Compositions and methods for identifying functional nucleic acid delivery vehicles

Abstract

Provided are methods and compositions for screening / identifying / characterizing nucleic acid delivery vehicles (e.g., liquid nanoparticle (LNP) formulations). Provided is a library of nucleic acid delivery vehicles with different chemical compositions, where the members of the library are barcoded by virtue of including a barcoded RNA molecule (in some cases a barcoded ligation-ready RNA molecule). The barcoded RNA molecule includes a first ribozyme, a second ribozyme, and a barcode sequence between the first and second ribozymes. Once a barcoded RNA molecule is successfully delivered into a cell, the first and second ribozymes cleave the barcoded RNA molecule to produce a 5'-OH end and a 2',3'-cyclic phosphate end, which ends can be ligated to one another by an intracellular RNA ligase, producing a circular RNA (cRNA) that includes the barcode sequence. Detecting barcode sequences from cRNAs therefore identifies the chemical composition of successful delivery vehicles.

Description

COMPOSITIONS AND METHODS FOR IDENTIFYING FUNCTIONAL NUCLEIC ACID DELIVERY VEHICLESCross-Reference

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 736,531 filed December 19, 2024, which application is incorporated herein by reference in its entirety.Incorporation by reference of Sequence Listing provided as an XML File

[0002] A Sequence Listing is provided herewith as a Sequence Listing XML, “BERK- 549WO_SEQ_LISTING.xml” created on December 16, 2025 and having a size of 6,863 bytes. The contents of the Sequence Listing XML are incorporated by reference herein in their entirety.I. Introduction

[0003] Lipid Nanoparticles (LNPs) are a leading nucleic acid delivery vehicle in industry. However, the development of new LNP formulations has been significantly impeded by limitations in the screening process. This is because each prospective LNP formulation must be individually injected into an animal model, such as a mouse, to evaluate its delivery efficiency. In the context of LNP development, where a large number of formulations and variables (e.g., lipid chemistry, lipid composition ratios) need to be extensively tested, the associated costs and time constraints severely limit research and development efforts. To address this challenge, various LNP barcoding methodologies have been previously proposed. These methods involve encapsulating nucleic acid cargoes, each containing a unique barcode within individual formulations. A single animal host can then be injected with a combined bolus of formulations. Following treatment, the target organs are harvested, and the barcodes are identified through various analytical methods.

[0004] However, these methodologies present several limitations, particularly the requirement for cell sorting (e.g., FACS) to isolate cells with successful delivery. This constraint limits the organs and host species that can be screened due to cell isolation challenges and detection sensitivity.

[0005] There is a need for compositions and methods that provide for more efficient screening of nucleic acid delivery vehicles, and such is provided herein.II. SUMMARY

[0006] Provided are methods and compositions for screening nucleic acid delivery vehicles (e.g., liquid nanoparticle (LNP) formulations). For example, provided is a library of nucleic acid delivery vehicles with different chemical compositions. The members of the library (i.e., the nucleic acid delivery vehicles) are barcoded by virtue of including a barcoded RNA molecule. Each unique barcode sequence can therefore be said to identify the chemical composition of the nucleic acid delivery vehicle of which it is part.

[0007] The barcoded RNA molecule includes a first ribozyme, a second ribozyme, and a barcode sequence between the first and second ribozymes. In other words, the barcoded RNA molecule includes, from 5’ to 3’: (i) a first ribozyme, (ii) a barcode sequence that identifies the chemical composition of the nucleic acid delivery vehicle, and (iii) a second ribozyme (i.e., the barcode sequence is flanked by ribozymes).

[0008] Once a barcoded RNA molecule is successfully delivered into a cell, the first and second ribozymes of the barcoded RNA molecule cleave the barcoded RNA molecule to produce a 5’-OH end and a 2’,3’-cyclic phosphate end. The ends can be ligated to one another by an intracellular RNA ligase (e.g., RtcB) to produce a circular RNA (cRNA) that includes the barcode sequence. These reactions (ribozyme cleavage followed by ligation of the ends for form a cRNA) only occur upon successful delivery of the barcoded RNA molecule into a cell. In other words, only upon successful nucleic acid delivery to a cell, defined by both cellular uptake and endosomal escape, the barcoded RNA molecule undergoes self-cleavage at the 5’ and 3’ ends, resulting in 5’-OH and 2’,3’-cyclic phosphate termini, followed by ligation of the ends by a cellular ligase (e.g., RtcB), thus forming a stable circular RNA (cRNA) [also referred to herein as a “stable circularized RNA” (“scRNA”)].

[0009] In some embodiments, a barcoded ligation-ready RNA molecule (e.g., of a subject library) is used. A barcoded ligation-ready RNA molecule does not include a first or second ribozyme (i.e., it lacks a ribozyme) because it already includes a 5’-OH end and a 2’,3’-cyclic phosphate end, which can be ligated to one another by an intracellular RNA ligase (e.g., RtcB) to produce a circular RNA (cRNA) that includes the barcode sequence. Such barcoded ligation-ready RNA molecules can be generated synthetically (e.g., chemical synthesis using a nucleic acid synthesizer). Such barcoded ligation-ready RNA molecules can also be generated by starting with molecules that do include a first and a second ribozyme, and then activating the ribozymes, e.g., in vitro (to generate the 5’-OH and 2’,3’-cyclic phosphate termini),prior to incorporating the barcoded RNAs as part of a subject library (a library of nucleic acid delivery vehicles).

[0010] The approach described herein takes advantage of the nearly ubiquitous endogenous RNA ligase, RtcB, and enzymes with related functions, which ligate unique RNA ends that are not normally present in RNA. More specifically, the barcoded RNA molecules are designed to include ribozyme sequences, where the ribozymes autocatalytically process the transcript, resulting in ends that are substrates for RNA-ligation.

[0011] After a subject library of nucleic acid delivery vehicles (with different chemical compositions) is delivered to cells (i.e. , administered to a plurality of cells), detection of the barcode sequences from circular RNAs (cRNAs) can be used to identify which nucleic acid delivery vehicles successfully delivered the identified barcode sequences. For example, RT-PCR primers can be designed to only amplify cRNA (positive hits) efficiently, discriminating them from linear RNA (negative hits) because only cRNA can produce a complete PCR product. The PCR products can be sequenced in order to identify the barcodes that were successfully delivered to cells.

[0012] Thus, provided are methods for identifying / characterizing (functional) nucleic acid delivery vehicles. The methods of this disclosure are sometimes referred to herein as “CYBR” (cytosolic-sensing barcoded RNA) - likewise, the compositions of this disclosure can also be referred to as CYBR compositions (e.g., a CYBR library). Such methods include: (a) administering a subject library of nucleic acid delivery vehicles to a plurality of cells; and (b) detecting the barcodes present in cRNAs resulting from said administering. The methods thereby identify, based on the barcodes that are detected, the chemical composition of nucleic acid delivery vehicles that successfully delivered the barcoded RNA molecules.

[0013] Reagents, compositions, and kits / systems that find use in practicing the subject methods are provided. For example, libraries of nucleic acid delivery vehicles are provided, which include barcoded RNA molecules. Also provided are libraries of nucleic acid delivery vehicles that include barcoded ligation-ready RNA molecules. Also provided are barcoded RNA molecules disclosed herein. Also provided are barcoded ligation-ready RNA molecules disclosed herein.III. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The following detailed description of embodiments of the invention will be better understood when read in conjunction with the appended drawings. It should beunderstood that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.

[0015] FIG. 1 provides a schematic representation of LNP barcoding using self-circularized RNA (scRNA).

[0016] FIG. 2A to 2B provide example 2% agarose gel electrophoresis of RT-PCR products from scRNA barcode samples before and after delivery. FIG. 2A shows unreacted RNA barcodes, with the top band corresponding to intact scRNA and the two lower bands representing incomplete RT-PCR products due to the disconnection between the 5' and 3' ends. FIG. 2B shows RT-PCR-amplified circular scRNA extracted from the mouse liver after 24-hour injection (single barcode, retro-orbital), showing a distinct band from efficient RT-PCR amplification. The successful amplification was also independently confirmed by Sanger sequencing, showing two distinct poly(A) spacers flanking a self-complementary spacer that indicates successful end termini ligation.

[0017] FIG. 3A to 3C demonstrate that barcoding by scRNA identifies LNP formulation that transfects target organs. FIG. 3A validates the scRNA barcoding strategy and shows that, among the formulations, L34 showed the highest predicted delivery efficiency, while L22 had a significantly lower predicted efficiency. Mice were treated with firefly Luciferase (ffLuciferase) reporter mRNA encapsulated within either L34 or L22 via retroorbital injection. After 5 hours, D-luciferin, the ffLuciferase substrate, was administered, and target organs were dissected for imaging. Successful delivery was confirmed by enzymatic-substrate conversion generating detectable luminescence. FIG. 3B quantifies delivery efficiency based on luminescence in lung and heart. Luminescence from the ffLuciferase reaction was quantified in the lung and heart. The subjects treated with L34 showed a significantly higher luminescence than L22 and background (untreated). These results validated the ability of scRNA barcoding strategy to predict and identify efficient LNP formulations in large screening cohorts (>10 formulations). FIG. 3C provides the predicted ranking of delivery efficiency for lung and heart tissue for different LNP formulations. Using normalized barcode reads (calculated as the read number of a specific barcode divided by the total barcode reads from NGS results), delivery efficiency rankings for lung and heart were established across the cohort. Here, the L34 formulation was predicted to outperform others in gene delivery efficiency for both lung and heart tissues, corresponding to the validation data in FIG. 3A and 3B.

[0018] FIG. 4 illustrates the LNP composition of the L34 formulation. The leading LNP ds (L34) identified by scRNA barcoding consists of commercially available, 1014 ionizable lipid, 1 ,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), Cholesterol, and DMG-PEG 2000 at the molar percentage of 42.5:21.68:34.74:1.07. The LNP was formed by injecting lipid mixture in ethanol phase to mRNA in 25 mM acetate buffer (aqueous) at 16 mgLipids:mgmRNA with the aqueous-to-organic phase ratio of 3:1. Image of the 1014 was taken from Cayman Chemical.

[0019] FIG. 5 provides the general nucleic acid sequence of scRNA barcodes (an example embodiment is depicted) (SEQ ID NO: 3). This figure presents a snapshot of the DNA template used to generate scRNA barcodes. The scRNA structure includes two main autocatalytic twister ribozyme sequences, labeled as Twist (Front) and Twist (Back), which flank both spacer regions and a unique barcode region (highlighted in red). Within the endosome, the twister ribozymes autocleave to produce reactive 5'- hydroxyl (5'-OH) and 3'-phosphate (3'-PO) termini. These are recognized by endogenous RtcB ligase and facilitate scRNA circularization.

[0020] FIG. 6 illustrates the detection of circularized RNA by RT-PCR amplification (an example embodiment is depicted (SEQ ID NO: 4). Following ligation and circularization, the scRNA acquires the predicted sequence. Two PCR primers are strategically positioned to enable efficient amplification of the cDNA product (derived from the reverse-transcribed circular RNA). This amplification produces a linear DNA amplicon suitable for the next-generation sequencing (NGS) workflow. The example FWD Primer is SEQ ID NO: 5, while the example REV primer is SEQ ID NO: 6.

[0021] FIG. 7 provides data demonstrating that CYBR can be used to screen LNP libraries in vivo (e.g., via sequencing organ tissue). A CYBR-barcoded LNP library, termed B- LNP, was administered to mice (20 formulations, 0.5 mg / kg total barcode, N = 3). After 24h, the liver, spleen, lung, heart, and kidney were retrieved and analyzed for LNP transfection via NGS of reverse-transcribed CYBR RNA extracted from each organ. The CYBR prediction for the LNP library in each organ is displayed as a heatmap, with the formulation predicted to have high delivery efficiency highlighted by the red arrow and the formulation predicted to have low delivery efficiency highlighted by the blue arrow. To validate the prediction, the luciferase mRNA delivery efficiencies of the highest- and the lowest-ranking LNP in each organ were investigated and plotted in a separate experiment (1 mg / kg mRNA, i.v).

[0022] FIG. 8 provides data demonstrating that CYBR can identify LNPs that efficiently transfect human CD34+ HSPCs at a fraction of the cost of traditional screeningmethods. CYBR screened a 30-member library, termed A-LNPs, in a single well (N = 3, 100,000 cells / well) of a 96-well plate. The heatmap shows predicted delivery for each formulation. LNPs with high predicted delivery (A1, red arrow) and low predicted delivery (A30 or MC3-DLin, blue arrow) were validated by a subsequent GFP mRNA delivery experiment. The LNP formulation A1 transfected 100% of HSPCs with GFP mRNA, whereas the control MC3-DLin formulation transfects <2% of the cells.

[0023] FIG. 9 provides data demonstrating that CYBR has the sensitivity needed to optimize lead LNP formulations in vivo. The lung-tropic 1014 formulation from the initial screen in FIG. 7 was optimized by varying lipid composition ratios, replacing DOPE with DSPC, or adding DOTAP. A total of 20 new formulations (B17-F LNPs) were generated and investigated for lung delivery in vivo. Two new formulations, B17-F8 and B17-F9, were identified by CYBR as superior to the original 1014 formulation. A separate experiment with luciferase mRNA demonstrated that B17-F8 and B17-F9 were better at delivering luciferase mRNA to the lung than the original 1014 formulation.IV. DEFINITIONS

[0024] The following terms have the following meanings unless otherwise indicated. Any undefined terms have their art recognized meanings.

[0025] The terms “polynucleotide” and “nucleic acid,” used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The terms "polynucleotide" and "nucleic acid" are used interchangeably herein to refer to all forms of nucleic acid (e.g., oligonucleotides) including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Polynucleotides include genomic DNA, cDNA and antisense DNA, and spliced or unspliced mRNA, rRNA, tRNA, IncRNA, RNA antagomirs, and inhibitory DNA or RNA (RNAi, e g., small or short hairpin (sh)RNA, microRNA (miRNA), aptamers, small or short interfering (si)RNA, trans-splicing RNA, or antisense RNA). Polynucleotides also include non-coding RNA, which include for example, but are not limited to, RNAi, miRNAs, IncRNAs, RNA antagomirs, aptamers, and any other non-coding RNAs known to those of skill in the art. Polynucleotides include naturally occurring, synthetic, and intentionally altered or modified polynucleotides as well as analoguesand derivatives. The term "polynucleotide" also refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or analogs thereof, and is synonymous with nucleic acid sequence. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The term polynucleotide, as used herein, refers interchangeably to double- and single-stranded molecules. Unless otherwise specified or required, any embodiment as described herein encompassing a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form. Polynucleotides can be single, double, or triplex, linear or circular, and can be of any length. In discussing polynucleotides, a sequence or structure of a particular polynucleotide may be described herein according to the convention of providing the sequence in the 5' to 3' direction.

[0026] By "hybridizable" or “complementary” or “substantially complementary" it is meant that a nucleic acid (e.g. RNA, DNA) comprises a sequence of nucleotides that enables it to non-covalently bind, i.e. form Watson-Crick base pairs and / or G / U base pairs, “anneal”, or “hybridize,” to another nucleic acid in a sequence-specific, antiparallel, manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid) under the appropriate in vitro and / or in vivo conditions of temperature and solution ionic strength. Standard Watson-Crick base-pairing includes: adenine (A) pairing with thymidine (T), adenine (A) pairing with uracil (U), and guanine (G) pairing with cytosine (C) [DNA, RNA], In addition, for hybridization between two RNA molecules (e.g., dsRNA), and for hybridization of a DNA molecule with an RNA molecule: guanine (G) can also base pair with uracil (U). For example, G / U base-pairing is at least partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of tRNA anti-codon base-pairing with codons in mRNA. Thus, in the context of this disclosure, a guanine (G) is considered complementary to both an uracil (U) and to an adenine (A). For example, when a G / U base-pair can be made at a given nucleotide position of a dsRNA duplex, the position is not considered to be non-complementary, but is instead considered to be complementary.

[0027] Hybridization and washing conditions are well known and exemplified in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), particularlyChapter 11 and Table 11.1 therein; and Sambrook, J. and Russell, W., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (2001). The conditions of temperature and ionic strength determine the "stringency" of the hybridization.

[0028] Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. The conditions appropriate for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, variables well known in the art. The greater the degree of complementarity between two nucleotide sequences, the greater the value of the melting temperature (Tm) for hybrids of nucleic acids having those sequences. For hybridizations between nucleic acids with short stretches of complementarity (e.g. complementarity over 35 or less, 30 or less, 25 or less, 22 or less, 20 or less, or 18 or less nucleotides) the position of mismatches can become important (see Sambrook et al., supra, 11.7-11.8). Typically, the length for a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more). Temperature, wash solution salt concentration, and other conditions may be adjusted as necessary according to factors such as length of the region of complementation and the degree of complementation.

[0029] It is understood that the sequence of a polynucleotide need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable or hybridizable. Moreover, a polynucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a bulge, a loop structure or hairpin structure, etc.). A polynucleotide can comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to a target region within the target nucleic acid sequence to which it will hybridize. For example, an antisense nucleic acid in which 18 of 20 nucleotides of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleotides may be clustered or interspersed with complementary nucleotides and need not be contiguous to each other or to complementary nucleotides. Percent complementarity between particular stretches of nucleic acid sequences within nucleic acids can be determined using any convenient method. Example methods include BLASTprograms (basic local alignment search tools) and PowerBLAST programs (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656), the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), e.g., using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489), and the like.

[0030] As used herein, a first molecule “specifically binds’’ or “preferentially binds” or “targets” another molecule if it binds with greater affinity, avidity, more readily, and / or with greater duration than it binds to other substances, e.g., in a sample, in a cell, etc. In some embodiments, a first molecule “specifically binds” or “targets” if it binds to or associates with the target molecule with an affinity or Ka (that is, an association rate constant of a particular binding interaction with units of 1 / M) of, for example, greater than or equal to about 105 M-1. In certain embodiments, the first molecule binds with a Ka greater than or equal to about 106 M-1 , 107 M-1 , 108 M-1 , 109 M-1 , 1010 M-1 , 1011 M-1 , 1012 M-1 , or 1013 M-1. Alternatively, affinity may be defined as an equilibrium dissociation constant (KD) of a particular binding interaction with units of M (e.g., 10-5 M to 10-13 M, or less). In some aspects, specific binding means the targeting moiety binds to the target molecule with a KD of less than or equal to about 10-5 M, less than or equal to about 10-6 M, less than or equal to about 10-7 M, less than or equal to about 10-8 M, or less than or equal to about 10-9 M, 10-10 M, 10-11 M, or 10-12 M or less. The binding affinity of a first molecule for a target molecule can be readily determined using conventional techniques, e.g., by competitive ELISA (enzyme-linked immunosorbent assay), equilibrium dialysis, by using surface plasmon resonance (SPR) technology (e.g., the BIAcore 2000 or BIAcore T200 instrument, using general procedures outlined by the manufacturer); by radioimmunoassay; or the like. The term “targets” can also be used to describe complementarity between nucleic acid molecules. As a non-limiting example, an siRNA that hybridizes with a target mRNA (preferentially hybridizes to the target mRNA over other mRNAs to decrease expression levels of the protein encoded by the target mRNA) can be said to “target” that mRNA.

[0031] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones. Polypeptides as described herein also include polypeptides having various amino acid additions,deletions, or substitutions relative to the amino acid sequence of a polypeptide of the present disclosure. In some embodiments, polypeptides that are homologs of a polypeptide of the present disclosure contain non-conservative changes of certain amino acids relative to the native sequence of a polypeptide of the present disclosure. In some embodiments, polypeptides that are homologs of a polypeptide of the present disclosure contain conservative changes of certain amino acids relative to the native sequence of a polypeptide of the present disclosure, and thus may be referred to as conservatively modified variants. A conservatively modified variant may include individual substitutions, deletions or additions to a polypeptide sequence which result in the substitution of an amino acid with a chemically similar amino acid.Conservative substitution tables providing functionally similar amino acids are well- known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the disclosure. The following eight groups contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)). A modification of an amino acid to produce a chemically similar amino acid may be referred to as an analogous amino acid.

[0032] A polynucleotide or polypeptide has a certain percent "sequence identity" to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same, and in the same relative position, when comparing the two sequences. Sequence identity can be determined in a number of different ways. To determine sequence identity, sequences can be aligned using various convenient methods and computer programs (e.g., BLAST, T-COFFEE, MUSCLE, MAFFT, etc.), available over the world wide web at sites including ncbi.nlm.nili.gov / BLAST, ebi .ac. uk / T ools / msa / tcoffee / , ebi . ac. uk / T ools / msa / muscle / , mafft.cbrc.jp / alignment / software / . See, e.g., Altschul et al. (1990), J. Mol. Bioi. 215:403-10.

[0033] A DNA sequence that "encodes" a particular RNA is a DNA nucleotide sequence that is transcribed into RNA. A DNA polynucleotide may encode an RNA (mRNA) that is translated into protein (and therefore the DNA and the mRNA both encode the protein), or a DNA polynucleotide may encode an RNA that is not translated intoprotein (i.e., a non-coding RNA (ncRNA) such as, e.g. a tRNA, an rRNA, an siRNA, a microRNA (miRNA), a guide RNA, and the like).

[0034] A "protein coding sequence" or a sequence that encodes a particular protein or polypeptide, is a nucleotide sequence that is transcribed into mRNA (in the case of DNA) and is translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences.

[0035] The terms "DNA regulatory sequences," "control elements," and "regulatory elements," used interchangeably herein, refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, and the like, that provide for and / or regulate transcription of a non-coding sequence (e.g., siRNA) or a coding sequence and / or regulate translation of an encoded polypeptide.

[0036] A cell has been “genetically modified” or "transformed" or "transfected" by exogenous DNA or exogenous RNA when such DNA or RNA has been introduced inside the cell. The presence of the exogenous DNA or RNA results in permanent or transient genetic change. Transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones that comprise a population of daughter cells containing the transforming DNA. A "clone" is a population of cells derived from a single cell or common ancestor by mitosis. A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations.

[0037] “Pharmaceutically effective amount” and “therapeutically effective amount” refer to an amount of a compound sufficient to treat a specified disorder or disease or one or more of its symptoms and / or to prevent the occurrence of the disease or disorder. In reference to tumorigenic proliferative disorders, a pharmaceutically or therapeutically effective amount comprises an amount sufficient to, among other things, cause the tumor to shrink or decrease the growth rate of the tumor.

[0038] The terms “patient”, “individual”, and “subject” refer to human and non-human subjects, especially mammalian subjects, including, but not limited to, human and non-human primates, including simians and humans; mammalian sport animals (e.g.,horses); mammalian farm animals (e.g., sheep, goats, etc.); mammalian pets (dogs, cats, etc.); and rodents (e.g., mice, rats, etc.).

[0039] The term “treating” or “treatment” as used herein means the treating or treatment of a disease or medical condition in a patient, such as a mammal (particularly a human) that includes: (a) preventing the disease or medical condition from occurring, such as, prophylactic treatment of a subject; (b) ameliorating the disease or medical condition, such as, eliminating or causing regression of the disease or medical condition in a patient; (c) suppressing the disease or medical condition, for example by, slowing or arresting the development of the disease or medical condition in a patient; or (d) alleviating a symptom of the disease or medical condition in a patient.

[0040] As used herein the term “isolated” is meant to describe a compound of interest that is in an environment different from that in which the compound naturally occurs. “Isolated” is meant to include compounds that are within samples that are substantially enriched for the compound of interest and / or in which the compound of interest is partially or substantially purified. For example, an "isolated" plasmid, nucleic acid, vector, virus, virion, host cell, or other substance refers to a preparation of the substance devoid of at least some of the other components present where the substance or a similar substance naturally occurs or from which it is initially prepared. Thus, for example, an isolated substance may be prepared by using a purification technique to enrich it from a source mixture. Enrichment can be measured on an absolute basis, such as weight per volume of solution, or it can be measured in relation to a second, potentially interfering substance present in the source mixture. Increasing enrichments of the embodiments of this invention are increasingly more isolated. An isolated plasmid, nucleic acid, vector, virus, host cell, or other substance is in some embodiments purified, e.g., from about 80% to about 90% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or at least about 99%, or more, pure.

[0041] As used herein, the term “substantially purified” refers to a compound that is removed from its natural environment and is at least 60% free, at least 75% free, at least 80% free, at least 85% free, at least 90% free, at least 95% free, at least 98% free, or more than 98% free, from other components with which it is naturally associated.

[0042] The term “physiological conditions” is meant to encompass those conditions compatible with living cells, e.g., predominantly aqueous conditions of a temperature, pH, salinity, etc. that are compatible with living cells.

[0043] The terms "pharmaceutically acceptable", "physiologically acceptable", and “pharmaceutical composition” refer to a biologically acceptable formulation, gaseous, liquid or solid, or mixture thereof, suitable for one or more routes of administration, in vivo delivery or contact A "pharmaceutically acceptable" or "physiologically acceptable" composition (or simply “pharmaceutical composition”) is a material that is not biologically or otherwise undesirable, e.g., the material may be administered to a subject without causing substantial undesirable biological effects.

[0044] The phrase a "unit dosage form" as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity optionally in association with a pharmaceutical carrier (excipient, diluent, vehicle or filling agent) which, when administered in one or more doses, produces a desired effect (e.g., prophylactic or therapeutic effect). In some embodiments, unit dosage forms may be within, for example, ampules and vials, including a liquid composition, or a composition in a freeze-dried or lyophilized state; a sterile liquid carrier, for example, can be added prior to administration or delivery in vivo. Individual unit dosage forms can be included in multi-dose kits or containers. Compositions of the disclosure, including pharmaceutical compositions, can be packaged in single or multiple unit dosage form for ease of administration and uniformity of dosage.

[0045] A "therapeutically effective amount" will fall in a relatively broad range determinable through experimentation and / or clinical trials. Effective dosages can be readily established by one of ordinary skill in the art through routine trials establishing dose response curves.

[0046] An "effective amount" or "sufficient amount" refers to an amount providing, in single or multiple doses, alone or in combination, with one or more other compositions (therapeutic agents such as a drug), treatments, protocols, or therapeutic regimens agents (including, for example, vaccine regimens), a detectable response of any duration of time (long or short term), an expected or desired outcome in or a benefit to a subject of any measurable or detectable degree or for any duration of time (e.g., for minutes, hours, days, months, years, or cured). The doses of an "effective amount" or "sufficient amount" for treatment (e.g., to ameliorate or to provide a therapeutic benefit or improvement) typically are effective to provide a response to one, multiple or all adverse symptoms, consequences or complications of the disease, one or more adverse symptoms, disorders, illnesses, pathologies, or complications, for example, caused by or associated with the disease, to a measurable extent, althoughdecreasing, reducing, inhibiting, suppressing, limiting or controlling progression or worsening of the disease is also a satisfactory outcome.

[0047] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0048] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0049] Certain ranges are presented herein with numerical values being preceded by the term "about." The term "about" is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number.

[0050] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, representative illustrative methods and materials are now described.

[0051] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the datesof publication provided may be different from the actual publication dates which may need to be independently confirmed.

[0052] It is noted that, as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. As such, the articles “a” and “an” are used herein to refer to one or to more than one (i . e. , to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element. Thus, for example, reference to “a cell” includes a plurality of such cells and reference to “the polypeptide” includes reference to one or more polypeptides and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.

[0053] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method can be carried out in the order of events recited or in any other order which is logically possible. For example, it is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.

[0054] While the apparatus and method has or will be described for the sake of grammatical fluidity with functional explanations, it is to be expressly understood that the claims, unless expressly formulated under 35 U.S.C. §112, are not to be construed as necessarily limited in any way by the construction of "means" or "steps" limitations, but are to be accorded the full scope of the meaning and equivalents of the definition provided by the claims under the judicial doctrine of equivalents, and in the casewhere the claims are expressly formulated under 35 U.S.C. §112 are to be accorded full statutory equivalents under 35 U.S.C. §112.V. DETAILED DESCRIPTIONLibrary of nucleic acids

[0055] As noted above, provided are methods and compositions for screening nucleic acid delivery vehicles (e g., liquid nanoparticle (LNP) formulations). For example, provided is a library of nucleic acid delivery vehicles with different chemical compositions. The members of the library (i.e., the nucleic acid delivery vehicles) are barcoded by virtue of including a barcoded RNA molecule. Each unique barcode sequence can therefore be said to identify the chemical composition of the nucleic acid delivery vehicle of which it is part.

[0056] The barcoded RNA molecule includes a first ribozyme, a second ribozyme, and a barcode sequence between the first and second ribozymes. In other words, the barcoded RNA molecule includes, from 5’ to 3’: (i) a first ribozyme, (ii) a barcode sequence that identifies the chemical composition of the nucleic acid delivery vehicle, and (iii) a second ribozyme.

[0057] Because the barcoded RNA molecules of the present disclosure include first and second ribozymes capable of cleaving the barcoded RNA molecule to produce a 5’- OH end and a 2’,3’-cyclic phosphate end (also referred to herein as a “3’-PO” for the purposes of the present disclosure), a subject barcoded RNA molecule may be processed to comprise a 5’-OH end and a 2’,3’-cyclic phosphate end. Such processing can be carried out by the RNA molecule itself, e.g., via the ribozymes. As such, in some instances, the RNA molecules of the present disclosure are linear (i.e., have a 5’ end and a 3’ end). After cleavage by the ribozymes, the RNA molecules will be linear with a 5’-OH end and a 2’,3’-cyclic phosphate end. In other instances, the RNA molecules of the present disclosure are further processed by a ligase to form circular RNA (i.e., RNA having no 5’ end or 3’ end).

[0058] For example, a subject barcoded RNA molecule can be delivered to a cell, but the ribozymes will not cleave until after entry into the cell. Without wishing to be bound by theory, it is believed that the ribozymes are not active inside of the cell until they are inside of an endosome, which includes the proper concentration of divalent cation (e.g., manganese (Mn2+)). After cleavage by the ribozymes to produce a 5’-OH end and a 2’,3’-cyclic phosphate end, and after endosomal escape, an intracellular RNA ligase (e.g., RtcB) then circularizes the molecule in the cytoplasm. RtcB is not presentin all organisms, but molecules with similar activities are present. In other words, there are molecules that ligate ends similar to the ligation activity of RtcB. RtcB (or other functionally similar molecules) may be overexpressed to maximize circular RNA if so desired.

[0059] The presence of a circularized version of a subject barcoded RNA molecule (one that includes the barcode sequence), which is referred to herein as a “circular RNA” or “cRNA”, indicates successful delivery of the parent barcoded RNA molecule to the cell via a given nucleic acid delivery vehicle. Because the barcode sequence identifies the chemical composition of the given nucleic acid delivery vehicle that was used, the presence of a cRNA with a given barcode indicates that the associated nucleic acid delivery vehicle is a successful vehicle.

[0060] As such, the barcoded RNA molecule has the ability to auto-process (auto-cleave) and thereby become a substrate for an RNA ligase, particularly the RNA ligase RtcB. Thus, in some cases, the RNA ligase is RtcB. In accordance with such embodiments, a linear RNA molecule having a 5’-OH end and a 2’,3’-cyclic phosphate end can be processed to form a circular RNA molecule.

[0061] As noted above, in some embodiments, a barcoded ligation-ready RNA molecule (e.g., of a subject library) is used. A barcoded ligation-ready RNA molecule does not include a first or second ribozyme (i.e. , it lacks a ribozyme) because it already includes a 5’-OH end and a 2’,3’-cyclic phosphate end, which can be ligated to one another by an intracellular RNA ligase (e.g., RtcB) to produce a circular RNA (cRNA) that includes the barcode sequence. Such barcoded ligation-ready RNA molecules can be generated synthetically (e.g., using chemical synthesis, e.g., using a nucleic acid synthesizer). Such barcoded ligation-ready RNA molecules can also be generated by starting with molecules that do include a first and a second ribozyme, and then activating the ribozymes, e.g., in vitro (to generate the 5’-OH and 2’,3’-cyclic phosphate termini), prior to incorporating the barcoded RNAs as part of a subject library (a library of nucleic acid delivery vehicles).

[0062] The RNA molecule of the present disclosure may circularize. For example, after it is acted upon by the RNA ligase, there are no termini, because all nucleotides are contiguously connected by covalent bonds. In some cases, 5’ and 3’ ends are no longer present due to the activity of the RNA ligase. Circular RNA means that the RNA has no observable end. Some RNA circles have unusual 5’ to 2’ linkages and not 5’ to 3’ linkages.

[0063] A subject library has 3 or more members (nucleic acid delivery vehicles with different chemical compositions). In some embodiments, a subject library has 5 or more members (e.g., 8 or more, 10 or more, 20 or more, 50 or more, 100 or more, 250 or more, or 500 or more members). In some cases, a subject library has 3-10,000 members (e.g., 3-8,000, 3-5,000, 3-2,500, 3-1 ,000, 3-500, 3-300, 3-200, 3-100, 3-50, 3-20, 5-10,000, 5-8,000, 5-5,000, 5-2,500, 5-1 ,000, 5-500, 5-300, 5-200, 5-100, 5-50, 5-20, 10-10,000, 10-8,000, 10-5,000, 10-2,500, 10-1,000, 10-500, 10-300, 10-200, IQ- 100, 10-50, 10-20, 20-10,000, 20-8,000, 20-5,000, 20-2,500, 20-1 ,000, 20-500, 20- 300, 20-200, 20-100, 20-50, 20-20, 8-10,000, 8-8,000, 8-5,000, 8-2,500, 8-1 ,000, 8- 500, 8-300, 8-200, 8-100, 8-50, 8-20, 50-10,000, 50-8,000, 50-5,000, 50-2,500, 50- 1 ,000, 50-500, 50-300, 50-200, 50-100, 50-50, or 50-20 members). In some cases, a subject library has 5-100 members. In some cases, a subject library has 5-50 members. In some cases, a subject library has 5-20 members.

[0064] For more information related to circularized RNAs (cRNAs) and their production, e.g., the use of ribozymes and ligase to produce cRNAs, see, e.g., Tong et al., Nat Biomed Eng. 2024 Aug 26; Katrekar et al., Nat Biotechnol. 2022 Jun;40(6):938-945; and Litke et al., Nat Biotechnol. 2019 Jun;37(6):667-675; as well as US Patent No. 11756183 and US Patent application publications US20230036370, all of which are incorporated herein by reference for such disclosures.Ribozymes

[0065] The first and second ribozymes are capable of cleaving the barcoded RNA molecule to produce a 5’-OH end and a 2’,3’-cyclic phosphate end that can be ligated to one another by an RNA ligase to produce a circular RNA (cRNA) comprising said barcode sequence.

[0066] Information related to ribozymes suitable for use in a subject barcoded RNA molecule (i.e., a barcoded RNA molecule of the present disclosure) can be found, e.g., in US Patent No. 11 ,756,183, which is incorporated by reference herein in its entirety. As used herein, the term “ribozyme” refers to an RNA sequence that hybridizes to a complementary sequence in a substrate RNA and cleaves the substrate RNA in a sequence specific manner at a substrate cleavage site. Typically, a ribozyme contains a catalytic region flanked by two binding regions. The ribozyme binding regions hybridize to the substrate RNA, while the catalytic region cleaves the substrate RNA at a substrate cleavage site to yield a cleaved RNA product. The nucleotide sequenceof the ribozyme binding regions may be completely complementary or partially complementary to the substrate RNA sequence with which the ribozyme hybridizes.

[0067] A subject barcoded RNA molecule includes sequences that may be cleaved by the first and second ribozymes to produce a 5’-OH end and a 2’,3’-cyclic phosphate end. In other words, a subject barcoded RNA molecule includes sequences that render it a substrate for cleavage by the first and second ribozymes, thus resulting in a 5’-OH end and a 2’,3’-cyclic phosphate end. As such, the ribozymes can be considered selfcleaving ribozymes because they cleave the RNA molecule of which they are a part. As such, each of the first ribozyme and the second ribozyme of a subject barcoded RNA molecule can be considered self-cleaving ribozymes. In some embodiments, each of the first ribozyme and the second ribozyme comprise the sequence that may be cleaved to produce a 5’-OH end and a 2’,3’-cyclic phosphate end, respectively.

[0068] Self-cleaving ribozymes are known in the art and are characterized by distinct active site architectures and divergent, but similar, biochemical properties. The cleavage activities of self-cleaving ribozymes are highly dependent upon divalent cations, pH, and base-specific mutations, which can cause changes in the nucleotide arrangement and / or electrostatic potential around the cleavage site (see, e.g., Weinberg et al., “New Classes of Self-Cleaving Ribozymes Revealed by Comparative Genomics Analysis,” Nat. Chem. Biol. 11 (8): 606-610 (2015) and Lee et al., “Structural and Biochemical Properties of Novel Self-Cleaving Ribozymes,” Molecules 22(4): E678 (2017), which are hereby incorporated by reference in their entirety).

[0069] Suitable self-cleaving ribozymes include, but are not limited to, Hammerhead, Hairpin, Hepatitis Delta Virus (“HDV”), Neurospora Varkud Satellite (“VS”), Vg1, glucosamine- 6-phosphate synthase(glmS), Twister, Twister Sister, Hatchet, Pistol, and engineered synthetic ribozymes, and derivatives thereof (see, e.g., Harris et al., “Biochemical Analysis of Pistol Self-Cleaving Ribozymes,” RNA 21(11):1852-8 (2015), which is hereby incorporated by reference in its entirety). Thus, in some cases, the first and second ribozymes can independently include: a Hammerhead ribozyme, a Hairpin ribozyme, a Hepatitis Delta Virus (“HDV”) ribozyme, a Varkud Satellite (“VS”) ribozyme, a Vg1 ribozyme, a glucosamine-6-phosphate synthase (“glmS”) ribozyme, a Twister ribozyme, a Twister Sister ribozyme, a Hatchet ribozyme, a Pistol ribozyme, an engineered synthetic ribozyme, or derivatives thereof. In some cases, the first and second ribozymes can independently include: a RNase P, a rRNA (such as a Peptidyl transferase 23S rRNA), a Leadzyme, a Group I intron ribozyme, a Group II intron ribozyme, or a GIR1 branching ribozyme, or derivatives thereof.

[0070] Twister ribozymes comprise three essential stems (P1, P2, and P4), with up to three additional optional stems (P0, P3, and P5). Three different types of Twister ribozymes have been identified depending on whether the termini are located within stem P1 (type P1), stem P3 (type P3), or stem P5 (type P5) (see, e.g., Roth et al., “A Widespread Self-Cleaving Ribozyme Class is Revealed by Bioinformatics,” Nature Chem. Biol. 10(1):56-60 (2014)). The fold of the Twister ribozyme is predicted to comprise two pseudoknots (T1 and T2, respectively), formed by two long-range tertiary interactions (see Gebetsberger et al., “Unwinding the Twister Ribozyme: from Structure to Mechanism,” WIRES RNA 8(3):e1402 (2017), which is hereby incorporated by reference in its entirety).

[0071] On example of a Twister ribozyme sequence is: GCCAUCAGUCGCCGGUCCCAAGCCCGGAUAAAAUGGGAGGGGGCGGGAAACC GCCUAACCAUGCCGACUGAUGGCAGAAAAAAAAAA (SEQ ID NO: 1) (see, e.g., FIG. 5 and FIG. 6).

[0072] Another example of a Twister ribozyme RNA sequence is: AAAAAAAAAACUGCCAUCAGUCGGCGUGGACUGUAGAACACUGCCAAUGCCGG UCCCAAGCCCGGAUAAAAGUGGAGGGUACAGUCCACGC (SEQ ID NO: 2) (see, e.g., FIG. 5 and FIG. 6).

[0073] In some cases, one of the ribozymes comprises SEQ ID NO: 1 and the other comprises SEQ ID NO: 2. In some cases, the first ribozyme comprises SEQ ID NO: 1 and the second ribozyme comprises SEQ ID NO: 2. In some cases, the first and second ribozymes are each independently selected from SEQ ID NO: 1 and SEQ ID NO: 2.

[0074] Twister Sister ribozymes are similar in sequence and secondary structure to Twister ribozymes. In particular, some Twister RNAs have P1 through P5 stems in an arrangement similar to Twister Sister and similarities in the nucleotides in the P4 terminal loop exist. However, these two ribozyme classes cleave at different sites, Twister Sister ribozymes do not appear to form pseudoknots via Watson-Crick base pairing (which occurs in all known twister ribozymes), and there is poor correspondence among many of the most highly conserved nucleotides in each of these two motifs (see Weinberg et al., “New Classes of Self-Cleaving Ribozymes Revealed by Comparative Genomics Analysis,” Nat. Chem. Biol. 11(8):606-610 (2015), which is hereby incorporated by reference in its entirety).

[0075] Pistol ribozymes are characterized by three stems: P1 , P2, and P3, as well as a hairpin and internal loops. A six-base-pair pseudoknot helix is formed by twocomplementary regions located on the P1 loop and the junction connecting P2 and P3; the pseudoknot duplex is spatially situated between stems P1 and P3 (Lee et al., “Structural and Biochemical Properties of Novel Self-Cleaving Ribozymes,” Molecules 22(4): E678 (2017), which is hereby incorporated by reference in its entirety).

[0076] Hammerhead ribozymes are composed of structural elements including three helices, referred to as stem I, stem II, and stem III, and joined at a central core of 11-12 single strand nucleotides. Hammerhead ribozymes may also contain loop structures extending from some or all of the helices. These loops are numbered according to the stem from which they extend (e.g., loop I, loop II, and loop III).

[0077] In some cases, the first ribozyme is a Twister ribozyme or a Twister Sister ribozyme. For example, the first ribozyme may be a P3 Twister ribozyme. In some cases, the second ribozyme is a Twister, Twister Sister, or Pistol Ribozyme. For example, the second ribozyme may be a P1 Twister ribozyme.

[0078] In some cases, the first ribozyme is a P3 Twister ribozyme and the second ribozyme is a P1 Twister ribozyme.

[0079] The ribozymes of the present disclosure include naturally-occurring (wildtype) ribozymes and modified ribozymes, e.g., ribozymes containing one or more modifications, which can be addition, deletion, substitution, and / or alteration of at least one (or more) nucleotide. Such modifications may result in the addition of structural elements (e.g., a loop or stem), lengthening or shortening of an existing stem or loop, changes in the composition or structure of a loop(s) or a stem(s), or any combination of these. As described herein, modification of the nucleotide sequence of naturally occurring self-cleaving ribozymes (e.g., a P3 Twister ribozyme) can increase or decrease the ability of a ribozyme to autocatalytically cleave its RNA. In some cases, each of the first and the second ribozyme is, independently, modified to comprise a non-natural or modified nucleotide. In some embodiments, each of the first and the second ribozyme is modified to comprise pseudouridine in place of uridine.

[0080] In another embodiment, each of the first and the second ribozyme is, independently, a split ribozyme or ligand-activated ribozyme derivative.

[0081] In some cases, a subject barcoded RNA molecule further includes first and second ligation sequences. As used herein, the phrase “ligation sequence” refers to a sequence complementary to another sequence, which enables the formation of Watson-Crick base pairing to form suitable substrates for ligation by a ligase, e.g., an RNA ligase. The purpose of the ligation sequence is to assist in circularization of the RNA molecule. While subject barcoded RNA molecules can circularize without ligationsequences, the ligation sequences can in some cases be used to increase efficiency of the ends coming together for the RNA ligase (e.g., RtcB). In other words, the ligation sequences can in some cases help draw the 5’ and 3’ ends of the RNA molecule closer to each other to assist in the circularization of the RNA molecule. The first ligation sequence and the second ligation sequence may each, independently, include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, or 15 nucleotides to promote basepairing with each other.Barcodes

[0082] The term “barcode sequence” or “molecular barcode” or simply “barcode”, as used herein, refers to a unique sequence of nucleotides (unique to the barcode and optionally a sequence of nucleotides common to other barcodes) used to identify and / or track the source of a polynucleotide (e.g., within a library of nucleic acids). For example, each member of a subject library that has a particular chemical composition can have a barcoded RNA molecule that has a barcode sequence unique to that particular chemical composition. As such, the barcode is paired / corresponds to the chemical composition of the delivery vehicle formulation, sequencing the barcode can be used to identify the chemical composition used to produce that specific nucleic acid delivery vehicle. In some cases, the barcoded RNA molecule includes primer site(s) (e.g., universal primer sites) upstream and / or downstream of the barcode. In some cases, e.g., the barcode sequence is flanked by upstream and downstream primer sites (e.g., universal primer sites).

[0083] A barcode sequence is present in a subject barcoded RNA molecule between the ribozyme sequences such that after circularization from auto-cleavage (by the ribozymes) and ligation (by an intracellular ligase), the barcode sequence will be present in the cRNA. A barcode sequence is also present between the 5’-OH end and the 2’,3’-cyclic phosphate end prior to circularization. In some embodiments, a barcoded ligation-ready RNA molecule is used, in which case the barcode sequence is present between the 5’-OH end and the 2’,3’-cyclic phosphate end.

[0084] Barcode sequences may vary widely in size and composition; the following references provide guidance for selecting sets of barcode sequences appropriate for particular embodiments: Brenner, U.S. Pat. No. 5,635,400; Brenner et al, Proc. Natl. Acad. Sci., 97: 1665-1670 (2000); Shoemaker et al, Nature Genetics, 14: 450-456 (1996); Morris et al, European patent publication 0799897A1 ; Wallace, U.S. Pat. No. 5,981 ,179; and the like.

[0085] In some embodiments, a barcode sequence has a length of 5-100 nucleotides (nt) (e.g., 5-90, 5-80, 5-70, 5-60, 5-50, 5-40, 5-35, 5-30, 5-25, 5-20, 5-15, 8-100, 8-90, 8- 80, 8-70, 8-60, 8-50, 8-40, 8-35, 8-30, 8-25, 8-20, 8-15, 10-100, 10-90, 10-80, 10-70, 10-60, 10-50, 10-40, 10-35, 10-30, 10-25, 10-20, 10-15, 12-100, 12-90, 12-80, 12-70,12-60, 12-50, 12-40, 12-35, 12-30, 12-25, 12-20, 12-15, 15-100, 15-90, 15-80, 15-70,15-60, 15-50, 15-40, 15-35, 15-30, 15-25, 15-20, 18-100, 18-90, 18-80, 18-70, 18-60,18-50, 18-40, 18-35, 18-30, 18-25, 18-20, 20-100, 20-90, 20-80, 20-70, 20-60, 20-50,20-40, 20-35, 20-30, or 20-25 nt). In some embodiments, a barcode sequence has a length of 5-40 nucleotides (nt) (e.g., 5-35, 5-30, 5-25, 5-20, 5-15, 8-40, 8-35, 8-30, 8- 25, 8-20, 8-15, 10-40, 10-35, 10-30, 10-25, 10-20, 10-15, 12-40, 12-35, 12-30, 12-25, 12-20, 12-15, 15-40, 15-35, 15-30, 15-25, 15-20, 18-40, 18-35, 18-30, 18-25, 18-20, 20-40, 20-35, 20-30, or 20-25 nt). In some cases, a barcode sequence has a length of 6-30 nt. In some cases, a barcode sequence has a length of 8-30 nt. In some cases, a barcode sequence has a length of 8-20 nt. In some cases, a barcode sequence has a length of 10-25 nt. In some embodiments, a barcode sequence has a length of 5 or more nt (e.g., 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, or 12 or more nt). In some embodiments, a barcode sequence has a length of 8 or more nt.

[0086] The barcoded RNA molecule (which includes the barcode) can be covalently or non- covalently attached to the nucleic acid delivery vehicle. In some embodiments, the barcoded RNA molecule is encapsulated by the nucleic acid delivery vehicle (e.g., in some cases in which the nucleic acid delivery vehicle is an LNP).

[0087] For additional information related to barcodes, see, e.g., US Patent Application Publication NO. 20200330607, which is incorporated herein by reference for such disclosure.Modified Nucleic Acids

[0088] In some embodiments, a subject barcoded RNA molecule has one or more modifications (e.g., one or more base modifications, one or more backbone modifications (e.g., one or more modified internucleoside linkages), one or more mimetics, one or more modified sugar moieties, and the like). In some cases, such modifications can, e.g., provide the nucleic acid with a new or enhanced feature (e.g., improved stability).

[0089] For example, in some cases, one or more sugar moieties is 2'-modified. As used herein, the term “2'-modified” or “2'-substituted” means a sugar comprising asubstituent at the 2'-position other than H or OH. 2'-modified nucleotides, include one or more moieties with 2' substituents - examples include, but are not limited to: alkyl, allyl, amino, azido, fluoro, thio, O-alkyl, e.g., O-methyl, O-allyl, OCF3, O-(CH2)2-O-CH3(e.g., 2'-O-methoxyethyl (MOE)), O-(CH2)2SCH3, )-(CH2)2-ONR2, and O-CH2C(O)-NR2, where each R is independently selected from H, alkyl, and substituted alkyl.

[0090] Suitable nucleic acid modifications include, but are not limited to: 2’-O-methyl modified nucleotides, 2’ fluoro modified nucleotides, locked nucleic acid (LNA) modified nucleotides, peptide nucleic acid (PNA) modified nucleotides, nucleotides with phosphorothioate linkages, and a 5’ cap (e.g., a 7-methylguanylate cap (m7G)). Additional details and additional modifications are described below.

[0091] LNA bases have a modification to the ribose backbone that locks the base in the C3'- endo position, which favors RNAA-type helix duplex geometry. This modification significantly increases Tm and is also very nuclease resistant. Multiple LNA insertions can be placed in an oligo at any position except the 3'-end. Applications have been described ranging from antisense oligos to hybridization probes to SNP detection and allele specific PCR. Due to the large increase in Tm conferred by LNAs, they also can cause an increase in primer dimer formation as well as self-hairpin formation. In some cases, the number of LNAs incorporated into a single oligo is 10 bases or less.

[0092] The phosphorothioate (PS) bond (i.e., a phosphorothioate linkage) substitutes a sulfur atom for a non-bridging oxygen in the phosphate backbone of a nucleic acid (e.g., an oligo). This modification renders the internucleotide linkage resistant to nuclease degradation. Phosphorothioate bonds can be introduced between the last 3-5 nucleotides at the 5'- or 3'-end of the oligo to inhibit exonuclease degradation. Including phosphorothioate bonds within the oligo (e.g., throughout the entire oligo) can help reduce attack by endonucleases as well.

[0093] In some cases, subject barcoded RNA molecule has one or more nucleotides that are 2'-O-Methyl modified nucleotides. In some cases, subject barcoded RNA molecule has one or more 2’ Fluoro modified nucleotides. In some cases, subject barcoded RNA molecule has one or more LNA bases. In some cases, subject barcoded RNA molecule has one or more nucleotides that are linked by a phosphorothioate bond (i.e., the subject nucleic acid has one or more phosphorothioate linkages). In some cases, subject barcoded RNA molecule has a combination of modified nucleotides.Modified backbones and modified internucleoside linkages

[0094] Examples of suitable nucleic acids (e.g., a barcoded RNA molecule) containing modifications include nucleic acids containing modified backbones or non-natural internucleoside linkages. Nucleic acids having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.

[0095] Suitable modified nucleic acid backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, phosphorodiamidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Suitable oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'- most internucleotide linkage i.e. a single inverted nucleoside residue which may be a basic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts (such as, for example, potassium or sodium), mixed salts and free acid forms are also included. Nucleoside subunits can be joined by a variety of intersubunit linkages, including, but not limited to, phosphodiester, phosphotriester, an alkylphosphonate, e.g., methylphosphonate, P3'^N5' phosphoramidate, N31— >P5’ phosphoramidate, N3'— >P5' thiophosphoramidate, phosphorodiamidate, and phosphorothioate linkages. In certain cases, intersubunit linkage has a chiral atom. Representative chiral intersubunit linkages include, but are not limited to, alkylphosphonates, phosphorodiamidates and phosphorothioates. Further, “oligonucleotides” includes chemical and biochemical modifications, such as those known to one skilled in the art, e.g., to the sugar (e.g., 2' substitutions), the base (see the definition of “nucleoside” below), and / or the 3' and 5' termini. In embodiments where the oligonucleotide moiety includes a plurality of intersubunit linkages, each linkage may be formed using the same chemistry or a mixture of linkage chemistries may be used. In embodiments where the oligonucleotide moiety includes a plurality of intersubunit linkages, one or more of the linkages may be chiral. Linkages having a chiral atom can be prepared as racemic mixtures, or as separate enantiomers.

[0096] In some cases, a barcoded RNA molecule comprises one or more phosphorothioate and / or heteroatom internucleoside linkages, in particular -CH2-NH-O-CH2-, -CH2- N(CH3)-O-CH2- (known as a methylene (methylimino) or MMI backbone), -CH2-O- N(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and -O-N(CH3)-CH2-CH2- (wherein the native phosphodiester internucleotide linkage is represented as -O-P(=O)(OH)-O- CH2-). MMI type internucleoside linkages are disclosed in the above referenced U.S. Pat. No. 5,489,677, the disclosure of which is incorporated herein by reference in its entirety. Suitable amide internucleoside linkages are disclosed in U.S. Pat. No. 5,602,240, the disclosure of which is incorporated herein by reference in its entirety.

[0097] Also suitable are nucleic acids having morpholino backbone structures as described in, e.g., U.S. Pat. No. 5,034,506. For example, in some embodiments, a subject nucleic acid comprises a 6-membered morpholino ring in place of a ribose ring. In some of these embodiments, a phosphorodiamidate or other non-phosphodiester internucleoside linkage replaces a phosphodiester linkage.

[0098] Suitable modified polynucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.Mimetics

[0099] A subject barcoded RNA molecule can include a nucleic acid mimetic. The term "mimetic" as it is applied to polynucleotides is intended to include polynucleotides wherein only the furanose ring or both the furanose ring and the internucleotide linkage are replaced with non-furanose groups, replacement of only the furanose ring is also referred to in the art as being a sugar surrogate. The heterocyclic base moiety or a modified heterocyclic base moiety is maintained for hybridization with an appropriate target nucleic acid. One such nucleic acid, a polynucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptidenucleic acid (PNA). In PNA, the sugar-backbone of a polynucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleotides are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.

[0100] One polynucleotide mimetic that has been reported to have excellent hybridization properties is a peptide nucleic acid (PNA). The backbone in PNA compounds is two or more linked aminoethylglycine units which gives PNA an amide containing backbone. The heterocyclic base moieties are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that describe the preparation of PNA compounds include, but are not limited to: U.S. Pat. Nos. 5,539,082; 5,714,331 ; and 5,719,262, the disclosures of which are incorporated herein by reference in their entirety.

[0101] Another class of polynucleotide mimetic that has been studied is based on linked morpholino units (morpholino nucleic acid) having heterocyclic bases attached to the morpholino ring. A number of linking groups have been reported that link the morpholino monomeric units in a morpholino nucleic acid. One class of linking groups has been selected to give a non-ionic oligomeric compound. The non-ionic morpholino-based oligomeric compounds are less likely to have undesired interactions with cellular proteins. Morpholino-based polynucleotides are non-ionic mimics of oligonucleotides which are less likely to form undesired interactions with cellular proteins (Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510). Morpholino-based polynucleotides are disclosed in U.S. Pat. No. 5,034,506, the disclosure of which is incorporated herein by reference in its entirety. A variety of compounds within the morpholino class of polynucleotides have been prepared, having a variety of different linking groups joining the monomeric subunits.

[0102] A further class of polynucleotide mimetic is referred to as cyclohexenyl nucleic acids (CeNA). The furanose ring normally present in a DNA / RNA molecule is replaced with a cyclohexenyl ring. CeNA DMT protected phosphoramidite monomers have been prepared and used for oligomeric compound synthesis following classical phosphoramidite chemistry. Fully modified CeNA oligomeric compounds and oligonucleotides having specific positions modified with CeNA have been prepared and studied (see Wang et al., J. Am. Chem. Soc., 2000, 122, 8595-8602, the disclosure of which is incorporated herein by reference in its entirety). In general the incorporation of CeNA monomers into a DNA chain increases its stability of a DNA / RNA hybrid. CeNA oligoadenylates formed complexes with RNA and DNAcomplements with similar stability to the native complexes. The study of incorporating CeNA structures into natural nucleic acid structures was shown by NMR and circular dichroism to proceed with easy conformational adaptation.

[0103] A further modification includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 4' carbon atom of the sugar ring thereby forming a 2'-C,4'-C- oxymethylene linkage thereby forming a bicyclic sugar moiety. The linkage can be a methylene (-CH2-), group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2 (Singh et al., Chem. Commun., 1998, 4, 455-456, the disclosure of which is incorporated herein by reference in its entirety). LNA and LNA analogs display very high duplex thermal stabilities with complementary DNA and RNA (Tm=+3 to +10° C), stability towards 3'-exonucleolytic degradation and good solubility properties. Potent and nontoxic antisense oligonucleotides containing LNAs have been described (e.g., Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638, the disclosure of which is incorporated herein by reference in its entirety).

[0104] The synthesis and preparation of the LNA monomers adenine, cytosine, guanine, 5- methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (e.g., Koshkin et al., Tetrahedron, 1998, 54, 3607-3630, the disclosure of which is incorporated herein by reference in its entirety). LNAs and preparation thereof are also described in WO 98 / 39352 and WO 99 / 14226, as well as U.S. applications 20120165514, 20100216983, 20090041809, 20060117410, 20040014959, 20020094555, and 20020086998, the disclosures of which are incorporated herein by reference in their entirety.

[0105] A “bicyclic nucleic acid” or a “bridged nucleic acid” (BNA) refers to a modified RNA nucleotide where the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon, thereby forming a bicyclic ring system. BNA monomers can contain a five-membered, six-membered or a seven-membered bridge structure with a fixed 3'-endo conformation. Bridged nucleic acids include without limitation, locked nucleic acids (LNA), ethylene-bridged nucleic acids (ENA) and constrained ethyl (cEt).

[0106] A “bridge” refers to a chain of atoms or a valence bond connecting two bridgeheads, where a “bridgehead” is any skeletal atom of a ring system (e.g., the ribose ring system) which is bonded to three or more skeletal atoms (excluding hydrogen). In some embodiments, the bridge in a BNA has 7-12 ring members and 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Unless otherwise specified, a BNA is optionally substituted with one or more substituents, e.g., including, but notlimited to alkyl, substituted alkyl, alkoxy, substituted alkoxy, hydroxy, amino and halogen.

[0107] An “ethylene-bridged nucleic acid” (ENA) refers to an LNA modified RNA nucleotide where the ribose moiety is modified with an extra bridge containing two carbon atoms between the 2' oxygen and the 4' carbon (see, e.g., Morita et al., Bioorganic Medicinal Chemistry, 2003, 11(10), 2211-2226). Ethylene-bridged nucleic acids are also encompassed by the term “bicyclic nucleic acids” or “bridged nucleic acids” (BNA).

[0108] A “constrained ethyl (cEt)” refers to an LNA modified RNA nucleotide where the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon, wherein the carbon atom of the bridge includes a methyl group. In some cases, the cEt is (S)-constrained ethyl. In other cases, the cEt is (R)-constrained ethyl (see, e.g., Pallan et al., Chem. Commun. (Camb)., 2012, 48(66), 8195-8197). Constrained ethyl nucleic acids are also encompassed by the term “bicyclic nucleic acids” or “bridged nucleic acids” (BNA).Modified sugar moieties

[0109] A subject barcoded RNA molecule can include one or more substituted sugar moieties. Suitable polynucleotides comprise a sugar substituent group selected from: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C.sub.1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Particularly suitable are O((CH2)nO) mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON((CH2)nCH3)2, where n and m are from 1 to about 10. Other suitable polynucleotides comprise a sugar substituent group selected from: C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A suitable modification includes 2'-methoxyethoxy (2'-O-CH2 CH2OCH3, also known as 2'-O-(2-methoxyethyl) (or 2 -MOE or 2’-O-MOE-RNA) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504, the disclosure of which is incorporated herein by reference in its entirety) i.e., an alkoxyalkoxy group. A further suitable modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2group, also known as 2'-DMAOE, as described in examples hereinbelow, and 2'- dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl-amino-ethoxy- ethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH3)2.

[0110] Other suitable sugar substituent groups include methoxy (-O-CH3), aminopropoxy (-- O CH2 CH2 CH2NH2), allyl (-CH2-CH=CH2), -O-allyl (-0- CH2— CH=CH2) and fluoro (F). 2'-sugar substituent groups may be in the arabino (up) position or ribo (down) position. A suitable 2'-arabino modification is 2'-F. Similar modifications may also be made at other positions on the oligomeric compound, particularly the 3' position of the sugar on the 3' terminal nucleoside or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligomeric compounds may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.Base modifications and substitutions

[0111] A subject barcoded RNA molecule may include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C=C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5- substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F- adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7- deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(1 H- pyrimido(5,4-b)(1 ,4)benzoxazin-2(3H)-one), phenothiazine cytidine (1 H-pyrimido(5,4- b)(1 ,4)benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido(5,4-(b) (1 ,4)benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido(4,5-b)indol-2-one), pyridoindole cytidine (H- pyrido(3',2':4,5)pyrrolo(2,3-d)pyrimidin-2-one).

[0112] Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7- deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991 , 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993; the disclosures of which are incorporated herein by reference in their entirety. Certain of these nucleobases are useful for increasing the binding affinity of an oligomeric compound. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5- propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1 .2° C. (Sanghvi et al., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278; the disclosure of which is incorporated herein by reference in its entirety) and are suitable base substitutions, e.g., when combined with 2'-O-methoxyethyl sugar modifications.Delivery Vehicles

[0113] Many different types of nucleic delivery vehicles will be known to one of ordinary skill in the art, and any convenient nucleic delivery vehicle can be used. In some embodiments, a delivery vehicle is a nanoparticle. In some embodiments, a delivery vehicle is a lipid nanoparticle (LNP) (e.g., liposome, micelle, asymmetric liposome particle (ALP), solid lipid nanoparticle (SLN), stable nucleic acid lipid particle (SNALP), and the like). Examples of nucleic delivery vehicles include, but are not limited to: nanoparticles (e.g., LNPs), viruses (e.g., AAV), and virus like particles (VLPs). A subject library of nucleic delivery vehicles can include various formulations of a given class of delivery vehicle (e.g., LNPs, viruses, VLPs, etc.), e.g., having different amounts / ratios of various components (e.g., different amounts and / or ratios of the lipids of an LNP) such that the various amounts / ratios can be tested (e.g., in some cases simultaneously) for delivery.

[0114] In some embodiments, a subject nucleic acid delivery vehicle is a virion (e.g., adeno- associated virus (AAV), lentivirus, retrovirus, parvovirus, adenovirus, and the like). For example, the members of the library may in some cases have different chemicalcompositions, e g., due to having different capsid protein sequences (e.g., different AAV capsids). Thus, as an illustrative non-limiting example, a library of viruses (e.g., AAVs) having different capsid proteins could be simultaneously screened for function (i.e. , ability to deliver a subject barcoded RNA molecule), and only those that are successful will lead to production of cRNA from the barcoded RNA molecule.

[0115] In some embodiments, the nucleic acid delivery vehicles of a subject library include virus-like particles (VLPs)(also known as enveloped delivery vehicles (EDVs)), which are natural or artificial nanostructures mimicking viruses but without enough viral genetic materials to support replication. For example, “VLP” refers to particles that self-assemble as a result of the expression of proteins encoding capsids, cores or envelops of viruses or even preparations of monolayered particles derived from a multilayered virus (see, e.g., Mohsen et al., Cell Mol Immunol 19, 993-1011 (2022); and He et al., Viruses. 2022 Aug 28; 14(9): 1905). EDVs can be produced using various combinations and ratios of proteins and / or nucleic acid components. As such, in some embodiments, the nucleic acid delivery vehicles of a subject library are EDVs.

[0116] In some embodiments, the nucleic acid delivery vehicles of a subject library include lipid nanoparticles (LNPs). As such, in some embodiments, the nucleic acid delivery vehicles of a subject library are LNPs.

[0117] In some embodiments, a delivery vehicle is a particulate delivery vehicle. In some embodiments, a delivery vehicle is conjugated to another molecule (e.g., a targeting moiety) - in which case the delivery vehicle can be said to comprise a targeting moiety.Nanoparticle Delivery Vehicles (e.g., lipid nanoparticles)

[0118] The following exemplary nucleic delivery vehicles can be used in the disclosed compositions and methods and include a subject barcoded RNA molecule.

[0119] In some embodiments, the delivery vehicle is a lipid nanoparticle, e.g., as described in Turnbull I C, et al. Methods Mol Biol. 2017 1521 :153-166, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicles is a polymerlipid nanoparticle, e.g., as described in Kaczmarek J C, et al. Angew Chem Int Ed Engl. 2016 55(44): 13808-13812, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a dendrimer-RNA nanoparticle, e.g., as described in Chahal J S, et al. Proc Natl Acad Sci USA. 2016 113(29) :E4133-42, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a poly(glycoamidoamine) brush, e.g., as described in Dong Y, et al.Nano Lett. 2016 16(2):842-8, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a lipid-like nanoparticle, e.g., as described in Eltoukhy A A, et al. Biomaterials. 2014 35(24): 6454-61 , which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a low- molecular-weight polyamines and lipid nanoparticle, e.g., as described in Dahlman J E, et al. Nat Nanotechnol. 2014 9(8):648-655, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a lipopeptide nanoparticle, e.g., as described in Dong Y, et al. Proc Natl Acad Sci USA. 2014 111 (11 ):3955-60, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a lipid-modified aminoglycoside derivative, e.g., as described in Zhang Y, et al. Adv Mater. 201325(33):4641-5, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a functional polyester, e.g., as described in Yan Y, et al. Proc Natl Acad Sci USA. 2016 113(39):E5702-10, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a degradable dendrimers, e.g., as described in Zhou K, et al. Proc Natl Acad Sci USA. 2016 113(3):520-5, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a lipocationic polyester, e.g., as described in Hao J, et al. J Am Chem Soc. 2015 137(29):9206-9, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a nanoparticle with a cationic cores and variable shell, e.g., as described in Siegwart D J, et al. Proc Natl Acad Sci USA. 2011 108(32):12996-3001 , which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is an amino-ester nanomaterial, e.g., as described in Zhang X, et al. ACS Appl Mater Interfaces. 2017 9(30):25481 -25487, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a polycationic cyclodextrin nanoparticle, e.g., as described in Zuckerman J E, et al. Nucleic Acid Ther. 2015 25(2):53-64, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a cyclodextrin-containing polymer conjugate of camptothecin, e.g., as described in Davis M E. Adv Drug Deliv Rev. 2009 61(13):1189-92, or Gaur S, et al. Nanomedicine. 2012 8(5):721-30, which are incorporated by reference for these teachings. In some embodiments, the delivery vehicle is an oligothioetheramide, e.g., as described in Sorkin M R, et al. Bioconjug Chem. 2017 28(4):907-912, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a macrocycles, e.g., as described in Porel M, et al. Nat Chem. 2016 June; 8(6):590-6, which is incorporated by reference for thisteaching. In some embodiments, the delivery vehicle is a lipid nanoparticle, e g., as described in Alabi C A, et al. Proc Natl Acad Sci USA. 2013 110(32): 12881 -6, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a poly(beta-amino ester) (PBAE) nanoparticle, e.g., as described in Zamboni C G, et al. J Control Release. 2017263:18-28, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a poly( - amino ester) (PBAE), e.g., as described in Green J J, et al. Acc Chem Res. 2008 41(6):749-59, which is incorporated by reference for this teaching. In some embodiments, the delivery vehicle is a stable nucleic acid lipid particles (SNALP), e.g., as described in Semple S C, et al. Nat Biotechnol. 201028(2): 172-6, which is incorporated by reference for this teaching. In some embodiments, the material is an amino sugar. In one embodiment the material is GalNAc, e.g., as described in Tanowitz M, et al. Nucleic Acids Res. 2017 Oct. 23; Nair J K, et al. Nucleic Acids Res. 2017 Sep. 15; and Zimmermann T S, et al. Mol Then 2017 Jan. 4; 25(1):71-78, which are incorporated by reference for these teachings.

[0120] In some cases, a nanoparticle is used as a subject nucleic delivery vehicle. As used herein, a “nanoparticle” is a particle having at least one dimension in the range of from 1 nm to 1000 nm, from 20 nm to 750 nm, from 50 nm to 500 nm, including 100 nm to 300 nm, e.g., 120-200 nm. The nanoparticle may have any suitable shape, including but not limited to spherical, spheroid, rod-shaped, disk-shaped, pyramid-shaped, cube-shaped, cylinder-shaped, nanohelical-shaped, nanospring-shaped, nanoringshaped, arrow-shaped, teardrop-shaped, tetrapod-shaped, prism-shaped, or any other suitable geometric or non-geometric shape. In some cases, a nanoparticle includes on its surface one or more targeting moieties , e.g., antibodies, ligands, aptamers, small molecules, etc. Nanoparticles include those described in Wang et al. (2010) Pharmacol. Res. 62(2):90-99; Rao et al. (2015) ACS Nano 9(6):5725-5740; and Byrne et al. (2008) Adv. Drug Deliv. Rev. 60(15):1615-1626.

[0121] In some cases, a lipid nanoparticle is used as a subject nucleic delivery vehicle. As used herein, the term “lipid nanoparticle” (LNP) refers to a transfer vehicle (e.g., for delivering a molecular payload such as nucleic acid and / or protein to a cell) comprising one or more lipids (e.g., ionizable lipids, anionic lipids, cationic lipids, noncationic lipids, neutral lipids, neutral phospholipids, polymerizable lipids, PEG- modified lipids, cholesterol, helper lipids, and the like). Historically, effective LNPs can include, e.g., in some cases, 4 components: an ionizable cationic lipid, zwitterionic phospholipid, cholesterol, and lipid polyethylene glycol) (PEG). The lipid(s) of an LNPcan include any convenient lipid. Examples include, but are not limited to DLin-DMA, DLin-K-DMA, 98NI2-5, CI2-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, PEGylated lipids and amino alcohol lipids.

[0122] LNP refers to a lipid-based vehicle useful for delivery of nucleic acid molecules and / or proteins and having dimensions on the nanoscale. In some embodiments, the nanoparticle is from about 1nm to about 1000nm, about 10nm to about 20nm, about 20nm to about 50nm, about 50nm to about 500 nm, or about 50nm to about 200nm (e.g., about 10-500 nm, about 20-500 nm, about 50-400 nm, about 50-300 nm, about 50-200 nm, about 50-150 nm, about 60-120 nm, or about 60-100 nm). As would be known to one of ordinary skill in the art, the average sizes (diameters) of the fully formed LNP, may be measured by dynamic light scattering on a Malvern Zetasizer.

[0123] Lipid nanoparticles may be, e.g., microspheres (including unilamellar and multilamellar vesicles, e.g. “Iiposomes”-lamellar phase lipid bilayers that, in some embodiments are substantially spherical, and can in some cases comprise an aqueous core, e.g., comprising one or more nucleic acids molecules, e.g., one or more RNA molecules), a dispersed phase in an emulsion, micelles or an internal phase in a suspension.

[0124] In some cases, an LNP includes a cationic lipid. Cationic lipids typically have a positively charged head group followed by a hydrophobic tail of varying composition. In an aqueous environment, these cationic lipids form micelles with positively charged surfaces that complex with DNA. Examples of cationic lipids include, but are not limited to: ADC, 1,2-dioleoyl-3-dimethylammonium-propane (DODAP), 1 ,2-dioleoyl-3- trimethylammonium-propane (DOTAP), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N- trimethylammonium chloride (DOPTAC), 1 ,2-dioleoyl-3-(2- (dimethylamino)ethoxy)propylamine (DODEA), and 1 ,2-dimyristoyl-3- trimethylammonium-propane (DMTAP).

[0125] In some cases, an LNP includes an ionizable lipid. Examples of ionizable lipids include, but are not necessarily limited to: 1014, OF-02, L-319, BP lipid 312, LP01 , Lipid HI-45, ALC-0315, lipid A9, D-Lin, DLin-MC3-DMA, ALC-0315, SM-102, LP01 , CL1 , TCL053, CKK-E12, ATX-002, DLin-DMA, DLenDMA, DLin-D-DMA, DLin-K- DMA, DLin-M-C2-DMA, DLin-K-DMA, DLin-KC2-DMA, DLin-KC3-DMA, DLin-KC4- DMA, DLin-C2K-DMA, DLin-MP-DMA, DODMA, 98N12-5, C12-200, DLin-C-DAP, DLin-DAC, DLinDAP, DLinAP, DLin-EG-DMA, DLin-2-DMAP, KL10, KL22, KL25, Octyl-CLinDMA, Octyl-CLinDMA (2R), Octyl-CLinDMA (2S), and analogs thereof.

[0126] In some cases, an LNP includes a neutral phospholipid. Examples of neutral phospholipids include, but are not necessarily limited to: : 5-heptadecylbenzene-1 ,3- diol (resorcinol), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), pohsphocholine (DOPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1 ,2-distearoyl- sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoyl phosphatidylcholine (MPPC), 1-palmitoyl-2-myristoyl phosphatidylcholine (PMPC), 1-palmitoyl-2-stearoyl phosphatidylcholine (PSPC), 1 ,2-diarachidoyl-sn-glycero-3-phosphocholine (DBPC), 1-stearoyl-2-palmitoyl phosphatidylcholine (SPPC), 1 ,2-dieicosenoyl-sn-glycero-3- phosphocholine (DEPC), palmitoyloleoyl phosphatidylcholine (POPC), lysophosphatidyl choline, dioleoyl phosphatidylethanolamine (DOPE), dilinoleoylphosphatidylcholine distearoylphosphatidylethanolamine (DSPE), dimyristoyl phosphatidylethanolamine (DMPE), dipalmitoyl phosphatidylethanolamine (DPPE), palmitoyloleoyl phosphatidylethanolamine (POPE), lysophosphatidylethanolamine and combinations thereof. In one embodiment, the neutral phospholipid may be selected from the group consisting of distearoylphosphatidylcholine (DSPC) and dimyristoyl phosphatidyl ethanolamine (DMPE). In another embodiment, the neutral phospholipid may be distearoylphosphatidylcholine (DSPC).

[0127] In some cases, an LNP includes a polymerizable lipid, e.g., a PEGylated lipid (e.g., DMG-PEG 2000, DSG-PEG 2000, ALC-0159). PEG-modified lipids (also referred to as PEGylated lipids) include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines and PEG-modified 1 ,2-diacyloxypropan-3-amines. For example, a PEG lipid can be PEG-c-DOMG, PEG-DMG (DMG-PEG), PEG-DLPE, PEG DMPE, PEG-DPPC, or a PEG-DSPE lipid. In some embodiments, the PEG-lipid are 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1 ,2- distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG- DSPE), PEG-disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG- distearyl, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG-DPPE), or PEG-1 , 2-dimyristyloxlpropyl-3-amine (PEG-c-DMA). In some embodiments, the PEG moiety has a size of about 1000, 2000, 5000, 10,000, 15,000 or 20,000 daltons. In some cases, instead of being PEG-modified, the polymerizable lipid can be modified with other hydrophilic polymers (other than PEG) - e.g., in some cases, the lipids in this paragraph can be modified with a hydrophilic polymer other than PEG.

[0128] A variety of different nanoparticles can be employed, including LNPs, polymeric nanoparticles, lipid polymer nanoparticles (LPNP), protein and peptide-based nanoparticles, DNA dendrimers and DNA-based nanocarriers, carbon nanotubes, microparticles, microcapsules, inorganic nanoparticles, peptide cage nanoparticles, and exosomes. (See, e.g., Riley and Vermerris Nanomaterials 2017, 7, 94; Thomas et al., Molecules 2019, 24, 3744; Bochicchio et al., Pharmaceutics 2021 , 13, 198; Munagala et al., Cancer Letters 2021 , 505, 58; Fu et al., 2020 NanoImpact 20, 100261 ; and Neshat et al. 2020 Current Opin. Biotechnol. 66:1-10.)

[0129] In some cases, an LNP include 1014, DOPE, Cholesterol, and DMG-PEG 2000. In some such cases a library can include various formulations of such an LNP, e.g., different amounts of each lipid such that various lipid ratios can be tested for delivery.

[0130] As noted above, delivery vehicles can be formulated from a variety of materials. In some embodiments, the delivery vehicles include helper lipids. Helper lipids can contribute to the stability and delivery efficiency of the delivery vehicles. In some cases, helper lipids with cone-shape geometry favoring the formation hexagonal II phase can be used. An example is dioleoylphosphatidylethanolamine (DOPE) which can promote endosomal release of cargo. Cylindrical-shaped lipid phosphatidylcholine can be used to provide greater bilayer stability, which is important for in vivo application of LNPs. Cholesterol can be included as a helper that improves intracellular delivery as well as LNP stability in vivo. Inclusion of a PEGylating lipid can be used to enhance LNP colloidal stability in vitro and circulation time in vivo. In some embodiments, the PEGylation is reversible in that the PEG moiety is gradually released in blood circulation. pH-sensitive anionic helper lipids, such as fatty acids and cholesteryl hemisuccinate (CHEMS), can trigger low-pH-induced changes in LNP surface charge and destabilization that can facilitate endosomal release.

[0131] Representative materials that can be used to produce subject nucleic acid delivery vehicles include, but are not limited to polyethylene glycol), cholesterol, 1 ,2-dioleoyl- sn-glycero-3-phosphoethanolamine (DOPE), 1-(1Z-hexadecenyl)-sn-glycero-3- phosphocholine, 1-O-1'-(Z)-octadecenyl-2-hydroxy-sn-glycero-3-phosphocholine, 1- (1Z-octadecenyl)-2-oleoyl-sn-glycero-3-phosphocholine, 1-(1Z-octadecenyl)-2- arachidonoyl-sn-glycero-3-phosphocholine, 1-O-1 '-(Z)-octadecenyl-2-hydroxy-sn- glycero-3-phosphoethanolamine, 1-(1Z-octadecenyl)-2-docosahexaenoyl-sn-glycero-3-phosphocholine, 1-(1Z-octadecenyl)-2-oleoyl-sn-glycero-3-phosphoethanolamine, 1 -(1 Z-octadecenyl)-2-arachidonoyl-sn-glycero-3-phosphoethanolamine, 1 -(1 Z- octadecenyl)-2-docosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2- (5'-oxo-valeroyl)-sn-glycero-3-phosphocholine, 1-palmitoyl-2-(9'-oxo-nonanoyl)-sn- glycero-3-phosphocholine, 1-palmitoyl-2-glutaryl-sn-glycero-3-phosphocholine, 1- hexadecyl-2-azelaoyl-sn-glycero-3-phosphocholine, 1-palmitoyl-2-azelaoyl-sn- glycero-3-phosphocholine, 1-(10-pyrenedecanoyl)-2-glutaroyl-sn-glycero-3- phosphocholine, 1-(10-pyrenedecanoyl)-2-(5,5-dimethoxyvaleroyl)-sn-glycero-3- phosphocholine, 1-palmitoyl-2-glutaroyl-sn-glycero-3-phosphoethanolamine-N-[4- (dipyrrometheneboron difluoride)butanoyl] (ammonium salt), 1-palmitoyl-2-(5,5- dimethoxyvaleroyl)-sn-glycero-3-phosphoethanolamine-N-[4-(dipyrrometheneboron difluoride)butanoyl] (ammonium salt), 2-((2,3- bis(oleoyloxy)propyl)dimethylammonio)ethyl hydrogen phosphate, 2-((2,3- bis(oleoyloxy)propyl)dimethylammonio)ethyl ethyl phosphate, 1-oleoyl-2- cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine, 1 ,2- dicholesterylhemisuccinoyl-sn-glycero-3-phosphocholine, 1-palmitoyl-2- cholesterylcarbonoyl-sn-glycero-3-phosphocholine, 1-palmitoyl-2- cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine, 1-O-hexadecanyl-2-O-(9Z- octadecenyl)-sn-glycero-3-phosphocholine, 1-O-hexadecanyl-2-O-(9Z-octadecenyl)- sn-glycero-3-phospho-(T-rac-glycerol (ammonium salt), 1-O-hexadecanyl-2-O-(9Z- octadecenyl)-sn-glycero-3-phosphoethanolamine, 1-O-hexadecyl-sn-glycerol (HG),1 .2-di-O-phytanyl-sn-glycerol, 1 ,2-di-O-phytanyl-sn-glycero-3-phosphoethanolamine,1 .2-di-O-tetradecyl-sn-glycero-3-phospho-(1'-rac-glycerol), 1 ,2-di-O-hexyl-sn-glycero- 3-phosphocholine, 1 ,2-di-0-dodecyl-sn-glycero-3-phosphocholine, 1 ,2-di-O-tridecy I- sn-glycero-3-phosphocholine, 1 ,2-di-O-hexadecyl-sn-glycero-3-phosphocholine, 1 ,2- di-O-octadecyl-sn-glycero-3-phosphocholine, 1 ,2-di-O-(9Z-octadecenyl)-sn-glycero-3- phosphocholine, 1 ,2-di-O-phytanyl-sn-glycero-3-phosphocholine, 1-O-octadecyl-2-O- methyl-sn-glycero-3-phosphocholine, 1 ', 3'-bis[1 ,2-dimyristoyl-sn-glycero-3-phospho]- sn-glycerol, 1 ',3'-bis[1,2-dimyristoleoyl-sn-glycero-3-phospho]-sn-glycerol, 1',3'- bis[1 ,2-dipalmitoleoyl-sn-glycero-3-phospho]-sn-glycerol, 1 ,3'-bis[1 ,2-distearoyl-sn- glycero-3-phospho]-sn-glycerol, 1 ', 3'-bis[1 ,2-dioleoyl-sn-glycero-3-phospho]-sn- glycerol, T,3'-bis[1 ,2-dipalmitoyl-sn-glycero-3-phospho]-sn-glycerol, 1',3'-bis[1- palmitoyl-2-oleoyl-sn-glycero-3-phospho]-sn-glycerol, 1-palmitoyl-2-oleoyl-sn-glycero- 3-phospho-(1 '-myo-inositol-4'-phosphate), 1-stearoyl-2-arachidonoyl-sn-glycero-3- phospho-(1"-myo-inositol-4'-phosphate), 1 ,2-dioctanoyl-sn-glycero-3-(phosphoinositol-3-phosphate), 1 ,2-dioctanoyl-sn-glycero-3-phospho-(1 '-myo-inositol-3',4',5'- trisphosphate), 1 ,2-dioctanoyl-sn-glycero-3-phospho-(1 '-myo-inositol-4',5'- bisphosphate), 1 ,2-dioctanoyl-sn-glycero-3-phospho-(1 '-myo-inositol-3',4'- bisphosphate), 1 ,2dioctanoyl-sn-glycero-3-phospho-(1 '-myo-inositol-4'-phosphate),1 .2-dioctanoyl-sn-glycero-3-phospho-(1 -myo-inositol), 1 ,2-dihexanoyl-sn-glycero-3- phospho-(1 '-myo-inositol-3',4',5'-trisphosphate), 1 ,2-dihexanoyl-sn-glycero-3-phospho- (T-myo-inositol-3',5'-bisphosphate), 1-stearoyl-2-arachidonoyl-sn-glycero-3-phospho- (1-myo-inositol-3',4',5'-trisphosphate), 1-stearoyl-2-arachidonoyl-sn-glycero-3- phospho-(1'-myo-inositol-4',5'-bisphosphate), 1-stearoyl-2-arachidonoyl-sn-glycero-3- phospho-(1'-myo-inositol-3',5-bisphosphate), 1,2-dioleoyl-sn-glycero-3-phospho-(T- myo-inositol-3',4',5'-trisphosphate), 1 ,2-dioleoyl-sn-glycero-3-phospho-(1 '-myo- inositol-4',5'-bisphosphate), 1 ,2-dioleoyl-sn-glycero-3-phospho-(1 '-myo-inositol-3',5'- bisphosphate), 1 ,2-dioleoyl-sn-glycero-3-phospho-(1 '-myo-inositol-3',4'-bisphosphate),1 .2-dioleoyl-sn-glycero-3-phospho-(1 '-myo-inositol-5'-phosphate), 1 ,2-dioleoyl-sn- glycero-3-phospho-(1 '-myo-inositol-4'-phosphate), 1 ,2-dioleoyl-sn-glycero-3-phospho- (1 '-myo-inositol-3'-phosphate), 1 ,2-dioleoyl-sn-glycero-3-phospho-(1 -myo-inositol), 1- stearoyl-2-arachidonoyl-sn-glycero-3-phosphoinositol, 1,2-distearoyl-sn-glycero-3- phosphoinositol, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoinositol, 1 ,2-dipalmitoyl-sn- glycero-3-phospho-(1'-myo-inositol), 1-oleoyl-2-(6-((4,4-difluoro-1 ,3-dimethyl-5-(4- methoxyphenyl)-4-bora-3a,4a-diaza-s-indacene-2-propionyl)amino)hexanoyl)-sn- glycero-3-phosphoinositol-4.5-bisphosphate, 1-oleoyl-2-hydroxy-sn-glycero-3- phospho-(1 '-myo-inositol), 1-tridecanoyl-2-hydroxy-sn-glycero-3-phospho-(T-myo- inositol), 1-palmitoyl-2-hydroxy-sn-glycero-3-phosphoinositol, 1-(10Z-heptadecenoyl)- 2-hydroxy-sn-glycero-3-phospho-(1'-myo-inositol), 1-stearoyl-2-hydroxy-sn-glycero-3- phosphoinositol, 1-arachidonoyl-2-hydroxy-sn-glycero-3-phosphoinositol, D-myo- inositol-1,3,4-trisphosphate, D-myo-inositol-1 ,3,5-triphosphate, D-myo-inositol-1 ,4,5- triphosphate, D-myo-inositol-1 ,3,4,5-tetraphosphate, 1-(10Z-heptadecenoyl)-2- hydroxy-sn-glycero-3-[phospho-L-serine], or any combination thereof.In certain embodiments, subject nucleic acid delivery vehicles are fabricated from or contain biocompatible polymers. A variety of biodegradable and / or biocompatible polymers are well known to those skilled in the art. Exemplary synthetic polymers suitable for use with the disclosed compositions and methods include but are not limited to poly(lactide), poly(glycolide), poly(lactic co-glycolic acid), poly(arylates), poly(anhydrides), poly(hydroxy acids), polyesters, poly(ortho esters), polycarbonates, polypropylene fumerates), poly(caprolactones), polyamides, polyphosphazenes,polyamino acids, polyethers, polyacetals, polylactides, polyhydroxyalkanoates, polyglycolides, polyketals, polyesteramides, poly(dioxanones), polyhydroxybutyrates, polyhydroxyvalyrates, polycarbonates, polyorthocarbonates, poly(vinyl pyrrolidone), biodegradable polycyanoacrylates, polyalkylene oxalates, polyalkylene succinates, poly(malic acid), poly(methyl vinyl ether), polyethylene imine), poly(acrylic acid), poly(maleic anhydride), biodegradable polyurethanes and polysaccharides. In certain embodiments, the materials include polyethylene glycol (PEG). In certain embodiments, the polymer used to make the materials is PEGylated (i.e. , conjugated to a polyethylene glycol moiety).

[0132] In some embodiments, subject nucleic acid delivery vehicles are formed from material identified to as Generally Recognized as Safe (GRAS) by the FDA.

[0133] Naturally-occurring polymers, such as polysaccharides and proteins, may also be employed to produce subject nucleic acid delivery vehicles. Exemplary polysaccharides include alginate, starches, dextrans, celluloses, chitin, chitosan, hyaluronic acid and its derivatives; exemplary proteins include collagen, albumin, and gelatin. Polysaccharides such as starches, dextrans, and celluloses may be unmodified or may be modified physically or chemically to affect one or more of their properties such as their characteristics in the hydrated state, their solubility, or their half-life in vivo. In certain embodiments, the materials do not include protein.

[0134] In other embodiments, a polymer includes polyhydroxy acids such as polylactic acid (PLA), polyglycolic acid (PGA), their copolymers poly(lactic-co-glycolic acid) (PLGA), and mixtures of any of these. In some embodiments, the materials include poly(lactic- co-glycolic acid) (PLGA). In some embodiments, the materials include poly(lactic acid). In certain other embodiments, the materials include poly(glycolic acid). These polymers are among the synthetic polymers approved for human clinical use as surgical suture materials and in controlled release devices. They are degraded by hydrolysis to products that can be metabolized and excreted. Furthermore, copolymerization of PLA and PGA offers the advantage of a large spectrum of degradation rates from a few days to several years by simply varying the copolymer ratio of glycolic acid to lactic acid, which is more hydrophobic and less crystalline than PGA and degrades at a slower rate.

[0135] Non-biodegradable polymers may also be used. Exemplary non-biodegradable, yet biocompatible polymers include polystyrene, polyesters, non-biodegradable polyurethanes, polyureas, poly(vinyl alcohol), polyamides, poly(tetrafluoroethylene), polyethylene vinyl acetate), polypropylene, polyacrylate, non-biodegradablepolycyanoacrylates, non-biodegradable polyurethanes, polymethacrylate, poly(methyl methacrylate), polyethylene, polypyrrole, polyanilines, polythiophene, and polyethylene oxide).

[0136] Any of the above polymers may be functionalized with a poly(alkylene glycol), for example, poly(ethylene glycol) (PEG) or poly(propyleneglycol) (PPG), or any other hydrophilic polymer system. Alternatively or in addition, they may have a particular terminal functional group, e.g., poly(lactic acid) modified to have a terminal carboxyl group so that a poly(alkylene glycol) or other material may be attached. Exemplary PEG-functionalized polymers include but are not limited to PEG-functionalized poly(lactic acid), PEG-functionalized poly(lactic-co-glycolic acid), PEG-functionalized poly(caprolactone), PEG-functionalized poly(ortho esters), PEG-functionalized polylysine, and PEG-functionalized polyethylene imine). When used in formulations for oral delivery, poly(alkylene glycols) are known to increase the bioavailability of many pharmacologically useful compounds, partly by increasing the gastrointestinal stability of derivatized compounds. For parenterally administered pharmacologically useful compounds, including particle delivery systems, poly(alkylene glycols) are known to increase stability, partly by decreasing opsinization of these compounds, thereby reducing immunogenic clearance, and partly by decreasing non-specific clearance of these compounds by immune cells whose function is to remove foreign material from the body. Poly(alkylene glycols) are chains may be as short as a few hundred Daltons or have a molecular weight of several thousand or more.

[0137] Co-polymers, mixtures, and adducts of any of the above modified and unmodified polymers may also be employed. For example, amphiphilic block co-polymers having hydrophobic regions and anionic or otherwise hydrophilic regions may be employed. Block co-polymers having regions that engage in different types of non-covalent or covalent interactions may also be employed. Alternatively or in addition, polymers may be chemically modified to have particular functional groups. For example, polymers may be functionalized with hydroxyl, amine, carboxy, maleimide, thiol, N- hydroxy-succinimide (NHS) esters, or azide groups. These groups may be used to render the polymer hydrophilic or to achieve particular interactions with materials that are used.

[0138] One skilled in the art will recognize that the molecular weight and the degree of crosslinking may be adjusted to control the decomposition rate of the polymer. Methods of controlling molecular weight and cross-linking to adjust release rates are well known to those skilled in the art.

[0139] Delivery vehicles may also be produced from non-polymer materials, e.g., metals, and semiconductors. For example, where it is desired to provide a contrast or imaging agent to a particular tissue, it may not be necessary to combine a particulate agent with a polymer carrier.

[0140] The surface chemistry of the delivery vehicles may be varied using any technique known to the skilled artisan. Both the surface hydrophilicity and the surface charge may be modified. Some methods for modifying the surface chemistry of polymer materials are discussed above. Silane or thiol molecules may be employed to tether particular functional groups to the surface of polymer or non-polymer materials. For example, hydrophilic (e.g., thiol, hydroxyl, or amine) or hydrophobic (e.g., perfluoro, alkyl, cycloalkyl, aryl, cycloaryl) groups may be tethered to the surface. Acidic or basic groups may be tethered to the surface of the materials to modify their surface charge. Exemplary acidic groups include carboxylic acids, nitrogen-based acids, phosphorus based acids, and sulfur based acids. Exemplary basic groups include amines and other nitrogen containing groups. The pKa of these groups may be controlled by adjusting the environment of the acidic or basic group, for example, by including electron donating or electron withdrawing groups adjacent to the acidic or basic group, or by including the acidic or basic group in a conjugated or non-conjugated ring. Alternatively, materials may be oxidized, for example, using peroxides, permanganates, oxidizing acids, plasma etching, or other oxidizing agents, to increase the density of hydroxyl and other oxygenated groups at their surfaces. Alternatively or in addition, borohydrides, thiosulfates, or other reducing agents may be used to decrease the hydrophilicity of the surface.

[0141] The delivery vehicles may be any size that permits cells to uptake the particles. For example, the particles can have a diameter of about 1 nm to about 1000 pm, or about 1 and about 50 nm, or 50 to 100 nm, or about 100 to about 500 nm, or about 500 to about 1000 nm, or about 1 pm to about 10 pm.

[0142] In some embodiments, a screening method is used to screen microparticles (having a diameter between 1 and 10 microns) or nanoparticles (having a diameter between 1 and 1000 nm) for characteristics suitable for delivering a nucleic acid to a cell / tissue / organ of interest.

[0143] The number of delivery vehicles characterized per run of the assay can be at least 5, 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500 or more depending on the size of the non-human mammal used in the assay.

[0144] In some embodiments, targeting agents may be employed to more precisely direct the delivery vehicles to a tissue or cell of interest. Therefore, subject nucleic acid delivery vehicles can contain a tissue-targeting moiety, a cell-targeting moiety, a receptortargeting moiety, or any combination thereof.

[0145] One skilled in the art will recognize that the tissue of interest need not be healthy tissue but may be a tumor or particular form of damaged or diseased tissue, such as areas of arteriosclerosis or unstable antheroma plaque in the vasculature. Targeting agents may target any part or component of a tissue. For example, to targeting agents may exhibit an affinity for an epitope or antigen on a tumor or other tissue cell, an integrin or other cell-attachment agent, an enzyme receptor, an extracellular matrix material, or a peptide sequence in a particular tissue. Targeting agents may include but are not limited to antibodies and antibody fragments (e.g. the Fab, Fab', or F(ab')2 fragments, or single chain antibodies), nucleic acid ligands (e.g., aptamers), oligonucleotides, oligopeptides, polysaccharides, low-density lipoproteins (LDLs), folate, transferrin, asialycoproteins, carbohydrates, polysaccharides, sialic acid, glycoprotein, or lipid. Targeting agents may include any small molecule, bioactive agent, or biomolecule, natural or synthetic, which binds specifically to a cell surface receptor, protein or glycoprotein found at the surface of cells. In some embodiments, the targeting agent is an oligonucleotide sequence. In certain embodiments, the targeting agent is an aptamer. In some embodiments, the targeting agent is a naturally occurring carbohydrate molecule or one selected from a library of carbohydrates. Libraries of peptides, carbohydrates, or polynucleotides for use as potential targeting agents may be synthesized using techniques known to those skilled in the art. Various macromolecule libraries may also be purchased from companies such as Invitrogen and Cambridge Peptide.

[0146] The targeting agent may be conjugated to the material by covalent interactions. For example, a polymeric material may be modified with a carboxylate group, following which an aminated targeting agent, or one that is modified to be aminated, is coupled to the polymer using a coupling reagent such as EDC or DCC. Alternatively, polymers may be modified to have an activated NHS ester which can then be reacted with an amine group on the targeting agent. Other reactive groups that may be employed to couple targeting agents to materials include but are not limited to hydroxyl, amine, carboxyl, maleimide, thiol, NHS ester, azide, and alkyne. Standard coupling reactions may then be used to couple the modified material to a second material having a complementary group (e.g., a carboxyl modified targeting agent coupled to anaminated polymer). Materials fabricated from inorganic materials may be modified to carry any of these groups using self-assembled monolayer forming materials to tether the desired functional group to the surface.

[0147] Alternatively, the targeting agents can be attached to the materials directly or indirectly via non-covalent interactions. Non-covalent interactions include but are not limited to electrostatic Interactions, affinity Interactions, metal coordination, physical adsorption, host-guest interactions, and hydrogen bonding interactions.

[0148] For additional information related to delivery vehicles, see, e.g., US Patent Application Publication NO. 20200330607, which is incorporated herein by reference for such disclosure.Methods

[0149] Provided are methods in which a subject library of nucleic acid delivery vehicles (see above) are administered to a plurality of cells. The cells can be any cell type and can be cells in culture (in vitro), or can be in vivo. As such, in some cases the library of nucleic acid delivery vehicles is administered to an individual (e.g., a non-human mammal such as a rodent (e.g., mouse, rat), a rabbit, a pig, a horse, a non-human primate, and the like). After administration, after a period of time has passed in which nucleic acids have been delivered to cells and cRNAs have formed, barcodes present in cRNAs (which result from successful delivery by nucleic acid delivery vehicles) are detected. As explained elsewhere herein, those barcodes that are detected (from cRNAs) indicate which nucleic acid delivery vehicles (i.e., which chemical compositions) successfully delivered the barcoded RNA molecules to the plurality of cells. In some cases, the members of the library are pooled prior to administering such that they are administered simultaneously. In some embodiments, a subject method includes pooling members of a subject library of nucleic acid delivery vehicles prior to administering. In some embodiments, a subject method includes formulating the library of nucleic acid delivery vehicles, i.e., formulating the delivery vehicles having different chemical compositions, where the different formulations include a subject barcoded RNA molecule.

[0150] Nucleic acid delivery vehicles of the present disclosure can be administered to a subject in any suitable form, e.g., in the form of a pharmaceutically acceptable composition, and can be formulated for any convenient route of administration, e.g., can be administered systemically or locally, and by any convenient route, e.g., oral, topical or parenteral administration. In some cases, administering includes localadministration. In some cases, administering includes systemic administration. Routes of administration can include, but are not necessarily limited to: oral (alimentary), intravenous, subcutaneous, intramuscular, intraperitoneal, intratumoral, mucosal, peritumoral, intra-pleural, intracranial (e.g., convection enhanced delivery), intraocular, topical, dermal, intradermal, transdermal, transmucosal, retro-orbital (e.g., retro-orbital injection), respiration (inhalation), intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, intravascular, intrathecal, intracavity, iontophoretic, intraocular, ophthalmic, optical, intraglandular, intraorgan, and intralymphatic, etc. In some cases, administering to a subject is via local administration (e.g., injection such as intratumoral injection). In some cases, administration is systemic administration (e.g., intravenous). Where a compound is provided as a liquid injectable (such as in those embodiments where the compound is administered intravenously or directly into a tissue), the compound can be provided as a ready-to-use dosage form, or as a reconstitutable storage-stable powder or liquid composed of pharmaceutically acceptable carriers and excipients.

[0151] Methods for formulating compounds can be adapted from those readily available. For example, compounds can be provided in a pharmaceutical composition comprising a compound of the present disclosure and a pharmaceutically acceptable carrier. The pharmaceutical composition may optionally include other additives (e.g., buffers, stabilizers, preservatives, and the like). In some embodiments, the formulations are suitable for administration to a mammal (e.g., a rodent such as a mouse or a rat, a pig, a horse, a rabbit, a dog, a cat, a non-human primate, and the like).

[0152] In some embodiments, the method includes creating or producing a new library of nucleic acid delivery vehicles based on those shown to be functional. The disclosed method in this way can be used to optimize the delivery vehicles. For example, parameters for optimization can include, but are not limited to: size; polymer composition; surface hydrophilicity; surface charge; amounts of each component; relative amounts / ratios of components; and the presence, composition and / or density of targeting agents on the material surface. The new library can be administered to determine which modifications / alterations / combinations were effective.Detection

[0153] One advantage of using a subject library of nucleic acid delivery vehicles (i.e., those that include a barcoded RNA molecule as described herein) is that there is no need for cell sorting. This is because the subject methods include use of a nucleic acidbarcode that can be detected in a way that distinguishes successfully delivered nucleic acid: detecting the barcode only from cRNAs, which are only produced in cells into which the barcoded RNA molecular was successfully delivered. Thus, in some embodiments, a subject method does not include cell sorting. For example, after administration, nucleic acids can be extracted from the population of cells (e.g., extracted from whole tissues or organs, from tissue or organ samples, from cells in culture, etc.), and detection can be performed such that only those barcodes that are present as part of cRNAs are detected. As an example, RT-PCR can be performed with primers that selectively amplify only from circularized RNAs (cRNAs) (e.g., outward-facing primers that lead to amplification across the ligated junction) (see, e.g., FIG. 1), and the PCR products can then be subjected to nucleic acid sequencing (e.g., using next generation sequencing, which is also referred to herein as high- throughput sequencing or deep sequencing) to detect and identify the barcodes.

[0154] In some embodiments, cRNAs (which include the barcode sequences from successfully delivered barcoded RNA molecules) can be enriched from the extracted nucleic acids or even isolated from the extracted nucleic acids prior to detection. For example, cRNAs may be separated from genomic DNA based on size differences or other characteristics, or genomic DNA can be degraded. In some cases, genomic DNA can be left unperturbed. Extracted cRNAs can be left concentrated or diluted for further analysis. As such, if cRNAs can be separated from non-cRNAs, then a selective PCR reaction might not be desired, e.g., the cRNAs could be sequenced directly, or a non-outward facing primer pair that does not necessarily lead to amplification across the ligated junction could be used. Once isolated, a cRNA extract can be sequenced directly or amplified, e.g., by PCR.

[0155] It is to be understood that detection of the barcodes can be performed using any convenient technique, and such techniques will be known and available to one of ordinary skill in the art. For example, as noted above, RT-PCR and / or enrichment / isolation followed by nucleic acid sequencing (e.g., next generation sequencing) can be used. As non-limiting examples, barcodes can be sequenced by Sanger sequencing, or by next-generation / high-throughput sequencing methods (e.g., Illumina, Roche 454, Ion torrent, nanopore-based sequencing, and the like). As another example, microarray based technology can be used to detect barcodes by using probes that selectively hybridize to the barcodes.

[0156] In some cases, the detecting will be quantitative in the sense that the amount of barcode detected from a sample (e.g., the number of sequence reads for a givenbarcode) can be used to determine relative effectiveness of the successful delivery vehicles. As an illustrative example, if the subject library includes various formulations of LNPs for delivery to a particular desired tissue (e.g., heart), it is possible that more than one formulation will successfully deliver the nucleic acid to that tissue. As such, more than one barcode will be detected from the nucleic acids extracted from the target tissue (e.g., heart tissue in this particular example). In some embodiments, the amount of barcode detected (e.g., the number of sequence reads detected) can be used to determine the relative effectiveness of the associated LNP formulations. For example, the formulation associated with the barcode having the highest quantity of detection (e.g., with the highest number of sequence reads) can in some cases therefore be determined to be more a more effective delivery vehicle than a formulation associated with a barcode having a lower quantity of detection (e.g., with a lower number of sequence reads). As such, in some cases a subject method can be used in a quantitative way to compare the effectiveness of the tested delivery vehicles.Cells

[0157] As noted, in some embodiments, a subject method includes administration of a subject library of nucleic acid delivery vehicles to a plurality of cells. A plurality of cells is 2 or more cells (e.g., 5 or more, 10 or more, 100 or more, 1 ,000 or more, 10,000 or more, 105or more, 106or more, 107or more, 108or more, 109or more, 1010or more, etc.). In some cases, administration is in vivo, in which case a library of nucleic acid delivery vehicles can be delivered (e.g., systemically) to most or even all of the cells of the individual (e.g., a non-human organism such as a non-human primate, mouse, rat, etc.).

[0158] Suitable eukaryotic and prokaryotic (e.g., bacterial) cells for nucleic acid delivery are well known in the art. For example, the cells may be eukaryotic cells. Examples of eukaryotic cells include, but are not limited to: fungal, animal, plant, yeast, vertebrate, invertebrate, insect, and mammalian cells. Mammalian cells include, but are not limited to: human, non-human primate, cat, dog, sheep, goat, cow, horse, pig, rabbit, camel, alpaca, and rodent (e.g., mouse, rat) cells.

[0159] In some cases, the plurality of cells are cells from any desired organ or tissue, e.g., the cells can be in culture in vitro or can be ex vivo. In some cases, the cells can be in vivo and therefore the barcoded RNA molecules of the library are delivered to the cells while they are part of an intact organ or tissue. Examples of suitable cells, celltypes, and tissues and organs include, but are not limited to, cells of an organ system such as skin, brain, heart, kidney, liver, stomach, large intestine, lungs, and the like. For example, adrenal glands, anus, appendix, bladder (urinary), bone, bone marrow, brain, bronchi, diaphragm, ears, esophagus, eye, fallopian tube, gallbladder, genitals, heart, hypothalamus, joints, kidney, large intestine, larynx, liver, lung, lymph node, mammary gland, mesentery, mouth, nasal cavity, nose, ovaries, pancreas, pineal gland, parathyroid gland, pharynx, pituitary gland, prostate, rectum, salivary gland, skeletal muscle, smooth muscle, skin, small intestine, spinal cord, spleen, stomach, teeth, thymus gland, thyroid, trachea, tongue, ureter, urethra, ligament, tendon, hair, vestibular system, placenta, testes, vas deferens, seminal vesicles, bulbourethral glands, parathyroid gland, thoracic duct, arteries, veins, capillaries, lymphatic vessels, tonsils, neurons, subcutaneous tissue, olfactory epithelium (nose), cerebellum, and any combination thereof.

[0160] In some cases, the plurality of cells are from multiple different tissues. For example, if administration is in vivo, cRNAs can be recovered / extracted from multiple (two or more) different tissues / cell types / organs, in some cases from the same individual. Thus, in one experiment, nucleic acid delivery to more than one tissue / cell type / organ can be assessed. For example, if one were interested in nucleic acid delivery to the heart and lungs, cRNAs can be extracted from both organs (either pooled or kept separated) and barcodes can be detected. While some particular formulation(s) may be successful (or perform better) in one particular organ (e.g., heart), other formulation(s) may be successful (or perform better) in a different organ (e.g., lungs).Kits

[0161] Provided are kits / systems for carrying out a subject method. Such kits comprise various combinations of components useful in any of the methods described elsewhere herein. In some embodiments a subject kit includes a library of nucleic acid delivery vehicles, wherein members of the library are nucleic acid delivery vehicles with different chemical compositions that comprise a subject barcoded RNA molecule for detecting cellular entry.

[0162] A kit can further include one or more additional reagents, where such additional reagents can be any convenient reagent. Components of a subject kit can be in separate containers; or can be combined in a single container. In some cases one or more of a kit’s components are pharmaceutically formulated for administration to a human.

[0163] In addition to above-mentioned components, a subject kit can further include instructions for using the components of the kit to practice the subject methods (e.g., dosing instructions, instructions to administer the component(s) to an individual. The instructions for practicing the subject methods are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic, etc. As such, the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging) etc. In some embodiments, the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, flash drive, etc. In some embodiments, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. via the internet, are provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.EXEMPLARY NON-LIMITING ASPECTS OF THE DISCLOSURE

[0164] Aspects, including embodiments, of the present subject matter described above may be beneficial alone or in combination, with one or more other aspects or embodiments. Without limiting the foregoing description, certain non-limiting aspects of the disclosure are provided below. As will be apparent to those of ordinary skill in the art upon reading this disclosure, each of the individually numbered aspects may be used or combined with any of the preceding or following individually numbered aspects. This is intended to provide support for all such combinations of aspects and is not limited to combinations of aspects explicitly provided below. It will be apparent to one of ordinary skill in the art that various changes and modifications can be made without departing from the spirit or scope of the invention.1. A library of nucleic acid delivery vehicles, wherein members of the library are nucleic acid delivery vehicles with different chemical compositions that comprise a barcoded RNA molecule for detecting cellular entry, wherein the barcoded RNA molecule comprises, from 5’ to 3’: (i) a first ribozyme, (ii) a barcode sequence that identifies the chemical composition of the nucleic acid delivery vehicle, and (iii) a second ribozyme,wherein the first and second ribozymes are capable of cleaving the barcoded RNA molecule to produce a 5’-OH end and a 2’,3’-cyclic phosphate end that can be ligated to one another by an RNA ligase to produce a circular RNA (cRNA) that comprises the barcode sequence.2. The library of1 , wherein each of the first and the second ribozyme is independently selected from the group consisting of: a Hammerhead ribozyme, a Hairpin ribozyme, a Hepatitis Delta Virus (“HDV”) ribozyme, a Varkud Satellite (“VS”) ribozyme, a Vg1 ribozyme, a glucosamine-6-phosphate synthase (“glmS”) ribozyme, a Twister ribozyme, a Twister Sister ribozyme, a Hatchet ribozyme, a Pistol ribozyme, an engineered synthetic ribozyme, or derivatives thereof.3. The library of1 , wherein the first and the second ribozymes are Twister ribozymes.4. The library of1 , wherein the first ribozyme comprises the sequence of SEQ ID NO: 1 and the second ribozyme comprises the sequence of SEQ ID NO: 2.5. The library of any one of1-4, wherein the RNA ligase is RtcB.6. The library of any one of1-5, wherein the nucleic acid delivery vehicles of the library are lipid nanoparticles having different chemical compositions.7. The library of any one of1-6, wherein the library includes greater than 10 members.8. The library of any one of1-7, wherein the barcode sequence has a length of 6 or more nucleotides.9. The library of any one of1-7, wherein the barcode sequence has a length of 8-30 nucleotides.10. A method for identifying nucleic acid delivery vehicles, the method comprising:(a) administering the library of nucleic acid delivery vehicles of any one of1-9 to a plurality of cells; and(b) detecting the barcodes present in cRNAs resulting from said administering, thereby identifying, based on the barcodes detected in (b), the chemical composition of nucleic acid delivery vehicles that successfully delivered the barcoded RNA molecules.11. The method of10, wherein the method does not include cell sorting.12. The method of10 or11 , wherein the plurality of cells are cells that are part of an organ or tissue.13. The method of any one of10-12, wherein the plurality of cells are from multiple different tissues.14. The method of any one of10-13, wherein the administering is in vivo and the library is administered to a non-human multicellular organism.15. The method of14, wherein the non-human multicellular organism is a mammal.16. The method of14 or15, wherein said administering comprises systemic administration.17. The method of14 or15, wherein said administering comprises local administration.18. The method of any one of10-17, wherein said detecting comprises nucleic acid amplification.19. The method of any one of10-18, wherein said detecting comprises nucleic acid sequencing.20. The method of any one of10-19, wherein said detecting comprises extracting nucleic acids from desired tissues or organs.21. The method of any one of10-19, wherein said detecting comprises extracting nucleic acids from heart tissue and / or lung tissue.22. A library of nucleic acid delivery vehicles, wherein members of the library are nucleic acid delivery vehicles with different chemical compositions that comprise a barcoded ligation-ready RNA molecule for detecting cellular entry, wherein the barcoded ligation-ready RNA molecule comprises, from 5’ to 3’: (i) a 5’-OH end, (ii) a barcode sequence that identifies the chemical composition of the nucleic acid delivery vehicle, and (iii) a 2’,3’-cyclic phosphate end, wherein (i) and (iii) can be ligated to one another by an RNA ligase to produce a circular RNA (cRNA) that comprises the barcode sequence.23. The library of 22, wherein the nucleic acid delivery vehicles of the library are lipid nanoparticles having different chemical compositions.24. The library of 22 or 23, wherein the barcode sequence has a length of 6 or more nucleotides.25. A method for identifying nucleic acid delivery vehicles, the method comprising: (a) administering the library of nucleic acid delivery vehicles of any one of 22-24 to a plurality of cells; and (b) detecting the barcodes present incRNAs resulting from said administering, thereby identifying, based on the barcodes detected in (b), the chemical composition of nucleic acid delivery vehicles that successfully delivered the barcoded ligation-ready RNA molecules.EXPERIMENTAL EXAMPLES

[0165] The following examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

[0166] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the present invention and practice the claimed methods. The following working examples therefore are not to be construed as limiting in any way the remainder of the disclosure.

[0167] General methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Cold Spring Harbor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference. Reagents, cloning vectors, cells, and kits for methods referred to in, or related to, this disclosure are available from commercial vendors such as BioRad, Agilent Technologies, Thermo Fisher Scientific, Sigma-Aldrich, New England Biolabs (NEB), Takara Bio USA, Inc., and the like, as well as repositories such as e.g., Addgene, Inc., American Type Culture Collection (ATCC), and the like.Example 1: Lipid nucleic barcoding using self-circularized RNA

[0168] As shown in FIG. 1 , each LNP formulation encapsulates a unique scRNA barcode sequence. During high-throughput screening in vivo, multiple LNP formulations (e.g., >10) can be administered to a single animal model host, thus, significantly reducing the cost and time required to assess delivery efficiency. Upon successful genedelivery, defined by both cellular uptake and endosomal escape, the scRNA undergoes self-cleavage at the 5’ and 3’ ends, resulting in a 5’-OH terminus and a 3’- PO terminus (a 2’,3’-cyclic phosphate end). The endogenous ligase enzyme RtcB then ligates the ends to form a stable circularized scRNA, which can be extracted and analyzed by next-generation sequencing (NGS). Additionally, RT-PCR primers are designed to only amplify the circularized scRNA (positive hits) efficiently, discriminating it from linear scRNA (negative hits), as only ligated scRNA can produce a complete PCR product.Example 2: Lipid nucleic barcoding using self-circularized RNA

[0169] FIG. 2 provides an example 2% agarose gel electrophoresis of RT-PCR products from scRNA barcode samples before and after delivery. FIG. 1 B depicts unreacted RNA barcodes, with the top band corresponding to intact scRNA and the two lower bands representing incomplete RT-PCR products due to the disconnection between the 5' and 3' ends. FIG. 2B depicts RT-PCR-amplified circular scRNA extracted from the mouse liver after 24-hour injection (single barcode, retro-orbital), showing a distinct band from efficient RT-PCR amplification. The successful amplification was also independently confirmed by Sanger sequencing, showing two distinct poly(A) spacers flanking a self-complementary spacer that indicates successful end termini ligation.Example 3: Barcoding by scRNA identifies LNP formulation that transfects target organs

[0170] A cohort of 18 unique lipid nanoparticle (LNP) formulations, each tagged with a distinct single-cell RNA (scRNA) barcode, was administered to a single mouse subject via retroorbital injection. After 24 hours, target organs, including the lung and heart, were collected, and scRNAs were isolated using TRIzol reagent. The scRNA samples were amplified by RT-PCR, gel-purified, and subjected to next-generation sequencing (NGS). Through analysis of reads containing unique nucleic acid sequences generated upon scRNA circularization, LNP formulations that successfully delivered RNA to each organ were identified.

[0171] Validation of scRNA barcoding strategy (FIG. 3A) Among the formulations, L34 showed the highest predicted delivery efficiency, while L22 had a significantly lower predicted efficiency. Mice were treated with firefly Luciferase (ffLuciferase) reporter mRNA encapsulated within either L34 or L22 via retroorbital injection. After 5 hours,D-luciferin, the ffLuciferase substrate, was administered, and target organs were dissected for imaging. Successful delivery was confirmed by enzymatic-substrate conversion generating detectable luminescence.

[0172] Quantification of delivery efficiency based on luminescence in lung and heart (FIG. 3B) Luminescence from the ffLuciferase reaction was quantified in the lung and heart. The subjects treated with L34 showed a significantly higher luminescence than L22 and background (untreated). These results validated the ability of scRNA barcoding strategy to predict and identify efficient LNP formulations in large screening cohorts (>10 formulations).

[0173] Predicted ranking of delivery efficiency for lung and heart tissue (FIG. 3C): Using normalized barcode reads (calculated as the read number of a specific barcode divided by the total barcode reads from NGS results), delivery efficiency rankings for lung and heart were established across the cohort. Here, the L34 formulation was predicted to outperform others in gene delivery efficiency for both lung and heart tissues, corresponding to the validation data in FIG. 3A and 3B.Example 4: LNP compositions of L34 formulation

[0174] As shown in FIG. 4, The leading LNP formulation for heart and lung delivery (L34) identified by scRNA barcoding consists of commercially available, 1014 ionizable lipid, 1 ,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), Cholesterol, and DMG- PEG 2000 at the molar percentage of 42.5:21.68:34.74:1.07. The LNP was formed by injecting lipid mixture in ethanol phase to mRNA in 25 mM acetate buffer (aqueous) at 16 mgLipidS:mgmRNA with the aqueous-to-organic phase ratio of 3:1. Image of the 1014 was taken from Cayman Chemical.Example 5: General nucleic acid sequence of scRNA barcodes

[0175] FIG. 5 presents an illustration of the DNA template used to generate scRNA barcodes. The scRNA structure includes two main autocatalytic twister ribozyme sequences, labeled as Twist (Front) and Twist (Back), which flank both spacer regions and a unique barcode region (highlighted in red). Within the endosome, the twister ribozymes autocleave to produce reactive 5'- hydroxyl (5'-OH) and 3'- phosphate (3'-PO) termini. These are recognized by endogenous RtcB ligase and facilitate scRNA circularization.Example 6: Detection of Circularized RNA by RT-PCR amplification

[0176] Following ligation and circularization, the scRNA acquires the predicted sequence shown in FIG. 6. Two PCR primers are strategically positioned to enable efficient amplification of the cDNA product (derived from the reverse-transcribed circular RNA). This amplification produces a linear DNA amplicon suitable for the next-generation sequencing (NGS) workflow.Example 7: Example embodiments using compositions and methods disclosed herein

[0177] FIG. 7 - CYBR can screen LNP libraries in vivo by sequencing of organ tissue. A CYBR-barcoded LNP library, termed B-LNP, was administered to mice (20 formulations, 0.5 mg / kg total barcode, N = 3). After 24h, the liver, spleen, lung, heart, and kidney were retrieved and analyzed for LNP transfection via NGS of reverse- transcribed CYBR RNA extracted from each organ. The CYBR prediction for the LNP library in each organ is displayed as a heatmap, with the formulation predicted to have high delivery efficiency highlighted by the red arrow and the formulation predicted to have low delivery efficiency highlighted by the blue arrow. To validate the prediction, the luciferase mRNA delivery efficiencies of the highest- and the lowest-ranking LNP in each organ were investigated and plotted in a separate experiment (1 mg / kg mRNA, i.v).

[0178] FIG. 8 - CYBR identifies an LNP that efficiently transfects human CD34+ HSPCs at a fraction of the cost of traditional screening methods. CYBR screened a 30-member library, termed A-LNPs, in a single well (N = 3, 100,000 cells / well) of a 96-well plate. The heatmap shows predicted delivery for each formulation. LNPs with high predicted delivery (A1 , red arrow) and low predicted delivery (A30 or MC3-DLin, blue arrow) were validated by a subsequent GFP mRNA delivery experiment. The LNP formulation A1 transfected 100% of HSPCs with GFP mRNA, whereas the control MC3-DLin formulation transfects <2% of the cells.

[0179] FIG. 9 - CYBR has the sensitivity needed to optimize lead LNP formulations in vivo. The lung-tropic 1014 formulation from the initial screen in FIG. 7 was optimized by varying lipid composition ratios, replacing DOPE with DSPC, or adding DOTAP. A total of 20 new formulations (B17-F LNPs) were generated and investigated for lung delivery in vivo. Two new formulations, B17-F8 and B17-F9, were identified by CYBR as superior to the original 1014 formulation. A separate experiment with luciferase mRNA demonstrated that B17-F8 and B17-F9 were better at delivering luciferase mRNA to the lung than the original 1014 formulation.

[0180] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

[0181] Accordingly, the preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e. , any elements developed that perform the same function, regardless of structure. Moreover, nothing disclosed herein is intended to be dedicated to the public regardless of whether such disclosure is explicitly recited in the claims.

[0182] The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of present invention is embodied by the appended claims. In the claims, 35 U.S.C. §112(f) or 35 U.S.C. §112(6) is expressly defined as being invoked for a limitation in the claim only when the exact phrase "means for" or the exact phrase "step for" is recited at the beginning of such limitation in the claim; if such exact phrase is not used in a limitation in the claim, then 35 U.S.C. § 112 (f) or 35 U.S.C. §112(6) is not invoked.

Claims

CLAIMSWhat is claimed is:1 . A library of nucleic acid delivery vehicles, wherein members of the library are nucleic acid delivery vehicles with different chemical compositions that comprise a barcoded RNA molecule for detecting cellular entry, wherein the barcoded RNA molecule comprises, from 5’ to 3’: (i) a first ribozyme, (ii) a barcode sequence that identifies the chemical composition of the nucleic acid delivery vehicle, and (iii) a second ribozyme, wherein the first and second ribozymes are capable of cleaving the barcoded RNA molecule to produce a 5’-OH end and a 2’,3’-cyclic phosphate end that can be ligated to one another by an RNA ligase to produce a circular RNA (cRNA) that comprises the barcode sequence.

2. The library of claim 1 , wherein each of the first and the second ribozyme is independently selected from the group consisting of: a Hammerhead ribozyme, a Hairpin ribozyme, a Hepatitis Delta Virus (“HDV”) ribozyme, a Varkud Satellite (“VS”) ribozyme, a Vg1 ribozyme, a glucosamine-6-phosphate synthase (“glmS”) ribozyme, a Twister ribozyme, a Twister Sister ribozyme, a Hatchet ribozyme, a Pistol ribozyme, an engineered synthetic ribozyme, or derivatives thereof.

3. The library of claim 1 , wherein the first and the second ribozymes are Twister ribozymes.

4. The library of claim 1 , wherein the first ribozyme comprises the sequence of SEQ ID NO: 1 and the second ribozyme comprises the sequence of SEQ ID NO: 2.

5. The library of any one of claims 1-4, wherein the RNA ligase is RtcB.

6. The library of any one of claims 1-5, wherein the nucleic acid delivery vehicles of the library are lipid nanoparticles having different chemical compositions.

7. The library of any one of claims 1-6, wherein the library includes greater than 10 members.

8. The library of any one of claims 1-7, wherein the barcode sequence has a length of 6 or more nucleotides.

9. The library of any one of claims 1-7, wherein the barcode sequence has a length of 8- 30 nucleotides.

10. A method for identifying nucleic acid delivery vehicles, the method comprising:(a) administering the library of nucleic acid delivery vehicles of any one of claims 1-9 to a plurality of cells; and(b) detecting the barcodes present in cRNAs resulting from said administering, thereby identifying, based on the barcodes detected in (b), the chemical composition of nucleic acid delivery vehicles that successfully delivered the barcoded RNA molecules.11 . The method of claim 10, wherein the method does not include cell sorting.

12. The method of claim 10 or claim 11 , wherein the plurality of cells are cells that are part of an organ or tissue.

13. The method of any one of claims 10-12, wherein the plurality of cells are from multiple different tissues.

14. The method of any one of claims 10-13, wherein the administering is in vivo and the library is administered to a non-human multicellular organism.

15. The method of claim 14, wherein the non-human multicellular organism is a mammal.

16. The method of claim 14 or claim 15, wherein said administering comprises systemic administration.

17. The method of claim 14 or claim 15, wherein said administering comprises local administration.

18. The method of any one of claims 10-17, wherein said detecting comprises nucleic acid amplification.

19. The method of any one of claims 10-18, wherein said detecting comprises nucleic acid sequencing.

20. The method of any one of claims 10-19, wherein said detecting comprises extracting nucleic acids from desired tissues or organs.

21. The method of any one of claims 10-19, wherein said detecting comprises extracting nucleic acids from heart tissue and / or lung tissue.

22. A library of nucleic acid delivery vehicles, wherein members of the library are nucleic acid delivery vehicles with different chemical compositions that comprise a barcoded ligationready RNA molecule for detecting cellular entry, wherein the barcoded ligation-ready RNA molecule comprises, from 5’ to 3’: (i) a 5’-OH end, (ii) a barcode sequence that identifies the chemical composition of the nucleic acid delivery vehicle, and (iii) a 2’,3’-cyclic phosphate end, wherein (i) and (iii) can be ligated to one another by an RNA ligase to produce a circular RNA (cRNA) that comprises the barcode sequence.

23. The library of claim 22, wherein the nucleic acid delivery vehicles of the library are lipid nanoparticles having different chemical compositions.

24. The library of claim 22 or claim 23, wherein the barcode sequence has a length of 6 or more nucleotides.

25. A method for identifying nucleic acid delivery vehicles, the method comprising:(a) administering the library of nucleic acid delivery vehicles of any one of claims 22-24 to a plurality of cells; and(b) detecting the barcodes present in cRNAs resulting from said administering, thereby identifying, based on the barcodes detected in (b), the chemical composition of nucleic acid delivery vehicles that successfully delivered the barcoded ligation-ready RNA molecules.

Images