium stearate, surfactants, perfume oil, fatty acid monoglycerides, diglycerides and triglycerides, polyoxyethylated medium or long chain fatty acids such as ricinoleic acid, and polyoxyethylated fatty acid mono-, di, and triglycerides such as capric or caprilic acids, petroethral fatty acid esters, hydroxymethyl celluloses such as hydroxymethyl, hydroxyethyl, hydroxypropyl, hydroxypropyl acetate succinate, polyvinylpyrrolidone, crosspovidone and the like. Preferably, the compounds of the present invention are administered in a pharmaceutical composition comprising of lipids, interbilayer crosslinked multilamellar vesicles, biodegradeable poly(D,L-lactic-co-glycolic acid) [PLGA]-based or poly anhydride-based nanoparticles or microparticles, nanoporous particle-supported lipid bilayers and as a conjugate with an antibody.

[0722] The pharmaceutical compositions can be sterile and, if desired, mixed with auxiliary agents, like lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavoring and / or aromatic substances and the like which do not deleteriously react with the active compound. It is to be understood that the term “carrier” also covers an antibody that delivers the compound of formula (I).

[0723] If liquid dosage forms are considered for the present invention, these can include pharmaceutically acceptable emulsions, solutions, suspensions and syrups containing inert diluents commonly used in the art such as water. These dosage forms may contain e.g. microcrystalline cellulose for imparting bulk, alginic acid or sodium alginate as a suspending agent, methylcellulose as a viscosity enhancer and sweeteners / flavoring agents.

[0724] For parenteral application, particularly suitable vehicles consist of solutions, preferably oily or aqueous solutions, as well as suspensions, emulsions, or implants. Pharmaceutical formulations for parenteral administration are particularly preferred and include aqueous solutions of the compounds of formula (I) in water-soluble form. Additionally, suspensions of the compounds of formula (I) may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Foreignfiling_text P24-264

[0725] 42

[0726] Particularly preferred dosage forms are injectable preparations of a compound of formula (I). Thus, sterile injectable aqueous or oleaginous suspensions can for example be formulated according to the known art using suitable dispersing agents, wetting agents and / or suspending agents. A sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent. Among the acceptable vehicles and solvents that can be used are water and isotonic sodium chloride solution. Sterile oils are also conventionally used as solvent or suspending medium. Preferred applications for injectable preparations comprising the compounds of the present invention are intravenous, intratumoral and peritumoral administration.

[0727] Suppositories for rectal administration of a compound of formula (I) can be prepared by e.g. mixing the compound with a suitable non-irritating excipient such as cocoa butter, synthetic triglycerides and polyethylene glycols which are solid at room temperature but liquid at rectal temperature such that they will melt in the rectum and release the compound according to formula (I) from said suppositories.

[0728] For administration by inhalation, the compounds according to the present invention may be conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g. gelatine for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

[0729] Oral dosage forms may be liquid or solid and include e.g. tablets, troches, pills, capsules, powders, effervescent formulations, dragees and granules. Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatine, gum tragacanth, methyl cellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. The oral dosage forms may be formulated to ensure an immediate release of the compound of formula (I) or a sustained release of the compound of formula (I).

[0730] A solid dosage form may comprise a film coating. For example, the inventive dosage form may be in the form of a so-called film tablet. A capsule of the invention may be a two-piece hard gelatine capsule, a two-piece hydroxypropylmethylcellulose capsule, a two-piece capsule made of vegetable or plant-based cellulose, or a two-piece capsule made of polysaccharide.

[0731] The dosage form according to the invention may be formulated for topical application. Suitable pharmaceutical application forms for such an application may be a topical nasal spray, sublingual administration forms and controlled and / or sustained release skin patches. For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner. Foreignfiling_text P24-264

[0732] 43

[0733] The compositions may conveniently be presented in unit dosage forms and may be prepared by any of the methods well known in the art of pharmacy. The methods can include the step of bringing the compounds into association with a carrier, which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Liquid dose units are vials or ampoules. Solid dose units are tablets, capsules and suppositories.

[0734] As regards human patients, the compound of formula (I) may be administered to a patient in an amount of about 0.001 mg to about 5000 mg per day, preferably of about 0.01 mg to about 1000 mg per day, more preferably of about 0.05 mg to about 250 mg per day, which is the effective amount. The phrase “effective amount” means an amount of compound that, when administered to a mammal in need of such treatment, is sufficient to treat or prevent a particular disease or condition.

[0735] Medical Indications

[0736] The compounds according to the present invention are suitable for use in medicine. The compounds of the present invention are useful for modulating TREX1 , in particular in inhibiting TREX1. Thus, the compounds according to the present invention are particularly suitable for use in the treatment of a disease associated with modulating, in particular inhibiting, TREX1 , in particular a proliferative disorder such as cancer or pre- cancerous syndromes.

[0737] Thus, in one embodiment, the present invention relates to a compound of formula (I) as defined herein or a pharmaceutical composition as defined herein for use in medicine. In particular, the compound of the present invention or a pharmaceutical composition comprising the same is for use in the treatment of a disease selected from the group consisting of cancer, such as breast cancer, small cell lung cancer, and colorectal cancer, TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0738] In further aspects, the present invention relates to methods of treatment comprising the administration of a compound of formula (I) as defined herein or a pharmaceutical composition comprising the same as defined herein to a human or animal body. In particular, the present invention relates to methods of treating diseases that can be addressed by TREX1 modulation, preferably that can be addressed by TREX1 inhibition, with a particular emphasis on cancers, such as breast cancer, small cell lung cancer and colorectal cancer, in particular cancers with chromosomal instability.

[0739] Moreover, the invention further relates to the manufacture of a medicament for the treatment of diseases that can be addressed by TREX1 modulation, preferably TREX1 inhibition, with a particular emphasis on cancers, such as breast cancer, small cell lung cancer and colorectal cancer, in particular cancers with chromosomal instability.

[0740] It is to be understood that in connection with the medical uses of the invention it can be preferred that the compounds according to the present invention are administered in Foreignfiling_text P24-264

[0741] 44 combination with antibodies, radiotherapy, surgical therapy, immunotherapy, chemotherapy, toxin therapy, gene therapy, or any other therapy known to those of ordinary skill in the art for treatment of a particular disease. This is particularly relevant in connection with the treatment of cancer.

[0742] The present invention is further illustrated by the following examples.

[0743] Examples

[0744] The compounds described herein may be prepared using the following methods and schemes. The sequence of reactions is an illustrative example. Swapping steps is possible and reaction conditions can be easily. Unless specified otherwise, all starting materials used are commercially available or can be synthesised analogously to the described intermediates or literature described routes.

[0745] The following abbreviations refer respectively to the definitions below: aq (aqueous), h (hour), g (gram), L (liter), mg (milligram), MHz (Megahertz), min. (minute), mm (millimeter), mmol (millimole), mM (millimolar), m.p. (melting point), eq ( eq.alent), mL (milliliter), L (microliter), ACN (acetonitrile), AcOH (acetic acid), CDCh (deuterated chloroform), CD3OD (deuterated methanol), CH3CN (acetonitrile), c-hex (cyclohexane), DCC (dicyclohexyl carbodiimide), DCM (dichloromethane), DIC (diisopropyl carbodiimide), DIEA (diisopropylethylamine), DMF (dimethylformamide), DMSO (dimethylsulfoxide), DMSO-de (deuterated dimethylsulfoxide), EDC (1-(3-dimethyl-amino-propyl)-3-ethylcarbodiimide), ESI (Electro-spray ionization), EtOAc (ethyl acetate), Et20 (diethyl ether), EtOH (ethanol), FA (formic acid), PG (protecting group), HATU (dimethylamino-([1,2,3]triazolo[4,5-b]pyridin-3-yloxy)-methylene]- dimethyl-ammonium hexafluorophosphate), HPLC (High Performance Liquid Chromatography), i-PrOH (2-propanol), K2CO3 (potassium carbonate), LC (Liquid Chromatography), MeOH (methanol), MgSC>4 (magnesium sulfate), MS (mass spectrometry), MTBE (Methyl tert-butyl ether), NaHCOs (sodium bicarbonate), NaBH4 (sodium borohydride), NMM (N-methyl morpholine), NMR (Nuclear Magnetic Resonance), PyBOP (benzotriazole- 1-yl-oxy-tris- pyrrolidino-phosphonium hexafluorophosphate), RT (room temperature), Rt (retention time), SPE (solid phase extraction), TBTU (2-(1-H-benzotriazole-1-yl)-1,1,3,3-tetramethyluromium tetrafluoro borate), TEA (triethylamine), TFA (trifluoroacetic acid), THF (tetrahydrofuran), TLC (Thin Layer Chromatography), UV (Ultraviolet).

[0746] Instrument specifications:

[0747] The microwave chemistry is performed on a single mode microwave reactor EmrysTM Optimiser from Personal Chemistry.

[0748] Preparative column chromatography was performed with a Teledyne-lsco CombiFlash EZ Prep or Biotage Isolera Prime or preparative HPLC (e.g. Agilent 1200. Column: Chromolith prep RP 18e Merck KGaA. Mobile phase: 0.1% formic acid in water / 0.1% formic acid in acetonitrile or as described)

[0749] LCMS data provided in the examples are given with retention time, purity and / or mass in m / z. Mass spectrum: LC / MS Waters ZMD (ESI) or Hewlett Packard System of the HP 1100 series (Ion source: Electrospray (positive mode) or Waters Acquity H Class SQD; Scan: 100-1000 m / z; Foreignfiling_text P24-264

[0750] 45

[0751] Fragmentation-voltage: 60 V; Gas-temperature: 300°C, DAD: 220 nm. Flow rate: 2.4 ml / Min.

[0752] The used splitter reduced the flow rate after the DAD for the MS to 0,75ml / Min; Column: Chromolith Speed ROD RP-18e 50-4.6; Solvent: LiChrosolv-quality from the company Merck KGaA or as mentioned in the method.

[0753] Preparative HPLC was performed on an Agilent 1200. Column: Chromolith prep RP 18e Merck KGaA. Mobile phase: 0.1% formic acid in water / 0.1% formic acid in acetonitrile.

[0754] 1H NMR was recorded on Bruker DPX-300, DRX-400 or AVII-400 spectrometer, using residual signal of deuterated solvent as internal reference. Chemical shifts (5) are reported in ppm relative to the residual solvent signal (5 = 2.49 ppm for 1 H NMR in DMSO-d6). 1H NMR data are reported as follows: chemical shift (multiplicity, coupling constants, and number of hydrogens). Multiplicity is abbreviated as follows: s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), br (broad).

[0755] General Synthetic Schemes:

[0756] Scheme A: synthesis route and typical conditions to key intermediate

[0757] Scheme B: synthesis route and typical conditions to described examples

[0758] Description of the synthesis scheme and compound examples:

[0759] Synthesis of Example No. 41: rac-5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6- oxo-1,6-dihydropyrimidin-4-yl)piperidin-3-yl]oxy}-2,3-dihydro-1H-isoindol-1-one

[0760] Intermediate tert-butyl 4-(3,5-difluorophenyl)-1 ,2,3,6-tetrahydropyridine-1-carboxylate Foreignfiling_text P24-264

[0761] 46

[0762] To a mixture of tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,2,3,6- tetrahydropyridine-1 -carboxylate (5.00 g; 15.85 mmol; 1.00 eq.) and 1-bromo-3,5- difluorobenzene (2.90 g; 14.26 mmol; 0.90 eq.) in Dioxane-1,4 (20.00 ml) and Water (4.00 ml) was added Pd(dtbpf)CI2 (1.09 g; 1.58 mmol; 0.10 eq.) and K2CO3 (4.60 g; 31.69 mmol; 2.00 eq.) at room temperature. The resulting mixture was stirred for 4 h at 100 °C under nitrogen atmosphere. The mixture was concentrated under reduced pressure and purified by column chromatography (silica gel, 82:18 PE / EA) to afford tert-butyl 4-(3,5-difluorophenyl)-1, 2,3,6- tetrahydropyridine-1 -carboxylate (3.70 g; 78.4 %) as colourless solid. LC / MS (Poroshell HPH- C18; Solvent A: 6.5mM NH4HCO3+NH4OH (pH=10); Solvent B: ACN): purity 99.2 %; Rt 1.282 min; (M+H-tBu) 240.02 m / z.

[0763] Intermediate tert-butyl 6-(3,5-difluorophenyl)-7-oxa-3-azabicyclo[4.1 ,0]heptane-3-carboxylate

[0764] To a stirred solution of tert-butyl 4-(3,5-difluorophenyl)-1,2,3,6-tetrahydropyridine-1-carboxylate (14.00 g; 46.05 mmol; 1.00 eq.) in DCM (200.00 ml), was added m-chloroperbenzoic acid (36.67 g; 138.14 mmol; 3.00 eq.) portion wise at 0 °C, the resulting suspension was stirred at RT for 16 h. The reaction mixture was filtered, washed with DCM (30 mL) and the filtrate was quenched with saturated sodium thiosulfate solution (150 mL). The organic layer was basified with 10% aqueous sodium hydroxide solution (100 mL), separated the layers and the aqueous layer was extracted with DCM (100 mL). The combined organic layer was washed with brine solution, dried with sodium sulphate, filtered and concentrated under reduced pressure to obtain a crude product. The crude was purified by flash column chromatography (230-400 silica gel, 8- 10% ethyl acetate in pet ether) to afford tert-butyl 6-(3,5-difluorophenyl)-7-oxa-3- azabicyclo[4.1.0]heptane-3-carboxylate (6.70 g; 45.1 %) as pale yellow liquid. 1H-NMR (400 MHz, DMSO-d6) 5 7.24-7.10 (m, 3H), 3.87-3.86 (m, 1 H), 3.82-3.81 (m, 1 H), 3.69-3.64 (m, 1H), Foreignfiling_text P24-264

[0765] 47

[0766] 3.22-3.14 (m, 2H), 2.47-2.42 (m, 1 H), 2.10-1.47 (m, 1 H), 1.44 (s, 9H). LC / MS (Instrument: Agilent 1290 Infinity II, Column: CSH C-18 (30x2.1mm) 1.7pm; Mobile phase A: 0.1% FA in Water, Mobile phase B: 0.1% FA in ACN, Flow Rate: 1.0mL / min, Gradient: 0.0 min: 03% B, 1.5- 1.9 min: 97% B, 2.0 min: 03% B): purity 97 %; Rt 1.242 min; (M-Boc+H) 212.2 m / z.

[0767] Intermediate rac- tert- butyl (3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-[(1-oxo-2,3-dihydro-1 H- isoindol-5-yl)oxy]piperidine-1 -carboxylate

[0768] A well stirred solution of tert-butyl 6-(3,5-difluorophenyl)-7-oxa-3-azabicyclo[4.1.0]heptane-3- carboxylate (300.00 mg; 0.93 mmol; 1.00 eq.) in Dimethylsulfoxide (3.00 ml), were added dipotassium carbonate (262.36 mg; 1.86 mmol; 2.00 eq.) and 5-hydroxy-2,3-dihydro-1 H- isoindol-1-one (141.57 mg; 0.93 mmol; 1.00 eq.) at RT and stirred at 100 °C for 16 h. The reaction mixture was poured into ice water (50 mL) and filtered. The precipitate was washed with water (20 mL) and dried well under reduced pressure to obtain crude product. The crude was purified by flash column chromatography (60-120 silica gel, MeOH / DCM) to afford rac-tert- butyl (3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-[(1-oxo-2,3-dihydro-1H-isoindol-5- yl)oxy]piperidine-1-carboxylate (300.00 mg; 65.9 %) as pale yellow solid.

[0769] LC / MS (Instrument: Agilent 1290 Infinity II, Column: CSH C-18 (30x2.1mm) 1.7 pm; Mobile phase A: 0.1% FA in Water, Mobile phase B: 0.1% FA in ACN, Flow Rate: 1.0mL / min, Gradient: 0.0 min: 03% B, 1.5-1.9 min: 97% B, 2.0 min: 03% B): purity 94 %; Rt 0.908 min; [M+H-tBu] 405.1 m / z.

[0770] Intermediate: rac-5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxypiperidin-3-yl]oxy}-2,3-dihydro-1H- isoindol-1-one hydrochloride

[0771] A well stirred suspension of rac- tert- butyl (3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-[(1-oxo- 2,3-dihydro-1 H-isoindol-5-yl)oxy]piperidine-1-carboxylate (300.00 mg; 0.61 mmol; 1.00 eq.) in DCM (3.00 ml), was added Hydrogen chloride solution 4.0M in dioxane (2.30 ml; 9.19 mmol; 15.00 eq.) at 0 °C. The resulting solution was stirred at RT for 2 h. The reaction mixture was concentrated under reduced pressure, triturated with MTBE and dried to afford rac-5-{[(3S,4R)- 4-(3,5-difluorophenyl)-4-hydroxypiperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one hydrochloride (240.00 mg; 87.9 %) as pale yellow solid. Foreignfiling_text P24-264

[0772] 48

[0773] LC / MS (Instrument: Agilent 1290 Infinity II, Column: CSH C-18 (30x2.1mm) 1.7 pm; Mobile phase A: 0.1% FA in Water, Mobile phase B: 0.1% FA in ACN, Flow Rate: 1.0mL / min, Gradient: 0.0 min: 03% B, 1.5-1.9 min: 97% B, 2.0 min: 03% B): purity 89 %; Rt 0.426 min; (M+H) 361.1 m / z.

[0774] Example No. 41 : rac-5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6- dihydropyrimidin-4-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one

[0775] A well stirred solution of rac-5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxypiperidin-3-yl]oxy}-2,3- dihydro-1 H-isoindol-1-one hydrochloride (240.00 mg; 0.54 mmol; 1.00 eq.) in DMSO (2.50 ml) were added 6-bromo-3-methyl-3,4-dihydropyrimidin-4-one (134.98 mg; 0.70 mmol; 1.30 eq.) and followed by N,N-Diisopropylethylamine (0.48 ml; 2.69 mmol; 5.00 eq.) at RT and stirred at 120 °C for 16 h. The reaction mixture was purified by reveres phase chromatography (10mM ammonium bicarbonate in water and Acetonitrile) to afford rac-5-{[(3S,4R)-4-(3,5- difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4-yl)piperidin-3-yl]oxy}-2,3- dihydro-1 H-isoindol-1-one (153.00 mg; 60.4 %) as off-white solid.

[0776] 1 H NMR (DMSO) 5; 1 H-NMR (400 MHz, DMSO-d6): ppm 8.27 (s, 1 H), 7.97 (s, 1 H), 7.42 (d, J = 8.0 Hz, 1 H), 7.26-7.22 (m, 2H), 7.08-7.02 (m, 1 H), 6.94 (d, J = 1.6 Hz, 1 H), 6.77-6.74 (m, 1 H), 5.98 (s, 1 H), 5.31 (s, 1 H), 4.59-4.56 (m, 1 H), 4.42 (s, 1 H), 4.28-4.17 (m, 3H), 3.49-3.46 (m, 1 H), 3.30-3.28 (m, 1 H), 3.21 (s, 3H), 2.68-2.60 (m, 1 H), 1.78-1.75 (m, 1 H). LC / MS (Instrument: Agilent 1290 Infinity II, Column: X-BRIDGE C8 (4.6 x 50 mm); 3.5pm; Mobile phase A:10mM Ammonium bicarbonate in water, Mobile phase B: Acetonitrile, 0 min: 10% B, 4.0-5.0 min: 95% B, 5.5-6.5 min: 10% B): purity 100 %; Rt 1.806 min; (M+H) 469.1 m / z.

[0777] Example No. 71- lsomer-1 : rel-5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo- 1 ,6-dihydropyrimidin-4-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one and Example No. 71- lsomer-2: rel-5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one Foreignfiling_text P24-264

[0778] 49

[0779] The enantiomeric mixture of rac-5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo- 1,6-dihydropyrimidin-4-yl)piperidin-3-yl]oxy}-2,3-dihydro-1H-isoindol-1-one (100 mg) was separated by chiral SFC on ChiralPAK AD-H

[0780] To afford enantiomer 1, first eluting (38.5 mg) and enantiomer 2, second eluting, (40.7 mg) as colourless solid. Stereocenters are arbitrarily assigned.

[0781] Enantiomer 1: Example No. 71- lsomer-1: rel-5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1- methyl-6-oxo-1,6-dihydropyrimidin-4-yl)piperidin-3-yl]oxy}-2,3-dihydro-1H-isoindol-1-one HPLC MS(LC-MS, Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1%B to 99%B; 2,0 to 2,5 min. 99%B): [M+H] 469.1 m / z; purity 100 %; Rt 1.241 min. Chiral SFC (Column AD-H 250x4.6 mm, Modifier 20% EtOH, Flow 6 ml / min): Rt 4.7 min.

[0782] Enantiomer 2: Example No. 71- lsomer-2:rel-5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1- methyl-6-oxo-1,6-dihydropyrimidin-4-yl)piperidin-3-yl]oxy}-2,3-dihydro-1H-isoindol-1-one LC-MS (Agilent 1200 Series, Chromolith HR RP-18e 50-4,6; 3.3ml / min; solvent A: Water + 0.1% TFA; solvent B: Acetonitrile + 0.1% TFA; 220 nm; 0 to 2,0 min: 1%B to 99%B; 2,0 to 2,5 min. 99%B): purity 100 %, Rt 1.24 min, [M+H] 469.1 m / z; Chiral SFC (Column AD-H 250x4.6 mm, Modifier 20% EtOH, Flow 6 ml / min): Rt 6.46 min.

[0783] Intermediate: rac-tert-butyl (3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3- yloxy)piperidine-1 -carboxylate

[0784] To a mixture of tert-butyl 6-(3,5-difluorophenyl)-7-oxa-3-azabicyclo[4.1.0]heptane-3-carboxylate (1.59 g; 4.72 mmol; 1.00 eq.) and pyridin-3-ol (1.42 g; 14.17 mmol; 3.00 eq.) in DMF (10.00 ml) was added Cs2CO3 (3.11 g; 9.45 mmol; 2.00 eq.) at room temperature. The resulting mixture was stirred for 4 h at 100 °C. The resulting mixture was poured into water (30 mL), extracted with EA (3 x 30 mL). The combined organic layers were washed with brine (30 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE / EA) to afford rac-tert-butyl (3R,4S)-4-(3,5-difluorophenyl)-4- hydroxy-3-(pyridin-3-yloxy)piperidine-1-carboxylate (1.16 g, 47.1 %) as colourless solid. LC / MS Foreignfiling_text P24-264

[0785] 50

[0786] (Shim-Pack C18; Solvent A:watei75mM NH4HCO3; Solvent B:Acetonitrile): purity 96.1 %; Rt 0.904 min; (M+H) 407.15.

[0787] Intermediate rac-(3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4-ol hydrochloride

[0788] HCI

[0789] (racemic mixture of O-O-trans isomers)

[0790] A solution of rac-tert-butyl (3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3- yloxy)piperidine-1 -carboxylate (1.14 g; 2.70 mmol; 1.00 eq.) in MeOH (5.00 ml) was added HCI (4 N in dioxane) (8.19 g; 26.96 mmol; 10.00 eq.) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure to afford rac-(3R,4S)-4- (3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4-ol hydrochloride (942 mg, 96%). LC / MS (Poroshell HPH-C18; Solvent A: 6.5mM NH4HCO3+NH4OH (pH=10); Solvent B: ACN): purity 93.7 %; Rt 0.584 min; (M+H) 307.2 m / z.

[0791] Example No. 58: rac-(3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3- yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol

[0792] A solution of rac-(3R,4S)-4- (3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4-ol hydrochloride (400.00 mg; 1.09 mmol; 1.00 eq.) and 2-chloropyrimidine (145.00 mg; 1.20 mmol; 1.10 eq.) in CH3CN (5.00 ml) was added DIEA (446.00 mg; 3.28 mmol; 3.00 eq.) dropwise at room temperature. The resulting mixture was stirred for 4 h at 100 °C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (eluting with 95:5 DCM / MeOH) to afford rac-(3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol (282.00 mg; 64.7 %) as colourless solid. LC / MS (Poroshell HPH-C18; Solvent A: 6.5mM NH4HCO3+NH4OH(pH=10); Solvent B: ACN): purity 96.5 %; Rt 0.702 min; (M+H) 385.15 m / z.

[0793] Separation into pure enantiomers. Stereocenters are arbitrarily assigned.

[0794] Example No. 2 - Enantiomer- 1: rel-(3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1- (pyrimidin-2-yl) piperidin-4-ol and Example No. 2 - Enantiomer-2: rel-(3S,4R)-4-(3,5- difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol Foreignfiling_text P24-264

[0795] 51 rac-(3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol (282.00 mg; 0.71 mmol; 1.00 eq.) was separated into both enantiomers with Prep-chiral-HPLC (CHIRALPAK IF 2*25 cm, 5 pm; Mobile Phase A: HEX(0.5% 2M NH3-MeOH), Mobile Phase B: EtOH; Flow rate: 20 mL / min; Gradient: isocratic 15; Wave Length: 220 / 254 nm; Sample Solvent: EtOH; Injection Volume: 0.3 mL) to afford enantiomer 1 (RT1 (min): 8.811) and enantiomer (RT2(min): 11.202. Stereocenters are arbitrarily assigned.

[0796] Enantiomer 1 (RT1 (min): 8.811) Example No. 2- Enantiomer-1 : rel-(3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol (84.90 mg; 0.22 mmol; 31.1 %; white solid)

[0797] 1 H NMR (DMSO) 5; 1 H NMR (400 MHz, DMSO-d6) 8.21 (s, 2H), 8.08 - 8.02 (m, 1 H), 7.88 (d, J = 2.7 Hz, 1 H), 7.25 (dd, J = 9.1 , 2.3 Hz, 2H), 7.25 - 7.10 (m, 2H), 7.05 (dd, J = 10.2, 8.0 Hz, 1 H), 6.53 (t, J = 4.7 Hz, 1 H), 5.97 (s, 1 H), 4.96 (d, J = 14.2 Hz, 1 H), 4.77 (d, J = 13.0 Hz, 1 H), 4.42 (s, 1 H), 3.52 (d, J = 14.0 Hz, 1 H), 3.32 (d, J = 14.1 Hz, 1 H), 2.59 (td, J = 13.2, 4.8 Hz, 1 H), 1.78 (d, J = 13.5 Hz, 1 H). HPLC (Poroshell HPH-C18; Solvent A: water / 5mM NH4HCO3; Solvent B: Acetonitrile): (percent area) 99.61 %; Rt 6.545 min. LC / MS(Shim-Pack C18;Solvent A:water / 5mM NH4HCO3; Solvent B:Acetonitrile): (percent area) 99.86 %; Rt 1.03 min; (M+H) 385.1.

[0798] Enantiomer (RT2(min): 11.202. Example No. 2-Enantiomer-2: rel-(3S,4R)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol (82.00 mg; 0.21 mmol; 30.1 %; white solid).

[0799] NMR 1 H NMR (400 MHz, DMSO-d6) 8.21 (s, 2H), 8.08 - 8.02 (m, 1 H), 7.87 (d, J = 2.7 Hz, 1 H), 7.25 (d, J = 8.7 Hz, 2H), 7.22 - 7.10 (m, 2H), 7.05 (t, J = 9.2 Hz, 1 H), 6.53 (t, J = 4.8 Hz, 1 H), 5.97 (s, 1 H), 4.96 (d, J = 14.1 Hz, 1 H), 4.77 (d, J = 12.5 Hz, 1 H), 4.42 (s, 1 H), 3.52 (d, J =

[0800] 14.1 Hz, 1 H), 2.59 (td, J = 13.3, 4.8 Hz, 1 H), 1.78 (d, J = 13.4 Hz, 1 H). LCMS (Shim-Pack C18; Solvent A: water / 5mM NH4HCO3; Solvent B: Acetonitrile): purity 99.86 %, Rt 1.03 min, [M+H]

[0801] 385.1 m / z.

[0802] Example No.7: rel-(3R,4S)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin- 3-yloxy)piperidin-4-ol

[0803] And Example No.88 rel-(3S,4R)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3- (pyridin-3-yloxy)piperidin-4-ol Foreignfiling_text P24-264

[0804] 52

[0805] Intermediate tert-butyl N-{2-[(2-chloropyrimidin-5-yl)oxy]ethyl}carbamate

[0806] A well stirred solution of 2-chloropyrimidin-5-ol (2.00 g; 14.86 mmol; 1.00 eq.) in THF (60.00 ml) were added triphenylphosphane (4.77 g; 17.83 mmol; 1.20 eq.) and tert-butyl N-(2- hydroxyethyl)carbamate (3.67 g; 22.29 mmol; 1.50 eq.) at 0 °C and then, Diethyl azodicarboxylate (3.17 g; 17.83 mmol; 1.20 eq.) in THF (10.00 ml) was added dropwise slowly at the same temperature. The reaction mixture was stirred at RT for 18h. The reaction mixture was concentrated and the resulting crude was purified by flash chromatography (silica gel: 230- 400; Eluent: 40% EtOAc in pet ether) to afford tert-butyl N-{2-[(2-chloropyrimidin-5- yl)oxy]ethyl}carbamate (3.50 g; 80.8 %) as Off white solid. 1 H NMR (DMSO) 5; 1 H-NMR (400 MHz, DMSO-d6): ppm 8.55 - 8.54 (m, 2H), 7.06 (t, J = 5.2 Hz, 1 H), 4.16 (t, J = 5.6 Hz, 2H), 3.33 - 3.29 (m, 2H), 1.37 (s, 9H). 1 H NMR complies. LC / MS (Column : XBridge BEH C18(4.6x50mm) 2.5pm;Solvent A: water + 10Mm NH4HCO3; Solvent B: AON; Flow: 1 ml / min; Gradient: 0 min: 5% B, 2.2 min: 100 % B, 3.2 min: 100% B, 3.5 min: 5% B, 4 min 5% B.): purity 93.87 %; Rt 1.68 min.

[0807] Intermediate rac- tert- butyl N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3- yloxy)piperidin-1-yl]pyrimidin-5-yl}oxy)ethyl]carbamate

[0808] A well stirred solution of rac-(3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4-ol (350.00 mg; 0.80 mmol; 1.00 eq.) in DMSO (8.00 ml) were added tert-butyl N-{2-[(2- chloropyrimidin-5-yl)oxy]ethyl}carbamate (301.67 mg; 1.03 mmol; 1.30 eq.) and N,N- Foreignfiling_text P24-264

[0809] 53

[0810] Diisopropylethylamine (0.42 ml; 2.39 mmol; 3.00 eq.) at RT and stirred at 100 °C for 18h. The reaction mixture was concentrated under reduced pressure. The resulting crude was purified by reverse phase chromatography (Buffer A:0.1% Ammonium bicarbonate in water; Buffer B: ACN) to afford rac-tert-butyl N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3- yloxy)piperidin-1-yl]pyrimidin-5-yl}oxy)ethyl]carbamate (150.00 mg; 32.6 %) as brown solid. 1 H NMR (DMSO) 5; 1 H-NMR (400 MHz, DMSO-d6): ppm 8.08 - 8.04 (m, 3H), 7.89 (d, J = 2.8 Hz, 1 H), 7.26 - 7.20 (m, 2H), 7.19 - 7.15 (m, 2H), 7.08 - 7.05 (m, 1 H), 7.04 - 6.92 (m, 1 H), 5.93 (s, 1 H), 4.85 - 4.81 (m, 1 H), 4.70 - 4.60 (m, 1 H), 4.42 (s, 1 H), 3.92 (t, J = 6.0 Hz, 2H), 3.51 - 3.48 (m, 1 H), 3.24 - 3.20 (m, 2H), 2.68 - 2.60 (m, 1 H), 1.78 - 1.75 (m, 1 H), 1 .37 (s, 9H). 1 H Merged with water peak. LC / MS (Instrument: Agilent 1290 Infinity II, MS conditions: MSD 6125B,CSH C-18 (30x2.1mm) 1.7 pm; Mobile Phase :A :0.1% HCOOH in H2O;Mobile phase :B:0.1% HCOOH in ACN, Flow Rate :1.0 ml / min; 0 min 3% of B, 1.5 min 97% of B; 1.9 min 97% of B, 2 min 3% of B): purity 93.96 %; Rt 0.92 min; Rt 544.3 m / z.

[0811] Intermediate rel-tert- butyl N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3- yloxy)piperidin-1-yl]pyrimidin-5-yl}oxy)ethyl]carbamate and Intermediate rel-tert-butyl N-[2-({2- [(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]carbamate

[0812] The racemic product of rac- tert- butyl N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3- (pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5-yl}oxy)ethyl]carbamate (150.00 mg; 0.26 mmol; 1.00 eq.) was purified by preparative chiral SFC (Method: Column: ChiralPak IG (250*20) mm, 5pm , Mobile Phase : CO2: 0.5% I PA in MeOH (50:50) % .Total Flow : 50 ml / min, Back pressure : 100 bar, Wavelength : 254 nm, Cycle time : 8.0 min ). Peak-1 and peak-2 fractions concentrated individually to afford (stereocenters arbitrarily assigned), Peak-1 (faster eluting isomer) fraction was concentrated to afford rel-tert-butyl N-[2-({2-[(3R,4S)- 4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]carbamate (64.00 mg). 1 H NMR (DMSO) 5; 1 H-NMR (400 MHz, DMSO-d6): ppm 8.06 - 8.04 (m, 3H), 7.89 (d, J = 2.4 Hz, 1 H), 7.26 - 7.20 (m, 2H), 7.18 - 7.13 (m, 2H), 7.08 - 7.05 (m, 1 H), 7.03 - 6.99 (m, 1 H), 5.94 (s, 1 H), 4.85 - 4.81 (m, 1 H), 4.65 - 4.61 (m, 1 H), 4.42 (s, 1 H), 3.92 (t, J = 5.6 Hz, 2H), 3.51 - 3.48 (m, 1 H), 3.20 - 3.17 (m, 3H), 2.65 - 2.58 (m, 1 H), 1.78 - 1.75 (m, 1 H), 1.37 (s, 9H). HPLC (Column: XBridge C8, 3.5 pm, 4.6 x 50 mm; Mobile phase :A :0.1% FA in H2O, B: ACN, Flow Rate :1.0 m l / min, 0 min 5% of B, 8.0 min 100% of B, 8.1 min 100% of B, 8.5 min 5% of B, 10 min 5% of B): (percent area) 99.9 %; Rt 5.04 min.

[0813] LC / MS(lnstrument: Agilent 1290 Infinity II, MS conditions: MSD 6125B,CSH C-18 (30x2.1mm) 1.7 pm; Mobile Phase :A :0.1% HCOOH in H2O;Mobile phase :B:0.1 % HCOOH in ACN, Flow Rate :1.0 ml / min; 0 min 3% of B, 1.5 min 97% of B; 1.9 min 97% of B, 2 min 3% of B): purity 99.56 %; Rt 0.92 min; (M+H) 544.3.

[0814] Peak-2 (later eluting isomer) fraction was concentrated to afford rel-tert-butyl N-[2-({2-[(3S,4R)- 4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]carbamate (57.00 mg) as pale brown solid. Foreignfiling text P24-264

[0815] 54

[0816] 1 H-NMR (400 MHz, DMSO-d6): ppm 8.06 - 8.04 (m, 3H), 7.89 (d, J = 2.4 Hz, 1 H), 7.26 - 7.23 (m, 2H), 7.18 - 7.15 (m, 2H), 7.06 - 7.00 (m, 2H), 5.94 (s, 1 H), 4.85 - 4.81 (m, 1 H), 4.65 - 4.61 (m, 1 H), 4.42 (s, 1 H), 3.91 (t, J = 6.0 Hz, 2H), 3.51 - 3.48 (m, 1 H), 3.24 - 3.20 (m, 2H), 2.65 - 2.58 (m, 1 H), 1.78 - 1.75 (m, 1 H), 1.37 (s, 9H). HPLC (Column: XBridge C8, 3.5 pm, 4.6 x 50 mm; Mobile phase :A :0.1 % FA in H2O, B: ACN, Flow Rate :1.0 m l / min, 0 min 5% of B, 8.0 min 100% of B, 8.1 min 100% of B, 8.5 min 5% of B, 10 min 5% of B): purity 99.87%; Rt 5.02 min. LC / MS (Instrument: Agilent 1290 Infinity II, MS conditions: MSD 6125B,CSH C-18 (30x2.1mm) 1.7 pm; Mobile Phase :A :0.1% HCOOH in H2O;Mobile phase :B:0.1 % HCOOH in ACN, Flow Rate :1.0 ml / min; 0 min 3% of B, 1.5 min 97% of B; 1.9 min 97% of B, 2 min 3% of B): purity 99.87%; Rt 0.92 min; (M+H) 544.3.

[0817] Example No 7.: rel-(3R,4S)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin- 3-yloxy)piperidin-4-ol

[0818] To a well stirred solution of rel-tert-butyl N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3- (pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5-yl}oxy)ethyl]carbamate (64.00 mg; 0.12 mmol; 1.00 eq.) in DCM (5.00 ml) was added 4M HCI in 1 ,4-dioxane (0.20 ml; 0.80 mmol) at 0 °C and stirred at RT for 3h.

[0819] The reaction mixture was concentrated under reduced pressure. The resulting crude was triturated with MTBE (2 X 10 ml), decanted. The resulting compound was dried under reduced pressure and further lyophilized to afford rel-(3R,4S)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5- difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4-ol hydrochloride (52.00 mg, 87.7 %) as pale brown solid. 1 H NMR (DMSO) 5; 1 H-NMR (400 MHz, DMSO-d6): ppm 8.35 - 8.33 (m, 2H), 8.19 (brs, 3H), 8.09 (s, 2H), 7.79 - 7.77 (m, 1 H), 7.72 - 7.68 (m, 1 H), 7.28 - 7.25 (m, 2H), 7.09 - 7.04 (m, 1 H), 4.87 - 4.84 (m, 1 H), 4.66 - 4.64 (m, 2H), 4.15 (t, J = 5.2 Hz, 2H), 3.59 - 3.56 (m, 1 H), 3.40 - 3.33 (m, 1 H), 3.17 - 3.13 (m, 2H), 2.68 - 2.57 (m, 1 H), 1.82 - 1.78 (m, 1 H). OH Proton merged with water peak. HPLC (Instrument: Agilent 1290 Infinity II, MS conditions: MSD 6125B,CSH C- 18 (30x2.1mm) 1.7 pm; Mobile phase A: 0.1%TFA in Water; Mobile phase B: ACN; Flow Rate : 0.8 mL / min; 0.0 min 5% of B, 15 min 100% of B, 20 min 100% of B; 26 min 5% of B, 30 min 5% of B,.): purity 95.22 %; Rt 9.54 min. LC / MS(lnstrument: Agilent 1290 Infinity II, MS conditions: MSD 6125B,CSH C-18 (30x2.1 mm) 1.7 pm; Mobile phase A: 0.1%TFA in Water; Mobile phase B: ACN; Flow Rate : 0.8 mL / min; 0.0 min 5% of B, 15 min 100% of B, 20 min 100% of B; 26 min 5% of B, 30 min 5% of B,.): (percent area) 96.34 %; Rt 8.5 min; (M+H) 444.1 m / z.

[0820] Example No. 88: rel-(3S,4R)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3- (pyridin-3-yloxy)piperidin-4-ol was prepared analogously to Example No. 7:

[0821] 1 H-NMR (400 MHz, DMSO-d6): ppm 8.28 - 8.22 (m, 2H), 8.10 (brs, 5H), 7.62 - 7.58 (m, 2H), 7.27 - 7.24 (m, 2H), 7.09 - 7.04 (m, 1 H), 4.86 - 4.84 (m, 1 H), 4.67 - 4.60 (m, 2H), 4.14 (t, J = 5.0 Hz, 2H), 3.58 - 3.54 (m, 1 H), 3.40 - 3.32 (m, 1 H), 3.18 - 3.14 (m, 2H), 2.68 - 2.60 (m, 1 H), 1.81 - 1.78 (m, 1 H). HPLC (Column: XBridge C8, 3.5 pm, 4.6 x 50 mm; Mobile phase:A:10mM Ammonium bicarbonate in water; Mobile phase: B: Acetonitrile; Flow:1.0mL / min; Rt.0.0 min Foreignfiling_text P24-264

[0822] 55

[0823] 5%; of B; Rt. 8.0 min, 95% of B; Rt.8.1 min, 95% of B; Rt.8.5 min, 5% of B; Rt.10.0 min, 5% of B;): purity 99.4 %, Rt 4.23 min, [M+H] 444.1 m / z.

[0824] The compounds described in Table 1 were prepared using the appropriate starting materials using a procedure similar to the described above examples and intermediates, like Examples No. 2, 7, 41 , 58, 71 , and 88 as well as schemes A and B.

[0825] Table 1 : Foreignfiling_text P24-264

[0826] 56 Foreignfiling_text P24-264

[0827] 57 Foreignfiling_text P24-264

[0828] 58 Foreignfiling_text P24-264

[0829] 59 Foreignfiling_text P24-264

[0830] 60 Foreignfiling_text P24-264

[0831] 61 Foreignfiling_text P24-264

[0832] 62 Foreignfiling_text P24-264

[0833] 63 Foreignfiling_text P24-264

[0834] 64 Foreignfiling_text P24-264

[0835] 65 Foreignfiling_text P24-264

[0836] 66 Foreignfiling_text P24-264

[0837] 67 Foreignfiling_text P24-264

[0838] 68 Foreignfiling_text P24-264

[0839] 69 Foreignfiling_text P24-264

[0840] 70 Foreignfiling_text P24-264

[0841] 71 Foreignfiling_text P24-264

[0842] 72 Foreignfiling_text P24-264

[0843] 73 Foreignfiling_text P24-264

[0844] 74 Foreignfiling_text P24-264

[0845] 75 Foreignfiling_text P24-264

[0846] 76 Foreignfiling_text P24-264

[0847] 77 Foreignfiling_text P24-264

[0848] 78 Foreignfiling_text P24-264

[0849] 79 Foreignfiling_text P24-264

[0850] 80 Foreignfiling_text P24-264

[0851] 81 Foreignfiling_text P24-264

[0852] 82 Foreignfiling_text P24-264

[0853] 83 Foreignfiling_text P24-264

[0854] 84 Foreignfiling_text P24-264

[0855] 85 Foreignfiling_text P24-264

[0856] 86 Foreignfiling_text P24-264

[0857] 87 Foreignfiling_text P24-264

[0858] 88 Foreignfiling_text P24-264

[0859] 89 Foreignfiling_text P24-264

[0860] 90 Foreignfiling_text P24-264

[0861] 91 Foreignfiling_text P24-264

[0862] 92 Foreignfiling_text P24-264

[0863] 93 Foreignfiling_text P24-264

[0864] 94 Foreignfiling_text P24-264

[0865] 95 Foreignfiling_text P24-264

[0866] 96 Foreignfiling_text P24-264

[0867] 97 Foreignfiling_text P24-264

[0868] 98 Foreignfiling_text P24-264

[0869] 99 Foreignfiling_text P24-264

[0870] 100 Foreignfiling_text P24-264

[0871] 101 Foreignfiling_text P24-264

[0872] 102

[0873] Biological data TREX1 nuclease assay - determination of TREX1 inhibition (IC50 TREX1):

[0874] The IC50 values were determined by a biochemical TREX1 nuclease assay. TREX1 (three prime repair exonuclease 1) degrades cytosolic ssDNA and dsDNA molecules that feature a 3’ overhang. A mixture of TREX1 protein and the test substance were incubated at different concentrations with addition of fluorescently labelled DNA substrate. Degradation of a 5’-FAM / 3’-BHQ1 dual labelled substrate, where iterative removal of nucleotides from the 3’ ends of oligos 1 and 2 causes an increase in fluorescent signal that is proportional to the amount of product. Foreignfiling_text P24-264

[0875] 103

[0876] In detail: The enzymatic TREX1 assay was carried out as Fluorescence Intensity (Fl) based 1536-well assay. Purified human recombinant TREX1 (human TREX1 , amino acids 1-242, UniProt ID Q9NSLI2, expressed in E. coli) was incubated in assay buffer for 30 minutes with the TREX1 inhibitor in various concentrations and without test substance as negative or neutral control. The assay buffer comprised 20 mM TRIS pH 7.5, 5 mM MgCh, 1 mM DTT, BSA 0.1% (1 mg / mL), 0.01% (v / v) IGEPAL® CA-630. The test-substance solutions were dispensed into the microtitre plates using a Hummingbird capillary pipettor (Digilab). Reactions were initiated by the addition of FAM / BHQ1 dual labelled DNA substrate (generated by annealing of oligo 1 : [FAM]-CTAAGTTCGTCAGGATTCCAGCATTGTAACAGTGATAGAG, and oligo 2: GCTGGAATCCTGACGAACTTAG -[BHQ1] (Integrated DNA Technologies)) in assay buffer. The pharmacologically relevant assay volume was 5 pl. The final concentrations in the assay during incubation of the reaction mixture were 0.03 - 0.04 nM TREX1 and 40 nM DNA substrate. After 60 min at room temperature, reactions were quenched by the addition of 3 pl of stop buffer (270 mM EDTA, 45 mM TRIS pH 7.5). The plates were analysed in a plate reader (PheraStar FSX, BMG LabTech) measuring fluorescence at 520 nm following excitation at 485 nm. The amount of product generated is directly proportional to the amounts of light emitted, i.e. the relative fluorescence units (RFU) at 520 nm. The measurement data were processed by means of the Genedata Screener software. In particular, IC50 values were determined by fitting a dose-response curve to the data points using nonlinear regression analysis.

[0877] IC50 = half-maximum inhibitory concentration

[0878] FAM = Carboxyfluorescein BHQ1 = Black Hole Quencher 1 TRIS = Tris(hydroxymethyl)aminomethane MgCh = magnesium chloride DTT = dithiothreitol BSA = Bovine Serum Albumin EDTA = ethylenediamine tetraacetate RT = room temperature

[0879] Results

[0880] The results are summarized in Table Ex-1 below, wherein the following classifications were applied.

[0881] TREX1 IC50: A: IC50 < 200 nm; B: 200 nM < IC50 < 1000 nM; C: 1000 nM < IC50 < 10000 nM; D: 10000 nM < IC50 < 30000 nM.

[0882] Table Ex-1 : Foreignfiling_text P24-264

[0883] 104 Foreignfiling_text P24-264

[0884] 105

Claims

1. Foreignfiling_text P24-264106Claims1. A compound of formula (I)or a stereoisomer, tautomer, N-oxide, or pharmaceutically acceptable salt thereof; whereinR1is 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rx;A is O, S, NR1A, or CH2; wherein R1Ais H, or R1Atogether with R1and the nitrogen atom to which they are attached formwherein the dashed line marks the connection to the carbon atom, to which A is attached; and wherein B is a 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclic or heterocyclic ring; wherein the aforementioned heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents Rx;R1Bis H;R2is 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl; wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or nonoxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RY; andR3is C(=O)R33, whereinR33is Ci-C2-alkyl, or 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl; wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; orForeignfiling_text P24-264107R3is 5- or 6-membered partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; wherein is halogen, CN, NO2, NRN1RN2, OR°, C(=O)NRN1RN2, C(=O)OR°, Ci-C4-aminoalkyl, C1-C4- hydroxyalkyl, Ci-C4-alkyl, or Ci-C4-haloalkyl; wherein RN1is H or Ci-C2-alkyl;RN2is H or Ci-C2-alkyl; andR° is H or Ci-C4-alkyl; or two Rxtogether form =0;RYis halogen, CN, Ci-C2-alkyl, or Ci-C2-alkoxy; andRzis halogen, CN, NO2, Ci-C4-alkyl, C3-C4-cycloalkyl, Ci-C4-haloalkyl, Ci-C4-alkoxy, or Ci- C4-haloalkoxy; or a groupwherein the dashed line marks the connection to R3; and wherein m is 1 or 2; andRNis H or C(=O)Rc; wherein Rcis -CH3, -CH2CH3, or -CH2-(O-CH2CH2)n-O-CH3, wherein n is 0, 1 , or 2; or two Rztogether form =0.

2. The compound according to claim 1 , whereinR1is pyrazolyl, phenyl, pyrazolyl, pyridinyl, pyrimidinyl, quinolinyl, isochinolinyl, indazolyl, pyrazolopyridinyl, imidazopyridinyl, 1-oxoisoindolinyl, or 1 ,3-dioxoindolinyl; wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rx.

3. The compound according to claim 1 or 2, whereinForeignfiling_text P24-2641084. The compound according to any one of claims 1 to 3, wherein A is O.

5. The compound according to any one of claims 1 to 4, whereinR1Bis H.

6. The compound according to any one of claims 1 to 5, whereinR2is phenyl, wherein each substitutable atom is independently unsubstituted or substituted with one or more, same or different substituents RY.

7. The compound according to any one of claims 1 to 6, wherein8. The compound according to any one of claims 1 to 7, whereinR3is C(=O)R33, whereinR33is Ci-C2-alkyl, or 5-membered aromatic heterocyclyl; wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or nonoxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; orR3is 5- or 6-membered partially or fully unsaturated, or aromatic heterocyclyl, or 9- or 10- membered partially or fully unsaturated, or aromatic heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein at least one nitrogen atom is present in ortho position to the point of attachment to the remainder of the molecule, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz.

9. The compound according to any one of claims 1 to 8, wherein R3is C(=O)R33,Foreignfiling_text P24-264109 whereinR33is pyrazolyl, imidazolyl, oxazolyl, or isoxazolyl, wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz; orR3is thiazolyl, pyridinyl, pyrimidinyl, pyridazinyl, 6-oxo-1 ,6-dihydropyrimidinyl, pyrazolopyrimidinyl, or imidazopyridinyl, wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents Rz.

11. The compound according to any one of claims 1 to 10, wherein the compound is a compound of formula (IA) or (IB), or a mixture thereof:

12. The compound according to any one of claims 1 to 10, wherein the compound is a compound of formula (IB):Foreignfiling_text P24-26411013. The compound according to any one of claims 1 to 11, wherein the compound is selected from the group consisting of 4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;4-(3,5-difluorophenyl)-1-(2-methylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(2-methylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol; (3S,4R)-4-(3,5-difluorophenyl)-1-(2-methylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol; 6-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-2-methyl-2,3- dihydropyridazin-3-one;6-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-2-methyl-2,3- dihydropyridazin-3-one;6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-2-methyl-2,3- dihydropyridazin-3-one;4-(3,5-difluorophenyl)-1-(5-ethoxypyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-1-(5-ethoxypyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol; (3R,4S)-4-(3,5-difluorophenyl)-1-(5-ethoxypyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[6-(trifluoromethyl)pyridazin-3-yl]piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[6-(trifluoromethyl)pyridazin-3-yl]piperidin-4- ol;(3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[6-(trifluoromethyl)pyridazin-3-yl]piperidin-4- ol;1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3R,4S)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4- ol;(3S,4R)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4- ol;N-[2-({2-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]acetamide;N-[2-({2-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]acetamide;N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]acetamide;3-[(5-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-3-[(5-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol; (3S,4R)-3-[(5-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2-carboxamide;5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxamide;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxamide;Foreignfiling_text P24-2641115-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-N-methylpyridine-2- carboxamide;5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-N- methylpyridine-2-carboxamide;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-N- methylpyridine-2-carboxamide;4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(pyrimidin-5-yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(pyrimidin-5-yloxy)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(pyrimidin-5-yloxy)piperidin-4-ol;4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-{[6-(trifluoromethyl)pyridin-3-yl]oxy}piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-{[6-(trifluoromethyl)pyridin-3-yl]oxy}piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-{[6-(trifluoromethyl)pyridin-3-yl]oxy}piperidin-4-ol;4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-3-yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-3-yloxy)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-3-yloxy)piperidin-4-ol;3-[(6-aminopyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-3-[(6-aminopyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-3-[(6-aminopyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;N-[2-({2-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]-2-[2-(2-methoxyethoxy)ethoxy]acetamide;N-[2-({2-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]-2-[2-(2-methoxyethoxy)ethoxy]acetamide;N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]-2-[2-(2-methoxyethoxy)ethoxy]acetamide;4-(3,5-difluorophenyl)-3-(4-fluorophenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-(4-fluorophenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-3-(4-fluorophenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;4-(3,5-difluorophenyl)-3-{pyrazolo[1 ,5-a]pyridin-6-yloxy}-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-{pyrazolo[1 ,5-a]pyridin-6-yloxy}-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-3-{pyrazolo[1 ,5-a]pyridin-6-yloxy}-1-(pyrimidin-2-yl)piperidin-4-ol; ethyl 6-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}imidazo[1 ,2- a]pyridine-2-carboxylate; ethyl 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3- yl]oxy}imidazo[1 ,2-a]pyridine-2-carboxylate; ethyl 6-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3- yl]oxy}imidazo[1 ,2-a]pyridine-2-carboxylate;4-(3,5-difluorophenyl)-3-[(1-methyl-1 H-indazol-5-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-[(1-methyl-1 H-indazol-5-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-3-[(1-methyl-1 H-indazol-5-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;4-(3,5-difluorophenyl)-1-{pyrazolo[1 ,5-a]pyrimidin-5-yl}-3-(pyridin-3-yloxy)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-1-{pyrazolo[1 ,5-a]pyrimidin-5-yl}-3-(pyridin-3-yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-{pyrazolo[1 ,5-a]pyrimidin-5-yl}-3-(pyridin-3-yloxy)piperidin-4-ol;4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-7-yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-7-yloxy)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-7-yloxy)piperidin-4-ol;5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol- 1-one;Foreignfiling_text P24-2641125-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;6-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3,4-dihydropyrimidin-4-one;6-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3,4- dihydropyrimidin-4-one;6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3,4- dihydropyrimidin-4-one;4-(3,5-difluorophenyl)-1-(2,6-dimethylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-1-(2,6-dimethylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(2,6-dimethylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;3-[3-(aminomethyl)phenoxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-3-[3-(aminomethyl)phenoxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-3-[3-(aminomethyl)phenoxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;4-(3,5-difluorophenyl)-3-(4-hydroxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-(4-hydroxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-3-(4-hydroxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;4-(3,5-difluorophenyl)-1-{3-methyl-3H-imidazo[4,5-b]pyridin-5-yl}-3-(pyridin-3-yloxy)piperidin-4- ol;(3S,4R)-4-(3,5-difluorophenyl)-1-{3-methyl-3H-imidazo[4,5-b]pyridin-5-yl}-3-(pyridin-3- yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-{3-methyl-3H-imidazo[4,5-b]pyridin-5-yl}-3-(pyridin-3- yloxy)piperidin-4-ol;6-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;6-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;3-(3-aminophenoxy)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-3-(3-aminophenoxy)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-3-(3-aminophenoxy)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindole-1 ,3-dione;5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl) piperidin-3-yl]oxy}-2, 3-dihydro- 1 H-isoindole-1 ,3-dione;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl) piperidin-3-yl]oxy}-2, 3-dihydro- 1 H-isoindole-1 ,3-dione;1-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]ethan-1-one;1-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]ethan-1-one;1-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]ethan-1-one;Foreignfiling_text P24-2641134-(3,5-difluorophenyl)-1-[1-(2-methoxyethyl)-1 H-pyrazole-4-carbonyl]-3-(pyridin-3- yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-[1-(2-methoxyethyl)-1 H-pyrazole-4-carbonyl]-3-(pyridin-3- yloxy)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-1-[1-(2-methoxyethyl)-1 H-pyrazole-4-carbonyl]-3-(pyridin-3- yloxy)piperidin-4-ol;4-(3,5-difluorophenyl)-1-(5-fluoropyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-1-(5-fluoropyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(5-fluoropyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[5-(trifluoromethyl)pyrimidin-2-yl]piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[5-(trifluoromethyl)pyrimidin-2-yl]piperidin-4- ol;(3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[5-(trifluoromethyl)pyrimidin-2-yl]piperidin-4- ol;4-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;4-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;4-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;4-(3,5-difluorophenyl)-3-(3-methoxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-(3-methoxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-3-(3-methoxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;6-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3-methyl-3,4- dihydropyrimidin-4-one;6-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3-methyl-3,4- dihydropyrimidin-4-one;6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3-methyl-3,4- dihydropyrimidin-4-one;4-(3,5-difluorophenyl)-1-(6-ethoxypyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-1-(6-ethoxypyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(6-ethoxypyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;4-(3,5-difluorophenyl)-3-phenoxy-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-phenoxy-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-3-phenoxy-1-(pyrimidin-2-yl)piperidin-4-ol;3-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzoic acid;3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzoic acid;3-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzoic acid;4-(3,5-difluorophenyl)-1-(pyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(pyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-1-(pyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;5-{[(4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3-carboxamide;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxamide;5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxamide;4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3-carbonitrile;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carbonitrile;Foreignfiling_text P24-2641145-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carbonitrile;5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3-carboxylic acid;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxylic acid;5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxylic acid;4-(3,5-difluorophenyl)-3-(isoquinolin-8-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-(isoquinolin-8-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-3-(isoquinolin-8-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;3-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;3-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;3-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzamide;3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzamide;3-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzamide;5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2-carboxylic acid;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxylic acid;5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxylic acid;4-(3,5-difluorophenyl)-3-(isoquinolin-7-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-(isoquinolin-7-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-3-(isoquinolin-7-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;6-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol- 1-one;6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;6-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;6-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;6-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;5-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;5-{[4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4-yl)piperidin-3- yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;Foreignfiling_text P24-2641155-{[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1H-isoindol-1-one;3-[(4-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-3-[(4-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-3-[(4-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;4-(3,5-difluorophenyl)-3-[(5-fluoropyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-[(5-fluoropyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-3-[(5-fluoropyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;4-(3,5-difluorophenyl)-3-[(6-methoxypyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-[(6-methoxypyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;(3S,4R)-4-(3,5-difluorophenyl)-3-[(6-methoxypyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol; 3-[4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1-olate;3-[(3S,4R)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1- olate and3-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1- olate.

14. The compound according to any one of claims 1 to 12, wherein the compound is selected from the group consisting of (3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(2-methylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-2-methyl-2,3- dihydropyridazin-3-one;(3R,4S)-4-(3,5-difluorophenyl)-1-(5-ethoxypyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[6-(trifluoromethyl)pyridazin-3-yl]piperidin-4- ol;(3R,4S)-1-[5-(2-aminoethoxy)pyrimidin-2-yl]-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)piperidin-4- ol;N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]acetamide;(3R,4S)-3-[(5-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxamide;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-N- methylpyridine-2-carboxamide;(3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(pyrimidin-5-yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-{[6-(trifluoromethyl)pyridin-3-yl]oxy}piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-3-yloxy)piperidin-4-ol;(3R,4S)-3-[(6-aminopyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;N-[2-({2-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyrimidin-5- yl}oxy)ethyl]-2-[2-(2-methoxyethoxy)ethoxy]acetamide;(3R,4S)-4-(3,5-difluorophenyl)-3-(4-fluorophenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-{pyrazolo[1,5-a]pyridin-6-yloxy}-1-(pyrimidin-2-yl)piperidin-4-ol; ethyl 6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3- yl]oxy}imidazo[1,2-a]pyridine-2-carboxylate;(3R,4S)-4-(3,5-difluorophenyl)-3-[(1-methyl-1H-indazol-5-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-{pyrazolo[1,5-a]pyrimidin-5-yl}-3-(pyridin-3-yloxy)piperidin-4- ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)-3-(quinolin-7-yloxy)piperidin-4-ol;Foreignfiling_text P24-2641165-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3,4- dihydropyrimidin-4-one;(3R,4S)-4-(3,5-difluorophenyl)-1-(2,6-dimethylpyrimidin-4-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3R,4S)-3-[3-(aminomethyl)phenoxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-(4-hydroxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-{3-methyl-3H-imidazo[4,5-b]pyridin-5-yl}-3-(pyridin-3- yloxy)piperidin-4-ol;6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;(3R,4S)-3-(3-aminophenoxy)-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl) piperidin-3-yl]oxy}-2, 3-dihydro- 1 H-isoindole-1 ,3-dione;1-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]ethan-1-one;(3R,4S)-4-(3,5-difluorophenyl)-1-[1-(2-methoxyethyl)-1 H-pyrazole-4-carbonyl]-3-(pyridin-3- yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-1-(5-fluoropyrimidin-2-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-[5-(trifluoromethyl)pyrimidin-2-yl]piperidin-4- ol;4-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;(3R,4S)-4-(3,5-difluorophenyl)-3-(3-methoxyphenoxy)-1-(pyrimidin-2-yl)piperidin-4-ol;6-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]-3-methyl-3,4- dihydropyrimidin-4-one;(3R,4S)-4-(3,5-difluorophenyl)-1-(6-ethoxypyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;(3R,4S)-4-(3,5-difluorophenyl)-3-phenoxy-1-(pyrimidin-2-yl)piperidin-4-ol;3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzoic acid;(3R,4S)-4-(3,5-difluorophenyl)-1-(pyridazin-3-yl)-3-(pyridin-3-yloxy)piperidin-4-ol;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxamide;(3R,4S)-4-(3,5-difluorophenyl)-3-(pyridin-3-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carbonitrile;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-3- carboxylic acid;(3R,4S)-4-(3,5-difluorophenyl)-3-(isoquinolin-8-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzonitrile;3-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}benzamide;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}pyridine-2- carboxylic acid;(3R,4S)-4-(3,5-difluorophenyl)-3-(isoquinolin-7-yloxy)-1-(pyrimidin-2-yl)piperidin-4-ol;6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;6-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(pyrimidin-2-yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H- isoindol-1-one;5-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1 H-isoindol-1-one;Foreignfiling_text P24-2641175-{[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-1-(1-methyl-6-oxo-1 ,6-dihydropyrimidin-4- yl)piperidin-3-yl]oxy}-2,3-dihydro-1H-isoindol-1-one;(3R,4S)-3-[(4-chloropyridin-3-yl)oxy]-4-(3,5-difluorophenyl)-1-(pyrimidin-2-yl)piperidin-4-ol; (3R,4S)-4-(3,5-difluorophenyl)-3-[(5-fluoropyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol; (3R,4S)-4-(3,5-difluorophenyl)-3-[(6-methoxypyridin-3-yl)oxy]-1-(pyrimidin-2-yl)piperidin-4-ol; 3-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1- olate; and 3-[(3R,4S)-4-(3,5-difluorophenyl)-4-hydroxy-3-(pyridin-3-yloxy)piperidin-1-yl]pyridazin-1-ium-1- olate.

15. A pharmaceutical composition comprising a pharmaceutically acceptable amount of the compound according to any one of claims 1 to 14 and optionally a pharmaceutically acceptable carrier, diluent or excipient.

16. A compound according to any one of claims 1 to 14 or a pharmaceutical composition according to claim 15 for use in medicine.

17. A compound according to any one of claims 1 to 14 or a pharmaceutical composition according to claim 15 for use in treating or preventing a disease selected from the group consisting of cancer, such as breast cancer, small cell lung cancer and colorectal cancer, in particular cancers with chromosomal instability, TREX1-mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).