Genomic analysis using tagmentation

Abstract

In an example method, a chemical cross-linker is introduced to cultured cells, so that at least DNA within the cultured cells is cross-linked and cells having fixed chromatin are formed. The cells having fixed chromatin are exposed to cell lysis to form a crude lysate. The crude lysate is introduced into a flow cell including: one of: i) first and second transposome complex dimers immobilized on a surface of the flow cell, the first transposome complex dimers including a first amplification domain and the second transposome complex dimers including a second amplification domain; or ii) a single transposome complex dimer immobilized on the surface, each of the single transposome complex dimers including two forked transposome complexes; and a primer set immobilized on the surface. Tagmentation of the cross-linked DNA in the crude lysate is initiated.

Description

GENOMIC ANALYSIS USING TAGMENTATIONCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application Serial Number 63 / 736,365, filed December 19, 2024, the content of which is incorporated by reference herein in its entirety.REFERENCE TO SEQUENCE LISTING

[0002] The Sequence Listing submitted herewith is hereby incorporated by reference in its entirety. The name of the file is ILI295BPCTJP-2925- PCT_Sequence_Listing.xml, the size of the file is 15,781 bytes, and the date of creation of the file is December 11 , 2025.BACKGROUND

[0003] Hi-C is a high-throughput genomic and epigenomic technique to capture chromatin conformation. The technique can elucidate the frequency at which two DNA fragments physically associate in 3D space, thus enabling chromosomal structure to be linked directly to genomic sequences.BRIEF DESCRIPTION OF THE DRAWINGS

[0004] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.

[0005] Fig. 1 A through Fig. 1 H depict different examples of transposome complexes;

[0006] Fig. 2A is a top view of a flow cell;

[0007] Fig. 2B is an enlarged, perspective, and cut-away view of one architecture of the flow cell of Fig. 2A, where transposome complexes are at least attached to interstitial regions of the flow cell;

[0008] Fig. 2C is an enlarged, perspective, and cut-away view of another architecture of the flow cell of Fig. 2A, where transposome complexes are attached to primers in depressions of the flow cell;

[0009] Fig. 2D is an enlarged, perspective, and cut-away view of yet another architecture of the flow cell of Fig. 2A, where transposome complexes are attached to primers in a lane of the flow cell;

[0010] Fig. 2E is an enlarged, perspective, and cut-away view of another architecture of the flow cell of Fig. 2A, where a single transposome complex dimer is immobilized in each of the depressions of the flow cell;

[0011] Fig. 3A and Fig. 3B illustrate a portion of one example of a method; and

[0012] Fig. 4 is a schematic flow diagram illustrating another example of a method.

[0013] Definitions

[0014] Nucleic Acid Sample

[0015] The term “nucleic acid sample,” as used herein, may refer to a sample, typically derived from any organism, including, as examples, animals, plants, fungi, and microbes. For example, such samples may be derived from one or more biological fluids, cells, tissues, organs, or organisms, comprising a nucleic acid or a mixture of nucleic acids comprising at least one nucleic acid sequence. Such samples may include sputum / oral fluid, amniotic fluid, blood, a blood fraction, or fine needle biopsy samples (such as surgical biopsy, fine needle biopsy, etc.), urine, peritoneal fluid, pleural fluid, and the like. Although the sample is often taken from a human subject (such as a patient), the sample may be from any mammal, including, for example, dogs, cats, horses, goats, sheep, cattle, pigs, etc. Alternatively, the sample may be microbial, such as bacteria, viral, or fungal. The sample may be used directly as obtained from the biological source or following a pretreatment to modify the character of the sample. For example, such pretreatment may include preparingplasma from blood, diluting viscous fluids and so forth. Methods of pretreatment may also involve filtration, precipitation, dilution, distillation, mixing, centrifugation, freezing, lyophilization, concentration, amplification, nucleic acid fragmentation, inactivation of interfering components, the addition of reagents, lysing, etc. If such methods of pretreatment are employed with respect to the sample, such pretreatment methods are typically such that the nucleic acid(s) of interest remain in the test sample, sometimes at a concentration proportional to that in an untreated test sample (such as namely, a sample that is not subjected to any such pretreatment method(s)). Such “treated” or “processed” samples are still considered to be biological “test” samples with respect to the methods described herein. A “nucleic acid sample” may also include nucleic acid sequence information stored in a memory, and which was originally obtained from a source such as one or more biological fluids, cells, tissues, organs, or organisms.

[0016] Fragmentation

[0017] The shearing or fragmenting of nucleic acid into shorter lengths. Fragmentation methods include enzymatic methods, physical methods (including sonication, nebulization, needle shearing, microwave, etc.), and chemical methods (including depurination, hydrolysis, oxidation, etc.). The terms “fragmenting enzymes” or “enzyme-based fragmentation” or “enzyme fragmentation,” as used herein, refer to enzymes that fragment nucleic acid. The enzymes can be a single enzyme or two or more enzymes that work together to fragment the nucleic acid. Some enzymes work on single stranded nucleic acid, whereas others work on double stranded nucleic acid and yet others work on one strand of a double stranded nucleic acid. Fragmenting enzymes can cut randomly or specifically. Examples of fragmenting enzymes include transposase, restriction enzymes, Argonaute, CRISPR -associated nuclease (Cas), endonucleases, exonuclease, topoisomerase, FRAGMENTASE™ (New England Biolabs, Ipswich, MA). Preferred fragmentation embodiments include methods that fragment while retaining proximity information of the fragments.

[0018] Transposase

[0019] As used herein, the term “transposase” is intended to mean an enzyme that is capable of forming a functional complex with a transposon element-containing composition (e.g., transposons, transposon ends, transposon end compositions) andcatalyzing insertion or transposition of the transposon element-containing composition into a target DNA with which it is incubated, for example, in an in vitro transposition reaction. The term can also include integrases from retrotransposons and retroviruses. Transposases, transposomes, and transposome complexes are generally known to those of skill in the art, as exemplified by the disclosure of U.S. Pat. App. Pub. 2010 / 0120098, which is incorporated herein by reference in its entirety. Although many examples described herein refer to Tn5 transposase and / or hyperactive Tn5 transposase, it will be appreciated that any transposition system that is capable of inserting a transposon element with sufficient efficiency to tag a target nucleic acid can be used. In particular examples, the transposition system is capable of inserting the transposon element in a random or in an almost random manner to tag the target nucleic acid. As used herein, the term “transposome” is intended to mean a transposase enzyme bound to a nucleic acid. Typically, the nucleic acid is double stranded. For example, the complex can be the product of incubating a transposase enzyme with double-stranded transposon DNA under conditions that support non- covalent complex formation. Transposon DNA can include Tn5 DNA, a portion of Tn5 DNA, a fusion of Tn5, or a portion of Tn5 with one or more auxiliary proteins, a transposon element composition, a mixture of transposon element compositions, or other nucleic acids capable of interacting with a transposase, such as the hyperactive Tn5 transposase.

[0020] Immobilization

[0021] The term “immobilized”, “affixed” and “attached” are used interchangeably herein and are intended to encompass direct or indirect, covalent or non-covalent attachment unless indicated otherwise, either explicitly or by context.

[0022] Exemplary covalent attachment includes, for example, those that result from the use of click chemistry techniques (catalysed or uncatalyzed), inverse electron demand Diels-Alder (IEDDA), amide bond formation, disulfide bridge formation, and other suitable covalent attachment techniques. Examples of non-covalent attachment include non-specific interactions (e.g., hydrogen bonding, ionic bonding, van der Waals interactions, metal-complex formation, lipophilic / hydrophilic interactions) or specific interactions (e.g., affinity interactions, receptor-ligand interactions, antibody-epitopeinteractions, avidin-biotin interactions, streptavidin-biotin interactions, lectincarbohydrate interactions). Exemplary attachments are set forth in U.S. Pat. Nos. 6,737,236 B1 ; 7,259,258 B2; 7,375,234 B2 and 7,427,678 B2; and U.S. Pat. App. Pub. 2011 / 0059865 A1 , each of which is incorporated herein by reference in its entirety.

[0023] In certain examples, the molecules (e.g., nucleic acids, enzymes) remain immobilized or attached to the solid support under the conditions to which they are exposed, for example in applications requiring nucleic acid amplification and / or sequencing. In other examples, the molecules are reversibly immobilized and can be removed from the solid support through the use of cleavable sites, linkers, and the like.

[0024] Solid Support

[0025] The terms “solid support,” “solid surface,” and other grammatical equivalents herein refer to any substrate that is appropriate for, or that can be modified to be appropriate for, the attachment of enzymes, nucleic acids, and complexes thereof. As will be appreciated by those in the art, the number of possible substrates is very large. Possible substrates include glass and modified or functionalized glass, polymers (including acrylics, polyacrylamides, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, polytetrafluoroethylene (TEFLON™), polyamide, etc.), polysaccharides, nitrocellulose, ceramics, resins, silica or silica-based materials, silicon and modified silicon, carbon, metals, optical fiber bundles, quartz, metal oxides, inorganic oxides, other suitable transparent materials, other suitable non-transparent materials, other suitable translucent materials, and combinations thereof. The composition and geometry of the solid support can vary with its use.

[0026] In some examples, the solid support or solid surface is a planar structure, such as a flow cell (or flowcell), slide, chip, microchip, array, microarray, wafer, panel, charge pad, and / or web. The planar structure can be a single surface structure having a single surface of sample / reaction sites. The planar structure can be a dual surface structure. One example of a dual surface structure includes a top substrate having a top surface of sample / reactions sites, a bottom substrate having a bottom surface of sample / reactions sites, and a spacer layer separating the top substrate and the bottom substrate. The solid support or solid surface can be open todirect application of a fluid. One example of an open solid support or open solid surface is an open flow cell having a single surface structure without an inlet port. In some examples, the solid support is not necessarily planar, such as, for example, the surface of a well, tube, or other vessel. Some specific examples include the surface of a microcentrifuge tube, a well of a multi-well plate, and the like.

[0027] In some examples, the solid support comprises one or more surfaces of a flow cell or flow cell. The term “flowcell” or “flow cell,” as used herein, refers to a solid surface across which one or more fluid reagents can be flowed. Examples of flow cells and related fluidic systems and detection platforms that can be readily used in the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008), WO 2004 / 018497; U.S. Pat. No. 7,057,026 B2; WO 1991 / 006678; WO 2007 / 123744; U.S. Pat. No. 7,329,492 B2; U.S. Pat. No. 7,211 ,414 B2; U.S. Pat. No. 7,315,019 B2; U.S. Pat. No. 7,405,281 B2, and U.S. Pat. App. Pub. 2008 / 0108082 A1 , each of which is incorporated herein by reference in its entirety. In some examples, the flow cells can include one or more flow lanes. For flow cells having a plurality of flow lanes, each of the flow lanes can be independently accessed or two or more flow lanes can be accessed as a group.

[0028] In some examples, the solid support or solid surface is a non-planar structure, such beads, microspheres, and / or inner and / or outer surface of a tube or vessel. The terms “beads”, “microspheres,” or “particles” or grammatical equivalents herein refer to small discrete particles. Suitable bead compositions include plastics, ceramics, glass, polystyrene, methylstyrene, acrylic polymers, acrylamide, paramagnetic materials, thoria sol, carbon graphite, titanium dioxide, latex, polysaccharide (e.g., DEXTRAN™, SEPHAROSE™, cellulose, agarose), nylon, crosslinked micelles, TEFLON™, as well as any other materials outlined herein for solid supports may all be used. “Microsphere Detection Guide” from Bangs Laboratories, Fishers Ind. is a helpful guide. In certain examples, the microspheres are magnetic microspheres or beads. The beads may or may not be spherical; and thus, irregular particles may be used. Alternatively or additionally, the beads may be porous. The bead sizes range from nanometers, i.e. 100 nm, to millimeters, i.e. 1 mm, with beads from about 0.2 micron to about 200 microns being preferred, and from about 0.5 toabout 5 microns being particularly desired in some applications, although in some examples, smaller or larger beads may be used.

[0029] Patterned / Random

[0030] In some examples, the solid support comprises a patterned surface suitable for immobilization of molecules, such as enzymes, nucleic acids, and complexes thereof, in an ordered pattern. A “patterned surface” refers to an arrangement of different regions in or on an exposed layer of a solid support. The features can be separated by interstitial regions that contribute to the pattern. In some examples, the interstitial regions can be a different height, creating wells or raised platform patterns. In other examples, the interstitial regions can have a different surface charges or surface energies. In yet other examples, the interstitial regions can have a different attachment moieties. In some examples, the pattern can be any suitable pattern, such as a grid patterns, radial patterns, and combinations thereof. In some examples, a patterned surface can contain pre-determined locations of features but the features are not arrayed in a repetitive pattern. Examples of grid patterns include rectangular patterns, hexagonal patterns, triangular, and other suitable grid patterns. The regions for immobilization of molecules may be depressed regions, elevated regions, or planar regions relative to the interstitial regions. The regions may be fabricated as is generally known in the art using a variety of techniques, including, for example, photolithography, stamping techniques, molding techniques, microetching techniques, and combinations thereof. As will be appreciated by those in the art, the technique used will depend on the composition and shape of the regions. For example, the regions for immobilization of molecules of a patterned surface may be wells, pits, channels, posts, pillars, ridges, stripes, swirls, lines, and other suitable topographies. For example, the wells may have any opening in any shape, such as circular, oval, polygonal (e.g., hexagonal, octagonal, square, rectangular, elliptical, etc.). Examples of patterned surfaces that can be used in the methods and compositions set forth herein are described in U.S. Pat. No. 8,778,849 B2, which is incorporated herein by reference in its entirety.

[0031] In some examples, the solid support comprises a surface suitable for immobilization of molecules, such as enzymes, nucleic acids, and complexes thereof,in a random distribution over the solid support. Exemplary random distribution over a solid support is described in U.S. Pat. No. 8,241 ,573 B2, which is incorporated herein by reference in its entirety.

[0032] Amplification

[0033] Some examplesfurther comprise amplifying and / or replicating one or more nucleic acid templates, including fragments thereof. The amplifying and / or replicating comprises use of one or more of a bridge amplification reaction, an isothermal bridge amplification reaction, a rolling circle amplification (RCA) reaction, a modified rolling circle multiple displacement amplification, a helicase-dependent amplification reaction, a recombinase-dependent amplification reaction, a singlestranded DNA binding (SSB) protein mediated Isothermal amplification, a PCR reaction, a strand-displacement reaction, a ligase chain reaction, a transcription- mediated reaction, a loop-mediated amplification reaction, other suitable reactions, and combinations thereof. Amplification can occur on the sequencing instrument or separately from the sequencing instrument.

[0034] Polonies

[0035] Some examplesfurther comprise rolling circle amplification / replication used to form polonies. The term “polony” or “polonies” used herein refers to a nucleic acid library molecule clonally amplified in-solution or on-support to generate an amplicon that can serve as a template molecule for sequencing. In some aspects, a linear library molecule can be circularized to generate a circularized library molecule, and the circularized library molecule can be clonally amplified in-solution or on-support to generate a concatemer. In some aspects, the concatemer can serve as a nucleic acid template molecule which can be sequenced. The concatemer is sometimes referred to as a polony. In some aspects, a polony includes nucleotide strands.

[0036] Nanoballs

[0037] A concatemer comprising multiple copies of a target nucleic acid molecule. Rolling circle amplification / replication can be used to form nucleic acid nanoballs. These nucleic acid copies may be arranged one after another in a continuous linear strand of nucleotides. These nucleic acid copies may result in a nanoball folding configuration. The multiple copies of the target nucleic acid moleculein a nucleic acid nanoball may each contain an adaptor sequence of a known sequence to facilitate amplification or sequencing. The adaptor sequence of each target nucleic acid molecule may be the same or different. The nucleic acid nanoball can be loaded on the surface of a solid support. The nanoball can be attached to the surface of the solid support by any suitable method. Examples of such methods include nucleic acid hybridization, biotin streptavidin binding, thiol binding, photoactive binding, covalent binding, antibody-antigen, physical constraints via hydrogels or other porous polymers, etc., or combinations thereof. In some cases, the nanoball can be digested with an enzyme (nuclease, etc.) to produce a smaller nanoball or a fragment from the nanoball.

[0038] Clusters

[0039] A localized group or collection of DNA or RNA molecules on a nucleotide- sample support, such as a flow cell, particle, polymer scaffold, or other solid surface. In particular, a cluster includes tens, hundreds, thousands, or more copies of a cloned (i.e. , the same) DNA or RNA segment. For example, in one or more examples, a cluster includes a grouping of oligonucleotides immobilized in a section of a flow cell or other nucleotide-sample slide. In some examples, the cluster can comprise one or more concatemers, such as, for example, a polony or a nanoball. In some examples, clusters are evenly spaced or organized in a systematic structure within a patterned flow cell. By contrast, in some cases, clusters are randomly organized within a nonpatterned flow cell. In typical examples, a cluster is the product of an amplification reaction. A cluster of oligonucleotides can be imaged utilizing one or more light signals, changes in pH, changes in conductance, and other signals. For instance, an oligonucleotide-cluster image may be captured by a camera during a sequencing cycle. The image captures light emitted by irradiated fluorescent labeled nucleotides incorporated into oligonucleotides, fluorescent labeled nucleotides bound but not incorporated into oligonucleotides, and other fluorescent labeled complexes associated with incorporated or bound nucleotides from one or more clusters on a flow cell. Examples of other sequencing procedures are set forth herein. In some examples, a cluster can be monoclonal or polyclonal.

[0040] Sequencing Procedures

[0041] The term “read” or “sequence read” (or sequencing reads) refers to a sequence obtained from a portion of a nucleic acid sample. A read may be represented by a string of nucleotides sequenced from any part or all of a nucleic acid molecule. Typically, though not necessarily, a read represents a short sequence of contiguous base pairs in the sample. The read may be represented symbolically by the base pair sequence (in A, T, C, or G) of the sample portion. It may be stored in a memory device and processed as appropriate to determine whether it matches a reference sequence or meets other criteria. A read may be obtained directly from a sequencing apparatus or indirectly from stored sequence information concerning the sample. In some cases, a read is a DNA sequence of sufficient length (such as at least about 25 bp) that can be used to identify a larger sequence or region, for example, that can be aligned and specifically assigned to a chromosome or genomic region or gene. For example, a sequence read may be a short string of nucleotides (such as 20-150 bases) sequenced from a nucleic acid fragment, a short string of nucleotides at one or both ends of a nucleic acid fragment, or the sequencing of the entire nucleic acid fragment that exists in the biological sample. Sequence reads may be obtained by any method known in the art. For example, a sequence read may be obtained in a variety of ways, such as using sequencing techniques or using probes, such as in hybridization arrays or capture probes, or amplification techniques.

[0042] The examples described herein can be used with any suitable sequencing chemistry, such as sequencing by synthesis (SBS), sequencing by binding, sequencing by ligation, or nanopore sequencing.

[0043] SBS can be performed with or without the use of reversible terminators. For example, SBS can be initiated by contacting the target nucleic acids with one or more nucleotides (e.g., labelled, synthetic, modified, or a combination thereof), DNA polymerase, etc. Those features where a primer is extended, using the target nucleic acid as a template, will incorporate a labeled nucleotide that can be detected. The incorporation time used in a sequencing run can be significantly reduced using the altered polymerases. Optionally, the labeled nucleotides can further include a reversible termination property that terminates further primer extension once anucleotide has been added to a primer. For example, a nucleotide analog having a reversible terminator moiety can be added to a primer such that subsequent extension cannot occur until a deblocking agent is delivered to remove the moiety. Thus, for examplesthat use reversible termination, a deblocking reagent can be delivered to the flow cell (before or after detection occurs). Washes can be carried out between the various delivery steps. The cycle can then be repeated n times to extend the primer by n nucleotides, thereby detecting a sequence of length n. Exemplary SBS procedures, fluidic systems, and detection platforms that can be readily adapted for use with an array produced by the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008); WO 2004 / 018497; WO 1991 / 006678; WO 2007 / 123744; U.S. Pat. Nos. 7,057,026 B2, 7,329,492 B2, 7,211 ,414 B2, 7,315,019 B2, 7,405,281 B2, and 8,343,746 B2. Sequence reads can de generated using sequencing instruments from Illumina, Inc. (San Diego, CA).

[0044] One example of SBS is termed sequencing by binding. One implementation of sequencing by binding includes cycles of initiating sequencing of a template with a reversible blocker on the 3’ end to prevent additional bases from incorporating, interrogating the template by flooding the flow cell with fluorescently tagged bases that do not include a blocker and measuring an emitted signal of bound bases, activating the 3’ end via removal of the reversible blocker, and incorporating the complementary base from unlabeled, blocked nucleotides. Reads using sequencing by binding can be generated from using instruments such as ONSO™ sequencing instruments from Pacific Biosciences of California, Inc. (Menlo Park, CA). Another implementation of sequencing by binding could be sequencing by avidity. In sequencing by avidity, fluorescent dye labeled cores termed avidites are used. One potential cycle of sequencing by avidity includes providing a reagent of polymerase and reversibly terminated nucleotides to templates immobilized on a solid surface, deblocking the incorporated nucleotides, flowing a set of four types of avidites, washing away unbound avidites, detecting the incorporated bases / nucleotides, and removing the bound avidites. The steps in the cycle of sequencing by avidity may be performed in other orders. Sequencing by avidity is described in Arslan, S., Garcia, F.J., Guo, M., et al., “Sequencing by avidity enables high accuracy with low reagent consumption.”Nat Biotech no\ 42, 132-138 (2024). https: / / doi.Org / 10.1038 / s41587-023-01750-7, which is incorporated by reference in its entirety. Reads using sequencing by avidity can be generated using instruments such as AVITI™ sequencing instruments from Element Biosciences (San Diego).

[0045] One example of SBS using an open flow cell and without using reversible terminators is disclosed in Almogy, G., (2022) “Cost-efficient whole genomesequencing using novel mostly natural sequencing-by-synthesis chemistry and open fluidics platform” https: / / doi.Org / 10.1101 / 2022.05.29.493900, which is incorporation by reference in its entirety. Sequence reads using an open flow cell can be generated using instruments such as UG 100TM Sequencer from Ultima Genomics, Inc. (Fremont, CA).

[0046] Some SBS examples include detection of a proton released upon incorporation of a nucleotide into an extension product. For example, sequencing based on detection of released protons can use an electrical detector and associated techniques that are described in U.S. Pat. Nos. 8,262,900 B2, 7,948,015 B2, 8,349,167 B2, and U.S. Pat. App. Pub. 2010 / 0137143 A1 , each of which is incorporated by reference in its entirety.

[0047] Sequence reads can be generated using instruments such as DNBSEQ™ sequencing instruments from MGI Tech Co., Ltd. (Shenzhen, China) and as SURFSeq™, FASTASeq™, and GenoLab™ sequencing instruments from GeneMind Biosciences Co., Ltd. (Shenzhen, China).

[0048] Some examples can use methods involving the real-time monitoring of DNA polymerase activity. For example, nucleotide incorporations can be detected through fluorescence resonance energy transfer (FRET) interactions between a fluorophore-bearing polymerase and y-phosphate-labeled nucleotides, or with zeromode waveguides. Techniques and reagents for FRET-based sequencing are described, for example, in Levene et al., Science 299, 682-686 (2003); Lundquist, et al., Opt. Lett. 33, 1026-1028 (2008); and Korlach, et al. Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008), each of which is incorporated by reference in its entirety. Techniques that sequence using zeromode waveguides are described in U.S. Pat. No. 6,917,726 B2, which is incorporated by reference in its entirety.

[0049] Transposome Complexes

[0050] Fig. 1 A through Fig. 1 H illustrate monomers of different examples of the transposome complexes 10A through 10H that may be used in the flow cells, methods, and kits disclosed herein. It is to be understood that during transposome complexes 10A through 10H assembly, dimers are capable of forming. The type of dimer that is formed can be controlled by controlling the type of annealed transposons (with transposon ends 14A, 14B, etc.) added to the solution with the transposase enzyme 12A, 12B, etc. during transposon complex 10A, 10B, etc. assembly. When a plurality transposons that form one type of the transposome complexes 10A, 10B, 10C, 10D, 10E, 10F, 10G, or 10H is incorporated into a liquid carrier with the transposase enzyme 12A, 12B, etc., the one type of transposome complexes 10A, 10B, 10C, 10D, 10E, 10F, 10G, or 10H will form and these transposome complexes 10A, 10B, 10C, 10D, 10E, 10F, 10G, or 10H are capable of forming homodimers. These homodimers may then be introduced into any of the flow cells 32 (see Fig. 2A) disclosed herein. If two different types of transposons - that form two different complexes, e.g., 10A and 10B - are included in solution with the transposase enzyme 12A, 12B, etc., homodimers and heterodimers will form. In any of the solutions, some transposome complexes 10A through 10H may not dimerize, and these individual transposome complexes 10A, 10B, 10C, 10D, 10E, 10F, 10G, or 10H can attach to the flow cell surface. The monomeric transposome complex(es) 10A, 10B, 10C, 10D, 10E, 10F, 10G, or 10H will not participate in tagmentation.

[0051] During some of the methods set forth herein, two types of transposome complex(es) 10A and 10B, or 10A and 10C, or 10D and 10E, or 10F and 10G are used together. It is to be understood that homodimers of these complexes 10A and 10B, or 10A and 10C, or 10D and 10E, or 10F and 10G may be formed separately in solution and then added to the flow cell 32 for attachment thereto. In other examples, one of the two types of transposome complex(es) 10A, 10D, or 10F is used in a solution based tagmentation, and the other of the two types of transposome complex(es) 10B, 10C, 10E, or 10G is immobilized on the flow cell surface as described herein. During still other examples of the methods set forth herein, one type of transposome complex10H is used. It is to be understood that homodimers of this complex may be formed either in solution prior to introduction into the flow cell 32 or in solution as they are being attached in the flow cell 32.

[0052] Referring specifically to Fig. 1A and Fig. 1 B, each of the transposome complexes 10A, 10B includes a transposase enzyme 12A, 12B non-covalently bound to a transposon end 14A, 14B. Each transposon end 14A, 14B is a double-stranded nucleic acid strand, one strand MEA or MEB of which is part of a transferred strand 16A, 16B and the other strand ME’ or ME’B of which is the non-transferred strand 18A, 18B. In other words, the transposon end 14A, 14B includes a portion of the respective transferred strand 16A, 16B that is hybridized to the non-transferred strand 18A, 18B.

[0053] The transferred strand 16A includes a 5’ end attachment group 20A, a first amplification domain 26, and a sequencing primer sequence 28A that is attached to the strand MEA of the transposon end 14A. The strand MEA of the transposon end 14A is positioned at the 3’ end of the transferred strand 16A. While not shown, the transferred strand 16A may further include an index sequence positioned between the first amplification domain 26 and the sequencing primer sequence 28A.

[0054] Similar to the transferred strand 16A, the transferred strand 16B includes a 5’ end attachment group 20B, a second amplification domain 38, and a sequencing primer sequence 28B that is attached to the strand ME’B of the transposon end 14B. The strand ME’B of the transposon end 14B is positioned at the 3’ end of the transferred strand 16B. Also while not shown, the transferred strand 16B may further include an index sequence positioned between the second amplification domain 38 and the sequencing primer sequence 28B.

[0055] In some examples, the 5’ end attachment groups 20A, 20B are capable of attaching to a transposome capture mechanism 57 that is attached over at least the interstitial regions 56 of the flow cell 32. In other examples, the 5’ end attachment groups 20A, 20B are capable of attaching directly to the substrate 50 or 52 that forms the interstitial regions 56 of the flow cell 32. Table 1 A provides examples of the transposome capture mechanism 57 and corresponding 5’ end attachment groups 20A, 20B that can covalently or non-covalently attach to the transposome capturemechanism. Non-covalent attachments may include electrostatic interaction, hydrophobic interaction, Van der Waals interaction, or hydrogen bonding. Table 1 B provides examples of the substrate surface groups and corresponding 5’ end attachment groups 20A, 20B that can covalently or non-covalently attach to the substrate surface groups.

[0056] In any of the examples at forth in Table 1 A and Table 1 B, the linker can be poly(ethylene glycol) (PEG), amino PEG, poly(N-isopropylacrylamide), polyacrylate, polyacrylamide, polyethylene oxide, poly-glycine, alkyl chains, or the like.

[0057] The interactions between the transposome capture mechanism 57 or the substrate surface groups and the 5’ end attachment groups 20A, 20B (or 3’ attachment group 42, see Fig. 1 C) are described in more detail in reference to Fig. 2B.

[0058] The first and second amplification domains 26, 38 have different sequences from each other, but have the same sequence, respectively, as first and second primers 34, 36 attached to the polymeric hydrogel 22 (e.g., in the flow cell 32). The first and second primers 34, 36 are amplification primers of a primer set. The first amplification domain 26, its complement, and the primer 34, together with the second amplification domain 38, its complement, and the primer 36 enable the amplification of the DNA sample fragments generated during tagmentation.

[0059] Examples of suitable sequences for the first amplification domain 26 / primer 34 and for the second amplification domain 38 / primer 36 include P5 and P7 primer sequences; P15 and P7 primer sequences; or any combination of the PA primer sequences, the PB primer sequences, the PC primer sequences, and the PD primer sequences set forth herein.

[0060] The P5 amplification domain / primer sequence is one of:P5 #1 : 5’ - 3’AATGATACGGCGACCACCGAGAUCTACAC (SEQ. ID. NO. 1);P5 #2: 5’ 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 2) where “n” is inosine in SEQ. ID. NO. 2; orP5 #3: 5’ 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 3) where “n” is alkene-thymidine (i.e., alkene-dT) in SEQ. ID. NO. 3.The P7 amplification domain / primer sequence may be any of the following:P7 #1 : 5’ — > 3’CAAGCAGAAGACGGCATACGAnAT (SEQ. ID. NO. 4)P7 #2: 5’ 3’CAAGCAGAAGACGGCATACnAGAT (SEQ. ID. NO. 5)P7 #3: 5’ 3’CAAGCAGAAGACGGCATACnAnAT (SEQ. ID. NO. 6) where “n” is 8-oxoguanine in each of SEQ. ID. NOS. 4-6.

[0061] In the examples of P5 and P7, the uracil, inosine, or “n” is a cleavage site 40A, 40B. The cleavage sites 40A, 40B of transposome complexes 10A, 10B that are used together are orthogonal (i.e. , not susceptible to the same cleaving agent), so that after fully adapted fragments are generated and amplified, forward or reverse strands can be removed, for example, from a flow cell surface, while the other of the reverse or forward strands remain attached for exposure to sequencing.

[0062] It is to be understood that other sequences may be used for the amplification domains 26, 38 and for the primers 34, 36, as long as the combination enables the desired amplification. As other examples, a P15, PA, PB, PC, or PD primer may be used.

[0063] The P15 amplification domain / primer sequence is:P15: 5’ - 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 7) where “n” is allyl-T (i.e., a thymine nucleotide analog having an allyl functionality).

[0064] The other amplification domain / primer sequences (PA-PD) mentioned above include:PA 5’ 3’GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ. ID. NO. 8)PB 5’ - 3’CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ. ID. NO. 9)PC 5’ 3’ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ. ID. NO. 10)PD 5’ 3’GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ. ID. NO. 11 )

[0065] While not shown in the example sequences for PA-PD, it is to be understood that any of these sequences may include a cleavage site 40A, 40B, such as uracil, 8-oxoguanine, allyl-T, diols, etc. at any point in the strand. As previously mentioned, the sequences for the first amplification domain 26 / primer 34 and for the second amplification domain 38 / primer 36 may be selected to have orthogonal cleavage sites (i.e. , one cleavage site is not susceptible to the cleaving agent used for the other cleavage site), so that after amplification, forward or reverse strands can be cleaved, leaving the other of the reverse or forward strands for sequencing.

[0066] Referring briefly to the primers 34, 36 that are immobilized within the flow cell 32, each of the primers 34, 36 may also include a polyT sequence at the 5’ end of the primer sequence. In some examples, the polyT region includes from 2 T bases to 20 T bases. As specific examples, the polyT region may include 3, 4, 5, 6, 7, or 10 T bases.

[0067] Referring back to Fig. 1 A, the sequencing primer sequences 28A, 28B of the transposome complexes 10A, 10B that are used together have different sequences from each other that respectively bind to sequencing primers that are introduced, e.g., to a flow cell surface after amplification have been performed. As examples, the sequencing primer sequences 28A may bind a sequencing primer that primes synthesis of a new strand that is complementary, e.g., to forward strand fragments / fragment amplicons and the sequencing primer sequence 28B may bind asequencing primer that primes synthesis of a new strand that is complementary, e.g., to reverse strand fragments / fragment amplicons.

[0068] The transposon ends 14A, 14B of each transposome complex 10A, 10B include the strands MEA, MEB respectively hybridized to the strands ME’ , ME’B. AS such, the strands MEA, ME’A are complementary and the strands MEB, ME’B are complementary. The double-stranded transposon ends 14A, 14B are respectively capable of complexing with the transposases 12A, 12B. As examples, the strands MEA, ME’A and MEB, ME’B of the transposon ends 14A, 14B may be the related but non-identical 19-base pair (bp) outer end (e.g., strands MEA, ME’A) and inner end (e.g., strands MEB, ME’B) sequences that serve as the substrate for the activity of the Tn5 transposase, or the mosaic ends recognized by a wild-type or mutant Tn5 transposase, or the R1 end (e.g., strands MEA, ME’A) and the R2 end (strands MEB, ME’B) recognized by the MuA transposase.

[0069] When included, the index sequences of the transposome complexesIOA, 10B are the same, and include a particular nucleic acid sequence that functions as a barcode for the DNA sample tagmented with the transposome complexes 10A,IOB. The unique indexes can be used for sample identification. Index sequences may range from 7 bases to 15 bases long.

[0070] In the example shown in Fig. 1A, the non-transferred strands 18A, 18B are respectively made up of the strands ME’A, ME’B.

[0071] The transposome complex 10A of Fig. 1 A may also be used with the transposome complex 10C shown in Fig. 1 C. These transposome complexes 10A, 10C are capable of asymmetric attachment to the flow cell surface.

[0072] The transposome complex 10A may be any of the examples described in reference to Fig. 1A, which include the transferred strand 16A having the 5’ end attachment group 20A that is capable of attaching to the transposome capture mechanism 57 at least at the interstitial regions 56 of the flow cell 32. In contrast to the transposome complex 10A, the transferred strand 16C of the transposome complex 10C does not include the 5’ end attachment group for surface attachment. Rather, the non-transferred strand 18C includes a 3’ end attachment group 42 for attachment to the transposome capture mechanism 57.

[0073] As shown in Fig. 1 C, the transposome complex 10C includes a transposase enzyme 12C non-covalently bound to the transposon end 14C. The transposon end 14C is a double-stranded nucleic acid strand, one strand (e.g., MEc) of which is part of the transferred strand 16C and the other strand (e.g., ME’c) of which is a part of the non-transferred strand 18C. Any of the example strands for the transposon end 14A, 14B (e.g., MEA and ME’A or MEB and ME’B) described herein may be used for the transposon end 14C.

[0074] In the transposome complex 10C, the transferred strand 16C includes a second amplification domain 38 and a sequencing primer sequence 28C that is attached to one strand MEc of the transposon end 14C. In some examples, the transferred strand 10C includes an index sequence (not shown) between the second amplification domain 38 and the sequencing primer sequence 28C. The strand MEc of the transposon end 14C is positioned at the 3’ end of the transferred strand 16C.

[0075] Similar to the transposome complexes 10A, 10B, the first and second amplification domains 26, 38 of the transposome complexes 10A, 10C have different sequences from each other, but have the same sequence, respectively, as first and second primers 34, 36 described herein.

[0076] Similar to the sequencing primer sequences 28A, 28B, the sequencing primer sequences 28A, 28C have different sequences from each other that respectively bind to sequencing primers introduced during sequencing.

[0077] As mentioned, the transposome complexes 10A, 10C are configured for asymmetric attachment to the transposome capture mechanism 57. As such, one of the complexes, i.e. , complex 10C, includes a 3’ end attachment group 42 for attachment to the transposome capture mechanism 57 or the substrate surface groups, and the other of the complexes, e.g., complex 10A, includes the 5’ end attachment group 20A for attachment to the transposome capture mechanism 57 or the substrate surface groups. The 3’ end attachment group 42 and the 5’ end attachment group 20A may be any groups that are capable of covalently or non- covalently attaching, directly or indirectly, to the transposome capture mechanism 57 or to the substrate surface groups. Any of the attachment groups set forth in Table 1A and Table 1 B may be used for the 3’ end attachment group 42.

[0078] In still other examples, the transposome complexes 10A and 10B or 10C may not include the 5’ end functional groups 20A and 20B or the 3’ end functional group 42. Rather, the amino acid side chains of the transposase enzyme 12A, 12B, 12C may be used to covalently or non-covalently bind the transposome complexes 10A and 10B or 10C to the transposome capture mechanism 57 or the substrate surface groups. For example, the amine groups in the lysine of the Tn5 transposase enzyme can covalently react to activated carboxylic acid groups of the mechanism 57 or substrate surface. For other examples, lysine, aspartic acid, and / or histidine present in the transposase enzyme may non-covalently bind (e.g., via electrostatic attraction) to streptavidin when it is used as the transposome capture mechanism 57. For still other examples, carboxylic acid groups of the mechanism 57 or substrate surface may act as a hydrogen bond donor and acceptor for the peptidic chains in the transposase enzyme 12A, 12C, 12C.

[0079] Fig. 1 D and Fig. 1 E depict two other transposome complexes 10D, 10E that can be used together in the flow cell architecture of Fig. 2C or Fig. 2D.

[0080] In the transposome complexes 10D, 10E, the transposon ends 14D, 14E respectively include the transferred strands 16D, MED and 16E, MEE hybridized to a portion ME’D, ME’E of the non-transferred strand 18D, 18E. The transposon ends 14D, 14E are double-stranded nucleic acid strands, one strand (e.g., MED) of which is the transferred strand 16D, 16E and the other strand (e.g., ME’D) of which is a part of the non-transferred strand 18D, 18E. As examples, the transferred strands 16D, MED and 16E, MEE and the portion ME’D, ME’E may be the related but non-identical 19-base pair (bp) outer end (e.g., strands MEA, ME’A) and inner end (e.g., strands MEB, ME’B) sequences that serve as the substrate for the activity of the Tn5 transposase, or the mosaic ends recognized by a wild-type or mutant Tn5 transposase, or the R1 end (e.g., strands MEA, ME’A) and the R2 end (strands MEB, ME’B) recognized by the MuA transposase. In each of these examples, the transferred strands 16D, MED and 16E, MEE do not include any additional sequences.

[0081] The transposase enzymes 12D, 12E are non-covalently bound to the transposon ends 14D, 14E. Any of the transposase enzymes disclosed herein may be used.

[0082] In these example complexes 10D, 10E, each of the non-transferred strands 18D, 18E includes additional sequences attached to the 3’ end of the portion ME’D, ME’E. In the transposome complex 10D, the non-transferred strand 18D includes a first sequencing primer sequence 28D attached to the 3’ end of the portion ME’D and a complement 26’ of the first amplification domain sequence 26 attached to the 3’ end of the first sequencing primer sequence 28D. Similarly, in the transposome complex 10E, the non-transferred strand 18E includes a second sequencing primer sequence 28E attached to the 3’ end of the portion ME’E and a complement 38’ of the second amplification domain sequence 38 attached to the 3’ end of the second sequencing primer sequence 28E.

[0083] The sequencing primer sequences 28D, 28E have different sequences from each other, but have the same sequence as the respective sequencing primers to be used during sequencing. The sequencing primer sequences 28D, 28E are used as respective templates to form the complementary sections. These complementary sections can hybridize to the respective sequencing primers.

[0084] The amplification domain sequence complements 26’, 38’ are respectively complementary to the primers 34, 36 in the depression 48 (Fig. 2C) or lane 54 (Fig. 2D) of the flow cell 32. This complementarity enables at least one of the transposome complexes 10D, 10E in homodimers thereof to respectively hybridize to flow cell surface bound primers 34, 36. Because the amplification domain sequence complements 26’, 38’ are present, these transposome complexes 10D, 10E do not include the 3’ end attachment groups.

[0085] While not shown in Fig. 1 D and Fig. 1 E, other complexes similar to complexes 10D, 10E include an additional sequence attached to the 5’ end of the strands MED, MEE. These additional sequences are sequencing primer complements which can bind to the sequencing primers used in sequencing. The 5’ end of these sequencing primer complements can be ligated to the surface bound primers 34, 36. The presence of the sequencing primer complements can reduce the amount of gapfill ligation that takes place during the formation of fully adapted fragments.

[0086] Fig. 1 F and Fig. 1 G also depict two other transposome complexes 10F, 10G that can be used together in the flow cell architecture of Fig. 2C or Fig. 2D.

[0087] The transposome complexes 10F, 10G are similar to the transposome complexes 10A, 10B, respectively, except that they do not include the 5’ end attachment groups 20A, 20B. Rather, the transferred strands 16F, 16G include capture sequence complements 29, 31.

[0088] More specifically, each of the transposome complexes 10F, 10G includes a transposase enzyme 12F, 12G non-covalently bound to a transposon end 14F, 14G. Each transposon end 14F, 14G is a double-stranded nucleic acid strand, one strand MEF or MEG of which is part of a transferred strand 16F, 16G and the other strand ME’F or ME’G of which is the non-transferred strand 18F, 18G. These strands MEF, ME’F and MEG, ME’G may be any of the examples set forth herein for MEA, ME’A and MEB, ME’B.

[0089] The transferred strand 16F includes a sequencing primer sequence 28F attached to the strand MEF of the transposon end 14F, a first amplification domain 26 attached to the sequencing primer sequence 28F, and a first capture sequence complement 29. Similarly, the transferred strand 16G includes a sequencing primer sequence 28G attached to the strand MEG of the transposon end 14G, a second amplification domain 38 attached to the sequencing primer sequence 28G, and a second capture sequence complement 31 .

[0090] Similar to the sequencing primer sequences 28A, 28B, the sequencing primer sequences 28F, 28G have different sequences from each other that respectively bind to sequencing primers introduced during sequencing.

[0091] Also similar to the transposome complexes 10A, 10B, the first and second amplification domains 26, 38 of the transposome complexes 10F, 10G have different sequences from each other, but have the same sequence, respectively, as first and second primers 34, 36 described herein.

[0092] The capture sequence complements 29, 31 are respectively complementary to the capture primers 33, 35 in the depression 48 (Fig. 2C) or lane 54 (Fig. 2D) of the flow cell 32. This complementarity enables at least one of the transposome complexes 10F, 10G in homodimers thereof to respectively hybridize to the capture primers 33, 35. Because the capture sequence complements 29, 31 are present, these transposome complexes 10F, 10G do not include the 5’ end attachmentgroups 20A, 20B. The capture primers 33, 35 have different sequences than the primers 34, 36, so that they do not participate in amplification.

[0093] One example of the capture sequence complements 29 or 31 is PX’, as shown:PX’ 5’ 3’CCTCCTCCTCCTCCTCCTCCTCCT (SEQ. ID. NO. 12).PY’ (sequence not shown) can be used for the other capture sequence complements 31 or 29, so that it can hybridize to the complementary primer 35, 33, without hybridizing to the primer 33, 35 or to the primers 34, 36. The capture primers 33, 35 are complementary, respectively, to the PX’ and PY’ sequences.

[0094] As shown in Fig. 1 F and Fig. 1 G, each of the transposome complexes 10F, 10G may also include a blocker base 41 incorporated into the transferred strands 16F, 16G between the amplification domains 26, 38 and the capture sequence complements 29, 31 . The blocker base 41 may be uracil or another nucleotide that prevents the extension reaction.

[0095] Referring now to Fig. 1 H, still another example of the transposome complex 10H is shown. This transposome complex 10H is a forked transposome complex.

[0096] The transferred strand 16H of the transposome complex 10H is similar to the transferred strand 16A, and includes a 5’ end functional group 20H, the first amplification domain 26, and a sequencing primer sequence 28H that is attached to the strand MEH of the transposon end 14H. The strand MEH of the transposon end 14H is positioned at the 3’ end of the transferred strand 16H. In some examples, the transferred strand 16H further includes an index sequence (not shown) positioned between the first amplification domain 26 and the sequencing primer sequence 28H. The 5’ end functional group 20H and the sequencing primer sequence 28H may be any of the examples set forth herein, respectively, for the 5’ end functional group 20A and the sequencing primer sequence 28A.

[0097] The non-transferred strands 18H of the transposome complexes 10H are made up of the strands ME’H and adapter segments 37 that create a forked adapter when hybridized to the transferred strands 16H. When the non-transferred strand 18H includes the adapter segments 37 and creates the forked adapter, it is to be understood that homodimers of this one type of transposome complex 10H are grafted to the polymeric hydrogel 22, without homodimers of another type of transposome complex 10A through 10G. This is because the individual complex 10H includes the first amplification domain 26 and the complement 38’ of the second amplification domain 38 to create fully adapted DNA fragments, and thus the second complexes, e.g., 10B, 10C, with the second amplification domain 38 are not needed. As one example, the transposome complex 10H includes the transferred strand 16H as described herein with the first amplification domain 26 and the non-transferred strand 18H includes the strand ME’H, a complement of the sequencing primer sequence 28I, and the complement 38’ of the second amplification domain 38.

[0098] In some examples, the cleavage sites 40A, 40B, 40C, 40F, 40G of the respective transposome complexes 10A, 10B, 10C, 10F, 10G may not be included.

[0099] Flow Cells

[0100] The transposome complexes 10A-10H may be used in different examples of the flow cell 32 disclosed herein.

[0101] Fig. 2A depicts an example of the flow cell 32 from a top view, and different structures 44A, 44B, 44C that may be included within individual flow channels 46 of the flow cell 32 are respectively shown in Fig. 2B, Fig. 2C, and Fig. 2D.

[0102] The structures 44A, 44B shown in Fig. 2A and Fig. 2B are patterned with depressions 48, while the structure 44C in Fig. 2C is patterned with a lane 54. While not shown, it is to be understood that a lid or a second structure may be attached to the structures 44A, 44B, 44C (e.g., at regions 58). Alternatively, the structures 44A, 44B, 44C are not bonded to another component, but rather, are open to the surrounding environment.

[0103] Each of the structures 44A, 44B, 44C may include a single-layer substrate 50 or a multi-layer substrate 52.

[0104] Examples of suitable materials for the single-layer substrate 50 include epoxy siloxane, glass, modified or functionalized glass, polymeric materials (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefins / cyclo-olefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, nylon (polyamides), etc.), ceram ics / ceramic oxides, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron doped p+ silicon), silicon nitride (SisN4), silicon oxide (SiO2), tantalum pentoxide (Ta2Os) or other tantalum oxide(s) (TaOx), hafnium oxide (HfO2), carbon, metals, or the like.

[0105] When the single-layer substrate 50 is used, the plurality of depressions 48 (Fig. 2B and Fig. 2C) or the single lane 54 (Fig. 2D) is defined at a surface of the single-layer substrate 50. Interstitial regions 56 surround each depression 48, and a perimeter region 58 surrounds the lane 54. The patterned structures 44A, 44B may also include a perimeter region 58. In these examples, the surface of the single-layer substrate 50 defines the interstitial regions 56 and / or the perimeter region 58.

[0106] Examples of the multi-layer substrate 52 include a base support 60 and a patterned material 62 positioned over the base support 60. The base support 60 may be any of the examples set forth herein for the single-layer substrate 50. The patterned material 62 may be any material that is capable of being patterned with the depressions 48 or the lane 54.

[0107] In an example, the patterned material 62 may be an inorganic oxide that is selectively applied to the base support 60, e.g., via vapor deposition, aerosol printing, or inkjet printing, in the desired pattern. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta2Os), aluminum oxide (e.g., AI2O3), silicon oxide (e.g., SiO2), hafnium oxide (e.g., HfC ), etc. In another example, the patterned material 62 may be a resin matrix material that is applied to the base support 60 and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, etc. Suitable patterning techniques include photolithography, nanoimprint lithography(NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, printing techniques, etc. Some examples of suitable resins include a polyhedral oligomeric silsesquioxane-based resin, a non-polyhedral oligomeric silsesquioxane epoxy resin, a polyethylene glycol) resin, a polyether resin (e.g., ring opened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP® from Bellex), and combinations thereof.

[0108] In an example, the substrate 50 or 52 may be round and have a diameter ranging from about 2 mm to about 300 mm, or may be a rectangular, having its largest dimension up to about 10 feet (~ 3 meters). In an example, the substrate 50 or 52 may be formed from a wafer having a diameter ranging from about 200 mm to about 300 mm. Wafers may subsequently be diced to form the individual substrate 50 or 52. In another example, the substrate 50 or 52 is a die having a width ranging from about 0.1 mm to about 10 mm. While example dimensions have been provided, it is to be understood that a substrate 50 or 52 with any suitable dimensions may be used. For another example, a rectangular panel may be used, which has a greater surface area than a 300 mm round wafer. These panels may subsequently be diced to form individual substrates 50 or 52.

[0109] Each flow cell 32 also includes a flow channel 46 (Fig. 2A). The flow channel 46 may be an enclosed channel that is defined between the structures 44A, 44B, 44C and a lid. In an alternate example, the flow channel 46 may be defined between two structures 44A, 44B, 44C that are bonded together. In enclosed versions of the flow cell 32, a separate material (not shown) may attach the perimeter regions 58 of the structures 44A, 44B, 44C to the lid or other structure so that the separate material defines at least a portion of the walls of the flow channel 46.

[0110] When the structures 44A, 44B, 44C are open to the surrounding environment, the flow channel 46 may be defined by a lane in which the depressions 48 are formed, or by the lane 54.

[0111] The flow cell 32 shown in Fig. 2A includes eight flow channels 46. It is to be understood, however, that any example of the flow cell 32 may include any number of flow channels 46 (e.g., one channel, four channels, etc.). With multiple channels46, it is to be understood that each flow channel 46 may be isolated from each other flow channel 46 so that fluid introduced into any particular flow channel 46 does not flow into any adjacent flow channel 46. Separation may be obtained through the separate material, which can be applied at the perimeter of each flow channel 46 and at the perimeter of the entire flow cell 32.

[0112] The length and width of the flow channel 46 may be smaller, respectively, than the length and width of the structures 44A, 44B, 44C so that a portion of the structure surface surrounds the flow channel 46 and is available for attachment to another structure 44A, 44B, 44C or to the lid, or is available to define the perimeter of the open flow channel 46. In some instances, the width of each flow channel 46 can be at least about 1 mm, at least about 2.5 mm, at least about 5 mm, at least about 7 mm, at least about 10 mm, or more. In some instances, the length of each flow channel 46 can be at least about 10 mm, at least about 25 mm, at least about 50 mm, at least about 100 mm, or more. The width and / or length of each flow channel 46 can be greater than, less than or between the values specified above. In another example, the flow channel 46 is square (e.g., 10 mm x 10 mm).

[0113] The depth / height of each flow channel 46 can be as small as a few monolayers thick, for example, when microcontact, aerosol, or inkjet printing is used to deposit the separate material that partially defines the flow channel walls. In other examples, the depth / height of each flow channel 46 can be about 1 pm, about 10 pm, about 50 pm, about 100 pm, or more. In an example, the depth / height may range from about 10 pm to about 100 pm. In another example, the depth / height is about 5 pm or less. It is to be understood that the depth / height of each flow channel 46 can also be greater than, less than or between the values specified above. The depth / height of the flow channel 46 also varies along the length and width of the flow cell 32, e.g., because of the depressions 48.

[0114] Referring now to Fig. 2A and Fig. 2B, the structures 44A, 44B include the depressions 48, which are defined in the single-layer substrate 50 or in the patterned material 62 of the multi-layer substrate 52, and that are separated by interstitial regions 56. Many different layouts of the depressions 48 may be envisaged, including regular, repeating, and non-regular patterns. In an example, the depressions 48 aredisposed in a hexagonal grid for close packing and improved density. Other layouts may include, for example, rectangular layouts, triangular layouts, and so forth. In some examples, the layout or pattern can be an x-y format in rows and columns. In some other examples, the layout or pattern can be a repeating arrangement of the depressions 48 and the interstitial regions 56.

[0115] The layout or pattern may be characterized with respect to the density (number) of the depressions 48 in a defined area. For example, the depressions 48 may be present at a density of approximately 2 million per mm2. The density may be tuned to different densities including, for example, a density of about 100 per mm2, about 1 ,000 per mm2, about 0.1 million per mm2, about 1 million per mm2, about 2 million per mm2, about 5 million per mm2, about 10 million per mm2, about 50 million per mm2, or more, or less. It is to be further understood that the density can be between one of the lower values and one of the upper values selected from the ranges above, or that other densities (outside of the given ranges) may be used. As examples, a high-density array may be characterized as having depressions 48 separated by less than about 100 nm, a medium-density array may be characterized as having the depressions 48 separated by about 400 nm to about 1 pm, and a low- density array may be characterized as having the depressions 48 separated by greater than about 1 pm.

[0116] The layout or pattern of the depressions 48 may also or alternatively be characterized in terms of the average pitch, or the spacing from the center of one depression 48 to the center of an adjacent depression 48 (center-to-center spacing) or from the right edge of one depression 48 to the left edge of an adjacent depression 48 (edge-to-edge spacing). The pattern can be regular, such that the coefficient of variation around the average pitch is small, or the pattern can be non-regular in which case the coefficient of variation can be relatively large. In either case, the average pitch can be, for example, about 50 nm, about 0.1 pm, about 0.5 pm, about 1 pm, about 5 pm, about 10 pm, about 100 pm, or more or less. The average pitch for a particular pattern can be between one of the lower values and one of the upper values selected from the ranges above. In an example, the depressions 48 have a pitch(center-to-center spacing) of about 1 .5 pm. While example average pitch values have been provided, it is to be understood that other average pitch values may be used.

[0117] The size of each depression 48 may be characterized by its volume, opening area, depth, and / or diameter or length and width. For example, the volume can range from about 1 xio-3pm3to about 100 pm3, e.g., about 1 xW2pm3, about 0.1 pm3, about 1 pm3, about 10 pm3, or more, or less. For another example, the opening area can range from about 1 xW3pm2to about 100 pm2, e.g., about 1 xW2pm2, about 0.1 pm2, about 1 pm2, at least about 10 pm2, or more, or less. For still another example, the depth can range from about 0.1 pm to about 100 pm, e.g., about 0.5 pm, about 1 pm, about 10 pm, or more, or less. For yet another example, the diameter or each of the length and width can range from about 0.1 pm to about 100 pm, e.g., about 0.5 pm, about 1 pm, about 10 pm, or more, or less.

[0118] In the structures 44A, 44B, the polymeric hydrogel 22 is positioned within each of the depressions 48. The polymeric hydrogel 22 is selected so that it can at least bind with a 5’ end of each of the primers 34, 36. In some examples, the polymeric hydrogel 22 is also selected so that it can also bind with a 5’ end of each of the capture primers 33, 35.

[0119] The polymeric hydrogel 22 may be a copolymer including a first recurring unit of formulawherein:R1is selected from the group consisting of -H, a halogen, an alkyl, an alkoxy, an alkenyl, an alkynyl, a cycloalkyl, an aryl, a heteroaryl, a heterocycle, and optionally substituted variants thereof;R2is selected from the group consisting of an azide, an amino, an alkenyl, an alkyne, a halogen, a hydrazone, a hydrazine, a carboxyl, a hydroxy, a tetrazole, a tetrazine, a nitrile oxide, a nitrone, a sulfate, and a thiol;each (CH2)Pcan be optionally substituted; and p is an integer from 1 to 50;

[0120] and a second recurring unit of formula (II):wherein: each of R3, R3', R4, R4’ is independently selected from the group consisting of -H, R5, -OR5, -C(O)OR5, -C(O)R5, -OC(O)R5, -C(O)NR6R7, and -NR6R7; R5is selected from the group consisting of -H, -OH, an alkyl, a cycloalkyl, a hydroxyalkyl, an aryl, a heteroaryl, a heterocycle, and optionally substituted variants thereof; and each of R6and R7is independently selected from the group consisting of -H and an alkyl.

[0121] The polymeric hydrogel 22 may be introduced over the entire substrate50 or 52 and then removed from the interstitial regions 56 (e.g., via polishing). In the example shown in Fig. 2B, this exposes the substrate surface groups at the interstitial regions 56 for subsequent attachment of the transposome capture mechanism 57. In the example shown in Fig. 2C, this isolates the primers 34, 36 or the primers 34, 36, 33, 35 within each of the depressions 48.

[0122] The structure 44A, 44B also includes the primers 34, 36 attached to the polymeric hydrogel 22 within each of the depressions 48. The primers 34, 36 respectively have the same sequence as the first and second amplification domains 26, 38. Any of the sequences set forth herein for the amplification domains 26, 38 may be used for the primers 34, 36. The primers 34, 36 may be grafted to the polymeric hydrogel 22 either before or after it is introduced into the depressions 48.

[0123] In the example shown in Fig. 2C, the primers 34, 36 alone can be attached within the depressions 48. Alternatively in the example shown in Fig. 2C, the primers 34, 36 and the capture primers 33, 35 can be attached within the depressions 48.

[0124] Referring specifically to Fig. 2A, the flow cell 32 includes, in addition to the substrate 50 or 52 and the depressions 48 defined therein, a transposome capturemechanism 57 attached over at least the interstitial regions 56, wherein the transposome capture mechanism 57 i) is to bind to a transposome complex 10A and 10B or 10C, or ii) includes a free end group that is to bind to the transposome complex 10A and 10B or 10C, or iii) includes a protein that is to bind to the transposome complex 10A and 10B or 10C; and a primer set (including primers 34, 36) attached over the depressions 48.

[0125] The transposome capture mechanism 57 is covalently or non-covalently attached to at least the interstitial regions 56 and is capable of covalently or non- covalently binding to the 5’ end attachment groups 20A, 20B of the transposome complexes 10A, 10B or to the 3’ end attachment groups 20C of the transposome complexes 10C.

[0126] In some examples, the transposome capture mechanism 57 includes a plurality of probes, each of which, at one end, is capable of attaching to the surface groups at the interstitial regions 56 and, at the opposed end, includes a free end group that can attach to the attachment groups 20A and 20B or 20C of the complexes 10A and 10B or 10C. Depending upon when the probes are introduced (e.g., before or after the polymeric hydrogel 22 and primers 34, 36 are introduced into the depressions 48), the probes may also attach to the substrate 50 or 52 through exposed surface groups within the depressions 48.

[0127] The end of the probe that can covalently attach to the surface groups at the interstitial regions 56 may be a silane (reacts with silanol surface groups), an amine group (reacts with epoxide surface groups), an alkyne (reacts with azide surface groups), or bicyclononyne (reacts with tetrazine surface groups). This end group may be a linker that is attached to the free end group or may be attached to an additional linker that is also attached to the free end group. Examples of suitable linkers include PEG or amino PEG. The free end group of the probe is biotin or streptavidin (the latter of which can be attached to the probe through biotin).

[0128] The following are some specific examples of probes that may be exclusively attached over the interstitial regions 56, e.g., when the polymeric hydrogel 22 and primers 34, 36 are introduced into the depressions 48 before probe attachment.

[0129] In one example, the interstitial regions 56 include surface silanol groups; and the probes include the linker and the free end group, where the linker is aminopolyethylene glycol), the free end group is selected from the group consisting of biotin and streptavidin. In this particular example, the end of the probe that can covalently attach to the surface groups at the interstitial regions 56 is a silane, which is attached to the linker. The following structure is one example of this probe:In another example, streptavidin is attached to the biotin of this structure, and thus the streptavidin is the free end group of this particular probe.

[0130] In another example, the interstitial regions 56 include methyl tetrazine surface groups, and the probes include the linker and the free end group, where the linker is bicyclononyne, and the free end group is selected from the group consisting of biotin and streptavidin. In this example, methyl tetrazine surface groups may be introduced to the interstitial regions 56 through the reaction of methyl tetrazine-amino PEG with epoxide groups at the surface of the substrate 50 or 52.

[0131] In still another example, the interstitial regions 56 include carboxylic acid groups (resulting from a leveling agent used in the substrate 50 or 52), and the probes include the linker and the free end group, where the linker is capable of amide formation (include an amine end group), esterification (include an alcohol end group), or thioesterification (includes a thiol end group). In these examples the free end group is selected from the group consisting of biotin and streptavidin.

[0132] Probes including biotin as the free end group can attach to transposome complexes 10A, 10B, 10C with biotin 5’ or 3’ end groups 20A, 20B, 20C when additional streptavidin is added, or to -biotin-streptavidin 5’ or 3’ end groups 20A, 20B, 20C.

[0133] In other examples, the transposome capture mechanism 57 includes a hydrogel layer with any example of the probes disclosed herein attached thereto. Inone example, the polymeric hydrogel 22 with the primers 34, 36 is applied within the depressions 48, and an additional hydrogel layer (not shown) is applied over the entire substrate 50 or 52, so that the interstitial regions 56 and the polymeric hydrogel 22 and primers 34, 36 are covered. The additional hydrogel layer may be any of the examples set forth herein for the polymeric hydrogel 22, and the R2functional groups are selected to bind to end groups of the probes. Examples of suitable R2functional groups and probe end group pairs include tetrazine and BCN or azide and alkyne.

[0134] In still another example, the transposome capture mechanism 57 is a hydrophobic layer that is applied to the interstitial regions 56. Examples of suitable hydrophobic materials include silicon-based coatings, polyurethane coatings, other hydrophobic carbon-based polymer coatings, fluoropolymer coatings (e.g., polytetrafluoroethylene), self-assembled monolayers, wax coatings, nano-silica coatings, or graphene and carbon-based coatings. The hydrophobic coating may be selectively applied to the interstitial regions 56. The hydrophobic, non-polar regions of streptavidin will anchor to the surface via hydrophobic interactions. These interactions may be promoted and stabilized in the presence of a high salt concentration used in tagmentation. In these examples, the streptavidin may be attached as part of the transposome capture mechanism 57, or may be part of the -biotin-streptavidin 5’ or 3’ end groups 20A, 20B, 20C.

[0135] In yet another example, the transposome capture mechanism 57 includes an amino acid, such as lysine, arginine, or histidine attached to the interstitial regions 56, and streptavidin attached to the amino acid. In these examples, streptavidin can be replaced with another suitable protein that can attach to the amino acid and can attach to the 5’ or 3’ end groups 20A, 20B, 20C. Lysine and / or arginine can be coupled to carboxylic acid moieties at the interstitial regions 56 via a peptide coupling. For example, carboxylic acid moieties the interstitial regions 56 can be activated with a coupling reagent (e.g., ethyl-(N’,N’-dimethylamino)propylcarbodiimide hydrochloride (EDC), O-(Benzotriazol-1-yl)-N,N,N’,N’-tetramethyluronium hexafluorophosphate (HBTU), ethyl-(N’,N’-dimethylamino)propylcarbodiimide hydrochloride (TBTU), 1- hydroxybenzotriazole (HOBt))for amide bond formation, this is followed by a substitution of the primary amine of the amino acid. For histidine, aNi-His tag reaction can be used, where the carboxylic acid moieties at the interstitial regions 56 are functionalized with nitriloacetic acid (NTA) using a coupling reagent (e.g., a carbodiimide). A solution containing streptavidin and having a pH above the isoelectronic point (pl) of streptavidin can be introduced to the interstitial regions 56. At these conditions, the streptavidin carries a net negative charge, leading to electrostatic attraction between the positively charged amino acids and repulsion from the negatively charged depressions 48 (where primers 34, 36 are attached). In these examples, the 5’ or 3’ end groups 20A, 20B, 20C are biotin.

[0136] Alternatively, the transposome capture mechanism 57 may include the amino acid, such as lysine, arginine, or histidine, attached at the interstitial regions 56, and the transposome complexes 10A and 10B or 10C can include -biotin-streptavidin attachment groups 20A and 20B or 20C.

[0137] In still another example, the transposome capture mechanism 57 includes the previously described methyl tetrazine groups attached to the interstitial regions 56. In this example, the probes are not used. Rather, the attachment groups 20A and 20B or 20C of the transposome complexes 10A and 10B or 10C include biotin-BCN. The BCN can react with the tetrazine.

[0138] In still a further example, the transposome capture mechanism 57 is silicon dioxide (SiCh) that is specifically generated at the interstitial regions 56. With the SiO2 present at the interstitial regions 56, the attachment groups 20A and 20B or 20C of the transposome complexes 10A and 10B or 10C may include the -biotin-l inker- si lane described herein. In these examples, the SiO2 can react with the silane to attach homodimers of the transposome complexes 10A and 10B or 10C to the flow cell 32. Alternatively, the SiC and -silane-linker-biotin or -silane-linker-biotin-streptavidin probes may be used together as the transposome capture mechanism 57.

[0139] In one example, the surface functional groups present at the interstitial regions 56 are selected from the group consisting of carboxylic acid groups, silanol groups, amide groups, alcohol groups, amine groups, and combinations thereof, and the transposome capture mechanism 57 is streptavidin. Any of these groups can be used as hydrogen-bond donors and acceptors for the peptidic chain at the surface of the streptavidin. In these examples, the 5’ or 3’ attachment groups 20A, 20B, 20C arebiotin. In these examples, the streptavidin can be replaced with another protein that can hydrogen bond to the surface functional groups and can attach to the 5’ or 3’ attachment groups 20A, 20B, 20C.

[0140] When streptavidin is used as the transposome capture mechanism 57, it is to be understood that some of the streptavidin may also become physically entangled in the polymeric hydrogel 22 in the depressions 48.

[0141] In other examples shown in Fig. 2A, the surface groups of the substrate 50 or 52 are exposed at the interstitial regions 56, and the attachment groups 20A and 20B or 20C are able to attach to the surface groups. In these examples, the additional transposome capture mechanism 57 is not utilized.

[0142] In one example, epoxide groups are exposed at the interstitial regions 56, and the attachment groups 20A and 20B or 20C of the transposome complexes 10A and 10B or 10C include biotin-bicyclononyne-methyl tetrazine-amino PEG-. The terminal amino of the attachment groups 20A and 20B or 20C can react with the surface bound epoxide groups.

[0143] In another example, azide groups are exposed at the interstitial regions 56, and the attachment groups 20A and 20B or 20C of the transposome complexes 10A and 10B or 10C include -biotin. The biotin can react with the surface bound azide groups.

[0144] In another example, carboxylic groups are exposed at the interstitial regions 56, and the attachment groups 20A and 20B or 20C of the transposome complexes 10A and 10B or 10C are selected from the group consisting of -biotinstreptavidin (resulting in hydrogen bonding), -amine (resulting in amide formation or hydrogen bonding), -alcohol (resulting in esterification or hydrogen bonding), -thiol (resulting in thioesterification), or -amide (resulting in hydrogen bonding).

[0145] In yet another example, silanol groups are exposed at the interstitial regions 56, and the attachment groups 20A and 20B or 20C of the transposome complexes 10A and 10B or 10C are selected from the group consisting of -biotinstreptavidin (resulting in hydrogen bonding), -alcohol (resulting in esterification or hydrogen bonding), or -amide (resulting in hydrogen bonding).

[0146] It is to be understood that if the 5’ or 3’ end groups 20A, 20B, 20C of the transposome complexes 10A, 10B, 10C are capable of covalently or non-covalently attaching to the polymeric hydrogel 22 in the depressions 48, at least some of the homodimers of the transposome complexes 10A and 10B or 10C may also become bound within the depressions 48.

[0147] Referring now to Fig. 2C and Fig. 2D, these examples of the flow cells 32 do not include the transposome capture mechanism 57 and do not specifically utilize the surface groups at interstitial region 56 to bound the transposome complexes 10A and 10B or 10C.

[0148] The flow cell architecture in Fig. 2C is similar to that shown in Fig. 2B in terms of the substrate 50 or 52, the depressions 48, and the polymeric hydrogel 22 and primers 34, 36 in the depressions 28. The flow cell architecture in Fig. 2C does not include the transposome capture mechanism 57. Rather, in one example, the flow cell architecture of Fig. 2C utilizes the primers 34, 36 to bind the transposome complexes 10D and 10E (Fig. 1 D and Fig. 1 E) and for amplification of fully adapted DNA fragments; and, in another example, the flow cell architecture of Fig. 2C utilizes the capture primers 33, 35 to bind the transposome complexes 10F and 10G (Fig. 1 F and Fig. 1 G) and the primers 34, 36 for amplification of fully adapted DNA fragments generated.

[0149] The flow cell architecture in Fig. 2D includes the structure 44C, which includes the lane 54 defined in the single-layer substrate 50 or in the patterned material 62 of the multi-layer substrate 52, and surrounded by the perimeter regions 58. The depth of lane 54 is large enough to house at least the polymeric hydrogel 22. In one example, the lane 54 may be filled with the polymeric hydrogel 22. In an example, the depth may be at least about 0.1 pm, at least about 0.5 pm, at least about 1 pm, at least about 10 pm, at least about 100 pm, or more. Alternatively or additionally, the depth can be at most about 1 x103pm, at most about 100 pm, at most about 10 pm, or less. In some examples, the depth is about 0.4 pm. The depth of the lane 54 can be greater than, less than or between the values specified above.

[0150] In one example, the flow cell architecture of Fig. 2D includes the primers 34, 36 attached to the polymeric hydrogel 22. In this example, some primers 34, 36bind the transposome complexes 10D and 10E (Fig. 1 D and Fig. 1 E) and other primers 34, 36 are used for amplification of fully adapted DNA fragments. In another example, the flow cell architecture of Fig. 2D includes the primers 34, 36 and the capture primers 33, 35 attached to the polymeric hydrogel 22. In this example, the capture primers 33, 35 bind the transposome complexes 10F and 10G (Fig. 1 F and Fig. 1 G) and the primers 34, 36 are used for amplification of fully adapted DNA fragments.

[0151] Referring now to Fig. 2E, still another flow cell architecture is shown. This flow cell architecture is similar to that shown in Fig. 2B in terms of the substrate 50 or 52 having depressions 48’ defined therein. Unlike the depressions 48 described in reference to Fig. 2B, however, these depressions 48’ have an average pitch (center- to-center spacing) ranging from about 30 nm to about 50 nm, and an average depression diameter of 20 nm or less. This pitch size and diameter help to ensure that a single transposome complex dimer is immobilized in a single depression 48’. This is due to size exclusion and steric hindrance. As such, tagmentation taking place within this flow cell architecture happens between two depressions 48’ and not within a single depression 48’.

[0152] As shown in Fig. 2E, each depression 48’ includes the polymeric hydrogel 22 and two transposome complexes 10H (in dimer form) immobilized to the polymeric hydrogel 22. The attachment of the transposome complexes 10H to the polymeric hydrogel 22 may be via any of the covalent or non-covalent binding mechanisms set forth herein. In one example, the polymer hydrogel 22 is a biotinylated hydrogel, the transposome complexes 10H include a biotin end group, and streptavidin links the biotin groups. In another example, the polymer hydrogel 22 is replaced with a streptavidin layer, the transposome complexes 10H include a biotin end group.

[0153] The transposome complexes 10H may be desirable with this architecture because it eliminates the formation of fully adapted fragments with the same amplification domain 26 or 38 at opposed ends. It is to be understood, however, that the other transposome complexes 10A and 10B, or 10A and 10C or 10A alone may be used in this example architecture.

[0154] The flow cell architecture shown in Fig. 2E is used for tagmentation and preparation of the fully adapted fragments. Another flow cell architecture that includes the primers 34, 36 in the depressions 48 without any other primers 33, 35 and without transposome complexes 10A through 10H may be used for amplification of those fully adapted fragments.

[0155] In any of the examples set forth herein, the transposome complexes 10A, 10B, or 10A, 10C, or 10D, 10E, or 10F, 10G, or 10H may be included as part of the flow cell 32 or may be added and attached within the flow cell 32 at the outset of the method. The attachment mechanisms for the transposome complexes 10A, 10B, or 10A, 10C, or 10H will depend upon the transposome attachment mechanism 57 or the surface groups at the interstitial regions 56 as described herein.

[0156] Moreover, any of the transposome attachment techniques described in reference to Fig. 2B through Fig. 2E may be combined so that transposome complexes are attached both in the depressions 48 and on the interstitial regions 56.

[0157] Methods

[0158] The methods disclosed herein utilize tagmentation on board an example of the flow cell 32 to elucidate information about the frequency at which two fully adapted DNA fragments physically associate in 3D space.

[0159] Fig. 3A and Fig. 3B depict a portion of one example method. This example method includes introducing a chemical cross-linker to cultured cells 64, thereby cross-linking at least DNA within the cultured cells 64 and forming cells 64’ having fixed chromatin; exposing the cells 64’ having fixed chromatin to cell lysis to form a crude lysate; introducing the crude lysate to a flow cell 32 including: one of: i) first and second transposome complex dimers (dimers of complexes 10A and 10B, or 10A and 10C, or 10D and 10E, or 10F and 10G) immobilized on a surface of the flow cell 32, the first transposome complex dimers (dimers of complexes 10A, 10D, or 10F) including a first amplification domain 26 or 26’ and the second transposome complex dimers (dimers of complexes 10B, 10C, 10E, or 10G) including a second amplification domain 38 or 38’, or ii) a single transposome complex dimer (dimers of complexes 10H) immobilized on the surface, each of the single transposome complex dimersincluding two forked transposome complexes 10H; and a primer set (primers 34, 36) immobilized on the surface; and initiating tagmentation of the cross-linked DNA in the crude lysate.

[0160] In this example, cultured cells 64 are used. The cultured cells 64 are exposed to a chemical cross-linker to cross-link at least the DNA in the cells 64. It is to be understood that the proteins 68A, 68B in the cells 64 can also be cross-linked. Thus, exposure to the chemical cross-linker fixes the chromatin in the cells 64. As examples, the chemical cross-linker is formaldehyde or disuccinimidyl glutarate.

[0161] Fig. 3A depicts the components of a cell 64, including chromatin. The chromatin is a complex of nucleic acids and proteins 68A, 68B. In Fig. 3A, the nucleic acids are a single strand having two different portions / sequences 66A (SeqA), 66B (Seq B) that are physically close to one another in the cell 64 via the interactions with the proteins 68A, 68B, but are genomically far apart from one another along the single strand. The exposure of the cell 64 to the chemical cross-linker crosslinks the proteins 68A, 68B and / or the different sequences 66A, 66B to fix the protein mediated interactions of the otherwise non-contiguous sequences 66A, 66B in the genome.

[0162] The cells having fixed chromatin (shown at reference numeral 64’ in Fig. 3A) are then exposed to lysis. Exposing the cells to cell lysis involves one of: thermal lysis, or exposure to an alkaline pH, or exposure to an enzyme and then osmotic stress. In one particular example, thermal lysis may be used to lyse the cells 64’. In another particular example, the cells 64’ can be exposed to alkaline pH. Any of a variety of basic compounds can be used for lysis including, for example, potassium hydroxide, sodium hydroxide, and the like. Additionally, the cells 64’ can be exposed to an enzyme that degrades the cell wall / membrane surrounding the nucleus. Cells 64’ lacking a cell wall / membrane surrounding the nucleus either naturally or due to enzymatic removal can also be lysed by exposure to osmotic stress. Other conditions that can be used to lyse the cells 64’ having fixed chromatin include exposure to detergents, mechanical disruption, sonication heat, pressure differential such as in a French press device, or Dounce homogenization. Agents that stabilize gDNA can be included in the obtained cell lysate, including, for example, nuclease inhibitors,chelating agents, salts, buffers and the like. In this example, the crude cell lysate may be used without further isolation of the gDNA.

[0163] The crude lysate is then the introduced into any example of the flow cell 32 for tagmentation. The flow cell 32 shown in Fig. 3B includes the depressions 48 and the transposome complexes 10A and 10B, 10A and 10C, 10D and 10E, 10F and 10G, or 10H attached within the depressions 48. Because the sequences 66A, 66B have been fixed, they will be tagmented by transposome complexes 10A and 10B, 10A and 10C, 10D and 10E, 10F and 10G, or 10H that are positioned in close proximity to one another (e.g., in the same depression 48 or in depressions 48 that are within one or two rows or columns of each other).

[0164] Regardless of the transposome complexes 10A and 10B, 10A and 10C, 10D and 10E, 10F and 10G, or 10H included in the flow cell 32, the crude lysate is added with a tagmentation buffer, and the flow cell 32 is then brought to a tagmentation temperature. Thus, in this example method, tagmentation involves introducing a tagmentation buffer into the flow cell 32 with the crude lysate; and bringing the flow cell 32 to a tagmentation temperature. The tagmentation buffer may include water, an optional co-solvent (e.g., dimethylformamide), a metal co-factor for the transposase (e.g., magnesium acetate), and a buffer salt (e.g., Tris acetate salt, pH 7.6). In an example, the optional co-solvent may be present in an amount up to about 11 %, the metal co-factor may be present in a concentration ranging from about 3 mM to about 5.5 mM, and the buffer salt may be present in a concentration ranging from about 7 mM to about 12 mM. Tagmentation (including fragmentation and attachment described in detail below) may take place at a temperature at or above 30°C. In one example, the temperature may range from 30°C to about 55°C. In another example, the temperature may range from 35°C to about 45°C.

[0165] When the transposome complexes 10A, 10B, or 10A, 10C are used, the cross-linked DNA in the crude lysate is tagmented by the transposome complexesIOA, 10B, or 10A, 10C. After being fragmented, the 5’ ends of both strands of the fragments of the cross-linked DNA are attached to respective 3’ ends of the transferred strands 16A, 16B or 16A, 16C of at least some of the transposome complexes 10A,IOB, or 10A, 10C. The 3’ ends of both strands of the fragments of the cross-linkedDNA are not ligated to the 5’ ends of the non-transferred strands 18A, 18B or 18A, 18C. As such, a gap exists between the 3’ end of each strand of the DNA fragment strands and the 5’ end of the corresponding non-transferred strand 18A, 18B or 18A, 18C. In one example, each gap is nine (9) base pairs long.

[0166] Tagmentation generates partially adapted DNA fragments. The tagmentation may occur randomly across the cross-linked DNA. The number of tagmentation events that take place on a single piece of cross-linked DNA will depend upon the length of the piece and the distance between neighboring transposome complex dimers. At a minimum, the transposome complexes 10A, 10B, or 10A, 10C can tagment the pieces within the cross-linked DNA at least every 30 base pairs.

[0167] The method then involves washing untagmented DNA fragments (not shown) from the flow cell 32. An example of the washing solution is an aqueous solution including a buffer agent (e.g., Tris), a salt (e.g., sodium chloride, sodium citrate, etc.), a surfactant (e.g., TWEEN polysorbates), and / or a chelating agent (e.g., EDTA). In one example, the washing solution includes water, the salt at a concentration ranging from about 25 mM to about 50 mM, the surfactant in an amount ranging from about 0.01 wt% to about 0.1 wt%, and optionally the chelating agent. The washing solution may have a relatively high pH, e.g., ranging from about 7 to about 10.

[0168] The method further includes generating fully adapted fragments from the partially adapted fragments; sequencing the fully adapted fragments; and inferring an interaction between at least two fully adapted fragments in a cultured cell 64 based on their position on the flow cell 32.

[0169] To generate the fully adapted fragments from the partially adapted fragments formed via tagmentation, the transposase enzymes 12A, 12B or 12A, 12C are removed from the transposome complexes 10A, 10B, or 10A, 10C, and an extension reaction is initiated.

[0170] Transposase enzyme removal may be accomplished, for example, using sodium dodecyl sulfate (SDS) or proteinase, or by heating the flow cell 32 to about 60°C. When heat is used, some example methods involve introducing the washingsolution into the flow cell 32; and heating the flow cell 32, containing the washing solution, to about 60°C.

[0171] When SDS or another chaotropic detergent has been used for transposase enzyme removal, the washing solution may be flushed through the flow channel 46 prior to initiating the extension reaction. This removes the chaotropic detergent, which may interfere with downstream enzyme activity.

[0172] To initiate the extension reaction, an extension mix or an extension amplification mix is introduced into the flow cell 32. An example of the extension mix includes nucleotides, a polymerase, and accessory proteins. The extension mix may be used when it is desirable to initiate amplification separately from extension. An example of the extension amplification mix includes nucleotides, a recombinase, a polymerase, and accessory proteins. The extension amplification mix may be used when it is desirable to initiate amplification along with extension. The extension or extension amplification mix may also include a buffer agent (e.g., Tris), enzymes, stabilizers, a metal co-factor, a surfactant (e.g., TWEEN polysorbates), and / or a cosolvent (e.g., glycerol, dimethylformamide, etc.). The ExAMP reagents available from Illumina Inc. are examples of suitable extension amplification mixes.

[0173] The flow cell 32 may be up to 60°C (e.g., at about 38°C) when the extension mix or the extension amplification mix is introduced.

[0174] At the outset of the extension reaction, the non-transferred strands 18A, 18B or 18A, 18C are dehybridized. Additional sequences (adapters) are added to the 3’ ends of the newly tagmented strands by an extension reaction using the extension or extension amplification mix. The extension reaction involves the addition of nucleotides in a template dependent fashion from the 3’ ends of the partially adapted DNA fragments using the respective transferred strands 16A, 16B or 16A, 16C as the template. The sequences resulting from the extension reaction render the partially adapted (tagmented) fragments fully adapted. At least some of the fully adapted fragments (not shown) that are generated along the transposome complex 10A include the first amplification domain 26 at one end and a complement 38’ of the second amplification domain 38 at the other end. At least some of the fully adapted fragments that are generated along the transposome complex 10B or 10C include the secondamplification domain 38 at one end and a complement 26’ of the first amplification domain 26 at the other end.

[0175] The fully adapted fragments are amplified using the primers 34, 36 and then sequenced. When the extension amplification mix is used, amplification takes place immediately when the fully adapted fragments are generated. When the extension mix is used, amplification does not occur immediately, but after an additional polymerase and nucleotides are added to the flow cell 32. In one example of cluster generation, the fully adapted fragments are denatured from one another, and loop over to hybridize to an adjacent, complementary primer 34, 36, and a polymerase copies the copied templates to form double stranded bridges, which are denatured to form two single stranded strands. These two strands loop over and hybridize to adjacent, complementary primers 34, 36, and are extended again to form two new double stranded loops. The process is repeated on each template copy by cycles of isothermal denaturation and amplification to create dense clonal clusters. Each cluster of double stranded bridges is denatured. In an example, the reverse strands are removed by a cleaving agent suitable for the cleavage site of the primers 36 to which the reverse strands are attached (e.g., specific base cleavage), leaving forward template strands / amplicons. In another example, the forward strands are removed by a cleaving agent suitable for the cleavage site of the primers 34 to which the forward strands are attached (e.g., specific base cleavage), leaving reverse template strands / amplicons. Clustering results in the formation of several fragments immobilized in the depressions 48. In these examples, the fully adapted fragments and resulting clusters are generated in depressions that are within close proximity to one another in the flow cell, as shown in Fig. 3B. The proximity of these clusters on the flow cell 32 may be used to infer the interactions of distant sequences 66A, 66B in the genome that are proximal to one another in the 3D space of the cell 64 due to the protein 68A, 68B interaction.

[0176] Sequencing may then be performed. In one example, sequencing by synthesis (SBS) is performed by introducing sequencing primers (which bind to the sequencing primer sequence 28A, 28B or 28C) followed by an incorporation mixincluding labeled nucleotides. Optical imaging may be used to detect each instance of nucleotide incorporation.

[0177] When the transposome complexes 10E, 10D are used, the cross-linked DNA in the crude lysate is tagmented by the transposome complexes 10E, 10D. Crude lysate introduction and tagmentation may be performed as described herein.

[0178] The partially adapted DNA fragments that are generated as a result of tagmentation with the transposome complexes 10E, 10D have their 5’ attached to the transferred strands 16D, 16E and also have gaps between the 3’ ends of tagmented DNA and the non-transferred strands 18D, 18E. In these examples, gaps are also present between the surface bound primers 34, 36 and the respective transferred strands 16E, 16D. These gaps may be about 14 base pairs (bp) or 15 bp.

[0179] To form the fully adapted DNA fragments in this example, the transposase enzymes 12D, 12E are removed as described herein, and a gap-fill ligation reaction is performed. The gap-fill ligation reaction is initiated to attach the 3’ ends of tagmented DNA to the non-transferred strands 18D, 18E, and to fill the gaps between the surface bound primers 34, 36 and the respective transferred strands 16E, 16D. The gap-fill ligation may be performed using a mixture of a non-strand displacing polymerase, a ligase, and nucleotides. A commercially available kit for gap-fill ligation may be used, such as Illumina Inc.’s DNA PCR free kit. Examples of non-strand displacing polymerases include T4 and T7 DNA polymerases, which are active at temperatures ranging from about 20°C to about 37°C. Examples of the DNA ligase include E. coli DNA ligase, T4 DNA ligase, etc. The gap-fill ligation mix also includes any of the nucleotides described herein. The gap-fill ligation forms the fully adapted DNA strands, which in this example, are attached to the flow cell surface through the primers 34, 36.

[0180] Amplification and sequencing can then be performed as described herein.

[0181] In another example, the transposome complexes 10D, 10E include the sequencing primer sequences as part of the transferred strands 16D, 16E, which would simplify the gap-fill ligation.

[0182] When the transposome complexes 10F, 10G are used, the cross-linked DNA in the crude lysate is tagmented by the transposome complexes 10F, 10G. Crude lysate introduction and tagmentation may be performed as described herein. Partially adapted DNA fragments are generated as a result of tagmentation, where the 5’ ends of the tagmented DNA are attached to the transferred strands 16F, 16G and gaps exist between the 3’ ends of tagmented DNA and the non-transferred strands 18D, 18E. The transposase enzymes 12D, 12E are then removed as described herein. An extension reaction is initiated as described herein using the extension mix or the extension amplification mix. During the extension reaction, the sequences may be extended down to the ends of the transferred strands 16F, 16G, thus displacing the capture primer 33, 35 and copying the complement 29, 31 sequence. Alternatively, when the blocker base 41 is included between the amplification domain 26, 38 and the capture sequence complements 29, 31 , the extension reaction is prevented from copying the complement 29, 31 sequence. The extension reaction generates the fully adapted DNA fragments. Amplification and sequencing can then be performed as described herein.

[0183] When the transposome complexes 10H are used, the cross-linked DNA in the crude lysate is tagmented by the transposome complexes 10H. Crude lysate introduction and tagmentation may be performed as described herein. The transposase enzymes 12H may then be removed using any of the techniques described herein. The method then includes initiating gap-fill ligation to attach the partially adapted DNA fragments to the non-transferred strands 18H. Gap-fill ligation may be performed with any suitable gap-fill ligation enzyme (e.g., tTaq608 polymerase, T7 exo minus polymerase, etc.) and any suitable ligase (e.g., E. coli DNA ligase, T4 DNA ligase, etc.), in combination with a solution of nucleotides. Gap-fill ligation may take place at a temperature ranging from about 37°C to about 50°C for about 5 minutes. The resulting fully adapted DNA fragments are attached across the depression 48’.

[0184] The fully adapted DNA fragments are first dehybridized from one another, and then a cleaving agent for fully adapted DNA fragments may be introduced into the flow channel 46. The cleaving agent that is used will depend upon thecleavage site 40H of the transposome complexes 10H. The cleaved fully adapted DNA fragments can then be transported to another flow channel 46 that includes the amplification chemistry (i.e., primers 34, 36). Amplification of the cleaved and transported fully adapted DNA fragments can take place using the primers 34, 36 as described herein. Amplification can be followed by sequencing.

[0185] In addition to identifying the sequence of the fully adapted DNA fragments, the positioning of the fully adapted DNA fragments on the flow cell 32 may reveal the interactions of the different sequences 66A, 66B in the 3D space of the cells 64.

[0186] In another example method that is similar to that described in reference to Fig. 3A and Fig. 3B, the cells 64 are not first exposed to the chemical cross-linking agent. This example method includes exposing cells 64 to cell lysis to form a crude lysate; introducing the crude lysate to a flow cell 32 including one of: i) first and second transposome complex dimers (dimers of complexes 10A and 10B, or 10A and 10C, or 10D and 10E, or 10F and 10G) immobilized on a surface of the flow cell 32, the first transposome complex dimers (dimers of complexes 10A, 10D, or 10F) including a first amplification domain 26 or 26’ and the second transposome complex dimers (dimers of complexes 10B, 10C, 10E, or 10G) including a second amplification domain 38 or 38’, or ii) a single transposome complex dimer (dimers of complexes 10H) immobilized on the surface, each of the single transposome complex dimers including two forked transposome complexes 10H; and a primer set (primers 34, 36) immobilized on the surface; and initiating tagmentation of the DNA in the crude lysate, thereby generating partially adapted fragments; generating fully adapted fragments from the partially adapted fragments; sequencing the fully adapted fragments; and inferring an interaction between at least two genomically distant fully adapted fragments in the cell 64 based on their position on the flow cell 32.

[0187] In still another example method that is similar to that described in reference to Fig. 3A and Fig. 3B, the cells 64 are exposed to both cross-linking and digestion off board the flow cell 32. This example method includes introducing a chemical cross-linker to cultured cells 64, thereby cross-linking at least DNA within the cultured cells 64 and forming cells 64’ having fixed chromatin; exposing the cells 64’having fixed chromatin to digestion (e.g., using a restriction enzyme), thereby cutting the cross-linked DNA at specific sites to create cross-linked fragments; exposing the cells 64’ containing the cross-linked DNA to cell lysis to form a crude lysate; introducing the crude lysate to a flow cell 32 including: one of: i) first and second transposome complex dimers (dimers of complexes 10A and 10B, or 10A and 10C, or 10D and 10E, or 10F and 10G) immobilized on a surface of the flow cell 32, the first transposome complex dimers (dimers of complexes 10A, 10D, or 10F) including a first amplification domain 26 or 26’ and the second transposome complex dimers (dimers of complexes 10B, 10C, 10E, or 10G) including a second amplification domain 38 or 38’, or ii) a single transposome complex dimer (dimers of complexes 10H) immobilized on the surface, each of the single transposome complex dimers including two forked transposome complexes 10H; and a primer set (primers 34, 36) immobilized on the surface; and initiating tagmentation of the cross-linked DNA fragments in the crude lysate. In one example, this process may enable several antibodies to enrich several cross-linked transcription factors. The proximity information would then reveal what distal sequences are in close proximity within the original sample.

[0188] Still another example method involves solution-based tagmentation.With solution-based tagmentation, a transposome complex fluid is used to tagment the cells 64’ described herein outside of the flow cell 32. As such, the transposome complexes 10A and 10B, 10A and 10C, 10D and 10D, 10F and 10G, or 10H are not attached to the flow cell 32 at the outset, but rather, are added with the tagmented DNA sample. Because the cells 64’ having fixed chromatin are exposed to tagmentation in solution, different samples can be tagmented separately with different transposome complexes 10A and 10B, 10A and 10C, 10D and 10D, 10F and 10G, or 10H including different index sequences. Each index sequence functions as a barcode for the DNA sample tagmented with the particular transposome complexes 10A and 10B, 10A and 10C, 10D and 10D, 10F and 10G, or 10H. Because of the unique indices for each sample, the tagmented fragments from several samples can be pooled together. This, in this example, multiple samples can be pooled together and introduced into the same flow cell 32 for simultaneous analysis.

[0189] A portion of this method is schematically shown in Fig. 4. This method generally includes introducing a chemical cross-linker to cultured cells 64, thereby cross-linking at least DNA within the cultured cells 64 and forming cells 64’ having fixed chromatin; introducing, to the cells 64’ having fixed chromatin, one of: i) first and second transposome complex dimers (dimers of complexes 10A and 10B, or 10A and 10C, or 10D and 10E, or 10F and 10G), the first transposome complex dimers (dimers of complexes 10A, 10D, or 10F) including a first amplification domain 26 or 26’ and the second transposome complex dimers (dimers of complexes 10B, 10C, 10E, or 10G) including a second amplification domain 38 or 38’, or ii) a single transposome complex dimer (dimers of complexes 10H), each of the single transposome complex dimers including two forked transposome complexes 10H; initiating tagmentation of the crosslinked DNA in the cells 64’ having fixed chromatin; after tagmentation, lysing the cells 64’ having fixed chromatin, thereby releasing intact tagmented, cross-linked DNA 70; and introducing the intact tagmented, cross-linked DNA 70 to a flow cell, whereby the intact tagmented, cross-linked DNA 70 attaches to a surface of the flow cell 32.

[0190] In this example, the cultured cells 64, including their nuclei and chromatin, are first permeabilized and the chromatin (e.g., the DNA, 66A, 66B and / or proteins 68A, 68B) are crosslinked. This may be performed as described in reference to Fig. 3A to form the cells 64’.

[0191] The cells 64’ are then mixed with the transposome complexes 10A and 10B, or 10A and 10C, or 10D and 10D, or 10F and 10G, or 10H in solution. In an example, the transposome complexes 10A and 10B, or 10A and 10C, or 10D and 10D, or 10F and 10G, or 10H are present in water in a concentration ranging from about 0.1 pM to about 1 pM. A buffer and / or salt may be added to the water. The buffer has a pH ranging from 5 to 12.

[0192] To the mixture of cells 64’ and the transposome complex fluid / solution, the tagmentation buffer is added, and the temperature of the solution is brought to the tagmentation temperature (e.g., from about 37°C to about 55°C). Tagmentation of the DNA in the cells 64’ proceeds as described herein, and the tagmentation time may range from about 2 minutes to about 15 minutes.

[0193] Following tagmentation in solution, the transposome enzymes 12A, etc. are not removed and lysis is performed. Lysis may be performed as described in reference to Fig. 3A. Lysis fully disrupts the cell membranes and releases the intact tagmented, cross-linked DNA 70, which remains intact due to the transposome enzymes 12A, etc.

[0194] If desirable, these processes may be performed for several different cells 64, and then the intact tagmented, cross-linked DNA 70 obtained from each of the different cells 64 may be pooled together. Pooling may take place as long as the transposome complexes 10A and 10B, or 10A and 10C, or 10D and 10D, or 10F and 10G, or 10H used for the DNA from the different cells 64 are uniquely indexed.

[0195] The intact tagmented, cross-linked DNA 70 or a pool of multiple intact tagmented, cross-linked DNA 70 is then introduced into the flow cell 32. In this example, the flow cell 32 includes the depressions 48 or the lane 54, and some component in the depressions 48 or the lane 54 to attach at least one of the transposome complexes 10 and / or 10B, 10A and / or 10C, 10D and / or 10E, 10F and / or 10G, or 10H. As example, the component may be the transposome capture mechanism 57; the polymeric hydrogel 22 or another anchoring layer, such as streptavidin; the primers 34, 36; or the capture primers 33, 35.

[0196] One intact tagmented, cross-linked DNA 70 attached to some of the depressions 48 of the flow cell 32 is depicted in Fig. 4. The 5’ and / or 3’ end functional groups 20A, 20B, 42, 20H, or surface bound primers 34, 36, or surface bound capture primers 33, 35 attach the intact tagmented, cross-linked DNA 70 to the flow cell surface. When biotin is used for attachment, streptavidin may be present in the depressions 48 or the lane 54 of the flow cell 32. Because the intact tagmented, cross-linked DNA 70 is held together post-tagmentation and post-lysis, the intact tagmented, cross-linked DNA 70 is attached to depressions 48 that are close together or within a particular area of the lane 54. Thus, the spatial link between the fragments from the same DNA sample (and the same cell 64) is maintained on the flow cell surface.

[0197] Once the intact tagmented, cross-linked DNA 70 is attached, a wash may be performed with an example of the washing solution described herein in order toremove any unbound material. Then, the transposase enzymes 12A, 12B, etc. may be removed using one of the methods disclosed herein. The tagmented (partially adapted) DNA sample fragments (which may be from the different samples) remain attached to the flow cell 32 through the 5’ and / or 3’ end functional groups 20A, 20B, 42, 20H, or surface bound primers 34, 36, or surface bound capture primers 33, 35.

[0198] The generation of the fully adapted DNA sample fragments (for each of the DNA sample fragments) will depend upon the transposome complex 10A and 10B, or 10A and 10C, or 10D and 10D, or 10F and 10G, or 10H that is used, and may be performed as described herein for each of the transposome complexes 10A and 10B (e.g., an extension reaction), or 10A and 10C (e.g., an extension reaction), or 10D and 10D (e.g., gap-fill ligation), or 10F and 10G (e.g., an extension reaction), or 10H (e.g., gap-fill ligation).

[0199] In one example, the intact tagmented, cross-linked DNA 70 attaches to the surface of the flow cell 32 by 5’ and / or 3’ end functional groups 20A and 20B or 20C of the first and second transposome complex dimers 10A and 10B or 10C; and the method further comprises: removing transposase enzymes 12A and 12B or 12C from each of the first and second transposome complex dimers 10A and 10B or 10C; and initiating an extension reaction to generate fully adapted fragments. In another example, the dimers 10D and 10E are used and the intact tagmented, cross-linked DNA 70 attaches to the surface of the flow cell 32 via hybridization of the respective amplification domain sequence complements to respective surface bound primers 34, 36; and the method further comprises: removing transposase enzymes 12D, 12E from each of the first and second transposome complex dimers 10D, 10E; and initiating gap-fill ligation to generate fully adapted fragments. In still another example, the dimers 10F and 10G are used and the intact tagmented, cross-linked DNA 70 attaches to the surface of the flow cell 32 via hybridization of the respective capture sequence complements 29, 31 to respective capture primers33, 35; and the method further comprises: removing transposase enzymes 12F, 12G from each of the first and second transposome complex dimers 10F, 10G; and initiating an extension reaction to generate fully adapted fragments. In still another example, the intact tagmented, cross-linked DNA 70 attaches to the surface of the flow cell 32 by 5’ functional groups20H of the single transposome complex dimers, and the method further comprises: removing transposase enzymes 12H from each of the single transposome complexes 10H of the dimers; and initiating gap-fill ligation to generate fully adapted fragments.

[0200] Amplification of any of the fully adapted fragments, and sequencing of the amplified fragments may also be performed as described herein. The index sequence data can be used to identify the particular DNA sample. Moreover, distant sequences 66A, 66B that were proximal to one another in the 3D space of the cell 64 will be captured by the proximity correlations of the clusters on the flow cell 32.

[0201] Still another example method involves a first solution-based tagmentation and a second flow cell based tagmentation. In this example, the pairs of transposome complexes 10A and 10B or 10A and 10C may be used. One of the complexes, e.g., 10A, is used in the solution-based tagmentation, and the other of the complexes 10B or 10C is used in the flow cell based tagmentation. This method generally includes introducing a chemical cross-linker to cultured cells 64, thereby cross-linking at least DNA within the cultured cells 64 and forming cells 64’ having fixed chromatin; introducing, to the cells 64’ having fixed chromatin, first transposome complex dimers (e.g., dimers of transposome complex 10A) including a first amplification domain 26; initiating tagmentation of the cross-linked DNA in the cells 64’ having fixed chromatin; after tagmentation, lysing the cells 64; having fixed chromatin, thereby releasing intact tagmented, cross-linked DNA 70; introducing the intact tagmented, cross-linked DNA 70 to a flow cell 32 having surface bound second transposome complex dimers (e.g., dimers of transposome complex 10B or 10C) including a second amplification domain 38; an initiating tagmentation of the intact tagmented, cross-linked DNA 70 with the surface bound second transposome complex dimers.

[0202] In this example, the cultured cells 64, including their nuclei and chromatin, are first permeabilized and the chromatin (e.g., the DNA, 66A, 66B and / or proteins 68A, 68B) are crosslinked. This may be performed as described in reference to Fig. 3A to form the cells 64’.

[0203] The cells 64’ are then mixed with the transposome complexes 10A in solution. In an example, the transposome complexes 10A are present in water in aconcentration ranging from about 0.1 pM to about 1 pM. A buffer and / or salt may be added to the water. The buffer has a pH ranging from 5 to 12.

[0204] To the mixture of cells 64’ and the transposome complex fluid / solution, the tagmentation buffer is added, and the temperature of the solution is brought to the tagmentation temperature (e.g., from about 37°C to about 55°C). A first tagmentation of the DNA in the cells 64’ proceeds as described herein, and the tagmentation time may range from about 2 minutes to about 15 minutes.

[0205] Following tagmentation, the transposome enzymes 12A are not removed and lysis is performed. Lysis may be performed as described in reference to Fig. 3A. Lysis fully disrupts the cell membranes and releases the intact tagmented, cross-linked DNA 70, which remains intact due to the transposome enzymes 12A. Unlike the example shown in Fig. 4, the intact tagmented, cross-linked DNA 70 generated in this example method has one type of transposome complex 10A attached to the fragmented DNA.

[0206] If desirable, these processes may be performed for several different cells 64, and then the intact tagmented, cross-linked DNA 70 obtained from each of the different cells 64 may be pooled together. Pooling may take place as long as the transposome complexes 10A used for the DNA from the different cells are uniquely indexed. The flow cell surface-bound transposome complexes 10B or 10C may or may not be indexed.

[0207] The intact tagmented, cross-linked DNA 70 or a pool of multiple intact tagmented, cross-linked DNA 70 is then introduced into the flow cell 32. In this example, the flow cell 32 includes the depressions 48 or the lane 54, and dimers of the other transposome complex 10B or 10C of the complex pair 10A and 10B or 10C attached to the flow cell surface as described in any of the examples described herein.

[0208] The tagmentation buffer is added with or after the intact tagmented, cross-linked DNA 70, and the temperature of the flow cell 32 is brought to the tagmentation temperature (e.g., from about 37°C to about 55°C). This initiates the second tagmentation of the (already tagmented) fragments of the intact tagmented, cross-linked DNA 70.

[0209] The transposase enzymes 12A and 12B or 12C are then removed from the transposome complexes 10A and 10B or 10C. The twice-tagmented fragments are now attached to the flow cell surface via the transferred strands 16B or the nontransferred strands 18C after the extension reaction is performed.

[0210] The generation of the fully adapted DNA sample fragments (for each of the DNA sample fragments) may be performed as described herein for the transposome complexes 10A and 10B, or 10A and 10C. Amplification of these fragments, and sequencing of the amplified fragments may also be performed as described herein. The index sequence data can be used to identify the particular DNA sample. Moreover, distant sequences 66A, 66B that were proximal to one another in the 3D space of the cell 64 will be captured by the proximity correlations of the clusters on the flow cell 32.

[0211] Additional Notes

[0212] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be appreciated that terminology explicitly employed herein that also may appear in any disclosure incorporated by reference should be accorded a meaning most consistent with the particular concepts disclosed herein.

[0213] Reference throughout the specification to “one example”, “another example”, “an example”, and so forth, means that a particular element (e.g., feature, structure, and / or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.

[0214] While several examples have been described in detail, it is to be understood that the disclosed examples may be modified. Therefore, the foregoing description is to be considered non-limiting.

Claims

What is claimed is:

1. A method, comprising: introducing a chemical cross-linker to cultured cells, thereby cross-linking at least DNA within the cultured cells and forming cells having fixed chromatin; exposing the cells having fixed chromatin to cell lysis to form a crude lysate; introducing the crude lysate to a flow cell including: one of: i) first and second transposome complex dimers immobilized on a surface of the flow cell, the first transposome complex dimers including a first amplification domain and the second transposome complex dimers including a second amplification domain; or ii) a single transposome complex dimer immobilized on the surface, each of the single transposome complex dimers including two forked transposome complexes; and a primer set immobilized on the surface; and initiating tagmentation of the cross-linked DNA in the crude lysate.

2. The method as defined in claim 1 , wherein the chemical cross-linker is formaldehyde or disuccinimidyl glutarate.

3. The method as defined in one of claim 1 or claim 2, wherein tagmentation of the cross-linked DNA generates partially adapted fragments; and wherein the method further comprises: generating fully adapted fragments from the partially adapted fragments; sequencing the fully adapted fragments; and inferring an interaction between at least two fully adapted fragments in a cultured cell based on their position on the flow cell.

4. The method as defined in one of claims 1 through 3, wherein initiating tagmentation involves:introducing a tagmentation buffer into the flow cell with the crude lysate; and bringing the flow cell to a tagmentation temperature.

5. The method as defined in one of claims 1 through 4, wherein exposing the cells having fixed chromatin to cell lysis involves one of: thermal lysis, or exposure to an alkaline pH, or exposure to an enzyme and then osmotic stress.

6. A method, comprising: exposing cells to cell lysis to form a crude lysate; introducing the crude lysate to a flow cell including: one of: iii) first and second transposome complex dimers immobilized on a surface of the flow cell, the first transposome complex dimers including a first amplification domain and the second transposome complex dimers including a second amplification domain; or iv) a single transposome complex dimer immobilized on the surface, each of the single transposome complex dimers including two forked transposome complexes; and a primer set immobilized on the surface; and initiating tagmentation of the DNA in the crude lysate, thereby generating partially adapted fragments; generating fully adapted fragments from the partially adapted fragments; sequencing the fully adapted fragments; and inferring an interaction between at least two genomically distant fully adapted fragments in a cell based on their position on the flow cell.

7. The method as defined in claim 6, wherein exposing the cells to cell lysis involves one of: thermal lysis, or exposure to an alkaline pH, or exposure to an enzyme and then osmotic stress.

8. The method as defined in one of claim 6 or claim 7, wherein initiating tagmentation involves: introducing a tagmentation buffer into the flow cell with the crude lysate; and bringing the flow cell to a tagmentation temperature.

9. A method, comprising: introducing a chemical cross-linker to cultured cells, thereby cross-linking at least DNA within the cultured cells and forming cells having fixed chromatin; introducing, to the cells having fixed chromatin, one of: i) first and second transposome complex dimers, the first transposome complex dimers including a first amplification domain and the second transposome complex dimers including a second amplification domain; or ii) a single transposome complex dimer, each of the single transposome complex dimers including two forked transposome complexes; initiating tagmentation of the cross-linked DNA in the cells having fixed chromatin; after tagmentation, lysing the cells having fixed chromatin, thereby releasing intact tagmented, cross-linked DNA; and introducing the intact tagmented, cross-linked DNA to a flow cell, whereby the intact tagmented, cross-linked DNA attaches to a surface of the flow cell.

10. The method as defined in claim 9, wherein the chemical cross-linker is formaldehyde or disuccinimidyl glutarate.11 . The method as defined in one of claim 9 or claim 10, wherein: the intact tagmented, cross-linked DNA attaches to the surface of the flow cell by 5’ and / or 3’ end functional groups of the first and second transposome complex dimers; and the method further comprises:removing transposase enzymes from the first and second transposome complex dimers; and initiating an extension reaction to generate fully adapted fragments.

12. The method as defined in one of claim 9 or claim 10, wherein: the first and second transposome complex dimers include respective amplification domain sequence complements; the intact tagmented, cross-linked DNA attaches to the surface of the flow cell via hybridization of the respective amplification domain sequence complements to respective surface bound primers; and the method further comprises: removing transposase enzymes from the first and second transposome complex dimers; and initiating gap-fill ligation to generate fully adapted fragments.

13. The method as defined in one of claim 9 or claim 10, wherein: the first and second transposome complex dimers include respective capture sequence complements; the intact tagmented, cross-linked DNA attaches to the surface of the flow cell via hybridization of the respective capture sequence complements to respective capture primers; and the method further comprises: removing transposase enzymes from the first and second transposome complex dimers; and initiating an extension reaction to generate fully adapted fragments.

14. The method as defined in one of claim 11 through claim 13, further comprising: generating fully adapted fragments from the partially adapted fragments; sequencing the fully adapted fragments; andinferring an interaction between at least two fully adapted fragments in a cultured cell based on their position on the flow cell.

15. A method, comprising: introducing a chemical cross-linker to cultured cells, thereby cross-linking at least DNA within the cultured cells and forming cells having fixed chromatin; introducing, to the cells having fixed chromatin, first transposome complex dimers including a first amplification domain; initiating tagmentation of the cross-linked DNA in the cells having fixed chromatin; after tagmentation, lysing the cells having fixed chromatin, thereby releasing intact tagmented, cross-linked DNA; introducing the intact tagmented, cross-linked DNA to a flow cell having surface bound second transposome complex dimers including a second amplification domain; and initiating tagmentation of the intact tagmented, cross-linked DNA with the surface bound second transposome complex dimers.

16. The method as defined in claim 15, wherein the chemical cross-linker is formaldehyde or disuccinimidyl glutarate.

Images