Methods and compositions for generating bovine extraembryonic endoderm cells
A novel composition and culture method using FGF4, BMP4, IL-6, XAV939, and A83-01 supports the derivation and long-term culture of bovine extraembryonic endoderm cells, addressing the challenge of establishing stable bXENs and enhancing bovine ESC maintenance and epiblast growth.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- UNIV OF FLORIDA RESEARCH FOUNDATION INC
- Filing Date
- 2025-12-10
- Publication Date
- 2026-06-25
Smart Images

Figure IMGF000009_0001 
Figure IMGF000009_0002 
Figure IMGF000010_0001
Abstract
Description
Methods and Compositions for Generating Bovine Extraembryonic Endoderm CellsGOVERNMENT SUPPORT
[0001] This invention was made with government support under Grant No. R01 HD102533, awarded by the National Institutes of Health. The government has certain rights in the invention.
[0002] This invention was made whole or in part by funding received from Genus R & D, Inc.INTRODUCTION
[0003] During the mammalian pre-implantation development, the first lineage differentiation specifies the inner cell mass (1CM) and trophectoderm (TE) in the blastocyst. The ICM further differentiates into epiblast and hypoblast (or primitive endoderm) in blastocyst. Subsequently, hypoblast or primitive endoderm gives rise to the yolk sac by implantation and is critical to support early conceptus development by producing a spectrum of serum proteins, generating early blood cells, and transporting nutrient from the uterus to the embryo. The development of hypoblast is a very- conserved process although its developmental timing varies among mammalian species. In cattle, the hypoblast specifies in day 8 blastocysts, and differentiates into yolk sac during implantation around day 18-23. The involution of yolk sac occurs 40 days postfertilization which companies the formation of the placenta. Particularly, hypoblast undergoes dynamic lineage development, which is coordinate with a period of rapid growth and elongation of embryo from spheroid form at day 9-11, to elongated form at day 12-14 to a filamentous form at day 16 until implantation, when majority of pregnancy loss occurs Proper hypoblast development and function are pivotal for the success of pregnancy. However, our knowledge of hypoblast development, particularly in ruminant species, is limited due to technical and logistic difficulties associated with in vivo experiments and a lack of manipulatable cell culture models. Furthermore, whether and how extraembryonic tissues support the development of pre-implantation epiblast remain largely unknown.
[0004] Extraembryonic endoderm stem cells (XENs) are established from the primitive endoderm of early embryos and represent valuable tools for studying hypoblast lineage differentiation and function during embryogenesis. To date, the XENs have been established in multiple species including mice, porcine, monkey, and humans. Notably, signaling pathways inducing XENs vary extensively among different mammals. Mouse XENs can be captured from1LEGAL02 / 45391128vlembryonic stem cells (ESCs) via retinoic acid and Activin-A. Human hypoblast has been induced from naive pluripotent stem cells dependent of FGF signaling as well as a chemical cocktail (BMPs, IL-6, FGF4, A83-01, XAV939, Platelet-derived growth factor-AA (PDGF-AA), and retinoic acid) (Okubo T el al., Hypoblast from human pluripotent stem cells regulates epiblast development. Nature 626, 357-366 (2024)). In the livestock domestic species, porcine XENs have been derived from blastocysts using either leukemia inhibitory' factor (LIF) / fibroblast growth factor 2 (FGF2) or LCDM (LIF, CH1R99021, (S)-(+)-dimethindene maleate, and minocycline hydrochloride) condition. Attempts to establish bovine XENs from blastocysts have also identified FGF2 as a facilitator, but the resultant cells could not be maintained in long-term culture. Thus far, the stable bovine XENs have not yet been established.SUMMARY
[0005] Described are compositions (small molecule cocktails) for de novo derivation and longterm culture of bovine extraembryonic endoderm cells (bXENs) comprising: FGF4, BMP4, IL-6, XAV939, and A83-01, wherein the composition does not contain retinoic acid.
[0006] In some embodiments, the composition is provided in a culture medium. In some embodiments, the culture medium comprises: DMEM: F12, Neurobasal medium, N2-supplement, B27-supplement, NEAA, GlutaMAX, and 2-mercaptoethanol. In some embodiments, the culture medium further comprises one or more of: KSR, BSA, Activin A, a ROCK inhibitor, and PDGF.
[0007] Also described are methods of generating bXENs comprising: isolating an inner cell mass (ICM) from a bovine blastocyst and culturing the ICM in a culture medium supplemented with FGF4, BMP4, XAV939, A83-01, and IL-6, thereby generating the bXENs. The bovine blastocyst can be, but is not limited to, in vitro fertilized blastocyst, a hatched blastocyst, or day 8 blastocyst. In some embodiments, the culture media comprises: DMEM: F12, Neurobasal medium, N2-supplement, B 27- supplement, NEAA, GlutaMAX, and 2-mercaptoethanol. In some embodiments, the culture medium further comprises one or more of: KSR, BSA, Activin A, PDGF, and a ROCK inhibitor.
[0008] In some embodiments, the bXENs generated using the described methods are stable to at least 30 passages and / or maintain a stabl e epithelial morphol ogy of flattened colonies with clearly defined margins and a normal diploid number of chromosomes.
[0009] In some embodiments, the bXENs generated using the described methods express SRY-box (SOX17) and GATA-binding factor 6 (GATA6); express extraembryonic visceral endoderm 7LEGAL02 / 45391128vl(VE) and parietal endoderm (PE) markers; and / or do not express SRY-box (SOX2) or caudal type homeobox 2 (CDX2).[00101 Also described are methods of generating short-term passaged bXENs comprising: isolating an inner cell mass (ICM) from the day 8 blastocyst, culturing the ICM in a first medium containing bovine fibroblast growth factor (bFGF), and Activin A until the ICMs attached and formed an outgrowth, and incubating the ICM in a second medium containing LIF, Chir99021, bFGF, and Activin A. In some embodiments, the first medium contains 1:1 DMEM: F12 and Neurobasal medium, lx N2-supplement, 1× B27-supplement, lx NEAA, lx GlutaMAX, and 0.1 mM 2 -mercaptoethanol. In some embodiments, the second medium contains 1:1 DMEM: Fl 2 and Neurobasal medium, 0.5x N2-supplement, 0.5x B27-supplement, 0.5x NEAA, 0.5x GlutaMAX, 0.1 mM 2-mercaptoethanol, ImM NaPy, 10 pg / mL I-ascorbic acid, lxInsulin-Transferrin-Selenium-Ethanolamine (ITS-X), 0.1% FBS, and 0.5% KSR. In some embodiments, the ICM is cultured in the first medium for about 3 days.[0011 j bXENs generated using the described methods can be modified to express a reporter protein, such as a fluorescent protein.
[0012] Also described are methods of making a EPTX-blastoids (also termed 3L-blastoids) comprising: (a) dissociating bEPSCs, bXENs, and bTSCs into single cells; (b) depleting feeder cells from the bEPSCs, bXENs, and bTSCs, and (c) combining the feeder cell depleted bEPSCs, bXENs, and bTSCs; wherein the bEPSCs, bXENs, and bTSCs self-assemble to form the EPTX-blastoid. In some embodiments, combining the feeder cell depleted bEPSCs, bXENs, and bTSCs comprises combining the feeder cell depleted bEPSCs, bXENs, and bTSCs at a ratio of 8:8:16 bEPSCs:bXENs:bTSCs. In some embodiments, the EPTX-blastoid mimics a blastocyst.
[0013] Also described are three-dimensional (3D) assemblies (e.g., EPTX-blastoids or 3L blastoids) comprising: bXENs, bEPSCs and bTSCs, wherein the 3D assemblies mimic blastocysts. The 3D assemblies can be made using the methods described for making EPTX-blastoids.
[0014] In some embodiments, bXENs generated using the described methods can be used to enhance the growth and sternness of bEPSCs,
[0015] In some embodiments, methods are described for protecting an epiblast from differentiation and / or degeneration comprising culturing the epiblast in the presence of FGF4, BMP4, XAV939, A83-01, and IL-6..3LEGAL02 / 45391128vlBRIEF DESCRIPTION OF THE FIGURES
[0016] FIG. 1. Derivation and characterization of bXENs. A. Representative image of outgrowth that formed from day 8 bovine blastocyst contains three morphologically distinct cell types and subsequent derivation and maintenance of bXENs over 30 passages. B Karyotype analysis of bXENs at passage 15. C. Immunofluorescence analysis of GATA6 and SOX17 (hypoblast markers), SOX2 (epiblast marker), as well as CDX2 (trophectoderm marker) in day 8 blastocysts. Scale bar, 50pm. D. Immunofluorescence analysis of GATA6, SOX17, SOX2, as well as CDX2 in bXENs, bEPSCs, and bTSCs, separately. Scale bar, 25pm. E. Relative expression of defined lineage marker genes in three stem cell lines (bars in order at each gene on the x axis bXEN, bEPSC, bTSC). F. The small molecules included in each medium recipe (R1-R6). G. Relative expression level of hypoblast marker genes in bXENs cultured in different mediums from F (bars in order at each gene on the x axis: Rl, R2, R2, R4, R5, G6). H. Cell number estimated within 3 days following passage. I. Morphology of bXENs cultured in XENM with or without A83-01. Data are presented as the mean ± SEM. *P < 0.05 from one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test.
[0017] FIG. 2. Transcriptomic and chromatin accessible features of bovine XENs. A. Principal component analysis (PCA) of transcriptomes of bXEN, bEPSCemb, bEPSC'ps, and bTSC. B. Heatmap showing the marker gene expression for PrE, VE, PE, Epi, and TE from each bovine stem cell type. C. Heatmap (left panel) showing lineage-specific expressed genes for bXENs, bEPSCs, and bTSCs, as well as the enriched signaling pathways (right panel) D. PCA of transcriptomes of bXENs and three major lineages from day 12-18 bovine hi vivo embryos. E.PCA of transcriptomes of XEN and ESC from bovine, mouse, and human. Datasets of bEPSCemband bEPSC1PSare from Zhao et al., PNAS 2021; Datasets of hNESCH1, hNESC119, hNESC,ps, hPESC, hXEN7f, and hXENGA1A6OEare from Okubo et al., Nature 2024. Datasets of mESC, mpXEN and mXEN are from Zhong et al., Stem Cell Research 2018. F. Venn diagram (top panel) showing the number of XEN enriched genes when compared to ESC among three mammalian species, as well as the enriched GO / KEGG (bottom panel) categories from overlapped genes and bovine specific genes, respectively. G. The enrichment of ATACseq peaks at annotated promoters (TSS + 2kb) (normalized and on average) in bXENs. H. Feature distribution of ATACseq peaks in bXENs (features (left panel) top to bottom shown in left panel (left to right)). I. The genome4LEGAL02 / 45391128vlbrowser views showing the ATAC-seq peaks and RNA-seq reads enrichment near APOE and SOX17 in bXENs. F. Motif enrichment analysi s of ATAC-seq peaks from bXENs.
[0018] FIG.3. 3D co-culture of bEPSCs and bXENs. A. Aggregates formed by 40 bEPSC cells cultured in N2B27 medium with 5% KSR B. Aggregates formed by the mixture of bEPSCs and bXENs cultured in N2B27 medium with 5% KSR. C. Aggregates formed by 10 bEPSC cells cultured in N2B27 medium with 5% KSR. D. Aggregates formed by 40 bXEN cells cultured in N2B27 medium with 5% KSR. E. Immunofluorescence analysis of cell aggregates formed by bEPSCs (Gl) or mixture of bEPSCs and bXENs (G2). SOX2; GATA6; DAPI. F. Assay to show the proliferative ability of cell aggregates by 40 EPSCs or a combination of 10 EPSCs and 30 XENs from day 0 till day 4. G. Aggregates generated by the mixture of 10 bEPSCs and 30 GFP tagged bXENs on day 1 and day 4, respectively. H. Diameters of aggregates formed by the mixture of bEPSCs and bXENs (E+X) or by the bEPSCs (E) alone. Data are presented as the mean ± SEM. *P < 0.05 from unpaired t-test.
[0019] FIG. 4. bXENs regulate the development of pre-implantation epiblasts. A. Schematic summarizing the treatment. The treatment was given at different developmental period before and after major genome activation or hypoblast specification (Experiment 1 (Exp. 1): day 1-8, Experiment 2 (Exp. 2): day 5-8; Experiment 3 (Exp. 3): day 8-12). B. Immunofluorescence analysis of SOX17 (hypoblast marker), SOX2 (epiblast marker), and CDX2 (trophectoderm) in day 8 blastocysts under the treatment in Exp.1 and Exp. 2. Scale bar, 50 pm. C. Ratio of SOX17 and SOX2" cells in embryos from Exp. 1-3. D. Developmental rates of embryos under Control or treatments. E. Immunofluorescence analysis of SOX17, SOX2, and CDX2 in day 12 embryos under the treatment in Exp. 3. Scale bar, 25 pm. F. Schematic summarizing the impact of hypoblast on maintenance or differentiation of epiblast. Data are presented as the mean ± SEM. *P < 0.05 from unpaired t-test.
[0020] FIG. 5. Generation of bovine blastoids by self-organization of bXENs, bEPSCs, and bTSCs. A-D. Top panel: Illustration of the bovine blastoid formation using different assembly approach (A: EPTX-blastoids - bEPSCs, bTSCs, and bXENs aggregation in FACLP medium, B: bEPSCs, bTSCs, and bXENs aggregation in ACL medium; C: bEPSCs and bTSCs aggregation in FACLP medium as our previous published, as well as the IVF blastocysts control. Bottom panel: Phase-contrast and immunofluorescence analysis of blastoids from distinct protocols and blastocysts, as well as the quantification of lineage composition in blastoids and blastocysts5LEGAL02 / 45391128vlS0X17; S0X2; CDX2 E. Blastoid formation rate from distinct protocols. F. Blastocele diameter measurement of blastoids from distinct protocols and blastocysts G. Inner cell mass (ICM) / embryo ratio measurement of blastoids from distinct protocols, as well as blastocysts. H.Joint uniform manifold approximation and projection (UMAP) embedding of 10X Genomics single-nucleus transcriptomes of bovine EPTX-blastoids and bovine day 8 blastocysts. I. Major cluster classification based on marker expression. J. Dot plot indicating the expression of markers of epiblast, trophectoderm, and hypoblast. K. Percentage of three cell types in blastoid and blastocyst. Data are presented as the mean±SEM. *P < 0.05 from one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test.[0021 J FIG. 6. Derivation and characterization of bXENscells. A. Representative image of outgrowth that formed from day 8 bovine blastocyst and subsequent generations of bXENs. B.UMAP analysis of transcriptom ic dataset of day 12 in vivo embryos revealing four distinct cell types identified as epiblast (EPI), hypoblast (HP), trophectoderm (TE), and intermediate (Int) cells. Dot plot representing the expression of gene markers for Epi, HP, and TE. Dot size represents the percentage of cells in the cluster expressing the gene markers, the color gradient represents the level of expression from high to low. C. UMAPs analysis showing the expression levels of selected hypoblast markers (CTSV, FETUB. APOAl, APOE, COL4A1, FN1) in day 12 in vivo embryos among all clusters. The color gradient at the right refers to the gene expression level (high expression = darker). D. Relative expression of defined lineage marker genes in three cell lines (bars in order at each gene on the x axis: bXEN, bEPSC, bTSC). Data are presented as the mean±SEM. < 0.05 from one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test.
[0022] FIG. 7. Transcriptional and epigenomic features of bovine XENs. A. RT-PCR analysis of extraembryonic endoderm markers (PDGFRA), classic endoderm markers (GATA4, SOX 17), definitive endoderm markers (CXCR4, KIT), and the pluripotency marker (NANOG) in bXENs. B. Heatmap showing the correlation between bXEN, bEPSC, and bTSC. The color gradient represents the level of correlation from high to low. C. Heatmap showing overlapped XEN enriched genes among human, mouse, and bovine. D. The genome browser views showing the ATAC-seq peaks and RNA-seq reads enrichment near NFYA, NFYC, CTCF and JUND in bXENs E. UMAPs showing the expression levels of specific transcription factors (ATF1, NFYC, CTCF and JUND) in day 12 in vivo embryos among all clusters. The color gradient at the right refers to6LEGAL02 / 45391128vlthe gene expression level. F Heatmap showing the gene expression of general endoderm and definitive endoderm gene markers in bXENs. G. The genome browser views showing the enrichments of ATAC-seq peaks and RNA-seq reads near CXCR4, KIT, EOMES and P0U2AF1 in bXENs. Data are presented as the mean ± SEM. *P < 0.05 from one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test.
[0023] FIG. 8. Immunofluorescence analysis of GATA6 (hypoblast), SOX2 (epiblast), as well as CDX2 (trophectoderm) in day 12 in vivo embryos. Scale bar, 100pm.
[0024] FIG. 9. Single cell RNA-seq analysis of blast oid and blastocyst. A. UMAP showing expression of trophectoderm (GATA2), hypoblast (PDGFRA), and epiblast markers (SLIT2), respectively. B. Heatmap showing the expression of cell lineage-specific genes in epiblast, trophectoderm, and hypoblast, as well as the biological functions regulated by the genes, separately.DETAILS DESCRIPTIONI. Definitions
[0025] Before describing the present teachings in detail, it is to be understood that the disclosure is not limited to specific compositions or process steps, as such may vary.
[0026] It should be noted that, as used in this specification and the appended claims, the singular form "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to “an oligomer” includes a plurality of oligomers and the like. The conjunction "or" is to be interpreted in the inclusive sense, i e., as equivalent to "and / or," unless the inclusive sense would be unreasonable in the context.
[0027] Unless specifically noted, embodiments in the specification that recite “comprising” various components are also contemplated as “consisting of’ or “consisting essentially of” the recited components. Embodiments in the specification that recite “consisting essentially of’ various components are also contemplated as “consisting of’. “Consisting essentially of’ means that additional component(s), composition(s) or method step(s) that do not materially change the basic and novel characteristics of the compositions and methods described herein may be included in those compositions or methods.
[0028] As used herein, the terms “about” and “approximately,” when used to modify an amount specified in a numeric value or range, indicates the numeric value as well as reasonable deviations from the value known to the skilled person in the art. In some embodiments, the term “about”7LEGAL02 / 45391128vlmeans within the typical ranges of tolerances in the art. Tn some embodiments, the term “about” means within 1 or 2 standard deviations from the mean. In some embodiments, the term “about” means ±10%. In some embodiments, the term “about” means ±5%. When the term “about” is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.
[0029] All ranges are to be interpreted as encompassing the endpoints in the absence of express exclusions such as "not including the endpoints"; thus, for example, "within 10-15" includes the values 10 and 15. One skilled in the art will understand that the recited ranges include the end values, as well as whole numbers in between the end values, and where practical, rational numbers within the range (.., the range 5-10 includes 5, 6, 7, 8, 9, and 10, and where practical, values such as 6.8, 9.35, etc.). When values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms a further aspect. For example, if the value “about 10” is disclosed, then “10” is also disclosed.
[0030] Fibroblast growth factor 4 (FGF4) a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF4 is a 21 kDa signaling protein known to be involved in several processes during embryonic development In mice, FGF4 facilitates the survival and growth of the inner cell mass during the post-implantation phase of development. In some embodiments, the FGF4 is human FGF4. In some embodiments, the FGF4 is bovine FGF4. In some embodiments, the FGF is recombinant FGF4. In some embodiments, the FGF4 is CAS No.123584-45-2.
[0031] Bone morphogenetic protein 4 (BMP4) is a member of the bone morphogenetic protein family which is part of the transforming growth factor-beta superfamily. BMPs are known to play a role in embryonic development. In some embodiments, the BMP4 is human BMP4 (UniProt Pl 2644). In some embodiments, the BMP4is bovine BMP4. In some embodiments, the BMP4is recombinant BMP4. In some embodiments, the BMP4 is CAS No. 123584-45-2.
[0032] IL-6 is an embryotrophic factor in bovine embryos, where it acts primarily to mediate inner cell mass (ICM) size. In some embodiments, the IL-6 is human IL-6 (UniProt P05231). In some embodiments, the IL-6 is bovine IL-6. In some embodiments, the IL-6 is recombinant IL-6. In some embodiments, the IL-6 is CAS No. 123584-45-2.8LEGAL02 / 45391128vl
[0033] XAV939 (CAS No. 284028-89-3) is tankyrase inhibitor that targets Wnt / 'P-catenin signaling.3,5,7,8-Tetrahydro-2-[4-(trifluoromethyl)phenyl]-4H-thiopyrano[4,3-d]pyrimidin-4-one (XAV939)
[0034] A83-01 (CAS No. 909910-43-6) is TGF-p pathway inhibitor. A83-01 is an inhibitor of activin receptor-like kinase (ALK) including ALK5 (type I transforming growth factor- receptor), ALK4 (type IB activin receptor), and ALK7 (type I NODAL receptor).3-(6-Methyl-2-pyridinyl)-N-phenyl-4-(4-quinolinyl)-1H-pyrazole-1-carbothioamide (A83-01)
[0035] Activin A is a member of the TGF-beta superfamily that is produced by many different cell types and is necessary for proper development. Activin A exists as a disulfide-linked homodimer that recognizes and binds to four Activin receptors, triggering activation of SMAD signaling pathways. Recombinant Activin A is commonly used to maintain the proliferative potential of human induced pluripotent stem cells and to promote differentiation of embryonic stem cells into endoderm and pancreatic B cells.
[0036] B27 supplement is a serum-free medium typically used for culturing cells. In some embodiments, B27 supplement comprises: vitamins ( biotin, DL alpha tocopherol acetate, DL alpha-tocopherol, vitamin A), proteins (catalase, insulin, transferrin, superoxide dismutase), corticosterone, D-galactose, ethanolamine, glutathione, L-carnitine, linoleic acid, linolenic acid, progesterone, putrescine, sodium selenite, and triodo-I-thyronine.9LEGAL02 / 45391128vl
[0037] CHIR99021 is a selective inhibitor of the enzyme glycogen synthase kinase-3 (GSK-3) (CAS number is 252917-06-9).
[0038] GlutaMAX™ is an L-alanyl-L-glutamine dipeptide.
[0039] KnockOut Serum Replacement (KSR) is a defined serum-free formulation optimized to grow and maintain undifferentiated embryonic stem cells in culture. KSR is FBS-free formulation designed to replace FBS.
[0040] Leukemia inhibitory' factor (LIF) is an interleukin 6 class cytokine that affects cell growth by inhibiting differentiation.
[0041] N-2 Supplement serum-free cell culture supplement (Bottenstein, J. E. (1985) Cell Culture in the Neurosciences). In some embodiments, N-2 supplement comprises: insulin, transferrin, putrescine, selenite, and progesterone.
[0042] In some embodiments, NEAA comprises glycine, alanine, asparagine, aspartic acid, glutamic acid, proline, and serine.
[0043] Neurobasal medium is a basal medium designed for long-term maintenance and maturation of pure pre-natal and embryonic neuronal cell populations without the need for an astrocyte feeder layer. In some embodiments Neurobasal medium comprises D-glucose (25 mM), sodium pyruvate (0.22 mM), amino acids, vitamins, and inorganic salts.
[0044] Platelet-derived growth factor is a growth factor that regulates cell growth and division. PDGF is known to play a role in mitogenesis (z.e., proliferation, of mesenchymal ceils such as fibroblasts, osteoblasts, tenocytes, vascular smooth muscle cells and mesenchymal stem cells), chemotaxis, of mesenchymal cells. Platelet-derived growth factor is a dimeric glycoprotein that can be composed of two A subunits (PDGF-AA), two B subunits (PDGF-BB), or one of each (PDGF-AB).
[0045] Rho-associated protein kinase (ROCK) inhibitors are drugs that block rho kinase and inhibit the ROCK pathway. Rock inhibitor include, but are not limited to, AT-13148, BA-210, [3-10LEGAL02 / 45391128vlelemene, belumosudil, chroman 1, DJ4, Fasudil, GSK-576371, GSK429286A, H-1152 inhibitor, hydroxyfasudil, ibuprofen, LX-7101, netarsudil, RKI-1447, ripasudil, TCS-7001, thiazovivin, verosudil (AR-12286), Y-27632, Y-30141, Y-33075, and Y-39983.
[0046] An inner cell mass (ICM) (also termed embryoblast) is a cluster of cells inside a blastocyst that develops into the embryo (i.e., will eventually give rise to the definitive structures of the fetus). The inner cell mass forms in the earliest stages of embryonic development, before implantation into the endometrium of the uterus. The ICM is entirely surrounded by the single layer of trophoblast cells of the trophectoderm. The ICM is pluripotent, meaning its cells can differentiate into all the cell types of the body. These pluripotent stem cells are composed of two layers, the epiblast and hypoblast which later develop into the three germ layers: ectoderm, endoderm, and mesoderm. There is variation between species of mammals as to the number of cells at compaction, with bovine embryos showing differences related to compaction as early as 9-15 cells.
[0047] Expanded potential stem cells (EPSCs) are a type of stem cell that can develop into both embryonic and extra-embryonic cell lineages, such as the placenta and yolk sac, a characteristic of early-stage development. They are derived from preimplantation embryos or by reprogramming other cells.
[0048] Trophoblast stem cells (TSCs) are specialized stem cells that play a role in the development and function of the placenta. TSCs are the precursors of the differentiated cells of the placenta.
[0049] Sternness refers to the ability to self-renew and the potential to differentiate into various cell types.II. Description
[0050] Bovine embryo-derived stem cells hold the potential to substantially advance biotechnology and agriculture. We describe compositions and methods for derivation (generation) and long-term culture of bovine extraembryonic endoderm cells (bXENs) from pre-implantation embryos. Transcriptomic and epigenomic analyses confirmed the identity of bXENs and demonstrated that they are resemble hypoblast cells of early bovine peri-implantation embryos,
[0051] In some embodiments, the described bXENs can be used to facilitate the maintenance of sternness of bovine ESCs and prevent bovine ESCs from differentiation. In the presence of small11LEGAL02 / 45391128vlmolecule cocktail sustaining bXENs, the growth and progression of epiblasts are also facilitated in the developing pre-implantati on embryo.[00521 We also describe in vitro bXEN models that are useful in elucidating the mechanistic features of early bovine embryogenesis and understanding hypoblast development. The bXEN models include improved bovine blastocyst-like structures (blastoids). The described bovine blastoid technology can be used in the development of novel artificial reproductive technologies for cattle breeding.
[0053] Described are compositions (small molecule cocktails) for de novo derivation and longterm culture of bovine extraembryonic endoderm cells (bXENs) comprising: fibroblast growth factor 4 (FGF4), bone morphogenetic protein 4 (BMP4), interleukin 6 (IL-6), 3,5,7,8-Tetrahydro-2-[4-(trifluoromethyl)phenyl]-4H-thiopyrano[4,3-d]pyrimidin-4-one (XAV939), and 3-(6-Methyl-2-pyridinyl)-Ar-phenyl-4-(4-quinolinyl)-1H-pyrazole-1-carbothioamide (A83-01) that supports de novo derivation and long-term culture of bovine XENs (bXENs). In some embodiments, the small molecule cocktail does not contain PDGF-AA or retinoic acid.
[0054] In some embodiments, the composition comprises about 25 to about 50 ng / mL FGF4.
[0055] In some embodiments, the composition comprises about 10 to about 20 ng / mL BMP4.
[0056] In some embodiments, the composition comprises about 0.5 to about 1 pM XAV939.
[0057] In some embodiments, the composition comprises about 2.0 to about 3.0 pM A83-01.
[0058] In some embodiments, the composition comprises about 10 to about 20 ng / mL IL-6.
[0059] In some embodiments, the composition comprises about 25 to about 50 ng / mL FGF4, about 10 to about 20 ng / mL BMP4, about 0.5 to about 1 pM XAV939, 2.0 to about 3.0 pM A83-01, and about 10 to about 20 ng / mL IL-6.
[0060] In some embodiments, the composition comprises about 25 ng / mL FGF4, about 10 ng / mL BMP4, about 1 M XAV939, about 3 pM A83-01, and about 10 ng / mL IL-6.
[0061] In some embodiments, the composition is provided in a culture medium (e.g, a medium suitable for growth and maintenance (survival) of bovine cells in vitro). The culture medium can be, but is not limited to, DMEM. F12 and Neurobasal medium. In some embodiments, the culture medium is supplemented one or more of with N2-supplement, B27-supplement, NEAA, GlutaMAX, and 2 -mercaptoethanol. In some embodiments, the culture medium is supplemented with N2-supplement, B27-supplement, NEAA, GlutaMAX, and 2 -mercaptoethanol. In some embodiments, the culture medium comprises a 1:1 ratio of DMEM: F12 and Neurobasal medium.12LEGAL02 / 45391128vlIn some embodiments, the culture medium comprises a 1:1 ratio of DMEM: F12 and Neurobasal medium supplemented with lx N2-supplement, lxB27-supplement, 1 x NEAA, lx GlutaMAX, 0.1 mM 2-mercaptoethanol. In some embodiments, the culture medium further comprises one or more of: KSR, BSA, Activin A, a ROCK inhibitor, and PDGF. In some embodiments, the culture medium further comprises one or more of: about 0.1% KSR, about 0.1% BSA, about 20 ng / mL Activin A, about 10 ng / mL PDGF, and about 10 pM / mL ROCK inhibitor. The ROCK inhibitor can be, but is not limited to, Y -27632. In some embodiments, neither the composition nor the culture medium contains retinoic acid.
[0062] Described are methods of generating bXENs comprising: isolating an inner cell mass (ICM) from a bovine blastocyst; and culturing the ICM in a culture medium supplemented any of the compositions (small molecule cocktails) for de novo derivation and long-term culture of bovine extraembryonic endoderm cells (bXENs) as described herein.
[0063] In some embodiments, the bovine blastocyst is an in vitro fertilized (IVF) bovine blastocyst. In some embodiments, the bovine blastocyst is a hatched bovine blastocyst. In some embodiments, the bovine blastocyst is a hatched IVF bovine blastocyst. In some embodiments, the bovine blastocyst is a day 8 bovine blastocyst. In some embodiments, the bovine blastocyst is a day 8 IVF bovine blastocyst. The IVF blastocyst can be made using any method available in the art for making a bovine blastocyst,
[0064] The culture medium (t / .g, a medium suitable for growth and maintenance (survival) of bovine cells in vitro) in which the ICM is cultured can be, but is not limited to, DMEM: F12 and Neurobasal medium. In some embodiments, the culture medium is supplemented one or more of with N2-supplement, B27-supplement, NEAA, GlutaMAX, and 2-mercaptoethanol. In some embodiments, the culture medium is supplemented with N2-supplement, B27-supplement, NEAA, GlutaMAX, and 2-mercaptoethanol. In some embodiments, the culture medium comprises a 1:1 ratio of DMEM. F12 and Neurobasal medium. In some embodiments, the culture medium comprises a 1:1 ratio of DMEM: F12 and Neurobasal medium supplemented with lx N2-supplement, lx B27-supplement, lxNEAA, l x GlutaMAX, and 0.1 mM 2-mercaptoethanol. In some embodiments, the culture medium further comprises one or more of: KSR, BSA, Activin A, a ROCK inhibitor, and PDGF. In some embodiments, the culture medium further comprises one or more of: about 0.1 % KSR, about 0.1% BSA, about 20 ng / mL Activin A, about 10 ng / mL PDGF, and about 10 pM / mL ROCK inhibitor The ROCK inhibitor can be, but is not limited to, Y-27632.13LEGAL02 / 45391128vlIn some embodiments, the culture medium is changed every day, every other day (every two days), every third day, or combinations thereof.
[0065] In some embodiments, neither the composition nor the culture medium contains retinoic acid
[0066] In some embodiments, the ROCK inhibitor is present in the culture medium for the first 24 hours. In some embodiments, the ROCK inhibitor is present in the culture medium for the only first 24 hours.
[0067] In some embodiments, the ICM is incubated in the culture medium at about 38.5°C and about 5% CO?
[0068] In some embodiments, the bXENs generated by the described methods are stable to at least 30 passages.
[0069] In some embodiments, the bXENs generated by the described methods maintain a stable epithelial morphology of flattened colonies with clearly defined margins and a normal diploid number of chromosomes.
[0070] In some embodiments, the bXENs generated by the described methods express SOX17 and GATA6.
[0071] In some embodiments, the bXENs generated by the described methods express extraembryonic visceral endoderm (VE) and parietal endoderm (PE) markers.
[0072] In some embodiments, the bXENs generated by the described methods do not express SOX2 or CDX2.
[0073] In some embodiments, the bXENs generated by the described methods are stable to at least 30 passages and maintain a stable epithelial morphology of flattened colonies with clearly defined margins and a normal diploid number of chromosomes.
[0074] In some embodiments, the bXENs generated by the described methods maintain a stable epithelial morphology of flattened colonies with clearly defined margins and a normal diploid number of chromosomes to at least 30 passages.
[0075] In some embodiments, the bXENs generated by the described methods express SOX 17, GATA6, an extraembryonic visceral endoderm (VE) marker and a parietal endoderm (PE) marker.
[0076] In some embodiments, the bXENs generated by the described methods express SOX17, GATA6, an extraembryonic visceral endoderm ( VE) marker and a parietal endoderm (PE) marker, but not SOX2 or CDX2.14LEGAL02 / 45391128vl
[0077] In some embodiments, the bXENs generated by the described methods are stable to at least 30 passages, maintain a stable epithelial morphology of flattened colonies with clearly defined margins and a normal diploid number of chromosomes, express SOX17 and GATA6, express extraembryonic visceral endoderm (VE) and parietal endoderm (PE) markers, and do not express SOX2 or CDX2.
[0078] Described are methods of generating short-term passaged bXENs comprising: isolating an inner cell mass (ICM) from the day 8 blastocyst, culturing the ICM in a first culture medium containing bFGF, and Activin A until the ICMs attached and formed an outgrowth; and after the ICM attached and formed an outgrowth incubating the ICM in a second culture medium containing LIF, Chir99021, bFGF, and Activin A. In some embodiments, the ICM is cultured in the first medium for about 3 days.
[0079] In some embodiments, the first culture medium comprises 20 ng / mL bFGF and 20 ng / mL Activin A. In some embodiments, the second culture medium comprises 20 ng / mL LIF, 1 µM Chir99021, 10 ng / mL bFGF, and 10 ng / mL Activin A. In some embodiments, the first culture medium comprises 20 ng / mL bFGF and 20 ng / mL Activin A and the second culture medium comprises 20 ng / mL LIF, 1 pM Chir99021, 10 ng / mL bFGF, and 10 ng / mL Activin A.
[0080] In some embodiments, the first culture medium further comprises 1:1 DMEM: F12 and Neurobasal medium, lx N2-supplement, lx B27-supplement, lxNEAA, lxGlutaMAX, and 0.1 mM 2-mercaptoethanol. In some embodiments, the second culture medium further comprises 1:1 DMEM: F12 and Neurobasal medium, 0.5xN2-supplement, 0.5x B27-supplement, 0.5x NEAA, 0.5 ’ GlutaMAX, 0.1 mM 2-mercaptoethanol, ImMNaPy, 10 pg / mL 1-ascorbic acid, lx ITS-X, 0.1% FBS, and 0.5% KSR. In some embodiments, the first culture medium further comprises 1:1 DMEM: Fl 2 and Neurobasal medium, lx N2-supplement, lx B27-supplement, lx NEAA, lx GlutaMAX, and 0.1 mM 2-mercaptoethanol; and the second culture medium further comprises 1: 1 DMEM: F12 and Neurobasal medium, 0.5xN2-supplement, 0.5x B27-supplement, 0.5x NEAA, 0.5x GlutaMAX, 0.1 mM 2-mercaptoethanol, ImM NaPy, 10 pg / mL 1-ascorbic acid, lx ITS-X, 0.1% FBS, and 0.5% KSR
[0081] bXENs generated using any of the described methods can be genetically modified. In some embodiments, a bXEN is genetically modified to form a reporter bXEN. A bXEN can be modified to a reporter bXEN by expressing a heterologous gene in the bXEN. The heterologous gene can be, but is not limited to, a marker (reported) protein. The marker protein can be any15LEGAL02 / 45391128vlmarker protein known in the art In some embodiments, the marker protein comprises a fluorescent protein. The fluorescent protein can be, but is not limited to, a green fluorescent protein or mCherr.[00821 Also described are methods of using the cultured bXENs to model epiblast and hypoblast lineage crosstalk and promote growth and sternness of bovine embryonic stem cells (ESCs), The methods comprise incubating or contacting the bovine embryonic stem cells (ESCs) with bXENs made using the methods described herein.
[0083] Also described are self-organized bovine blastocyst-like structures (EPTX-blastoids) and methods of manufacturing the self-organized bovine blastocyst-like structures. In some embodiments, the self-organized bovine blastocyst-like structures, EPTX (EPSCs, TSCs, and XENs, also terms EPTX-blastoids) are made by assembling bXENs (generated as described herein) with expanded potential stem cells (EPSCs) and trophoblast stem cells (TSCs). The self-organized bovine EPTX blastocyst-like structures provide an improved blastocyst model compared to two lineage (ESC and TSC) assembled blastoids as described in Pinzon- Arteaga CA eta.1. (in “Bovine blastocyst-like structures derived from stem cell cultures.” Cell Stem Cell 30, 611-616 e617 (2023)).
[0084] In some embodiments, the methods comprise: dissociating bEPSCs, bTSCs, and bXENs into single cells; depleting feeder cells (<?.., inactivate Mouse Embryonic Fibroblasts (iMEF) cells) from the bEPSCs, bTSCs, and bXENs; and combining the feeder cell depleted bEPSCs, bTSCs, and bXENs, wherein the bEPSCs, bTSCs, and bXENs self-assemble to form a EPTX-blastoid. In some embodiments, the bXENs used in forming the EPTX-blastoid are generated using any of the methods described herein for generating bXENs. In some embodiments, the EPTX-blastoids morphologically resemble day 8 IVF blastocysts.
[0085] Blastoids have previously been made using a blastoid medium having a tFACL+PD culture condition (FGF2, Activin-A, Chir99021, LIF, PD0325901). It has been shown that FGF2 can bias the cell fate of ICM towards PrE. Integrating bXENs into the blastoid, obviates the need for FGF2 for blastoid induction. Thus, in some embodiments, the bEPSCs, bTSCs, and bXENs are cultured in medium that does not contain FGF2. We also identified that the MEK inhibitor PD0325901 inhibits hypoblast specification from ICM, which might deplete hypoblasts. Thus, in some embodiments, the bEPSCs, bTSCs, and bXENs are cultured in medium that does not contain a MEK inhibitor (e.., does not contain PD0325901). In some embodiments, the bEPSCs, bTSCs, and bXENs are combined and cultured in medium that does not contain FGF2 or a MEK inhibitor.16LEGAL02 / 45391128vlIn some embodiments, the bEPSCs, bTSCs, and bXENs are combined and culture in a medium comprising Activin-A, Chir99021, LIF. In some embodiments, the bEPSCs, bTSCs, and bXENs are combined and culture in a medium comprising about 10 ng / mL to about 20 ng / mL Activin A. In some embodiments, the bEPSCs, bTSCs, and bXENs are combined and culture in a medium comprising about 0.5 mM to about 1.5 Mm Chir99021. In some embodiments, the bEPSCs, bTSCs, and bXENs are combined and culture in a medium comprising about 10 ng / mL to about 20 ng / mL LIF. In some embodiments, the bEPSCs, bTSCs, and bXENs are combined and culture in a medium comprising about 10 ng / mL to about 20 ng / mL Activin A, about 0.5 mM to about 1.5 Mm Chir99021, and about 10 ng / mL to about 20 ng / mL LIF.
[0086] The bEPSCs, bTSCs, and bXENs, and can be dissociated into single cells using any method available in the art for dissociating aggregates of mammalian cells in culture. In some embodiments, dissociating bEPSCs, bTSCs, and bXENs into single cells comprises treating the cells with trypsin, a trypsin-like enzyme (e.g., TrypLE), or a similar enzyme. The cells are treated with the trypsin, the trypsin-like enzyme (c.., TrypLE), or the similar enzyme for sufficient time to dissociate the cells. In some embodiments, dissociating bEPSCs, bTSCs, and bXENs into single cells comprises treating TrypLE followed by neutralizing with the same volume of their culture medium. In some embodiments, dissociating bEPSCs, bTSCs, and bXENs into single cells comprises treating TrypLE. for 3 min, 15 min, and 7 min, respectively, followed by neutralizing with the same volume of their culture medium.
[0087] Depleting feeder cells (e.g., iMEF cells) from the bEPSCs, bTSCs, and bXENs can be done using any method available in the art for depleting feeder cells from other mammalian cells. In some embodiments, depleting iMEF cells from the bEPSCs, bTSCs, and bXENs comprises filtering through passing 40 pm cell strainers.
[0088] In some embodiments, the feeder cell depleted bEPSCs, bTSCs, and bXENs are combined at a ratio of 1: 1:2 bEPSCs:bXENs:bTSCs. In some embodiments, the feeder cell depleted bEPSCs, bTSCs, and bXENs are combined at a ratio of 8:8:16 bEPSCs:bXENs:bTSCs. In some embodiments, combining the feeder cell depleted bEPSCs, bTSCs, and bXENs comprises combining 9600 bEPSCs, 9600 bXENs, and 19200 bTSCs. After combining the bEPSCs, bTSCs, and bXENs, the cells self-assemble to form the EPTX-blastoid.
[0089] In some embodiments, the self-assemble EPTX-blastoid mimics a blastocyst
[0090] Also described are EPTX-blastoids made using the described methods.17LEGAL02 / 45391128vl
[0091] Also described is a 3D assembly comprising bXENs, bEPSCs and bTSCs, wherein the 3D assembly mimics a blastocyst. The 3D assembly can be made using the methods described for making a EPTX-blastoid. In some embodiments, the bXENs of the 3D assembly are generated using any of the methods described herein for generating bXENs.
[0092] In some embodiments, the described bXENs can be used to promote growth and progression of epiblasts in a developing pre-implantation embryo. The bXENs used promote growth and progression of epiblasts in a developing pre-implantation embryo can be generated using any of the methods described herein for generating bXENs.
[0093] In some embodiments, the described bXENs can be used to enhance growth and sternness of bEPSCs. In some embodiment, the bEPSCs are cultured in the presence of bXENs. The bXENs used in enhance growth and sternness of bEPSCs can be generated using any of the methods described herein for generating bXENs.
[0094] Also described are methods of protecting an epiblast from differentiation and / or degeneration comprising culturing the epiblast in the presence of a FGF4, BMP4, XAV939, A83-01, and IL-6. In some embodiments, the epiblast is cultured in the presence of a about 25 ng / mL FGF4, about 10 ng / mL BMP4, about 1 M XAV939, about 3 pM A83-01, and about 10 ng / mL IL-6.
[0095] Hypoblast and its derivatives play a vital role in supporting and patterning the embryo, however, owing to applicable approaches associated with hi vivo experiments, knowledge of hypoblast lineage segregation and development remains largely unknown Here we demonstrated that a small molecule cocktail (FGF'4, BMP4, IL-6, XA V939, and A83-01) could support de novo derivation and maintenance of stable bXENs from bovine IVF blastocysts. Hypoblast lineage segregation and development is a conserved progress, while signaling to specify and sustain hypoblast is divergent among mammalian species. In mice, XENs do not require FGF signaling and can be maintained in the presence of retinoic acid and Activin-A. In humans, hypoblast induction requires FGF signaling (Dattani A et al. “Naive pluripotent stem cell-based models capture FGF-dependent human hypoblast lineage specification” Cell Siem Cell 31, 1058-1071 elO55 (2024)) and can also be induced from naive pluripotent stem cells using a small molecule cocktail of BMPs, IL-6, FGF4, A83-01, XAV939, PDGF-AA, and retinoic acid (Okubo T et al. “Hypoblast from human pluripotent stem cells regulates epiblast development.” Nature 626, 357-366 (2024)). In the domestic species, porcine XENs can be derived from blastocysts using either18LEGAL02 / 45391128vlLIF / FGF2 or LCD (LIF, CHIR99021, (S)-(+)-dimethindene maleate, and minocycline hydrochloride) (Park CN el al. “Extraembryonic Endoderm (XEN) Cells Capable of Contributing to Embryonic Chimeras Established from Pig Embryos.” Stem Cell Reports 16, 212-223 (2021) and Zhang ML el al. “Derivation of Porcine Extra-Embryonic Endoderm Cell Lines Reveals Distinct Signaling Pathway and Multipotency States.” Int J Mol Sci 22 (2021)). Of note, LCDM is reported to maintain both bovine iPSCs (Xiang J et al. “LCDM medium supports the derivation of bovine extended pluripotent stem cells with embryonic and extraembryonic potency in bovine-mouse chimeras from iPSCs and bovine fetal fibroblasts.” FEES J 288, 4394-4411 (2021)) and TSCs (W ng Y 2023). Interestingly, previous studies have demonstrated that FGF2 is also a key factor maintaining bovine primitive endoderm cells (Talbot NC et al. “Isolation and characterization of a bovine visceral endoderm cell line derived from a paithenogenetic blastocyst’ In Vitro Cell Dev Biol Anim 41, 130-141 (2005 ) and Smith MK et al. “Technical note: improving the efficiency of generating bovine extraembryonic endoderm cells.” J Anim Sci 98 (2020)). In the presence of FGF2, bEPSCs could be efficiently converted to hypoblast cells (Wang Y 2023). Here we have also shown that bXENs cells can be induced in the presence of FGF2, however, they are only capable for short-term self-renewal. Instead, a modification of human hypoblast induction condition by removing retinoic acid supports long-term culture of bXENs. The bXENs established in this study fill a gap and add a reliable stem cell model for research into pre- and periimplantation development of an ungulate species.
[0096] We have demonstrated the regulatory role of hypoblast in regulating epiblast development in a ruminant species. This has also been most recently highlighted in both mouse and humans using in vitro experimental models. In humans, the existence of hypoblast can facilitate ESCs in generating a pro-amniotic-like cavity, v hich recapitulates the anterior-posterior pattern and mimics several aspects of the post-implantation embryo. In mouse, primitive endoderm stem cells supported the lineage plasticity and the PrE alone was sufficient to regenerate a complete blastocyst and continue post-implantation development. Unlike many other mammalian species, ruminant species undergo a unique conceptus elongation process before implantation. During this phase, dramatic proliferation and differentiation of trophoblast and hypoblast lineage occur while the germ layer differentiation from epiblast is only observed until day 16, which may constitute limited developmental potential of bovine XENs compared to humans and mouse. Thus, the bovine19LEGAL02 / 45391128vlXENs model established here have mirrored the physiological lineage interaction between hypoblast and epiblast during bovine conceptus elongation.[00971 We also describe the development of an improved protocol to assemble bovine blastoids by self-organization of bXENs, bEPSCs, and bTSCs. In our previous study, the bovine EPT blastoids assembled from bEPSCs and bTSCs had a lower proportion of hypoblast lineages compared to the IVF blastocysts (Pinzon-Arteaga CA 2023), which may compromise their developmental potential. Instead, with the integration of bXENs, we have shown that the EPTX-blastoids described herein more closely resemble bovine blastocysts compared to the first generation of bovine blastoids (EPT blastoids) in terms of morphology, lineage composition and allocation, and transcriptional features. So far, most of the established blastoid models from other species, especially human, are self-organized from naive ESCs or EPSCs, (X. Liu X et al. “Modelling human blastocysts by reprogramming fibroblasts into iBlastoids.” Nature 591, 627-632 (2021); Yu L et al. “Blastocyst-like structures generated from human pluripotent stem cells.” Nature 591, 620-626 (2021); and Kagawa H et al. “Human blastoids model blastocyst development and implantation.” Nature 601, 600-605 (2022)), which comes up with concern that the differentiated TE-like lineage transcriptionally resembles amniotic ectoderm. Utilizing an assembly approach with authentic TSCs could eliminate this concern. Strikingly, embryo-like structures were generated through assembling mouse ESCs, TSCs, and XENs in vitro, which recapitulates the developmental characteristics of mouse embryos up to day 8.5 (Amadei G et al. “Embryo model completes gastrulation to neurulation and organogenesis.” Nature 610, 143-153 (2022) and Lau KYC etal. “Mouse embryo model derived exclusively from embryonic stem cells undergoes neurulation and heart development.” Cell Stem Cell 29, 1445-1458 e!448 (2022)), demonstrating that blastoids derived by assembling approach with three lineages possess higher developmental potential. This is significant in large mammals, particularly for domestic livestock, as blastoid technology described herein.
[0098] We have described an authentic extraembryonic endoderm (XEN) cell line and developed an improved bovine blastoid technology. We have also shown the value of bovine XEN in modeling cell-cell communications.20LEGAL02 / 45391128vlEXAMPLESExample 1. Methods.[00991 Animal care and use: Bovine peri-implantation embryos were collected from nonlactating, 3-year-old crossbreed (Bos taurus x Bos indicus) cows. All cows were housed in open pasture.
[0100] All the cells (EPSCs, TSCs, and XENs) used in this study were routinely tested for mycoplasma contamination.
[0101] A. Bovine IVF embryo production. The IVF embryos used in this study were produced as previously described. Briefly, bovine cumulus-oocyte complexes (COCs) were aspirated from selected follicles of slaughterhouse ovaries. BO-IVM medium (IVF Bioscience) was used for oocyte in vitro maturation. IVF was performed using cryopreserved semen from a Holstein bull with proven fertility Embryos were then washed and cultured in BO-IVC medium (IVF Bioscience) at 38.5 °C with 6% CO2. Day 8 hatched blastocysts were collected and were processed for bXENsderivation. For post-hatching culture from day 8 until day 12, embryos were transferred into extended culture medium containing Dulbecco's Modified Eagle Medium: Nutrient Mixture F12 (DMEM: F12; 1:1 mixture ofDMEM and Ham's F12 media; Gibco) and Neurobasal medium (Gibco) (1:1 mixture of DMEM: F12 and Neurobasal medium), 1xN2-supplement (Gibco), 1xB27-supplement (Gibco), lxNon-Essential Amino Acid (NEAA; Gibco), IxGlutaMAX (Gibco), 0.1 mM 2-mercaptoethanol (Gibco), 10 pM / mL Rho-associated protein kinase (ROCK) inhibitor (Tocris, 1254; trans-4-[(1R)-1-Aminoethyl]-N-4-pyridinylcyclohexanecarboxamide dihydrochloride), 20 ng / mL Activin A (Peprotech, 100-18B). For the treatment group, 25 ng / mL FGF4 (sigma, F8424), 10 ng / mL BMP4 (R& D SYSTEMS, 314-BP-050 / CF), 1 pM XAV939 (Sigma, X3004-5MG), 3 pM A83-01 (sigma SML0788-25MG), lOng / mL IL-6 (sigma, SRP3096) were added.
[0102] Bovine in vivo embryo collection. Cows were synchronized. Bovine peri-implantation embryos were collected 12 days after artificial insemination. Embryos were recovered by standard non-surgical flush.
[0103] B. Derivation and culture of bXENs. ICMs were isolated from day 8 blastocysts by microsurgery and were placed in separate wells of a 24-well plate that was seeded with mitomycin C-treated mouse embryonic fibroblast (MEF) cells. To derive bXENs, the ICMs were initially cultured in pre-bXENsmedium containing DMEM: F12 and Neurobasal medium (1:1), lxN2-21LEGAL02 / 45391128vlsupplement, lx B27-supplement, l x NEAA, lx GlutaMAX, 0.1 mM 2-mercaptoethanol, 20 ng / mL bFGF (also termed FGF2) (Peprotech, 100-18B), 20 ng / mL Activin A. After three days, when all the ICMs attached and formed outgrowth, the medium was changed to bXENsmedium containing DMEM: F12 and Neurobasal medium (1:1), 0.5xN2-supplement, 0.5x B27-supplement, 0.5x NEAA, 0.5x GlutaMAX, 0.1 mM 2-mercaptoethanol, ImM Sodium Pyruvate (NaPy) (Sigma, s8636), 10 pg / ml 1-ascorbic acid (Sigma, A92902), lx Insulin-Transferrin-Selenium-Ethanolamine (ITS-X) (Gibco, 51500-056), 0.1% Fetal Bovine Serum (FBS), 0.5% KnockOut Serum Replacement (KSR), 20 ng / mL Leukemia Inhibitory' Factor (LIF) (Peprotech, 300-05), IpM 6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-lH-imidazol-2-yl)-2-pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile (Chir99021, CAS No. 252917-06-9 (Sigma, SML-1046), 10 ng / mL basic fibroblast growth factor (bFGF), 10 ng / mL Activin A.
[0104] To derive bXEN, the ICMs were cultured in 5F-XEN medium containing DMEM: F12 and Neurobasal medium (1: 1), 1 x N2-supplement, 1× B27-supplement, lx NEAA, lx GlutaMAX, 0.1 mM 2-mercaptoethanol, 25 ng / mL FGF4, 10 ng / mL BMP4, 1 pM XAV939, 3 pM A83-01, 10 ng / mL IL-6. To promote the proliferation of hypoblast, 0.1% KSR, 0.1% Bovine Serum Albumin (BSA) (MP biomedicals), 20ng / mL Activin A, and 10 ng / mL PDGF (R& D SYSTEMS, BT220- 010 / CF) were also added during the derivation of bXEN and were optional for bXENs maintenance. All the cells were cultured at 38.5°C and 5% CO₂. The culture medium was changed every other day. On day 7 or 8, outgrowths were dissociated by TrypLE (Gibco, 12605-010) for 5-7 mins at 38 5 °C and passaged. For optimal survival rate, 10 pM Rho-associated protein kinase (ROCK) inhibitor Y-27632 was added to the culture medium during first 24 hours. Once established, both bXENsand bXEN were passaged every 3-5 days at a 1:5 split ratio using TrypLE. Each well of cells was dissociated by 0.5mL TrypLE for 5 mins at 38.5°C, the same volume of DMEM: F12 with 1% BSA was used to neutralize. bXENs could be cryopreserved by CELLBANKER 2 (ZENOGEN) according to the manufacturer’s instructions.
[0105] C. Bovine EPSCs culture. Bovine EPSCs were maintained in bovine EPSC culture medium (3i+LAF) (Zhao L et al. “Establishment of bovine expanded potential stem cells.” Proc Natl Acad Sci U S A 118 (2021)): mTeSR base (STEMCELL, 85850), 1% BSA,10ng / ml LIF, 20ng / ml Activin A, 0.3 pM WH-4-023 (CAS No. 837422-57-8), 1 pM Chir99021, 5 pM IWR1, 50 pg / ml Ascorbic acid (Vitamin C). bEPSCs were passaged every 2 days at a 1:6 split ratio using TrypLE. Each well of cells was dissociated by 0.5mL TrypLE for 5 mins at 38.5°C, the same22LEGAL02 / 45391128vlvolume of bXEN medium was used to neutralize TrypLE, ROCK inhibitor is necessary for each passage. bEPSCs could be cryopreserved by CELLBANKER 2 according to the manufacturer’s instructions.
[0106] D. Bovine TSCs culture. Bovine TSCs were derived and cultured in LCDM (Wang Y et al. “Establishment of bovine trophoblast stem cells.” Cell Rep 42, 112439 (2023)) (hLIF, CHIR99021, Dimethindene maleate (DiM) and minocycline hydrochloride (MiH)) media (DMEM: F12 and Neurobasal medium (1:1), 0.5x N2-supplement, 0.5xB27-supplement, lx NEAA, lxGlutaMAX, 0.1 mM 2-mercaptoethanol, 0.1% BSA (MP biomedicals), 10 ng / mL LIF, 3 pM CHIR99021 2 pM DiM (Tocris, 1425) and 2 pM MiH (Santa Cruz, sc-203339). bTSCs were passaged every 4 days at a 1:4 split ratio using Accutase (Gibco, Al 110501). Each well of bTSCs was dissociated by 1 mL Accutase for 5 mins at 38.5°C, the same volume of bTSCs medium was used to dilute Accutase for neutralizing the reaction. bTSCs were cryopreserved by CELLBANKER 1 according to the manufacturer’s instructions.
[0107] E. Generation of reporter bXENs. The pLenti CM V GFP Puro plasmid (Addgene #17448) was packaged into lentivirus in 293T cells using JetPrime reagent (Polyplus, 101000015) following manufacturer’s instructions. After 48 hours incubation, the medium was collected and concentrated using the Lenti-X™ Concentrator (Takara, 631231). Then the GFP-lentiviruses were transfected into bXENs with 5 pg / mL polybrene (sigma, TR-1003-G), 1 pg / mL of puromycin (sigma, P8833) was added to the culture medium 2-3 days after transfection. Drug-resistant colonies with GFP signaling were manually picked and further expanded.
[0108] F. Blastoid formation. For EPTX-blastoid formation, bEPSCs, bTSCs, and bXENs were dissociated into single cells by treating with TrypLE for 3 min, 15 min, and 7 min, respectively, followed by neutralizing with the same volume of their culture medium. After centrifugation at 300×g for 5 min, cells were resuspended in their normal culture media with ROCK inhibitor. Single-cell dissociation was made by gentle but constant pipetting until no visible cell clumps exist. To deplete iMEF cells, cells of three cell lines were filtered through 40 pm cell strainers (Corning) separately and placed in precoated 6 well plates (Coming) with 0.1% gelatin and incubated for 35 minutes at 38.5°C. Cells were then collected and stained with lx trypanblue and manually counted in a Neubauer chamber. Current protocol is optimized for 8 bEPSCs, 8 bXENs and 16 bTSCs per well in a 1200 well Aggrewell 400 microwell culture plate (Stemcell technologies) for 9600, 9600, and 19200 of each cell type per well. Each well was precoated with 500 µL of Anti-Adherence23LEGAL02 / 45391128vlRinsing Solution (Stemcell technologies) and spun for 5 minutes at 1500xg. Wells were rinsed with 1 mL of PBS just before aggregation. The cells for one well were mixed and centrifuged at 300*g for 5 min, followed by resuspension with 1 mL ACL medium (DMEM: F12 and Neurobasal medium (1:1), 1xN2-supplement, lx B27-supplement, 1xNEAA, lx GlutaMAX, 0.1 mM 2-mercaptoethanol, 0.5 x ITS-X, 20 ng / ml LIF, 10 ng / ml Activin A, IpM Chir99021, supplemented with lx CEPT cocktail (Chen Y et al. “A versatile polypharmacology platform promotes cytoprotection and viability of human pluripotent and differentiated cells.) Nat Methods 18, 528-541 (2021).) (50 nM chroman-1 (C, Tocris), 5 pM emricasan (E, Selleckchem), 0.7 µM trans-ISRIB (T, Tocris), and lx polyamine supplement (P, Thermo)). To ensure even distribution of the cells within each microwell, cells were gently mixed by pipetting with a P200 pipette. The plate was first placed in incubator for 8 min to allow the cells to settle down, then centrifuged at 700xg for 3 minutes and put back to incubator Half of the medium was changed daily, the blastoids showed up from day 2 and could be collected on day 3 or day 4.
[0109] G. Bovine EPSCs and XENs co-culture. bEPSCs and bXENs were dissociated into single cells and depleted of feeder cells as described above. Ten bEPSCs and 30 bXENs, or 40 bEPSCs, or 10 bEPSCs, or 40 bXENs were seeded in each well of a 1200 well Aggrewell 400 microwell culture plate. A separate experiment was conducted to examine the association between the starting cell number of bEPSCs (1, 5, 10, 20, and 40) and their aggregate formation efficiency. Each well was precoated with 500 µL of Anti-Adherence Rinsing Solution, spun for 5 minutes at 1500xg, and rinsed with 1 mL PBS before seeding The co-cultured cells were mixed and centrifuged at 300xg for 5 min, followed by resuspension with 1 mL N2B27 medium (DMEM: Fl 2 and Neurobasal medium (1:1), lxN2-supplement, lx B27-supplement, lx NEAA, lx GlutaMAX, 0.1 mM 2-mercaptoethanol) with 5% KSR and 10 pM Y27632 before seeding into the plate. To ensure even distribution of the cells within each microwell, cells were gently mixed by pipetting with a P200 pipette. The plate was first placed in incubator for 8 min to allow the cells to settle down, then centrifuged at 700xg for 3 min and put back to incubator. Half of the medium was changed daily and the aggregation structures were cultured until day 4.
[0110] H. Karyotyping assay. bXENs were incubated with 1 mL KaryoMAX colcemid solution (Gibco, 15212012) at 38.5°C for 4-5 hours. Cells were then dissociated using 1 mL Trypsin (Gibco, 25200-056) at 38.5°C and centrifuged at 300xg for 5 min. The cells were resuspended in 1 mL PBS solution and centrifuged at 400xg for 2 min. The supernatant was aspirated and 500 µL 0.56%24LEGAL02 / 45391128vlKC1 was added to resuspend the cells. The cells were incubated for 15 min, then centrifuged at 400xg for 2 min. 1 mL cold fresh Camoy’s fixative (3:1 methanol: acetic acid) was added to resuspend the cells, followed by a 10 min incubation on ice. After centrifuge, 200 mL Camoy’s fixative was added to resuspend the cells Cells were dropped on the clean slides and air dried and soaked in a solution (1:25 of Giemsa stain (Sigma, GS500): deionized water) for 9 min. Slides were rinsed with deionized water and air dried. The images were taken by Leica DM6B at 1000× magnification under oil immersion.
[0111] I. Immunofluorescence analysis. Cells, blastoids, and blastocysts were fixed in 4% paraformaldehyde (PFA) for 20 min at room temperature, and then rinsed in wash buffer (0.1% Triton X-100 and 0.1% polyvinyl pyrrolidone in PBS) three times. Following fixation, cells were permeabilized with 1% Triton X-100 in PBS for 30 min and then rinsed with wash buffer. Samples were then transferred to blocking buffer (0.1% Triton X-100, 1% BSA, 0.1 M glycine, 10% donkey serum) for 2 h at room temperature. Subsequently, the cells were incubated with the primary antibodies overnight at 4°C. The primary antibodies used in this experiment include anti-SOX2 (Biogenex, an833), anti-CDX2 (Biogenex, MU392A; 1:100), anti-GATA6 (R& D SYSTEMS, AF1700; 1:100), and anti-SOX17 (R&D SYSTEMS, AF1924; 1:100). For secondary antibody incubation, the cells were incubated with Fluor 488- or 555- or 647-conjugated secondary' antibodies for 1 hour at room temperature. Followed by DAPI staining (Invitrogen, D1306) for 15 min. The images were taken with a fluorescence confocal microscope (Leica).
[0112] J. Quantitative real-time PCR. Total RNA was extracted from cells using RNeasy Micro Kit (Qiagen) according to the manufacture’s protocol. First-strand cDNA was synthesized using the iScript cDNA Synthesis Kit (BIO-RAD). The qRT-PCR was performed using SYBR Green PCR Master Mix (BIORAD) with specific primers (Table 1 ). Data was analyzed using the BIO¬ RAD software provided with the instrument. The relative gene expression values were calculated using the AACT method and normalized to internal control beta-actin.Table 1. qPCR primersPrimer Sequence Primer Sequenceb SOX2 F TTTGTCCGAGACGGAGAAGC b SOX2 R CTCCCGGCAGTGTGTACTTA b NANOG F GCAGAAAAACAACTGGCCGA b NANOG R GTTCACCAAACACCCCTGGT b_OCT4_F GAAAGACGTGGTCCGAGTGT b OCT4 R GCCAGAGGAAAGGATACGGGb_CDX2_F GCCATGAGGAGCATGGACTC b_CDX2_R AACCACAGTCGTCTTTCCCC25LEGAL02 / 45391128vlb GATA3 F TAACATCGACGGTCAAGGCAA b GATA3 R GATGGACGTCTTGGAGAAGGG b_GATA2_F GTTGCGCAAACTGTCAGACG b_GATA2_R TCCTТCTTCATGGTCAGCGG b GATA4 F CGGGCTGTCATCCCACTATG b GATA4 R GACAGAAGACGCGTAGCCTT b_GATA6_F TTTTATТCACCAGCGGCACC b GATA6 R CTTTTAGCTCCTCGGGTGGG b_SOX17_F CTTCATGGTGTGGGCGAAG b_SOX17_R TAGGAGATAGGACAGCGGGAA b APOE F CGGTTTCTGGAGGCGAAGAA b APOE R CTCCATATCCGCCTGGCATC b FETUB F GGCTCTGTGCCTGTTGGTAT b RETUB R TTTTCACCTCTAGGCGTGGG b CTSV F AATGGGGCTGGAATGGCTAC b CTSV R AGGCTGTCCTCAAGTCCTCT b_FNl_F CTGGTAACCCTTCCACACCC b_FNl_R AGTGCCGGGAAGCTGAATAC b COL4A1 F CTTTGCTCTACGTGCAAGGC b COL4A1 R TAGGAGTAGTCGTTGCGGGAb_APOAl_F AGTTCTGGGACAACCTGGAAAA b APOA1 R TCGTGCCACTTCTTCTGGAACTC
[0113] K. RNA-seq library’ preparation and data analysis. Total RNA of bXENs was extracted using RNeasy Micro Kit (Qiagen). The RNA-seq libraries were generated using the Smart-seq2 v4 kit with minor modifications from the manufacturer’s instructions. Briefly, individual cells were lysed, and mRNA was captured and amplified with the Smart-seq2 v4 kit (Clontech). After AMPure XP beads purification, the high-quality amplified RNAs were subject to library preparation using Nextera XT DNA Library Preparation Kit (Illumina) and multiplexed by Nextera XT Indexes (Illumina). The concentration of sequencing libraries was determined using Qubit dsDNA HS Assay Kit (Life Technologies) and KAPA Library Quantification Kits (KAPA Biosystems). The size of sequencing libraries was determined using the Agilent D5000 ScreenTape with Tapestation 4200 system (Agilent). Pooled indexed libraries were then sequenced on the Illumina HiSeq X platform with 150-bp pair-end reads.
[0114] Multiplexed sequencing reads that passed filters were trimmed to remove low-quality reads and adaptors by Trim Galore (version 0.6.7) (-q 25 - length 20 max_n 3 -stringency 3). The quality of reads after filtering was assessed by FastQC, followed by alignment to the bovine genome (ARS-UCD1.3) by HISAT2 (version 2.2.1) with default parameters. The output SAM files were converted to BAM files and sorted using SAMtools (version 1.14). Read counts of all samples were quantified using featureCounts (version 2.0.1) with the bovine genome as a reference and were adjusted to provide counts per million (CPM) mapped reads. Principal component analysis and cluster analysis were performed with R (a free software environment for statistical computing and graphics). Differentially expressed genes (DEGs) were identified using edgeR in R. Genes were considered differentially expressed when they provided a false discovery rate of26LEGAL02 / 45391128vl<0.05 and fold change >2. ClusterProfiler was used to reveal the Gene Ontology and KEGG pathways in R.[01151 L. ATAC-seq library preparation and data analysis. The ATAC-seq libraries from fresh cells were prepared as previously described Shortly, cells were lysed on ice, then incubated with the Tn5 transposase (TDE1, Illumina) and tagmentation buffer. Tagmentated DNA was purified using MinElute Reaction Cleanup Kit (Qiagen). The ATAC-seq libraries were amplified by Illumina TrueSeq primers and multiplexed by index primers. Finally, high quality indexed libraries were pooled together and sequenced on Illumina NovaSeq platform with 150-bp paired-end reads.
[0116] The ATACseq analysis followed our established analysis pipeline. All quality assessed ATAC-seq reads were aligned to the bovine reference genome using Bowtie 2.3 with following options: -very-sensitive -X 2000 -no-mixed -no-discordant, Alignments resulted from PCR duplicates or locations in mitochondria were excluded. Only unique alignments within each sample were retained for subsequent analysis. ATAC-seq peaks were called separately for each sample by MACS2 with following options: -keep-dup all -nolambda -nomodel. The ATAC-seq bigwig files were generated using bamcoverage from deeptools. The ATAC-seq signals were normalized in the Integrative Genome Viewer genome browser. The enrichment of transcriptional factor motifs in peaks was evaluated using HOMER Motif Di scovery and Analysis algorithm.
[0117] M. Single nuclei isolation and scRNA-seq library preparation. The snRNA-seq libraries from frozen blastoids and day 8 blastocysts were prepared using Chromium Nuclei Isolation Kit (10x Genomics, PN-1000493) with minor modifications from the manufacturer’s instructions. In brief, frozen blastoids and day 8 blastocysts were transferred to pre-chilled sample dissociation tube and were dissociated with pestle within lysis buffer, then the tube was incubated on ice for 7 min. Then the dissociated sample was pipetted onto assembled nuclei isolation column and centrifuged 16,000×rcf for 20 sec. After being washed with debris removal buffer and wash buffer, the nuclei pellet was resuspended in 50 pL resuspension buffer and performed cell counting Nucleus were loaded into a lOx Genomics Chromium Chip following manufacturer instruction (10x Genomics, Chromium Next GEM Single Cell 3 ’ Reagent Kit v3.1 Dual Index) and sequenced with an Illumina Novaseq 6000 System (Novogene).
[0118] N. snRNA-seq data analysis To analyze lOx Genomics single-cell data, the base call files (BCL) were transferred to FASTQ files by using CellRanger (v.7.1.0) mkfastq with default parameters, followed by aligning to the most recent bovine reference genome downloaded from27LEGAL02 / 45391128vlEnsembl database (UCD1.3), then the doublets were detected and removed from single cells by using Scrublet (0.2.3) with default parameters. The generated count matrices from all the samples were integrated by R package Seurat (4.3.0) utilizing canonical correlation analysis (CCA) with default parameters. The data was scaled for linear dimension reduction and non-linear reduction using principal component analysis (PCA) and UMAP, respectively. The following clustering and visualization were performed by using the Seurat standard workflow with the parameters “dim = 1:10” in “FindNeighbors” function and “resolution =0.5” in “FindClusters” function. The function “FindAllMarkers” in Seurat was used to identify differentially expressed genes in each defined cluster The cutoff value to define the differentially expressed genes was p.adjust value <0.05, and fold change >0.25. The UMAP plots and bubble plots with marker genes were generated using “CellDimPlot” and “GroupHeatmap” functions in R package SCP (0.4.0), respectively. Gene ontology (GO) and pathway analysis were performed using R package clusterProfiler (4.6.1).
[0119] O. Quantification and statistical analysis. Data were analyzed using GraphPad Prism 9 (GraphPad Software, Inc.) unless otherwise stated Two-tailed unpaired or paired / -tests were used to determine the significance of differences between the means of two groups. One-way ANOVA followed by multiple comparisons was used to determine the significance of differences among means of more than two groups. Values of p < 0,05 were considered statistically significant Statistical analyses of sequencing data were performed in R. Genes with |fold change) >2 and p value < 005 were identified as significant DEGs Gene ontology (GO) and pathway analysis were performed using R package clusterProfiler (4.6.1). The value of p value < 0.05 was considered significant.Table 2. Resources tableChemicals, peptides, and recombinant proteins source identifierRecombinant human LIF Peprotech Cat. No. 300-05 CHIR99021 Sigma Cat. No. SML-1046 Dimethindene maleate Tocris Cat. No. 1425Minocycline hydrochloride Santa cruz Cat, No. sc-203339 Insulin-Transferrin-Selenium-Ethanolamine (ITS-X) Gibco Cat. No. 51500-056 PD0325901 Axon Medchem Cat. No. 1408 Recombinant Human FGF-basic Peprotech Cat. No. 100-18B Recombinant Human / Murine / Rat Activin A Peprotech Cat. No. 120-14EEmricasan Selleckchem Cat. No. 50-136-523428LEGAL02 / 45391128vlPolyamine supplement Sigma Cat No. P8483 trans-ISRIB, 10mg Tocris Cat. No. 5284Chroman 1 (HY-15392) MedChemExpress Cat. No. 502029121 mTeSR™ 1 STEMCELL Cat. No. 85850WH-4-023 Tocris Cat, No 5413endo-IWR 1 Sigma Cat. No. 10161XAV-939 Sigma Cat. No. X3004L-Ascorbic acid 2 -phosphate Sigma Cat. No. A92902FGF4 sigma Cat, No, F8424BMP4 R& D SYSTEMS Cat. No. 314-BP-050 / CF IL-6 Sigma Cat. No. SRP3096A83-01 Sigma Cat. No. SML0788 Knockout™ SR Gibco Cat. No. 10828-028 PDGF R& D SYSTEMS Cat. No. BT220-010 / CF DMEM Gibco Cat. No. 11995-040 FBS Gibco Cat. No. 26140-079 Dulbecco’s phosphate buffered saline Sigma Cat. No. D8537(1X), no calcium, no magnesium (DPBS)Y-27632 Tocris Cat. No. 1254 DMEM / F12 medium HyClone Cat. No. SH30023.01 Neurobasal medium Gibco Cat. No. 21103-049N2 supplement (100×) Gibco Cat. No. 17502-048 B27 supplement (50x) Gibco Cat. No. 17504044 MEM Non-Essential Amino Acids Solution (100×) Gibco Cat. No. 11140-050 GlutaMAX™ Supplement (100×) Gibco Cat. No. 350500612-Mercaptoethanol (55 mM) Gibco Cat. No. 21985023 Accutase Gibco Cat. No. A1110501Tn5 transposase Illumina Cat. No. 20034197BSA MP Biomedicals Cat. No. 0219989950TrypLE_ Express Gibco Cat. No. 12605-010Example 2. De novo derivation of bovine XENs from blastocysts
[0120] We have previously shown that a combination of four molecules (FGF2, Activin-A, L1F, and Chir99021) was able to efficiently convert SOX2+bovine extended pluripotent stem cells (EPSCs) into SOX17+hypoblast cells (Pinzon- Arteaga 2023). Therefore, we first adapted these four factors (4F-XENM) to derive bovine XENs from day 8 hatched IVF blastocysts. We observed outgrowths of XEN-like colonies (FIG. 6A). Since robust hypoblast markers remain largely unknown in bovine, by mining a single cell RNA-seq dataset of bovine day 12 embryo, we identified a group of genes (including CTSV, FETUB, APOA1, APOE, COL4A1, and FN1) that were highly expressed specifically in hypoblast lineages, and were thus regarded as hypoblast 29LEGAL02 / 45391128vlmarkers (FIG 6B, C). We found that these bXEN-like cells highly expressed all identified bovine hypoblast markers, while barely expressing epiblast (SOX2, OCT4, and NANOG) or trophoblast (CDX2, GATA3, and GATA2) markers (FIG. 6D). However, these XENs can only be maintained up to ten passages, therefore, named as short-term passaged bovine XENs (bXENs).
[0121] Recently, authentic human hypoblast cells were successfully induced from naive pluripotent stem cells with seven chemical molecules, including BMPs (a pSMADl / 5 / 9 activator), IL-6 (a pSTAT3 activator), FGF4, A83-01 (a pSMAD2 inhibitor and ALK4 / 5 / 7 inhibitor) and XAV939 (a WNT / p-catenin inhibitor and tankyrase inhibitor) along with PDGF-AA and retinoic acid (Okubo T etal. “Hypoblast from human pluripotent stem cells regulates epiblast development.” Nature 626, 357-366 (2024)). To further establish long-term culture of bovine XENs, we assessed different combinations of these seven factors with 4F-XENM. Our screening showed that neither seven factors nor adding individual or any combinations of seven factors into 4F-XENM medium could establish stable bovine XENs (Table 3). Surprisingly, we found that a combination of FGF4, BMP4, IL-6, XAV939, and A83-01 (combination termed 5F-XENM) was able to efficiently support the outgrowth of bXEN-like morphological colonies from blastocysts (FIG. 1A). The derived bXENs-like colonies maintained stable and self-renewal properties with long-term passages (>30) (FIG. 1A), therefore named as long-term passaged bovine XENs, or bXENs. Further characterization revealed that bXENs maintained stable epithelial morphology of flattened colonies with clearly defined margins (FIG. 1A) and a normal diploid number of chromosomes (2N - 60) after long-term in vitro culture (FIG. IB). Immunostaining analysis showed that, similar to hypoblasts of bovine blastocysts, bXENs expressed SOX17 and GATA6, but not SOX2 or CDX2 which is positive in bEPSCs or bTSCs, respectively (FIG. 1C, D). They also highly expressed all identified novel hypoblast markers (FIG. IE). To distinguish the established XEN cells from definitive endoderm, we analyzed extraembryonic and definitive endoderm markers and found that bXENs highly expressed extraembryonic markers such as PDGFRA, GATA4, and SOX17, while barely expressing definitive endoderm markers, such as CXCR4 and KIT (FIG. 7A).Table 3. Culture conditions screened for the derivation of bovine XENs.Ml M2 M3 M4 M5 M6 M7 M8 M9 MIO Ml 1 M12 Ml 3 Basal N2B27 Z Z Z Z Z Z Z mediumSmall A83-01molecules BMP430LEGAL02 / 45391128vlFGF4 Z Z Z Z IL-6PDGF XAV939retinoicacidActivin A ZFGF2 zLIF Z ZChir99021 ZIWR1DiMMillOutgrowth rate (%) 0 / 4 0 / 4 1 / 4 2 / 4 2 / 4 0 / 4 0 / 4 7 / 10 5 / 6 0 / 4 6 / 8Long-tenn maintenance
[0122] Furthermore, we determined the essential small molecules that facilitate maintenance of bXENs. First, A83-01 alone could maintain the stable expansion of bXENs while the cell proliferation and the marker gene expression were reduced (FIG. IF, G, H). Withdrawal of A83-01 from 5F-XENM, bXENs exhibited differentiation and failed to expand into stable cell lines (FIG. II), suggesting A83-01 is indispensable in maintaining bXENs. Second, we observed that withdrawal of XAV939 or XAV939 together with IL-6 has a limited impact on the expression of bXENs’ marker genes (FIG. 1G) and cell proliferation (FIG. 1H). Third, absence of XAV939 and BMP4 resulted in reduced expression level of hypoblast markers such asFETUB, APOE, and FN1 (FIG. 1G), Finally, we demonstrated that BMP4 and FGF4 were two major factors affecting bXENs’ proliferation (FIG. 1H). Together, we demonstrated that 5F-XENM was effective in supporting the maintenance ofbXENs.
[0123] Collectively, we developed a culture condition (5F-XENM) that supports de novo derivation and maintenance of stable bXENs in vitro.Example 3. Transcriptional and chromatin accessibility features ofbXENs
[0124] We next explored the transcriptomes ofbXENs by RNA sequencing (RNA-seq) analysis. We compared the transcriptomes of bXENs with bovine EPSCs and bovine TSCs. Principal component analysis (PCA) revealed that bXENs were clustered distinct from bEPSCs in PCI and bTSCs in PC2, respectively (FIG. 2A), indicating the unique identity of three types of bovine stem cells, which is also shown in the correlation analysis (FIG. 7B). The identity ofbXENs was further confirmed by the expression of representative marker genes of their corresponding blastocyst 31LEGAL02 / 45391128vllineages (PrE, Epi, and TE) in these three types of bovine stem cells (FIG. 2B) Of note, bXENs also highly expressed both extraembryonic visceral endoderm (VE) and parietal endoderm (PE) markers (FIG. 2B), suggesting their developmental capacity towards VE and PE of the yolk sac. Additionally, we identified signaling pathways that were uniquely enriched in bXENs, including PI3K-Akt, cholesterol metabolism, focal adhesion, TNF, and TGF-beta signaling pathways (FIG.2C). Intriguingly, when integrating transcriptomes of bXENs with single cell transcriptomes of hypoblast lineages of bovine embryos at days 12, 14, 16, and 18, we found that bXENs are closely clustered with highly proliferating hypoblasts from spheroid embryos (D12 and D14) while distinct from more differenti ted hypoblasts of elongated embryos (DI 6 and D18), suggesting bXENs resemble early hypoblast populations in vivo (FIG. 2D).
[0125] Additional transcriptomic comparisons of XENs and ESCs among cattle, human, and mice further confirmed the lineage identity of bXENs (FIG. 2E). To further investigate the unique transcriptomic features of bXENs, we explored XEN specific genes compared to ESC in three mammalian species separately and identified 400 genes that are commonly enriched in XENs (FIG.7C). These genes were involved in regulating canonical hypoblast functions, including circulatory system development, cell fate commitment, and embryo development (FIG. 2F). Additionally, 274 genes are uniquely in bovine, mainly involved in manipulating ligand-receptor interaction, cytokine-cytokine receptor interaction, and steroid hormone biosynthesis (FIG, 2F). It is also noteworthy that bovine and human XENs share more common genes than those compared to mouse.
[0126] We also conducted ATAC-seq analysis to characterize the genome-wide chromatin accessibility of bXENs (FIG. 2G, H). Our analysis showed that the chromatin accessibilities of hypoblast lineage marker genes are consistent with their expression profiles (e.g., APOE and SOX17) (FIG. 21). We confirmed that canonical hypoblast transcriptional factors (TFs) binding motifs are enriched in bXENs, such as GATA6, GATA4, SOX 17 (FIG 2J). In addition, we identified several novel bovine hypoblast TFs including CTCF, BATF, ATF3, FOSL2, KLF5, KLF3, ELF1, JUNE), and NFY, and HLF (FIG. 2J). We further confirmed that their chromatin accessibilities are consistent with their gene expression as well (FIG. 7D). Most of them (CTCF. NFYA, NFYC, JUND) were also highly expressed in the hypoblast cells of a day 12 bovine embryo(FIG. 7E). Additionally, we analyzed the definitive endoderm markers against bXENs32LEGAL02 / 45391128vltranscriptional and chromatin accessibility datasets and found that these markers were not active in bXENs (FIG. 7F, G), further reinforcing their distinct identity from definitive endoderm.[01271 Together, the RNA-seq and ATAC-seq analyses confirmed the molecular identity of bXENs and shed light on the molecular features during the earliest steps of hypoblast development in bovine.Example 4. bXENs regulate the development of EPSCs and pre -implantation epiblasts.
[0128] In cattle, the attachment of blastocysts is preceded by a period of rapid growth and elongation, when hypoblast lineages present dynamic changes between spheroid (D12 and D14) and elongated (DI 6 and DI 8) embryos, and have intense communication with both epiblast and trophectoderm lineages. Given that both epiblast and hypoblast specify from ICM and the plasticity of two lineages are largely unknown, here we implemented a 3D co-culture model with bXENs and bEPSCs to examine whether or how hypoblast regulates the development of epiblast during bovine embryogenesis. We mixed different ratios of bEPSC:bXEN cell populations (Groupl (Gl): bEPSCs:bXENs = 40:0; Group2 (G2): bEPSCs:bXENs = 10:30; Group3 (G3): bEPSCs:bXENs = 10:0; and Group4 (G4): bEPSCs:bXENs = 0:40) (FIG. 3A-D). We found that co-cultures in both Gl and G2 formed spherical structures, but not those from G3 and G4 (FIG.3A-D). Next, we conducted immunofluorescence analysis of SOX2 and GATA6 that are exclusively expressed in bEPSCs and bXENs, respectively. We found that spherical structures organized from bEPSCs alone in Gl largely remain SOX2 positive with GATA6 positive cells located at the peripheral region (FIG. 3E). Further quantification showed that aggregates in Gl consisted of three types of structures, including Tl) SOX27GATA6'1, T2) SOX27GATA6, T3) SOX2 / GAT / \6 (FIG. 3E). These results indicate a loss of pluripotency and random differentiation of EPSCs to hypoblasts-like cells, that was consistent with previous observations both in humans and bovine. On the contrary, co-culture of bEPSCs with bXENs in G2 resulted in spherical structures with cleaner and smoother periphery region compared to those of Gl (FIG.3B), suggesting an improved proliferation and survival of aggregates. Further immunostaining analysis showed that all cells in G2 remain SOX2 positive without any detection of GATA6+cells (FIG. 3E), suggesting that the present of bXENs prevents bEPSCs differentiation. To rule out the possibility that XENs transdifferentiate into SOX2+cells, we tagged bXENs with GFP, followed by co-culture. We observed that bXENs were aggregated with bEPSCs on day 1, and all GFP+33LEGAL02 / 45391128vlbXENs disappeared by day 4 (FIG. 3G). Additionally, we found that, in the presence of bXENs in G2, bEPSCs’ proliferation was significantly facilitated relative to Gl, based on the size of formed spherical structures (FIG. 3H). These results demonstrated that the presence of bXENs and associated communications support the growth and sternness of bEPSCs.
[0129] To further confirm the effects of the small molecule cocktail sustaining bXENs in promoting epiblast development of pre-implantation embryos, we treated bovine in vitro cultured embryos with defined small molecular cocktails sustaining bXENs (BMP4, FGF4, A83-01, XAV939, IL-6). The treatment was given at different developmental period before and after major genome activation or hypoblast specification (Experiment 1 (Exp. 1): day 1-8; Experiment 2 (Exp.2): day 5-8; Experiment 3 (Exp. 3): day 8-12) (FIG. 4A). The subsequent developmental rate and lineage composition and allocation were measured by immunostaining analysis of epiblast marker SOX2, hypoblast marker SOX17, and trophectoderm marker CDX2 When treating embryos with bXEN small molecule cocktails from either day 1-8 (Exp. 1) or day 5-8 (Exp. 2), we found day 8 hatched blastocysts had a significantly increased SOX27 SOX171cell ratio compared to the control group (FIG. 4B, C). We also observed that these bXEN small molecule cocktail had no impact on early cleavage and trophoblast differentiation until blastocyst (FIG. 4D). However, the blastocyst hatching rate decreased dramatically presumably due to the issue of lineage specification within ICM (FIG. 4D), Further treating blastocysts with bXEN small molecule cocktails during extended culture period from day 8 (Exp. 3). We observed that day 12 embryos had a well-defined and condensed SOX2 spot in the ICM region (FIG. 4E), consistent with in vivo D 12 embryos (FIG. 8), while ICM structures went through degeneration in control group (FIG.4E). When calculating the ratio of SOX2!and SOX174cells, we observed a significantly higher SOX2+cells and lower SOX17^ cells in treated group compared to control. These results demonstrated that bXEN small molecule cocktails could effectively protect epiblast from differenti tion or degeneration during bovine pre-implantation development,
[0130] Taking together, our experiments with both co-culture cell model and IVF embryos demonstrated that XENs or their molecule signaling regulate regulate the development of EPSCs or pre-implantation epiblasts, respectively, in bovine.34LEGAL02 / 45391128vlExample 5. Generation of bovine blastoids by self-organization of bXENs, bEPSCs, and bTSCs.
[0131] We have previously reported the successful generation of bovine blastoids by selfassembly of bEPSCs and bTSCs (EPT blastoids) in tFACL+PD culture condition. However, the blastoids generated by this two-lineage approach exhibited a lower proportion of hypoblast lineage compared to IVF blastocysts, which may limit their developmental capacity. The establishment of bXENs prompted us to develop improved a bovine blastoid protocol through 3D assembly of bXENs, bEPSCs and bTSCs. We first aggregated three bovine stem cell types (bEPSC / bXEN / bTSC = 8:8:16) using the culture condition (FGF2, Activin-A, Chir99021, LIF, and PD0325901) as we previously reported. We found that this condition can support the formation of blastoids with high efficiency (46.60% + 3.80%) within 4 days. The resulted blastoids contained blastocele-like cavity, an outer TE-like layer, and an ICM-like compartment, morphologically equivalent to day 8 blastocysts (FIG 5 A, D, E). However, these blastoids have vanished SOX17+hypoblasts compared to day 8 IVF blastocysts (FIG. 5A, D), similarly as we observed in our EPT- blastoids (also termed 2L-blastoids) (FIG. 5C).
[0132] It has been shown that FGF2 could bias the cell fate of ICM towards PrE. As we integrated XENs, the FGF2 is not necessary for the blastoid induction anymore. Also, MEK inhibitor PD0325901 inhibits hypoblast specification from ICM, which might be the reason for the vanished hypoblasts. Therefore, we removed both FGF2 and PD0325901 from the culture condition, and found that the modified medium, ACL (Activin-A, Chir99021, LIF) supported the formation of blastoids morphologically resemble day 8 IVF blastocysts (FIG. 5B). The efficiency of blastoid formation from three lineages (EPTX blastoids reached 40.84% + 4.76% within 4 days. Importantly, EPTX-blastoids had a similar proportion of hypoblast and a slightly higher ratio of epiblast population compared to day 8 blastocysts, with majority hypoblast cells surrounding epiblasts (FIG. 5B, D). Additionally, the blastocelle size and ICM / blastocelle ratio of EPTX-blastoid were also equivalent to day-8 IVF blastocysts (FIG. 5F, G). Thus, the bovine EPTX-blastoid model established in this study more closely resembled blastocysts compared to the EPT-blastoids,
[0133] To determine the transcriptional states of EPTX-blastoids, we performed single-nucleus RNA sequencing (snRNAseq) analysis of EPTX-blastoids using the lOx genomics low throughput (up to 1,000 cells) platform. To ensure precise comparison, we also generated snRNA-seq datasets of bovine day 8 IVF blastocysts using the same lOx genomics platform. Joint uniform manifold35LEGAL02 / 45391128vlapproximation and projection (UMAP) analysis revealed overall cells from EPT-blastoid clustered well with blastocyst-derived cells (FIG. 5H) We annotated three major cell clusters from blastocysts representing three blastocyst lineages, including Cluster 1 highly expressed SOX2, VIM, SLIT2, NNAT, CDH2, and NANOG as epiblasts, Cluster 2 highly expressed GATA6, HDAC1, HDAC8, HNF4A, PDGFRA, and RUNX1 as hypoblast, and Cluster 3 highly expressed DAB2, GATA2 / 3, KRT8, SFN, TEAD4, TFAP2C as trophectoderm cells (FIG. 5I, J). Of note, in the blastocyst, the defined epiblast cells still expressed hypoblast markers, and vice versa (FIG.5 J), suggesting the segregation of epiblast and hypoblast within ICM was not completed yet. The marker gene expression had the same patterns in all three annotated lineages from both EPTX-blastoids and blastocysts, such as GATA2 (TE markers), PDGFRA (HYPO markers), and SLIT2 (EPI markers), indicating EPTX-blastoids transcriptionally resembled blastocysts (FIG. 9A). The comparative clustering analysis of EPTX-blastoids and blastocyst cells showed thatblastoids have a lower hypoblast cell population and higher epiblast population compared to the blastocysts (FIG.5K). This confounding factor in single cell gene expression analysis may constitute the difference of lineage composition from immunostaining analysis. Additionally, we performed GO analysis of genes specifically enriched in each of three lineages of EPTX-blastoids. We found that genes specific to epiblasts are involved in regulating nervous system development, cell junction organization, and stem cell population maintenance; genes upregulated in hypoblasts regulate cell morphogenesis and cell fate commitment, and genes highly expressed in trophectoderm cells are involved in manipulating lipid biosynthetic process, actin cytoskeleton organization, and cell migration (FIG. 9B). Intriguingly, it was shown that most of the lineage specific genes in epiblast and hypoblast lineages were transcription factors (TFs) or TF cofactors, unveiling the lineage specific functions of those critical TFs during lineage specification within ICM and further differentiation events (FIG. 9B).
[0134] We have developed an efficient and robust protocol to generate bovine blastoids by assembling bXENs, bEPSCs, and bTSCs that can self-organize and faithfully recreate all blastocyst lineages.36LEGAL02 / 45391128vl
Claims
1. Claims:
1. A composition for de novo derivation and long-term culture of bovine extraembryonic endoderm cells (bXENs) comprising: fibroblast growth factor 4 (FGF4), bone morphogenetic protein 4 (BMP4), interleukin 6 (IL-6), 3,5,7,8-Tetrahydro-2-[4-(trifluoromethyl)phenyl]-4FI-thiopyrano[4,3-d]pyrimidin-4-one (XAV939), and 3-(6-Methyl-2-pyridinyl)- / V-phenyI-4-(4-quinolinyl)-l / / -pyrazole-l-carbothioamide (A83-01), wherein the composition does not contain retinoic acid2. The composition of claim 1, wherein the composition is provided in a culture medium.
3. The composition of claim 2, wherein the composition comprises about 25 ng / mL FGF4, about 10 ng / mL BMP4, about 1 pM XAV939, about 3 pM A83-01, and about 10 ng / mL IL-6.
4. The composition of claim 2, wherein the culture medium further comprises: DMEM: F12, Neurobasal medium, N2-supplement, B27-supplement, NEAA, GlutaMAX, and 2-mercaptoethanol5. The composition of claim 4, wherein the culture medium comprises: 1:1 Dulbecco's Modified Eagle Medium: Nutrient Mixture F12 (DMEM: F12) and Neurobasal medium, lx N2-supplement, lx B27-supplement, lxNEAA, lx GlutaMAX, 0.1 mM, and 2-mercaptoethanol,6. The composition of any one of claims 2-5 wherein the culture medium further comprises one or more of: KnockOut Serum Replacement (KSR), Bovine Serum Albumin (BSA), Activin A, a Rho-associated protein kinase (ROCK) inhibitor, and Platelet-derived growth factor (PDGF).
7. The composition of claim 6, wherein the medium further comprises one or more of: about 0.1% KSR, about 0.1% BSA, about 20 ng / mL Activin A, about 10 ng / mL PDGF, and about 10 pM / mL ROCK inhibitor.9.3710.LEGAL02 / 45391128vl 8. The composition of claim 6 or 7. wherein the ROCK inhibitor comprises11.Y-27632.
9. A method of generating bXENs comprising:13.(a) isolating an inner cell mass (ICM) from a bovine blastocyst; and (b) culturing the ICM in a culture medium supplemented with FGF4, BMP4, XAV939, A83-01, and IL-6;14.thereby generating the bXENs.
10. The method of claim 9, wherein the bovine blastocyst is an in vitro fertilized blastocyst.
11. The method of claim 9 or 10, wherein the blastocyst is a hatched blastocyst.
12. The method of claim 9 or 10, wherein the blastocyst is a day 8 blastocyst.
13. The method of any one of claims 9-12, wherein the culture medium is supplemented with 25 ng / mL FGF4, 10 ng / mL BMP4, 1 pM XAV939, 3 pM A83-01, and 10 ng / mL IL-6.
14. The method of any one of claims 9-13, wherein the culture media comprises: DMEM F12, Neurobasal medium, N2-supplement, B27-supplement, NEAA, GlutaMAX, and 2-mercaptoethanol.
15. The method of claim 14, wherein the culture media comprises 1:1 DMEM: F12 and Neurobasal medium, lx N2-supplement, 1× B27-supplement, 1 x NEAA, lx GlutaMAX, and 0.1 mM 2-mercaptoethanol.
16. The method of any one of claim 9-15, wherein the culture medium further comprises one or more of: KSR, BSA, Activin A, PDGF, and a ROCK inhibitor.
17. The method of claim 16, wherein the culture medium comprises one or more of: 0.1% KSR, 0.1% BSA, 20 ng / mL Activin A, 10 ng / mL PDGF, and 10 pM / mL ROCK inhibitor.
18. The method of claim 16 or 17, wherein the ROCK inhibitor comprises Y-27632.24.3825.LEGAL02 / 45391128vl 19. The method of any one of claims 16-18, wherein the method comprises incubating the cells in medium containing the ROCK inhibitor for the first 24 hours.
20. The method of any one of claims 9-19, wherein the method comprises culturing the ICM with the culture medium at about 38.5°C and about 5% CO2.
21. The method of any one of claims 9-20, wherein the method comprises changing the culture medium every other day.
22. The method of any one of claims 9-21, wherein the bXENs:29.(a) are stable to at least 30 passages; and30.(b) maintain a stable epithelial morphology of flattened colonies with clearly defined margins and a normal diploid number of chromosomes.
23. The method of claims 22, wherein the bXENs:32.(a) express SRY-boxl7 (SOX17) and GATA-binding factor 6 (GATA6);33.(b) express extraembryonic visceral endoderm (YE) and parietal endoderm (PE) markers; and34.(c) do not express SRY-box2 (SOX2) or caudal type homeobox 2 (CDX2).
24. A method of generating short-term passaged bXENs comprising36.(a) isolating an inner cell mass (ICM) from the day 8 blastocyst (b) culturing the ICM in a first medium containing bFGF, and Activin A until the ICMs attached and formed an outgrowth; and37.(c) after the ICM attached and formed an outgrowth incubating the ICM in a second medium containing leukemia inhibitory' factor (LIF), Chir99021, bovine fibroblast growth factor (bFGF), and Activin A.
25. The method of claim 24, wherein39.(a) the first medium contains 20 ng / mL bFGF and 20 ng / mL Activin A; and (b) the second medium contains 20 ng / mL LIF, IpM Chir99021, 10 ng / mL bFGF, and 10 ng / mL Activin A.
26. The method of claim 24 or 25, wherein41.3942.LEGAL02 / 45391128vl (a) the first medium contains 1:1 DMEM: F12 and Neurobasal medium, 1xN2-supplement, 1× B27-supplement> 1* NEAA, lxGlutaMAX, and 0.1 mM 2- mercaptoethanol; and43.(b) the second medium contains 1:1 DMEM: F12 and Neurobasal medium, 0.5xN2-supplement, 0.5xB27-supplement, 0.5xNEAA, 0.5xGlutaMAX, 0.1 mM2-mercaptoethanol, ImM Sodium Pyruvate (NaPy), 10 pg / mL 1-ascorbic acid, lxITS-X, 0.1% fetal bovine serum (FBS), and 0.5% KSR.
27. The method of any one of claims 24-26, wherein the ICM is cultured in the first medium for about 3 days.
28. A reporter bXEN comprising a bXEN generated by the method of any one of claims 9-23, wherein the bXEN is modified to express a reporter protein.
29. The reporter bXEN of claim 28, wherein the reporter protein comprises a fluorescent protein.
30. A method of making a EPTX-blastoid comprising:48.(a) dissociating bovine expanded potential stem cells (bEPSCs), bXENs, and bovine trophoblast stem cells (bTSCs) into single cells;49.(b) depleting inactivated Mouse Embryonic Fibroblasts (iMEF) cells from the bEPSCs, bXENs, and bTSCs, and50.(c) combining the iMEF cell depleted bEPSCs, bXENs, and bTSCs; wherein the bEPSCs, bXENs, and bTSCs self-assemble to form the EPTX-blastoid31. The method of claim 30, wherein depleting iMEF cells comprises filtering the dissociating bEPSCs, bTSCs, and bXENs through a 40 pm cell strainer.
32. The method of claim 30 or 31, wherein combining the iMEF cell depleted bEPSCs, bXENs, and bTSCs comprises combining the iMEF cell depleted bEPSCs, bXENs, and bTSCs at a ratio of 8:8:16 bEPSCs:bXENs:bTSCs.53.4054.LEGAL02 / 45391128vl 33. The method of claim 1, wherein combining the iMEF cell depleted bEPSCs, bXENs, and bTSCs comprises combining 9600 bEPSCs, 9600 bXENs, and 19200 bTSCs.
34. The method of any one of claims 30-33, wherein the EPTX-blastoid mimics a blastocyst.
35. A three-dimensional (3D) assembly comprising: bXENs, bEPSCs and bTSCs, wherein the 3D assembly mimics a blastocyst.
36. The 3D assembly of claim 35, wherein the bXENs are generated by the method of any one of claims 9-23.
37. A method of enhancing growth and sternness of bEPSCs comprises culturing the bEPSCs in the presence of bXENs.
38. The method of claim 34, wherein the bXENs are generated by the method of any one of claim s 9-23.
39. A method of protecting an epiblast from differentiation and / or degeneration comprising culturing the epiblast in the presence of a FGF4, BMP4, XAV939, A83-01, and IL-6.
40. The method of claim 38, wherein the method comprises culturing the epiblast in the presence of a 25 ng / mL FGF4, 10 ng / mL BMP4, 1 pM XAV939, 3 pM A83-01, and62.10 ng / mL IL-663.4164.LEGAL02 / 45391128vl