Composition for inducing expression of TMC1 in cell membrane

A fusion protein with a membrane binding inducing sequence from GAP-43 and sodium butyrate stabilizes TMC1 expression on hair cell membranes, addressing the challenge of limited membrane expression and restoring mechanotransduction channel function for hearing loss treatment.

WO2026142221A1PCT designated stage Publication Date: 2026-07-02UI (UNIVERSITY IND FOUNDATION) YONSEI UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
UI (UNIVERSITY IND FOUNDATION) YONSEI UNIVERSITY
Filing Date
2025-12-22
Publication Date
2026-07-02

AI Technical Summary

Technical Problem

Existing technologies face challenges in stably expressing TMC1 protein on the cell membrane of hair cells, which is crucial for restoring mechanotransduction channel function and treating hearing loss, due to limited translocation and membrane expression of externally introduced TMC1 or nucleic acids.

Method used

A fusion protein is developed by conjugating a membrane binding inducing sequence, derived from the N-terminus of the GAP-43 protein, to the TMC1 protein, along with the use of sodium butyrate to enhance membrane expression, thereby stabilizing TMC1 on the cell membrane.

Benefits of technology

The fusion protein and sodium butyrate composition significantly increase TMC1 expression and restore mechanoelectric conversion channel function, effectively preventing or treating hearing loss by enhancing membrane binding and stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025022473_02072026_PF_FP_ABST
    Figure KR2025022473_02072026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for inducing cell membrane expression of TMC1 and a method for inducing cell membrane expression of TMC1 using same. By fusing a fragment of the GAP-43 protein to TMC1 to induce artificial palmitoylation, TMC1 can be stably expressed on the cell surface. Accordingly, the present invention is expected to be advantageously used in the development of new drugs for various diseases related to the activity, function, and expression abnormality of TMC1 by efficiently simulating the in vivo expression pattern of TMC1 to enable functional experiments thereof at the cellular level.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for inducing expression of TMC1 in the cell membrane

[0001] The present invention relates to a composition for expressing TMC1 in a cell membrane and a method for expressing TMC1 in a cell membrane using the same.

[0002]

[0003] TMC1 (Transmembrane Channel-like protein 1) is a membrane protein expressed in hair cells of the inner ear and is known as a key component of the mechanotransduction (MET) channel that converts sound stimuli into electrical signals.

[0004] Specifically, when the inner ear vibrates due to sound waves, the stereocilia of hair cells are physically displaced, and consequently, MET channels containing TMC1 open, allowing calcium ions (Ca 2+ ) and sodium ions (Na + Cations such as ) enter the cell. This influx of ions triggers an electrical signal, which is transmitted to the brain via the auditory nerve and perceived as sound.

[0005] Mutations or dysfunctions of the TMC1 gene are known to cause disruptions in this MET process, leading to congenital or progressive sensorineural hearing loss. In fact, TMC1 mutations are reported to be one of the major causative genes for non-syndromic hearing loss, and the restoration of TMC1 function is recognized as a key therapeutic target for the treatment of hearing loss.

[0006] Meanwhile, TMC1 is known to be expressed not only in auditory function but also in the hair cells of the semicircular canals and vestibular system, playing a role in maintaining the sense of balance by detecting rotational motion, linear acceleration, and gravitational stimuli. Therefore, dysfunction of TMC1 may be accompanied by not only hearing loss but also abnormalities in the sense of balance.

[0007] However, TMC1 is known to be a protein with very limited translocation to the normal cell membrane and stable membrane expression even when synthesized within the cell; consequently, there have been significant technical difficulties in restoring TMC1 function in hair cells using externally introduced TMC1 or nucleic acids encoding it.

[0008] Due to these issues, since 2011, when it was discovered that TMC1 is a key component of the MET channel, gene therapy or protein-based therapeutic strategies targeting TMC1 have not been implemented as practical therapeutic means.

[0009] Therefore, there is an urgent need in the field of hearing loss treatment for the development of new technologies capable of stably expressing TMC1 on the cell membrane of hair cells and thereby restoring damaged MET channel function.

[0010]

[0011] Throughout this specification, numerous papers and patent documents are referenced and cited. The disclosures of the cited papers and patent documents are incorporated by reference into this specification in their entirety to more clearly explain the state of the art to which the present invention pertains and the content of the present invention.

[0012]

[0013] Conventionally, for sensorineural hearing loss caused by TMC1 gene deletion or dysfunction, there has been no effective treatment method capable of directly restoring TMC1 channel function in cochlear hair cells. In particular, although TMC1 is a key component of the mechanotransduction (MET) channel, there have been technical limitations to the practical application of gene replacement therapy due to the problem that externally introduced TMC1 proteins or nucleic acids encoding them cannot be stably expressed on the cell membrane within hair cells.

[0014] Accordingly, the inventors made diligent research efforts to discover a therapeutic agent for hearing loss capable of restoring damaged MET channel function in cochlear hair cells by inducing the targeting of TMC1 to the cell membrane and its stable membrane expression. As a result, it was confirmed that when a modified TMC1 protein, which is palmitoylated and bound to an N-terminal motif of the GAP-43 protein, is used, TMC1 is stably expressed in the cell membrane of hair cells and the mechanoelectric conversion current is restored to a normal level, and through this, it was first identified that a composition capable of preventing or treating hearing loss caused by TMC1 functional deficiency can be provided.

[0015]

[0016] Accordingly, the objective of the present invention is to provide a fusion protein in which a target protein to be expressed in a cell membrane and a membrane binding inducing sequence that induces expression in the cell membrane are fused.

[0017] Another objective of the present invention is to provide a composition for inducing cell membrane expression of a target protein comprising, as an active ingredient, 18 to 22 consecutive amino acids of the N-terminus of the GAP-43 protein or a gene encoding the same.

[0018] Another objective of the present invention is to provide a composition for inducing the expression of TMC1 protein comprising butyrate as an active ingredient.

[0019] Another objective of the present invention is to provide a composition for the prevention or treatment of hearing loss comprising a variant TMC1 protein or a gene encoding it as an active ingredient.

[0020]

[0021] According to one aspect of the present invention, the present invention provides a fusion protein in which a target protein to be expressed in a cell membrane and a membrane binding inducing sequence that induces expression in a cell membrane are fused.

[0022] The inventors have made diligent research efforts to discover a treatment for hearing loss capable of restoring damaged MET channel function in hair cells by inducing stable expression of the TMC1 protein in the cell membrane. As a result, they were the first to identify that TMC1 is stably expressed in the cell membrane of hair cells by binding an amino acid sequence derived from the N-terminus of the GAP-43 protein to the TMC1 protein.

[0023] The term “membrane binding inducing sequence” as used in this specification refers to an amino acid sequence that induces a target protein expressed within a cell to move to or stably bind to a cell membrane, and includes a sequence that can promote cell membrane expression of the target protein through lipid modification, increased membrane affinity, or membrane targeting signals.

[0024] As used herein, the term “fusion protein” means a protein in which two or more proteins or amino acid sequences having different functions are combined into a single continuous polypeptide.

[0025]

[0026] According to a specific embodiment of the present invention, the aforementioned target protein is the TMC1 protein.

[0027] As used herein, the term “TMC1 (transmembrane channel-like protein 1) protein” refers to a protein found in the hair cells of the inner ear responsible for hearing and balance, and is known to act as a core component of mechanoelectrical transduction channels. This protein acts as a pore-forming unit of MET channels and regulates the flow of cations such as calcium and sodium. In particular, the TMC1 protein plays an essential role in auditory function and is a very important protein for maintaining normal hearing function. Mutations in the TMC1 gene have been identified as a major cause of non-syndromic hearing loss, and gene therapy targeting this is being presented as a new possibility for treating hearing loss. In the present invention, the wild-type TMC1 protein may be composed of amino acids represented by the sequence of Sequence Listing 1.

[0028] In this specification, the TMC1 protein may be used as a full-length protein or may include a functional portion thereof. In this specification, the term “functional portion” means a fragment from which some amino acid residues have been removed from the full-length protein, which is an analog of the full-length protein that retains its inherent biological activity and function. The functional portion may be a fragment from which a continuous amino acid residue has been removed for a length of 10% or less of the total length, more specifically 9% or less, more specifically 8% or less, more specifically 7% or less, more specifically 6% or less, more specifically 5% or less, more specifically 4% or less, more specifically 3% or less, more specifically 2% or less, and most specifically 1% or less at the N-terminus, C-terminus, or both N- and C-terminuses of the protein.

[0029] As used herein, the term "auditory function" refers to a series of physiological processes in which sound vibrations enter through the outer ear, vibrate the eardrum, are amplified as they pass through the middle ear, and are then converted into electrical signals recognizable by the brain in the inner ear. Specifically, when the inner ear vibrates, the stereocilia of hair cells are displaced, and consequently, mechanoelectrical transduction (MET) channels containing the TMC1 protein are opened, thereby allowing calcium ions (Ca 2+ ) and sodium ions (Na + Cations such as ) enter the cell. This generates an electrical signal, which is transmitted to the brain via nerves and perceived as sound (see Fig. 1).

[0030] The TMC1 protein of the present invention is expressed in the hair cells of the semicircular canals and vestibular organs and is involved in converting mechanical stimuli resulting from rotational motion, linear acceleration, and changes in gravity into electrical signals. Specifically, the semicircular canals detect rotational motion, while the saccule and utricle, which are vestibular organs, detect linear acceleration and the direction of gravity; in this process, TMC1 acts as a key component of the mechanical stimulus conversion channel. When the stereocilia of the hair cells move, the channel containing the TMC1 protein opens, allowing ions to flow into the cell, and the electrical signals generated by this are transmitted to the brain via nerves, thereby enabling the maintenance of balance and posture. In addition, mutations or dysfunctions of the TMC1 gene are known to cause a decline in auditory function, hearing loss, or hearing impairment, and to date, TMC1 has been reported to function as a channel mediating sodium leakage current, an osmotic pressure-dependent ion channel, and a phospholipid scramblase, in addition to being a pressure-dependent ion channel (see Figures 2 and 3).

[0031]

[0032] According to a specific embodiment of the present invention, the aforementioned membrane binding inducing sequence is conjugated to the N-terminus of the target protein.

[0033] By conjugating the above membrane binding inducing sequence to the N-terminus of the target protein, the translated fusion protein contains a cell membrane targeting signal from the early translation stage after being synthesized in the cell, and accordingly, the target protein can efficiently move to the cell membrane or be stably expressed on the cell membrane without remaining in the cytoplasm.

[0034] More specifically, as seen in the examples described below, when the target protein is the TMC1 protein, the membrane binding inducing sequence is conjugated to the N-terminus, thereby significantly increasing the cell membrane expression of the TMC1 protein in hair cells, and consequently, the recovery of damaged mechanoelectrical transduction (MET) channel function can be induced.

[0035]

[0036] According to a specific embodiment of the present invention, the aforementioned membrane binding inducing sequence comprises a sequence of 18 to 22 consecutive amino acids at the N-terminus of the GAP-43 protein.

[0037] As used herein, the term “GAP-43” refers to a protein primarily expressed in the nervous system known to be involved in neurodevelopment, axonal growth, neuroregeneration, and synaptic plasticity. The GAP-43 protein can undergo lipid modifications, such as palmitoylation, through specific amino acid sequences located at its N-terminus, and is known to possess the characteristic of binding to cell membranes or structures near the cell membrane through such modifications.

[0038] More specifically, the aforementioned membrane binding inducing sequence is a sequence of 19 to 21 amino acids at the N-terminus of the GAP-43 protein, and most specifically, the aforementioned membrane binding inducing sequence is a sequence of 20 amino acids at the N-terminus of the GAP-43 protein, which means the sequences of residues 1 to 20 of sequence list 2.

[0039]

[0040] According to a specific embodiment of the present invention, at least one of the cysteine ​​residues that is residue 3 or 4 of sequence 2 of the aforementioned sequence list is palmitoylized.

[0041] As used herein, the term "palmitoylation" refers to a post-translational modification in which a fatty acid, such as palmitic acid, is added to specific amino acid residues of a protein via a covalent bond. This process significantly influences the function, localization, and stability of proteins and is involved in various physiological and pathological processes within cells. Specifically, palmitoylation primarily occurs on cysteine ​​residues of proteins and is referred to as S-palmitoylation. When it rarely occurs on serine or threonine residues, it is referred to as O-palmitoylation. Unlike other lipid modifications (e.g., prenylation, myristoylation), palmitoylation is characterized by its reversibility; this enables dynamic regulation of proteins and is known to play a crucial role in intracellular signal transduction and protein transport. Palmitoylation increases the hydrophobicity of proteins, enhancing their ability to bind to cell membranes or organelle membranes, thereby strengthening membrane binding. It can also regulate protein localization by participating in the transport or retention of specific proteins within the cell membrane or organelle.

[0042]

[0043] According to another aspect of the present invention, the present invention provides a composition for inducing cell membrane expression of a target protein comprising, as an active ingredient, 18 to 22 consecutive amino acids of the N-terminus of a GAP-43 protein or a gene encoding the same.

[0044] The meaning of the GAP-43 protein, the continuous amino acid sequence of its N-terminus, and the target protein used in the present invention is omitted to avoid excessive duplication, as previously described.

[0045] As seen in the examples described below, the inventors first identified that a target protein is expressed more effectively in a cell membrane by conjugating a sequence of 18 to 22 amino acids of the N-terminus of the GAP-43 protein or a gene encoding such a sequence to the N-terminus of the target protein. Accordingly, the present invention experimentally confirmed that the TMC1 protein is highly expressed in a cell membrane by conjugating a sequence of amino acids of the N-terminus of the GAP-43 protein to the N-terminus of the TMC1 protein.

[0046]

[0047] According to a specific embodiment of the present invention, the above-described composition additionally comprises sodium butyrate.

[0048] As used herein, the term "sodium butyrate" refers to a sodium salt of butyric acid, a low-molecular-weight compound having the chemical formula C4H7NaO2. Sodium butyrate acts as a histone deacetylase (HDAC) inhibitor within cells to relax the chromatin structure.

[0049] As seen in the examples described below, the inventors have for the first time identified that sodium butyrate contributes to increasing the expression level of a target protein, particularly TMC1 protein or a variant thereof, and to inducing or maintaining stable expression in the cell membrane.

[0050]

[0051] According to a specific embodiment of the present invention, the above-described composition induces the expression of a target protein in the cell membrane of a hair cell.

[0052] As used herein, the term “hair cell” refers to a sensory cell located in the inner ear that performs the function of converting mechanical stimuli, such as sound, head movement, or gravity, into electrical signals.

[0053] Hair cells include inner hair cells and outer hair cells located in the cochlea of ​​the inner ear, and also include hair cells located in the semicircular canals and vestibular organs. The hair cells have stereocilia on their cell surface, and mechanical displacement of the stereocilia activates mechanoelectric conversion channels, inducing ion influx and generating electrical signals. In the present invention, the hair cells refer to target cells directly associated with the recovery of auditory function or the sense of balance through the recovery of the function of MET channels containing the TMC1 protein.

[0054]

[0055] According to another aspect of the present invention, the present invention provides a composition for inducing the expression of TMC1 protein comprising butyrate as an active ingredient.

[0056] The meaning of the TMC1 protein used in the present invention is omitted to avoid excessive duplication as previously mentioned.

[0057] As used herein, the term “butyric acid” refers to a short-chain fatty acid having the chemical formula C4H7NaO2, which is a low-molecular-weight compound that can be generated in nature and within the body or supplied from an external source. More specifically, the butyrate is an inorganic butyric acid salt.

[0058] As used herein, the term “inorganic butyric acid salt” refers to a compound in which the carboxyl group of butyric acid forms a salt with an inorganic cation. Inorganic butyric acid salts may have improved water solubility, stability, or handling properties compared to free butyric acid, and may exhibit substantially the same or similar physiological effects as butyric acid within cells. The inorganic cation of the inorganic butyric acid salt is sodium (Na₂S). + ), potassium (K + ), calcium (Ca 2+ ), magnesium (Mg 2+ ) or ammonium (NH4 + It may include, but is not limited to. Most specifically, the butyrate is sodium butyrate.

[0059]

[0060] According to another aspect of the present invention, the present invention provides a composition for the prevention or treatment of hearing loss comprising a variant TMC1 protein or a gene encoding the same as an active ingredient, comprising the following:

[0061] (a) TMC1 protein; and

[0062] (b) A sequence of 18 to 22 amino acids at the N-terminus of the GAP-43 protein bound to the N-terminus of the TMC1 protein.

[0063] As previously mentioned, the TMC1 protein, GAP-43 protein, and the sequence of 18 to 22 consecutive amino acids at the N-terminus used in the present invention are omitted to avoid excessive duplication.

[0064]

[0065] According to another aspect of the present invention, the present invention provides a method for preventing or treating hearing loss comprising the step of administering a variant TMC1 protein or a gene encoding the same to a subject, the method comprising:

[0066] (a) TMC1 protein; and

[0067] (b) A sequence of 18 to 22 amino acids at the N-terminus of the GAP-43 protein bound to the N-terminus of the TMC1 protein.

[0068] As previously mentioned, the TMC1 protein, GAP-43 protein, and the sequence of 18 to 22 consecutive amino acids at the N-terminus used in the present invention are omitted to avoid excessive duplication.

[0069] As shown in the examples described below, the inventors confirmed that when a variant TMC1 protein or a gene encoding it was introduced into hair cells of a hearing-impaired mouse model in which TMC1 gene function was deficient or reduced, the expression of the TMC1 protein at the cell membrane of the hair cells significantly increased.

[0070] Furthermore, it was observed that in hair cells into which the aforementioned mutant TMC1 protein was introduced, ion current through mechanoelectric conversion channels was restored or significantly improved, and it was confirmed that stimulus-response characteristics were also restored to a level similar to that of normal control groups. These results support the fact that a composition containing the mutant TMC1 protein of the present invention or the gene encoding it as an active ingredient can be effectively used as a composition for preventing or treating hearing loss by restoring damaged MET channel function in hair cells.

[0071] In this specification, the term “hearing loss” refers to any condition in which sound stimuli are not perceived normally or cognitive ability is impaired due to a dysfunction of the outer ear, middle ear or inner ear, auditory nerve, or central nervous system. Such hearing loss may occur congenitally or acquiredly and may appear permanently or temporarily. Specifically, hearing loss that can be prevented or treated by the composition of the present invention may include, but is not limited to, sensorineural hearing loss, conductive hearing loss, or mixed hearing loss.

[0072]

[0073] According to a specific embodiment of the present invention, the hearing loss that can be prevented or treated by the composition of the present invention is TMC1-related autosomal recessive nonsyndromic hearing loss caused by a functional deficiency or mutation of the TMC1 gene.

[0074]

[0075] In this specification, the term “prevention” means suppressing the occurrence of a disease or illness in subjects who have not been diagnosed with having such a disease or illness but are at risk of developing such a disease or illness.

[0076] In this specification, the term “treatment” means (a) inhibition of the progression of a disease, illness, or symptom; (b) alleviation of a disease, illness, or symptom; or (c) elimination of a disease, illness, or symptom. The composition of the present invention can inhibit, eliminate, or alleviate the progression of hearing loss symptoms in patients with hearing loss, thereby ultimately improving their condition. Accordingly, the composition of the present invention may serve as a therapeutic composition for hearing loss in itself, or it may be applied as a therapeutic adjuvant when administered together with other pharmacological components. Accordingly, in this specification, the terms “treatment” or “therapeutic agent” include the meaning of “therapeutic aid” or “therapeutic adjuvant.”

[0077] In the present invention, the term “therapeutic effective amount” refers to the content of a composition in which the pharmacological component within the composition is contained in an amount sufficient to provide a therapeutic or preventive effect to an individual to whom the pharmaceutical composition of the present invention is to be administered, and includes the meaning of “preventive effective amount.”

[0078]

[0079] The features and advantages of the present invention are summarized as follows:

[0080] (a) The present invention provides a fusion protein that enables stable expression of TMC1 in the cell membrane of a hair cell by providing a TMC1 protein fused with a membrane binding inducing sequence.

[0081] (b) The present invention provides a composition for the prevention or treatment of hearing loss caused by TMC1 functional deficiency or abnormality by restoring the function of damaged mechanoelectric conversion channels in hair cells through the fusion protein.

[0082]

[0083] Figure 1 is a figure showing the structure and function of inner ear hair cells.

[0084] Figures 2 and 3 illustrate the previously known roles of TMC1, such as the role of TMC1 as a pressure-dependent ion channel, a channel mediating sodium (Na+) leakage current, an osmotic pressure-dependent ion channel, and phospholipid scramble.

[0085] Figure 4 is a figure showing the structure and function of TMC1 helper proteins, CIB2 and TMIE.

[0086] Figure 5 is a figure showing the results of confirming the membrane expression defect of TMC1 according to one embodiment of the present invention.

[0087] Figure 6 is a figure confirming the effect of sodium butyrate on stabilizing TMC1 expression according to one embodiment of the present invention.

[0088] Figure 7 is a figure confirming the degree of cell membrane expression of palmTMC1 according to one embodiment of the present invention.

[0089] FIGS. 8a and 8b are figures confirming the role of palmTMC1 / CIB2 / TMIE as a sodium leakage ion channel according to one embodiment of the present invention.

[0090] Figure 9 illustrates the effects of the mutant TMC1 protein on MET channel function and the recovery of auditory function in a mouse model of hearing loss. Figure 9a shows the degree of MET current recovery in hair cells of mice with hearing loss into which the mutant TMC1 protein or the gene encoding it has been introduced. Figure 9b shows the stimulus-response characteristics in the mice compared with a normal control group. Figure 9c shows a comparison of changes in physiological indicators reflecting auditory function.

[0091]

[0092] The present invention will be described in more detail below through examples. These examples are intended solely to explain the invention more specifically, and it will be obvious to those skilled in the art that the scope of the invention is not limited by these examples according to the gist of the invention.

[0093]

[0094] Examples

[0095] Experimental method

[0096] Cell Culture

[0097] Human embryonic kidney (HEK) 293T cells (#CRL-3216, American Type Culture Collection, Manassas, VA, USA) were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and penicillin (50 IU / mL) / streptomycin (50 μg / mL; Invitrogen, Waltham, MA, USA). Cells were cultured at 37°C and 5% CO2 and subcultured every 2 to 3 days.

[0098]

[0099] Plasmids and Transfection

[0100] The plasmid encoding human TMC1 (NM_138691.3) was purchased from OriGene (Rockville, MD, USA), and the plasmids encoding human CIB2 (NM_006383.4) and TMIE (NM_147196.3) were purchased from GenScript (Piscataway, NJ, USA). The coding sequence of TMC1 was amplified by PCR and subcloned into the pcDNA3.1(+) vector using NheI and NotI restriction sites. During PCR amplification, a MYC tag (EQKLISEEDL) was inserted at the 5' end upstream of the start codon, and a Kozak sequence (GCCACC) and a new start codon (ATG) were also inserted. The plasmids encoding CIB2 and TMIE were subcloned into the purchased pcDNA3.1(+)-C-FLAG vector and used directly in experiments.

[0101] The sequence of 22 amino acids at the N-terminus of the GAP-43 protein is 'MLCCMRRTKQVEKNDEDQKIEQ', and the DNA sequence coding for it is 'ATGCTGTGCTGTATGAGAAGAACCAAACAGGTTGAAAAGAATGATGAGGACCAAAAGATTGAACAA'. Depending on the model system in which the protein is to be expressed, the codons in the DNA sequence can be modified to suit the system. Since HEK293T cells are human-derived cells, the sequence of 20 amino acids at the N-terminus of the GAP-43 protein was modified to use codons commonly used in human cells to express it more efficiently, resulting in 'ATGCTGTGCTGTATGAGAAGAACCAAACAGGTTGAAAAGAATGATGAGGACCAAAAGATC'. The DNA sequence can be inserted into the N-terminus of TMC1 through the processes of Polymerase Chain Reaction (PCR) and restriction enzyme digestion.

[0102] HEK293T cells were seeded into 24-well plates one day prior to transfection. On the day of transfection, the cell density was approximately 50 to 70%, and plasmids were transfected using PEI-MAX transfection reagent (Polysciences, Warrington, PA, USA) according to the manufacturer's instructions. TMC1, CIB2, and TMIE were transfected at amounts of 500 ng, 250 ng, and 250 ng, respectively, and 50 ng of EGFP was added to visualize the transfected cells. The ratio of plasmid (μg) to PEI (μg) was 1:3. The cells were then used for experiments for 24 to 48 hours after transfection.

[0103]

[0104] Chemical

[0105] Sodium butyrate (#B5887) was purchased from Sigma Aldrich (St. Louis, MA, USA). It was diluted to a concentration of 200 mM in culture medium or Dulbecco's Phosphate Buffered Saline (Invitrogen) and filtered using a 0.22 μm membrane filter (Millipore, Burlington, MA, USA). Sodium butyrate was added to cells to achieve a final concentration of 5 mM or 10 mM, and the cells were incubated for 24 hours prior to the experiment.

[0106]

[0107] Electrophysiology

[0108] Channel activity of TMC1-transfected HEK293T cells was measured at room temperature (22 to 25 °C) using the whole-cell voltage clamp method. Prior to the experiment, cells were isolated and mounted on the stage of an inverted microscope (Ti-U; Nikon, Tokyo, Japan) equipped with a high-density mercury lamp light source for green fluorescence excitation. Microglass pipettes (World Precision Instruments, Sarasota, FL, USA) were fabricated using PP-830 single-stage glass microelectrode pullers (Narisige, Japan) with resistances of 2 to 5 MΩ. Liquid junction potentials were rectified using an offset circuit before each recording. Current was recorded using a MultiClamp 700 B amplifier and a Digidata 1440A interface, digitized at 10 kHz, and low-pass filtered at 1 kHz using pClamp software 10.7 (Molecular Devices, San Jose, CA, USA). The whole-cell patch clamp configuration was verified by ensuring a compensated series resistance of less than 10 MΩ before each recording. In the whole-cell configuration, current was measured in a gap-free configuration, and the membrane potential was maintained at -60 mV.

[0109]

[0110] Solutions

[0111] Whole-cell voltage clamp experiments were performed using a basal extracellular bath solution containing 150 mM NaCl, 10 mM HEPES, 5 mM glucose, 2 mM MgCl2, and 10 mM sorbitol, and the pH was adjusted to 7.4 using NaOH. For the N-methyl-D-glucamine (NMDG)-based extracellular solution, NaCl was replaced with NMDG-Cl and the pH was adjusted using HCl. The osmotic pressure of the bath solution was approximately 310 mOsm. The base pipette solution contained 130 mM Na-gluconate, 10 mM CsCl, 10 mM HEPES, 2 mM EGTA, 1 mM MgCl2, 0.7 mM MCaCl2, 0.5 mM MCa-GTP, and 2 mM Mg-ATP, and the osmotic pressure of the internal solution was approximately 294 mOsm.

[0112]

[0113] Na+ Leak Channel Activity

[0114] After establishing the whole-cell configuration, the cells were monitored for 3 minutes to ensure a stable configuration and allow sufficient time for intracellular solution diffusion. TMC1 leak channel activity was evaluated by switching the extracellular solution from NMDG-Cl to NaCl, which generated a current of approximately 50 to 100 pA at -60 mV. Since the current amplitude was small even in the whole-cell configuration, cells with a basal current exceeding 10 pA in the NMDG-Cl solution were considered to have leaks and were excluded from further analysis. Generally, the basal current level in the NMDG-Cl solution was approximately 1 to 2 pA.

[0115]

[0116] Whether GAP-tagging affects TMC1 function in hair cells

[0117] We evaluated whether tagging the N-terminal amino acid sequence of the GAP-43 protein affects TMC1 function in cochlear hair cells. GAP-TMC1-HA or TMC1-HA was used on Tmc1 cells 2–3 days after birth (P2–3). dn / dn ; Tmc2 KO / KO It was introduced into the outer hair cells of double mutant mice by the injection method (Fig. 9a).

[0118]

[0119] Experimental results

[0120] The inventors confirmed that compounds referred to as chemical chaperones maintain the structure and production of TMC1 in a highly stable manner. In particular, it was confirmed that TMC1 exhibited an expression level more than 10 times higher than the conventional level when treated with sodium butyrate at a concentration of 5 to 10 mM (see Fig. 6). Furthermore, noting the fact that some proteins move from the Golgi endoplasmic reticulum to the cell surface when palmitoylated at the amino terminus of a protein, the palmitoylated-TMC1 (palmTMC1) protein was constructed by conjugating 20 amino acids from the amino terminus of the GAP-43 protein to the amino terminus of TMC1. Palmitoylation occurs at cysteine ​​positions 3 and 4 among the 20 amino acids of the GAP-43 protein.

[0121] The inventors confirmed that palmTMC1 was stably present on the cell surface when treated with sodium butyrate, which stabilizes the structure of palmTMC1 (see Fig. 7). In addition, sodium leakage ion channel activity was measured when palmTMC1, CIB2, and TMIE were co-overexpressed in cells and is shown in Fig. 8a. It was verified that palmTMC1 exhibited significantly superior activity when treated with sodium butyrate (see Fig. 8b).

[0122]

[0123] Channel function of TMC1 protein tagged with GAP-43 protein

[0124] It was confirmed that the TMC1 protein (GAP-TMC1-HA), tagged with the N-terminal amino acid sequence of the GAP-43 protein, exhibits mechanoelectrical transduction (MET) channel function substantially equivalent to that of the untagged TMC1-HA in extracochlear hair cells.

[0125] Specifically, Tmc1 without GAP-TMC1-HA or TMC1-HA introduced dn / dn ; Tmc2 KO / KO The double mutant mouse is a hearing loss model known to have a deficiency in MET channel function, and when GAP-TMC1-HA or TMC1-HA was introduced into the outer hair cells of the model, a significant MET current was induced by mechanical stimulation (see Fig. 9b).

[0126] Furthermore, the maximal current amplitude of the MET current measured in outer hair cells expressing GAP-TMC1-HA was substantially the same as that measured in outer hair cells expressing TMC1-HA. This implies that the N-terminal derived sequence of the GAP-43 protein does not inhibit the ion conductivity or pore function of the TMC1 channel.

[0127] In addition, an analysis of the pattern of current change according to the magnitude of mechanical stimulation revealed a similar stimulus-response relationship in both the GAP-TMC1-HA expression group and the TMC1-HA expression group, in which the MET current gradually increased and then saturated as the stimulation intensity increased (see Fig. 9c). This suggests that GAP-tagging does not induce significant changes in the activation, sensitivity, or kinetic characteristics of the TMC1 channel.

[0128] From the above results, it was confirmed that even when the N-terminal amino acid sequence of the GAP-43 protein is tagged to the TMC1 protein, the mechanoelectric conversion channel function of TMC1 is maintained in the native cellular context of cochlear hair cells.

[0129] In other words, it is determined that the above membrane binding-inducing sequence promotes the cell membrane expression of TMC1 while not having a substantial effect on the intrinsic physiological functions of TMC1.

[0130]

[0131] Foregoing, specific parts of the present invention have been described in detail. It is evident to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A fusion protein formed by fusing a target protein to be expressed at the cell membrane and a membrane binding inducing sequence that induces expression at the cell membrane.

2. A fusion protein according to claim 1, characterized in that the target protein is the TMC1 protein.

3. A fusion protein according to claim 1, characterized in that the membrane binding inducing sequence is conjugated to the N-terminus of the target protein.

4. A fusion protein according to claim 3, characterized in that the membrane binding inducing sequence comprises a continuous sequence of 18 to 22 amino acids at the N-terminus of the GAP-43 protein.

5. A fusion protein according to claim 4, characterized in that the membrane binding inducing sequence comprises the amino acid sequence of sequence list 2.

6. A fusion protein according to claim 5, characterized in that at least one of the cysteine ​​residues, which is residue 3 or 4 of sequence 2 of the sequence list above, is palmitoylated.

7. A composition for inducing cell membrane expression of a target protein comprising, as an active ingredient, 18 to 22 consecutive amino acids of the N-terminus of a GAP-43 protein or a gene encoding the same.

8. A composition according to claim 7, characterized in that the composition additionally comprises sodium butyrate.

9. The composition according to claim 7, characterized in that the composition induces the expression of a target protein in the cell membrane of a hair cell.

10. A fusion protein according to claim 9, characterized in that the target protein is the TMC1 protein.

11. A composition for inducing the expression of TMC1 protein containing butyrate as an active ingredient.

12. The composition according to claim 11, characterized in that the composition induces the expression of TMC1 protein in the cell membrane of a hair cell.

13. A composition for the prevention or treatment of hearing loss comprising, as an active ingredient, a variant TMC1 protein including the following or a gene encoding the same: (a) TMC1 protein; and (b) A sequence of 18 to 22 amino acids at the N-terminus of the GAP-43 protein bound to the N-terminus of the TMC1 protein.