Self-amplifying messenger RNA molecules
Modified samRNA molecules with specific structural and functional modifications address immune activation issues, ensuring prolonged antigen expression and effective immune responses.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- GLAXOSMITHKLINE BIOLOGICALS SA
- Filing Date
- 2025-12-22
- Publication Date
- 2026-07-02
Smart Images

Figure IMGF000100_0001 
Figure IMGF000100_0002 
Figure IMGF000101_0001
Abstract
Description
[0001] 70395W001 SELF-AMPLIFYING MESSENGER RNA MOLECULES
[0002] SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing, which has been submitted electronically in computer readable form in an XML format and is hereby incorporated by reference in its entirety. Said XML file, created on 16 December 2025, is named “70395W001.xml” and is 627,498 bytes in size.
[0004] FIELD OF THE INVENTION
[0005] The present invention relates to RNA molecules and compositions of RNA molecules (e.g. self-amplifying messenger ribonucleic acids (samRNA)) comprising modified nucleotides, such as N1-methyl-pseudouridine.
[0006] BACKGROUND TO THE INVENTION
[0007] Self-amplifying messenger ribonucleic acid (samRNA) molecules including split-vector self-amplifying mRNA (“trans-amplifying mRNA” herein) have the capacity to provide a transfected cell with longer expression of exogenous or heterologous nucleic acids, including nucleic acids encoding heterologous proteins such as antigens, antibodies, etc. For example, samRNA platforms can cause expression of a gene of interest in vivo for around 30 days, whereas conventional (non-replicating) mRNA can cause expression for several days. Like other exogenous RNA, samRNA and trans-amplifying RNA have the capacity to activate the innate immune system and may lead to unintended effects such as those related to introduction of the heterologous (or exogenous) nucleic acids, as well as those related to replication of exogenous RNA. The innate immune activation could suppress the activity of the heterologous nucleic acids introduced by the samRNA or the trans-amplifying RNA. For example, innate immune activation can suppress expression of an antigen encoded by the heterologous nucleic acid of the samRNA or the trans-amplifying RNA.
[0008] It has been shown that for conventional (non-replicating) mRNA, the substitution of conventional nucleotides, such as uridine with various modified nucleotides, such as uridine analogs (N1-methylpseudouridine and the like) reduces innate immune activation while preserving antigen expression in the targeted cells. However, samRNA has been shown to be negatively affected by the substitution of uridine with various uridine analogs. Consequently, there is a need for new samRNAs tolerant to modified nucleotides. In addition, there is a need70395W001 for samRNAs that reduce innate immune activation while preserving antigen expression in the targeted cells.
[0009] SUMMARY OF THE INVENTION
[0010] In one aspect, there is provided a composition comprising either (i) a first RNA molecule comprising a first RNA sequence and a second RNA molecule comprising a second RNA sequence or (ii) a first RNA molecule comprising a first RNA sequence and a second RNA sequence; the first RNA sequence encoding one or more proteins capable of replicating a selfamplifying messenger RNA (samRNA) in an intracellular environment; the second RNA sequence comprising a heterologous nucleic acid; the first and / or the second RNA molecules comprising a genus of nucleotide of which at least 10% is a subgenus thereof consisting of modified nucleotides; the first and / or second RNA sequence further comprising one or more of the modifications selected from (a)-(d):
[0011] a) a 3’ poly-adenosine monophosphate (poly(A)) tail of at least 50 nucleotides in length;
[0012] b) one or more regions of the first and / or second RNA sequence, that have a lower percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides, compared to the percentage of nucleotides that are uridine in the corresponding one or more regions of a corresponding wild type reference sequence;
[0013] c) a 3’ untranslated region (UTR) comprising a polynucleotide sequence of m(Txm)y, where x is 4 or 5, y is 6 or more, and m is independently selected from A or C; or d) a construct encoding a heterologous polypeptide interferon effector that suppresses an interferon response.
[0014] In embodiments, the first and / or second RNA molecule comprises 2, 3 or 4 of the modifications selected from (a)-(d).
[0015] In one aspect, there is provided a RNA molecule comprising a first RNA sequence and a second RNA sequence; the first RNA sequence encoding one or more proteins capable of replicating a self-amplifying messenger RNA (samRNA) in an intracellular environment; the second RNA sequence comprising a heterologous nucleic acid; the RNA molecule comprising a genus of uridine and uridine-substitutable modified nucleotides of which at least 10% of the genus are uridine-substitutable modified nucleotides; the RNA molecule further comprising one or more of the modifications selected from (a)-(d):70395W001 a) a 3’ poly-adenosine monophosphate (poly(A)) tail of at least 50 nucleotides in length;
[0016] b) one or more regions of the first and / or second RNA sequence, that have a lower percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides, compared to the percentage of nucleotides that are uridine in the corresponding one or more regions of a corresponding wild type reference sequence;
[0017] c) a 3’ untranslated region (UTR) comprising a polynucleotide sequence of m(Txm)y, where x is 4 or 5, y is 6 or more, and m is independently selected from A or C; or
[0018] d) a construct encoding a heterologous polypeptide interferon effector that suppresses an interferon response.
[0019] In embodiments, the RNA molecule comprises 2, 3 or 4 of the modifications selected from (a)-(d).
[0020] In another aspect, there is provided a DNA molecule encoding an RNA molecule described in the preceding aspects.
[0021] In a further aspect, there is provided a composition comprising an RNA molecule described in the preceding aspects and a pharmaceutically acceptable delivery vehicle.
[0022] In a further aspect, there is provided a method of eliciting an immune response against an immunogen in a subject, the method comprising administering to the subject an effective amount to elicit the immune response of the RNA molecule or the first and / or second RNA molecule or the composition.
[0023] In a further aspect, there is provided a use of the RNA molecule or the first and / or second RNA molecule or the composition for the manufacture of a medicament.
[0024] In a further aspect, there is provided a RNA molecule or the first and / or second RNA molecule or a composition for use as a medicament.
[0025] In a further aspect, there is provided a RNA molecule or the first and / or second RNA molecule or composition for use in eliciting an immune response to an immunogen in a subject.
[0026] In a further aspect, there is provided a method of manufacturing the RNA molecule or the first and / or second RNA molecule.
[0027] In a further aspect, there is provided a method of manufacturing the composition.70395W001 DESCRIPTION OF DRAWINGS
[0028] The detailed description of preferred embodiments of the invention will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, the drawings show certain, but not all, preferred embodiments. It should be understood that embodiments of the invention are not limited to the precise arrangements and instrumentalities of those shown in the drawings.
[0029] FIGS. 1A-C shows the effect of uridine (U) depletion of nsP1-4 protein genes on potency (RNA infectivity) of self-amplifying messenger ribonucleic acid (samRNA) in BHK and Vero cells. FIG. 1 A shows a schematic representation of the genomes of samRNAs used in the study. Compared to a parental unmodified samRNA A848 genome, KT20 contains uridine-depleted sequence of nsP1-4 genes. BHK (FIG. 1B) or Vero (FIG. 1C) cells were transfected in triplicates with 500 ng per well (24 well plate format) of KT20 or A848 RNAs where 0% or 100% of the uridines (U) were substituted with N1 -methylpseudouridine (ml^P) and potency (percent of eGFP positive cells) was analyzed at 16 hours post RNA transfection by flow cytometry.
[0030] FIG. 2 shows the role of the T22 region of the VEEV 3’UTR on potency of samRNAs generated with 100% ml^P (sam-ml^P). FIG. 2 shows a schematic representation of the samRNAs used in the study. Dashed boxes around the nucleotides indicate an insertion of sequence in the T22 region. Compared to KT20, construct KT88 contains a complete deletion of the T22 region of the 3’UTR, while in KT87 the T22 region was substituted with scrambled 26 nt sequence. KT95, KT96 and KT97 contain an insertion of UUUUA, UUUUUAUUUUA and UUUUUAUUUUAUUUUUC sequences respectively at the 5’ end of the T22 region of the 3’ UTR. KT98 and KT99 contain an insertion of CUUUU or UCUUUUCUUUU sequences, respectively, at the 3’ end of the T22 region of the 3’ UTR. KT100 contains an insertion of UUUUUAUUUUA sequence at the 5’ end and an insertion of UCUUUUCUUUU sequence at the 3’ end of the T22 region of KT20. It is to be understood that any T (thymidine) of any samRNA construct depicted in FIG. 2 may be replaced by a ‘U’ (uridine) and / or a ‘ml^P’ (N1-methylpseudouridine).
[0031] FIG. 3A-C shows the effect of 5’ extensions of the T22 region with UUUUA, UUUUUA and / or UUUUUC sequence on gene-of-interest expression from sam-ml^P RNAs. BHK cells were transfected in quadruplicates with 500 ng per well (24 well plate format) of the indicated sam-ml RNAs. Potency (Fig. 3A), eGFP signal intensity (Fig. 3B) or total eGFP expression70395W001 (calculated as product of potency and eGFP signal intensity, Fig. 3C) were analyzed at 16 hours post RNA transfection by flow cytometry.
[0032] FIG. 4A-C shows the effect of 3’ and 573’ extensions of the T22 region with U-rich sequences on gene-of-interest expression from sam-ml^P RNAs. BHK cells were transfected in quadruplicates with 500 ng per well (24 well plate format) of the indicated sam-ml^P RNAs. Potency (FIG. 4A), eGFP signal intensity (FIG. 4B) or total eGFP expression (calculated as product of potency and eGFP signal intensity, FIG. 4C) were analyzed at 16 hours post RNA transfection.
[0033] FIG. 5A-C demonstrates that the length of poly-A tail affects the levels of gene-of-interest expression from sam-ml^P RNAs in BHK cells. BHK cells were transfected in quadruplicates with 500 ng per well (24 well plate format) of the indicated sam-ml^P RNAs. Potency (FIG. 5A), eGFP signal intensity (FIG. 5B) or total eGFP expression (FIG. 5C) were analyzed at 16 hours post RNA transfection by flow cytometry.
[0034] FIG. 6A-D demonstrates the role of the sequence element(s) located at the 5’ end of nsP1 gene of VEEV in modulating the level of gene-of-interest (eGFP) expression from sam-ml^P RNAs. FIG. 6A is a schematic representation of the samRNAs. KT20 was modified by extending the wild type nsP1 sequence of VEEV to the 5’ first 218 or 311 nts of nsP1, thereby generating KT107 and KT108 respectively (see FIG. 6A). BHK cells in quadruplicate wells were transfected with 500 ng per well (24 well plate format) of the indicated sam-ml^P RNAs then potency (FIG. 6B), eGFP signal intensity (FIG. 6C) or total eGFP expression (FIG. 6D) were analyzed at 16 hours post RNA transfection by flow cytometry.
[0035] FIG. 7A-F demonstrates the effect of incorporating into a single samRNA genome the genetic modifications that individually improve gene-of-interest expression from sam-m1ψ. Genetic modifications that improved gene-of-interest expression from sam-m1ψ were inserted in various combinations into the genome of a parental samRNA ROC11 BJ human fibroblast cells in quadruplicate wells were transfected with 50, 150 and 500 ng per well (24 well plate format) of the indicated sam-ml^P RNAs then potency (FIG. 7A, 7D), eGFP signal intensity (FIG. 7B, 7E) or total eGFP expression (FIG. 7C, 7F) were analyzed at 16 hours post RNA transfection by flow cytometry.70395W001 FIG. 8A-E illustrates the effect of A3G substitution on gene-of-interest expression from sam-mlHJ and sam-U RNAs in Vero cells. FIG. 8A is a schematic representation of the samRNAs used in the study. The A3G mutation restoring wild-type 5’ UTR sequence was introduced into ROC11 containing poly-A sequence of 40 nts in length, or into KT 176 construct, which contains a poly-A of 80 nts in length. Vero cells in quadruplicate wells were transfected with 500 ng per well (24 well plate format) of the indicated sam-ml^ and sam-U RNAs, followed by flow cytometric analysis of potency (FIG. 8B), eGFP signal intensity (FIG. 8C), total eGFP expression (FIG. 8D) or analysis of nanoLuc expression in Vero cell lysates (FIG. 8E). As a control the cells were transfected with sam-ml^P and sam-U RNAs derived from construct KT115.
[0036] FIG. 9A-D demonstrates how epistatic interactions between the A3G mutation and d’terminal nucleotides of the sam-ml^P differentially affect the level of gene-of-interest expression (nLuc) in cells with impaired (Vero cells) or intact innate immune signaling (THP1 macrophages and BJ fibroblasts). FIG. 9A is a schematic representation of the samRNAs used in the study. Vero (FIG. 9B), THP1-derived M0 macrophages (FIG. 9C), and BJ human fibroblast (FIG. 9D) cells in quadruplicate wells were transfected with 100 ng per well (24 well plate format) of the indicated sam-ml^P RNAs. At 16 hours post RNA transfection cells were lysed, followed by assessment of nLuc activity (luminescence) in cells lysates..
[0037] FIG. 10A-F depicts the effects of co-expressing the authentic 5’-end of samRNA together with either 3A or3G nt on sam-ml^’s potency (FIG. 10A, FIG. 10D), eGFP signal intensity (FIG. 10B, FIG. 10E), and total eGFP expression (FIG. 10C, FIG. 10F; calculated as a product of potency and eGFP signal intensity) in the cells with intact innate signaling pathways. THP1-derived M0 macrophages (FIG. 10A, 10B, 10C) and BJ human fibroblast (FIG. 10D, 10E, 10F) cells in quadruplicate wells were transfected with 100 ng per well (24 well plate format) of the indicated samRNAs, and eGFP expression was analyzed by flow cytometry at 16 hours post transfection.
[0038] FIG. 11A-D illustrates how insertion of the RNA binding domain (72 amino acids) of NS1 gene of influenza A virus (NS1 RBD) into samRNA genomes affects gene-of-interest expression (nLuc) from sam-ml^P and sam-U RNAs in the cells containing impaired (Vero cells) or intact (THP1 macrophages) innate signaling pathways. FIG. 11A is a schematic representation of the samRNAs used in the study. Vero cells (FIG. 11 B) and THP1 -derived M0 macrophages (FIG.70395W001 11C, 11 D) in quadruplicate wells were transfected with 100 or 500 ng (24 well plate format) of sam-m1 or sam-U RNAs derived from constructs ROC11, KT115, KT172, KT 186, and KT187. At 16 hours post-transfection, cells were lysed, followed by assessment of nLuc activity (luminescence) in cells lysates.
[0039] FIG. 12A-C shows effects of incorporation of ml^P into samRNAs on gene-of-interest expression (nLuc) and IRF pathway activation (Lucia Luciferase expression) in THP1-dual M0 macrophages from samRNA. THP1-dual monocytes were differentiated into M0 macrophages and were transfected with 500 ng of sam-ml^P or sam-U RNAs in quadruplicate wells. At 16 hours post-transfection, cells were lysed and nLuc activity was assessed in cell culture lysates (FIG. 12A). In addition, cell culture supernatants were collected and assessed for Lucia luciferase activity (FIG. 12B).. The relative IRF pathway activation value (RIPA) was calculated as a ratio between Lucia luciferase and nLuc expression (FIG. 12C).
[0040] FIG. 13A-D shows the approaches for optimizing the expression of NS1RBD gene from the non-structural ORF of samRNAs. FIG. 13A shows a schematic representation of the samRNA genomes used in the study: * - authentic 5’-end of VEEV genome (no extra G at the 5’ end); NS1(RBD) - RNA-binding domain of NS1 protein of Influenza A virus’; NS1(Ud) - uridine-depleted sequence of NS1(RBD); UBIQ - ubiquitin gene; T2A - Thosea asigna virus 2A protease sequence; P2A - 2A protease sequence of Porcine teschovirus-1 M - start codon (M) in uridine-depleted copy of nsP1 sequence; AM - deletion of start codon (M) in uridine-depleted copy of nsP1 gene; WT218nt - wild type 218 nt sequence of 5’-terminus of nsP1 gene of VEEV;
[0041] 218 nsP1 Ud - uridine-depleted 218 nt sequence of the 5’-end of nsPI gene; IRES - internal ribosome entry site from Enterovirus A71. Vero cells and TH P1 -dual M0 macrophages were transfected in quadruplicate wells with 200 ng of sam-ml^P or sam-U RNAs (24-well plate format). At 16 hours post transfection cells were lysed, followed by assessment of nLuc activity (FIGs. 13B, 13C). In addition, cells culture supernatants from THP1-dual M0 macrophages were collected and assessed for Lucia luciferase activity. RIPA values (FIG. 13D) for each RNA was calculated as a ratio between nLuc and Lucia luciferase relative luminescence units.
[0042] FIG. 14A-D compares different strategies for expression of the NS1 RBD gene from samRNAs. Vero cells (FIG. 14A), BJ fibroblasts (FIG. 14B), and THP1-dual M0 macrophages (FIG. 14C, 14D) were seeded in 24 well plate, and quadruplicate wells were transfected with70395W001 200 ng of sam-ml^ or sam-U RNAs. At 16 hours post transfection cells were lysed, followed by assessment of nLuc activity (FIG. 14A, 14B, 140). In addition, cell culture supernatants from THP1-dual M0 macrophages were collected and assessed for Lucia luciferase activity. RIPA values for each RNA (FIG. 14D) was calculated as a ratio between nLuc and Lucia luciferase relative luminescence units (RLU).
[0043] FIG. 15A-H demonstrates the effect of uridine depletion of NS1RBD gene in the KT202, and the deletion ofXbal-Notl linker sequence in KT201 on gene-of-interest expression and IRF pathway activation by sam-ml^P or sam-U RNAs. Vero, THP1-dual M0 macrophages and BJ human fibroblast cells were transfected in quadruplicate wells with 200 ng per well (24 well plate format) of samRNAs followed by analysis of nLuc and Lucia luciferase expression at 16 hours post-transfection. FIGs. 15A, 15B, 15C, 15E, 15F, 15G show nLuc activity (RLU) in the Vero (FIGs. 15A, 15E), BJ (FIGs. 15B, 15F), and THP1-dual M0 macrophage (FIGs. 15C, 15G) cell lysates. FIGs. 15D and 15H depict a relative IRF pathway activation values (RIPA), which were calculated as a ratio between Lucia luciferase and nLuc expression in THP1-dual M0 macrophages.
[0044] FIG. 16A-D demonstrates the effect of genetic modifications that increase eGFP / nLuc expression from sam-ml^P on expression of SARS-CoV-2 Omicron BA.5 Spike (SPK) protein in Vero cells. FIG. 16A depicts the genome organization of samRNAs used in the study. * - depicts an authentic for VEEV 5’UTR structure, while G - indicates that an additional (not authentic for VEEV genome) guanine residue is added to the 5’end of the samRNA during IVT reaction. SPK001 depicts non-replicating mRNA, expressing the same SPK protein gene as all samRNAs. A30 / linker / A37 - shows a poly-A tail structure of SPK001, where a stretch of 30A residues is followed by a 10 nts linker, followed by a stretch of 37A residues. Vero cells were transfected in triplicates with 40 ng per well (96 well plate format) of sam-ml^P or sam-U RNAs, or with non-replicating mRNA SPK001. Potency (FIG. 16B), SPK signal intensity (FIG. 16C) or total SPK expression (FIG. 16D; calculated as a product of potency and SPK signal intensity values) were analyzed at 16 hours post-transfection by flow cytometry.
[0045] FIG. 17 shows potency in BJ human fibroblasts of sam-ml^P and sam-U RNAs that were encapsulated into lipid nanoparticles (RNA-LNPs). BJ cells seeded in 96 well-plates were treated in duplicate wells with 40, 13.3, 4.4, and 1.4 ng of the indicated RNA-LNPs. As a control, the cells were treated with mRNA SPKOOI-ml^P, or with media only (neg.). At 18 hours post-70395W001 transfection the samRNA potency (% of SPK positive cells) and SPK signal intensity (data not shown) were determined by High Content Imaging (HCI). The triangle symbols below the X-axis indicate that RNA-LNP concentrations decrease in the following order: 40ng, 13.3ng, 4.4ng, and 1.4 ng.
[0046] FIG. 18 shows a comparison of potency of sam-ml^P and sam-U RNA-LNPs in THP1-dual MO macrophages. THP1-dual cells were differentiated into MO macrophages and treated in duplicate wells with 40, 13.3, 4.4, and 1.4 ng of the indicated RNA-LNPs. As a control, the cells were treated with mRNA-LNP SPKOOI-ml^P, or with media only (neg.). At 18 hours posttreatment the potency (% of SPK positive cells) of samRNA and SPK signal intensity (data not shown) were determined by High Content Imaging (HCI). The triangle symbols below X axis indicate that RNA-LNP concentrations decrease in the following order: 40ng, 13.3ng, 4.4ng, and 1.4 ng.
[0047] FIG. 19A-B depicts absolute (FIG. 19A) and relative (FIG. 19B) levels of IFN-p in the supernatants of BJ cells treated with 40 ng of RNA-LNPs. The IFN-p concentration (FIG. 19A) was assessed in the supernatants of BJ cells using VeriKine-HS Human IFN-Beta Serum ELISA Kit, and it is expressed as pg / mL of cell culture supernatant. To calculate relative IFN-p expression values (FIG. 19B), the absolute IFN-p concentrations (FIG. 19A) were divided by the total SPK expression values.
[0048] FIG. 20A-D shows the comparison of IFN-p production and IRF pathway activation (Lucia luciferase expression) in THP1-dual MO macrophages cells treated with RNA-LNPs. The IFN-p concentration (FIG. 20A) was assessed in the supernatants of THP1-dual MO macrophages treated with 40 ng / well of RNA-LNPs using VeriKine-HS Human IFN-Beta Serum ELISA Kit, and it is expressed as pg / mL of cell culture supernatant. To calculate relative IFN-p expression values (FIG. 20B), absolute IFN-p concentrations (FIG. 20A) were divided by the total SPK expression values. Lucia luciferase expression was determined in supernatants collected from cells treated with 40, 13.3, 4.4, and 1.4 ng of RNA-LNPs, followed by calculation of Integrated Lucia Luciferase values using AUC function implemented in the Prism9 software (FIG. 20C). To calculate the Relative IRF response values, Integrated Lucia Luciferase values were divided by Integrated Total SPK Expression values (FIG. 20D).70395W001 FIG. 21A-B shows a comparison of potency (FIG. 21 A) and total SPK expression (FIG.
[0049] 21 B) in monocyte-derived dendritic cells (moDC). Human peripheral blood mononuclear cells (hPBMC) were differentiated into moDC and treated in duplicates with 150, 50, and 16.6 ng of the indicated RNA-LNPs. As a control the moDCs were treated with media only (Media). At 22 hours post treatment cells were fixed and SPK protein expression was analyzed by High Content Imaging to determine potency (FIG. 21A) and SPK signal intensity values (data not shown). Total SPK expression values (FIG. 21 B) were calculated as a product of potency and SPK signal intensity values. The triangle symbols below the X axis indicate that RNA-LNP concentrations decrease in the following order: 150 ng, 50 ng, and 16.6 ng.
[0050] FIG. 22A-C shows the comparison of neutralizing antibody responses elicited against SARS-CoV-2 spike of Omicron BA.5 pseudovirus after immunization with the indicated samRNAs or non-replicating mRNA SPK001. Female BALB / c mice (n=6 per group) were immunized with 0.15pg or0.015pg of sam-ml^P and sam-U RNA formulated into RV94 (2-(5-((4-((1,4-dimethylpiperidine-4-carbonyl)oxy)hexadecyl)oxy)-5-oxopentyl)propane-1,3-diyl dioctanoate) LNP. As a control, mice were inoculated with a non-replicating mRNA SPK001-ml^P formulated at either 0.15 pg or 0.015 pg dosages, or saline. Mice received two intramuscular injections three weeks apart. The vaccine-specific antibody responses were measured three weeks after the first immunization (day 21; FIG. 22A bottom) and two weeks after the second immunization (day 35; FIG. 22A top). Dots represent individual mouse responses, the horizontal lines represent the geometric mean titers, and the error bars represent 95%CI. FIGs. 22B, 22C show geometric means ratios for Omicron BA.5 spike pseudovirus neutralization titers after the 1st(FIG. 22B) and 2nd(FIG. 22C) immunizations. Vertical lines represent geometric mean ratios and error bars represent 90% confidence interval (LCI - lower limit of confidence interval).
[0051] FIG. 23 depicts a schematic representation of the sequence structure features observed in some exemplary alphavirus-based samRNA vaccines.
[0052] FIG. 24 depicts a proposed mechanism of self-amplification and expression of exemplary synthetic samRNA vaccines.
[0053] DETAILED DESCRIPTION OF THE INVENTION DEFINITIONS70395W001 Unless defined otherwise, all technical and scientific terms herein have the same meaning as commonly understood by one of ordinary skill in the art. The following terminology will be used. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
[0054] The articles “a” and “an” herein refer to one or to more than one ( / .e., to at least one) of the grammatical object of the article.
[0055] “Or” herein refers to “one or a combination of” as in “one or a combination of A, B, or C.” A list of alternatives conjoined by “and” from which at least one alternative is selected (e.g. Markush language), intends all combinations within the list of alternatives.
[0056] To avoid reciting transitional language such as “X comprises, consists of, or is... A, B, or C,” in each and every instance, recitation of “X comprises an A, a B, or a C” herein contemplates embodiments wherein “X consists of an A, a B, or a C,” “X consists of an A, a B, a C, or combinations thereof,” “X consists of one or more of an A, a B, or a C,” “X is one or more of an A, a B, or a C,” “X is an A, a B, a C, or combinations thereof,” “X is selected from an A, a B, or a C,” “X is selected from an A, a B, a C, or combinations thereof,” “X is selected from the group consisting of an A, a B, a C, and combinations thereof,” “X is selected from at least one of the group consisting of an A, a B, and a C,” or “X is selected from one or more of the group consisting of an A, a B, and a C”. An embodiment listing “X comprises A, B, or C” — contemplates embodiments which specifically exclude any individual or combinations of components such as “X comprises A, but not B or C” or “X comprises A but does not comprise B or C.”
[0057] A list of alternative compounds after the transitional language does not imply that a chemical bond exists between them. For example, “a zwitterionic lipid comprising 1,2-diheptadecanoyl-sn-glycero-3-phosphocholine (17:0 PC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (19:0 PC), or 1,2-diarachidoyl-sn-glycero-3-phosphocholine (20:0 PC)” is meant to convey that the category (i.e. genus) of zwitterionic lipids can include within that category discrete lipids (i.e. species) such as DSPC, 17:0 PC, 19:0 PC, and 20:0 PC without being limited to the interpretation, for example, that the zwitterionic lipid has covalently bound to it one or more of DSPC, 17:0 PC, 19:0 PC, and 20:0 PC. As noted above, “a” or “an” includes “more than one” discrete items within the category; therefore each of the terms after the “comprising” or other supported term can include a sub-genus, and each need not necessarily be a species (e.g. the noble gas comprising a helium atom (a helium-4, a helium-3, or a helium-6), a neon atom (a neon-20, a neon-22, or a neon-23), an argon atom (an70395W001 argon-40, an argon-38, or an argon-42), or a krypton atom (a krypton-85, a krypton-95, or a krypton-92)).
[0058] " About" as used herein when referring to a measurable value such as an amount, a temporal duration, a quantum of measurement, and the like, is meant to encompass variations of + / - 20%, + / -10%, + / - 5%, + / -1%, or + / - 0.1% from the specified value that distinguishes the value from the adjacent ordered values in the list.
[0059] For illustrative but non-limiting purposes, “alphavirus” includes Venezuelan equine encephalitis virus (VEE: e.g. Trinidad donkey,, etc.), Semliki Forest Virus (SFV), Sindbis virus, Ross River virus, Western equine encephalitis virus, Eastern equine encephalitis virus, Chikungunya virus, S. A. AR86 virus, Everglades virus, Mucambo virus, Barmah Forest virus, Middelburg virus, Pixuna virus, O’nyong-nyong virus, Getah virus, Sagiyama virus, Bebaru virus, Mayaro virus, Una virus, Aura virus, Whataroa virus, Banbanki virus, Kyzylagach virus, Highlands J virus, Fort Morgan virus, Ndumu virus, and Buggy Creek virus. See, e.g., Rupp et al (2015) J. Gen. Virology 96:2483-500. An " RNA replicon," or "self-amplifying messenger RNA (samRNA)" is an RNA molecule which can direct its own amplification once it is introduced into the intracellular environment. The RNA replicon or samRNA encodes one or more proteins that are capable of amplifying the RNA replicon or samRNA in an intracellular environment. For instance, an RNA replicon or samRNA may be constructed from an alphavirus so that it encodes nsP1-4 (e.g., non-structural protein 1 (nsP1, a.k.a. non-structural alphavirus protein 1), nsP2, nsP3, and nsP4, e.g., further alphavirus nsP1-4). “Capable” is used to refer to the ability of these proteins to co-opt intracellular proteins to thereby amplifying the RNA replicon or samRNA once said RNA replicon or samRNA are introduced into the cell, and the cell’s transcriptional and translational machinery causes expression of said proteins. “Capable” is also used to refer to the requirement that the cell provide the nucleotides necessary to produce the new strand of samRNA or RNA replicon. These one or more proteins that amplify the RNA replicon or samRNA are encoded together or separately on one or more sequences of the samRNA or RNA replicon. These one or more RNA sequences that together encode the one or more proteins that amplify the RNA are, as RNA sequences, cis-acting RNA sequences. The one or more proteins that amplify the RNA replicon or samRNA are cis-acting proteins. The term alphavirus may include chimeric alphaviruses (e.g., as described by Perri et al., (2003) J. Virol.
[0060] 77(19): 10394-403) that contain genome sequences from more than one alphavirus. See, e.g., the TC83CR chimeric replicon of WO2014170493.
[0061] In some embodiments, a composition comprising a first RNA molecule comprising a first RNA sequence and a second RNA molecule comprising a second RNA sequence is provided,70395W001 the first RNA molecule and second RNA molecule together being able to direct their own amplification once introduced into the intracellular environment. Therefore, that which is encoded in individual sequences of the samRNA or the RNA replicon can be divided out into discrete RNA molecules and introduced together into the cell, and together these first and second RNA molecules encode one or more proteins capable of amplifying the first and / or second RNA molecules in an intracellular environment. This plurality of RNA molecules are collectively called trans-amplifying mRNA.
[0062] In some embodiments provided is “self-amplifying messenger RNA” (samRNA) and in other embodiments, provided are a first RNA molecule and a second RNA molecule which are collectively trans-amplifying mRNA. In this regard, contemplated are samRNA or an RNA replicon, which is a stand-alone RNA molecule, ( / .e., samRNA). Also contemplated is trans-amplifying mRNA. Both the samRNA and the trans-amplifying mRNA are contemplated to deliver a heterologous nucleic acid to a cell ( / .e., a second RNA molecule or a second RNA sequence) and also deliver one or more nucleic acids that encode one or more proteins capable of replicating or amplifying the samRNA or the trans-amplifying mRNA in the intracellular environment. By delivering the one or more nucleic acids that encode one or more proteins capable of replicating or amplifying the samRNA or the trans-amplifying mRNA, it is contemplated that the one or more nucleic acids that encode one or more proteins capable of replicating or amplifying the samRNA or the trans-amplifying mRNA will be amplified in the cell by said proteins and that the heterologous nucleic acid will be amplified in the cell by said proteins. In this regard, the samRNA is self-amplifying. The first and second RNA molecules, collectively trans-amplifying mRNA, is also self-amplifying. However, in some embodiments of the trans-amplifying mRNA, the heterologous nucleic acid is separated on a stand-alone nucleic acid molecule from the one or more nucleic acids that encode the one or more proteins capable of amplifying the trans-amplifying mRNA in the intracellular environment. In this embodiment, the heterologous nucleic acid is understood not to be self-amplifying by itself even though the overall composition of the plurality of RNA molecules is self-amplifying. Therefore, “a first RNA molecule comprising a first RNA sequence and a second RNA molecule comprising a second RNA sequence” is used to refer to a plurality of RNA molecules that together have all the components ( / .e., sequences, regions, etc.) of the “stand-alone” samRNA ( / .e., a first RNA molecule, or a first RNA sequence, and one or more second RNA molecules, or one or more second RNA sequences, wherein the first RNA molecule, or first RNA sequence, encodes one or more proteins capable of replicating the samRNA or the trans-amplifying mRNA in an intracellular environment, and one or more second RNA molecules, or the one or more second70395W001 RNA sequences, comprising a heterologous nucleic acid), while also, avoiding any misinterpretation wherein it is erroneously believed that each and every RNA molecule in the trans-amplifying mRNA must be self-amplifying.
[0063] “One or more proteins capable of replicating” the samRNA, or the trans-amplifying mRNA “in an intracellular environment” refers to those above-noted proteins that are at least as a collective capable of causing such self-amplification or auto-amplification. The example of alphavirus non-structural protein-1 (nsP1), nsP2, nsP3, and nsP4 is illustrative of such a collective. Non-structural protein 1 is an mRNA capping enzyme, which possesses both guanine-7-methyltransferase (MTase) and guanylyltransferase (GTase) activities, where they direct the methylation and capping of newly synthesized viral genomic and subgenomic RNA. These enzymes synthesize a 5’ cap on newly synthesized strands of the samRNA or the trans-amplifying mRNA. This 5’ cap prevents the mRNA from being degraded by cellular 5' exonucleases, thereby promoting retainment of newly synthesized strands. But by itself, nsP1 does not synthesize new strands of nucleic acid. Non-structural protein 2 comprises a helicase for synthesis of new strands. Non-structural protein 2 provides for RNA triphosphatase activity for 5’ capping. Non-structural protein 2 also comprises a papain-like cysteine protease, which can process the preprotein comprising nsP1-4. However, by itself, nsP2 cannot replicate new strands of nucleic acid. Non-structural protein 3 does not by itself replicate new strands of nucleic acid, even though it may regulate transcription from the messenger RNA. Non-structural protein 4 is a highly conserved RNA-dependent RNA polymerase. But it must be isolated from the other proteins in the preprotein comprising nsP1-4 ( / .e., by the papain-like domain of nsP2). Its enzymatic activity in part might require some the helicase activity or protease activity from nsP2 or capping activity of nsP1. Accordingly, nsP1-4, collectively are capable of replicating the samRNA or the trans-amplifying mRNA in an intracellular environment.
[0064] The at least one of the one or more proteins that amplify or replicate the samRNA, or the trans-amplifying mRNA in an intracellular environment, or the one or more proteins that are capable of amplifying or replicating the samRNA, or the trans-amplifying mRNA once the samRNA, or the trans-amplifying mRNA are / is in an intracellular environment, may be from an alphavirus. The one of the one or more proteins that amplify the samRNA, or the trans-amplifying mRNA may be from an alphavirus. The at least one of the one or more proteins that amplify the samRNA, or the trans-amplifying mRNA may be from a virus other than an alphavirus. The one or more proteins that amplify the samRNA, or the trans-amplifying mRNA may be from a virus other than an alphavirus. The virus other than an alphavirus may comprise a positive-stranded RNA virus. The virus other than an alphavirus that is a positive-strand RNA70395W001 virus may comprise a picornavirus, flavivirus, rubivirus, pestivirus, hepacivirus, calicivirus, or coronavirus.
[0065] The samRNA or the trans-amplifying mRNA may comprise virally-derived cis-acting elements which provide for said self-amplification, self-replication, or auto-amplification in an intracellular environment.
[0066] Suitable wild-type cis-acting alphavirus sequences are well-known and are available from sequence depositories, such as the American Type Culture Collection, 10801 University Boulevard, Manassas, Virginia, U. S. Representative examples of suitable alphaviruses include (by ATCC deposit number) Aura (ATCC VR-368), Bebaru virus (ATCC VR-600, ATCC VR-1240), Cabassou (ATCC VR-922), Chikungunya virus (ATCC VR-64, ATCC VR-1241), Eastern equine encephalomyelitis virus (ATCC VR-65, ATCC VR-1242), Fort Morgan (ATCC VR-924), Getah virus (ATCC VR-369, ATCC VR-1243), Kyzylagach (ATCC VR-927), Mayaro virus (ATCC VR-66; ATCC VR-1277), Middleburg (ATCC VR-370), Mucambo virus (ATCC VR-580, ATCC VR-1244), Ndumu (ATCC VR-371), Pixuna virus (ATCC VR-372, ATCC VR-1245), Ross River virus (ATCC VR-373, ATCC VR-1246), Semliki Forest (ATCC VR-67, ATCC VR-1247), Sindbis virus (ATCC VR-68, ATCC VR-1248), Tonate (ATCC VR-925), Triniti (ATCC VR-469), Una (ATCC VR-374), Venezuelan equine encephalomyelitis (ATCC VR-69, ATCC VR-923, ATCC VR-1250 ATCC VR-1249, ATCC VR-532), Western equine encephalomyelitis (ATCC VR-70, ATCC VR-1251, ATCC VR-622, ATCC VR-1252), Whataroa (ATCC VR-926), and Y-62-33 (ATCC VR-375).
[0067] The term "conservative sequence modifications" within the context of amino acid sequences refers to amino acid modifications that do not significantly affect or alter the binding characteristics of the antigen, immunogen, protein, antibody, or antibody fragment containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into an antigen, an immunogen, a protein, an antibody, or an antibody fragment by, for example, site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Similar side chains include categorization by substitution of and with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).70395W001 “Antigens” refers to a molecule that provokes an adaptive immune response and that can be bound by a protein comprising complementarity-determining regions such as an antibody or a T cell receptor (e.g., causing an immune system to produce antibodies against the antigens). Herein, use of the term “antigen” encompasses immunogenic / antigenic proteins and immunogenic / antigenic fragments (e.g., an immunogenic / antigenic fragment that induces (or is capable of inducing) an immune response to a pathogen).
[0068] “Sequence,” “nucleic acid,” or “region” as used within the context of a nucleic acid includes information about the sense ( / .e. positive) and anti-sense ( / .e. negative, e.g. reverse complementary) sequences of the same nucleic acid. A “sequence,” “nucleic acid,” or “region” that “encodes” a coding sequence, wherein the coding sequence is transcribed and / or translated, includes information about the sense and antisense (e.g. reverse complementary) sequences of the same nucleic acid. The coding sequences may encode a heterologous polypeptide. The heterologous polypeptide may comprise an immunogen (a.k.a. antigens). The coding sequence may encode an antibody. The antibody may be an antibody against the immunogen or antigen. The immunogen or antigen may comprise a venom, a poison, an allergen, a cancer antigen, a bacterial antigen, a viral antigen, a fungal antigen, a parasite antigen, or a fragment thereof. That is, the antibody against an immunogen or an antigen may be an antibody against a venom, a poison, an allergen, a cancer antigen, a bacterial antigen, a viral antigen, a fungal antigen, a parasite antigen, or a fragment thereof. The coding sequence may encode an immunogen or an antigen, which is a venom, a poison, an allergen, a cancer antigen, a bacterial antigen, a viral antigen, a fungal antigen, a parasite antigen, or a fragment thereof.
[0069] The coding sequence can encode a heterologous polypeptide, which has a therapeutic use. For example, a subject can be deficient in absolute or relative activity of the protein by, for example, having a defective coding region, regulatory region, or regulatory elements for the gene encoding the protein. The administered RNA can provide the coding sequences or regulatory elements therefor for said protein to compensate for said deficiency. The heterologous polypeptide can comprise an immunotherapeutic molecule or an enzyme. For example, the enzyme may comprise a galactose-1 -phosphate uridylyltransferase (GALT) or acid sphingomyelinase, which would be administered to a subject having reduced or deficient activity for the native enzyme, i.e. someone having galactosemia or Niemann-Pick disease respectively.
[0070] This contemplation and support of both sense and antisense strands for the sequence, nucleic acid, or region is due to the property of a nucleic acid to undergo semi-conservative replication whereby genetic information is retained. In semi-conservative replication, the two70395W001 strands of double-stranded nucleic acid are separated ( / .e. melt or are separated by a helicase), and each of the two strands are used as a template from which a newly synthesized, reverse complementary strand is formed. That is, in semi-conservative replication, the genetic information, whether as sense or antisense is preserved, and a protein, immunogen, miRNA, or promoter, for example, may be produced from the initial strand or strands synthesized therefrom regardless of whether the initial strand is sense or antisense.
[0071] Within the context of samRNA and trans-amplifying mRNA, semi-conservative replication provides for the propagation of, for example, the information encoding the antigen regardless of whether the sequence encoding the antigen was sense or antisense. In this regard, it is understood that the samRNA or the trans-amplifying mRNA can comprise one or more sequences that encode one or more proteins capable of replicating the samRNA or trans-amplifying mRNA in an intracellular environment, and that these sequences that encode the one or more proteins capable of replicating the samRNA or trans-amplifying mRNA in an intracellular environment are encoded in a sense or positive-strand orientation. It is at least the translation of the one or more proteins capable of replicating the samRNA or trans-amplifying mRNA from the samRNA or trans-amplifying mRNA in its original form (c.f. daughter mRNA molecules or replicated mRNA molecules), and as it entered the cell that does the translating, that at least qualify samRNA or trans-amplifying mRNA as being messenger RNA.
[0072] The above-noted support and contemplation of sense and antisense strands applies not only to a samRNA or trans-amplifying mRNA, but also to the making and use of a conventional RNA, which is often transcribed from DNA and plasmids, which may encode sense or antisense information, depending upon the step of the manufacture of the mRNA. To illustrate how “sequence,” “nucleic acid,” or “region” as used within the context of a nucleic acid includes information about the sense ( / .e. positive) and anti-sense, if a specific sequence, called “A”, is listed as having the sequence of 5’-ATGG-3’ in the sense strand ( / .e. positive strand) then it is contemplated and supported that A also has the sequence of 3’-TACC-5’ in the antisense strand ( / .e. negative strand) or complementary strand ( / .e. A comprises 5’-ATGG-3’ or 3’-TACC-5’), if present.
[0073] As statements above provide, “sequence,” or “region,” as used herein, unless otherwise specified, also contemplates and supports sequences incorporating different forms of nucleic acids, i.e. RNA and DNA, of the same information, or sequences incorporating differing nucleotides found in the different forms of the nucleic acids (i.e. uridines in RNA and thymidines in DNA), as well as sense and anti-sense (e.g. reverse complementary) information therein. For example, RNA may be produced from plasmids of DNA, and thereby the sequence of the70395W001 plasmid contemplates and supports the sequence of the RNA and vice versa. Since the substitution of standard nucleotides with modified nucleotides are contemplated herein (e.g. the substitution of uridines with N1 -methylpseudouridines (ml^P) is contemplated herein), a sequence, or region herein also contemplates and supports sequences incorporating analogs of the standard nucleotides (i.e. uridines) herein. To illustrate, if A in RNA (sense) is 5’-AUGG-3’, A also comprises 5’-ATGG-3’, being the sense DNA, and 3’-TACC-5’ being the anti-sense DNA, as well as 3’-UACC-5’, being the antisense RNA. To also illustrate, 5’-AUGG-3’ also supports and contemplates the sequence of S’-A^IM^GG-S’, as well as 3’-(m1l4J)ACC-5.’ To distinguish between sense and anti-sense (e.g. complementary) sequences, a prime symbol (‘) may be used, i.e. for ease of tracking original genomic material, transcripts, first strand synthesis, second strand synthesis, sense, and antisense strands. To further illustrate, if a first singlestranded region comprises 5’-AATGATACGGCGACCACCGA-3’, then that first single-stranded region also supports and comprises 5’-TCGGTGGTCGCCGTATCATT-3’.
[0074] A “first” and a “second” are provided herein, such as “a first sequence” and “a second sequence” or “a first RNA sequence” and “a second RNA sequence”. It is to be understood that the second RNA sequence is not necessarily downstream (3’) of the first RNA sequence or that it is not necessarily upstream (5’) of the first RNA sequence either. “First” or “second” with regard to an “RNA sequence” is not meant to connote the order along a stand-alone molecule, but rather “first” and “second” are used for nominative convenience. In this regard, a “first” or “second” or any numbered thing is to be understood to use such numbering as to differentiate between said things.
[0075] “Identity,” “homology,” and within this context, “percent identity” or “percent homology” take the following definitions depending upon whether it is an amino acid sequence or a nucleic acid sequence. “Identity” or “homology” (i.e. percent identity) with respect to an amino acid sequence is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the reference amino acid sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. The percent identity is defined as the nucleotide or protein basic local alignment search tool (BLAST) from the United States Government’s National Library of Medicine, National Center for Biotechnology Information (blast.ncbi.nlm.nih.gov / Blast.cgi) as available on the earliest effective priority date of these corresponding applications using align two or more sequences and optimized for default settings. For nucleotide sequences, the default settings are to include highly similar sequences, 100 max target sequences, automatically adjusting parameters for short input sequences,70395W001 expected threshold of 0.05, word size of 28, max matches in a query range of 0, match / mismatch scores of 1 / -2, linear gap costs, filtering low complexity regions, and mask for lookup tables. For protein sequences, the default settings are to include non-redundant protein sequences, “blastp (protein-protein BLAST),” max target sequences of 100, automatically adjusting parameters for short input sequences, expected threshold of 0.05, word size of 3, max matches in a query range of 0, matrix of BLOSUM62, gap costs of Existence: 11, Extension: 1, compositional adjustments of conditional composition score matrix adjustment, no filters for low complexity regions, and no masking for lookup table or lower case letters.
[0076] “Identity” or “homology” (i.e. percent identity) with respect to a nucleic acid sequence is defined herein as the percentage of nucleotides in the candidate sequence that are identical with the reference nucleic acid sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. The exchange of uridine and thymidine shall be equivalent (i.e. not taken into account) for calculating percent identity. The substitution of uridine or thymidine with a uridine- or thymidine-substitutable modified nucleotide (i.e. U substituted with ml^P) shall be equivalent (i.e. not taken into account) for calculating percent identity. The substitution of adenosine with an adenosine-substitutable modified nucleotide shall be equivalent (i.e. not taken into account) for calculating percent identity. The substitution of guanosine with a guanosine-substitutable modified nucleotide shall be equivalent (i.e. not taken into account) for calculating percent identity. The substitution of cytosine with a cytosine-substitutable modified nucleotide shall be equivalent (i.e. not taken into account) for calculating percent identity. Where the present disclosure refers to a sequence by reference to a UniProt or Genbank accession code, the sequence referred to is the current version at the filing date of the earliest effective filing date.
[0077] “Nucleic acid,” “polynucleotide,” and “oligonucleotide” as used herein all have the same meaning and they are inherently composed of a sequence of nucleotides, each nucleotide comprising one, two, or three phosphates and a nucleoside, a nucleoside comprising a pentose sugar (e.g. deoxyribose and ribose) and a nucleobase (e.g. a purine comprising adenine or guanine and a pyrimidine comprising cytosine, uracil, N1 -methyluracil, and thymine). The nucleosides (i.e. sugar and nucleobase) can be standard nucleosides (i.e. adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine (a.k.a. deoxythymidine), uridine, deoxyuridine, cytidine, or deoxycytidine), or they may be modified nucleosides (e.g. pseudouridine (a.k.a. 5-([3-D-Ribofuranosyl)pyrimidine-2,4(1H,3H)-dione or 5-[(2S,3R,4S,5R)-3,4-Dihydroxy-5-(hydroxymethyl)oxolan-2-yl]pyrimidine-2,4(1H,3H)-dione, CAS No. 1445-07-4, PubChem CID 15047), N1 -methyluridine, N1 -methylpseudouridine (a.k.a. 5-[(2S,3R,4S,5R)-3,4-70395W001 Dihydroxy-5-(hydroxymethyl)oxolan-2-yl]-1-methylpyrimidine-2, 4-dione, CAS No. 13860-38-3, PubChem CID 99543), or deoxyribose-containing or ribose-containing forms thereof). A “nucleic acid,” “polynucleotide,” and “oligonucleotide” can be a stand-alone molecule ( / .e. an RNA molecule) or they may be “region,” or “sequence” therein, and in this regard, the use of “region,” or “sequence” is used to distinguish between such and a stand-alone molecule.
[0078] The term “genus of nucleotide” refers to a class of nucleotides comprising one of the standard nucleosides ( / .e. adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine (a.k.a. deoxythymidine), uridine, deoxyuridine, cytidine, or deoxycytidine) and modified nucleotides thereof. The genus of nucleotide may be uridine and uridine-substitutable modified nucleotides, such genus of nucleotide therefore consisting of uridine and uridine-substitutable modified nucleotides. The genus of nucleotide may be cytidine and cytidine-substitutable modified nucleotides, such genus therefore consisting of cytidine and cytidine-substitutable modified nucleotides. The genus of nucleotide may be guanosine and guanosine-substitutable modified nucleotides, such genus therefore consisting of guanosine and guanosine-substitutable modified nucleotides. The genus of nucleotide may be adenosine and adenosine-substitutable modified nucleotides, such genus therefore consisting of adenosine and adenosine-substitutable modified nucleotides. With reference to the genus of nucleotide, a “subgenus thereof consisting of modified nucleotides” refers to class of modified nucleotides comprised within the genus of nucleotide. In other words, a class of nucleotides comprising no standard nucleosides. The term “modified nucleotide” is defined elsewhere herein. For example, comprised within the genus of uridine and uridine-substitutable modified nucleotides is the subgenus thereof consisting of uridine-substitutable modified nucleotides. Therefore, for an “RNA molecule comprising a genus of uridine and uridine-substitutable modified nucleotides of which at least 10% is a subgenus thereof consisting of uridine-substitutable modified nucleotides” or “RNA molecule comprising a genus of uridine and uridine-substitutable modified nucleotides of which at least 10% of the genus are uridine-substitutable modified nucleotides”, this means that 10% of the uridines in the RNA molecule are replaced with uridine-substitutable modified nucleotides. To illustrate further, consider an RNA molecule of 100 nucleotides in length having 10 uridines and 10 uridine-substitutable modified nucleotides, such RNA molecule comprises a genus of uridine and uridine-substitutable modified nucleotides of which 50% is a subgenus thereof consisting of uridine-substitutable modified nucleotides.
[0079] The term “construct” refers to a nucleic acid that encodes polypeptide sequences described herein. A construct can be delivered to a subject as a RNA component of a samRNA, or a construct may also refer to the nucleic acid, such as DNA, from which the RNA construct is70395W001 transcribed. Thus, by “construct” is intended a nucleic acid that encodes polypeptide sequences described herein, and may comprise DNA, RNA, or non-naturally occurring nucleic acid monomers.
[0080] The term “heterologous polypeptide” includes a heterologous glycoprotein of the heterologous polypeptide, a heterologous lipo-protein of the heterologous polypeptide, a heterologous lipo-glyco-protein of the heterologous polypeptide, and other terms for the protein that is the result of the post-translational modification of the heterologous polypeptide as translated. In this regard, the heterologous polypeptide may be translated from the sequence that encodes the heterologous polypeptide once the recombinant RNA is in a cell. The translated heterologous polypeptide, as encoded by the sequence that encodes the heterologous polypeptide, may have moieties to which post-translational modification adds the sugars, lipids, lipids and sugars, and other post-translational modifications. Accordingly, “the sequence encodes a heterologous polypeptide” means and refers to a sequence that encodes a heterologous polypeptide and post-translational products thereof, including glycoproteins thereof, lipoproteins thereof, lipo-glycoproteins thereof, and post-translational products thereof. The sequence encoding the heterologous peptide comprises the heterologous nucleic acid. The term “heterologous polypeptide” includes a pre-form and / or a pro-form of a biologically active molecule of the heterologous polypeptide and combinations thereof with the aforementioned post-translationally modified heterologous polypeptide, including heterologous glycoprotein of the heterologous polypeptide, a heterologous lipo-protein of the heterologous polypeptide, a heterologous lipo-glyco-protein of the heterologous polypeptide (e.g. pre-pro-insulin and respiratory syncytial virus pre-fusion g / ycoprotein).
[0081] The term “immunogen” or also known as an "antigen" (Ag) refers to a molecule that provokes an immune response and can be bound by a protein comprising complementary-determining regions such as an antibody or a T-cell receptor. An antibody includes a B-cell receptor ( / .e. an antibody complexed with CD79A and CD79B). As noted above, the recombinant RNA molecules can comprise a sequence that encodes an immunogen.
[0082] The above-noted immune response against the antigen may involve either antibody production against the antigen ( / .e. antibody-antigen binding), or the activation of specific immunologically-competent cells to the antigen ( / .e. T-cell receptor binding to the antigen), or both. Any macromolecule, including virtually all proteins or peptides, and further including all proteins and peptides comprising post-translational modifications such as the additions of sugars, lipids, and combinations thereof, can serve as an antigen. Antigens can be derived from recombinant or genomic nucleic acids. Any nucleic acid, which comprises a nucleotide70395W001 sequence or a partial nucleotide sequence encoding a protein that elicits an immune response thereby encodes an "antigen" or “immunogen.” An antigen or immunogen may be encoded by a full-length nucleotide sequence of a gene. Antigens or immunogens may be encoded by a partial nucleotide sequence and partial nucleotide sequences of more than one gene. The antigen or immunogen may be the full-length native protein or proteins. The antigen or immunogen may be a truncated portion of the full-length native protein or proteins. These nucleotide sequences may be arranged in various combinations to encode polypeptides that elicit the desired immune response. An antigen therefore need not be encoded by a "gene" at all. An antigen can be generated, synthesized, or derived from a biological sample and the amino acid sequence of the protein antigen might be reverse translated or codon optimized to generate a polynucleotide sequence that then encodes the antigen. With regard to the antigen being a full-length or truncated protein and with regard to the antigen activating a T-cell, it is understood that the cells expressing the RNA will express and process the antigen in the intracellular environment into antigenic peptides that can be bound by a major histocompatibility complex (MHC) molecule so that a T-cell receptor may recognize the MHC-presented antigen.
[0083] Such a biological sample can include, but is not limited to a pathogen, a tissue sample, a tumor sample, a cell, or a fluid with other biological components. The pathogen can include a bacteria or a virus. The immunogen or antigen may comprise a venom, a poison, an allergen, a cancer antigen, a bacterial antigen, a viral antigen, a fungal antigen, a parasite antigen, or a fragment thereof.
[0084] The term "antibody," as used herein, refers to an immunoglobulin molecule, which comprises three heavy-chain complementary-determining regions and three light-chain complementary-determining regions (collectively an antigen-determining region), and therefrom specifically binds with an antigen. An antibody can comprise the quintessential “Y” shaped immunoglobulin which comprises two arms and a stem and which comprises two heavy-chains and two light-chains. Each arm comprises a variable region which comprises said light-chain and heavy-chain complementary-determining regions, and each arm comprising a light-chain and a portion (CH1 region) of the heavy-chain. Each stem comprises two portions of a heavychain, each portion comprising a CH2 region and a CH3 region. That is, antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies can also be fragments of said intact antibody, wherein the fragment comprises said three heavy-chain complementary-determining regions and said three light-chain complementary-determining regions ( / .e. said antigen-determining regions), and therefrom specifically binds with an antigen. The antibodies70395W001 may exist in a variety of forms including, for example, Fv, Fab, F(ab)2, linear antibodies, and single chain antibodies (scFv). Antibodies can include polyclonal antibodies, monoclonal antibodies, humanized antibodies, human antibodies, bispecific antibodies, and multi-specific antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, N. Y.; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).
[0085] The terms “protein”, “polypeptide” and “peptide” are used interchangeably herein and refer to any peptide-linked chain of amino acids, regardless of length or post-translational modification (e.g. phosphorylation or addition of sugars, lipids, or combinations thereof). It should also be understood that the term “antigen” encompasses full length proteins, truncated proteins, modified proteins, and peptides.
[0086] The term "post-translational" used herein refers to events that occur after the translation of a nucleotide triplet into an amino acid and the formation of a peptide bond to the proceeding amino acid in the sequence. Such post-translational events may occur after the entire polypeptide was formed or already during the translation process on those parts of the polypeptide that have already been translated. Post-translational events typically alter or modify the chemical or structural properties of the resultant polypeptide. Examples of post-translational events include the addition of sugars, lipids, phospho-groups, cleavage of the peptide chain, or restructuring of folding by, for example, heat shock proteins.
[0087] The term "co-translational" used herein refers to events that occur during the translation process of a nucleotide triplet into an amino acid chain. Those events typically alter or modify the chemical or structural properties of the resultant amino acid chain. Examples of co-translational events include but are not limited to events that may stop the translation process entirely or interrupted the peptide bond formation resulting in two discreet translation products.
[0088] As used herein, the terms "polyprotein" or "artificial polyprotein" refer to an amino acid chain that comprises, or essentially consists of or consists of two amino acid chains that are not naturally connected to each other. The polyprotein may comprise one or more further amino acid chains. Each amino acid chain is preferably a complete protein, i.e. spanning an entire ORF, or a fragment, domain or epitope thereof. The individual parts of a polyprotein may either be permanently or temporarily connected to each other. Parts of a polyprotein that are permanently connected are translated from a single ORF and are not later separated co- or post-translationally. Parts of polyproteins that are connected temporarily may also derive from a single ORF but are divided co-translationally due to separation during the translation process or70395W001 post-translationally due to cleavage of the peptide chain, e.g. by an endopeptidase. Additionally or alternatively, parts of a polyprotein may also be derived from two different ORF and are connected post-translationally, for instance through covalent bonds.
[0089] An "epitope", also known as antigenic determinant, is the sequence of a macromolecule that is recognized by the immune system, specifically by antibodies orTCRs, (e.g. by B cells, orT cells). Such epitope is that part or sequence of a macromolecule capable of binding to an antibody or antigen-binding fragment thereof. In this context, the term "binding" preferably relates to a specific binding. It is preferred that the term "epitope" refers to the sequence of protein or polyprotein that is recognized by the immune system. Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three-dimensional structural characteristics, as well as specific charge characteristics. Conformational and non-conformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents.
[0090] “Protect” or “protection” in the context of “eliciting a protective immune response” or in the context of protecting against infection, diseases, or conditions caused by a pathogen in a subject means to produce either directly ( / .e. by encoding an antibody against an antigen) or indirectly ( / .e. by encoding an antigen to which the immune system responds by producing antiantigen antibodies or anti-antigen TCR-mediated immune responses) or to elicit an immune response that decreases the likelihood of: 1) the host’s body being a reservoir for the replication of the pathogen, and / or to such a level of replication that it can pass from that host to another, or 2) the likelihood or severity of a symptom or a reduction in the number of symptoms of infection by said pathogen. Protection may reduce the incidence of an infection, disease, or condition caused by pathogen ( / .e. whether symptomatic and asymptomatic) possibly leading to the control of the disease associated with said-pathogen (e.g. severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) causing the disease known as coronavirus virus disease 2019 (COVID-19)) and / or to the control of associated adverse health outcomes caused by the pathogen.
[0091] “Prevent” or “prevention” in the context of “eliciting a preventative immune response” or “prevent the infection” or in the context of prevent against infection, diseases, or conditions caused by a pathogen is used within an epidemiological context and epidemiological effect observed in a sample of the population (and the use of such terms should not be reduced to any one the failure of random individual subject per se to demonstrate such an effect). As such, “a subject” with regard to “prevent” or “prevention” is a representative subject of the sample of the population for which the epidemiological effect has been observed, and as such, the subject is70395W001 able to produce either directly ( / .e. by encoding an antibody against an antigen) or indirectly ( / .e. by encoding an antigen to which the immune system responds by producing anti-antigen antibodies and / or anti-antigen TCR-mediated immune responses) or to elicit an immune response that reduces the likelihood of: 1) the host’s body being a reservoir for the replication of the pathogen, and / or to such a level of replication that it can pass from that host to another, or 2) the likelihood or severity of a symptom or a reduction in the number of symptoms of infection by said pathogen such that the infection, diseases, or conditions caused by the pathogen would be theoretically prevented. Prevention may reduce the incidence of an infection, disease, or condition caused by pathogen ( / .e. whether symptomatic and asymptomatic) possibly leading to the control of the disease associated with said-pathogen (e.g. severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2)) to prevent the larger spread throughout the population and / or to the control of associated adverse health outcomes caused by the pathogen in said subject who is representative of the epidemiological sample of the population. Herd immunity is an example of prevention, even when the administration to qualifying individuals prevents the infection to individuals who might not be as qualified for treatment because of some pre-existing condition (such as bone-marrow transplant or other suppression of the immune system) that suppresses said individual’s immune response.
[0092] “Treat” or “treatment” in the context of infection, diseases, or conditions caused by a pathogen means to treat via administration, post-infection any pathogen-causing symptom, effect, or phenotype. Treatment may mean to decrease the severity or frequency of symptoms of the condition or disease in a subject, slow, or eliminate the progression of the condition, totally or partially eliminate the symptoms of the disease or condition in the subject, or reduce or eliminate the number of pathogens in the subject. Treatment of an infection, disease, or condition caused by a pathogen includes ameliorating, stabilizing, reducing, or eliminating the symptoms, effects, or phenotypes caused by the pathogen.
[0093] In the different aspects, there is provided at least one RNA molecule being a selfamplifying messenger ribonucleic acid (samRNA) (e.g., a first RNA molecule comprising a first RNA sequence and a second RNA sequence) ortrans-amplifying messenger RNA (e.g., a first RNA molecule comprising a first RNA sequence and a second RNA molecule comprising a second RNA sequence). In each aspect, each of these mRNAs comprise a genus of nucleotide of which at least 10% is a subgenus thereof consisting of modified nucleotides. Each of these RNA comprise a first RNA sequence encoding one or more proteins capable of replicating a samRNA in an intracellular environment, and a second RNA sequence comprising a heterologous nucleic acid. Each of these RNA may have additional structures such as70395W001 subgenomic promoters, poly adenosine monophosphate (poly(A)) tails, 5’ caps, 5’ untranslated regions, 3’ untranslated regions, and further features further specifying each of these components, such as a cap-1, the heterologous nucleic acid encoding a heterologous protein, the heterologous protein comprising an antigen, etc. In several aspects, the samRNA or the trans-amplifying mRNA may have uses in the manufacture of medicaments, such as those for delivering a heterologous nucleic acid, for preventing a disease, for treating a disease, for delivering a heterologous protein, or for delivering an inhibitory RNA. Or in several aspects, the samRNA or the trans-amplifying mRNA may have uses in eliciting an immune response, preventing infection, treating infection, or delivering a heterologous protein, a heterologous nucleic acid, or an inhibitory RNA. Or in several aspects, the samRNA or the trans-amplifying mRNA may be comprised within a composition, may be manufactured, may be administered in a method having the above-noted uses. Throughout all of the above-noted aspects, it is to be understood that disclosure of embodiments that support one aspect are intended to, and do, support embodiments of the other aspects. This statement is not limited to supporting across the samRNA and the trans-amplifying mRNA, but may be used to support and contemplate between compositions of matter, uses of matter, manufacture of the matter, methods of administering the matter, etc. For example, a 5’ cap to the samRNA may be used to support embodiments to the 5’ cap of the trans-amplifying mRNA, or for example, a method of producing a 5’ capped RNA may be used to support embodiments to the 5’ cap RNA, or methods of making the samRNA or trans-amplifying mRNA may be used to support the use of the samRNA or the trans-amplifying mRNA for the manufacture of a medicament.
[0094] Self-amplifying messenger ribonucleic acid (samRNA)
[0095] samRNA molecules are well known in the art and can be produced by using replication elements derived from, e.g., alphaviruses, and substituting the structural viral proteins with a nucleotide sequence encoding a protein of interest. Figure 23 depicts a schematic overview of an exemplary samRNA molecule. A samRNA molecule is typically a +-strand molecule which can be directly translated after delivery to a cell, and this translation provides a RNA-dependent RNA polymerase which then produces both antisense and sense transcripts from the delivered RNA. Thus the delivered RNA leads to the production of multiple daughter RNAs. These daughter RNAs, as well as collinear subgenomic transcripts, may be translated themselves to provide in situ expression of an encoded polypeptide, or may be transcribed to provide further transcripts with the same sense as the delivered RNA which are translated to provide in situ expression of the antigen. The overall result of this sequence of transcriptions is a huge70395W001 amplification in the number of the introduced samRNAs and so the encoded antigen becomes a major polypeptide product of the cells. Figure 24 depicts a schematic overview of the amplification of samRNA molecules.
[0096] In one aspect, provided is a composition comprising a first RNA molecule comprising a first RNA sequence and a second RNA sequence. In another aspect, provided is a RNA molecule comprising a first RNA sequence and a second RNA sequence. The RNA molecule may be a samRNA. The first RNA sequence encoding one or more proteins capable of replicating a selfamplifying messenger RNA (samRNA) in an intracellular environment; the second RNA sequence comprising a heterologous nucleic acid.
[0097] The first RNA sequence may encode one or more proteins capable of replicating the samRNA in an intracellular environment. The one or more proteins capable of replicating the samRNA in an intracellular environment may comprise an alphavirus non-structural protein-1 (nsP1), an alphavirus nsP2, an alphavirus nsP3, or an alphavirus nsP4. The one or more proteins capable of replicating the samRNA in an intracellular environment may comprise an alphavirus nsP1, an alphavirus nsP2, an alphavirus nsP3, and an alphavirus nsP4.
[0098] The first RNA sequence may comprise a sequence encoding the one or more proteins that has at least 80% sequence identity to SEQ ID NO: 48 or SEQ ID NO: 49. The first RNA sequence may comprise a sequence encoding the one or more proteins that has at least 85% sequence identity to SEQ ID NO: 48 or SEQ ID NO: 49. The first RNA sequence may comprise sequence encoding the one or more proteins that has at least 90% sequence identity to SEQ ID NO: 48 or SEQ ID NO: 49. The first RNA sequence may comprise a sequence encoding the one or more proteins that has at least 95% sequence identity to SEQ ID NO: 48 or SEQ ID NO: 49. The first RNA sequence may comprise SEQ ID NO: 48 or SEQ ID NO: 49.
[0099] The one or more proteins capable of replicating the samRNA in an intracellular environment may comprise an enzyme that is capable of synthesizing a 5' cap in an intracellular environment (e.g., a 7-methylguanosine). This cap can enhance cellular retainment of the samRNA and can enhance transcription and translation therefrom. The one or more proteins capable of replicating the samRNA in an intracellular environment may comprise a helicase or a protease. The helicase may enhance the replicase activity ( / .e., by removing secondary structures / hybridization thereby providing higher RNA-dependent RNA polymerase activity).
[0100] Whereas natural alphavirus genomes encode structural virion proteins in addition to the one or more proteins capable of replicating the samRNA in an intracellular environment, the samRNA molecules disclosed herein may not encode alphavirus structural proteins. Thus, the samRNA can lead to the production of genomic RNA copies of itself in a cell, but not to the70395W001 production of RNA-containing virions. The inability to produce these virions means that, unlike a wild-type alphavirus, the samRNA molecule cannot perpetuate itself in infectious form. The alphavirus structural proteins which are necessary for perpetuation in wild-type viruses may be absent from samRNAs of the present disclosure and their place may be taken by gene(s) encoding the immunogen of interest, such that the subgenomic transcript may encode the immunogen rather than the structural alphavirus virion proteins. The samRNA may lack nucleic acids encoding alphavirus structural proteins. The samRNA may lack nucleic acids encoding viral structural proteins. The samRNA may differ from viral self-amplifying subgenomic RNA in that it may, for example, lack the capsid proteins necessary for virion packaging and cellular entry thereby.
[0101] The alphavirus may comprise Venezuelan equine encephalitis virus (VEE; e.g., Trinidad donkey, TC83CR, etc.), Semliki Forest virus (SFV), Sindbis virus, Ross River virus, Western equine encephalitis virus, Eastern equine encephalitis virus, Chikungunya virus, S. A. AR86 virus, Everglades virus, Mucambo virus, Barmah Forest virus, Middelburg virus, Pixuna virus, O'nyong-nyong virus, Getah virus, Sagiyama virus, Bebaru virus, Mayaro virus, Una virus, Aura virus, Whataroa virus, Banbanki virus, Kyzylagach virus, Highlands J virus, Fort Morgan virus, Ndumu virus, or Buggy Creek virus.
[0102] The nucleic acids encoding the one or more proteins capable of amplifying the samRNA in an intracellular environment may be from positive-strand viruses and thereby may be from positive-strand nucleic acids. Accordingly, provided are proteins and nucleic acids encoding proteins that are positive-stranded (positive sense-stranded) RNAs which lead to translation of a replicase (or replicase-transcriptase) after delivery to a cell. The replicase may be translated as a polyprotein. The replicase in the polyprotein may auto-cleave to provide a replication complex which creates genomic-strand copies of the positive-strand delivered RNA. Said copies would be negative sense (negative-strand) transcripts, which can be transcribed to give further copies of the positive-stranded parent RNA and also to give a subgenomic transcript which is translated to obtain the heterologous protein ( / .e., an antigen, antibody, etc). Translation of the subgenomic transcript thus leads to in situ expression of the antigen by the infected cell.
[0103] Suitable alphavirus replicons can use a replicase from a Sindbis virus, a Semliki forest virus, an eastern equine encephalitis virus, a Venezuelan equine encephalitis virus, etc. Mutant or wildtype virus sequences can be used e.g., the attenuated TC83 mutant of VEEV has been used in replicons, see the following reference: W02005 / 113782, the content of which is incorporated by reference.70395W001 The one or more proteins capable of replicating the samRNA in an intracellular environment may comprise proteins from a positive-strand virus. The positive-strand virus may comprise a picornavirus, a flavivirus, a rubivirus, a pestivirus, a hepacivirus, a calicivirus, or a coronavirus.
[0104] The first RNA molecule (e.g., samRNA) may have two open reading frames. The first (5') open reading frame may encode the one or more proteins capable of amplifying the samRNA in an intracellular environment; the second (3') open reading frame providing for transcription (and possibly translation) of the heterologous nucleic acid. The samRNA may have additional (e.g., downstream) open reading frames, e.g., to encode further antigens or to encode accessory polypeptides.
[0105] An empty samRNA may comprise from 5’ to 3’ a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% identical to SEQ ID NO: 105 or SEQ ID NO: 106, and a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% identical to SEQ ID NO: 107 or SEQ ID NO: 108. An empty samRNA may comprise from 5’ to 3’ a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% identical to SEQ ID NO: 105, and a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% identical to SEQ ID NO: 108. An empty samRNA may comprise from 5’ to 3’ a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% identical to SEQ ID NO: 106, and a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% identical to SEQ ID NO: 108. An empty samRNA may comprise from 5’ to 3’ a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% identical to SEQ ID NO: 105, and a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% identical to SEQ ID NO: 107. The heterologous nucleic acid would be inserted in between in order to express a heterologous protein.
[0106] The samRNA can have various lengths, but a typical samRNA may be 5000 to 25000 nucleotides in length.
[0107] The samRNA may comprise or consist essentially of a VEE-derived samRNA.
[0108] The samRNA can conveniently be prepared by in vitro transcription (IVT). IVT can use a (cDNA) template created and propagated in plasmid form in bacteria, or created synthetically (for example by gene synthesis and / or polymerase chain-reaction (PCR) engineering methods). For instance, a DNA-dependent RNA polymerase (such as the bacteriophage T7, T3 or SP6 RNA polymerases) can be used to transcribe the samRNA from a DNA template. Appropriate capping and poly(A) addition reactions can be used as required (although the samRNA’s70395W001 poly(A) tail is often encoded within the DNA template). These RNA polymerases can have stringent requirements for the transcribed 5' nucleotide(s) and in some embodiments these requirements must be matched with the requirements of the encoded replicase, to ensure that the IVT-transcribed RNA can function efficiently as a substrate for its self-encoded replicase.
[0109] Modified nucleotides
[0110] “Modified nucleotide” herein refers to a nucleotide that contains one or more chemical modifications (e.g., substitutions) in or on the nitrogenous base of the nucleoside (e.g., cytosine (C), thymine (T) or uracil (U), adenine (A) or guanine (G)) and / or one or more chemical modifications in or on the phosphates of the backbone. A modified nucleotide can contain further chemical modifications in or on the sugar moiety of the nucleoside (e.g. ribose, modified ribose, six-membered sugar analog, or open-chain sugar analog), or the phosphate. The preparation of nucleotides and modified nucleotides and nucleosides are well-known in the art.
[0111] The RNA molecule (e.g. a samRNA) or the first and / or second RNA molecules (collectively trans-amplifying RNA) comprise a genus of nucleotide of which at least 10% is a subgenus thereof consisting of modified nucleotides. The RNA molecule may comprise a genus of nucleotide of which at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% is a subgenus thereof consisting of modified nucleotides. The first and / or second RNA molecules may comprise a genus of nucleotide of which at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% is a subgenus thereof consisting of modified nucleotides.
[0112] The modified nucleotides may comprise: pseudouridine; N1 -methylpseudouridine; N1-ethylpseudouridine; 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine; 2-methylthio-N6-methyladenosine; 2-methylthio-N6-threonyl carbamoyladenosine; N6-glycinylcarbamoyladenosine; N6-isopentenyladenosine; N6-methyladenosine; N6-threonylcarbamoyladenosine; 1,2'-O-dimethyladenosine; 1 -methyladenosine; 2'-O-methyladenosine; 2'-O-ribosyladenosine (phosphate); 2-methyladenosine; 2-methylthio-N6 isopentenyladenosine; 2-methylthio-N6-hydroxynorvalyl carbamoyladenosine; 2'-O-methyladenosine; 2'-O-ribosyladenosine (phosphate); Isopentenyladenosine; N6-(cis-70395W001 hydroxyisopentenyl)adenosine; N6,2'-O-dimethyladenosine; N6,2'-O-dimethyladenosine;
[0113] N6, N6,2'-O-trimethyladenosine; N6, N6-dimethyladenosine; N6-acetyladenosine; N6-hydroxynorvalylcarbamoyladenosine; N6-methyl-N6-threonylcarbamoyladenosine; 2-methyladenosine; 2-methylthio-N6-isopentenyladenosine; 7-deaza-adenosine; N1-methyl-adenosine; N6, N6 (dimethyl)adenine; N6-cis-hydroxy-isopentenyl-adenosine;.alpha. -thio-adenosine; 2 (amino)adenine; 2 (aminopropyl)adenine; 2 (methylthio) N6 (isopentenyl)adenine; 2-(alkyl)adenine; 2-(aminoalkyl)adenine; 2-(aminopropyl)adenine; 2-(halo)adenine; 2-(halo)adenine; 2-(propyl)adenine; 2'-Amino-2'-deoxy-ATP; 2'-Azido-2'-deoxy-ATP; 2'-Deoxy-2'-a-aminoadenosine TP; 2'-Deoxy-2'-a-azidoadenosine TP; 6 (alkyl)adenine; 6 (methyl)adenine; 6-(alkyl)adenine; 6-(methyl)adenine; 7 (deaza)adenine; 8 (alkenyl)adenine; 8 (alkynyl)adenine; 8 (amino)adenine; 8 (thioalkyl)adenine; 8-(alkenyl)adenine; 8-(alkyl)adenine; 8-(alkynyl)adenine; 8-(amino)adenine; 8-(halo)adenine; 8-(hydroxyl)adenine; 8-(thioalkyl)adenine; 8-(thiol)adenine; 8-azido-adenosine; aza adenine; deaza adenine; N6 (methyl)adenine; N6-(isopentyl)adenine; 7-deaza-8-aza-adenosine; 7-methyladenine; 1 -Deazaadenosine TP; 2'Fluoro-N6-Bz-deoxyadenosine TP; 2'-OMe-2-Amino-ATP; 2'O-methyl-N6-Bz-deoxyadenosine TP; 2'-a-Ethynyladenosine TP; 2-aminoadenine; 2-Aminoadenosine TP; 2-Amino-ATP; 2'-a-Trifluoromethyladenosine TP; 2-Azidoadenosine TP; 2'-b-Ethynyladenosine TP; 2-Bromoadenosine TP; 2'-b-Trifluoromethyladenosine TP; 2-Chloroadenosine TP; 2'-Deoxy-2',2'-difluoroadenosine TP; 2'-Deoxy-2'-a-mercaptoadenosine TP; 2'-Deoxy-2'-a-thiomethoxyadenosine TP; 2'-Deoxy-2'-b-aminoadenosine TP; 2'-Deoxy-2'-b-azidoadenosine TP; 2'-Deoxy-2'-b-bromoadenosine TP; 2'-Deoxy-2'-b-chloroadenosine TP; 2'-Deoxy-2'-b-fluoroadenosine TP; 2'-Deoxy-2'-b-iodoadenosine TP; 2'-Deoxy-2'-b-mercaptoadenosine TP; 2'-Deoxy-2'-b-thiomethoxyadenosine TP; 2-Fluoroadenosine TP; 2-Iodoadenosine TP; 2-Mercaptoadenosine TP; 2-methoxy-adenine; 2-methylthio-adenine; 2-Trifluoromethyladenosine TP; 3-Deaza-3-bromoadenosine TP; 3-Deaza-3-chloroadenosine TP; 3-Deaza-3-fluoroadenosine TP; 3-Deaza-3-iodoadenosine TP; 3-Deazaadenosine TP; 4'-Azidoadenosine TP; 4'-Carbocyclic adenosine TP; 4'-Ethynyladenosine TP; 5'-Homo-adenosine TP; 8-Aza-ATP; 8-bromo-adenosine TP; 8-Trifluoromethyladenosine TP; 9-Deazaadenosine TP; 2-aminopurine; 7-deaza-2,6-diaminopurine; 7-deaza-8-aza-2,6-diaminopurine; 7-deaza-8-aza-2-aminopurine; 2,6-diaminopurine; 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine; 2-thiocytidine; 3-methylcytidine; 5-formylcytidine; 5-hydroxymethylcytidine; 5-methylcytidine; N4-acetylcytidine; 2'-O-methylcytidine; 2'-O-methylcytidine; 5,2'-O-dimethylcytidine; 5-formyl-2'-O-methylcytidine; Lysidine; N4,2'-O-dimethylcytidine; N4-acetyl-2'-O-methylcytidine; N4-methylcytidine; N4, N4-Dimethyl-2'-OMe-Cytidine TP; 4-methylcytidine; 5-aza-cytidine; Pseudo-iso-cytidine; pyrrolo-70395W001 cytidine;.alpha. -thio-cytidine; 2-(thio)cytosine; 2'-Amino-2'-deoxy-CTP; 2'-Azido-2'-deoxy-CTP; 2'-Deoxy-2'-a-aminocytidine TP; 2'-Deoxy-2'-a-azidocytidine TP; 3 (deaza) 5 (aza)cytosine; 3 (methyl)cytosine; 3-(alkyl)cytosine; 3-(deaza) 5 (aza)cytosine; 3-(methyl)cytidine; 4,2'-O-dimethylcytidine; 5 (halo)cytosine; 5 (methyl)cytosine; 5 (propynyl)cytosine; 5 (trifluoromethyl)cytosine; 5-(alkyl)cytosine; 5-(alkynyl)cytosine; 5-(halo)cytosine; 5-(propynyl)cytosine; 5-(trifluoromethyl)cytosine: 5-bromo-cytidine; 5-iodo-cytidine; 5-propynyl cytosine; 6-(azo)cytosine; 6-aza-cytidine; aza cytosine; deaza cytosine; N4 (acetyl)cytosine; 1-methyl-1-deaza-pseudoisocytidine; 1-methyl-pseudoisocytidine; 2-methoxy-5-methyl-cytidine: 2-methoxy-cytidine; 2-thio-5-methyl-cytidine; 4-methoxy-1-methyl-pseudoisocytidine; 4-methoxy-pseudoisocytidine; 4-thio-1-methyl-1-deaza-pseudoisocytidine; 4-thio-1-methyl-pseudoisocytidine; 4-thio-pseudoisocytidine; 5-aza-zebularine; 5-methyl-zebularine; pyrrolo-pseudoisocytidine; Zebularine; (E)-5-(2-Bromo-vinyl)cytidine TP; 2,2'-anhydro-cytidine TP hydrochloride; 2'Fluor-N4-Bz-cytidine TP; 2'Fluoro-N4-Acetyl-cytidine TP; 2'-O-Methyl-N4-Acetyl-cytidine TP; 2'O-methyl-N4-Bz-cytidine TP; 2'-a-Ethynylcytidine TP; 2'-a-Trifluoromethylcytidine TP; 2'-b-Ethynylcytidine TP; 2'-b-Trifluoromethylcytidine TP; 2'-Deoxy-2',2'-difluorocytidine TP; 2'-Deoxy-2'-a-mercaptocytidine TP; 2'-Deoxy-2'-a-thiomethoxycytidine TP; 2'-Deoxy-2'-b-aminocytidine TP; 2'-Deoxy-2'-b-azidocytidine TP; 2'-Deoxy-2'-b-bromocytidine TP; 2'-Deoxy-2'-b-chlorocytidine TP; 2'-Deoxy-2'-b-fluorocytidine TP; 2'-Deoxy-2'-b-iodocytidine TP; 2'-Deoxy-2'-b-mercaptocytidine TP; 2'-Deoxy-2'-b-thiomethoxycytidine TP; 2'-O-Methyl-5-(1-propynyl)cytidine TP; 3'-Ethynylcytidine TP; 4'-Azidocytidine TP; 4'-Carbocyclic cytidine TP; 4'-Ethynylcytidine TP; 5-(1-Propynyl)ara-cytidine TP; 5-(2-Chloro-phenyl)-2-thiocytidine TP; 5-(4-Amino-phenyl)-2-thiocytidine TP; 5-Aminoallyl-CTP; 5-Cyanocytidine TP; 5-Ethynylara-cytidine TP; 5-Ethynylcytidine TP; 5'-Homo-cytidine TP; 5-Methoxycytidine TP; 5-Trifluoromethyl-Cytidine TP; N4-Amino-cytidine TP; N4-Benzoyl-cytidine TP; Pseudoisocytidine; 7-methylguanosine; N2,2'-O-dimethylguanosine; N2-methylguanosine; Wyosine; 1,2'-O-dimethylguanosine; 1 -methylguanosine; 2'-O-methylguanosine; 2'-O-ribosylguanosine (phosphate); 2'-O-methylguanosine; 2'-O-ribosylguanosine (phosphate); 7-aminomethyl-7-deazaguanosine; 7-cyano-7-deazaguanosine; Archaeosine; Methylwyosine; N2,7-dimethylguanosine; N2, N2,2'-O-trimethylguanosine; N2, N2,7-trimethylguanosine; N2, N2-dimethylguanosine; N2,7,2'-O-trimethylguanosine; 6-thio-guanosine; 7-deaza-guanosine; 8-oxo-guanosine; N1-methyl-guanosine;.alpha. -thio-guanosine; 2 (propyl)guanine; 2-(alkyl)guanine; 2'-Amino-2'-deoxy-GTP; 2'-Azido-2'-deoxy-GTP; 2'-Deoxy-2'-a-aminoguanosine TP; 2'-Deoxy-2'-a-azidoguanosine TP; 6 (methyl)guanine; 6-(alkyl)guanine; 6-(methyl)guanine; 6-methyl-guanosine; 7 (alkyl)guanine; 7 (deaza)guanine; 7 (methyl)guanine; 7-(alkyl)guanine; 7-70395W001 (deaza)guanine; 7-(methyl)guanine; 8 (alkyl)guanine; 8 (alkynyl)guanine; 8 (halo)guanine; 8 (thioalkyl)guanine; 8-(alkenyl)guanine; 8-(alkyl)guanine; 8-(alkynyl)guanine; 8-(amino)guanine; 8-(halo)guanine; 8-(hydroxyl)guanine; 8-(thioalkyl)guanine; 8-(thiol)guanine; aza guanine; deaza guanine; N (methyl)guanine; N-(methyl)guanine; 1-methyl-6-thio-guanosine; 6-methoxy-guanosine; 6-thio-7-deaza-8-aza-guanosine; 6-thio-7-deaza-guanosine; 6-thio-7-methyl-guanosine; 7-deaza-8-aza-guanosine; 7-methyl-8-oxo-guanosine; N2, N2-dimethyl-6-thio-guanosine; N2-methyl-6-thio-guanosine; 1-Me-GTP; 2'Fluoro-N2-isobutyl-guanosine TP; 2'0-methyl-N2-isobutyl-guanosine TP; 2'-a-Ethynylguanosine TP; 2'-a-Trifluoromethylguanosine TP; 2'-b-Ethynylguanosine TP; 2'-b-Trifluoromethylguanosine TP; 2'-Deoxy-2',2'-difluoroguanosine TP; 2'-Deoxy-2'-a-mercaptoguanosine TP; 2'-Deoxy-2'-a-thiomethoxyguanosine TP; 2'-Deoxy-2'-b-aminoguanosine TP; 2'-Deoxy-2'-b-azidoguanosine TP; 2'-Deoxy-2'-b-bromoguanosine TP; 2'-Deoxy-2'-b-chloroguanosine TP; 2'-Deoxy-2'-b-fluoroguanosine TP; 2'-Deoxy-2'-b-iodoguanosine TP; 2'-Deoxy-2'-b-mercaptoguanosine TP; 2'-Deoxy-2'-b-thiomethoxyguanosine TP; 4'-Azidoguanosine TP; 4'-Carbocyclic guanosine TP; 4'-Ethynylguanosine TP; 5'-Homo-guanosine TP; 8-bromo-guanosine TP; 9-Deazaguanosine TP; N2-isobutyl-guanosine TP; 1-methylinosine; Inosine; 1,2'-O-dimethylinosine; 2'-O-methylinosine; 7-methylinosine; 2'-O-methylinosine; Epoxyqueuosine; galactosyl-queuosine; Mannosylqueuosine; Queuosine; allyamino-thymidine; aza thymidine; deaza thymidine; deoxy-thymidine; 2'-O-methyluridine; 2-thiouridine; 3-methyluridine; 5-carboxymethyluridine; 5-hydroxyuridine; 5-methyluridine; 5-taurinomethyl-2-thiouridine; 5-taurinomethyluridine; Dihydrouridine; (3-(3-amino-3-carboxypropyl)uridine; 1 -methyl-3-(3-amino-5-carboxypropyl)pseudouridine; 1 -methylpseduouridine; 1-methyl-pseudouridine; 2'-O-methyluridine; 2'-O-methylpseudouridine; 2'-O-methyluridine; 2-thio-2'-O-methyluridine; 3-(3-amino-3-carboxypropyl)uridine; 3,2'-O-dimethyluridine; 3-Methyl-pseudo-Uridine TP; 4-thiouridine; 5-(carboxyhydroxymethyl)uridine; 5-(carboxyhydroxymethyl)uridine methyl ester, 5,2'-O-dimethyluridine; 5,6-dihydro-uridine; 5-aminomethyl-2-thiouridine; 5-carbamoylmethyl-2'-O-methyluridine; 5-carbamoylmethyluridine; 5-carboxyhydroxymethyluridine; 5-carboxyhydroxymethyluridine methyl ester, 5-carboxymethylaminomethyl-2'-O-methyluridine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethyl-2-thiouridine; 5-caboxymethylaminomethyluridine; 5-carboxymethylaminomethyluridine; 5-Carbamoylmethyluridine TP; 5-methoxycaeoonylmethyl-2'-O-methyluridine; 5-methoxycarbonylmethyl-2-thiouridine; 5-methoxycarbonylmethyluridine; 5-methoxyuridine; 5-methyl-2-thiouridine; 5-methylaminomethyl-2-selenouridine; 5-methylaminomethyl-2-thiouridine; 5-methylaminomethyluridine; 5-Methyldihydrouridine; 5-Oxyacetic acid-Uridine TP; 5-Oxyacetic acid-methyl ester-Uridine TP; N1 -methyl-pseudo-70395W001 uridine; N1-ethyl-pseudo-uridine; uridine 5-oxyacetic acid; uridine 5-oxyacetic acid methyl ester; 3-(3-Amino-3-carboxypropyl)-Uridine TP; 5-(iso-Pentenylaminomethyl)-2-thiouridine TP; 5-(iso-Pentenylaminomethyl)-2'-O-methyluridine TP; 5-(iso-Pentenylaminomethyl)uridine TP; 5-propynyl uracil;.alpha. -thio-uridine; 1 (aminoalkylamino-carbonylethylenyl)-2(thio)-pseudouridine; 1 (aminoalkylaminocarbonylethylenyl)-2,4-(dithio)pseudouridine; 1 (aminoalkylaminocarbonylethylenyl)-4 (thio)pseudouridine; 1 (aminoalkylaminocarbonylethylenyl)-pseudouridine; 1 (aminocazbonylethylenyl)-2(thio)-pseudouridine; 1 (aminocarbonylethylenyl)-2,4-(dithio)pseudouridine; 1 (aminocarbonylethylenyl)-4 (thio)pseudouridine; 1 (aminocarbonylethylenyl)-pseudouridine; 1 substituted 2(thio)-pseudouridine; 1 substituted 2,4-(dithio)pseudouridine; 1 substituted 4 (thio)pseudouridine; 1 substituted pseudouridine; 1-(aminoalkylamino-carbonylethylenyl)-2-(thio)-pseudouridine; 1-Methyl-3-(3-amino-3-carboxypropyl) pseudouridine TP; 1-Methyl-3-(3-amino-3-carboxypropyl)pseudo-UTP; 1-Methyl-pseudo-UTP; 2 (thio)pseudouridine; 2' deoxy uridine; 2' fluorouridine; 2-(thio)uracil; 2,4-(dithio)psuedouracil; 2' methyl, 2'amino, 2'azido, 2'fluoro-guanosine; 2'-Amino-2'-deoxy-UTP; 2'-Azido-2'-deoxy-UTP; 2'-Azido-deoxyuridine TP; 2'-O-methylpseudouridine; 2' deoxy uridine; 2' fluorouridine; 2'-Deoxy-2'-a-aminouridine TP; 2'-Deoxy-2'-a-azidouridine TP; 2-methylpseudouridine; 3 (3 amino-3 carboxypropyl)uracil; 4 (thio)pseudouridine; 4-(thio)pseudouridine; 4-(thio)uracil; 4-thiouracil; 5 (1,3-diazole-1-alkyl)uracil; 5 (2-aminopropyl)uracil; 5 (aminoalkyl)uracil; 5 (dimethylaminoalkyl)uracil; 5 (guanidiniumalkyl)uracil; 5 (methoxycarbonylmethyl)-2-(thio)uracil; 5 (methoxycarbonyl-methyl)uracil; 5 (methyl) 2 (thio)uracil; 5 (methyl) 2,4 (dithio)uracil; 5 (methyl) 4 (thio)uracil; 5 (methylaminomethyl)-2 (thio)uracil; 5 (methylaminomethyl)-2,4 (dithio)uracil; 5 (methylaminomethyl)-4 (thio)uracil; 5 (propynyl)uracil; 5 (trifluoromethyl)uracil; 5-(2-aminopropyl)uracil; 5-(alkyl)-2-(thio)pseudouridine; 5-(alkyl)-2,4 (dithio)pseudouridine; 5-(alkyl)-4 (thio)pseudouridine; 5-(alkyl)pseudouridine; 5-(alkyl)uracil; 5-(alkynyl)uracil; 5-(allylamino)uracil; 5-(cyanoalkyl)uracil; 5-(dialkylaminoalkyl)uracil; 5-(dimethylaminoalkyl)uracil; 5-(guanidiniumalkyl)uracil; 5-(halo)uracil; 5-(1,3-diazole-1-alkyl)uracil; 5-(methoxy)uracil; 5-(methoxycarbonylmethyl)-2-(thio)uracil; 5-(methoxycarbonyl-methyl)uracil; 5-(methyl) 2(thio)uracil; 5-(methyl) 2,4 (dithio)uracil; 5-(methyl) 4 (thio)uracil; 5-(methyl)-2-(thio)pseudouridine; 5-(methyl)-2,4 (dithio)pseudouridine; 5-(methyl)-4 (thio)pseudouridine; 5-(methyl)pseudouridine; 5-(methylaminomethyl)-2 (thio)uracil; 5-(methylaminomethyl)-2,4(dithio)uracil; 5-(methylaminomethyl)-4-(thio)uracil; 5-(propynyl)uracil; 5-(trifluoromethyl)uracil; 5-aminoallyl-uridine; 5-bromo-uridine; 5-iodo-uridine; 5-uracil; 6 (azo)uracil; 6-(azo)uracil; 6-aza-uridine; allyamino-uracil; aza uracil; deaza uracil; N370395W001 (methyl)uracil; Pseudo-UTP-1-2-ethanoic acid; Pseudouridine; 4-Thio-pseudo-UTP; 1-carboxymethyl-pseudouridine; 1-methyl-1-deaza-pseudouridine; 1-propynyl-uridine; 1-taurinomethyl-1 -methyl-uridine; 1 -taurinomethyl-4-thio-uridine; 1 -taurinomethyl-pseudouridine; 2-methoxy-4-thio-pseudouridine; 2-thio-1-methyl-1-deaza-pseudouridine; 2-thio-1-methyl-pseudouridine; 2-thio-5-aza-uridine; 2-thio-dihydropseudouridine; 2-thio-dihydrouridine; 2-thio-pseudouridine; 4-methoxy-2-thio-pseudouridine; 4-methoxy-pseudouridine; 4-thio-1-methyl-pseudouridine; 4-thio-pseudouridine; 5-aza-uridine; Dihydropseudouridine; (,+-.)1-(2-Hydroxypropyl)pseudouridine TP; (2R)-1-(2-Hydroxypropyl)pseudouridine TP; (2S)-1-(2-Hydroxypropyl)pseudouridine TP; (E)-5-(2-Bromo-vinyl)ara-uridine TP; (E)-5-(2-Bromo-vinyl)uridine TP; (Z)-5-(2-Bromo-vinyl)ara-uridine TP; (Z)-5-(2-Bromo-vinyl)uridine TP; 1 -(2,2,2-Trifluoroethyl)-pseudo-UTP; 1-(2,2,3,3,3-Pentafluoropropyl)pseudouridine TP; 1 -(2,2-Diethoxyethyl)pseudouridine TP; 1-(2,4,6-Trimethylbenzyl)pseudouridine TP; 1-(2,4,6-Trimethyl-benzyl)pseudo-UTP; 1 -(2,4,6-T rimethyl-phenyl)pseudo-UTP; 1 -(2-Amino-2-carboxyethyl)pseudo-UTP; 1-(2-Amino-ethyl)pseudo-UTP; 1-(2-Hydroxyethyl)pseudouridine TP; 1-(2-Methoxyethyl)pseudouridine TP; 1-(3,4-Bis-trifluoromethoxybenzyl)pseudouridine TP; 1-(3,4-Dimethoxybenzyl)pseudouridine TP; 1-(3-Amino-3-carboxypropyl)pseudo-UTP; 1-(3-Amino-propyl)pseudo-UTP; 1-(3-Cyclopropyl-prop-2-ynyl)pseudouridine TP; 1-(4-Amino-4-carboxybutyl)pseudo-UTP; 1-(4-Amino-benzyl)pseudo-UTP; 1-(4-Amino-butyl)pseudo-UTP; 1-(4-Amino-phenyl)pseudo-UTP; 1-(4-Azidobenzyl)pseudouridine TP; 1-(4-Bromobenzyl)pseudouridine TP; 1-(4-Chlorobenzyl)pseudouridine TP; 1-(4-Fluorobenzyl)pseudouridine TP; 1-(4-Iodobenzyl)pseudouridine TP; 1-(4-Methanesulfonylbenzyl)pseudouridine TP; 1-(4-Methoxybenzyl)pseudouridine TP; 1-(4-Methoxy-benzyl)pseudo-UTP; 1 -(4-Methoxy-phenyl)pseudo-UTP; 1 -(4-Methylbenzyl)pseudouridine TP; 1-(4-Methyl-benzyl)pseudo-UTP; 1-(4-Nitrobenzyl)pseudouridine TP; 1-(4-Nitro-benzyl)pseudo-UTP; 1-(4-Nitro-phenyl)pseudo-UTP; 1-(4-Thiomethoxybenzyl)pseudouridine TP; 1-(4-Trifluoromethoxybenzyl)pseudouridine TP; 1-(4-Trifluoromethylbenzyl)pseudouridine TP; 1-(5-Amino-pentyl)pseudo-UTP; 1-(6-Amino-hexyl)pseudo-UTP; 1,6-Dimethyl-pseudo-UTP; 1-[3-(2-{2-[2-(2-Aminoethoxy)-ethoxy]-ethoxy}-ethoxy)-propionyl]pseudouri- dine TP; 1-{3-[2-(2-Aminoethoxy)-ethoxy]-propionyl} pseudouridine TP; 1 -Acetylpseudouridine TP; 1-Alkyl-6-(1-propynyl)-pseudo-UTP; 1-Alkyl-6-(2-propynyl)-pseudo-UTP; 1-Alkyl-6-allyl-pseudo-UTP; 1-Alkyl-6-ethynyl-pseudo-UTP; 1-Alkyl-6-homoallyl-pseudo-UTP; 1-Alkyl-6-vinyl-pseudo-UTP; 1 -Allylpseudouridine TP; 1-Aminomethyl-pseudo-UTP; 1 -Benzoylpseudouridine TP; 1 -Benzyloxymethylpseudouridine TP; 1-Benzyl-pseudo-UTP; 1-Biotinyl-PEG2-pseudouridine TP; 1-Biotinylpseudouridine TP; 1-Butyl-pseudo-UTP; 1-70395W001 Cyanomethylpseudouridine TP; 1-Cyclobutylmethyl-pseudo-UTP; 1-Cyclobutyl-pseudo-UTP; 1-Cycloheptylmethyl-pseudo-UTP; 1 -Cycloheptyl-pseudo-UTP; 1 -Cyclohexylmethyl-pseudo-UTP; 1-Cyclohexyl-pseudo-UTP; 1-Cyclooctylmethyl-pseudo-UTP; 1-Cyclooctyl-pseudo-UTP; 1-Cyclopentylmethyl-pseudo-UTP; 1 -Cyclopentyl-pseudo-UTP; 1 -Cyclopropylmethyl-pseudo-UTP; 1-Cyclopropyl-pseudo-UTP; 1-Ethyl-pseudo-UTP; 1-Hexyl-pseudo-UTP; 1-Homoallylpseudouridine TP; 1-Hydroxymethylpseudouridine TP; 1-iso-propyl-pseudo-UTP; 1-Me-2-thio-pseudo-UTP; 1-Me-4-thio-pseudo-UTP; 1-Me-alpha-thio-pseudo-UTP; 1-Methanesulfonylmethylpseudouridine TP; 1 -Methoxymethylpseudouridine TP; 1-Methyl-6-(2,2,2-Trifluoroethyl)pseudo-UTP; 1-Methyl-6-(4-morpholino)-pseudo-UTP; 1-Methyl-6-(4-thiomorpholino)-pseudo-UTP; 1-Methyl-6-(substituted phenyl)pseudo-UTP; 1-Methyl-6-amino-pseudo-UTP; 1-Methyl-6-azido-pseudo-UTP; 1-Methyl-6-bromo-pseudo-UTP; 1-Methyl-6-butyl-pseudo-UTP; 1-Methyl-6-chloro-pseudo-UTP; 1-Methyl-6-cyano-pseudo-UTP; 1-Methyl-6-dimethylamino-pseudo-UTP; 1 -Methyl-6-ethoxy-pseudo-UTP; 1 -Methyl-6-ethylcarboxylate-pseudo-UTP; 1-Methyl-6-ethyl-pseudo-UTP; 1-Methyl-6-fluoro-pseudo-UTP; 1-Methyl-6-formyl-pseudo-UTP; 1-Methyl-6-hydroxyamino-pseudo-UTP; 1-Methyl-6-hydroxy-pseudo-UTP; 1-Methyl-6-iodo-pseudo-UTP; 1 -Methyl-6-iso-propyl-pseudo-UTP; 1 -Methyl-6-methoxy-pseudo-UTP; 1-Methyl-6-methylamino-pseudo-UTP; 1-Methyl-6-phenyl-pseudo-UTP; 1-Methyl-6-propyl-pseudo-UTP; 1-Methyl-6-tert-butyl-pseudo-UTP; 1-Methyl-6-trifluoromethoxy-pseudo-UTP; 1-Methyl-6-trifluoromethyl-pseudo-UTP; 1 -Morpholinomethylpseudouridine TP; 1-Pentyl-pseudo-UTP; 1-Phenyl-pseudo-UTP; 1 -Pivaloylpseudouridine TP; 1 -Propargylpseudouridine TP; 1-Propyl-pseudo-UTP; 1-propynyl-pseudouridine; 1-p-tolyl-pseudo-UTP; 1-tert-Butyl-pseudo-UTP; 1 -Thiomethoxymethylpseudouridine TP; 1 -Thiomorpholinomethylpseudouridine TP; 1-Trifluoroacetylpseudouridine TP; 1-Trifluoromethyl-pseudo-UTP; 1-Vinylpseudouridine TP; 2,2'-anhydro-uridine TP; 2'-bromo-deoxyuridine TP; 2'-F-5-Methyl-2'-deoxy-UTP; 2'-OMe-5-Me-UTP; 2'-OMe-pseudo-UTP; 2'-a-Ethynyluridine TP; 2'-a-Trifluoromethyluridine TP; 2'-b-Ethynyluridine TP; 2'-b-Trifluoromethyluridine TP; 2'-Deoxy-2',2'-difluorouridine TP; 2'-Deoxy-2'-a-mercaptouridine TP; 2'-Deoxy-2'-a-thiomethoxyuridine TP; 2'-Deoxy-2'-b-aminouridine TP; 2'-Deoxy-2'-b-azidouridine TP; 2'-Deoxy-2'-b-bromouridine TP; 2'-Deoxy-2'-b-chlorouridine TP; 2'-Deoxy-2'-b-fluorouridine TP; 2'-Deoxy-2'-b-iodouridine TP; 2'-Deoxy-2'-b-mercaptouridine TP; 2'-Deoxy-2'-b-thiomethoxyuridine TP; 2-methoxy-4-thio-uridine; 2-methoxyuridine; 2'-O-Methyl-5-(1-propynyl)uridine TP; 3-Alkyl-pseudo-UTP; 4'-Azidouridine TP; 4'-Carbocyclic uridine TP; 4'-Ethynyluridine TP; 5-(1-Propynyl)ara-uridine TP; 5-(2-Furanyl)uridine TP; 5-Cyanouridine TP; 5-Dimethylaminouridine TP; 5'-Homo-uridine TP; 5-iodo-2'-fluoro-deoxyuridine TP; 5-Phenylethynyluridine TP; 5-Trideuteromethyl-6-deuterouridine TP; 5-Trifluoromethyl-Uridine TP;70395W001 5-Vinylarauridine TP; 6-(2,2,2-Trifluoroethyl)-pseudo-UTP; 6-(4-Morpholino)-pseudo-UTP; 6-(4-Thiomorpholino)-pseudo-UTP; 6-(Substituted-Phenyl)-pseudo-UTP; 6-Amino-pseudo-UTP; 6-Azido-pseudo-UTP; 6-Bromo-pseudo-UTP; 6-Butyl-pseudo-UTP; 6-Chloro-pseudo-UTP; 6-Cyano-pseudo-UTP; 6-Dimethylamino-pseudo-UTP; 6-Ethoxy-pseudo-UTP; 6-Ethylcarboxylate-pseudo-UTP; 6-Ethyl-pseudo-UTP; 6-Fluoro-pseudo-UTP; 6-Formyl-pseudo-UTP; 6-Hydroxyamino-pseudo-UTP; 6-Hydroxy-pseudo-UTP; 6-Iodo-pseudo-UTP; 6-iso-Propyl-pseudo-UTP; 6-Methoxy-pseudo-UTP; 6-Methylamino-pseudo-UTP; 6-Methyl-pseudo-UTP; 6-Phenyl-pseudo-UTP; 6-Phenyl-pseudo-UTP; 6-Propyl-pseudo-UTP; 6-tert-Butyl-pseudo-UTP; 6-T rifluoromethoxy-pseudo-UTP; 6-T rifluoromethyl-pseudo-UTP; Alpha-thio-pseudo-UTP;
[0114] Pseudouridine 1-(4-methylbenzenesulfonic acid) TP; Pseudouridine 1-(4-methylbenzoic acid) TP; Pseudouridine TP 1-[3-(2-ethoxy)]propionic acid; Pseudouridine TP 1 -[3-{2-(2-[2-(2-ethoxy)-ethoxy]-ethoxy)-ethoxy}]propionic acid; Pseudouridine TP 1-[3-{2-(2-[2-{2-(2-ethoxy)-ethoxy)-ethoxy}-ethoxy]-ethoxy}]propionic acid; Pseudouridine TP 1-[3-{2-(2-[2-ethoxy]-ethoxy)-ethoxy}]propionic acid; Pseudouridine TP 1-[3-{2-(2-ethoxy)-ethoxy}]propionic acid;
[0115] Pseudouridine TP 1-methylphosphonic acid; Pseudouridine TP 1-methylphosphonic acid diethyl ester; Pseudo-UTP-N1-3-propionic acid; Pseudo-UTP-N1-4-butanoic acid; Pseudo-UTP-N1-5-pentanoic acid; Pseudo-UTP-N1-6-hexanoic acid; Pseudo-UTP-N1-7-heptanoic acid; Pseudo-UTP-N1-methyl-p-benzoic acid; Pseudo-UTP-N1-p-benzoic acid; Wybutosine;
[0116] Hydroxywybutosine; Isowyosine; Peroxywybutosine; undermodified hydroxywybutosine; 4-demethylwyosine; 2,6-(diamino)purine; 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl: 1,3-(diaza)-2-(oxo)-phenthiazin-1-yl; 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 1,3,5-(triaza)-2,6-(dioxa)-naphthalene; 2 (amino)purine; 2,4,5-(trimethyl)phenyl; 2' methyl, 2'amino, 2'azido, 2'fluoro-cytidine; 2' methyl, 2'amino, 2'azido, 2'fluoro-adenine; 2'methyl, 2'amino, 2'azido, 2'fluoro-uridine; 2'-amino-2'-deoxyribose; 2-amino-6-Chloro-purine; 2-aza-inosinyl; 2'-azido-2'-deoxyribose; 2'fluoro-2'-deoxyribose; 2'-fluoro-modified bases; 2'-O-methyl-ribose; 2-oxo-7-aminopyridopyrimidin-3-yl; 2-oxo-pyridopyrimidine-3-yl; 2-pyridinone; 3 nitropyrrole; 3-(methyl)-7-(propynyl)isocarbostyrilyl; 3-(methyl)isocarbostyrilyl; 4-(fluoro)-6-(methyl)benzimidazole; 4-(methyl)benzimidazole; 4-(methyl)indolyl; 4,6-(dimethyl)indolyl; 5 nitroindole; 5 substituted pyrimidines; 5-(methyl)isocarbostyrilyl; 5-nitroindole; 6-(aza)pyrimidine; 6-(azo)thymine; 6-(methyl)-7-(aza)indolyl; 6-chloro-purine; 6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenthiazin-1-yl; 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenthiazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-l-yl; 7-(aza)indolyl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-70395W001 phenoxazinl-yl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenthiazin-1-yl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(guanidiniumalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(guanidiniumalkyl-hydroxy)-1,3-(diaza)-2-(oxo)-phenthiazin-1-yl; 7-(guanidiniumalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(propynyl)isocarbostyrilyl; 7-(propynyl)isocarbostyrilyl, propynyl-7-(aza)indolyl; 7-deaza-inosinyl; 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-substituted 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 9-(methyl)-imidizopyridinyl; Aminoindolyl;
[0117] Anthracenyl; bis-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; bis-ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Difluorotolyl; Hypoxanthine; Imidizopyridinyl; Inosinyl; Isocarbostyrilyl; Isoguanisine; N2-substituted purines; N6-methyl-2-amino-purine; N6-substituted purines; N-alkylated derivative; Napthalenyl; Nitrobenzimidazolyl; Nitroimidazolyl; Nitroindazolyl; Nitropyrazolyl; Nubularine; 06-substituted purines; O-alkylated derivative; ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Oxoformycin TP; para-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; para-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Pentacenyl; Phenanthracenyl;
[0118] Phenyl; propynyl-7-(aza)indolyl; Pyrenyl; pyridopyrimidin-3-yl; pyridopyrimidin-3-yl, 2-oxo-7-amino-pyridopyrimidin-3-yl; pyrrolo-pyrimidin-2-on-3-yl; Pyrrolopyrimidinyl; Pyrrolopyrizinyl; Stilbenzyl; substituted 1,2,4-triazoles; Tetracenyl; Tubercidine; Xanthine; Xanthosine-5'-TP; 2-thio-zebularine; 5-aza-2-thio-zebularine; 7-deaza-2-amino-purine; pyridin-4-one ribonucleoside; 2-Amino-riboside-TP; Formycin A TP; Formycin B TP; Pyrrolosine TP; 2'-OH-ara-adenosine TP; 2'-OH-ara-cytidine TP; 2'-OH-ara-uridine TP; 2'-OH-ara-guanosine TP; 5-(2-carbomethoxyvinyl)uridine TP; or N6-(19-Amino-pentaoxanonadecyl)adenosine TP.
[0119] “Uridine-substitutable modified nucleotide” herein refers to modified nucleotides that are able or recognized to substitute for uridine but not for adenosine, cytidine or guanosine in any given nucleic acid. “Adenosine-substitutable modified nucleotide” herein refers to modified nucleotides that are able or recognized to substitute for adenosine but not for cytidine, guanosine or uridine in any given nucleic acid. “Cytidine-substitutable modified nucleotide” herein refers to modified nucleotides that are able or recognized to substitute for cytidine but not for adenosine, guanosine or uridine in any given nucleic acid. “Guanosine-substitutable modified nucleotide” herein refers to modified nucleotides that are able or recognized to substitute for guanosine but not for adenosine, cytidine or uridine in any given nucleic acid.
[0120] One or more uridine nucleotides in the RNA molecule may be replaced with a uridine-substitutable modified nucleotide. The RNA molecule may comprise a genus of uridine and uridine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at70395W001 least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% is a subgenus thereof consisting of uridine-substitutable modified nucleotides. The RNA molecule may comprise a genus of uridine and uridine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the genus are uridine-substitutable modified nucleotides. The first and / or second RNA molecules may comprise a genus of uridine and uridine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% is a subgenus thereof consisting of uridine-substitutable modified nucleotides. The first and / or second RNA molecules may comprise a genus of uridine and uridine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the genus are uridine-substitutable modified nucleotides. The RNA molecule may comprise a genus of uridine and uridine-substitutable modified nucleotides of which 100% is a subgenus thereof consisting of uridine-substitutable modified nucleotides, except for the first 5’ uridine. The RNA molecule may comprise a genus of uridine and uridine-substitutable modified nucleotides of which 100% of the genus are uridine-substitutable modified nucleotides, except for the first 5’ uridine. The first and / or second RNA molecules may comprise a genus of uridine and uridine-substitutable modified nucleotides of which 100% is a subgenus thereof consisting of uridine-substitutable modified nucleotides, except for the first 5’ uridine. The first and / or second RNA molecules may comprise a genus of uridine and uridine-substitutable modified nucleotides of which 100% of the genus are uridine-substitutable modified nucleotides, except for the first 5’ uridine.
[0121] The uridine-substitutable modified nucleotides or the thymidine-substitutable modified nucleotides may comprise: pseudouridine; N1 -methylpseudouridine; N1 -ethylpseudouridine; Inosine; 1,2'-O-dimethylinosine; 2'-O-methylinosine; 7-methylinosine; 2'-O-methylinosine;
[0122] Epoxyqueuosine; galactosyl-queuosine; Mannosylqueuosine; Queuosine; allyamino-thymidine; aza thymidine; deaza thymidine; deoxy-thymidine; 2'-O-methyluridine; 2-thiouridine; 3-70395W001 methyluridine; 5-carboxymethyluridine; 5-hydroxyuridine; 5-methyluridine; 5-taurinomethyl-2-thiouridine; 5-taurinomethyluridine; Dihydrouridine; (3-(3-amino-3-carboxypropyl)uridine; 1-methyl-3-(3-amino-5-carboxypropyl)pseudouridine; 1 -methylpseduouridine; 1 -methyl-pseudouridine; 2'-O-methyluridine; 2'-O-methylpseudouridine; 2'-O-methyluridine; 2-thio-2'-O-methyluridine; 3-(3-amino-3-carboxypropyl)uridine; 3,2'-O-dimethyluridine; 3-Methyl-pseudo-Uridine TP; 4-thiouridine; 5-(carboxyhydroxymethyl)uridine; 5-(carboxyhydroxymethyl)uridine methyl ester, 5,2'-O-dimethyluridine; 5,6-dihydro-uridine; 5-aminomethyl-2-thiouridine; 5-carbamoylmethyl-2'-O-methyluridine; 5-carbamoylmethyluridine; 5-carboxyhydroxymethyluridine; 5-carboxyhydroxymethyluridine methyl ester, 5-carboxymethylaminomethyl-2'-O-methyluridine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethyl-2-thiouridine; 5-caboxymethylaminomethyluridine; 5-carboxymethylaminomethyluridine; 5-Carbamoylmethyluridine TP; 5-methoxycaeoonylmethyl-2'-O-methyluridine; 5-methoxycarbonylmethyl-2-thiouridine; 5-methoxycarbonylmethyluridine; 5-methoxyuridine; 5-methyl-2-thiouridine; 5-methylaminomethyl-2-selenouridine; 5-methylaminomethyl-2-thiouridine; 5-methylaminomethyluridine; 5-Methyldihydrouridine; 5-Oxyacetic acid-Uridine TP; 5-Oxyacetic acid-methyl ester-Uridine TP; N1-methyl-pseudo-uridine; N1-ethyl-pseudo-uridine; uridine 5-oxyacetic acid; uridine 5-oxyacetic acid methyl ester; 3-(3-Amino-3-carboxypropyl)-Uridine TP; 5-(iso-Pentenylaminomethyl)-2-thiouridine TP; 5-(iso-Pentenylaminomethyl)-2'-O-methyluridine TP; 5-(iso-Pentenylaminomethyl)uridine TP; 5-propynyl uracil;.alpha. -thio-uridine; 1 (aminoalkylamino-carbonylethylenyl)-2(thio)-pseudouridine; 1 (aminoalkylaminocarbonylethylenyl)-2,4-(dithio)pseudouridine; 1 (aminoalkylaminocarbonylethylenyl)-4 (thio)pseudouridine; 1 (aminoalkylaminocarbonylethylenyl)-pseudouridine; 1 (aminocazbonylethylenyl)-2(thio)-pseudouridine; 1 (aminocarbonylethylenyl)-2,4-(dithio)pseudouridine; 1 (aminocarbonylethylenyl)-4 (thio)pseudouridine; 1 (aminocarbonylethylenyl)-pseudouridine; 1 substituted 2(thio)-pseudouridine; 1 substituted 2,4-(dithio)pseudouridine; 1 substituted 4 (thio)pseudouridine; 1 substituted pseudouridine; 1-(aminoalkylamino-carbonylethylenyl)-2-(thio)-pseudouridine; 1-Methyl-3-(3-amino-3-carboxypropyl) pseudouridine TP; 1-Methyl-3-(3-amino-3-carboxypropyl)pseudo-UTP; 1-Methyl-pseudo-UTP; 2 (thio)pseudouridine; 2' deoxy uridine; 2' fluorouridine; 2-(thio)uracil; 2,4-(dithio)psuedouracil; 2' methyl, 2'amino, 2'azido, 2'fluoro-guanosine; 2'-Amino-2'-deoxy-UTP; 2'-Azido-2'-deoxy-UTP; 2'-Azido-deoxyuridine TP; 2'-O-methylpseudouridine; 2' deoxy uridine; 2' fluorouridine; 2'-Deoxy-2'-a-aminouridine TP; 2'-Deoxy-2'-a-azidouridine TP; 2-methylpseudouridine; 3 (3 amino-3 carboxypropyl)uracil; 4 (thio)pseudouridine; 4-(thio)pseudouridine; 4-(thio)uracil; 4-thiouracil; 5 (1,3-diazole-1-70395W001 alkyl)uracil; 5 (2-aminopropyl)uracil; 5 (aminoalkyl)uracil; 5 (dimethylaminoalkyl)uracil; 5 (guanidiniumalkyl)uracil; 5 (methoxycarbonylmethyl)-2-(thio)uracil; 5 (methoxycarbonyl-methyl)uracil; 5 (methyl) 2 (thio)uracil; 5 (methyl) 2,4 (dithio)uracil; 5 (methyl) 4 (thio)uracil; 5 (methylaminomethyl)-2 (thio)uracil; 5 (methylaminomethyl)-2,4 (dithio)uracil; 5 (methylaminomethyl)-4 (thio)uracil; 5 (propynyl)uracil; 5 (trifluoromethyl)uracil; 5-(2-aminopropyl)uracil; 5-(alkyl)-2-(thio)pseudouridine; 5-(alkyl)-2,4 (dithio)pseudouridine; 5-(alkyl)-4 (thio)pseudouridine; 5-(alkyl)pseudouridine; 5-(alkyl)uracil; 5-(alkynyl)uracil; 5-(allylamino)uracil; 5-(cyanoalkyl)uracil; 5-(dialkylaminoalkyl)uracil; 5-(dimethylaminoalkyl)uracil; 5-(guanidiniumalkyl)uracil; 5-(halo)uracil; 5-(1,3-diazole-1-alkyl)uracil; 5-(methoxy)uracil; 5-(methoxycarbonylmethyl)-2-(thio)uracil; 5-(methoxycarbonyl-methyl)uracil; 5-(methyl) 2(thio)uracil; 5-(methyl) 2,4 (dithio)uracil; 5-(methyl) 4 (thio)uracil; 5-(methyl)-2-(thio)pseudouridine; 5-(methyl)-2,4 (dithio)pseudouridine; 5-(methyl)-4 (thio)pseudouridine; 5-(methyl)pseudouridine; 5-(methylaminomethyl)-2 (thio)uracil; 5-(methylaminomethyl)-2,4(dithio)uracil; 5-(methylaminomethyl)-4-(thio)uracil; 5-(propynyl)uracil; 5-(trifluoromethyl)uracil; 5-aminoallyl-uridine; 5-bromo-uridine; 5-iodo-uridine; 5-uracil; 6 (azo)uracil; 6-(azo)uracil; 6-aza-uridine; allyamino-uracil; aza uracil; deaza uracil; N3 (methyl)uracil; Pseudo-UTP-1-2-ethanoic acid; Pseudouridine; 4-Thio-pseudo-UTP; 1-carboxymethyl-pseudouridine; 1-methyl-1-deaza-pseudouridine; 1-propynyl-uridine; 1-taurinomethyl-1 -methyl-uridine; 1 -taurinomethyl-4-thio-uridine; 1 -taurinomethyl-pseudouridine; 2-methoxy-4-thio-pseudouridine; 2-thio-1-methyl-1-deaza-pseudouridine; 2-thio-1-methyl-pseudouridine; 2-thio-5-aza-uridine; 2-thio-dihydropseudouridine; 2-thio-dihydrouridine; 2-thio-pseudouridine; 4-methoxy-2-thio-pseudouridine; 4-methoxy-pseudouridine; 4-thio-1-methyl-pseudouridine; 4-thio-pseudouridine; 5-aza-uridine; Dihydropseudouridine; (,+-.)1-(2-Hydroxypropyl)pseudouridine TP; (2R)-1-(2-Hydroxypropyl)pseudouridine TP; (2S)-1-(2-Hydroxypropyl)pseudouridine TP; (E)-5-(2-Bromo-vinyl)ara-uridine TP; (E)-5-(2-Bromo-vinyl)uridine TP; (Z)-5-(2-Bromo-vinyl)ara-uridine TP; (Z)-5-(2-Bromo-vinyl)uridine TP; 1 -(2,2,2-Trifluoroethyl)-pseudo-UTP; 1-(2,2,3,3,3-Pentafluoropropyl)pseudouridine TP; 1 -(2,2-Diethoxyethyl)pseudouridine TP; 1-(2,4,6-Trimethylbenzyl)pseudouridine TP; 1-(2,4,6-Trimethyl-benzyl)pseudo-UTP; 1 -(2,4,6-T rimethyl-phenyl)pseudo-UTP; 1 -(2-Amino-2-carboxyethyl)pseudo-UTP; 1-(2-Amino-ethyl)pseudo-UTP; 1-(2-Hydroxyethyl)pseudouridine TP; 1-(2-Methoxyethyl)pseudouridine TP; 1-(3,4-Bis-trifluoromethoxybenzyl)pseudouridine TP; 1-(3,4-Dimethoxybenzyl)pseudouridine TP; 1-(3-Amino-3-carboxypropyl)pseudo-UTP; 1-(3-Amino-propyl)pseudo-UTP; 1-(3-Cyclopropyl-prop-2-ynyl)pseudouridine TP; 1-(4-Amino-4-carboxybutyl)pseudo-UTP; 1-(4-Amino-benzyl)pseudo-UTP; 1-(4-Amino-butyl)pseudo-UTP; 1-70395W001 (4-Amino-phenyl)pseudo-UTP; 1-(4-Azidobenzyl)pseudouridine TP; 1-(4-Bromobenzyl)pseudouridine TP; 1-(4-Chlorobenzyl)pseudouridine TP; 1-(4-Fluorobenzyl)pseudouridine TP; 1-(4-Iodobenzyl)pseudouridine TP; 1-(4-Methanesulfonylbenzyl)pseudouridine TP; 1-(4-Methoxybenzyl)pseudouridine TP; 1-(4-Methoxy-benzyl)pseudo-UTP; 1 -(4-Methoxy-phenyl)pseudo-UTP; 1 -(4-Methylbenzyl)pseudouridine TP; 1-(4-Methyl-benzyl)pseudo-UTP; 1-(4-Nitrobenzyl)pseudouridine TP; 1-(4-Nitro-benzyl)pseudo-UTP; 1-(4-Nitro-phenyl)pseudo-UTP; 1-(4-Thiomethoxybenzyl)pseudouridine TP; 1-(4-Trifluoromethoxybenzyl)pseudouridine TP; 1-(4-Trifluoromethylbenzyl)pseudouridine TP; 1-(5-Amino-pentyl)pseudo-UTP; 1-(6-Amino-hexyl)pseudo-UTP; 1,6-Dimethyl-pseudo-UTP; 1-[3-(2-{2-[2-(2-Aminoethoxy)-ethoxy]-ethoxy}-ethoxy)-propionyl]pseudouri- dine TP; 1-{3-[2-(2-Aminoethoxy)-ethoxy]-propionyl} pseudouridine TP; 1 -Acetylpseudouridine TP; 1-Alkyl-6-(1-propynyl)-pseudo-UTP; 1-Alkyl-6-(2-propynyl)-pseudo-UTP; 1-Alkyl-6-allyl-pseudo-UTP; 1-Alkyl-6-ethynyl-pseudo-UTP; 1-Alkyl-6-homoallyl-pseudo-UTP; 1-Alkyl-6-vinyl-pseudo-UTP; 1 -Allylpseudouridine TP; 1-Aminomethyl-pseudo-UTP; 1 -Benzoylpseudouridine TP; 1 -Benzyloxymethylpseudouridine TP; 1-Benzyl-pseudo-UTP; 1-Biotinyl-PEG2-pseudouridine TP; 1-Biotinylpseudouridine TP; 1-Butyl-pseudo-UTP; 1-Cyanomethylpseudouridine TP; 1-Cyclobutylmethyl-pseudo-UTP; 1-Cyclobutyl-pseudo-UTP; 1-Cycloheptylmethyl-pseudo-UTP; 1 -Cycloheptyl-pseudo-UTP; 1 -Cyclohexylmethyl-pseudo-UTP; 1-Cyclohexyl-pseudo-UTP; 1-Cyclooctylmethyl-pseudo-UTP; 1-Cyclooctyl-pseudo-UTP; 1-Cyclopentylmethyl-pseudo-UTP; 1 -Cyclopentyl-pseudo-UTP; 1 -Cyclopropylmethyl-pseudo-UTP; 1-Cyclopropyl-pseudo-UTP; 1-Ethyl-pseudo-UTP; 1-Hexyl-pseudo-UTP; 1-Homoallylpseudouridine TP; 1-Hydroxymethylpseudouridine TP; 1-iso-propyl-pseudo-UTP; 1-Me-2-thio-pseudo-UTP; 1-Me-4-thio-pseudo-UTP; 1-Me-alpha-thio-pseudo-UTP; 1-Methanesulfonylmethylpseudouridine TP; 1 -Methoxymethylpseudouridine TP; 1-Methyl-6-(2,2,2-Trifluoroethyl)pseudo-UTP; 1-Methyl-6-(4-morpholino)-pseudo-UTP; 1-Methyl-6-(4-thiomorpholino)-pseudo-UTP; 1-Methyl-6-(substituted phenyl)pseudo-UTP; 1-Methyl-6-amino-pseudo-UTP; 1-Methyl-6-azido-pseudo-UTP; 1-Methyl-6-bromo-pseudo-UTP; 1-Methyl-6-butyl-pseudo-UTP; 1-Methyl-6-chloro-pseudo-UTP; 1-Methyl-6-cyano-pseudo-UTP; 1-Methyl-6-dimethylamino-pseudo-UTP; 1 -Methyl-6-ethoxy-pseudo-UTP; 1 -Methyl-6-ethylcarboxylate-pseudo-UTP; 1-Methyl-6-ethyl-pseudo-UTP; 1-Methyl-6-fluoro-pseudo-UTP; 1-Methyl-6-formyl-pseudo-UTP; 1-Methyl-6-hydroxyamino-pseudo-UTP; 1-Methyl-6-hydroxy-pseudo-UTP; 1-Methyl-6-iodo-pseudo-UTP; 1 -Methyl-6-iso-propyl-pseudo-UTP; 1 -Methyl-6-methoxy-pseudo-UTP; 1-Methyl-6-methylamino-pseudo-UTP; 1-Methyl-6-phenyl-pseudo-UTP; 1-Methyl-6-propyl-pseudo-UTP; 1-Methyl-6-tert-butyl-pseudo-UTP; 1-Methyl-6-trifluoromethoxy-pseudo-UTP; 1-70395W001 Methyl-6-trifluoromethyl-pseudo-UTP; 1 -Morpholinomethylpseudouridine TP; 1-Pentyl-pseudo-UTP; 1-Phenyl-pseudo-UTP; 1 -Pivaloylpseudouridine TP; 1 -Propargylpseudouridine TP; 1-Propyl-pseudo-UTP; 1-propynyl-pseudouridine; 1-p-tolyl-pseudo-UTP; 1-tert-Butyl-pseudo-UTP; 1 -Thiomethoxymethylpseudouridine TP; 1 -Thiomorpholinomethylpseudouridine TP; 1-Trifluoroacetylpseudouridine TP; 1-Trifluoromethyl-pseudo-UTP; 1-Vinylpseudouridine TP; 2,2'-anhydro-uridine TP; 2'-bromo-deoxyuridine TP; 2'-F-5-Methyl-2'-deoxy-UTP; 2'-OMe-5-Me-UTP; 2'-OMe-pseudo-UTP; 2'-a-Ethynyluridine TP; 2'-a-Trifluoromethyluridine TP; 2'-b-Ethynyluridine TP; 2'-b-Trifluoromethyluridine TP; 2'-Deoxy-2',2'-difluorouridine TP; 2'-Deoxy-2'-a-mercaptouridine TP; 2'-Deoxy-2'-a-thiomethoxyuridine TP; 2'-Deoxy-2'-b-aminouridine TP; 2'-Deoxy-2'-b-azidouridine TP; 2'-Deoxy-2'-b-bromouridine TP; 2'-Deoxy-2'-b-chlorouridine TP; 2'-Deoxy-2'-b-fluorouridine TP; 2'-Deoxy-2'-b-iodouridine TP; 2'-Deoxy-2'-b-mercaptouridine TP; 2'-Deoxy-2'-b-thiomethoxyuridine TP; 2-methoxy-4-thio-uridine; 2-methoxyuridine; 2'-O-Methyl-5-(1-propynyl)uridine TP; 3-Alkyl-pseudo-UTP; 4'-Azidouridine TP; 4'-Carbocyclic uridine TP; 4'-Ethynyluridine TP; 5-(1-Propynyl)ara-uridine TP; 5-(2-Furanyl)uridine TP; 5-Cyanouridine TP; 5-Dimethylaminouridine TP; 5'-Homo-uridine TP; 5-iodo-2'-fluoro-deoxyuridine TP; 5-Phenylethynyluridine TP; 5-Trideuteromethyl-6-deuterouridine TP; 5-Trifluoromethyl-Uridine TP; 5-Vinylarauridine TP; 6-(2,2,2-Trifluoroethyl)-pseudo-UTP; 6-(4-Morpholino)-pseudo-UTP; 6-(4-Thiomorpholino)-pseudo-UTP; 6-(Substituted-Phenyl)-pseudo-UTP; 6-Amino-pseudo-UTP; 6-Azido-pseudo-UTP; 6-Bromo-pseudo-UTP; 6-Butyl-pseudo-UTP; 6-Chloro-pseudo-UTP; 6-Cyano-pseudo-UTP; 6-Dimethylamino-pseudo-UTP; 6-Ethoxy-pseudo-UTP; 6-Ethylcarboxylate-pseudo-UTP; 6-Ethyl-pseudo-UTP; 6-Fluoro-pseudo-UTP; 6-Formyl-pseudo-UTP; 6-Hydroxyamino-pseudo-UTP; 6-Hydroxy-pseudo-UTP; 6-Iodo-pseudo-UTP; 6-iso-Propyl-pseudo-UTP; 6-Methoxy-pseudo-UTP; 6-Methylamino-pseudo-UTP; 6-Methyl-pseudo-UTP; 6-Phenyl-pseudo-UTP; 6-Phenyl-pseudo-UTP; 6-Propyl-pseudo-UTP; 6-tert-Butyl-pseudo-UTP; 6-T rifluoromethoxy-pseudo-UTP; 6-T rifluoromethyl-pseudo-UTP; Alpha-thio-pseudo-UTP;
[0123] Pseudouridine 1-(4-methylbenzenesulfonic acid) TP; Pseudouridine 1-(4-methylbenzoic acid) TP; Pseudouridine TP 1-[3-(2-ethoxy)]propionic acid; Pseudouridine TP 1 -[3-{2-(2-[2-(2-ethoxy)-ethoxy]-ethoxy)-ethoxy}]propionic acid; Pseudouridine TP 1-[3-{2-(2-[2-{2-(2-ethoxy)-ethoxy)-ethoxy}-ethoxy]-ethoxy}]propionic acid; Pseudouridine TP 1-[3-{2-(2-[2-ethoxy]-ethoxy)-ethoxy}]propionic acid; Pseudouridine TP 1-[3-{2-(2-ethoxy)-ethoxy}]propionic acid;
[0124] Pseudouridine TP 1-methylphosphonic acid; Pseudouridine TP 1-methylphosphonic acid diethyl ester; Pseudo-UTP-N1-3-propionic acid; Pseudo-UTP-N1-4-butanoic acid; Pseudo-UTP-N1-5-pentanoic acid; Pseudo-UTP-N1-6-hexanoic acid; Pseudo-UTP-N1-7-heptanoic acid; Pseudo-UTP-N1-methyl-p-benzoic acid; Pseudo-UTP-N1-p-benzoic acid; Wybutosine;70395W001 Hydroxywybutosine; Isowyosine; Peroxywybutosine; undermodified hydroxywybutosine; 4-demethylwyosine; 2,6-(diamino)purine; 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl: 1,3-(diaza)-2-(oxo)-phenthiazin-1-yl; 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 1,3,5-(triaza)-2,6-(dioxa)-naphthalene; 2 (amino)purine; 2,4,5-(trimethyl)phenyl; 2' methyl, 2'amino, 2'azido, 2'fluoro-cytidine; 2' methyl, 2'amino, 2'azido, 2'fluoro-adenine; 2'methyl, 2'amino, 2'azido, 2'fluoro-uridine; 2'-amino-2'-deoxyribose; 2-amino-6-Chloro-purine; 2-aza-inosinyl; 2'-azido-2'-deoxyribose; 2'fluoro-2'-deoxyribose; 2'-fluoro-modified bases; 2'-O-methyl-ribose; 2-oxo-7-aminopyridopyrimidin-3-yl; 2-oxo-pyridopyrimidine-3-yl; 2-pyridinone; 3 nitropyrrole; 3-(methyl)-7-(propynyl)isocarbostyrilyl; 3-(methyl)isocarbostyrilyl; 4-(fluoro)-6-(methyl)benzimidazole; 4-(methyl)benzimidazole; 4-(methyl)indolyl; 4,6-(dimethyl)indolyl; 5 nitroindole; 5 substituted pyrimidines; 5-(methyl)isocarbostyrilyl; 5-nitroindole; 6-(aza)pyrimidine; 6-(azo)thymine; 6-(methyl)-7-(aza)indolyl; 6-chloro-purine; 6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenthiazin-1-yl; 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenthiazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-l-yl; 7-(aza)indolyl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazinl-yl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenthiazin-1-yl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(guanidiniumalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(guanidiniumalkyl-hydroxy)-1,3-(diaza)-2-(oxo)-phenthiazin-1-yl; 7-(guanidiniumalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(propynyl)isocarbostyrilyl; 7-(propynyl)isocarbostyrilyl, propynyl-7-(aza)indolyl; 7-deaza-inosinyl; 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-substituted 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 9-(methyl)-imidizopyridinyl; Aminoindolyl;
[0125] Anthracenyl; bis-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; bis-ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Difluorotolyl; Hypoxanthine; Imidizopyridinyl; Inosinyl; Isocarbostyrilyl; N2-substituted purines; N6-methyl-2-amino-purine; N6-substituted purines; N-alkylated derivative; Napthalenyl; Nitrobenzimidazolyl; Nitroimidazolyl; Nitroindazolyl; Nitropyrazolyl; Nubularine; 06-substituted purines; O-alkylated derivative; ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Oxoformycin TP; para-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; para-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Pentacenyl; Phenanthracenyl;
[0126] Phenyl; propynyl-7-(aza)indolyl; Pyrenyl; pyridopyrimidin-3-yl; pyridopyrimidin-3-yl, 2-oxo-7-amino-pyridopyrimidin-3-yl; pyrrolo-pyrimidin-2-on-3-yl; Pyrrolopyrimidinyl; Pyrrolopyrizinyl; Stilbenzyl; substituted 1,2,4-triazoles; Tetracenyl; Tubercidine; Xanthine; Xanthosine-5'-TP; 2-70395W001 thio-zebularine; 5-aza-2-thio-zebularine; 7-deaza-2-amino-purine; pyridin-4-one ribonucleoside; 2-Amino-riboside-TP; Formycin A TP; Formycin B TP; Pyrrolosine TP; 2'-OH-ara-cytidine TP; 2'-OH-ara-uridine TP TP; or 5-(2-carbomethoxyvinyl)uridine TP. The uridine-substitutable modified nucleotides may be selected from pseudouridine, N1 -methylpseudouridine, 5-methyluridine or N1-ethylpseudouridine. The uridine-substitutable modified nucleotides may comprise N1-methylpseudouridine.
[0127] One or more cytidines in the RNA molecule may be replaced with a cytidine-substitutable modified nucleotide. The RNA molecule may comprise a genus of cytidine and cytidine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% is a subgenus thereof consisting of cytidine-substitutable modified nucleotides. The RNA molecule may comprise a genus of cytidine and cytidine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the genus are cytidine-substitutable modified nucleotides. The first and / or second RNA molecules may comprise a genus of cytidine and cytidine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% is a subgenus thereof consisting of cytidine-substitutable modified nucleotides. The first and / or second RNA molecules may comprise a genus of cytidine and cytidine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the genus are cytidine-substitutable modified nucleotides. The RNA molecule may comprise a genus of cytidine and cytidine-substitutable modified nucleotides of which 100% is a subgenus thereof consisting of cytidine-substitutable modified nucleotides, except for the first 5’ cytidine. The RNA molecule may comprise a genus of cytidine and cytidine-substitutable modified nucleotides of which 100% of the genus are cytidine-substitutable modified nucleotides, except for the first 5’ cytidine. The first and / or second RNA molecules may comprise a genus of cytidine and cytidine-70395W001 substitutable modified nucleotides of which 100% is a subgenus thereof consisting of cytidine-substitutable modified nucleotides, except for the first 5’ cytidine. The first and / or second RNA molecules may comprise a genus of cytidine and cytidine-substitutable modified nucleotides of which 100% of the genus are cytidine-substitutable modified nucleotides, except for the first 5’ cytidine.
[0128] The cytidine-substitutable modified nucleotides may comprise 2-thiocytidine; 3-methylcytidine; 5-formylcytidine; 5-hydroxymethylcytidine; 5-methylcytidine; N4-acetylcytidine; 2'-O-methylcytidine; 2'-O-methylcytidine; 5,2'-O-dimethylcytidine; 5-formyl-2'-O-methylcytidine; Lysidine; N4,2'-O-dimethylcytidine; N4-acetyl-2'-O-methylcytidine; N4-methylcytidine; N4, N4-Dimethyl-2'-OMe-Cytidine TP; 4-methylcytidine; 5-aza-cytidine; Pseudo-iso-cytidine; pyrrolo-cytidine;.alpha. -thio-cytidine; 2-(thio)cytosine; 2'-Amino-2'-deoxy-CTP; 2'-Azido-2'-deoxy-CTP; 2'-Deoxy-2'-a-aminocytidine TP; 2'-Deoxy-2'-a-azidocytidine TP; 3 (deaza) 5 (aza)cytosine; 3 (methyl)cytosine; 3-(alkyl)cytosine; 3-(deaza) 5 (aza)cytosine; 3-(methyl)cytidine; 4,2'-O-dimethylcytidine; 5 (halo)cytosine; 5 (methyl)cytosine; 5 (propynyl)cytosine; 5 (trifluoromethyl)cytosine; 5-(alkyl)cytosine; 5-(alkynyl)cytosine; 5-(halo)cytosine; 5-(propynyl)cytosine; 5-(trifluoromethyl)cytosine: 5-bromo-cytidine; 5-iodo-cytidine; 5-propynyl cytosine; 6-(azo)cytosine; 6-aza-cytidine; aza cytosine; deaza cytosine; N4 (acetyl)cytosine; 1-methyl-1-deaza-pseudoisocytidine; 1-methyl-pseudoisocytidine; 2-methoxy-5-methyl-cytidine: 2-methoxy-cytidine; 2-thio-5-methyl-cytidine; 4-methoxy-1-methyl-pseudoisocytidine; 4-methoxy-pseudoisocytidine; 4-thio-1-methyl-1-deaza-pseudoisocytidine; 4-thio-1-methyl-pseudoisocytidine; 4-thio-pseudoisocytidine; 5-aza-zebularine; 5-methyl-zebularine; pyrrolo-pseudoisocytidine; Zebularine; (E)-5-(2-Bromo-vinyl)cytidine TP; 2,2'-anhydro-cytidine TP hydrochloride; 2'Fluor-N4-Bz-cytidine TP; 2'Fluoro-N4-Acetyl-cytidine TP; 2'-O-Methyl-N4-Acetyl-cytidine TP; 2'O-methyl-N4-Bz-cytidine TP; 2'-a-Ethynylcytidine TP; 2'-a-Trifluoromethylcytidine TP; 2'-b-Ethynylcytidine TP; 2'-b-Trifluoromethylcytidine TP; 2'-Deoxy-2',2'-difluorocytidine TP; 2'-Deoxy-2'-a-mercaptocytidine TP; 2'-Deoxy-2'-a-thiomethoxycytidine TP; 2'-Deoxy-2'-b-aminocytidine TP; 2'-Deoxy-2'-b-azidocytidine TP; 2'-Deoxy-2'-b-bromocytidine TP; 2'-Deoxy-2'-b-chlorocytidine TP; 2'-Deoxy-2'-b-fluorocytidine TP; 2'-Deoxy-2'-b-iodocytidine TP; 2'-Deoxy-2'-b-mercaptocytidine TP; 2'-Deoxy-2'-b-thiomethoxycytidine TP; 2'-O-Methyl-5-(1-propynyl)cytidine TP; 3'-Ethynylcytidine TP; 4'-Azidocytidine TP; 4'-Carbocyclic cytidine TP; 4'-Ethynylcytidine TP; 5-(1-Propynyl)ara-cytidine TP; 5-(2-Chloro-phenyl)-2-thiocytidine TP; 5-(4-Amino-phenyl)-2-thiocytidine TP; 5-Aminoallyl-CTP; 5-Cyanocytidine TP; 5-Ethynylara-cytidine TP; 5-Ethynylcytidine TP; 5'-Homo-cytidine TP; 5-Methoxycytidine TP; 5-Trifluoromethyl-Cytidine TP; N4-Amino-cytidine TP; N4-Benzoyl-cytidine TP; Pseudoisocytidine;70395W001 2'fluoro-cytidine; or 2'-OH-ara-cytidine TP. The cytidine-substitutable modified nucleotides may comprise 5-hydroxymethylcytidine or 5-methylcytidine.
[0129] One or more guanosines in the RNA molecule may be replaced with a guanosine-substitutable modified nucleotide. The RNA molecule may comprise a genus of guanosine and guanosine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% is a subgenus thereof consisting of guanosine-substitutable modified nucleotides. The RNA molecule may comprise a genus of guanosine and guanosine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the genus are guanosine-substitutable modified nucleotides. The first and / or second RNA molecules may comprise a genus of guanosine and guanosine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% is a subgenus thereof consisting of guanosine-substitutable modified nucleotides. The first and / or second RNA molecules may comprise a genus of guanosine and guanosine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the genus are guanosine-substitutable modified nucleotides. The RNA molecule may comprise a genus of guanosine and guanosine-substitutable modified nucleotides of which 100% is a subgenus thereof consisting of guanosine-substitutable modified nucleotides, except for the first 5’ guanosine. The RNA molecule may comprise a genus of guanosine and guanosine-substitutable modified nucleotides of which 100% of the genus are guanosine-substitutable modified nucleotides, except for the first 5’ guanosine. The first and / or second RNA molecules may comprise a genus of guanosine and guanosine-substitutable modified nucleotides of which 100% is a subgenus thereof consisting of guanosine-substitutable modified nucleotides, except for the first 5’ guanosine. The first and / or second RNA molecules may comprise a genus of guanosine and guanosine-70395W001 substitutable modified nucleotides of which 100% of the genus are guanosine-substitutable modified nucleotides, except for the first 5’ guanosine.
[0130] The guanosine-substitutable modified nucleotides may comprise: 7-methylguanosine; N2,2'-O-dimethylguanosine; N2-methylguanosine; Wyosine; 1,2'-O-dimethylguanosine; 1-methylguanosine; 2'-O-methylguanosine; 2'-O-ribosylguanosine (phosphate); 2'-O-methylguanosine; 2'-O-ribosylguanosine (phosphate); 7-aminomethyl-7-deazaguanosine; 7-cyano-7-deazaguanosine; Archaeosine; Methylwyosine; N2,7-dimethylguanosine; N2, N2,2'-O-trimethylguanosine; N2, N2,7-trimethylguanosine; N2, N2-dimethylguanosine; N2,7,2'-O-trimethylguanosine; 6-thio-guanosine; 7-deaza-guanosine; 8-oxo-guanosine; N1-methyl-guanosine;.alpha. -thio-guanosine; 2 (propyl)guanine; 2-(alkyl)guanine; 2'-Amino-2'-deoxy-GTP; 2'-Azido-2'-deoxy-GTP; 2'-Deoxy-2'-a-aminoguanosine TP; 2'-Deoxy-2'-a-azidoguanosine TP; 6 (methyl)guanine; 6-(alkyl)guanine; 6-(methyl)guanine; 6-methyl-guanosine; 7 (alkyl)guanine; 7 (deaza)guanine; 7 (methyl)guanine; 7-(alkyl)guanine; 7-(deaza)guanine; 7-(methyl)guanine; 8 (alkyl)guanine; 8 (alkynyl)guanine; 8 (halo)guanine; 8 (thioalkyl)guanine; 8-(alkenyl)guanine; 8-(alkyl)guanine; 8-(alkynyl)guanine; 8-(amino)guanine; 8-(halo)guanine; 8-(hydroxyl)guanine; 8-(thioalkyl)guanine; 8-(thiol)guanine; aza guanine; deaza guanine; N (methyl)guanine; N-(methyl)guanine; 1-methyl-6-thio-guanosine; 6-methoxy-guanosine; 6-thio-7-deaza-8-aza-guanosine; 6-thio-7-deaza-guanosine; 6-thio-7-methyl-guanosine; 7-deaza-8-aza-guanosine; 7-methyl-8-oxo-guanosine; N2, N2-dimethyl-6-thio-guanosine; N2-methyl-6-thio-guanosine; 1-Me-GTP; 2'Fluoro-N2-isobutyl-guanosine TP; 2'O-methyl-N2-isobutyl-guanosine TP; 2'-a-Ethynylguanosine TP; 2'-a-Trifluoromethylguanosine TP; 2'-b-Ethynylguanosine TP; 2'-b-Trifluoromethylguanosine TP; 2'-Deoxy-2',2'-difluoroguanosine TP; 2'-Deoxy-2'-a-mercaptoguanosine TP; 2'-Deoxy-2'-a-thiomethoxyguanosine TP; 2'-Deoxy-2'-b-aminoguanosine TP; 2'-Deoxy-2'-b-azidoguanosine TP; 2'-Deoxy-2'-b-bromoguanosine TP; 2'-Deoxy-2'-b-chloroguanosine TP; 2'-Deoxy-2'-b-fluoroguanosine TP; 2'-Deoxy-2'-b-iodoguanosine TP; 2'-Deoxy-2'-b-mercaptoguanosine TP; 2'-Deoxy-2'-b-thiomethoxyguanosine TP; 4'-Azidoguanosine TP; 4'-Carbocyclic guanosine TP; 4'-Ethynylguanosine TP; 5'-Homo-guanosine TP; 8-bromo-guanosine TP; 9-Deazaguanosine TP; N2-isobutyl-guanosine TP; 1-methylinosine; Inosine; 1,2'-O-dimethylinosine; 2'-O-methylinosine; 7-methylinosine; 2'-O-methylinosine; Epoxyqueuosine; galactosyl-queuosine; Mannosylqueuosine; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazinl-yl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenthiazin-1-yl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(guanidiniumalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(guanidiniumalkyl-hydroxy)-1,3-(diaza)-2-(oxo)-phenthiazin-1-yl; 7-(guanidiniumalkylhydroxy)-70395W001 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(propynyl)isocarbostyrilyl; 7-(propynyl)isocarbostyrilyl, propynyl-7-(aza)indolyl; 7-deaza-inosinyl; 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-substituted 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 9-(methyl)-imidizopyridinyl; Aminoindolyl; Anthracenyl; bis-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; bis-ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Difluorotolyl; Hypoxanthine; Imidizopyridinyl; Inosinyl; Isocarbostyrilyl; Isoguanisine; N2-substituted purines; N6-methyl-2-amino-purine; N6-substituted purines; N-alkylated derivative; Napthalenyl; Nitrobenzimidazolyl; Nitroimidazolyl; Nitroindazolyl; Nitropyrazolyl; Nubularine; 06-substituted purines; O-alkylated derivative; ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Oxoformycin TP; para-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; para-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Pentacenyl; Phenanthracenyl;
[0131] Phenyl; propynyl-7-(aza)indolyl; Pyrenyl; pyridopyrimidin-3-yl; pyridopyrimidin-3-yl, 2-oxo-7-amino-pyridopyrimidin-3-yl; pyrrolo-pyrimidin-2-on-3-yl; Pyrrolopyrimidinyl; Pyrrolopyrizinyl; Stilbenzyl; substituted 1,2,4-triazoles; Tetracenyl; Tubercidine; Xanthine; Xanthosine-5'-TP; 2-thio-zebularine; 5-aza-2-thio-zebularine; 7-deaza-2-amino-purine; pyridin-4-one ribonucleoside; 2-Amino-riboside-TP; Formycin A TP; Formycin B TP; Pyrrolosine TP; or 2'-OH-ara-guanosine TP.
[0132] One or more adenosines in the RNA molecule may be replaced with an adenosine-substitutable modified nucleotide. The RNA molecule may comprise a genus of adenosine and adenosine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% is a subgenus thereof consisting of adenosine-substitutable modified nucleotides. The RNA molecule may comprise a genus of adenosine and adenosine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the genus are adenosine-substitutable modified nucleotides. The first and / or second RNA molecules may comprise a genus of adenosine and adenosine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% is a subgenus thereof70395W001 consisting of adenosine-substitutable modified nucleotides. The first and / or second RNA molecules may comprise a genus of adenosine and adenosine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the genus are adenosine-substitutable modified nucleotides. The RNA molecule may comprise a genus of adenosine and adenosine-substitutable modified nucleotides of which 100% is a subgenus thereof consisting of adenosine-substitutable modified nucleotides, except for the first 5’ guanosine. The RNA molecule may comprise a genus of adenosine and adenosine-substitutable modified nucleotides of which 100% of the genus are adenosine-substitutable modified nucleotides, except for the first 5’ guanosine. The first and / or second RNA molecules may comprise a genus of adenosine and adenosine-substitutable modified nucleotides of which 100% is a subgenus thereof consisting of adenosine-substitutable modified nucleotides, except for the first 5’ adenosine. The first and / or second RNA molecules may comprise a genus of adenosine and adenosine-substitutable modified nucleotides of which 100% of the genus are adenosine-substitutable modified nucleotides, except for the first 5’ adenosine.
[0133] The adenosine-substitutable modified nucleotides may comprise: 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine; 2-methylthio-N6-methyladenosine; 2-methylthio-N6-threonyl carbamoyladenosine; N6-glycinylcarbamoyladenosine; N6-isopentenyladenosine; N6-methyladenosine; N6-threonylcarbamoyladenosine; 1,2'-O-dimethyladenosine; 1-methyladenosine; 2'-O-methyladenosine; 2'-O-ribosyladenosine (phosphate); 2-methyladenosine; 2-methylthio-N6 isopentenyladenosine; 2-methylthio-N6-hydroxynorvalyl carbamoyladenosine; 2'-O-methyladenosine; 2'-O-ribosyladenosine (phosphate);
[0134] Isopentenyladenosine; N6-(cis-hydroxyisopentenyl)adenosine; N6,2'-O-dimethyladenosine; N6,2'-O-dimethyladenosine; N6, N6,2'-O-trimethyladenosine; N6, N6-dimethyladenosine; N6-acetyladenosine; N6-hydroxynorvalylcarbamoyladenosine; N6-methyl-N6-threonylcarbamoyladenosine; 2-methyladenosine; 2-methylthio-N6-isopentenyladenosine; 7-deaza-adenosine; N1-methyl-adenosine; N6, N6 (dimethyl)adenine; N6-cis-hydroxy-isopentenyl-adenosine;.alpha. -thio-adenosine; 2 (amino)adenine; 2 (aminopropyl)adenine; 2 (methylthio) N6 (isopentenyl)adenine; 2-(alkyl)adenine; 2-(aminoalkyl)adenine; 2-(aminopropyl)adenine; 2-(halo)adenine; 2-(halo)adenine; 2-(propyl)adenine; 2'-Amino-2'-deoxy-ATP; 2'-Azido-2'-deoxy-ATP; 2'-Deoxy-2'-a-aminoadenosine TP; 2'-Deoxy-2'-a-azidoadenosine TP; 6 (alkyl)adenine; 6 (methyl)adenine; 6-(alkyl)adenine; 6-(methyl)adenine; 7 (deaza)adenine; 8 (alkenyl)adenine; 870395W001 (alkynyl)adenine; 8 (amino)adenine; 8 (thioalkyl)adenine; 8-(alkenyl)adenine; 8-(alkyl)adenine; 8-(alkynyl)adenine; 8-(amino)adenine; 8-(halo)adenine; 8-(hydroxyl)adenine; 8-(thioalkyl)adenine; 8-(thiol)adenine; 8-azido-adenosine; aza adenine; deaza adenine; N6 (methyl)adenine; N6-(isopentyl)adenine; 7-deaza-8-aza-adenosine; 7-methyladenine; 1-Deazaadenosine TP; 2'Fluoro-N6-Bz-deoxyadenosine TP; 2'-OMe-2-Amino-ATP; 2'O-methyl-N6-Bz-deoxyadenosine TP; 2'-a-Ethynyladenosine TP; 2-aminoadenine; 2-Aminoadenosine TP; 2-Amino-ATP; 2'-a-Trifluoromethyladenosine TP; 2-Azidoadenosine TP; 2'-b-Ethynyladenosine TP; 2-Bromoadenosine TP; 2'-b-Trifluoromethyladenosine TP; 2-Chloroadenosine TP; 2'-Deoxy-2',2'-difluoroadenosine TP; 2'-Deoxy-2'-a-mercaptoadenosine TP; 2'-Deoxy-2'-a-thiomethoxyadenosine TP; 2'-Deoxy-2'-b-aminoadenosine TP; 2'-Deoxy-2'-b-azidoadenosine TP; 2'-Deoxy-2'-b-bromoadenosine TP; 2'-Deoxy-2'-b-chloroadenosine TP; 2'-Deoxy-2'-b-fluoroadenosine TP; 2'-Deoxy-2'-b-iodoadenosine TP; 2'-Deoxy-2'-b-mercaptoadenosine TP; 2'-Deoxy-2'-b-thiomethoxyadenosine TP; 2-Fluoroadenosine TP; 2-Iodoadenosine TP; 2-Mercaptoadenosine TP; 2-methoxy-adenine; 2-methylthio-adenine; 2-Trifluoromethyladenosine TP; 3-Deaza-3-bromoadenosine TP; 3-Deaza-3-chloroadenosine TP; 3-Deaza-3-fluoroadenosine TP; 3-Deaza-3-iodoadenosine TP; 3-Deazaadenosine TP; 4'-Azidoadenosine TP; 4'-Carbocyclic adenosine TP; 4'-Ethynyladenosine TP; 5'-Homo-adenosine TP; 8-Aza-ATP; 8-bromo-adenosine TP; 8-Trifluoromethyladenosine TP; 9-Deazaadenosine TP; Wybutosine; Hydroxywybutosine; Isowyosine; Peroxywybutosine; undermodified hydroxywybutosine; 4-demethylwyosine; 2,6-(diamino)purine; 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl: 1,3-(diaza)-2-(oxo)-phenthiazin-1-yl; 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 1,3,5-(triaza)-2,6-(dioxa)-naphthalene; 2 (amino)purine; 2,4,5-(trimethyl)phenyl; 2' methyl, 2'amino, 2'azido, 2'fluoro-cytidine; 2' methyl, 2'amino, 2'azido, 2'fluoro-adenine; 2'methyl, 2'amino, 2'azido, 2'fluoro-uridine; 2'-amino-2'-deoxyribose; 2-amino-6-Chloro-purine; 2-aza-inosinyl; 2'-azido-2'-deoxyribose; 2'fluoro-2'-deoxyribose; 2'-fluoro-modified bases; 2'-O-methyl-ribose; 2-oxo-7-aminopyridopyrimidin-3-yl; 2-oxo-pyridopyrimidine-3-yl; 2-pyridinone; 3 nitropyrrole; 3-(methyl)-7-(propynyl)isocarbostyrilyl; 3-(methyl)isocarbostyrilyl; 4-(fluoro)-6-(methyl)benzimidazole; 4-(methyl)benzimidazole; 4-(methyl)indolyl; 4,6-(dimethyl)indolyl; 5 nitroindole; 5 substituted pyrimidines; 5-(methyl)isocarbostyrilyl; 5-nitroindole; 6-(aza)pyrimidine; 6-(azo)thymine; 6-(methyl)-7-(aza)indolyl; 6-chloro-purine; 6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenthiazin-1-yl; 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenthiazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-l-yl; 7-(aza)indolyl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-70395W001 phenoxazinl-yl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenthiazin-1-yl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(guanidiniumalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(guanidiniumalkyl-hydroxy)-1,3-(diaza)-2-(oxo)-phenthiazin-1-yl; 7-(guanidiniumalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(propynyl)isocarbostyrilyl; 7-(propynyl)isocarbostyrilyl, propynyl-7-(aza)indolyl; 7-deaza-inosinyl; 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7-substituted 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 9-(methyl)-imidizopyridinyl; Aminoindolyl;
[0135] Anthracenyl; bis-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; bis-ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Difluorotolyl; Hypoxanthine; Imidizopyridinyl; Inosinyl; Isocarbostyrilyl; Isoguanisine; N2-substituted purines; N6-methyl-2-amino-purine; N6-substituted purines; N-alkylated derivative; Napthalenyl; Nitrobenzimidazolyl; Nitroimidazolyl; Nitroindazolyl; Nitropyrazolyl; Nubularine; 06-substituted purines; O-alkylated derivative; ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Oxoformycin TP; para-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; para-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; Pentacenyl; Phenanthracenyl;
[0136] Phenyl; propynyl-7-(aza)indolyl; Pyrenyl; pyridopyrimidin-3-yl; pyridopyrimidin-3-yl, 2-oxo-7-amino-pyridopyrimidin-3-yl; pyrrolo-pyrimidin-2-on-3-yl; Pyrrolopyrimidinyl; Pyrrolopyrizinyl; Stilbenzyl; substituted 1,2,4-triazoles; Tetracenyl; Tubercidine; Xanthine; Xanthosine-5'-TP; 2-thio-zebularine; 5-aza-2-thio-zebularine; 7-deaza-2-amino-purine; pyridin-4-one ribonucleoside; 2-Amino-riboside-TP; Formycin A TP; Formycin B TP; Pyrrolosine TP; 2'-OH-ara-adenosine TP; 2'-OH-ara-cytidine TP; 2'-OH-ara-uridine TP; 2'-OH-ara-guanosine TP; 5-(2-carbomethoxyvinyl)uridine TP; or N6-(19-Amino-pentaoxanonadecyl)adenosine TP.
[0137] One or more uridines in the RNA molecule may be replaced with a N1-methylpseudouridine. The RNA molecule may comprise a genus of uridine and uridine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of uridines in the RNA molecule are replaced with N1-methylpseudouridine. The first and / or second RNA molecules may comprise a genus of uridine and uridine-substitutable modified nucleotides of which at least 10% at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of uridine in the first and / or second RNA molecules are replaced with N1 -methylpseudouridine. The RNA70395W001 molecule may comprise a genus of uridine and uridine-substitutable modified nucleotides of which 100% of uridines in the RNA molecule are replaced with N1-methylpseudouridine, except for the first 5’ uridine. The first and / or second RNA molecules may comprise a genus of uridine and uridine-substitutable modified nucleotides of which 100% of uridines in the first and / or second RNA molecules are replaced with N1 -methylpseudouridine, except for the first 5’ uridine.
[0138] RNA molecules comprising modifications
[0139] Provided herein is a composition comprising either (i) a first RNA molecule comprising a first RNA sequence and a second RNA molecule comprising a second RNA sequence or (ii) a first RNA molecule comprising a first RNA sequence and a second RNA sequence; the first RNA sequence encoding one or more proteins capable of replicating a self-amplifying messenger RNA (samRNA) in an intracellular environment; the second RNA sequence comprising a heterologous nucleic acid; the first and / or the second RNA molecules comprising a genus of nucleotide of which at least 10% is a subgenus thereof consisting of modified nucleotides; the first and / or second RNA sequence further comprising one or more of the modifications selected from (a)-(d):
[0140] a) a 3’ poly-adenosine monophosphate (poly(A)) tail of at least 25, at least 30 or at least 40 nucleotides in length;
[0141] b) one or more regions of the first and / or second RNA sequence, that have a lower percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides, compared to the percentage of nucleotides that are uridine in the corresponding one or more regions of a corresponding wild type reference sequence;
[0142] c) a 3’ untranslated region (UTR) comprising a polynucleotide sequence of m(Txm)y, where x is 4 or 5, y is 6 or more, and m is independently selected from A or C; or d) a construct encoding a heterologous polypeptide interferon effector that suppresses an interferon response.
[0143] In one aspect, the first and the second RNA sequence are part of a contiguous first RNA molecule. The first and the second RNA sequence may be part of a contiguous samRNA molecule. In another aspect, the composition comprises at least two RNA molecules; the first of the RNA molecules comprising the first RNA sequence; the second of the RNA molecules comprising the second RNA sequence. Therefore, a samRNA or at least two RNA molecules (collectively trans-amplifying mRNA) may comprise one or more of the modifications selected70395W001 from (a)-(d). A samRNA or trans-amplifying mRNA may comprise 2, 3 or all of the modifications selected from (a)-(d). Each of the modifications (a) to (d) will be further described below.
[0144] (a) Poly-adenosine monophosphate (poly(A)) tails
[0145] The first and / or second RNA molecule may comprise a poly(A) tail. The first and / or second RNA molecule may also comprise a poly(A) polymerase recognition sequence (e.g. AAUAAA) near its’ 3’ end. The poly(A) tail may be 3’ of the 3’UTR. The poly(A) tail may be a 3’ poly(A) tail, i.e. the poly(A) tail may be at the 3’ end of the RNA molecule.
[0146] The inventors have found that, by increasing the length of the poly(A) tail of an RNA molecule (e.g. a samRNA) comprising modified nucleotides (e.g. N1-methylpseudouridine), the expression of a heterologous protein encoded therein is significantly improved.
[0147] The first and / or second RNA molecule may comprise a 3’ poly(A) tail consisting of adenosine monophosphate residues (i.e. thereby generating a length of exclusively consecutive adenosine monophosphate residues). The first and / or second RNA molecule may comprise a 3’ poly(A) tail that is split. The 3’ split poly(A) tail may comprise, consist of, or be, in 5’ to 3’ order, a sequence of consecutive adenosine monophosphate residues, a spacer, and a sequence of consecutive adenosine monophosphate residues. The 3’ split poly(A) tail may be ordered from 5’ to 3’ as the sequence of consecutive adenosine monophosphate residues, the spacer, and the sequence of consecutive adenosine monophosphate residues. The 3’ split poly(A) tail may be at the 3’ end of the first and / or second RNA molecule. The 3’ split poly(A) tail may comprise SEQ ID NO: 83. The 3’ split poly(A) tail may consist of SEQ ID NO: 83.
[0148] The first and / or second RNA molecule may comprise a 3’ poly(A) tail of at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 nucleotides in length. The first and / or second RNA molecule may comprise a 3’ poly(A) tail of at least 40 nucleotides in length. The first and / or second RNA molecule may comprise a 3’ poly(A) tail of at least 50 nucleotides in length. The first and / or second RNA molecule may comprise a 3’ poly(A) tail of at least 60 nucleotides in length. The first and / or second RNA molecule may comprise a 3’ poly(A) tail of at least 70 nucleotides in length. The first and / or second RNA molecule may comprise a 3’ poly(A) tail of at least 80 nucleotides in length. The first and / or second RNA molecule may comprise a 3’ poly(A) tail of at least 90 nucleotides in length. The first and / or second RNA molecule may comprise a 3’ poly(A) tail of at least 100 nucleotides in length.
[0149] The first and / or second RNA molecule may comprise a 3’ poly(A) tail of 50 to 250 nucleotides in length. The first and / or second RNA molecule may comprise a 3’ poly(A) tail of 5070395W001 to 200 nucleotides in length. The first and / or second RNA molecule may comprise a 3’ poly(A) tail of 50 to 150 nucleotides in length. The first and / or second RNA molecule may comprise a 3’ poly(A) tail of 50 to 100 nucleotides in length. The first and / or second RNA molecule may comprise a 3’ poly(A) tail of 60 to 90 nucleotides in length. The first and / or second RNA molecule may comprise a 3’ poly(A) tail of about 80 nucleotides in length.
[0150] The first and / or second RNA molecule may comprise a 3’ poly(A) tail comprising at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 consecutive adenosine monophosphate residues. The first and / or second RNA molecule may comprise a 3’ poly(A) tail comprising at least 40 consecutive adenosine monophosphate residues. The first and / or second RNA molecule may comprise a 3’ poly(A) tail comprising at least 50 consecutive adenosine monophosphate residues. The first and / or second RNA molecule may comprise a 3’ poly(A) tail comprising at least 60 consecutive adenosine monophosphate residues. The first and / or second RNA molecule may comprise a 3’ poly(A) tail comprising at least 70 consecutive adenosine monophosphate residues. The first and / or second RNA molecule may comprise a 3’ poly(A) tail comprising at least 80 consecutive adenosine monophosphate residues. The first and / or second RNA molecule may comprise a 3’ poly(A) tail comprising at least 90 consecutive adenosine monophosphate residues. The first and / or second RNA molecule may comprise a 3’ poly(A) tail comprising at least 100 consecutive adenosine monophosphate residues.
[0151] (b) Reduced percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides
[0152] The inventors have found that, in an RNA molecule comprising modified nucleotides (e.g. N1-methylpseudouridine), the expression of a heterologous protein encoded therein is improved by reducing the percentage of uridine and / or uridine-substitutable modified nucleotides in one or more regions of the RNA molecule.
[0153] The first and / or second RNA molecule may comprise one or more regions that have a lower percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides, compared to the percentage of nucleotides that are uridine in the corresponding one or more regions of a corresponding wild type reference sequence. The “percentage of uridine and uridine-substitutable modified nucleotides” means the percentage of the total population of all nucleotides in the region of the first and / or second RNA sequence that are either uridine-substitutable modified nucleotides or uridine nucleotides. For example, in the case of a region of an RNA molecule having 100 nucleotides including 10 uridine nucleotides and 10 uridine-70395W001 substitutable modified nucleotides, 20% of the nucleotides are uridine and uridine-substitutable modified nucleotides in said region. Thus, an RNA molecule having “one or more regions of the first and / or second RNA sequence, that have a lower percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides, compared to the percentage of nucleotides that are uridine in the corresponding one or more regions of a corresponding wild type reference sequence” means that the first and / or second RNA molecule has a region with a percentage of nucleotides that are either uridine or uridine-substitutable modified nucleotides that is a lower percentage compared to the same region in a wild type reference sequence of the first and / or second RNA molecule. For example, 15% of a region of a first RNA molecule may be uridine and uridine-substitutable modified nucleotides, whereas 20% of the nucleotides in the corresponding region of a corresponding wild type reference sequence may be uridine and uridine-substitutable modified nucleotides.
[0154] The one or more regions may comprise (i) at least a portion of a nucleic acid encoding an alphavirus nsP1, an alphavirus nsP2, an alphavirus nsP3, and an alphavirus nsP4 and / or (ii) a nucleic acid encoding a heterologous polypeptide interferon effector that suppresses an interferon response.
[0155] The first and / or second RNA molecule and the one or more regions therein may comprise sequence features that do not have a lower percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides, compared to the percentage of nucleotides that are uridine in the corresponding one or more regions of a corresponding wild type reference sequence. For example, such sequence features may include the subgenomic promoter or stem-loop regions. The first RNA molecule may comprise an opal stop codon (i.e. UGA) between the nsP3 coding region and the nsP4 coding region. The first RNA molecule may comprise a conserved sequence element represented by SEQ ID NO: 51. The first RNA molecule may comprise a stem-loop region represented by SEQ ID NO: 52. The first or second RNA molecule may comprise a subgenomic promoter represented by SEQ ID NO: 50. The first or second RNA sequence may comprise a subgenomic promoter represented by SEQ ID NO: 50.
[0156] The first RNA molecule may comprise a first RNA sequence having a lower percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides compared to the percentage of nucleotides that are uridine in the corresponding region of a corresponding wild type reference sequence, wherein no more than the first 5’ 90, such as no more than the first 5’ 100, no more than the first 5’ 110, no more than the first 5’ 120, no more than the first 5’ 130, no more than the first 5’ 140, no more than the first 5’ 150, no more than the first 5’ 160, no more70395W001 than the first 5’ 170, no more than the first 5’ 180, no more than the first 5’ 190, no more than the first 5’ 200, no more than the first 5’ 210, no more than the first 5’ 220, no more than the first 5’ 230, no more than the first 5’ 240, no more than the first 5’ 250, no more than the first 5’ 260, no more than the first 5’ 270, no more than the first 5’ 280, no more than the first 5’ 290, no more than the first 5’ 300, no more than the first 5’ 310, no more than the first 5’ 320, no more than the first 5’ 330, no more than the first 5’ 340, no more than the first 5’ 350, no more than the first 5’ 360, no more than the first 5’ 370, no more than the first 5’ 380, no more than the first 5’ 390, no more than the first 5’ 400, no more than the first 5’ 410, no more than the first 5’ 420, no more than the first 5’ 430, no more than the first 5’ 440, no more than the first 5’ 450, no more than the first 5’ 460, no more than the first 5’ 470, no more than the first 5’ 480, no more than the first 5’ 490, or no more than the first 5’ 500 nucleotides of the first RNA sequence has a percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides that is substantially the same compared to the percentage of nucleotides that are uridine in the corresponding region of a corresponding wild type reference sequence. No more than the first 5’ 200 nucleotides of the first RNA sequence may have a percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides that is substantially the same compared to the percentage of nucleotides that are uridine in the corresponding region of a corresponding wild type reference sequence. No more than the first 5’ 270 nucleotides of the first RNA sequence may have a percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides that is substantially the same compared to the percentage of nucleotides that are uridine in the corresponding region of a corresponding wild type reference sequence. The first RNA molecule may comprise SEQ ID NO: 68. The first RNA molecule may comprise a conserved sequence element represented by SEQ ID NO: 51. The first RNA molecule may comprise SEQ ID NO: 69.
[0157] The one or more regions may have a percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides of 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, or 12% or less. The one or more regions may have a percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides of 13% or less. The one or more regions may have a percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides of between 10 to 20%, 10 to 15% or 10 to 13%. The one or more regions may have a percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides of between 11 to 13%.
[0158] The one or more regions may comprise at least a portion of a nucleic acid encoding an alphavirus nsP1, an alphavirus nsP2, an alphavirus nsP3, and an alphavirus nsP4. The one or70395W001 more regions may comprise a sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 73. The one or more regions may comprise a sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 74.
[0159] The one or more regions may comprise a nucleic acid encoding a heterologous polypeptide interferon effector that suppresses an interferon response. The one or more regions may comprise a sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 77.
[0160] The one or more regions may comprise a sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 71 or SEQ ID NO: 72. The one or more regions may comprise a sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 96 or SEQ ID NO: 97.
[0161] The corresponding wild type reference sequence may comprise SEQ ID NO: 1. The corresponding wild type reference sequence may comprise SEQ ID NO: 76.
[0162] (c) Modified 3’UTRs
[0163] The inventors have found that the “T22 region” (represented by SEQ ID NO: 59) of the 3’UTR of samRNAs comprising modified nucleotides can be adapted to include sequence insertions, thereby increasing the expression of a heterologous protein encoded on the RNA molecule.
[0164] The first and / or second RNA molecule may comprise a 3’ untranslated region (UTR) comprising a polynucleotide sequence of m(Txm)y, where x is 4 or 5, y is 6 or more, and m is independently selected from A or C. The first and / or second RNA sequence may comprise a 3’ untranslated region (UTR) comprising a polynucleotide sequence of m(Txm)y, where x is 4 or 5, y is 6 or more, and m is independently selected from A or C.
[0165] The 3’UTR may comprise a polynucleotide sequence of mm(Txm)ym, where x is 4 or 5, y is 6 or more, and m is independently selected from A or C. The 3’UTR may comprise a polynucleotide sequence of mm(Txm)6m, where x is 4 or 5, and m is independently selected from A or C. The 3’UTR may comprise a polynucleotide sequence of SEQ ID NO: 60 or SEQ ID NO: 61. The 3’UTR may comprise a polynucleotide sequence of SEQ ID NO: 60. The 3’UTR may comprise a polynucleotide sequence of SEQ ID NO: 62 or SEQ ID NO: 65. The 3’UTR may comprise a polynucleotide sequence of SEQ ID NO: 62.70395W001 The 3’UTR may comprise a polynucleotide sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 53 or SEQ ID NO: 56. The 3’UTR may comprise a polynucleotide sequence of SEQ ID NO: 53 or SEQ ID NO: 56. The 3’UTR may comprise a polynucleotide sequence of SEQ ID NO: 53.
[0166] (d) Construct encoding a heterologous polypeptide interferon effector
[0167] Exogenous RNA has the capacity to activate the innate immune system. Innate immune activation would potentially cause unintended effects apart from those related to introduction of the heterologous (or exogenous) nucleic acids. The innate immune activation could also suppress the activity of the heterologous nucleic acids introduced by the RNA molecule. For example, the innate immune activation could suppress expression of an antigen encoded by the heterologous nucleic acid of the samRNA or the trans-amplifying RNA. The inventors have found that, by incorporating a construct encoding a heterologous polypeptide interferon effector in an RNA molecule having modified nucleotides (e.g. N1-methylpseudouridine), the expression of a heterologous protein from the RNA molecule is increased whilst also decreasing innate immune signaling in the treated cells.
[0168] The first and / or second RNA molecule may comprise a construct encoding a heterologous polypeptide interferon effector that suppresses an interferon response. The first and / or second RNA sequence may comprise a construct encoding a heterologous polypeptide interferon effector that suppresses an interferon response.
[0169] A “heterologous polypeptide interferon effector” includes wild-type viral or host cell proteins that alter or interrupt IFN functions, such as cytoplasmic RNA sensing, or hinder IFN signaling pathways, such as JAK-STAT, or a variant, or a fragment thereof. By “VP35” is intended a polypeptide of the Ebola virus or a variant, or a fragment thereof. By “N” is intended Porcine Reproductive and Respiratory Syndrome Virus N or a variant, or a fragment thereof. By “NS1” is intended the NS1 polypeptide of influenza A or a variant, or a fragment thereof. By “PB1-F2” is intended a polypeptide of the 1918 pandemic influenza strain or a variant, or a fragment thereof.
[0170] The construct encoding the heterologous polypeptide interferon effector may comprise a nucleic acid sequence encoding NS1, VP35, N, PB1 -F2, or a variant or fragment thereof. The heterologous polypeptide interferon effector may be NS1, or a variant or fragment thereof. The heterologous polypeptide interferon effector may be the RNA binding domain of NS1. The heterologous polypeptide interferon effector may be VP35, or a variant or fragment thereof. The70395W001 heterologous polypeptide interferon effector may be N, or a variant or fragment thereof. The heterologous polypeptide interferon effector may be PB1-F2, or a variant or fragment thereof.
[0171] The construct encoding the heterologous polypeptide interferon effector may comprise a sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 76 or SEQ ID NO: 77.
[0172] Additional elements may be included in the construct in order to optimize the expression of the heterologous polypeptide interferon effector. The construct may comprise one or more selfcleaving peptides. Suitable self-cleaving peptides include the family of 2A self-cleaving peptides (a.k.a 2A autoproteases) which includes foot-and-mouth disease virus 2A (F2A), equine rhinitis A virus 2A (E2A), porcine teschovirus-1 2A (P2A) or thosea asigna virus 2A (T2A). See Liu et al, Sci Rep 7, 2193 (2017). The one or more self-cleaving peptides of the construct may comprise T2A and / or P2A. The construct may comprise, in 5’ to 3’ order, sequence encoding: the T2A self-cleaving peptide (e.g. SEQ ID NO: 80), the heterologous polypeptide interferon effector, and the P2A self-cleaving peptide (e.g. SEQ ID NO: 84).
[0173] The construct may comprise sequence encoding a T2A self-cleaving peptide. The construct encoding the T2A self-cleaving peptide may comprise a sequence that has at least 80%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 80.
[0174] The construct may comprise sequence encoding a P2A self-cleaving peptide. The construct encoding the P2A self-cleaving peptide may comprise a sequence that has at least 80%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 84.
[0175] The construct may further comprise sequence encoding one or more linker peptides. The one or more linker peptides may link the one or more self-cleaving peptides to the heterologous polypeptide interferon effector. The one or more linker peptides may link the construct to a 5’ terminal region of the RNA molecule. The one or more linker peptides may be located 5’ relative to the T2A self-cleaving peptide and / or between the heterologous polypeptide interferon effector and the P2A self-cleaving peptide. Suitable linker peptides are known in the art. The construct may comprise a sequence encoding a linker peptide comprising or consisting of the amino acid sequence GSG. The construct may comprise a sequence encoding a linker peptide comprising a sequence that has at least 80% sequence identity to SEQ ID NO: 89. The construct may comprise a sequence encoding a linker peptide comprising or consisting of SEQ ID NO: 89.
[0176] The construct may comprise a polynucleotide sequence encoding a ubiquitin. The ubiquitin may be any suitable ubiquitin, such as a human ubiquitin or a murine ubiquitin. The polynucleotide sequence encoding the ubiquitin may comprise a sequence that has at least 80%, at least 85%, at least 90%, at least 95% or 100% sequence identity to SEQ ID NO: 78. The70395W001 construct may comprise, in 5’ to 3’ order, sequence encoding: the T2A self-cleaving peptide, the heterologous polypeptide interferon effector, and the ubiquitin.
[0177] The construct may comprise a sequence that has at least 80%, at least 85%, at least 90%, at least 95% or 100 sequence identity to SEQ ID NO: 90 or SEQ ID NO: 94. The construct may comprise a sequence that has at least 80%, at least 85%, at least 90%, at least 95% or 100 sequence identity to SEQ ID NO: 81.
[0178] The term “cap-dependent translation” or “cap-dependent initiation of translation” refers to a canonical mode of eukaryotic protein translation whereby recruitment of the ribosome to the mRNA to initiate translation is dependent on the 5’ cap present on RNA molecules. The term “cap-independent” or “cap-independent initiation of translation” refers to an alternative mode of eukaryotic translation in which a 5’ cap is not required to recruit a ribosome and initiate translation of a mRNA. Cap-independent translation may be achieved by inclusion of an internal ribosome entry site (IRES) in a mRNA. Cap-independent translation may also be achieved by using cap-independent translational enhancers (CITEs). See Shatsky et al, Trends in Biochem. Sci. 43:11 (2018).
[0179] Translation of the heterologous polypeptide interferon effector may be cap-dependent. Translation of the heterologous polypeptide interferon effector may be cap-independent. Capindependent translation of the heterologous polypeptide interferon effector may be achieved by inclusion of an internal ribosome entry site (IRES) in the construct. The construct may comprise an IRES. The construct may comprise a sequence that has at least 80%, at least 85%, at least 90%, at least 95% or 100 sequence identity to SEQ ID NO: 98. The construct may comprise a sequence that has at least 80%, at least 85%, at least 90%, at least 95% or 100 sequence identity to SEQ ID NO: 99.
[0180] The construct may be 3’ relative to a subgenomic promoter. The subgenomic promoter may comprise SEQ ID NO: 50.
[0181] The construct may be 5’ relative to a nucleic acid encoding the one or more proteins capable of replicating a samRNA in an intracellular environment. The construct may be 3’ relative to a 5’ terminal region comprising a 5’UTR and the first 5’ 140 nucleotides of a nucleic acid encoding an alphavirus nsP1 protein. The construct may be 3’ relative to a 5’ terminal region comprising a 5’UTR and the first 5’ 140 nucleotides of a nucleic acid encoding an alphavirus nsP1 protein.
[0182] 5’ Cap
[0183] The first and / or second RNA molecule may comprise a 5’ cap. The samRNA or the transamplifying mRNA may comprise a 5’ cap. A 5’ cap comprises a guanosine connected to the70395W001 RNA molecule via a 5’ to 5’ triphosphate linkage by mRNA guanylyltransferase, and wherein the guanine of said guanosine is methylated at its 7 position. In this context, a 5’ to 5’ triphosphate linkage occurs when the 5’ end of the ribose of said guanosine is linked to the 5’ end of the ribose of the RNA molecule via a triphophosphate group by mRNA guanylyltransferase.
[0184] Thereafter, the guanine of said guanosine is methylated at its 7 position by (guanine-N7-)-methyltransferase. Without further methylation, this cap is known as cap-0 and is expressed as 5’(m7Gp)(ppN)[pN]N, wherein the former “N” indicates the first (5’) nucleobase of the samRNA, the “pN” indicates a further nucleotide in the RNA molecule, and the addition of “[..]N” in “[pN]N” indicates the repeating polymeric structure of the RNA molecule and thereby collectively each sequentially adjacent nucleotide in the RNA molecule.
[0185] An additional oxygen-linked methylation by a 2’-0-methyltransferase to the 2’ carbon of the ribose of the nucleotide of the RNA molecule immediately adjacent to said guanosine results in a cap-1 structure, which is expressed as 5’(m7Gp)(ppm2N)[pN]N, wherein the addition of the “m2” indicates the oxygen-linked methylation of the 2’ carbon of the ribose of the nucleotide immediately adjacent (via the triphosphate linkage) to said guanosine. And further still, an additional methylation to the next (3’) nucleotide of the RNA molecule immediately adjacent to the nucleotide methylated in cap-1 results in a cap-2 structure, which is expressed as 5'(m7Gp)(ppm2N)(m2pN)[pN]n, wherein the addition of the latter “m2” indicates the methylation of the nucleotide immediately adjacent to the nucleotide methylated in cap-1. This cap-2 methylation is also to the 2’ carbon of the ribose of that immediately adjacent nucleotide. The 5’ cap may be a cap-0, a cap-1, or a cap-2. The 5’ cap may be a cap-0. The 5’ cap may be a cap-1. The 5’ cap may be a cap-2.
[0186] Kits providing all of the materials for a 5’ cap, whether it is cap-1 or cap-2, and supplemental kits adding cap-1 and cap-2 capacity to a cap-0 kit can be used. The methods for 5’ capping can be carried out according to the manufacturer’s instructions.
[0187] Untranslated regions (UTRs) and 5’ terminal nucleotides
[0188] The first and / or second RNA molecule may comprise a 5’UTR and / or a 3’UTR. The first and / or second RNA sequence may comprise a 5’UTR and / or a 3’UTR.
[0189] The 5’UTR and / or the 3’UTR may be derived from an alphavirus. The alphavirus may be Venezuelan equine encephalitis virus (VEE: e.g. Trinidad donkey, TC83CR, etc.), Semliki Forest Virus (SFV), Sindbis virus, Ross River virus, Western equine encephalitis virus, Eastern equine encephalitis virus, Chikungunya virus, S. A. AR86 virus, Everglades virus, Mucambo virus, Barmah Forest virus, Middelburg virus, Pixuna virus, O’nyong-nyong virus, Getah virus,70395W001 Sagiyama virus, Bebaru virus, Mayaro virus, Una virus, Aura virus, Whataroa virus, Banbanki virus, Kyzylagach virus, Highlands J virus, Fort Morgan virus, Ndumu virus, or Buggy Creek virus. The 5’UTR may be VEE-derived.
[0190] The 5’UTR may comprise a polynucleotide sequence that has at least 90%, at least 95%, at least 99% or 100% sequence identity to any one of SEQ ID NOs: 100-103. The 5’ UTR may comprise a polynucleotide sequence of SEQ ID NO: 101 or SEQ ID NO:102. The 5’UTR may be 5’ of the first RNA sequence. The 5’UTR may be 5’ of the second RNA sequence. The 5’UTR may be 5’ of the first RNA sequence and the second RNA sequence.
[0191] The 3’UTR may comprise a polynucleotide sequence that has at least 80%, at least 85%, 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 53 or SEQ ID NO: 56. The 3’UTR may be 3’ of the first RNA sequence. The 3’UTR may be 3’ of the second RNA sequence. The 3’UTR may be 3’ of the first RNA sequence and the second RNA sequence. The 3’ UTR may be 5’ of a poly(A) tail.
[0192] The inventors found that expression of a heterologous protein encoded by the heterologous nucleic acid on the modified RNA molecule can be further improved by ensuring the nucleotide positions 1 to 3 of the RNA molecule have the sequence AUA or AUG. The term “positions 1 to 3” or “nucleotide positions 1 to 3” refers to the first three nucleotides at the 5’ end of the RNA molecule, excluding any 5’ cap nucleotide. The first and / or second RNA molecule may comprise the sequence AUA or AUG at positions 1 to 3 of the first and / or second RNA molecule.
[0193] Subc / enomic promoters
[0194] The first and / or second RNA molecule may comprise one or more viral subgenomic "junction region" promoters or subgenomic promoters directing the expression of heterologous nucleic acid sequences, which may be modified in order to increase or reduce viral transcription of the subgenomic fragment and heterologous sequence(s) to be expressed. Other control elements can be used, as described below. Subgenomic promoters, also known as junction region promoters, can be used to regulate protein expression. Alphaviral subgenomic promoters regulate expression of alphaviral structural proteins. See Strauss and Strauss, " The alphaviruses: gene expression, replication, and evolution," Microbiol Rev. 1994 September; 58(3):491-562. A polycistronic polynucleotide can comprise a subgenomic promoter from any alphavirus. When two or more subgenomic promoters are present in a polycistronic polynucleotide, the promoters can be the same or different. For example, the subgenomic promoter can have the sequence CTCTCTACGGCTAACCTGAATGGA (SEQ ID NO: 50).70395W001 Subgenomic promoters can be modified in order to increase or reduce viral transcription of the proteins. See U. S. Pat. No. 6,592,874.
[0195] Order of components
[0196] The RNA molecule may comprise any of the following: the 5’ cap, the 5’UTR, a first subgenomic promoter, the first RNA sequence, the second RNA sequence, a second subgenomic promoter, the 3’UTR, and a poly(A) tail. The RNA molecule may comprise all of the following: the 5’ cap, the 5’UTR, a first subgenomic promoter, the second RNA sequence, a second subgenomic promoter, the first RNA sequence, the 3’UTR, and a poly(A) tail. The RNA molecule may comprise all of the following and in the following order: 5’-the 5’ cap, the 5’UTR, the first RNA sequence, subgenomic promoter, the second RNA sequence, the 3’UTR, and a poly(A) tail-3’. The RNA molecule may comprise all of the following and in the following order: 5’-the 5’ cap, the 5’UTR, a first subgenomic promoter, the first RNA sequence, a second subgenomic promoter, the second RNA sequence, the 3’UTR, and a poly(A) tail-3’.
[0197] Heterologous nucleic acid
[0198] In one aspect, the RNA molecule (e.g. a samRNA) or the at least two RNA molecules (collectively trans-amplifying RNA) comprises a second RNA sequence comprising a heterologous nucleic acid. The second RNA or second RNA sequence may comprise two or more heterologous nucleic acids. The samRNA may comprise two or more heterologous nucleic acids. The heterologous nucleic acid may encode a heterologous protein. The heterologous nucleic acid may comprise an inhibitory RNA. The heterologous nucleic acid may comprise an inhibitory RNA and encode a heterologous protein. The inhibitory RNA may comprise an antisense RNA, a small interfering RNA, or a microRNA. The heterologous protein may comprise an immunogen, an antibody, or a therapeutic protein.
[0199] The heterologous protein may comprise an immunogen or an antibody against the immunogen. The heterologous protein may comprise an antigen or an antibody against the antigen. The heterologous protein may comprise or consist of an immunogen. The heterologous protein may comprise or consist of an antibody. The heterologous protein may comprise or consist of an antibody against an immunogen.
[0200] The immunogen may elicit an immune response against at least one of the following bacteria, be an immunogen from at least one of the following bacteria, be an immunogen derived from at least one of the following bacteria (i.e. by being derived, it may not be the exact immunogen polypeptide, but may have modifications which may stabilize the protein for, for70395W001 example, expression in a cell or eliciting an immune response), or be an immunogen mimotope of a polypeptide from at least one of the following bacteria: Neisseria meningitidis including, but are not limited to, membrane proteins such as adhesins, autotransporters, toxins, iron acquisition proteins, and factor H binding protein; Streptococcus pneumoniae including, but are not limited to, the RrgB pilus subunit, the beta-N-acetyl-hexosaminidase precursor (spr0057), spr0096, general stress protein GSP-781 (spr2021, SP2216), serine / threonine kinase StkP (SP1732), and pneumococcal surface adhesin PsaA; Streptococcus pyogenes; Moraxella catarrhalis; Bordetella pertussis including but are not limited to, pertussis toxin or toxoid (PT), filamentous haemagglutinin (FHA), pertactin, and agglutinogens 2 and 3; Staphylococcus aureus including a hemolysin, esxA, esxB, ferrichrome-binding protein (sta006), and the sta011 lipoprotein; Clostridium tetani including tetanus toxoid immunogen; Cornynebacterium diphtheriae including diphtheria toxoid immunogen; Haemophilus influenzae; Pseudomonas aeruginosa’, Streptococcus agalactiae; Chlamydia trachomatis including, but are not limited to, PepA, LcrE, ArtJ, DnaK, CT398, OmpH-like, L7 / L12, OmcA, AtoS, CT547, Eno, HtrA,and MurG; Chlamydia pneumoniae; Helicobacter pylori; Escherichia coli, including the following pathological subforms enterotoxigenic E. coli (ETEC), enteroaggregative E. coli (EAggEC), diffusely adhering E. coli (DAEC), enteropathogenic E. coli (EPEC), enterohemorrhagic E. coli (EHEC), and extraintestinal pathogenic E. coli (ExPEC), including therein uropathogenic E.coli (UPEC) and meningitis / sepsis-associated E.coli (MNEC); Bacillus anthracis; Yersinia pestis; Staphylococcus epidermis’, Clostridium difficile; Clostridium perfringens’, Clostridium botulinums; Legionella pneumophila; Coxiella burnetiid; Brucella, including B. abortus, B.canis, B.melitensis, B.neotomae, B.ovis, B.suis, B.pinnipediae; Francisella, including F. novicida, F. philomiragia, F. tularensis. Neisseria gonorrhoeae, including polypeptides of the outer membrane vesicles; Treponema pallidum; Haemophilus ducreyi; Enterococcus faecalis; Enterococcus faecium; Staphylococcus saprophyticus; Yersinia enterocolitica; Mycobacterium tuberculosis; Rickettsia; Listeria monocytogenes; Vibrio cholerae; Salmonella including Salmonella typhii; Borrelia burgdorferi; Porphyromonas gingivalis; and Klebsiella. Clostridium difficile immunogens may comprise Toxin A and Toxin B (also known as TcdA and TcdB respectively), fragments thereof, detoxifying mutations thereof, and combinations thereof. The detoxifying mutations of TcdA, TcdB, and fragments thereof may comprise insertions, deletions, and point-mutations. The detoxifying mutations and fragments of TcdA and TcdB can be those in WO2014 / 197651, WO2015 / 123767, and WO2019 / 64115.
[0201] The immunogen may elicit an immune response against at least one of the following viruses, be an immunogen from at least one of the following viruses, be an immunogen derived from at70395W001 least one of the following viruses (i.e. by being derived, it may not be the exact immunogen polypeptide, but may have modifications which may stabilize the polypeptide for, for example, expression in a cell or eliciting an immune response), or be an immunogen mimotope of a polypeptide from at least one of the following viruses: Orthomyxovirus including influenza A, B, or C virus, including from influenza A virus subtypes H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, and H16 and including the immunogens of neuraminidase matrix M2 proteins, and hemagglutinin; Paramyxoviridae viruses including, but are not limited to, those derived from Pneumoviruses including respiratory syncytial virus (RSV), Rubulaviruses including mumps virus, Paramyxoviruses including parainfluenza virus, Metapneumoviruses, Morbilliviruses including measles, including the spike-like proteins immunogens thereof, membrane fusion proteins, (i.e. encoded as proteins by the RNA but becoming glycoproteins once translated by the mammalian cell expressing said protein; e.g. RSV F and RSV pre-F) and attachment proteins (i.e. encoded as proteins by the RNA but becoming glycoproteins once translated by the mammalian cell expressing said protein; e.g. RSV G); Poxviridae: Viral immunogens include, but are not limited to, those derived from Orthopoxvirus such as Variola vera, including but not limited to, Variola major and Variola minor; Picornavirus including Rhinoviruses, Heparnavirus, Cardioviruses, Aphthoviruses, and Enteroviruses including EV71 enterovirus, coxsackie A virus, coxsackie B virus, type 1 poliovirus, type 2 poliovirusand type 3 poliovirus; Bunyavirus including Orthobunyavirus such as California encephalitis virus, a Phlebovirus such as Rift Valley Fever virus, and a Nairovirus such as Crimean-Congo hemorrhagic fever virus; Heparnavirus including hepatitis A virus (HAV); Filovirus including Marburg virus and Ebolavirus including Zaire ebolavirus, Tai Forest ebolavirus (nee Ivory Coast ebolavirus), Sudan ebolavirus, Reston ebolavirus, Bundibugyo ebolavirus, and Bombali ebolavirus; Togavirus including, Alphavirus, Arterivirus, and Rubivirus including Rubivirus rubella, Rubivirus ruteetense, and Rubivirus strelense; Flavivirus including Tick-borne encephalitis (TBE) virus, Dengue virus (e.g. types 1, 2, 3 or 4), Yellow Fever virus, Japanese encephalitis virus, Kyasanur Forest Virus, West Nile encephalitis virus, St. Louis encephalitis virus, Russian spring-summer encephalitis virus, Powassan encephalitis virus, and Zikavirus; Pestivirus including Bovine viral diarrhea (BVDV), Classical swine fever (CSFV), and Border disease (BDV); Hepadnavirus including Hepatitis B virus, such as hepatitis B virus surface antigen (HBsAg); other hepatitis viruses, including hepatitis C virus, delta hepatitis virus, hepatitis E virus, and hepatitis G virus; Rhabdovirus including alpharahabdovirinae, Almendravirus, Alphanemrhavirus, Alphapaprhavirus, Alpharicinrhavirus, Arurhavirus, Barhavirus, Caligrhavirus, Curiovirus, Ephemerovirus, Hapavirus, Ledantevirus, Lostrhavirus,70395W001 Lyssavirus such as rabies virus, Merhavirus, Mousrhavirus, Ohlsrhavirus, Perhabdovirus, Sawgrhavirus, Sigmavirus, Sprivivirus, Sripuvirus, Sunrhavirus, Tibrovirus, Tupavirus, Vesiculovirus, Zarhavirus, Betarhabdovirinae, Alphanucleorhabdovirus, Betanucleorhabdovirus, Cytorhabdovirus, Dichorhavirus, Gammanucleorhabdovirus, Varicosavirus, Gammarhabdovirinae, Novirhabdovirus, Alphacrustrhavirus, Alphadrosrhavirus, Alphahymrhavirus, Betahymrhavirus, Betanemrhavirus, Betapaprhavirus, Betaricinrhavirus; Caliciviridae including Norwalk virus (Norovirus) and Norwalk-like Viruses, such as Hawaii Virus and Snow Mountain Virus; Coronavirus including alpha-, beta-, gamma-, and deltacoronaviruses, including severe acute respiratory syndrome (SARS) coronavirus, SARS-CoV-2, Middle East respiratory syndrome coronavirus, human coronavirus HKU1, coronavirus avian infectious bronchitis (IBV), Mouse hepatitis virus (MHV), and Porcine transmissible gastroenteritis virus (TGEV), including a spike polypeptide immunogen, nucleoprotein immunogen, membrane protein immunogen, and ORF3a protein immunogen; Retrovirus including Oncovirus, Lentivirus, such as human immunodeficiency virus 1 and 2, and Spumavirus; Reovirus including Orthoreovirus, Rotavirus, Orbivirus, and Coltivirus; Parvovirus including Parvovirus B19; Herpesvirus including a human herpesvirus including Herpes Simplex Viruses (HSV), such as HSV types 1 and 2, Varicella-zoster virus (VZV), Epstein-Barr virus (EBV), Cytomegalovirus (CMV), Human Herpesvirus 6 (HHV6), Human Herpesvirus 7 (HHV7), and Human Herpesvirus 8 (HHV8), including such immunogens as gB, gEv(e.g. VZV gE), gH (e.g. CMV gH), gl, gL (e.g. CMV gL), gO; gM, gN; UL128, UL130, and UL131A (e.g. CMV UL128, UL130, and UL131A); Papovaviruses including Polyomaviruses and Papillomaviruses, including 1, 2, 4, 5, 6, 8, 11, 13, 16, 18, 31, 33, 35, 39, 41, 42, 47, 51, 57, 58, 63, and 65 thereof; and Adenovirus including Adenovirus A such as adenoviruses 12, 18, 31, Adenovirus B such as adenoviruses 3, 7, 11, 14, 16, 21, 34, 35, 50, and 55, Adenovirus C such as adenoviruses 1, 2, 5, 6, and 57, Adenovirus D such as adenoviruses 8, 9, 10, 13, 15, 17, 19, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 33, 36, 37, 38, 39, 42, 43, 44, 45, 46, 47, 48, 49, 51, 53, 54, 56, 58, 59, 60, 62, 63, 64, 65, 67, 69, 70, 71, 72, 73, 74, and 75, Adenovirus E such as adenovirus 4, Adenovirus F such as adenoviruses 40 and 41, and Adenovirus G such as adenovirus 52.
[0202] The immunogen may elicit an immune response against at least one of the following fungi, be an immunogen from at least one of the following fungi, be an immunogen derived from at least one of the following fungi (i.e. by being derived, it may not be the exact immunogen polypeptide, but may have modifications which may stabilize the polypeptide for, for example, expression in a cell or eliciting an immune response), or be an immunogen mimotope of a70395W001 polypeptide from at least one of the following fungi: Dermatophytres, Epidermophyton floccusum, Microsporum audouini, Microsporum canis, Microsporum distortum, Microsporum equinum, Microsporum gypsum, Microsporum nanum, Trichophyton concentricum, Trichophyton equinum, Trichophyton gallinae, Trichophyton gypseum, Trichophyton megnini, Trichophyton mentagrophytes, Trichophyton quinckeanum, Trichophyton rubrum, Trichophyton schoenleini, Trichophyton tonsurans, Trichophyton verrucosum, T. verrucosum var. album, var. discoides, var. ochraceum, Trichophyton violaceum, and / or Trichophyton faviforme-, Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus nidulans, Aspergillus terreus, Aspergillus sydowi, Aspergillus flavatus, Aspergillus glaucus, Blastoschizomyces capitatus, Candida albicans, Candida enolase, Candida tropicalis, Candida glabrata, Candida krusei, Candida parapsilosis, Candida stellatoidea, Candida kusei, Candida parakwsei, Candida lusitaniae, Candida pseudotropicalis, Candida guilliermondi, Cladosporium carrionii, Coccidioides immitis, Blastomyces dermatidis, Cryptococcus neoformans, Geotrichum clavatum, Histoplasma capsulatum, Klebsiella pneumoniae, Microsporidia, Encephalitozoon spp., Septata intestinalis; Enterocytozoon bieneusi; Brachiola spp, Microsporidium spp., Nosema spp., Pleistophora spp., Trachipleistophora spp., Vittaforma spp Paracoccidioides brasiliensis, Pneumocystis carinii, Pythiumn insidiosum, Pityrosporum ovale, Sacharomyces cerevisae, Saccharomyces boulardii, Saccharomyces pombe, Scedosporium apiosperum, Sporothrix schenckii, Trichosporon beigelii, Toxoplasma gondii, Penicillium marneffei, Malassezia spp., Fonsecaea spp., Wangiella spp., Sporothrix spp., Basidiobolus spp., Conidiobolus spp., Rhizopus spp, Mucorspp, Absidia spp, Mortierella spp, Cunninghamella spp, Saksenaea spp., Alternaria spp, Curvularia spp, Helminthosporium spp, Fusarium spp, Aspergillus spp, Penicillium spp, Monolinia spp, Rhizoctonia spp, Paecilomyces spp, Pithomyces spp, and Cladosporium spp.
[0203] The immunogen may elicit an immune response against at least one of the following parasites, be an immunogen from at least one of the following parasites, be an immunogen derived from at least one of the following parasites (i.e. by being derived, it may not be the exact immunogen polypeptide, but may have modifications which may stabilize the polypeptide for, for example, expression in a cell or eliciting an immune response), or be an immunogen mimotope of a polypeptide from at least one of the following parasites: Plasmodium, such as P.falciparum, P.vivax, P.malariae, and P.ovale and Caligidae family, particularly those from the Lepeophtheirus and Caligus genera, such as sea lice such as Lepeophtheirus salmonis or Caligus rogercresseyi.
[0204] The immunogen may elicit an immune response against: pollen allergens (tree, herb, weed, and grass pollen allergens); insect or arachnid allergens (inhalant, saliva and venom allergens,70395W001 e.g. mite allergens, cockroach and midges allergens, hymenopthera venom allergens); animal hair and dandruff allergens (from e.g. dog, cat, horse, rat, mouse, etc.); and food allergens (e.g. a gliadin). Important pollen allergens from trees, grasses and herbs are such originating from the taxonomic orders of Fagales, Oleales, Pinales and platanaceae including, but not limited to, birch (Betula), alder (Alnus), hazel (Corylus), hornbeam (Carpinus) and olive (Olea), cedar (Cryptomeria and Juniperus), plane tree (Platanus), the order of Poales including grasses of the genera Lolium, Phleum, Poa, Cynodon, Dactylis, Holcus, Phalaris, Secale, and Sorghum, the orders of Asterales and Urticales including herbs of the genera Ambrosia, Artemisia, and Parietaria. Other important inhalation allergens are those from house dust mites of the genus Dermatophagoides and Euroglyphus, storage mite e.g. Lepidoglyphys, Glycyphagus and Tyrophagus, those from cockroaches, midges and fleas e.g. Blatella, Periplaneta, Chironomus and Ctenocepphalides, and those from mammals such as cat, dog and horse, venom allergens including such originating from stinging or biting insects such as those from the taxonomic order of Hymenoptera including bees (Apidae), wasps (Vespidea), and ants (Formicoidae).
[0205] The immunogen may be a tumor antigen selected from: p53, ART-4, BAGE,
[0206] beta-catenin, Bcr-abL, CAMEL, CAP-1, CASP-8, CDC27, CDK4, CEA, CLAUDIN-6 (CLDN6), CLAUDIN-18.2 (CLDN18.2) and CLAUDIN-12, c-MYC, CT, Cyp-B, DAM, ELF2M, ETV6-AMLI, G250, GAGE, GnT-V, ClaplOO, HAGE, HER-2 / neu, HPV-E7, HPV-E6, HAST-2, hTERT (or hTRT), LAGE, LDLR / FUT, MAGE-A, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGEA8, MAGE-A9, MAGE-A10, MAGE-A11, or MAGE-A12, MAGE-B, MAGE-C, MART-1 / Melan-A, MCIR, Myosin / m, MUCI, MUM1, -2, -3, NA88-A, NFI, NY-ESO-1, NY-BR-I, p190 minor, Pml / RARa, PRAME, proteinase 3, PSA, PSM, RAGE, RU1 or RU2, SAGE, SART-1 orSART-3, SCGB3A2, SCP1, SCP2, SCP3, SSX, SURVIVIN, TEL / AMLI, TPVm, TRP-I, TRP-2, TRP-2 / INT2, TPTE and WT, SSX2, GAGE-1, GAGE-2, p21 / Ras, caspase-8, CIA 0205, HLA-A2-R1701, TCR, triosephosphate isomerase, KIA 0205, CDC-27, Galectin 4, Galectin 9, WT 1, carbonic anhydrase, aldolase A, mammaglobin, alphafetoprotein, KSA, gastrin, telomerase catalytic protein, MUC-1, G-250, carcinoembryonic antigen, gp100, MC1R, melanocyte-stimulating hormone receptor, tyrosinase, PAP, PSMA, PSH-P1, PSM-P1, PSM-P2, p15, Hom / Mel-40, H-Ras, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein Barr virus antigens, EBNA, human papillomavirus (HPV) antigens, including E6 and E7, hepatitis B and C virus antigens, human T-cell lymphotropic virus antigens, TSP-180, p185erbB2, p180erbB-3, c-met, mn-23H1, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, p16, TAGE, PSCA, CT7, 43-9F, 5T4, 791 Tgp72, beta-HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29\BCAA), CA 195, CA 242, CA-50, CAM43, CD68\KP1, CO-029, FGF-5, Ga73370395W001 (EpCAM), HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 (Mac-2 binding protein / cyclophilin C-associated protein), TAAL6, TAG72, TLP, TPS, and the like.
[0207] Compositions
[0208] Provided herein is a composition, the composition comprising any of the above-noted first and / or second RNA molecules (samRNAs or trans-amplifying mRNAs) and a pharmaceutically acceptable delivery vehicle. The pharmaceutically acceptable delivery vehicle can be selected for the route of administration, and would include those formulations for oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, buccal, sublingual, or suppository administration. The cell populations may be administered parenterally. The term "parenteral" includes intravenous, intramuscular, subcutaneous, rectal, vaginal, and intraperitoneal administration. The cells may be administered to the subject using peripheral systemic delivery by intravenous, intraperitoneal, or subcutaneous injection.
[0209] Compositions may be provided as sterile liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may be buffered to a selected pH ( / .e., acidic). The pharmaceutically acceptable delivery vehicles can be selected based on the rule of five for non-oral routes ( / .e., ophthalmic, inhalation, or transdermal administration).
[0210] A composition may be provided, the composition comprising any of the above-noted the samRNAs and a polyalkyleneimine. The molar ratio of the number of nitrogen atoms (N) in the polyalkyleneimine to the number of phosphor atoms (P) in the single stranded RNA (N: P ratio) may be 2.0 to 15.0. The composition may have an ionic strength of 50 mM or less.
[0211] Compositions described herein may include the first and / or second RNA molecules, constructs, nucleic acid sequences, and / or polypeptide sequences described elsewhere herein in plain water (e.g., "w.f.i." or “water for injection”) or in a buffer e.g., a phosphate buffer, a Tris buffer, a borate buffer, a succinate buffer, a histidine buffer, or a citrate buffer. Buffer salts will typically be included in the 5-20 mM range. Compositions may have a pH between 5.0 and 9.5 e.g., between 6.0 and 8.0. Compositions may include sodium salts (e.g., sodium chloride) to give tonicity. A concentration of 10 mg / mL + / -.2 mg / mL NaCI is typical, e.g., about 9 mg / mL. Compositions may include metal ion chelators. These can prolong RNA stability by removing ions which can accelerate phosphodiester hydrolysis. Thus, a composition may comprises EDTA, EGTA, BAPTA, or pentetic acid. Such chelators are typically present at between 10-500 pM, e.g., 0.1 mM. A citrate salt, such as sodium citrate, can also act as a chelator, while70395W001 advantageously also providing buffering activity. Compositions may have an osmolality of between 200 mOsm / kg and 400 mOsm / kg, e.g., between 240-360 mOsm / kg, or between 290-310 mOsm / kg. Compositions may comprise a preservative, such as thiomersal or 2-phenoxyethanol. The preservative may be mercury-free. The composition may be preservative-free. The composition may be aseptic or sterile. The composition may be non-pyrogenic, e.g., containing <1 EU (endotoxin unit, a standard measure) per dose, and preferably <0.1 EU per dose. The composition may be gluten-free. The composition may be in unit dose form. A unit dose may be formulated to provide an effective amount in a volume from 0.1 mL to 1.0 mL, e.g., about 0.5 mL. The compositions disclosed herein may be an immunogenic composition that, when administered to a subject, induces a humoral and / or cellular antigen-specific immune response ( / .e., an immune response which specifically recognizes a naturally occurring antigen from a pathogen). For example, an immunogenic composition may induce a memory T and / or B cell population that responds to the antigen or immunogen and thereby the pathogen to neutralize the antigen, immunogen, or pathogen, orcause a THI or TH2 response. The composition may be formulated as a vaccine ( / .e., to elicit an immune response wherein the immune response is a protective immune response). Alternatively, the composition may be formulated as a therapeutic ( / .e., to elicit an immune response wherein the immune response is a therapeutic immune response, i.e., to prevent re-emergence of a latent virus).
[0212] The composition can be formulated as vaccine composition. The vaccine will comprise an immunologically effective amount of the first nucleic acid which encodes an antigen or an antibody against the antigen. By "an immunologically effective amount" is intended that the administration of that amount to a subject, either in a single dose or as part of a series, is effective for inducing a measurable immune response against the antigen and thereby the pathogen that produces said antigen. This amount varies depending upon the health and physical condition of the individual to be treated, age, the taxonomic group of individual to be treated (e.g., human, non-human primate, etc.), the capacity of the individual's immune system to synthesize antibodies, the degree of protection desired, the formulation of the composition or vaccine, the treating doctor's assessment of the medical situation, the severity of the disease, the potency of the compound administered, the mode of administration, and other relevant factors. The amount will fall in a relatively broad range that can be determined through trials. An immunologically effective amount of a first RNA that encodes an immunogen or antigen is an amount sufficient to prevent or treat infection by the pathogen that produces the antigen or immunogen. Vaccines as disclosed herein may either be prophylactic (i.e., to induce a protective immune response to the pathogen) or therapeutic (i.e., to treat infection). The vaccine70395W001 compositions disclosed herein may induce an effective immune response against the pathogen, i.e., a response sufficient for treatment or sufficient for eliciting a protective immune response to infection by the pathogen.
[0213] The composition may further comprise an additional antigen, a nucleic acid encoding the antigen, or a nucleic acid encoding an antibody against the antigen. The composition may be administered to a subject in combination with a further composition which comprises an additional antigen, a nucleic acid encoding the antigen, or a nucleic acid encoding an antibody against the antigen.
[0214] The composition may comprise, or be administered in conjunction with, one or more adjuvants (e.g., vaccine adjuvants). By "adjuvant" is intended that is capable of increasing an immune response against an antigen compared to administration of said antigen alone or nucleic acid encoding said antigen alone. Compositions may further comprise one or more immunostimulants, for example, a saponin such as QS21. The addition of cholesterol to the composition (i.e., to the LNP) can be used to reduce any hemolytic activity, or toxicity, from the saponin.
[0215] Adjuvants include, but are not limited to: (A) mineral-containing compositions, for example aluminum and calcium salts, such as aluminum phosphates; (B) oil emulsions, for example squalene-in-water emulsions, such as MF59, AS03, complete Freund's adjuvant (CFA), and incomplete Freund's adjuvant (IF A); (C) saponin formulations; (D) virosomes and virus-like particles (VLPs); (E) bacterial or microbial derivatives such as non-toxic derivatives of enterobacterial lipopolysaccharide (LPS), Lipid A derivatives, immunostimulatory oligonucleotides and ADP-ribosylating toxins and detoxified derivatives thereof; (F) human immunomodulators, for example cytokines, such as interleukins, interferons, macrophage colony stimulating factor, and tumor necrosis factor; (G) bioadhesives and mucoadhesives, such as esterified hyaluronic acid microspheres, cross-linked derivatives of poly(acrylic acid), polyvinyl alcohol, polyvinyl pyrollidone, polysaccharides and carboxymethylcellulose; (H) microparticles, for example particles of about 100 nm to about 150 pm in diameter, more preferably about 200 nm to about 30 pm in diameter, and most preferably about 500 nm to about 10 pm in diameter) formed from materials that are biodegradable and non-toxic (e.g., a poly(a-hydroxy acid), a polyhydroxybutyric acid, a polyorthoester, a polyanhydride, a polycaprolactone, etc.), with poly(lactide-co-glycolide) are preferred, optionally treated to have a negatively-charged surface (e.g., with SDS) or a positively-charged surface (e.g., with a cationic detergent, such as CTAB); (I) liposomes and / or lipid nanoparticles (LNP); (J) polyoxyethylene ether and polyoxyethylene ester formulations; (K) polyphosphazene (POPP); (L) muramyl70395W001 peptides; or (M) imidazoquinolone compounds, for example imiquimod and its homologues. In this regard, the adjuvant may have additional qualities such as acting as a pharmaceutically acceptable delivery vehicle and for allowing entry of an RNA into a cell.
[0216] The pharmaceutically acceptable delivery vehicle may comprise a liposome or lipid nanoparticle (LNP). The liposome or LNP may encapsulate the RNA molecule. The liposome or LNP may encapsulate the samRNA. The liposome or LNP may encapsulate the at least two RNA molecules. The LNP can comprise multilamellar vesicles (MLV); small uniflagellar vesicles (SUV); or large unilamellar vesicles (LUV). MLVs have multiple bilayers in each vesicle, forming several separate aqueous compartments. SUVs and LUVs have a single bilayer encapsulating an aqueous core. SUVs typically have a diameter less than or equal to 50 nm, and LUVs have a diameter greater than 50 nm. LUVs may have a diameter in the range of 50-220 nm. For a composition comprising a population of LUVs with different diameters: (i) at least 80% by number should have diameters in the range of 20-220 nm, (ii) the average diameter (Zav, by intensity) of the population is ideally in the range of 40-200 nm, and / or (iii) the diameters should have a polydispersity index <0.2. The LNP may comprise cholesterol. The LNPs may have a solid core (i.e., lack an aqueous core). The LNPs may comprise an aqueous core.
[0217] Various amphiphilic lipids can form bilayers in an aqueous environment to encapsulate a RNA-containing aqueous core as a LNP. These lipids can be anionic, cationic, or zwitterionic. These lipids can have an anionic, cationic, or zwitterionic hydrophilic head group. Some lipids are anionic whereas other are zwitterionic and others are cationic. Suitable classes of phospholipid include, but are not limited to, phosphatidylethanolamines, phosphatidylcholines, phosphatidylserines, and phosphatidyl-glycerols. Useful cationic lipids include, but are not limited to, dioleoyl trimethylammonium propane (DOTAP), 1,2-distearyloxy-N, N-dimethyl-3-aminopropane (DSDMA), 1,2-dioleyloxy-N, Ndimethyl-3-aminopropane (DODMA), 1,2-dilinoleyloxy-N, N-dimethyl-3-aminopropane (DLinDMA), and 1,2-dilinolenyloxy-N, N-dimethyl-3-aminopropane (DLenDMA). Zwitterionic lipids include, but are not limited to, acyl zwitterionic lipids and ether zwitterionic lipids. Examples of useful zwitterionic lipids are 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), and dodecylphosphocholine. The lipids can be saturated or unsaturated. The use of at least one unsaturated lipid for preparing liposomes is preferred. If an unsaturated lipid has two tails, both tails can be unsaturated, or it can have one saturated tail and one unsaturated tail.
[0218] Liposomal nanoparticles can be formed from a single lipid or from a mixture of lipids. A mixture may comprise (i) a mixture of anionic lipids (ii) a mixture of cationic lipids (iii) a mixture of zwitterionic lipids (iv) a mixture of anionic lipids and cationic lipids (v) a mixture of anionic70395W001 lipids and zwitterionic lipids (vi) a mixture of zwitterionic lipids and cationic lipids or (vii) a mixture of anionic lipids, cationic lipids and zwitterionic lipids. Similarly, a mixture may comprise both saturated and unsaturated lipids. For example, a mixture may comprise 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) (zwitterionic, saturated), DlinDMA (cationic, unsaturated), and / or 1,2-dimyristoyl-rac-glycerol (DMG) (anionic, saturated). Where a mixture of lipids is used, not all of the component lipids in the mixture need to be amphiphilic e.g., one or more amphiphilic lipids can be mixed with cholesterol.
[0219] The hydrophilic portion of a lipid can be PEGylated ( / .e., modified by covalent attachment of a polyethylene glycol). This modification can increase stability and prevent nonspecific adsorption of the liposomes. Various lengths of PEG can be used e.g., between 0.5-8 kDa. One example of the combination of a PEG and the above-noted lipids is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG 2000). Others include 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt) and distearoyl-rac-glycerol-PEG2K. The LNP may comprise DSPC, DlinDMA, PEG-DMG, and cholesterol. The LNP may comprise 10% DSPC (zwitterionic), 40% DlinDMA (cationic), 48% cholesterol and 2% PEG-conjugated DMG (2 kDa PEG) by mole.
[0220] Other useful LNPs are described in the following references: W02012 / 006376;
[0221] WO2012 / 030901; WO2012 / 031046; WO2012 / 031043; WO2012 / 006378; WO2011 / 076807; WO2013 / 033563; WO2013 / 006825; WO2014 / 136086; WO2015 / 095340; WO2015 / 095346; W02016 / 037053. The LNPs may be RV01 liposomes, see the following references:
[0222] W02012 / 006376 and Geall et al. (2012) PNAS USA. September 4; 109(36): 14604-9.
[0223] As noted above, liposomes and LNPs are listed as adjuvants, but in this regard, they also provide another function that is, in some embodiments, co-extensive with, and in some embodiments, independent of adjuvanticity. That is, RNA, by itself and unprotected, may be degraded by the subject’s RNAses. LNPs provide a means to protect the RNA by encapsulating or comprising within them an amount of the RNA of the overall composition or formulation. The LNP’s effects as being in some cases an adjuvant, in other cases a delivery vehicle, and in other cases both, can be cell-dependent. To illustrate but without being bound by a particular theory, the LNP may provide adjuvanticity to peripheral blood mononuclear cells in that the RNA activates the cells but may not be expressed therein, but the LNP may provide a delivery vehicle, but not adjuvanticity, to other somatic cell types, for arguendo example, skeletal muscle cells.
[0224] The pharmaceutically acceptable delivery vehicle may comprise a lipid nanoparticle (LNP). The LNPs may encapsulate, comprise within them, consist essentially within them, or70395W001 have within them at least 85%, at least 90%, at least 95%, at least 99% or 100% of the RNA molecules. The LNPs may encapsulate, comprise within them, consist essentially within them, or have within them at least 85%, at least 90%, at least 95%, at least 99% or 100% of the samRNA ortrans-amplifying mRNAs. In this regard, the foregoing percentages reference the number of RNA molecules encapsulated or comprised within the LNPs compared to the total number of RNA molecules in the composition and not the percentage of the length of any one RNA molecule being within and outside of the LNP.
[0225] The LNP may comprise lipids comprising: a cationic lipid (i.e., a cation-ionizable lipid), an optional sterol (e.g., cholesterol), an optional polymer-conjugated lipid, and an optional noncationic lipid (“non-cationic lipid” being discrete from the cationic lipid, the optional sterol (e.g., cholesterol), and the optional polymer-conjugated lipid, the “non-cationic lipid” being i.e., an optional anionic lipid or an optional neutral lipid, including zwitterionic lipids). The optional neutral lipid may comprise a neutral lipid zwitterionic lipid. The polymer-conjugated lipid may comprise a polyethylene glycol-conjugated lipid.
[0226] Various amphiphilic lipids can form bilayers in an aqueous environment to encapsulate a RNA-containing aqueous core as a LNP. These lipids can have an anionic, cationic, or zwitterionic hydrophilic head group. Some phospholipids are anionic whereas other are zwitterionic and others are cationic. Suitable classes of phospholipid include, but are not limited to, phosphatidylethanolamines, phosphatidylcholines, phosphatidylserines, and phosphatidylglycerols. Useful cationic lipids include, but are not limited to, dioleoyl trimethylammonium propane (DOTAP), 1,2-distearyloxy-N, N-dimethyl-3-aminopropane (DSDMA), 1,2-dioleyloxy-N, Ndimethyl-3-aminopropane (DODMA), 1,2-dilinoleyloxy-N, N-dimethyl-3-aminopropane (DLinDMA), and 1,2-dilinolenyloxy-N, N-dimethyl-3-aminopropane (DLenDMA). Zwitterionic lipids include, but are not limited to, acyl zwitterionic lipids and ether zwitterionic lipids.
[0227] Examples of useful zwitterionic lipids are 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), and dodecylphosphocholine. The lipids can be saturated or unsaturated. The use of at least one unsaturated lipid for preparing liposomes is preferred. If an unsaturated lipid has two tails, both tails can be unsaturated, or it can have one saturated tail and one unsaturated tail.
[0228] The LNP may comprise a polyethylene glycol-conjugated (PEG-conjugated) lipid. The PEG-conjugated lipid may comprise a polyethylene glycol (PEG) having various lengths and molecular weights.
[0229] The PEG-conjugated lipid may comprise 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000. In 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-70395W001 2000, the “2000” represents the median molecular weight in Daltons of the PEG. The PEG-conjugated lipid may comprise 1,2-dimyristoyl-sn-glycero-2-phosphoethanolamine-N-[methoxy(polyethylene glycol)]. The PEG-conjugated lipid may comprise 1,2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol.
[0230] The LNP may further comprise a non-cationic lipid, which may comprise an anionic lipid, a neutral lipid, or a zwitterionic lipid. The neutral lipid may comprise a neutral zwitterionic lipid. The anionic lipid, the neutral lipid, or the zwitterionic lipid may comprise a phospho-group (i.e., is a phospholipid), a choline, ora sphingolipid.
[0231] The LNP may further comprise a sterol.
[0232] Methods of administering the RNA molecules
[0233] Provided herein is a method of eliciting an immune response in a subject to an immunogen, wherein the method comprises administering to the subject an effective amount of the first and / or second RNA molecule or the composition, wherein the heterologous nucleic acid encodes a heterologous protein, wherein the heterologous protein comprises the immunogen or an antibody against the immunogen. The immune response may be a protective immune response. The immune response may be a therapeutic immune response. The immunogen may comprise a venom, a poison, an allergen, a cancer antigen, a bacterial antigen, a viral antigen, a fungal antigen, a parasite antigen, or a fragment thereof. The heterologous protein may comprise the antibody against the immunogen. The heterologous protein may comprise the immunogen.
[0234] Also provided herein is a method of delivering an inhibitory RNA in the first and / or second RNA molecule to a subject, wherein the method comprises administering to the subject an effective amount of the first and / or second RNA molecule or a composition comprising the first and / or second RNA molecule, and wherein the second RNA sequence comprises the inhibitory RNA. The inhibitory RNA may be against a native messenger RNA encoding a native protein, and the administering may decrease the expression of the native protein in the subject when compared to the expression of the native protein in the subject without the administering. Also provided is a method of delivering to a subject a heterologous nucleic acid in the first and / or second RNA molecule or the composition comprising the first and / or second RNA molecule, wherein the method comprises administering an effective amount of the first and / or second RNA molecule. The subject may be human. The subject may be a mammal, such as a human ora large veterinary mammal (e.g., horses, cattle, deer, goats, pigs). Where the composition or first and / or second RNA molecule is for eliciting a protective immune response,70395W001 the subject is preferably a human, such as a child (e.g., a toddler or infant), a teenager, and the first and / or second RNA molecule or the compositions comprising the first and / or second RNA molecule may be formulated as a vaccine. Where the composition or first and / or second RNA molecule is used as a treatment or for therapeutic use, the human is preferably a teenager or an adult. A vaccine intended for children may also be administered to adults.
[0235] The first and / or second RNA molecule or composition comprising the first and / or second RNA molecule may be administered to the subject intramuscularly, intradermally, subcutaneously, transcutaneously, topically, intraperitoneally, intrathecally, pulmonarily ( / .e., inhaled), intracerebroventricularly, intravenously, intra-arterially, onto a mucosa ( / .e., vaginally), buccally, sublingually, intranasally, optically, to the cornea, or into the eyeball.
[0236] The above-noted methods may comprise, be, or consist of more than one administration (i.e., two, three, four, five, six, or seven administrations). The above-noted methods may comprise, be, or consist of at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 administrations (i.e., two, three, four, five, six, or seven administrations). The above-noted methods may comprise, be, or consist of no more than 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 administrations (i.e., two, three, four, five, six, or seven administrations). The above-noted methods may comprise, be, or consist of more than one administration of an effective amount (i.e., two, three, four, five, six, or seven administrations). The above-noted methods may comprise, be, or consist of at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 administrations of an effective amount (i.e., two, three, four, five, six, or seven administrations of an effective amount). The above-noted methods may comprise, be, or consist of no more than 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 administrations of an effective amount (i.e., two, three, four, five, six, or seven administrations of an effective amount).
[0237] The administration may comprise a primary administration and a booster administration. The effective amount may differ between the primary administration and the booster administration. An effective amount of the first and / or second RNA molecule may be less than 10 pg, less than 5 pg, less than 4 pg, less than 3 pg, less than 2 pg, or less than 1 pg. An effective amount of the first and / or second RNA molecule may be less than 0.5 pg, less than 0.4 pg, less than 0.3 pg, less than 0.2 pg, or less than 0.1 pg.
[0238] The first and / or second RNA molecule may be provided in a unit dose form containing less than 10 pg, less than 5 pg, less than 4 pg, less than 3 pg, less than 2 pg, or less than 1 pg RNA. The first and / or second RNA molecule may be provided in a unit dose form containing less than 0.5 pg, less than 0.4 pg, less than 0.3 pg, less than 0.2 pg, or less than 0.1 pg.
[0239] The above-noted methods may comprise, be, or consist of more than one primary administration (i.e., two, three, four, five, six, or seven administrations). The above-noted70395W001 methods may comprise, be, or consist of at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 primary administrations (i.e., two, three, four, five, six, or seven administrations of an effective amount). The above-noted methods may comprise, be, or consist of no more than 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 primary administrations (i.e., two, three, four, five, six, or seven administrations of an effective amount).
[0240] The immune response that the primary administration elicits may comprise a cell-mediated immune response, an antibody-response (e.g., humoral immune response), a THI immune response, or a TH2 immune response. The eliciting of the immune response by the primary administration may be from a naive immune response where the immune system has no detectable antibody response that is against the immunogen, cell-mediated immune response that is against the immunogen, THI immune response that is against the immunogen, or a TH2 immune response that is against the immunogen to a cell-mediated immune response that is against the immunogen, an antibody-response (e.g., humoral immune response) that is against the immunogen, a THI immune response that is against the immunogen, or a TH2 immune response that is against the immunogen. The eliciting of the immune response by the primary administration may be from an experienced immune response where the antibody response that is against the immunogen, the cell-mediated immune response that is against the immunogen, the THI immune response that is against the immunogen, or the TH2 immune response that is against the immunogen is unable to reduce the likelihood of at least one symptom of the disease or from being infectious to others by the disease to a cell-mediated immune response that is against the immunogen, an antibody-response (e.g., humoral immune response) that is against the immunogen, a THI immune response that is against the immunogen, or a TH2 immune response that is against the immunogen that reduces the likelihood of at least one symptom of the disease or the likelihood of being infectious to others by the disease. The at least one symptom of the disease may comprise death, respiratory distress, reduced blood oxygen, fever, chills, a febrile response, shortness of breath, difficulty breathing, fatigue, muscle aches, body aches, headaches, new or loss of smell, mucus production, sore throat, congestion, runny nose, nausea, vomiting, diarrhea, confusion, pressure in the chest, persistent pain, inability to wake, inability to stay awake, pale skin, gray skin, bluecolored skin, pale lips, gray lips, blue-colored lips, pale nail-beds, gray nail-beds, blue-colored nail-beds, low reperfusion of extremities, low reperfusion of the body, encephalitis, stroke, ischemia, fibromyalgia, or myocarditis.
[0241] The above-noted methods may comprise, be, or consist of more than one booster administration (i.e., two, three, four, five, six, or seven administrations). The above-noted70395W001 methods may comprise, be, or consist of at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 booster administrations (i.e., two, three, four, five, six, or seven administrations of an effective amount). The above-noted methods may comprise, be, or consist of no more than 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 booster administrations (i.e., two, three, four, five, six, or seven administrations of an effective amount).
[0242] The immune response that the booster administration elicits may comprise a cell-mediated immune response, an antibody-response (e.g., humoral immune response), a THI immune response, or a TH2 immune response. The eliciting of the immune response by the booster administration may be from an experienced immune response where the antibody response that is against the immunogen, the cell-mediated immune response that is against the immunogen, the THI immune response that is against the immunogen, or the TH2 immune response that is against the immunogen is unable to reduce the likelihood of at least one symptom of the disease or from being infectious to others by the disease to a cell-mediated immune response that is against the immunogen, an antibody-response (e.g., humoral immune response) that is against the immunogen, a THI immune response that is against the immunogen, or a TH2 immune response that is against the immunogen that reduces the likelihood of at least one symptom of the disease or the likelihood of being infectious to others by the disease. The eliciting of the immune response by the booster administration may be from an experienced immune response where the antibody response that is against the immunogen, the cell-mediated immune response that is against the immunogen, the THI immune response that is against the immunogen, or the TH2 immune response that is against the immunogen is, at the time of booster administration, able to reduce the likelihood of at least one symptom of the disease or from being infectious to others by the disease, but some time thereafter and without the booster administration, would not be able to reduce the likelihood of at least one symptom of the disease or from being infectious to others by the disease (i.e., a boosting of the duration of the immune response). In such cases, the booster administration elicits an immune response when compared to the same individual who would not have received the booster administration and who would have otherwise not been able to reduce the likelihood of at least one symptom of the disease or from being infectious to others by the disease (i.e., boosted duration). In such cases, the eliciting of the immune response by the booster administration may comprise a renewed cell-mediated immune response that is against the immunogen, a renewed antibody-response (e.g., humoral immune response) that is against the immunogen, a renewed THI immune response that is against the immunogen, or a renewed TH2 immune response that is against the immunogen that reduces the likelihood of at least one70395W001 symptom of the disease or the likelihood of being infectious to others by the disease during the period in which, without the booster administration, the subject would have otherwise had an increased likelihood of at least one symptom of the disease or an increased likelihood of being infectious to the disease (i.e., boosted duration). The booster administration may elicit an immune response that is above the immune response elicited by the primary administration. The immune response that is elicited by the booster administration may be an antibody response that is above that elicited by the primary administration, a cell-mediated immune response that is above that elicited by the primary administration, a THI immune response that is above that elicited by the primary administration, or a TH2 immune response that is above that elicited by the primary administration. At least one symptom of the disease may comprise death, respiratory distress, reduced blood oxygen, fever, chills, a febrile response, shortness of breath, difficulty breathing, fatigue, muscle aches, body aches, headaches, new or loss of smell, mucus production, sore throat, congestion, runny nose, nausea, vomiting, diarrhea, confusion, pressure in the chest, persistent pain, inability to wake, inability to stay awake, pale skin, gray skin, blue-colored skin, pale lips, gray lips, blue-colored lips, pale nail-beds, gray nail-beds, blue-colored nail-beds, low reperfusion of extremities, low reperfusion of the body, encephalitis, stroke, ischemia, fibromyalgia, or myocarditis.
[0243] Processes of manufacture of RNA molecules
[0244] Provided herein is a method of manufacturing the first and / or second RNA molecule according to the invention. The method may comprise admixing an RNA polymerase, triphosphate nucleotides, and a template nucleic acid comprising a sequence of the first and / or second RNA molecule, thereby obtaining an admixture; the admixing being under conditions wherein the RNA polymerase produces the first and / or second RNA molecule from the template nucleic acid. The admixture may comprise a genus of nucleotide triphosphates of which at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% is a subgenus thereof consisting of modified nucleotide triphosphates. Thus, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% of the triphosphate nucleotides of the method may be modified nucleotides. The admixture may comprise a genus of uridine triphosphates and uridine-substitutable modified triphosphates of which at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% is a subgenus thereof consisting of uridine-substitutable modified triphosphates. The admixture may70395W001 comprise a genus of uridine triphosphates and uridine-substitutable modified triphosphates of which at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% are uridine-substitutable modified triphosphates. At least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% of the triphosphate nucleotides may be uridine-substitutable modified triphosphates. At least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% of the triphosphate nucleotides may be N1-methylpseudouridine triphosphates. The admixing may be under conditions wherein the RNA polymerase produces the RNA molecule from the template nucleic acid. The N1-methylpseudouridine triphosphates and / or the uridine triphosphates may be converted to N1-methylpseudouridines and / or uridines respectively by the RNA polymerase ( / .e., DNA-dependent RNA polymerase or RNA-dependent RNA polymerase) as they are incorporated into the newly synthesized strand of RNA.
[0245] As noted above, the first and / or second RNA molecule may comprise a 5’ cap, which may be a cap-0, cap-1, or cap-2. The 5’ cap may be attached to the RNA post-transcriptionally. Accordingly, provided herein is a method of producing an RNA molecule comprising a 5’ cap, which may be a cap-0, cap-1, or cap-2. The method may comprise:
[0246] a first admixing of an RNA polymerase, the triphosphate nucleotides, and a template nucleic acid comprising a sequence of the first and / or second RNA molecule, thereby obtaining an admixture; the admixture having a genus of nucleotide triphosphates of which at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% is a subgenus thereof consisting of modified nucleotide triphosphates; the first admixing being under conditions wherein the RNA polymerase produces the first and / or second RNA molecule from the template nucleic acid, thereby obtaining an uncapped first and / or second RNA molecule; and
[0247] a second admixing of the uncapped first and / or second RNA molecule, a messenger RNA guanylyltransferase, guanosine triphosphate, a (guaninine-N7-)-methyltransferase, and S-adenosyl-L-methionine, the second admixing being under conditions that cause a 5’ to 5’ triphosphate cap linkage, the second admixing optionally further comprising a 2’-O-methyltransferase, and optionally the second admixing being under conditions that form cap-1 or cap-2.
[0248] Alternatively, the 5’ cap may alternatively be added co-transcriptionally to an RNA molecule. Accordingly, provided herein is a method of producing an RNA molecule comprising a 5’ cap,70395W001 the method comprising admixing an RNA polymerase, triphosphate nucleotides, a cap analog, and a template nucleic acid comprising a sequence of the first and / or second RNA molecule, thereby obtaining an admixture; the admixing being under conditions wherein the RNA polymerase produces the first and / or second RNA molecule from the template nucleic acid. The term “cap analog” refers to a structural derivative of a 5’ cap which may be used for in vitro synthesis of 5’ capped mRNA molecules.
[0249] The RNA polymerase may be a T7 RNA polymerase. As noted above, a composition comprising the RNA molecule and a pharmaceutically acceptable vehicle is provided. The method may comprise encapsulating the RNA molecule in the pharmaceutically acceptable delivery vehicle or adsorbing the RNA molecule to the pharmaceutically acceptable delivery vehicle. The encapsulation may occur by spray-jet of two or more solutions, such as a first solution and a second solution. The first solution may comprise the RNA molecule, and the second solution may comprise the lipids and other lipophilic components of the lipid nanoparticles suspended in water, at a pH of about 5.5. The two solutions may be spray jet sprayed at one another to form nanoparticles. The pH may then be adjusted to around 6.5. The pH may be further adjusted to around 7.4 to form compositions of nanoparticles having a narrower range of diameters.
[0250] Uses of RNA molecules to form medicaments and RNA molecules for use in, for example, eliciting an immune response, preventing infection or treating infection
[0251] Provided herein is a use of the first and / or second RNA molecule for the manufacture of a medicament. Also provided herein is a use of the first and / or second RNA molecule for the manufacture of a medicament for delivering the heterologous nucleic acid to a subject in need thereof; the use comprising admixing the first and / or second RNA molecule with a pharmaceutically acceptable delivery vehicle. The pharmaceutically acceptable delivery vehicle may comprise a lipid nanoparticle (LNP). The LNP may encapsulate the first and / or second RNA molecule.
[0252] Provided herein is a use of the first and / or second RNA molecule for the manufacture of a medicament for eliciting an immune response to the immunogen in a subject. The immune response may be a protective immune response. The immune response may be a therapeutic immune response. The immune response may be an antibody immune response. The immune response may be a cellular immune response.70395W001 Provided herein is a use of the first and / or second RNA molecule for the manufacture of a medicament for prophylaxis or treatment of an infection by a pathogen in a subject. Also provided herein is a use of the first and / or second RNA molecule for the manufacture of a medicament for the in vivo expression of a heterologous protein in a subject.
[0253] Provided herein is a use of the first and / or second RNA molecule for the manufacture of a medicament for preventing a disease caused by a pathogen; the pathogen comprising an immunogen; the use comprising admixing the first and / or second RNA molecule with a pharmaceutically acceptable delivery vehicle. The pharmaceutically acceptable delivery vehicle may comprise a lipid nanoparticle (LNP). The LNP may encapsulate the first and / or second RNA molecule. The immunogen may comprise a venom, a poison, an allergen, a cancer antigen, a bacterial antigen, a viral antigen, a fungal antigen, a parasite antigen, or a fragment thereof. The heterologous protein may comprise the antibody against the immunogen. The heterologous protein may comprise the immunogen.
[0254] Provided herein is a use of the first and / or second RNA molecule for the manufacture of a medicament for treating a disease caused by a pathogen; the pathogen comprising an immunogen; the use comprising admixing the first and / or second RNA molecule with a pharmaceutically acceptable delivery vehicle. The pharmaceutically acceptable delivery vehicle may comprise a LNP. The LNP may encapsulate the first and / or second RNA molecule. The immunogen may comprise a venom, a poison, an allergen, a cancer antigen, a bacterial antigen, a viral antigen, a fungal antigen, a parasite antigen, or a fragment thereof. The heterologous protein may comprise the antibody against the immunogen. The heterologous protein may comprise the immunogen.
[0255] The subject may be a human.
[0256] The composition or first and / or second RNA molecule provided herein may be for use as a medicament. The composition or first and / or second RNA molecule provided herein may be for use in preventing infection by a pathogen in a subject. The first and / or second RNA molecule provided herein may be for use in treating infection by a pathogen in a subject. The subject may be a human.
[0257] The invention is further illustrated by reference to the following clauses.
[0258] Clauses:
[0259] 1. A composition comprising either (i) a first RNA molecule comprising a first RNA sequence and a second RNA molecule comprising a second RNA sequence or (ii) a first70395W001 RNA molecule comprising a first RNA sequence and a second RNA sequence; the first RNA sequence encoding one or more proteins capable of replicating a self-amplifying messenger RNA (samRNA) in an intracellular environment; the second RNA sequence comprising a heterologous nucleic acid; the first and / or the second RNA molecules comprising a genus of nucleotide of which at least 10% is a subgenus thereof consisting of modified nucleotides; the first and / or second RNA sequence further comprising one or more of the modifications selected from (a)-(d):
[0260] a) a 3’ poly-adenosine monophosphate (poly(A)) tail of at least 25, at least 30 or at least 40 nucleotides in length;
[0261] b) one or more regions of the first and / or second RNA sequence, that have a lower percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides, compared to the percentage of nucleotides that are uridine in the corresponding one or more regions of a corresponding wild type reference sequence;
[0262] c) a 3’ untranslated region (UTR) comprising a polynucleotide sequence of m(Txm)y, where x is 4 or 5, y is 6 or more, and m is independently selected from A or C; or d) a construct encoding a heterologous polypeptide interferon effector that suppresses an interferon response.
[0263] The composition according to clause 1 comprising a first RNA molecule comprising a first RNA sequence and a second RNA sequence.
[0264] The composition according to clause 1 comprising a first RNA molecule comprising a first RNA sequence and a second RNA molecule comprising a second RNA sequence. The first and / or second RNA molecule according to any preceding clause comprising 2, 3 or 4 of the modifications selected from (a)-(d).
[0265] The first and / or second RNA molecule according to any preceding clause, wherein at least 25% of the genus of nucleotide is a subgenus thereof consisting of modified nucleotides.
[0266] The first and / or second RNA molecule according to any preceding clause, wherein at least 50% of the genus of nucleotide is a subgenus thereof consisting of modified nucleotides.
[0267] The first and / or second RNA molecule according to any preceding clause, wherein at least 75% of the genus of nucleotide is a subgenus thereof consisting of modified nucleotides.70395W001 8. The first and / or second RNA molecule according to any preceding clause, wherein at least 95% of the genus of nucleotide is a subgenus thereof consisting of modified nucleotides.
[0268] 9. The first and / or second RNA molecule according to any preceding clause, wherein 100% of the genus of nucleotide is a subgenus thereof consisting of modified nucleotides. 10. The first and / or second RNA molecule according to any preceding clause, wherein the genus of nucleotide is uridine and uridine-substitutable modified nucleotides.
[0269] 11. The first and / or second RNA molecule according to clause 10, wherein the subgenus thereof consists of uridine-substitutable modified nucleotides.
[0270] 12. The first and / or second RNA molecule according to clause 11, wherein 100% of the genus are uridine-substitutable modified nucleotides, except for the first 5’ uridine.
[0271] 13. The first and / or second RNA molecule according to clause 11 or 12, wherein the uridine- substitutable modified nucleotides are selected from pseudouridine, N1- methylpseudouridine, 5-methyluridine or N1-ethylpseudouridine.
[0272] 14. The first and / or second RNA molecule according to clause 13, wherein the uridine- substitutable modified nucleotides are N1 -methylpseudouridine.
[0273] 15. The first RNA molecule according to any preceding clause, wherein the one or more proteins capable of replicating a samRNA in an intracellular environment comprise an alphavirus nsP1, an alphavirus nsP2, an alphavirus nsP3, and an alphavirus nsP4. 16. The first RNA molecule according to clause 15 comprising a sequence encoding the one or more proteins that has at least 80% sequence identity to SEQ ID NO: 48 or SEQ ID NO: 49.
[0274] 17. The first RNA molecule according to clause 16, wherein the sequence comprises SEQ ID NO: 48 or SEQ ID NO: 49.
[0275] 18. The first and / or second RNA molecule according to any preceding clause comprising or consisting essentially of a VEE-derived samRNA comprising one or more of the modifications selected from (a)-(d).
[0276] 19. The first or second RNA molecule according to any preceding clause, comprising a subgenomic promoter.
[0277] 20. The first or second RNA molecule according to clause 19, wherein the subgenomic promoter comprises or consists of SEQ ID NO: 50.
[0278] 21. The first and / or second RNA molecule according to any preceding clause, wherein the 3’ poly(A) tail consists of adenosine monophosphate residues.70395W001 The first and / or second RNA molecule according to any one of clauses 1 to 19, wherein the 3’ poly(A) tail is split.
[0279] The first and / or second RNA molecule according to clause 22, wherein the 3’ split poly(A) tail comprises, in 5’ to 3’ order, a sequence of consecutive adenosine monophosphate residues, a spacer, and a sequence of consecutive adenosine monophosphate residues.
[0280] The first and / or second RNA molecule according to clause 23, wherein the 3’ split poly(A) tail comprises or consists of SEQ ID NO: 83.
[0281] The first and / or second RNA molecule according to any preceding clause, wherein the 3’ poly(A) tail is at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 nucleotides in length.
[0282] The first and / or second RNA molecule according to any preceding clause, wherein the 3’ poly(A) tail is 50 to 250, 50 to 200, 50 to 150 or 50 to 100 nucleotides in length.
[0283] The first and / or second RNA molecule according to any preceding clause, wherein the 3’ poly(A) tail is 60 to 90 nucleotides in length.
[0284] The first and / or second RNA molecule according to any preceding clause, wherein the 3’ poly(A) tail is about 80 nucleotides in length.
[0285] The first and / or second RNA molecule according to any preceding clause, wherein the one or more regions of (b) comprises (i) at least a portion of a nucleic acid encoding an alphavirus nsP1, an alphavirus nsP2, an alphavirus nsP3, and an alphavirus nsP4 and / or (ii) a nucleic acid encoding the heterologous polypeptide interferon effector that suppresses an interferon response.
[0286] The first RNA molecule according to any one of clauses 15 to 29, comprising an opal stop codon between the nsP3 coding region and the nsP4 coding region.
[0287] The first and / or second RNA molecule according to any one of clauses 15 to 30 comprising a conserved sequence element represented by SEQ ID NO: 51.
[0288] The first and / or second RNA molecule according to any one of clauses 15 to 31 comprising a stem-loop region represented by SEQ ID NO: 52.
[0289] The first RNA molecule according to any preceding clause, wherein the first RNA sequence has a lower percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides compared to the percentage of nucleotides that are uridine in the corresponding region of a corresponding wild type reference sequence. The first RNA molecule according to clause 33, wherein no more than the first 5’ 90, such as no more than the first 5’ 100, no more than the first 5’ 110, no more than the first70395W001 5’ 120, no more than the first 5’ 130, no more than the first 5’ 140, no more than the first 5’ 150, no more than the first 5’ 160, no more than the first 5’ 170, no more than the first 5’ 180, no more than the first 5’ 190, no more than the first 5’ 200, no more than the first 5’ 210, no more than the first 5’ 220, no more than the first 5’ 230, no more than the first 5’ 240, no more than the first 5’ 250, no more than the first 5’ 260, no more than the first 5’ 270, no more than the first 5’ 280, no more than the first 5’ 290, no more than the first 5’ 300, no more than the first 5’ 310, no more than the first 5’ 320, no more than the first 5’ 330, no more than the first 5’ 340, no more than the first 5’ 350, no more than the first 5’ 360, no more than the first 5’ 370, no more than the first 5’ 380, no more than the first 5’ 390, no more than the first 5’ 400, no more than the first 5’ 410, no more than the first 5’ 420, no more than the first 5’ 430, no more than the first 5’ 440, no more than the first 5’ 450, no more than the first 5’ 460, no more than the first 5’ 470, no more than the first 5’ 480, no more than the first 5’ 490, or no more than the first 5’ 500 nucleotides of the first RNA sequence has a percentage of nucleotides that are uridine and uridine- substitutable modified nucleotides that is substantially the same compared to the percentage of nucleotides that are uridine in the corresponding region of a corresponding wild type reference sequence.
[0290] 35. The first RNA molecule according to clause 34, wherein no more than the first 5’ 200 nucleotides of the first RNA sequence has a percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides that is substantially the same compared to the percentage of nucleotides that are uridine in the corresponding region of a corresponding wild type reference sequence.
[0291] 36. The first RNA molecule according to clause 34, wherein no more than the first 5’ 270 nucleotides of the first RNA sequence has a percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides that is substantially the same compared to the percentage of nucleotides that are uridine in the corresponding region of a corresponding wild type reference sequence
[0292] 37. The first and / or second RNA molecule according to any preceding clause, comprising a 5’UTR comprising any one of SEQ ID NOs: 100-103.
[0293] 38. The first and / or second RNA molecule according to clause 37, comprising a 5’ UTR comprising SEQ ID NO: 102.
[0294] 39. The first RNA molecule according to any preceding clause, comprising SEQ ID NO: 68.
[0295] 40. The first RNA molecule according to any preceding clause, comprising SEQ ID NO: 69.70395W001 41. The first and / or second RNA molecule according to any preceding clause, wherein the one or more regions of (b) has a percentage of nucleotides that are uridine and uridine- substitutable modified nucleotides of 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, or 12% or less.
[0296] 42. The first and / or second RNA molecule according to clause 41, wherein the one or more regions of (b) has a percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides of 13% or less.
[0297] 43. The first and / or second RNA molecule according to any preceding clause, wherein the one or more regions of (b) has a percentage of nucleotides that are uridine and uridine- substitutable modified nucleotides of between 10 to 20%, 10 to 15% or 10 to 13%.
[0298] 44. The first and / or second RNA molecule according to clause 43, wherein the one or more regions of (b) has a percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides of between 11 to 13%.
[0299] 45. A composition comprising either (i) a first RNA molecule comprising a first RNA sequence and a second RNA molecule comprising a second RNA sequence or (ii) a first RNA molecule comprising a first RNA sequence and a second RNA sequence; the first RNA sequence encoding one or more proteins capable of replicating a samRNA in an intracellular environment; the second RNA sequence comprising a heterologous nucleic acid; wherein no natural uridine nucleotides are present in the first and / or the second RNA molecules; the first and / or second RNA sequence further comprising one or more of the modifications selected from (a)-(d):
[0300] a) a 3’ poly-adenosine monophosphate (poly(A)) tail of at least 25, at least 30 or at least 40 nucleotides in length;
[0301] b) one or more regions of the first and / or second RNA sequence, that have a lower percentage of nucleotides that are uridine-substitutable modified nucleotides, compared to the percentage of nucleotides that are uridine in the corresponding one or more regions of a corresponding wild type reference sequence; c) a 3’ untranslated region (UTR) comprising a polynucleotide sequence of m(Txm)y, where x is 4 or 5, y is 6 or more, and m is independently selected from A or C; or d) a construct encoding a heterologous polypeptide interferon effector that suppresses an interferon response.
[0302] 46. The first RNA molecule according to any preceding clause, wherein the one or more regions of b) comprises a sequence that has at least 80% sequence identity to SEQ ID NO: 73 or SEQ ID NO: 74.70395W001 47. The first RNA molecule according to clause 46, wherein the one or more regions of b) comprises SEQ ID NO: 73 or SEQ ID NO: 74.
[0303] 48. The first and / or second RNA molecule according to any preceding clause, wherein the one or more regions of b) comprises a sequence that has at least 80% sequence identity to SEQ ID NO: 77.
[0304] 49. The first and / or second RNA molecule according to clause 48, wherein the one or more regions of b) comprises SEQ ID NO: 77.
[0305] 50. The first RNA molecule according to any preceding clause, wherein the one or more regions of b) comprises SEQ ID NO: 71 or SEQ ID NO: 72.
[0306] 51. The first and / or second RNA molecule according to any preceding clause, wherein the one or more regions of b) comprises SEQ ID NO: 96 or SEQ ID NO: 97.
[0307] 52. The first and / or second RNA molecule according to any preceding clause, wherein the wild type reference sequence of b) comprises SEQ ID NO: 1.
[0308] 53. The first and / or second RNA molecule according to any preceding clause, wherein the wild type reference sequence of b) comprises SEQ ID NO: 76.
[0309] 54. The first and / or second RNA molecule according to any preceding clause, wherein the 3’UTR of c) comprises a polynucleotide sequence of mm(Txm)ym, where x is 4 or 5, y is 6 or more, and m is independently selected from A or C.
[0310] 55. The first and / or second RNA molecule according to any preceding clause, wherein the 3’UTR of c) comprises a polynucleotide sequence of mm(Txm)6m, where x is 4 or 5, and m is independently selected from A or C.
[0311] 56. The first and / or second RNA molecule according to any preceding clause, wherein the 3’UTR of c) comprises a polynucleotide sequence of SEQ ID NO: 60 or SEQ ID NO: 61.
[0312] 57. The first and / or second RNA molecule according to any preceding clause, wherein the 3’UTR of c) comprises a polynucleotide sequence of SEQ ID NO: 62 or SEQ ID NO: 65.
[0313] 58. The first and / or second RNA molecule according to any preceding clause, wherein the 3’UTR of c) comprises a polynucleotide sequence of SEQ ID NO: 53 or SEQ ID NO: 56.
[0314] 59. The first and / or second RNA molecule according to any preceding clause, comprising the sequence AUA or AUG at positions 1 to 3 of the first and / or second RNA molecule.
[0315] 60. The first and / or second RNA molecule according to clause 59, comprising the sequence AUG at positions 1 to 3 of the first and / or second RNA molecule.
[0316] 61. The first and / or second RNA molecule according to any preceding clause, wherein the heterologous polypeptide interferon effector is NS1, or a variant or fragment thereof.70395W001 62. The first and / or second RNA molecule according to any preceding clause, wherein the heterologous polypeptide interferon effector is the RNA-binding domain of NS1.
[0317] 63. The first and / or second RNA molecule according to any preceding clause, wherein the construct encoding the heterologous polypeptide interferon effector comprises a sequence that has at least 80% sequence identity to SEQ ID NO: 76 or SEQ ID NO: 77.
[0318] 64. The first and / or second RNA molecule according to any preceding clause, wherein the construct encoding the heterologous polypeptide interferon effector comprises SEQ ID NO: 76 or SEQ ID NO: 77.
[0319] 65. The first and / or second RNA molecule according to any preceding clause, wherein translation of the heterologous polypeptide interferon effector is cap-independent.
[0320] 66. The first and / or second RNA molecule according to clause 65, wherein the construct comprises an internal ribosome entry site (IRES).
[0321] 67. The first and / or second RNA molecule according to any preceding clause, wherein the construct encodes ubiquitin or a fragment thereof.
[0322] 68. The first and / or second RNA molecule according to any preceding clause, wherein the construct encodes one or more self-cleaving peptides.
[0323] 69. The first and / or second RNA molecule according to clause 68, wherein the one or more self-cleaving peptides comprise T2A and / or P2A.
[0324] 70. The first and / or second RNA molecule according to clause 69, wherein the construct comprises, in 5’ to 3’ order, sequence encoding: the T2A self-cleaving peptide, the heterologous polypeptide interferon effector, and the P2A self-cleaving peptide.
[0325] 71. The first and / or second RNA molecule according to clause 70, wherein the construct further comprises sequence encoding one or more linker peptides.
[0326] 72. The first and / or second RNA molecule according to clause 71, wherein the linker peptide is located 5’ relative to the T2A self-cleaving peptide and / or between the heterologous polypeptide interferon effector and the P2A self-cleaving peptide.
[0327] 73. The first and / or second RNA molecule according to clause 72, wherein the construct comprises a sequence that has at least 80% sequence identity to SEQ ID NO: 90 or SEQ ID NO: 94.
[0328] 74. The first and / or second RNA molecule according to clause 73, wherein the construct comprises SEQ ID NO: 90 or SEQ ID NO: 94.
[0329] 75. The first and / or second RNA molecule according to clause 69, wherein the construct comprises, in 5’ to 3’ order, sequence encoding: the T2A self-cleaving peptide, the heterologous polypeptide interferon effector, and the ubiquitin or a fragment thereof.70395W001 76. The first and / or second RNA molecule according to clause 75, wherein the construct comprises a sequence that has at least 80% sequence identity to SEQ ID NO: 81.
[0330] 77. The first and / or second RNA molecule according to clause 76, wherein the construct comprises SEQ ID NO: 81.
[0331] 78. The first and / or second RNA molecule according to any preceding clause, wherein the construct comprises in 5’ to 3’ order: an internal ribosome entry site (IRES) and a nucleic acid encoding the heterologous polypeptide interferon effector.
[0332] 79. The first and / or second RNA molecule according to clause 78, wherein the construct comprises a sequence that has at least 80% sequence identity to SEQ ID NO: 99.
[0333] 80. The first and / or second RNA molecule according to clause 79, wherein the construct comprises SEQ ID NO: 99.
[0334] 81. The first and / or second RNA molecule according to any preceding clause, wherein the construct is 3’ relative to a subgenomic promoter.
[0335] 82. The first RNA molecule according to any one of clauses 1 to 80, wherein the construct is 5’ relative to a nucleic acid encoding the one or more proteins capable of replicating the samRNA in an intracellular environment.
[0336] 83. The first RNA molecule according to clause 82, wherein the construct is 3’ relative to a 5’ terminal region comprising a 5’UTR and the first 5’ 140 nucleotides of a nucleic acid encoding an alphavirus nsP1 protein.
[0337] 84. The first RNA molecule according to clause 83, wherein the 5’ terminal region comprises the first 5’ 218 nucleotides of a nucleic acid encoding an alphavirus nsP1 protein.
[0338] 85. The first and / or second RNA molecule according to any preceding clause, further comprising a 5’ cap.
[0339] 86. The first and / or second RNA molecule according to clause 85, wherein the 5’ cap is a cap-0, cap-1 or a cap-2.
[0340] 87. The first and / or second RNA molecule according to clause 86, wherein the 5’ cap is a cap-1.
[0341] 88. The first and / or second RNA molecule according to any preceding clause comprising a 5’UTR.
[0342] 89. The first and / or second RNA molecule according to clause 88, wherein the 5’UTR comprises a sequence that has at least 90% sequence identity to SEQ ID NO: 101 or SEQ ID NO: 102.
[0343] 90. The first and / or second RNA molecule according to clause 89, wherein the 5’UTR comprises SEQ ID NO: 101 or SEQ ID NO: 102.70395W001 91. The first RNA molecule according to any one of clauses 88 to 90, wherein the 5’UTR is 5’ of the first RNA sequence.
[0344] 92. The first and / or second RNA molecule according to any preceding clause comprising a 3’UTR.
[0345] 93. The first and / or second RNA molecule according to clause 92, wherein the 3’UTR comprises a sequence that has at least 80% sequence identity to SEQ ID NO: 53 or SEQ ID NO: 56.
[0346] 94. The first and / or second RNA molecule according to clause 93, wherein the 3’UTR comprises SEQ ID NO: 53 or SEQ ID NO: 56.
[0347] 95. The first RNA molecule according to any one of clauses 92 to 94, wherein the 3’UTR is 3’ of the first RNA sequence and, if present, the second RNA sequence.
[0348] 96. The first and / or second RNA molecule according to any preceding clause comprising a 3’ poly(A) tail.
[0349] 97. The first and / or second RNA molecule according to clause 96, wherein the 3’ poly(A) tail is 3’ of a 3’UTR.
[0350] 98. The first and / or second RNA molecule according to clause 96 or 97, wherein the 3’ poly(A) tail is at the 3’ end of the first and / or second RNA molecule.
[0351] 99. The first and / or second RNA molecule according to any preceding clause, wherein the heterologous nucleic acid comprises an inhibitory RNA.
[0352] 100. The first and / or second RNA molecule according to clause 99, wherein the inhibitory RNA comprises an antisense RNA, a small interfering RNA, or a microRNA.
[0353] 101. The first and / or second RNA molecule according to any preceding clause, wherein the heterologous nucleic acid encodes a heterologous protein.
[0354] 102. The first and / or second RNA molecule according to clause 101, wherein the heterologous protein comprises an immunogen, an antibody, or a therapeutic protein. 103. The first and / or second RNA molecule according to clause 101, wherein the heterologous protein comprises an immunogen.
[0355] 104. The first and / or second RNA molecule according to clause 103, wherein the heterologous protein consists of an immunogen.
[0356] 105. The first and / or second RNA molecule according to clause 101, wherein the heterologous protein comprises an antibody.
[0357] 106. The first and / or second RNA molecule according to clause 105, wherein the heterologous protein consists of an antibody.70395W001 107. The first and / or second RNA molecule according to clause 105 or 106, wherein the antibody is an antibody against an immunogen.
[0358] 108. The first and / or second RNA molecule according to any one of clauses 102 to 107, wherein the immunogen elicits an immune response against a bacterium.
[0359] 109. The first and / or second RNA molecule according to any one of clauses 102 to 108, wherein the immunogen is derived from a bacterium.
[0360] 110. The first and / or second RNA molecule according to clause 108 or 109, wherein the bacterium is selected from: Neisseria meningitidis including, but are not limited to, membrane proteins such as adhesins, autotransporters, toxins, iron acquisition proteins, and factor H binding protein; Streptococcus pneumoniae including, but are not limited to, the RrgB pilus subunit, the beta-N-acetyl-hexosaminidase precursor (spr0057), spr0096, general stress protein GSP-781 (spr2021, SP2216), serine / threonine kinase StkP (SP1732), and pneumococcal surface adhesin PsaA; Streptococcus pyogenes;
[0361] Moraxella catarrhalis; Bordetella pertussis including but are not limited to, pertussis toxin or toxoid (PT), filamentous haemagglutinin (FHA), pertactin, and agglutinogens 2 and 3; Staphylococcus aureus including a hemolysin, esxA, esxB, ferrichrome-binding protein (sta006), and the sta011 lipoprotein; Clostridium tetani including tetanus toxoid immunogen; Cornynebacterium diphtheriae including diphtheria toxoid immunogen; Haemophilus influenzae; Pseudomonas aeruginosa’, Streptococcus agalactiae;
[0362] Chlamydia trachomatis including, but are not limited to, PepA, LcrE, ArtJ, DnaK, CT398, OmpH-like, L7 / L12, OmcA, AtoS, CT547, Eno, HtrA,and MurG; Chlamydia pneumoniae; Helicobacter pylori; Escherichia coli, including the following pathological subforms enterotoxigenic E. coli (ETEC), enteroaggregative E. coli (EAggEC), diffusely adhering E. coli (DAEC), enteropathogenic E. coli (EPEC), enterohemorrhagic E. coli (EHEC), and extraintestinal pathogenic E. coli (ExPEC), including therein uropathogenic E.coli (UPEC) and meningitis / sepsis-associated E.coli (MNEC); Bacillus anthracis; Yersinia pestis; Staphylococcus epidermis’, Clostridium difficile; Clostridium perfringens’, Clostridium botulinums; Legionella pneumophila; Coxiella burnetiid; Brucella, including B.abortus, B.canis, B.melitensis, B.neotomae, B.ovis, B.suis, B.pinnipediae; Francisella, including F. novicida, F. philomiragia, F. tularensis. Neisseria gonorrhoeae, including polypeptides of the outer membrane vesicles; Treponema pallidum; Haemophilus ducreyi; Enterococcus faecalis; Enterococcus faecium; Staphylococcus saprophyticus; Yersinia enterocolitica; Mycobacterium tuberculosis; Rickettsia; Listeria monocytogenes;70395W001 Vibrio cholerae; Salmonella including Salmonella typhii; Borrelia burgdorferi;
[0363] Porphyromonas gingivalis; and Klebsiella.
[0364] 111. The first and / or second RNA molecule according to any one of clauses 102 to 107, wherein the immunogen elicits an immune response against a virus.
[0365] 112. The first and / or second RNA molecule according to any one of clauses 102 to 107 or 111, wherein the immunogen is derived from a virus.
[0366] 113. The first and / or second RNA molecule according to clause 111 or 112, wherein the virus is selected from Orthomyxovirus including influenza A, B, or C virus, including from influenza A virus subtypes H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, and H16 and including the immunogens of neuraminidase matrix M2 proteins, and hemagglutinin; Paramyxoviridae viruses including, but are not limited to, those derived from Pneumoviruses including respiratory syncytial virus (RSV), Rubulaviruses including mumps virus, Paramyxoviruses including parainfluenza virus, Metapneumoviruses, Morbilliviruses including measles, including the spike-like proteins immunogens thereof, membrane fusion proteins, (i.e. encoded as proteins by the RNA but becoming glycoproteins once translated by the mammalian cell expressing said protein; e.g. RSV F and RSV pre-F) and attachment proteins (i.e. encoded as proteins by the RNA but becoming glycoproteins once translated by the mammalian cell expressing said protein; e.g. RSV G); Poxviridae: Viral immunogens include, but are not limited to, those derived from Orthopoxvirus such as Variola vera, including but not limited to, Variola major and Variola minor; Picornavirus including Rhinoviruses, Heparnavirus, Cardioviruses, Aphthoviruses, and Enteroviruses including EV71 enterovirus, coxsackie A virus, coxsackie B virus, type 1 poliovirus, type 2 poliovirusand type 3 poliovirus; Bunyavirus including Orthobunyavirus such as California encephalitis virus, a Phlebovirus such as Rift Valley Fever virus, and a Nairovirus such as Crimean- Congo hemorrhagic fever virus; Heparnavirus including hepatitis A virus (HAV); Filovirus including Marburg virus and Ebolavirus including Zaire ebolavirus, Tai Forest ebolavirus (nee Ivory Coast ebolavirus), Sudan ebolavirus, Reston ebolavirus, Bundibugyo ebolavirus, and Bombali ebolavirus; Togavirus including, Alphavirus, Arterivirus, and Rubivirus including Rubivirus rubella, Rubivirus ruteetense, and Rubivirus strelense; Flavivirus including Tick-borne encephalitis (TBE) virus, Dengue virus (e.g. types 1, 2, 3 or 4), Yellow Fever virus, Japanese encephalitis virus, Kyasanur Forest Virus, West Nile encephalitis virus, St. Louis encephalitis virus, Russian spring-summer encephalitis virus, Powassan encephalitis virus, and Zikavirus; Pestivirus including Bovine viral70395W001 diarrhea (BVDV), Classical swine fever (CSFV), and Border disease (BDV);
[0367] Hepadnavirus including Hepatitis B virus, such as hepatitis B virus surface antigen (HBsAg); other hepatitis viruses, including hepatitis C virus, delta hepatitis virus, hepatitis E virus, and hepatitis G virus; Rhabdovirus including alpharahabdovirinae, Almendravirus, Alphanemrhavirus, Alphapaprhavirus, Alpharicinrhavirus, Arurhavirus, Barhavirus, Caligrhavirus, Curiovirus, Ephemerovirus, Hapavirus, Ledantevirus, Lostrhavirus, Lyssavirus such as rabies virus, Merhavirus, Mousrhavirus, Ohlsrhavirus, Perhabdovirus, Sawgrhavirus, Sigmavirus, Sprivivirus, Sripuvirus, Sunrhavirus, Tibrovirus, Tupavirus, Vesiculovirus, Zarhavirus, Betarhabdovirinae, Alphanucleorhabdovirus, Betanucleorhabdovirus, Cytorhabdovirus, Dichorhavirus, Gammanucleorhabdovirus, Varicosavirus, Gammarhabdovirinae, Novirhabdovirus, Alphacrustrhavirus, Alphadrosrhavirus, Alphahymrhavirus, Betahymrhavirus, Betanemrhavirus, Betapaprhavirus, Betaricinrhavirus; Caliciviridae including Norwalk virus (Norovirus) and Norwalk-like Viruses, such as Hawaii Virus and Snow Mountain Virus; Coronavirus including alpha-, beta-, gamma-, and delta-coronaviruses, including severe acute respiratory syndrome (SARS) coronavirus, SARS-CoV-2, Middle East respiratory syndrome coronavirus, human coronavirus HKU1, coronavirus avian infectious bronchitis (IBV), Mouse hepatitis virus (MHV), and Porcine transmissible gastroenteritis virus (TGEV), including a spike polypeptide immunogen, nucleoprotein immunogen, membrane protein immunogen, and ORF3a protein immunogen; Retrovirus including Oncovirus, Lentivirus, such as human immunodeficiency virus 1 and 2, and Spumavirus; Reovirus including Orthoreovirus, Rotavirus, Orbivirus, and Coltivirus; Parvovirus including Parvovirus B19; Herpesvirus including a human herpesvirus including Herpes Simplex Viruses (HSV), such as HSV types 1 and 2, Varicella-zoster virus (VZV), Epstein-Barr virus (EBV), Cytomegalovirus (CMV), Human Herpesvirus 6 (HHV6), Human Herpesvirus 7 (HHV7), and Human Herpesvirus 8 (HHV8), including such immunogens as gB, gEv(e.g. VZV gE), gH (e.g. CMV gH), gl, gL (e.g. CMV gL), gO; gM, gN; UL128, UL130, and UL131A (e.g. CMV UL128, UL130, and UL131A); Papovaviruses including Polyomaviruses and Papillomaviruses, including 1, 2, 4, 5, 6, 8, 11, 13, 16, 18, 31, 33, 35, 39, 41, 42, 47, 51, 57, 58, 63, and 65 thereof; and Adenovirus including Adenovirus A such as adenoviruses 12, 18, 31, Adenovirus B such as adenoviruses 3, 7, 11, 14, 16, 21, 34, 35, 50, and 55, Adenovirus C such as adenoviruses 1, 2, 5, 6, and 57, Adenovirus D such as adenoviruses 8, 9, 10, 13, 15, 17, 19, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 33, 36, 37, 38, 39, 42, 43, 44, 45, 46, 47,70395W001 48, 49, 51, 53, 54, 56, 58, 59, 60, 62, 63, 64, 65, 67, 69, 70, 71, 72, 73, 74, and 75, Adenovirus E such as adenovirus 4, Adenovirus F such as adenoviruses 40 and 41, and Adenovirus G such as adenovirus 52.
[0368] . The first and / or second RNA molecule according to any one of clauses 102 to 107, wherein the immunogen elicits an immune response against a fungi.
[0369] . The first and / or second RNA molecule according to any one of clauses 102 to 107 or 114, wherein the immunogen is derived from a fungi.
[0370] . The first and / or second RNA molecule according to clause 114 or 115, wherein the fungi is selected from Dermatophytres, Epidermophyton floccusum, Microsporum audouini, Microsporum canis, Microsporum distortum, Microsporum equinum, Microsporum gypsum, Microsporum nanum, Trichophyton concentricum, Trichophyton equinum, Trichophyton gallinae, Trichophyton gypseum, Trichophyton megnini, Trichophyton mentagrophytes, Trichophyton quinckeanum, Trichophyton rubrum, Trichophyton schoenleini, Trichophyton tonsurans, Trichophyton verrucosum, T. verrucosum var. album, var. discoides, var. ochraceum, Trichophyton violaceum, and / or Trichophyton faviforme-, Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus nidulans, Aspergillus terreus, Aspergillus sydowi, Aspergillus flavatus, Aspergillus glaucus, Blastoschizomyces capitatus, Candida albicans, Candida enolase, Candida tropicalis, Candida glabrata, Candida krusei, Candida parapsilosis, Candida stellatoidea, Candida kusei, Candida parakwsei, Candida lusitaniae, Candida pseudotropicalis, Candida guilliermondi, Cladosporium carrionii, Coccidioides immitis, Blastomyces dermatidis, Cryptococcus neof ormans, Geotrichum clavatum, Histoplasma capsulatum, Klebsiella pneumoniae, Microsporidia, Encephalitozoon spp., Septata intestinalis; Enterocytozoon bieneusi; Brachiola spp, Microsporidium spp., Nosema spp., Pleistophora spp., Trachipleistophora spp., Vittaforma spp Paracoccidioides brasiliensis, Pneumocystis carinii, Pythiumn insidiosum, Pityrosporum ovale, Sacharomyces cerevisae, Saccharomyces boulardii, Saccharomyces pombe, Scedosporium apiosperum, Sporothrix schenckii, Trichosporon beigelii, Toxoplasma gondii, Penicillium marneffei, Malassezia spp., Fonsecaea spp., Wangiella spp., Sporothrix spp., Basidiobolus spp., Conidiobolus spp., Rhizopus spp, Mucor spp, Absidia spp, Mo tierella spp, Cunninghamella spp, Saksenaea spp., Alternaria spp, Curvularia spp, Helminthosporium spp, Fusarium spp, Aspergillus spp, Penicillium spp, Monolinia spp, Rhizoctonia spp, Paecilomyces spp, Pithomyces spp, and Cladosporium spp.70395W001 117. The first and / or second RNA molecule according to any one of clauses 102 to 107, wherein the immunogen elicits an immune response against a parasite.
[0371] 118. The first and / or second RNA molecule according to any one of clauses 102 to 107 or 117, wherein the immunogen is derived from a parasite.
[0372] 119. The first and / or second RNA molecule according to clause 117 or 118, wherein the parasite is selected from Plasmodium, such as P.falciparum, P.vivax, P.malariae, and P.ovale and Caligidae family, particularly those from the Lepeophtheirus and Caligus genera, such as sea lice such as Lepeophtheirus salmonis orCaligus rogercresseyi.
[0373] 120. The first and / or second RNA molecule according to any one of clauses 102 to 107, wherein the immunogen elicits an immune response against an allergen.
[0374] 121. The first and / or second RNA molecule according to any one of clauses 102 to 107 or 120, wherein the immunogen is derived from an allergen.
[0375] 122. The first and / or second RNA molecule according to clause 120 or 121, wherein the allergen is selected from pollen allergens (tree, herb, weed, and grass pollen allergens); insect or arachnid allergens (inhalant, saliva and venom allergens, e.g. mite allergens, cockroach and midges allergens, hymenopthera venom allergens); animal hair and dandruff allergens (from e.g. dog, cat, horse, rat, mouse, etc.); and food allergens (e.g. a gliadin). Important pollen allergens from trees, grasses and herbs are such originating from the taxonomic orders of Fagales, Oleales, Pinales and platanaceae including, but not limited to, birch (Betula), alder (Alnus), hazel (Corylus), hornbeam (Carpinus) and olive (Olea), cedar (Cryptomeria and Juniperus), plane tree (Platanus), the order of Poales including grasses of the genera Lolium, Phleum, Poa, Cynodon, Dactylis, Holcus, Phalaris, Secale, and Sorghum, the orders of Asterales and Urticales including herbs of the genera Ambrosia, Artemisia, and Parietaria. Other important inhalation allergens are those from house dust mites of the genus Dermatophagoides and Euroglyphus, storage mite e.g. Lepidoglyphys, Glycyphagus and Tyrophagus, those from cockroaches, midges and fleas e.g. Blatella, Periplaneta, Chironomus and Ctenocepphalides, and those from mammals such as cat, dog and horse, venom allergens including such originating from stinging or biting insects such as those from the taxonomic order of Hymenoptera including bees (Apidae), wasps (Vespidea), and ants (Formicoidae).
[0376] 123. The first and / or second RNA molecule according to any one of clauses 102 to 107, wherein the immunogen elicits an immune response against a cancer.70395W001. The first and / or second RNA molecule according to any one of clauses 102 to 107 or 123, wherein the immunogen is a cancer antigen.
[0377] . The first and / or second RNA molecule according to clause 124, wherein the cancer antigen is selected from (i) cancer-testis antigens such as NY-ESO-1, SSX2, SCP1 as well as RAGE, BAGE, GAGE and MAGE family polypeptides, for example, GAGE-1, GAGE-2, MAGE-1, MAGE-2, MAGE-3, MAGE-4, MAGE-5, MAGE-6, and MAGE-12 (which can be used, for example, to address melanoma, lung, head and neck, NSCLC, breast, gastrointestinal, and bladder tumors; (ii) mutated antigens, for example, p53 (associated with various solid tumors, e.g., colorectal, lung, head and neck cancer), p21 / Ras (associated with, e.g., melanoma, pancreatic cancer and colorectal cancer), CDK4 (associated with, e.g., melanoma), MUM1 (associated with, e.g., melanoma), caspase-8 (associated with, e.g., head and neck cancer), CIA 0205 (associated with, e.g., bladder cancer), HLA-A2-R1701, beta catenin (associated with, e.g., melanoma), TCR (associated with, e.g., T-cell non-Hodgkins lymphoma), BCR-abl (associated with, e.g., chronic myelogenous leukemia), triosephosphate isomerase, KIA 0205, CDC-27, and LDLR-FUT; (iii) over-expressed antigens, for example, Galectin 4 (associated with, e.g., colorectal cancer), Galectin 9 (associated with, e.g., Hodgkin’s disease), proteinase 3 (associated with, e.g., chronic myelogenous leukemia), WT 1 (associated with, e.g., various leukemias), carbonic anhydrase (associated with, e.g., renal cancer), aldolase A (associated with, e.g., lung cancer), PRAME (associated with, e.g., melanoma), HER-2 / neu (associated with, e.g., breast, colon, lung and ovarian cancer), mammaglobin, alpha-fetoprotein (associated with, e.g., hepatoma), KSA (associated with, e.g., colorectal cancer), gastrin (associated with, e.g., pancreatic and gastric cancer), telomerase catalytic protein, MUC-1 (associated with, e.g., breast and ovarian cancer), G-250 (associated with, e.g., renal cell carcinoma), p53 (associated with, e.g., breast, colon cancer), and carcinoembryonic antigen (associated with, e.g., breast cancer, lung cancer, and cancers of the gastrointestinal tract such as colorectal cancer); (iv) shared antigens, for example, melanoma-melanocyte differentiation antigens such as MART-1 / Melan A, gp100, MC1R, melanocyte-stimulating hormone receptor, tyrosinase, tyrosinase related protein-1 / TRP1 and tyrosinase related protein-2 / TRP2 (associated with, e.g., melanoma); (v) prostate associated antigens such as PAP, PSA, PSMA, PSH-P1, PSM-P1, PSM-P2, associated with e.g., prostate cancer; (vi) immunoglobulin idiotypes (associated with myeloma and B cell lymphomas, for example).70395W001 126. The first and / or second RNA molecule according to clause 102, wherein the heterologous protein comprises a therapeutic protein.
[0378] 127. The first and / or second RNA molecule according to clause 126, wherein the heterologous protein consists of a therapeutic protein.
[0379] 128. A DNA molecule encoding the first and / or second RNA molecule according to any preceding clause.
[0380] 129. A composition comprising the first and / or second RNA molecule according to any one of clauses 1 to 127 and a pharmaceutically acceptable delivery vehicle.
[0381] 130. The composition according to clause 129, wherein the pharmaceutically acceptable delivery vehicle is a submicron cationic oil-in-water emulsion, a lipid nanoparticle (LNP), ora biodegradable polymeric microparticle delivery system.
[0382] 131. The composition according to clause 130, wherein the pharmaceutically acceptable delivery vehicle is a LNP.
[0383] 132. The composition according to clause 131, wherein the LNPs encapsulate the first and / or second RNA molecule.
[0384] 133. The composition according to clause 131 or 132, wherein (i) the LNPs comprise lipids and (ii) the lipids comprise a cation-ionizable lipid and cholesterol.
[0385] 134. The composition according to clause 133, wherein the cation-ionizable lipid comprises a tertiary amine and has a pKa from 5.0 to 7.6.
[0386] 135. The composition according to any one of clauses 131 to 134, wherein the Z- average diameter is from 50 to 200 nm.
[0387] 136. The composition according to clause 135, wherein the Z-average diameter is from 60 to 180 nm.
[0388] 137. The composition according to clause 136, wherein the Z-average diameter is from 80 to 160 nm.
[0389] 138. The composition according to any one of clauses 133 to 137, wherein the polydispersity index is 0.3 or lower.
[0390] 139. The composition according to clause 138, wherein the polydispersity index is 0.2 or lower.
[0391] 140. The composition according to any one of clauses 133 to 139, wherein the cation- ionizable lipid has a pKa from 5.5 to 7.2.
[0392] 141. The composition according to clause 140, wherein the cation-ionizable lipid has a pKa from 5.75 to 7.0.70395W001. The composition according to any one of clauses 133 to 141, wherein the cation- ionizable lipid comprises the following:
[0393]
[0394] ; or
[0395] . The composition according to any one of clauses 133 to 141, wherein the cation- ionizable lipid consists of the following:
[0396]
[0397] 70395W001
[0398]
[0399] 144. The composition according to any one of clauses 133 to 141, wherein the cation- ionizable lipid comprises:
[0400]
[0401] 145. The composition according to any one of clauses 133 to 141, wherein the cation- ionizable lipid comprises:
[0402]
[0403] 146. The composition according to any one of clauses 133 to 141, wherein the cation- ionizable lipid comprises:70395W001
[0404]
[0405] ; or
[0406] . The composition according to any one of clauses 133 to 146, wherein the lipids comprise polyethylene glycol-conjugated (PEG-conjugated) lipids.
[0407] . The composition according to clause 147, wherein the PEG-conjugated lipid comprises 1,2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol.
[0408] . The composition according to clause 147, wherein the PEG-conjugated lipid comprises 2-[(polyethylene glycol)-2000]-N, N-ditetradecylacetamide.
[0409] . The composition according to any one of clauses 133 to 149, wherein the lipids comprise a neutral lipid or zwitterionic lipid.
[0410] . The composition according to clause 150, wherein the zwitterionic lipid comprises 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).
[0411] . A method of eliciting an immune response against the immunogen in a subject, the method comprising administering to the subject an effective amount to elicit the immune response of the first and / or second RNA molecule according to any one of clauses 102 to 125 or the composition according to any one of clauses 129 to 151.. The method according to clause 152, wherein the immunogen comprises a venom, a poison, an allergen, a cancer antigen, a bacterial antigen, a viral antigen, a fungal antigen, a parasite antigen, or a fragment thereof.
[0412] . Use of the first and / or second RNA molecule according to any one of clauses 1 to 127 or the composition according to any one of clauses 129 to 151 for the manufacture of a medicament.
[0413] . Use of the first and / or second RNA molecule according to any one of clauses 102 to 125 or the composition according to any one of clauses 129 to 151 for the manufacture of a medicament for eliciting an immune response to the immunogen in a subject.
[0414] . Use of the first and / or second RNA molecule according to any one of clauses 102 to 125 or the composition according to any one of clauses 129 to 151 for the manufacture of a medicament for prophylaxis of infection by a pathogen in a subject.70395W001. Use of the first and / or second RNA molecule according to any one of clauses 102 to 125 or the composition according to any one of clauses 129 to 151 for the manufacture of a medicament for treatment of infection by a pathogen in a subject.. Use of the first and / or second RNA molecule according to any one of clauses 1 to 127 or the composition according to any one of clauses 129 to 151 for the manufacture of a medicament for the in vivo expression of the heterologous protein in a subject.
[0415] . The first and / or second RNA molecule according to any one of clauses 1 to 127 or the composition according to any one of clauses 129 to 151 for use as a medicament.. The first and / or second RNA molecule according to any one of clauses 102 to 125 or the composition according to any one of clauses 129 to 151 for use in eliciting an immune response to the immunogen in a subject.
[0416] . The first and / or second RNA molecule according to any one of clauses 102 to 125 or the composition according to any one of clauses 129 to 151 for use in prophylaxis of infection by a pathogen in a subject.
[0417] . The first and / or second RNA molecule according to any one of clauses 102 to 125 or the composition according to any one of clauses 129 to 151 for use in treatment of infection by a pathogen in a subject.
[0418] . The first and / or second RNA molecule according to any one of clauses 1 to 127 or the composition according to any one of clauses 129 to 151 for use in the in vivo expression of the heterologous protein in a subject.
[0419] . The method, use, first and / or second RNA molecule for use or composition for use according to any one of clauses 152 to 163, wherein the immune response is a protective immune response.
[0420] . The method, use, first and / or second RNA molecule for use or composition for use according to any one of clauses 152 to 163, wherein the immune response is a therapeutic immune response.
[0421] . The method, use, first and / or second RNA molecule for use or composition for use according to any one of clauses 152 to 165, wherein the immune response is an antibody response.
[0422] . The method, use, first and / or second RNA molecule for use or composition for use according to any one of clauses 152 to 165, wherein the immune response is a cellular immune response.70395W001 168. The method, use, first and / or second RNA molecule for use or composition for use according to any one of clauses 152 to 167, wherein the subject is a human.
[0423] 169. The method, use, first and / or second RNA molecule for use or composition for use according to any one of clauses 152 to 168 for intramuscular administration.
[0424] 170. The first and / or second RNA molecule according to any one of clauses 1 to 127, wherein the heterologous protein is a fusion protein of a plurality of immunogens.
[0425] 171. The first and / or second RNA molecule according to any one of clauses 1 to 127, comprising a plurality of sequences encoding heterologous proteins.
[0426] 172. The composition according to any one of clauses 129 to 151, comprising a plurality of RNA molecules comprising sequences encoding different heterologous proteins.
[0427] 173. A method of manufacturing the first and / or second RNA molecule according to any one of clauses 1 to 127 or 170 or 171, the method comprising admixing an RNA polymerase, triphosphate nucleotides, and a template nucleic acid comprising a sequence of the first and / or second RNA molecule, thereby obtaining an admixture; the admixing being under conditions wherein the RNA polymerase produces the first and / or second RNA molecule from the template nucleic acid.
[0428] 174. The method according to clause 173, wherein the RNA polymerase is a T7 RNA polymerase.
[0429] 175. A method of manufacturing the first and / or second RNA molecule according to any one of clauses 1 to 127 or 170 or 171, the method comprising a step of transcribing the DNA molecule of clause 128 to produce the first and / or second RNA molecule. 176. The method according to clause 175, wherein the transcription is in vitro.
[0430] 177. A method of manufacturing the composition according to any one of clauses 129 to 151 or 172, the method comprising:
[0431] a) admixing the first and / or second RNA molecule with an aqueous buffer, thereby obtaining an aqueous RNA molecule solution;
[0432] b) admixing the lipids in an organic solvent, thereby obtaining a lipid solution; c) admixing the lipid solution and the first and / or second RNA molecule solution with at least a T-mixer, a microfluidics mixer, or an impinging jet mixer, thereby obtaining a first solution, wherein the first solution comprises the LNPs, wherein at least some of the first and / or second RNA molecules are encapsulated in the LNPs; and70395W001 d) purifying the LNPs to obtain the at least 80% of the first and / or second RNA molecules being encapsulated by the LNPs.
[0433] Interpretation of sequence listing
[0434] In the Sequence Listing, it is to be understood that any “U” or “u” (uridine) depicted therein may be replaced with any of the uridine-substitutable modified nucleotides noted above, including a N1-methylpseudouridine, pseudouridine, 5-methyluridine or N1 -ethylpseudouridine, and that the percentage “u” replaced with uridine-substitutable modified nucleotides corresponds with those described in the embodiments above. For example, “a genus of uridine nucleotide of which 50% is a subgenus thereof” contemplates and supports substitution of 50% of the “u” with “ml HL” For example, “a genus of uridine nucleotide of which 25% is a subgenus thereof” contemplates and supports substitution of 25% of the “u” with “m1HL” For example, “a genus of uridine nucleotide of which 75% is a subgenus thereof’ contemplates and supports substitution of 75% of the “u” with “ml HL” In the Sequence Listing, it is to be understood that any “A” or “a” (adenosine) depicted therein may be replaced with any of the adenosine-substitutable modified nucleotides noted above, and that the percentage “A” or “a” replaced with adenosine-substitutable modified nucleotides corresponds with those described in the embodiments above. In the Sequence Listing, it is to be understood that any “T” or “t” (thymidine) depicted therein may be replaced with any of the thymidine-substitutable modified nucleotides noted above, and that the percentage “T” or “t” replaced with thymidine-substitutable modified nucleotides corresponds with those described in the embodiments above. In the Sequence Listing, it is to be understood that any “C” or “c” (cytidine) depicted therein may be replaced with any of the cytidine-substitutable modified nucleotides noted above, and that the percentage “C” or “c” replaced cytidine-substitutable modified nucleotides corresponds with those described in the embodiments above. In the Sequence Listing, it is to be understood that any “G” or “g” (guanosine) depicted therein may be replaced with any of the guanosine-substitutable modified nucleotides noted above, and that the percentage “G” or “g” replaced guanosine-substitutable modified nucleotides corresponds with those described in the embodiments above.
[0435] Where the present disclosure refers to a sequence by reference to a UniProt, Genbank, National Center for Biotechnology Information (NCBI, www.ncbi.nlm.nih.gov) reference sequence, accession number (No.), or accession code, the sequence referred to is the current version at the filing date of the earliest effective filing date. Herein a “reference sequence” and “accession code” is referred to as “accession code” for the sole purpose of simplicity and70395W001 without regard to whether the original Uniprot, GenBank, or NCBI listing recites “reference sequence,” “accession no.,” or “accession code.”
[0436] EXAMPLES
[0437] Cloning and propagation of plasmids encoding samRNAs - General Methods.
[0438] All constructs were generated using standard PCR-based and restriction enzyme digestion-based molecular cloning methods. DNA fragments were amplified using PLATINUM SuperFi II Green PCR Master Mix (THERMO FISHER) or excised from plasmid DNA using restriction enzyme digestion. Fragments were assembled into circular plasmids using T4 DNA ligase (AGILENT) or NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs (NEB)). Plasmids were transformed into NEB® Stable Competent E. coli (High Efficiency) cells (NEB). Bacteria was propagated at 30°C in 2xYT media and plasmids were purified using Qiagen maxi Kits (Qiagen, Valencia, Calif., USA).
[0439] samRNA Synthesis-General Methods
[0440] To produce in vitro transcribed RNA plasmid DNAs were linearized by incubation with 1x NEB buffer 3.1 and 20 units BspQI restriction enzyme (NEB) at 50°C for 2 hours. Linearized DNA templates were purified by mixing them with equal volume of phenol: chloroform: isoamyl alcohol, followed by centrifugation. The aqueous phase was added to a clean eppendorf tube and 1:10 volume of 3M sodium acetate was added to each tube followed by 2:1 volume of 100% ethanol. Samples were chilled on ice for 20 minutes and centrifuged for 30 minutes at 12,000 rpm. The supernatant was removed. The pellets were washed with 70% ethanol by centrifugation for 5 minutes. The supernatant was removed. The dried DNA pellets were resuspended in nuclease free water to the final DNA concentration of approximately 0.5 pg / pl.
[0441] Linearized DNA plasmids were transcribed into RNA at 30°C using T7-RNA polymerase (NEB) in the presence of Inorganic Pyrophosphatase and RNase Inhibitor (New England Biolabs). To generate RNAs containing either 100% uridine or 100% N1 -methylpseudouridine (m1Ψ) the in-vitro transcription (IVT) reactions were supplemented with 6 mM of ATP, GTP and CTP (NEB) and with either UTP (3 or 6 mM; NEB) or with ml^PTP (3 mM; TriLink Biotech). For enzymatic capping RNA transcripts were capped in the presence of GTP and S-adenosylmethionine (New England Biolabs), using Vaccinia Capping Enzyme and mRNA Cap 2'-O-Methyltransferase purified (New England Biolabs) for2h at 30°C. To generate samRNAs70395W001 which were co-translationally capped using CleanCap® Reagent AU (TriLink Biotech), IVT reactions were supplemented with 5 mM of ATP, GTP and CTP, either 2.5 mM of UTP or ml^PTP, and with 4 mM of CleanCap AU. Reactions were carried out for 2hrs at 30°C in the presence of 8 units / pL of T7-RNA polymerase (NEB), 0.002 units / pL of Yeast Inorganic Pyrophosphatase (NEB) and 1 unit / pL of Murine RNase Inhibitor (NEB). For convenience throughout the Examples samRNA generated in IVT reaction which contains UTP will be referred to as sam-U, whilst RNA generated with ml^PTP in the admixture of the IVT reaction will be referred to as sam-mlMT
[0442] Following IVT reactions, DNA template was digested with TURBO DNase (LifeTechnologies) and capped RNA transcripts were precipitated by 2.8 M LiCI. RNAs were collected by centrifugation at 15,000 rpm for 30 minutes at 4°C. The supernatant was removed and pellets were washed by adding 5ml 70% ethanol and centrifugation for 5 min. The RNA was dissolved in nuclease-free water and the RNA concentration was measured by using a NanoDrop spectrophotometer (Thermo Fisher Scientific). The RNA quality (sizes and specificity of products) was assessed by denaturing 1% glyoxal agarose gel electrophoresis using NorthernMax™-gly sample loading dye (ThermoFisher).
[0443] Cell Cultures - General Methods
[0444] Baby hamster kidney cells (BHK cells) and BJ cells (human fibroblast) were maintained in DMEM medium (w / L-Glutamine, 4.5g / L Glucose and Sodium Pyruvate) supplemented with 10 volume% heat-inactivated fetal bovine serum (FBS) and 1% Pen / Strep / L-Glutamine (Gibco). Vero cells (Cercopithecus aethiops kidney cells) were maintained in DMEM medium (w / L-Glutamine, 4.5g / L Glucose and Sodium Pyruvate) supplemented with 5 volume% heat-inactivated FBS and 1% Pen / Strep / L-Glutamine (Gibco). THP1 cells (human monocyte-like cells) were maintained in RPMI 1640 Medium (w / L-Glutamine) supplemented with 10 volume % heat-inactivated FBS and 1% Pen / Strep / L-Glutamine (Gibco). THP1-dual cells were maintained in RPMI 1640 Medium (w / L-Glutamine) supplemented with 2 mM L-glutamine, 25 mM HEPES, 10% heat-inactivated fetal bovine serum, 100 pg / ml Normocin™ (InvivoGen) and 1% Pen / Strep. Human skeletal muscle cells (hSkM) were maintained in Skeletal Muscle Cell Growth Basal Medium-2 (Lonza) supplemented with SkGM™-2 SingleQuots™ Kit (Catalog No. CC-3244 containing human Epidermal Growth Factor [hEGF], Dexamethasone, L-glutamine, FBS, and Gentamicin / Amphotericin-B [GA]). 2. Human peripheral blood mononuclear cells (hPBMC) were defrosted in growth media [RPMI 1640 1x with L-glutamine and HEPES (Corning cat no. IQ-041 -CV), 1x pen / strep solution (Gibco), 5% heat-inactivated human male AB OTC serum (Access biologicals, lot A20103-HI)] containing DNAse 1 (concentration of 1ul / mL), and after70395W001 centrifugation and counting, the cells were resuspended in a growth media to concentration of 2 million cells / mL. Overall, 200,000 cells were plated in a well of 96-well plate and used directly for RNA transfections or RNA / LNP treatments. To produce monocyte derived dendritic cells (moDC), human monocytes, which were negatively selected from hPBMCs, were obtained from Hemacare. Monocytes were thawed, washed, and resuspended in growth media (RPMI 1640 Medium (w / L-Glutamine) supplemented with 10 volume % heat-inactivated FBS and 1% Pen / Strep / L-Glutamine (Gibco) containing IL-4 (250 ng / mL, Miltenyi) and GM-CSF (400 ng / mL; Miltenyi) at a density of 1,000,000 cells per 1 ml in 96 or 6 well plate. Monocytes were allowed to differentiate for 5 days, with the media replaced every 2 days. On day 5, cells were treated in triplicate with serially diluted RNA-LNP in growth media.
[0445] Analysis of Gene-of-lnterest Expression From samRNAs - General Methods
[0446] Adherent cells (BHK, Vero, BJs, hSkM) were plated into 24 or 96 well plate using appropriate growth medium and transfected with the specified amounts of RNA using TransIT-mRNA Transfection kit (Mirus Bio) or Lipofectamine 3000. Prior to RNA transfections, THP1 cells and THP1 dual monocytes were differentiated for 24 hrs into M0 macrophages in the presence of 30 ng / mL of Phorbol-12-myristate-13-acetate (PMA). THP1 and THP1 dual M0 macrophages were maintained in growth medium without antibiotics. Subsequently M0 macrophages were transfected with the specified amounts of RNA using TransIT-mRNA Transfection kit (Mirus Bio). Alternatively, adherent cells or M0 macrophages were treated with various amounts of sam-RNA which were formulated into RV94 LNPs. In some instances, the cells were assessed for the reporter expression ( / .e., NanoLuc® Luciferase (nLuc) or enhanced green fluorescent protein (eGFP)) by flow cytometry (eGFP) or nLuc assay (nLuc). In some instances, cells were fixed with 4% PFA and stained with anti-SARS-CoV-2 monoclonal antibody Bebtelovimab (Lilly). Frequencies of SARS-CoV-2 Spike (SPK) positive (+) cells and SPK signal intensity were analyzed by CX7 Cell Insight HCS Platform (Thermo), or by flow cytometry using iQue3 instrument (Sartorius).
[0447] Analysis of Cell Viability - General Methods
[0448] At 16, 24, 48, and 66 hours post RNA transfection cell culture plates were removed from incubator and were left at room temperature for 30 minutes. Equal volume (54 uL) of CellTiter-Glo® 2.0 reagent (Promega) was added to cell culture medium present in each well. Plates were placed on an orbital shaker (200 rpm) for 2 min to induce cell lysis. One hundred uL of lysed cells were transferred into black 96 well plate, and plate was incubated at room70395W001 temperature for 10 minutes to stabilize the luminescent signal. Luminescence was measured on GloMax® Discover microplate reader (Promega). The cell viability values were expressed as a percent of viable cells in the sample transfected with samRNAs (luminance signal; relative units) compared to a control cells (not transfected).
[0449] LNP / RNA Formulation-General Methods
[0450] mRNA-LNPs were prepared using flash precipitation method, by mixing an ethanolic solution of lipids (organic phase) with an aqueous solution of mRNA (aqueous phase), in a microfluidic mixing chip, at a total flow rate of 12 mL / min, at 1:2 volumetric flow rate ratio of organic to aqueous phase, using a NanoAssemblr Ignite System (Precision Nanosystems,...
Claims
1. 70395W001 CLAIMS1. A RNA molecule comprising a first RNA sequence and a second RNA sequence; the first RNA sequence encoding one or more proteins capable of replicating a selfamplifying messenger RNA (samRNA) in an intracellular environment; the second RNA sequence comprising a heterologous nucleic acid; the RNA molecule comprising a genus of uridine and uridine-substitutable modified nucleotides of which at least 10% of the genus are uridine-substitutable modified nucleotides; the RNA molecule further comprising one or more of the modifications selected from (a)-(d):a) a 3’ poly-adenosine monophosphate (poly(A)) tail of at least 50 nucleotides in length;b) one or more regions of the first and / or second RNA sequence, that have a lower percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides, compared to the percentage of nucleotides that are uridine in the corresponding one or more regions of a corresponding wild type reference sequence;c) a 3’ untranslated region (UTR) comprising a polynucleotide sequence of m(Txm)y, where x is 4 or 5, y is 6 or more, and m is independently selected from A or C; or d) a construct encoding a heterologous polypeptide interferon effector that suppresses an interferon response.
2. The RNA molecule according to claim 1 comprising 2, 3 or 4 of the modifications selected from (a)-(d).
3. The RNA molecule according to any preceding claim, wherein at least 25%, at least 50%, at least 75% or at least 95% of the genus are uridine substitutable modified nucleotides.
4. The RNA molecule according to any preceding claim, wherein 100% of the genus are uridine-substitutable modified nucleotides, except for the first 5’ uridine.
5. The RNA molecule according to any preceding claim, wherein 100% of the genus are uridine-substitutable modified nucleotides.
6. The RNA molecule according to any preceding claim, wherein the uridine-substitutable modified nucleotides are N1 -methylpseudouridine.
7. The RNA molecule according to any preceding claim, wherein the one or more proteins capable of replicating a samRNA in an intracellular environment comprise an alphavirus nsP1, an alphavirus nsP2, an alphavirus nsP3, and an alphavirus nsP4.70395W001 8. The RNA molecule according to any preceding claim comprising or consisting essentially of a VEE-derived samRNA comprising one or more of the modifications selected from (a)-(d).
9. The RNA molecule according to any preceding claim, wherein the 3’ poly(A) tail consists of adenosine monophosphate residues.
10. The RNA molecule according to any preceding claim, wherein the 3’ poly(A) tail is at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 nucleotides in length.
11. The RNA molecule according to any preceding claim, wherein the 3’ poly(A) tail is 50 to 250, 50 to 200, 50 to 150 or 50 to 100 nucleotides in length.
12. The RNA molecule according to any preceding claim, wherein the 3’ poly(A) tail is 60 to 90 nucleotides in length.
13. The RNA molecule according to any preceding claim, wherein the 3’ poly(A) tail is about 80 nucleotides in length.
14. The RNA molecule according to any preceding claim, wherein the one or more regions of (b) comprises (i) at least a portion of a nucleic acid encoding an alphavirus nsP1, an alphavirus nsP2, an alphavirus nsP3, and an alphavirus nsP4 and / or (ii) a nucleic acid encoding the heterologous polypeptide interferon effector that suppresses an interferon response.
15. The RNA molecule according to any one of claims 7 to 14, comprising an opal stop codon between the nsP3 coding region and the nsP4 coding region.
16. The RNA molecule according to any one of claims 7 to 15, wherein the nsP4 coding region comprises a stem-loop region represented by SEQ ID NO: 52.
17. The RNA molecule according to any preceding claim, wherein the first RNA sequence has a lower percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides compared to the percentage of nucleotides that are uridine in the corresponding region of a corresponding wild type reference sequence.
18. The RNA molecule according to claim 17, wherein no more than the first 5’ 220 nucleotides of the first RNA sequence has a percentage of nucleotides that are uridine and uridine-substitutable modified nucleotides that is substantially the same compared to the percentage of uridine nucleotides in the corresponding region of a corresponding wild type reference sequence.
19. The RNA molecule according to any preceding claim, wherein the one or more regions of (b) has a percentage of nucleotides that are uridine and uridine-substitutable modified70395W001 nucleotides of 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, or 12% or less.
20. The RNA molecule according to any preceding claim, wherein the wild type reference sequence of b) comprises SEQ ID NO: 1.
21. The RNA molecule according to any preceding claim, wherein the 3’UTR of (c) comprises a polynucleotide sequence of mm(Txm)ym, where x is 4 or 5, y is 6 or more, and m is independently selected from A or C.
22. The RNA molecule according to any preceding claim, wherein the 3’UTR of (c) comprises a polynucleotide sequence of mm(Txm)6m, where x is 4 or 5, and m is independently selected from A or C.
23. The RNA molecule according to any preceding claim, wherein the 3’UTR of (c) comprises a polynucleotide sequence of SEQ ID NO: 60 or SEQ ID NO: 61.
24. The RNA molecule according to any preceding claim, wherein the 3’UTR of (c) comprises a polynucleotide sequence of SEQ ID NO: 62 or SEQ ID NO: 65.
25. The RNA molecule according to any preceding claim, wherein the 3’UTR of (c) comprises a polynucleotide sequence of SEQ ID NO: 53 or SEQ ID NO: 56.
26. The RNA molecule according to any preceding claim, comprising the sequence AUG at positions 1 to 3 of the RNA molecule.
27. The RNA molecule according to any preceding claim, wherein the heterologous polypeptide interferon effector is NS1, or a variant or fragment thereof.
28. The RNA molecule according to any preceding claim, wherein the heterologous polypeptide interferon effector is the RNA-binding domain of NS1.
29. The RNA molecule according to any preceding claim, wherein translation of the heterologous polypeptide interferon effector is cap-independent.
30. The RNA molecule according to any preceding claim, wherein the construct comprises an internal ribosome entry site (IRES).
31. The RNA molecule according to any preceding claim, wherein the construct encodes one or more self-cleaving peptides.
32. The RNA molecule according to claim 31, wherein the one or more self-cleaving peptides comprise T2A and / or P2A.
33. The RNA molecule according to any preceding claim, wherein the construct comprises in 5’ to 3’ order: an internal ribosome entry site (IRES) and a nucleic acid encoding the heterologous polypeptide interferon effector.
34. The RNA molecule according to any preceding claim, further comprising a 5’ cap.70395W001 35. The RNA molecule according to claim 34, wherein the 5’ cap is a cap-0, cap-1 or a cap- 2.
36. The RNA molecule according to any preceding claim, wherein the heterologous nucleic acid encodes a heterologous protein.
37. The RNA molecule according to claim 36, wherein the heterologous protein comprises an immunogen, an antibody, or a therapeutic protein.
38. A DNA molecule encoding the RNA molecule according to any preceding claim.
39. A composition comprising the RNA molecule according to any one of claims 1 to 37 and a pharmaceutically acceptable delivery vehicle.
40. A method of eliciting an immune response against the immunogen in a subject, the method comprising administering to the subject an effective amount to elicit the immune response of the RNA molecule according to claim 37 or the composition according to claim 39.
41. Use of the RNA molecule according to any one of claims 1 to 37 or the composition according to claim 39 for the manufacture of a medicament.
42. The RNA molecule according to any one of claims 1 to 37 or the composition according to claim 39 for use as a medicament.
43. The RNA molecule according to claim 37 or the composition according to claim 39 for use in eliciting an immune response to the immunogen in a subject.
44. A method of manufacturing the RNA molecule according to any one of claims 1 to 37, the method comprising admixing an RNA polymerase, triphosphate nucleotides, and a template nucleic acid comprising a sequence of the RNA molecule, thereby obtaining an admixture; the admixing being under conditions wherein the RNA polymerase produces the RNA molecule from the template nucleic acid.
45. A method of manufacturing the RNA molecule according to any one of claims 1 to 37, the method comprising a step of transcribing the DNA molecule of claim 38 to produce the RNA molecule.