Microorganism with reduced branched-chain amino acid transporter activity, and method for producing 5'-inosinic acid using same
By engineering Corynebacterium with reduced branched-chain amino acid transporter activity and enhanced efflux proteins, the production of 5'-inosinic acid is enhanced, addressing yield limitations in existing methods and improving flavor-enhancing properties.
Patent Information
- Application Number
- PCT/KR2025/022794
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-26
- Filing Date
- 2025-12-24
- Publication Date
- 2026-07-02
AI Technical Summary
Existing methods for producing 5'-inosinic acid, a flavor-enhancing nucleic acid-based seasoning, face challenges in achieving high yield due to limitations in microorganism efficiency and excretion mechanisms.
A microorganism of the genus Corynebacterium with reduced branched-chain amino acid transporter activity is engineered to enhance 5'-inosinic acid production capacity through modifications such as gene deletions, protein expression enhancements, and efflux protein activity improvements.
The engineered microorganism significantly increases 5'-inosinic acid production efficiency, enabling higher yields and improved flavor-enhancing capabilities.
Abstract
Description
Microorganism with reduced branched-chain amino acid transporter activity and method for producing 5'-inosinic acid using the same
[0001] The present application relates to a microorganism with reduced branched-chain amino acid transporter activity and a method for producing 5'-inosinic acid using the same.
[0002]
[0003] 5'-inosine monophosphate (IMP), one of the nucleic acid-based substances, is used in various fields such as food, pharmaceuticals, and medical applications as an intermediate in nucleic acid metabolic pathways. In particular, along with 5'-guanine monophosphate (GMP), it is a substance widely used as a food seasoning additive or for food purposes. Although 5'-inosine monophosphate is known to produce a beef flavor on its own, it is gaining popularity as a flavor-enhancing nucleic acid-based seasoning because it is known to enhance the flavor of monosodium glutamate (MSG).
[0004] Methods for producing 5'-inosinic acid include enzymatically degrading ribonucleic acid extracted from yeast cells and chemically phosphorylating inosine produced by fermentation, and methods using microorganisms capable of directly producing 5'-inosinic acid are gaining attention. In order to produce 5'-inosinic acid in high yield, there is a prior study (US 2020-0377917 A1) that newly identified the excretion protein involved in 5'-inosinic acid excretion.
[0005]
[0006] One objective of the present application is to provide a microorganism of the genus Corynebacterium that produces 5'-inosine monophosphate (IMP), the branched-chain amino acid transporter activity of which is reduced relative to the intrinsic activity.
[0007]
[0008] One aspect of the present application provides a microorganism of the genus Corynebacterium that produces 5'-inosine monophosphate (IMP), the branched-chain amino acid transporter activity of which is reduced relative to the intrinsic activity.
[0009] In one embodiment, the branched-chain amino acid transporter may have at least 80% sequence identity with SEQ ID NO. 9.
[0010] A microorganism according to any one of the aforementioned embodiments may have a deletion in part or all of the gene encoding a branched-chain amino acid transporter.
[0011] As a microorganism according to any one of the preceding embodiments, the microorganism may be a microorganism of the genus Corynebacterium in which the expression of a gene encoding a branched-chain amino acid transporter is weakened. As a microorganism according to any one of the preceding embodiments, the microorganism of the genus Corynebacterium may be Corynebacterium stationaryis.
[0012] As a microorganism according to any one of the aforementioned embodiments, the microorganism may have increased 5'-inosinic acid production capacity compared to a non-modified microorganism.
[0013] As a microorganism according to any one of the aforementioned embodiments, the microorganism may additionally have enhanced activity of the 5'-inosinic acid effluxing protein.
[0014] As a microorganism according to any one of the aforementioned embodiments, the enhancement of the activity of the 5'-inosinic acid effluxing protein of the microorganism is
[0015] 1) Increase in the intracellular copy number of protein-coding polynucleotides;
[0016] 2) Modification of a gene expression regulatory region on a chromosome that codes for a protein;
[0017] 3) Modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of a protein-coding gene transcript;
[0018] 4) Modification of the amino acid sequence of the above protein to increase protein activity;
[0019] 5) Modification of the polynucleotide sequence encoding the protein to increase protein activity;
[0020] 6) Introduction of a foreign protein exhibiting protein activity or a foreign polynucleotide encoding the same;
[0021] 7) Codon optimization of protein-coding polynucleotides;
[0022] 8) Analyze the tertiary structure of the protein to select and modify or chemically modify the exposed sites;
[0023] 9) Regulation of the cellular localization of proteins; or
[0024] 10) It may be based on one or more combinations selected from 1) to 9) above.
[0025] As a microorganism according to any one of the aforementioned embodiments, the enhancement of the activity of the 5'-inosinic acid effluxing protein of the microorganism is
[0026] (1) Increase in the intracellular copy number of protein-coding polynucleotides;
[0027] (2) Modification of the gene expression regulatory region on the chromosome that codes for a protein;
[0028] (3) Modification of the amino acid sequence of the above protein to increase protein activity;
[0029] (4) Modification of the polynucleotide sequence encoding the protein to increase protein activity;
[0030] (5) Introduction of a foreign protein that exhibits protein activity or a foreign polynucleotide encoding the same; or
[0031] It may be one or more combinations selected from (1) to (5) above.
[0032] As a microorganism according to any one of the aforementioned embodiments, the enhancement of the activity of the 5'-inosinic acid effluxing protein of the microorganism may be a substitution of the gene promoter on the chromosome encoding the protein with a strong promoter.
[0033] Another aspect of the present application provides a method for producing 5'-inosinic acid, comprising the step of culturing a microorganism having 5'-inosinic acid production capacity in a medium, wherein the branched-chain amino acid transporter activity is reduced compared to the intrinsic activity.
[0034] In one embodiment, the method may additionally include the step of recovering a target substance from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium.
[0035] Another aspect of the present application provides a composition for producing 5'-inosinic acid comprising a microorganism having the ability to produce 5'-inosinic acid, wherein the branched-chain amino acid transporter activity is reduced relative to the intrinsic activity, a culture of said microorganism, a fermented product of said microorganism, or a combination of two or more of these.
[0036]
[0037] The microorganism of the present application can efficiently produce 5'-inosinic acid.
[0038]
[0039] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to other descriptions and embodiments. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below. Additionally, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated by reference into this specification in their entirety to more clearly explain the level of the art to which this application pertains and the content of this application.
[0040] definition
[0041] As used in the specification and appended claims of this application, singular articles (“a,” “an,” and “the”) may include plural objects unless otherwise noted. Also, unless otherwise noted, singular terms may include plural forms, and plural terms may include singular forms. Additionally, in the specification and appended claims of this application, unless otherwise noted, the use of “or” may be used to include “and / or”.
[0042] In this application, the term "about" may be placed before a specific numerical value. As used in this application, the term "about" includes not only the exact number specified after the term, but also a range that is approximately that number or close to that number. Whether the number is close to or nearly that specific number may be determined by considering the context in which the number is presented. For example, the term "about" may refer to a range of -10% to +10% of a numerical value. For another example, the term "about" may refer to a range of -5% to +5% of a given numerical value. However, it is not limited thereto.
[0043] In this application, the term “consisting of” means that the proportion of the specific feature, step, component, or other component(s) described below the term is 100%. The feature, step, component, or other component described below the term “consisting of” may be essential or mandatory. For example, any other feature, step, component, or other component, or non-essential feature, step, component, or other component, in addition to the feature, step, component, or other component described below the term “consisting of,” may be excluded.
[0044] In this application, the term “consisting essentially of” means that one or more unspecified features, steps, components, or other components may be present, where the features, steps, components, or other components of the subject matter claimed in this application are not substantially affected by the presence of said unspecified features, steps, components, or other components.
[0045] In this application, the term "comprising" means the presence of the features, steps, components, or other components described below the above term, and does not exclude the presence of one or more additional features, steps, components, or other components. The features, steps, components, or other components described below the "comprising" in this application may be essential or mandatory, but some embodiments may further include other optional or non-essential features, steps, components, or other components.
[0046] Protein, polypeptide
[0047] In this application, the terms "protein" or "polypeptide" refer to a polymer or oligomer of a sequence of amino acid residues. In this application, "polypeptide," "protein," and "peptide" may be used interchangeably.
[0048] With respect to amino acid sequences in this application, it is evident that a polypeptide or protein "comprising" an amino acid sequence described by a specific sequence number, or a polypeptide or protein "consisting" of an amino acid sequence described by a specific sequence number, may include a polypeptide or protein in which some amino acid(s) are deleted, modified, substituted, or added, provided that it has the same or corresponding activity as the polypeptide or protein composed of the amino acid sequence number. For example, the polypeptide or protein may include a polypeptide or protein having additions or deletions of amino acid(s) that do not alter the function of the protein, naturally occurring mutations, silent mutations, or conservative substitutions within or before and after (N-terminus or C-terminus) the polypeptide or protein, provided that it has the same or corresponding activity.
[0049] In this application, the term "conservative substitution" means substituting an amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little to no effect on the activity of the polypeptide or protein.
[0050]
[0051] Gene, polynucleotide
[0052] In this application, the term "gene" means, in a narrow sense, a polynucleotide encoding a functional molecule, and in a broad sense, a polynucleotide comprising the polynucleotide encoding the functional molecule and the regions before and after the polynucleotide.
[0053] In this application, the terms “polynucleotide,” “nucleic acid,” or “nucleic acid molecule” refer to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, and which is a strand of DNA (e.g., cDNA or genomic DNA) or RNA (e.g., mRNA) of a certain length or longer. In this application, “polynucleotide,” “nucleic acid,” and “nucleic acid molecule” may be used interchangeably.
[0054] Identity, homology
[0055] In this application, the terms "identity" or "homology" refer to the degree of similarity between two given amino acid or base sequences and may be expressed as a percentage. In this application, "homology" and "identity" may often be used interchangeably.
[0056] The sequence homology or identity of a conserved polynucleotide or polypeptide is determined by a standard arrangement algorithm, and a default gap penalty established by the program used may be used together.
[0057] Whether any two polynucleotide or polypeptide sequences have homology or identity can be determined using a known computer algorithm, such as the “FASTA” program, using default parameters as in, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined by comparing sequence information using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), or by using GAP computer programs such as the Smith-Waterman algorithm (Smith and Waterman, Adv. Appl. Math (1981) 2:482) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET [AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO et al.](1988) SIAM J Applied Math 48: 1073). For example, homology or identity can be determined using BLAST from the National Biotechnology Information Database Center or ClustalW.
[0058] Additionally, whether any two polynucleotide sequences are homologous or identical can be determined by Southern hybridization experiments under appropriate hybridization conditions, and said appropriate hybridization conditions can be determined by methods well known to those skilled in the art within the scope of the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York), but are not limited thereto. For example, homologous or identical polynucleotide sequences can generally be hybridized under stringent conditions along the entire sequence or at least about 50%, 60%, 70%, 80%, or 90% of the total length.
[0059] In this application, the term “stringent condition” means a condition that enables specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8). For example, the conditions may include hybridizing polynucleotides with high homology or identity with each other, having homology or identity of 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, and not hybridizing polynucleotides with lower homology or identity, or washing conditions equivalent to the washing conditions of normal southern hybridization, such as 60°C, 1 χSSC, 0.1% SDS, specifically 60°C, 0.1 χSSC, 0.1% SDS, more specifically 68°C, 0.1 χSSC, 0.1% SDS, and washing once, specifically two to three times, at a salt concentration and temperature equivalent to the washing conditions of normal southern hybridization.
[0060] The above hybridization may occur between nucleotides having bases of mutually complementary sequences, but hybridized polynucleotides may contain some mismatch between bases depending on the degree of hybridization. The term “complementary” is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, with respect to DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may include not only substantially similar base sequences but also isolated nucleic acid fragments that are complementary to the entire sequence.
[0061] For example, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected by hybridizing at a Tm value of 55°C. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and can be appropriately adjusted by a person skilled in the art.
[0062] The appropriate strictness for hybridizing the above polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the art (e.g., J. Sambrook et al., i.e.).
[0063]
[0064] Nucleic acid constructs, vectors, transformations
[0065] In this application, the term "nucleic acid construct" refers to an artificially designed single or double-stranded nucleic acid molecule contained in a vector that can be used to incorporate a target genetic material into a suitable host or host cell. For example, the nucleic acid construct may include a transgene delivered via a transformation vector that causes the insertion sequence to be replicated and / or expressed in the host cell. For example, the transgene may be replicated from an existing sequence or artificially synthesized.
[0066] In this application, the term "vector" refers to a DNA product for delivering a target polynucleotide into a suitable host or host cell.
[0067] For example, the vector may comprise a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) to enable the expression of the target polypeptide within a suitable host. The expression control region may comprise a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell (microorganism), the vector may replicate or function independently of the host genome, or it may be integrated into the genome itself to replicate or function.
[0068] In addition, as an example, the vector of the present application may include a sequence for inserting a target polynucleotide into a chromosome. The insertion of the polynucleotide into the chromosome using said vector may be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto.
[0069] The vectors used in this application are not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pDC-based, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors may be used as plasmid vectors. As an example, pDZ, pDC, pDC24, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors may be used.
[0070] The above vector may additionally include a selection marker to determine whether the vector has been transformed into a host cell or further inserted into a chromosome within the host cell. The selection marker is intended to select cells transformed by the vector or to confirm whether a target polynucleotide has been inserted into a chromosome, and markers conferring selectable phenotypes, such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or the expression of surface polypeptides, may be used. Since only cells expressing the selection marker survive or exhibit other phenotypic traits in an environment treated with a selective agent, the transformed cells can be selected.
[0071] In this application, the term "transformation" means introducing a target polynucleotide, or a vector containing the same, into a host cell (microorganism) to alter the genetic traits of the host cell (microorganism). The transformed polynucleotide may be inserted into the chromosomes of the host cell (microorganism) or located outside the chromosomes. Additionally, the polynucleotide may contain DNA or RNA. The polynucleotide may be introduced in an appropriate form depending on the purpose of introduction. For example, a polynucleotide for expressing a target polypeptide may be introduced into the host cell (microorganism) in the form of an expression cassette, which is a genetic structure containing all the elements necessary for self-expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to the coding sequence of the target polypeptide. The expression cassette may be in the form of a self-replicating expression vector. In addition, the above polynucleotide may be introduced into a host cell (microorganism) in its own form and operably linked to a sequence required for expression in the host cell (microorganism), but is not limited thereto.
[0072] In this application, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned at an appropriate location so that the regulatory sequence controls the expression of a coding sequence. Accordingly, "operably linked" includes a regulatory region of a functional domain having known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, being attached to or linked to a target (gene or polypeptide) so as to regulate the expression, secretion, or function of the target according to said known or desired activity. For example, it may mean that a promoter sequence and a polynucleotide sequence are functionally linked to initiate and mediate the transcription of a polynucleotide encoding a polypeptide.
[0073] In this application, the term "expression" includes, but is not limited to, any step involved in the generation of a polypeptide, e.g., transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0074] In this application, the term "expression vector" means a linear or circular nucleic acid molecule comprising a target polynucleotide sequence and a regulatory sequence operably linked for the expression thereof. For example, it may comprise a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression regulatory region (or expression regulatory sequence) so as to enable the expression of the target polypeptide within a suitable host.
[0075] In this application, the term "regulatory sequence" refers to a polynucleotide sequence required for the regulation of the expression of a target polynucleotide sequence. Each regulatory sequence may be a natural (of the same origin) or foreign (derived from a different gene) sequence with respect to the coding sequence, a variant thereof, or another artificial sequence. Examples of the regulatory sequences include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence coding for a ribosome binding site, and a sequence regulating transcription and translation termination. The minimum unit of the regulatory sequence may include a promoter, a transcription and translation termination sequence.
[0076] In this application, the term "genetic recombination" refers to a natural or artificial process in which elements constituting a gene, such as DNA or RNA, are altered from their original sequences during the process of disassembly and reassembly.
[0077] In this application, the term "recombinant gene" refers to a gene, DNA, or polynucleotide having a new genomic composition resulting from genetic recombination, such as chemical synthesis or genetic engineering techniques. In this application, the terms "recombinant gene," "recombinant DNA," and "recombinant polynucleotide" may be used interchangeably. For example, the recombinant gene may include an artificial combination of nucleic acid fragments, such as regulatory sequences, that are not found together in nature.
[0078] In this application, the term "recombinant protein" refers to a protein produced as a result of genetic recombination.
[0079] microorganism
[0080] In this application, the term "microorganism (or strain)" includes both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and may be a microorganism in which specific mechanisms are weakened or reduced due to causes such as the insertion of external genes or the reduction or inactivation of the activity of endogenous genes, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product. In this application, the terms "microorganism," "strain," "host," and "host cell" may be used interchangeably.
[0081] In this application, the term “recombinant microorganism” refers to a microorganism that is genetically modified to exhibit a different genotype and / or phenotype compared to a naturally occurring microorganism (e.g., when the genetic modification affects the nucleic acid sequence coding of the microorganism), and may include both offspring and potential offspring of said microorganism. In this application, the terms “recombinant microorganism,” “genetically modified microorganism,” “recombinant host cell,” “recombinant cell,” and “recombinant strain” may be used interchangeably. The recombinant microorganism may, for example, express a gene not found in its natural (non-recombinant) form; not express a gene expressed in its natural form; or express a natural gene in a manner different from that expressed in its natural form.
[0082] In this application, the term "non-modified microorganism (strain)" does not exclude microorganisms (strains) containing naturally occurring mutations, and may refer to wild-type microorganisms (strains) or natural-type microorganisms (strains) themselves, or microorganisms (strains) prior to genetic mutations caused by natural or artificial factors. In this application, the term "non-modified microorganism (strain)" may be used interchangeably with "pre-modification microorganism (strain)," "non-mutated microorganism (strain)," "parent microorganism," "parent strain," "wild-type microorganism (strain)," "reference microorganism (strain)," or "standard microorganism (strain)." In this application, a non-modified microorganism may refer to a microorganism (strain) whose branched-chain amino acid transporter activity of this application has not decreased relative to its intrinsic activity, or prior to such decrease, but is not limited thereto. In addition, the non-modified microorganism in this application may be a microorganism comprising a polypeptide consisting of SEQ ID NO. 9 or a polynucleotide consisting of SEQ ID NO. 1, or a polypeptide having a function corresponding to said polypeptide or a polynucleotide encoding the same, but is not limited thereto.
[0083] Decrease in protein (polypeptide) activity
[0084] In this application, the term "reduction" of protein (polypeptide) activity encompasses both the decrease in protein (polypeptide) activity relative to its intrinsic activity and inactivation within a host cell (microorganism). That is, the reduction in protein (polypeptide) activity may include: protein (polypeptide) activity that is reduced relative to its intrinsic activity or activity prior to modification, where the protein (polypeptide) is not completely inactivated within the host cell (microorganism); or protein (polypeptide) activity that is completely inactivated.
[0085] For example, the above reduction may include cases where the protein (polypeptide) activity is lower or absent compared to the protein (polypeptide) possessed by the non-transformed host cell (microorganism) before transformation due to mutations in the polynucleotide encoding the protein (polypeptide); cases where the overall level of protein (polypeptide) expression within the cell is lower compared to the non-transformed host cell (microorganism) before transformation due to inhibition of the expression of the polynucleotide or protein (polypeptide); cases where the expression of the polynucleotide or protein (polypeptide) does not occur at all; and cases where the protein (polypeptide) activity is low or absent even if protein (polypeptide) expression occurs normally.
[0086] The above "intrinsic activity" refers to the activity of a specific protein (polypeptide) originally possessed by the host cell (microorganism) prior to transformation or the non-transformed host cell (microorganism) when a trait changes due to genetic variation caused by natural or artificial factors. This term may be used interchangeably with "pre-transformation activity."
[0087] The above host cell (microorganism) may be a prokaryotic or eukaryotic microorganism.
[0088] A decrease in the activity of a protein (polypeptide) relative to its intrinsic activity means that the activity and / or concentration (expression level) of the protein (polypeptide) in the host cell (microorganism) has become lower than the activity and / or concentration (expression level) of the said protein (polypeptide) originally possessed by the host cell (microorganism) prior to transformation or the non-transformed host cell (microorganism).
[0089] Whether the activity of the above protein (polypeptide) is reduced can be confirmed from the degree of activity, expression amount, or increase in the amount of product attributable to the activity of the said protein (polypeptide).
[0090] For example, the above reduction may be a reduction in the activity or concentration of the corresponding protein (polypeptide) to approximately less than 100%, approximately 90% or less, approximately 80% or less, approximately 70% or less, approximately 60% or less, approximately 50% or less, approximately 40% or less, approximately 30% or less, approximately 20% or less, approximately 10% or less, approximately 5% or less, or 0%, but is not limited thereto.
[0091] The reduction in the activity of the above protein (polypeptide) can be achieved by various methods well known in the art, and is not limited to, as long as the activity of the target protein (polypeptide) can be reduced compared to that of the host cell (microorganism) before modification. Specifically, it may be, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
[0092] Specifically, the reduction in the activity of the protein (polypeptide) of the present application is
[0093] 1) Deletion of all or part of a gene encoding a protein (polypeptide);
[0094] 2) Modification of a gene expression regulatory region on a chromosome encoding a protein (polypeptide) (e.g., introduction of a mutation within the expression regulatory region, replacement with a sequence having expression-inhibiting activity, or insertion of a sequence having expression-inhibiting activity);
[0095] 3) Modification of the amino acid sequence of the protein (polypeptide) so as to reduce the activity of the protein (polypeptide) (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence);
[0096] 4) Modification of the polynucleotide sequence encoding the protein (polypeptide) so as to reduce the activity of the protein (polypeptide) (e.g., modification of the polynucleotide sequence of the protein (polypeptide) coding gene to code for a modified protein (polypeptide) so as to reduce the activity of the protein (polypeptide);
[0097] 5) A modification of the nucleotide sequence encoding the start codon or 5'-UTR of a gene encoding a protein (polypeptide);
[0098] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding a protein (polypeptide);
[0099] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence to the front of the Shine-Dalgarno sequence of a gene encoding a protein (polypeptide) in order to form a secondary structure that prevents ribosome attachment;
[0100] 8) Addition of a reverse-transcribed promoter to the 3' end of the ORF (open reading frame) of a polynucleotide sequence encoding a protein (polypeptide) (Reverse transcription engineering, RTE);
[0101] 9) Regulation of the cellular localization of proteins (polypeptides); or
[0102] 10) It may be based on one or more combinations selected from 1) to 9) above, but is not particularly limited thereto.
[0103] for example,
[0104] The deletion of all or part of the gene encoding the protein (polypeptide) mentioned above 1) may be performed using homologous recombination via a vector for insertion into a chromosome within a microorganism, or using electromagnetic waves such as ultraviolet rays, X-rays, gamma rays, or chemical substances, but is not limited thereto.
[0105] In addition, the replacement of the gene expression regulatory region on the chromosome encoding the above 2) protein (polypeptide) with a sequence having expression-inhibiting activity may, for example, be the introduction of a mutation on the expression regulatory region by deletion, insertion, substitution, or a combination thereof to reduce the expression-inducing activity of the expression regulatory region, or the replacement with a sequence having further expression-inhibiting activity. The expression regulatory region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
[0106] Additionally, the modification of the amino acid sequence or polynucleotide sequence of the protein (polypeptide) of 3) and 4) above may involve introducing a sequence variation of deletion, insertion, substitution, or a combination thereof into the amino acid sequence of the protein (polypeptide) or the polynucleotide sequence encoding the protein (polypeptide) to reduce the activity of the protein (polypeptide), or replacing it with an amino acid sequence or polynucleotide sequence modified to reduce activity, but is not limited thereto. The modification of the sequence may be performed, for example, by inserting a polynucleotide of the modified sequence into a chromosome by homologous recombination, but is not limited thereto. In one embodiment, the protein (polypeptide) may be inactivated by introducing a variation within the polynucleotide sequence encoding the protein (polypeptide) to form a stop codon, but is not limited thereto.
[0107] In addition, the modification of the nucleotide sequence coding for the start codon or 5'-UTR of the gene coding for the protein (polypeptide) above 5) may, for example, be a substitution with another start codon that has a lower protein (polypeptide) expression rate compared to the intrinsic start codon, or a modification with a sequence coding for an RBS sequence that has a lower protein (polypeptide) expression rate compared to the intrinsic RBS (ribosome binding site) sequence, but is not limited thereto.
[0108] The introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the protein (polypeptide) mentioned above 6) can be performed, for example, by referring to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986], but is not limited thereto.
[0109] 7) Adding a sequence complementary to the Shine-Dalgarno sequence to the front of the Shine-Dalgarno sequence of a gene encoding a protein (polypeptide) in order to form a secondary structure that prevents ribosome attachment may make mRNA translation impossible or slow down, but is not limited thereto.
[0110] Reverse transcription engineering (RTE) of a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the polynucleotide sequence encoding the protein (polypeptide) above may reduce activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide, thereby inhibiting the translation of the protein (polypeptide).
[0111] The above 9) regulation of the intracellular localization of a protein (polypeptide) may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.
[0112] Such a decrease in protein (polypeptide) activity may be a decrease in the activity or concentration of the corresponding protein (polypeptide) relative to the activity or concentration of the protein (polypeptide) expressed in the wild type or host cell (microorganism) prior to modification, but is not limited thereto.
[0113] Modification of part or all of the polynucleotides in the host cells (microorganisms) of the present application may be induced by (a) a method using homologous recombination using a chromosome insertion vector or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment by light and / or chemicals such as ultraviolet rays and radiation, but is not limited thereto.
[0114] "Increase" in protein (polypeptide) activity
[0115] In this application, the term "increase" of protein (polypeptide) activity means that the activity of a protein (polypeptide) within a host cell (microorganism) increases relative to its intrinsic activity. The increase may be used interchangeably with terms such as activation, up-regulation, overexpression, and enhancement. The host cell (microorganism) may be a prokaryotic or eukaryotic microorganism.
[0116] The increase in the above protein (polypeptide) activity may include both the occurrence of protein (polypeptide) activity that the host cell (microorganism) did not inherently possess, and the occurrence of protein (polypeptide) activity that is enhanced compared to the inherent activity or activity prior to modification.
[0117] For example, the above "exhibiting protein (polypeptide) activity that was not inherently possessed" or exhibiting enhanced protein (polypeptide) activity may be due to the "introduction of protein (polypeptide)," but is not limited thereto.
[0118] In this application, the term "introduction" of a protein (polypeptide) means that the activity of a specific protein is exhibited as a result of a gene that the microorganism did not originally possess being expressed within the microorganism, or that the polypeptide activity is enhanced, increased, or improved compared to the intrinsic activity of the said protein or its activity prior to modification. For example, this may be due to the introduction of a gene encoding the said protein (polypeptide) into a host cell (microorganism). For example, a polynucleotide encoding a specific protein (polypeptide) may be introduced into a chromosome within the host cell (microorganism), or a vector containing a polynucleotide encoding a specific protein (polypeptide) may be introduced into the host cell (microorganism) to exhibit or improve its activity.
[0119] The above "intrinsic activity" refers to the activity of a specific protein (polypeptide) originally possessed by the host cell (microorganism) prior to transformation or the non-transformed host cell (microorganism) when a trait changes due to genetic variation caused by natural or artificial factors. This term may be used interchangeably with "pre-transformation activity."
[0120] An increase in the activity of a protein (polypeptide) relative to its intrinsic activity means that the activity and / or concentration (expression level) of the protein (polypeptide) in the host cell (microorganism) has been enhanced compared to the activity and / or concentration (expression level) of the said protein (polypeptide) originally possessed by the host cell (microorganism) prior to transformation or the non-transformed host cell (microorganism).
[0121] For example, the above increase may be that the activity of the corresponding protein (polypeptide) was absent, or that the activity or concentration thereof is increased to approximately 1% or more, approximately 10% or more, approximately 25% or more, approximately 50% or more, approximately 75% or more, approximately 100% or more, approximately 150% or more, approximately 200% or more, approximately 300% or more, approximately 400% or more, or approximately 500% or more, up to approximately 1000% or approximately 2000% or more, based on the activity or concentration in the host cell (microorganism) before transformation or in the non-transformed host cell (microorganism), but is not limited thereto.
[0122] An increase in the activity of the above protein (polypeptide) can be achieved by introducing an exogenous protein (polypeptide) or by increasing the activity of the intrinsic protein (polypeptide). Whether the activity of the above protein (polypeptide) has increased can be confirmed from an increase in the degree of activity, expression amount, or amount of product attributable to the activity of the said protein (polypeptide).
[0123] Increased activity of the above protein (polypeptide) can be achieved by various methods well known in the art, and is not limited to, as long as the activity of the target protein (polypeptide) can be increased compared to that of the host cell (microorganism) before modification. Specifically, it may be, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
[0124] Specifically, the increase in the activity of the protein (polypeptide) of the present application is
[0125] 1) Increase in the intracellular copy number of polynucleotides encoding proteins (polypeptides);
[0126] 2) Modification of a gene expression regulatory region on a chromosome encoding a protein (polypeptide) (e.g., introduction of a mutation within the expression regulatory region, replacement with a sequence having greater activity, or insertion of a sequence having greater activity);
[0127] 3) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of a gene transcript encoding a protein (polypeptide);
[0128] 4) Modification of the amino acid sequence of the protein (polypeptide) to increase protein (polypeptide) activity;
[0129] 5) Modification of the polynucleotide sequence encoding the protein (polypeptide) to increase the activity of the protein (polypeptide) (e.g., modification of the polynucleotide sequence of the protein (polypeptide) coding gene to code for a modified protein (polypeptide) to increase the activity of the protein (polypeptide);
[0130] 6) Introduction of a foreign protein (polypeptide) exhibiting protein (polypeptide) activity or a foreign polynucleotide encoding the same;
[0131] 7) Codon optimization of polynucleotides encoding proteins (polypeptides);
[0132] 8) Analyze the tertiary structure of the protein (polypeptide) to select and modify or chemically modify the exposed sites;
[0133] 9) Regulation of the cellular localization of proteins (polypeptides); or
[0134] 10) It may be based on one or more combinations selected from 1) to 9) above, but is not particularly limited thereto.
[0135] for example,
[0136] The increase in the intracellular copy number of the polynucleotide encoding the protein (polypeptide) described in 1) above may be achieved by introducing a vector containing the polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence into a host cell (microorganism). Alternatively, one or more copies of the polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence may be introduced into the chromosomes within the host cell (microorganism). The introduction into the chromosomes may be performed by introducing a vector capable of inserting the polynucleotide into the chromosomes within the host cell (microorganism), but is not limited thereto. The vector is as described above. The regulatory sequence may be a natural form (of the same origin) or a foreign sequence (derived from a different gene) with respect to the polynucleotide sequence, a variant of these, or another artificial sequence, and may induce the expression of the polynucleotide within the host cell (microorganism).
[0137] The replacement of a gene expression regulatory region (or expression regulatory sequence) on a chromosome encoding a protein (polypeptide) in the above 2) with a sequence having greater activity may, for example, involve introducing a sequence variation by deletion, insertion, substitution, or a combination thereof to further increase the activity of the expression regulatory region, or by replacing it with a sequence having greater activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a potent promoter, but is not limited thereto.
[0138] Examples of known strong promoters include, but are not limited to, cj1 to cj7 promoters (US Patent No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL1 promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. 10584338 B2), O2 promoter (US Patent No. 10273491 B2), tkt promoter, and yccA promoter.
[0139] The above 3) modification of the nucleotide sequence of the region coding for the start codon or 5'-UTR of the gene coding for the protein (polypeptide) may be, for example, a modification that codes for another start codon with a higher protein (polypeptide) expression rate compared to the intrinsic start codon, or an RBS sequence with a higher protein (polypeptide) expression rate compared to the intrinsic RBS (ribosome binding site) sequence, but is not limited thereto.
[0140] The modification of the amino acid sequence or polynucleotide sequence of the protein (polypeptide) in 4) and 5) above may be the introduction of a sequence variation by deletion, insertion, substitution, or a combination thereof to the amino acid sequence of the protein (polypeptide) or the polynucleotide sequence encoding the protein (polypeptide) to increase the activity of the protein (polypeptide), or the replacement with an amino acid sequence or polynucleotide sequence modified to increase activity, but is not limited thereto. The replacement may be performed, for example, by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto.
[0141] The introduction of an exogenous polynucleotide exhibiting the activity of the protein (polypeptide) described in 6) above may be the introduction into a host cell (microorganism) of an exogenous polynucleotide encoding a protein (polypeptide) that exhibits the same or similar activity as the protein (polypeptide). As long as the exogenous polynucleotide exhibits the same or similar activity as the protein (polypeptide), there are no restrictions on its origin or sequence. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the protein (polypeptide) may be produced and its activity increased by the expression of the introduced polynucleotide within the host cell.
[0142] The above 7) codon optimization of a polynucleotide encoding a protein (polypeptide) may be a codon optimization of the endogenous polynucleotide so that transcription or translation increases within the host cell (microorganism), or a codon optimization of the exogenous polynucleotide so that optimized transcription and translation occur within the host cell (microorganism).
[0143] 8) Analyzing the tertiary structure of the protein (polypeptide) above to select an exposed site for modification or chemical modification may, for example, involve determining a template protein candidate based on the degree of sequence similarity by comparing the sequence information of the protein (polypeptide) to be analyzed with a database in which sequence information of known proteins is stored, and confirming the structure based on this to select an exposed site to modify or chemically modify.
[0144] The above 9) regulation of the intracellular localization of a protein (polypeptide) may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.
[0145] Such an increase in protein (polypeptide) activity may be an increase in the activity or concentration of the corresponding protein (polypeptide) relative to the activity or concentration of the protein (polypeptide) expressed in the wild-type or pre-modification host cell (microorganism), or an increase in the amount of products attributable to the activity of the said protein (polypeptide), but is not limited thereto.
[0146] culture
[0147] In this application, the term "culture" means growing microorganisms under appropriately controlled environmental conditions. The culture process may be carried out according to suitable media and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art depending on the microorganism selected. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto.
[0148] In this application, the term "medium" refers to a substance mixed with nutrients as the main component required to culture microorganisms, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, any medium and other culture conditions used for culturing the microorganisms of this application may be used without special limitations as long as they are media used for culturing microorganisms in general. For example, the microorganisms of this application may be cultured under aerobic conditions while controlling the temperature, pH, etc., in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins. For example, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].
[0149] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane residue, and corn steeping liquid may be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other carbon sources in appropriate amounts may be used without limitation. These carbon sources may be used individually or in combination of two or more types, but are not limited thereto.
[0150] The above nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. These nitrogen sources may be used alone or in combination of two or more types, but are not limited thereto.
[0151] The above ingredients may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins, and / or suitable precursors. These components or precursors may be added to the medium in a batch or continuous manner. However, they are not limited thereto.
[0152] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during cultivation, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress the formation of bubbles. Furthermore, to maintain an aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.
[0153] In the culture of the present application, the culture temperature may be maintained at 20 to 45°C, specifically 25 to 40°C, and culture may be carried out for about 10 to 160 hours, but is not limited thereto.
[0154] In the present application, the term "culture" means a culture solution, concentrated culture solution, dried culture solution, culture filtrate, concentrated culture filtrate, or dried culture filtrate obtained by culturing a specific microorganism in a culture medium, wherein the culture solution means containing the specific microorganism, and the culture filtrate means not substantially containing the specific microorganism (wherein "substantially" means excluding the specific microorganism separated by filtration, etc., and does not mean that the microorganism is completely excluded from the filtrate). The formulation of the culture is not limited and may be, for example, a liquid, an emulsion, or a solid.
[0155] In this application, the term "fermentation" refers to a process in which microorganisms decompose organic matter using their own enzymes, excluding putrefaction. Although fermentation and putrefaction proceed through similar processes, if useful substances are produced as a result of the decomposition, it is called fermentation, whereas if foul odors are emitted or harmful substances are produced, it is called putrefaction.
[0156] In this application, the method of obtaining a fermented product from the microorganism is not particularly limited and can be obtained according to methods commonly used in the relevant technical field or similar fields.
[0157] In this application, the term "fermented product" includes not only the fermented substance itself, but also all types of substances containing a fermented product generated from said microorganisms, such as a substance containing a fermented microorganism, a culture produced from a fermented microorganism, a fermented product of a culture, a concentrated fermented product, a dried product of a fermented product, a filtrate of a fermented product, a filtrate of a concentrated fermented product, or a dried product of a filtrate of a fermented product, an extract of a fermented product, or a diluted solution of a fermented product.
[0158]
[0159] Specific description of the present application
[0160]
[0161] The following is a more detailed description of the specific embodiments of the present application.
[0162]
[0163] One aspect of the present application provides a microorganism having 5'-inosinic acid production capacity, wherein branched-chain amino acid transporter activity is reduced relative to intrinsic activity.
[0164] The reduced branched-chain amino acid transporter activity may be measured by measuring the amount of the branched-chain amino acid transporter or the polynucleotide encoding the branched-chain amino acid transporter, or by measuring the 5'-inosinic acid production capacity (or yield), but is not limited thereto. For example, if the 5'-inosinic acid production capacity of the microorganism of the present application is increased compared to the 5'-inosinic acid production capacity of a natural wild-type microorganism or an unmodified microorganism (e.g., a microorganism expressing a wild-type polypeptide having branched-chain amino acid transporter activity (e.g., the polypeptide of SEQ ID NO. 9)), the reduced branched-chain amino acid transporter activity may be measured by measuring the increased 5'-inosinic acid production capacity, but is not limited thereto.
[0165] In one embodiment, the microorganism of the present application may be Corynebacterium stationaryis that does not contain an amino acid sequence having at least 70%, e.g., 80%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO. 9; or a polynucleotide encoding the same.
[0166] In one embodiment, the microorganism of the present application may be Corynebacterium stationaryis that does not contain an amino acid sequence having at least 70%, e.g., 80%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the functional fragment of SEQ ID NO. 9, or a polynucleotide encoding the same. For example, the functional fragment may consist of at least 250, 300, 320, 340, or 360 amino acids included in the amino acid sequence of SEQ ID NO. 9, but is not limited to these examples, and a sequence in which some amino acids are deleted, substituted, or added as long as it exhibits the activity of a protein composed of the amino acid sequence of SEQ ID NO. 9 may also be included in the functional fragment of SEQ ID NO. 9.
[0167]
[0168] In this application, the term "Branched-Chain Amino Acid Transporter" is also referred to as "Branched-Chain Amino Acid Transporter" and is a protein involved in the intracellular / extracellular transport of leucine, isoleucine, and valine, which are classified as branched-chain amino acids. The branched-chain amino acid transporter of this application may be referred to as BrnQ. The BrnQ protein is known in the art and, specifically, may be a branched-chain amino acid transporter encoded by the brnQ gene, but is not limited thereto. The amino acid and polynucleotide sequences of the branched-chain amino acid transporter can be obtained from known databases, such as GenBank of NCBI, but are not limited thereto.
[0169] For example, the branched-chain amino acid transporter may include the amino acid sequence of SEQ ID NO. 9 or an amino acid sequence having 70% or more homology or identity therewith, but is not limited thereto as long as it has branched-chain amino acid transporter activity. Specifically, even if some sequences in the amino acid sequence of SEQ ID NO. 9 are deleted, modified, or substituted, or if other sequences are added to the amino acid sequence of SEQ ID NO. 9, if the protein exhibits efficacy corresponding to the branched-chain amino acid transporter, it may be included in the BrnQ protein. In addition, any protein that has, includes, is composed of, or is essentially composed of the amino acid sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the amino acid sequence of SEQ ID NO. 9, and exhibits efficacy corresponding to the branched-chain amino acid transporter of the present application may be included in the branched-chain amino acid transporter of the present application. Specifically, the branched-chain amino acid transporter may be a protein composed of the amino acid sequence of SEQ ID NO. 9 present in microorganisms of the genus Corynebacterium, such as Corynebacterium stationaryis, but is not limited thereto.
[0170]
[0171] In addition, the sequence of a polynucleotide encoding a branched-chain amino acid transporter having an amino acid sequence having 70% or more homology or identity with the amino acid sequence of SEQ ID NO. 9 or an amino acid sequence having 70% or more homology or identity with the sequence of SEQ ID NO. 1 or a sequence having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the sequence of SEQ ID NO. 1 may be encoded by a polynucleotide having or containing a sequence having said sequence or essentially consisting of said sequence, but is not limited thereto. The nucleotide sequence of SEQ ID NO. 1 may be obtained from known databases, such as GenBank of NCBI, but is not limited thereto.
[0172] In some embodiments of the present application, the polynucleotide (gene) comprising the base sequence of SEQ ID NO. 1 may be modified to "polynucleotide (gene) having the base sequence of SEQ ID NO. 1" or "polynucleotide (gene) consisting of the base sequence of SEQ ID NO. 1".
[0173]
[0174] In this application, the term 5'-inosine monophosphate may be used interchangeably with IMP. IMP is one of the nucleic acid-based substances, known to produce a beef flavor on its own and known to enhance the flavor of monosodium glutamate (MSG), and is a substance that is gaining attention as a flavorful nucleic acid-based seasoning.
[0175]
[0176] For the purposes of this application, the microorganisms of this application may include all microorganisms capable of producing the desired 5'-inosinic acid by reducing branched-chain amino acid transporter protein activity relative to intrinsic activity. For example, the microorganisms of this application may have increased 5'-inosinic acid production capacity by reducing branched-chain amino acid transporter activity relative to intrinsic activity, but are not limited thereto. Specifically, the microorganisms with reduced branched-chain amino acid transporter production capacity may be genetically engineered microorganisms or recombinant microorganisms, and may be microorganisms with increased 5'-inosinic acid production capacity compared to natural wild-type microorganisms or non-modified microorganisms having intrinsic branched-chain amino acid transporter activity, but are not limited thereto.
[0177] For example, microorganisms having 5'-inosinic acid production ability may include not only microorganisms that inherently have 5'-inosinic acid production ability, but also microorganisms that do not inherently have 5'-inosinic acid production ability but are endowed with 5'-inosinic acid production ability. 5'-inosinic acid production ability may be endowed or enhanced by the reduced branched-chain amino acid transporter activity or species improvement of the present application.
[0178] For example, the recombinant microorganism having the ability to produce 5'-inosinic acid according to the present application may include any microorganism that can be transformed through a vector to produce 5'-inosinic acid by reducing the branched-chain amino acid transporter activity of the present application or to increase the ability to produce 5'-inosinic acid.
[0179] For example, the parent microorganism or non-modified microorganism that produces 5'-inosinic acid, to which a modification reducing branched-chain amino acid transporter production capacity is applied in the present application, may be a microorganism that inherently contains a protein composed of the amino acid sequence of SEQ ID NO. 9, or a protein composed of an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with SEQ ID NO. 9.
[0180] For example, a parent microorganism or a non-modified microorganism that produces 5'-inosinic acid and to which a modification reducing the branched-chain amino acid transporter production capacity is applied may be a microorganism that inherently contains: a polynucleotide capable of encoding a protein comprising an amino acid sequence having at least 70% homology with SEQ ID NO. 9; or a polynucleotide comprising a base sequence of SEQ ID NO. 1, or a base sequence having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the base sequence of SEQ ID NO. 1.
[0181]
[0182] The microorganism of the present application may include a microorganism in which branched-chain amino acid transporter activity is reduced relative to intrinsic activity by any one of various known methods.
[0183] For example, the microorganism in which the branched-chain amino acid transporter activity of the present application is reduced compared to the intrinsic activity may be a microorganism in which the sequence of the brnQ gene expression regulatory region is modified and / or, the branched-chain amino acid transporter coding polynucleotide of the brnQ gene is modified (e.g., part or all of the said sequence is deleted), but is not limited thereto. Specifically, the microorganism may be a microorganism in which the branched-chain amino acid transporter is inactivated or not expressed due to a deletion of all or part of the nucleotide sequence of SEQ ID NO. 1, or in which the activity of the branched-chain amino acid transporter is weakened due to a deletion of part of the nucleotide sequence of SEQ ID NO. 1. In addition, the microorganism may be a microorganism in which the start codon coding sequence of the nucleotide sequence of SEQ ID NO. 1 is modified to GTG or TTG, thereby reducing the expression of the branched-chain amino acid transporter and weakening its activity, but is not limited thereto.
[0184] For example, a microorganism of the present application whose branched-chain amino acid transporter activity is reduced relative to its intrinsic activity may include a portion of the nucleotide sequence of SEQ ID NO. 1, and may have a weakened branched-chain amino acid transporter activity corresponding to the amino acid formed by SEQ ID NO. 9, or may not exhibit said branched-chain amino acid transporter activity. However, it is not limited thereto.
[0185] For example, the microorganism with increased 5'-inosinic acid production capacity of the present application may be a microorganism with increased 5'-inosinic acid production capacity compared to the parent microorganism (parent strain) before mutation or the non-mutated microorganism, but is not limited thereto. For example, the parent microorganism (parent strain) before mutation or the non-mutated microorganism for comparing whether the 5'-inosinic acid production capacity has increased may be the ATCC6872 strain, the KCCM12151P strain, or the KCCM12137P strain, but is not limited thereto.
[0186] For example, the microorganism with increased 5'-inosinic acid production capacity may be increased by about 0.01% or more, specifically about 0.1% or more, about 0.2.5% or more, about 0.5% or more, about 0.6% or more, about 0.7% or more, about 0.8% or more, about 0.9% or more, about 1% or more, about 2% or more, about 3% or more, about 4% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, or about 10% or more compared to the 5'-inosinic acid production capacity of the parent microorganism (parent strain) or non-modified microorganism before mutation, but is not limited thereto as long as it has a positive increase amount compared to the production capacity of the parent microorganism (parent strain) or non-modified microorganism before mutation. There are no specific restrictions on the upper limit of the above production increase, and it may be, for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, or about 15% or less, but is not limited thereto.
[0187]
[0188] As a microorganism according to any one of the aforementioned embodiments, the microorganism of the genus Corynebacterium of the present application is Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium It may be Corynebacterium ammoniagenes, Corynebacterium thermoaminogenes, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens. As another example, the microorganism of the present application may be a Corynebacterium sp. classified as the genus Corynebacterium but not classified as a subspecies.As another example, the microorganism of the present application may include microorganisms classified into the genus Brevibacterium, which are Coryneform bacteria, such as Brevibacterium flavum and Brevibacterium lactofermentum.
[0189] Specifically, the microorganism of the present application may be Corynebacterium stationis.
[0190] Meanwhile, Corynebacterium stationis is of the same species as Brevibacterium ammoniagenes and was classified as belonging to the same taxon as Corynebacterium ammoniagenes and Brevibacterium stationis (International Journal of Systematic and Evolutionary Microbiology 60: 874-879). Additionally, the aforementioned Brevibacterium ammoniagenes was renamed Corynebacterium stationis.
[0191] Accordingly, in this application, the terms Corynebacterium stationary, Brevibacterium stationary, Corynebacterium ammoniagenes, and Brevibacterium ammoniagenes may be used interchangeably.
[0192]
[0193] Although it is already known that microorganisms of the genus Corynebacterium possess a 5'-inosinic acid production pathway, their production capacity is significantly low, and the genes acting on the production mechanism or the mechanism principles have not all been elucidated. Therefore, the microorganisms of the genus Corynebacterium having 5'-inosinic acid production capacity of the present application may include the natural wild-type microorganism itself, a microorganism of the genus Corynebacterium that has acquired enhanced 5'-inosinic acid production capacity by increasing or decreasing the activity of genes related to the 5'-inosinic acid production mechanism, or a microorganism of the genus Corynebacterium that has acquired enhanced 5'-inosinic acid production capacity by introducing or increasing the activity of external genes.
[0194]
[0195] The microorganism having 5'-inosinic acid production ability of the present application may further include additional modifications that increase 5'-inosinic acid production ability.
[0196] For example, to enhance the 5'-inosinic acid biosynthetic pathway, the activity of genes of the competing pathway, 5'-inosinic acid influx and / or degradation genes may be weakened or inactivated; and / or the activity of 5'-inosinic acid efflux proteins may be increased, resulting in a microorganism with enhanced 5'-inosinic acid production capacity, but is not limited thereto.
[0197] In this application, the term "5'-inosine effluxing protein" refers to a protein involved in effluxing 5'-inosine monophosphate (IMP) out of the cell. For the purposes of this application, the term may be used interchangeably with proteins having IMP effluxing ability, proteins having 5'-inosine effluxing ability, 5'-inosine effluxing protein, etc. Specifically, it may be represented as ImpE, and more specifically as ImpE1, ImpE2, but is not limited thereto. Furthermore, the protein may be derived from the genus Corynebacterium, specifically from Corynebacterium stationaris, but is not limited thereto. For example, it is obvious that a protein derived from Corynebacterium stationaris and having 5'-inosine effluxing ability and corresponding activity can be used as the protein of this application.
[0198] Examples of the 5'-inosinate-releasing proteins applicable to the present application are disclosed in U.S. Publication No. US 2020-0377917 A1, U.S. Publication No. US 2019-0284595 A1, U.S. Publication No. US 2020-0377558 A1, U.S. Publication No. US 2020-0377557 A1, U.S. Publication No. 2022-0348616 A1, U.S. Publication No. US 2023-0192780 A1, etc. The entire specifications of the above patents may be incorporated as reference material for the present application. Additionally, proteins having amino acid sequences in which some sequences are deleted, modified, substituted, or added, having the same or corresponding activity as the proteins described in the above patent specifications, are also included within the scope of the 5'-inosinate-releasing proteins applicable to the present application.
[0199]
[0200] Another aspect of the present application provides a method for producing 5'-inosinic acid, comprising the step of culturing a microorganism having the ability to produce 5'-inosinic acid in a medium, wherein the branched-chain amino acid transporter activity of the present application is reduced compared to the intrinsic activity.
[0201] In the method of the present application, any culture conditions and methods known in the art may be used for the culture of microorganisms. Such a culture process can be easily adjusted and used by a person skilled in the art depending on the microorganism selected.
[0202] The 5'-inosinic acid produced by the culture of the present application may be secreted into the medium or remain in the cell.
[0203]
[0204] In one embodiment, the method for producing 5'-inosinic acid of the present application may additionally include the step of preparing a microorganism of the present application, the step of preparing a medium for culturing said microorganism, or a combination thereof (in any order), for example, prior to the culturing step.
[0205] The method for producing 5'-inosinic acid according to the present application may further include a step of recovering a target substance, specifically 5'-inosinic acid, from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium. The recovery step may be additionally included after the culture step.
[0206] The above recovery may involve collecting the desired 5'-inosinic acid using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous, or fed-batch culture method. For example, various chromatographic methods such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting out), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC, or a combination thereof may be used, and the target substance, specifically 5'-inosinic acid, may be recovered from the culture medium or microorganism using a suitable method known in the art.
[0207] In addition, the method for producing 5'-inosinic acid according to the present application may additionally include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the method for producing 5'-inosinic acid according to the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.
[0208] In the method of the present application, the reduction of branched-chain amino acid transporter activity and 5'-inosinic acid, etc., are as described in the other embodiments above.
[0209]
[0210] Another aspect of the present application provides a composition for producing 5'-inosinic acid comprising a microorganism having the ability to produce 5'-inosinic acid, wherein the branched-chain amino acid transporter activity of the present application is reduced compared to the intrinsic activity, a culture of said microorganism, a fermented product of said microorganism, or a combination of two or more of these.
[0211] The composition of the present application may further include any suitable excipients commonly used in compositions for producing 5'-inosinic acid, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers or isotonic agents, but are not limited thereto.
[0212] In one specific example, each component present in the composition of the present application may be included in a microbiologically effective amount or in an amount that can be appropriately present in a composition for production.
[0213] In the composition of the present application, the reduction in branched-chain amino acid transporter activity and 5'-inosinic acid, etc., are as described in the other embodiments above.
[0214]
[0215] Another aspect of the present application provides a use of the 5'-inosinic acid production of microorganisms in which the branched-chain amino acid transporter activity of the present application is reduced relative to the intrinsic activity.
[0216] In the use of the present application, the reduction of branched-chain amino acid transporter activity and 5'-inosinic acid, etc., are as described in the other embodiments above.
[0217]
[0218] The present application will be explained in more detail below through examples. However, the following examples are merely preferred embodiments for illustrating the present application and are therefore not intended to limit the scope of the rights of the present application. Meanwhile, technical matters not described in this specification can be fully understood and easily implemented by a person skilled in the art who is proficient in the technical field of the present application or a similar technical field.
[0219]
[0220] Example 1: Production of branched-chain amino acid transporter brnQ-deficient microorganisms and verification of IMP production capacity
[0221] 1-1. Construction of brnQ gene deletion vector
[0222] Branched-Chain Amino Acid Transporters (brnQ) are pathways for the in- and out-of-cell movement of pyruvate-derived leucine, isoleucine, and valine. Accordingly, as an example, to produce a microorganism with reduced protein activity in an inosinic acid-producing strain, we intended to verify whether inosinic acid production capacity is enhanced by deleting the brnQ gene to secure the molecular chain amino acids released externally.
[0223] To delete the endogenous gene brnQ (sequence number 1) of Corynebacterium stationaryis, which encodes a branched-chain amino acid transporter, the plasmid pDC24 (sequence number 2, KR 10-2024-0167588 A) was constructed as follows.
[0224] The chromosomal genes of the wild-type strain ATCC6872 of Corynebacterium stationaryis were isolated using Intron’s G-spin Total DNA extraction mini kit (Cat. No. 17045) according to the protocol provided in the kit, and using this as a template, gene fragments (brnQ-1, brnQ-2) were obtained by polymerase chain reaction using primer pairs with sequences of SEQ ID NOs. 3 and 4 and primer pairs with sequences of SEQ ID NOs. 5 and 6, respectively. The conditions of the PCR method were as follows: denaturation at 94°C for 5 minutes, followed by denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, repeated 30 times, followed by polymerization at 72°C for 7 minutes.
[0225] The pDC24 vector was treated with smaI (New England Biolabs, Beverly, MA) and fusion cloned with the gene fragment (brnQ-1brnQ-2) obtained above. Fusion cloning was performed using the In-Fusion® HD Cloning Kit (Clontech). The prepared vector was named pDC24-△brnQ.
[0226] The sequences of the primers used for vector construction are as follows.
[0227] SEQ ID NO: NAME Sequence (5'→3')3brnQ-LFAATTCGAGCTCGGTACCCGGCGAATCCTTATAACCCAC4brnQ-LRGTTCCCCAGCCCTGTGGCACCAAAGAACATCGAAA5brnQ-RFATGTTCTTTGGTGCCACAGGGCTGGGGAACAAATA6brnQ-RRCGACTCTAGAGGATCCCCAAGTGCGACGCGAAAGCATA
[0228]
[0229] 1-2. Production of brnQ gene-deficient strains
[0230] To determine whether the deletion of the brnQ gene, which is one of the factors reducing branched-chain amino acid transporter activity, could lead to an increase in IMP production, experiments were conducted to delete the brnQ gene in Corynebacterium stationaryis KCCM12151P and KCCM12137P (US 2020-0377917 A1) as examples of IMP-producing strains.
[0231] After transforming Corynebacterium stationaryis KCCM12151P and KCCM12137P (IMP-producing strains) with the pDC24-△brnQ vector prepared in 1-1 above by electroporation, strains with the vector inserted into the chromosome were selected as primary candidates in a screening medium containing 25 mg / L of kanamycin. Subsequently, strains with a deleted brnQ gene were selected from the homologous recombination strains using the primer pair of SEQ ID NO. 7 and SEQ ID NO. 8. The selected strains were confirmed to have a deletion of some amino acids in the branched-chain amino acid transporter encoded by the brnQ gene, including the gene sequence of SEQ ID NO. 10, and these strains were named CJI-3568 and CJI-3679.
[0232] Sequence No. Name Sequence (5'→3')7brnQ-CFATCGACCGCATCGCCACTGC8brnQ-CRAGTAGCGTGTCGCCTGCTCT
[0233]
[0234] 1-3. Evaluation of 5'-inosinic acid production capacity of brnQ gene-deficient strains
[0235] To measure the 5'-inosinic acid production capacity of the CJI-3568 and CJI-3679 strains prepared in Examples 1-2 above, a flask potency evaluation was performed. Corynebacterium stationaryis KCCM12151P, CJI-3568, KCCM12137P, and CJI-3679 were inoculated into 14 ml tubes containing 3 ml of the following seed medium, respectively, and cultured at 30°C for 24 hours with shaking at 170 rpm. 2 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 29 ml of the following production medium (24 ml of main medium + 5 ml of separate sterile medium), and cultured at 30°C for 72 hours with shaking at 170 rpm. After the culture was completed, the production of 5'-inosinic acid was measured by the HPLC method.
[0236] The composition of the above seed medium and fermentation medium is as follows.
[0237]
[0238] <IMP 종배지>
[0239] Glucose 1%, Peptone 1%, Meat Juice 1%, Yeast Extract 1%, Sodium Chloride 0.25%, Adenine 100 mg / L, Guanine 100 mg / L, pH 7.2
[0240]
[0241] <IMP 플라스크 발효배지(본배지)>
[0242] Sodium glutamate 0.1%, ammonium chloride 1%, magnesium sulfate 1.2%, calcium chloride 0.01%, iron sulfate 20 mg / L, manganese sulfate 20 mg / L, zinc sulfate 20 mg / L, copper sulfate 5 mg / L, L-cysteine 23 mg / L, beta-alanine 24 mg / L, nicotinic acid 8 mg / L, biotin 45 µg / L, thiamine hydrochloride 5 mg / L, adenine 30 mg / L, phosphoric acid (85%) 1.9%, glucose 4.2%, fructose 2.4%
[0243]
[0244] <IMP 플라스크 발효배지 (별도살균배지)>
[0245] Phosphoric acid (85%) 23.3 g / L, ammonia (28%) 16.25 g / L, potassium hydroxide 25.5 g / L
[0246]
[0247] The culture results of IMP-producing strains Corynebacterium stationaryis KCCM12151P, KCCM12137P, and brnQ-deficient strains derived from them are shown in Table 3 below.
[0248] Comparison of 5'-Inosinic Acid Production Capacity Due to brnQ Deficiency Strain No. | Introduction Type | ODIMP (g / L) | Concentration Increase Rate (%) KCCM12151P | Control | 37.8 | 4.2 -CJI | 3568 KCCM12151P | △brnQ | 38.1 | 4.6 | 9.5 KCCM12137P | Control | 38.0 | 5.1 -CJI | 3679 KCCM12137P | △brnQ | 38.2 | 5.5 | 7.8
[0249] As shown in Table 3, when the brnQ gene was deleted, the 5'-inosinic acid production capacity increased to 9.5% and 7.8% compared to the control group, confirming that weakening BrnQ activity can be usefully applied to 5'-inosinic acid production.
[0250]
[0251] Example 2: Production of microorganisms with weakened branched-chain amino acid transporter expression and confirmation of IMP production capacity
[0252] 2-1. Construction of brnQ gene initiation codon modification vector
[0253] As an example, to construct a microorganism with reduced branched-chain amino acid transporter activity in an inosinic acid-producing strain, we modified the start codon of the brnQ gene to secure externally released branched-chain amino acids and investigated whether inosinic acid production capacity is enhanced.
[0254] To modify the start codon of the endogenous gene brnQ (Sequence No. 1) of Corynebacterium stationaryis encoding a branched-chain amino acid transporter, the plasmid pDC24 (Sequence No. 2) was constructed as follows.
[0255] The chromosomal genes of the wild-type strain ATCC6872 of Corynebacterium stationaryis were isolated using Intron’s G-spin Total DNA extraction mini kit (Cat. No. 17045) according to the protocol provided in the kit, and using this as a template, gene fragments (brnQ-3, brnQ-4) were obtained by polymerase chain reaction using primer pairs with sequences of SEQ ID NOs. 11 and 12 and primer pairs with sequences of SEQ ID NOs. 13 and 14, respectively. The conditions of the PCR method were as follows: denaturation at 94°C for 5 minutes, followed by denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, repeated 30 times, followed by polymerization at 72°C for 7 minutes.
[0256] The pDC24 vector was treated with smaI (New England Biolabs, Beverly, MA) and fusion cloned with the gene fragments (brnQ-3, brnQ-4) obtained above. Fusion cloning was performed using the In-Fusion® HD Cloning Kit (Clontech). The prepared vector was named pDC24-brnQ(a1g).
[0257] The sequences of the primers used for vector construction are as follows.
[0258] SEQ ID NO NAME Sequence (5'→3')11brnQ-LF2AATTCGAGCTCGGTAcccGATGGCGTCGGAACCTTAGG12brnQ-LR2CGACGGTGTCAGACAcTGAAGTGCCCGTCCTTTGG13brnQ-RF3AGGACGGGCACTTCAgTGTCTGACACCGTCGCGTC14brnQ-RR3ctctagaggatccccAGAGCTGGAGTCAAAAAGCG
[0259]
[0260] 2-2. Production of strains with modified brnQ gene start codons
[0261] To determine whether weakening of the brnQ gene activity, which is one of the branched-chain amino acid transporter activities, could lead to an increase in IMP production, experiments were conducted to modify the start codon of the brnQ gene on Corynebacterium stationaryis KCCM12151P and KCCM12137P (US 2020-0377917 A1) as examples of IMP-producing strains.
[0262] The pDC24-brnQ(a1g) vector prepared in 2-1 above was transformed into Corynebacterium stationaryis KCCM12151P and KCCM12137P (IMP-producing strains), respectively, by electroporation, and strains with the vector inserted into the chromosome were selected as primary candidates in a screening medium containing 25 mg / L of kanamycin. Subsequently, from the strains in which homologous recombination occurred, strains in which the start codon of the brnQ gene was changed to GTG were selected using the primer pair of SEQ ID NO. 15 and SEQ ID NO. 16. It was confirmed that the start codon of the branched-chain amino acid transporter encoded by the brnQ gene in the selected strains was changed from ATG to GTG (SEQ ID NO. 17), and these strains were named CJI-3675 and CJI3680.
[0263] Sequence No. Name Sequence (5'→3')15brnQ-CF2TCGACCTATCTTTTGTGGTTG16brnQ-CR2GCGACGGTGTCAGACAc
[0264]
[0265] 2-3. Evaluation of 5'-inosinic acid production capacity of brnQ gene start codon-weakened strains
[0266] To measure the 5'-inosinic acid production capacity of the CJI-3675 and CJI-3680 strains prepared in Example 2-2 above, a flask potency evaluation was performed. Corynebacterium stationaryis KCCM12151P, CJI-3675, KCCM12137P, and CJI-3680 were inoculated into a 14 ml tube containing 3 ml of the following seed medium and cultured at 30°C for 24 hours with shaking at 170 rpm. 2 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 29 ml of the following production medium (24 ml of main medium + 5 ml of separate sterile medium) and cultured at 30°C for 72 hours with shaking at 170 rpm. After the culture was completed, the production of 5'-inosinic acid was measured by the HPLC method.
[0267] The composition of the above seed medium and fermentation medium is as follows.
[0268]
[0269] <IMP 종배지>
[0270] Glucose 1%, Peptone 1%, Meat Juice 1%, Yeast Extract 1%, Sodium Chloride 0.25%, Adenine 100 mg / L, Guanine 100 mg / L, pH 7.2
[0271]
[0272] <IMP 플라스크 발효배지(본배지)>
[0273] Sodium glutamate 0.1%, ammonium chloride 1%, magnesium sulfate 1.2%, calcium chloride 0.01%, iron sulfate 20 mg / L, manganese sulfate 20 mg / L, zinc sulfate 20 mg / L, copper sulfate 5 mg / L, L-cysteine 23 mg / L, beta-alanine 24 mg / L, nicotinic acid 8 mg / L, biotin 45 µg / L, thiamine hydrochloride 5 mg / L, adenine 30 mg / L, phosphoric acid (85%) 1.9%, glucose 4.2%, fructose 2.4%
[0274]
[0275] <IMP 플라스크 발효배지 (별도살균배지)>
[0276] Phosphoric acid (85%) 23.3 g / L, ammonia (28%) 16.25 g / L, potassium hydroxide 25.5 g / L
[0277]
[0278] The culture results of strains with modified brnQ gene start codons in IMP-producing strains Corynebacterium stationaryis KCCM12151P and KCCM12137P are shown in Table 6 below.
[0279] Comparison of 5'-Inosinic Acid Production Ability Following Modification of the brnQ Gene Initiation Codon Strain No. | Introduction Type | ODIMP (g / L) | Concentration Increase Rate (%) KCCM12151P | Control | 37.8 | 4.2 -CJI | 3675 KCCM12151P | brnQ(gtg) | 38.0 | 4.4 | 4.8 KCCM12137P | control | 38.1 | 4.9 -CJI | 3680 KCCM12137P | bnrQ(gtg) | 38.3 | 5.2 | 6.1
[0280] As shown in Table 6, when the expression of the brnQ gene was weakened by changing the start codon, the 5'-inosinic acid production capacity increased to 4.8% and 6.1% compared to the control group, confirming that weakening BrnQ activity can be useful for 5'-inosinic acid production.
[0281]
[0282] The following table summarizes the brnQ sequences disclosed in this application.
[0283] 서열번호이름서열 (5'->3')1brnQCTTTCCGCGGGCTCGATGCCGTTATGGCCGTTGCGGTTCCATTCATCGTCTTCTTGTACCCACCAGCGATCACCTTGATCGTGCTGACTTTGGTGCAGCCACTGGTACGCAAGGTCGTTGGTTTCTACTGGACCTACCGCCTGGCGCTGTGGACCTCAGTCATCTGGTCGGCACTGACAACCATCGCCGCACAGGGCTGGGGAACAAATATCTTGGAACCGGTGTTGAACCTATCGCCGGGTCAGGATTTGGACTTAGGCTGGATTACGCCTACCTTCATCGTCATCATCATTGGTGTCGTTATTGATATCGCCACCAAGAATGCACGACGTGAGGCCGTCTAG9BrnQ (AA)MSDTVASAPAKSKVPSPLLTIVIASLTLFSMFFGAGNLIFPPMVGVSSGTNFWPAIIGFLIAGVLLPVAAIVAVAISGYSVRDLAARGGVFFGVIFSVMAYLSIGAFYALPRTGAVAMETAVTPLVGWEGTAANGIFNLIFFGIALALSWKKNSVIDVLGRFLTPALVILLIALICLAIFNYERLPGAPTEDYSSTPMVTGLFEGYNTMDAIAGLAFGIVIIGSLRAKGFGSGGTLVRSTVLTGVIAGVLLAGIYLGLGYMAQTVPNGQSYESGAALLADSANLTMGTPGQTIFSLIVILACLTTAVGLISATSAFFNTLVPKLSYHVWAIIFTVLSIAIAFRGLDAVMAVAVPFIVFLYPPAITLIVLTLVQPLVRKVVGFYWTYRLALWTSVIWSALTTIAAQGWGTNILEPVLNLSPGQDLDLGWITPTFIVIIIGVVIDIATKNARREAV
[0284] From the foregoing description, those skilled in the art to which this application pertains will understand that this application may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this application should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.
Claims
1. Microorganisms of the genus Corynebacterium that produce 5'-inosine monophosphate (IMP), with branched-chain amino acid transporter activity reduced relative to intrinsic activity.
2. A microorganism according to claim 1, wherein the branched-chain amino acid transporter is composed of the amino acid sequence of SEQ ID NO.
9.
3. In claim 1, the microorganism is a microorganism of the genus Corynebacterium having a deletion in part or all of the gene encoding a branched-chain amino acid transporter.
4. In claim 1, the microorganism is a microorganism of the genus Corynebacterium in which the expression of a gene encoding a branched-chain amino acid transporter is weakened.
5. In paragraph 1, the microorganism is a microorganism that is Corynebacterium stationis.
6. In paragraph 1, the microorganism is one in which the 5'-inosinic acid production capacity is increased compared to a non-modified microorganism.
7. In paragraph 1, the microorganism is further a microorganism in which the activity of the 5'-inosinic acid effluxing protein is enhanced.
8. In claim 7, the enhancement of the activity of the above 5'-inosinic acid effluxing protein is (1) Increase in the intracellular copy number of protein-coding polynucleotides; (2) Modification of the gene expression regulatory region on the chromosome that codes for a protein; (3) Modification of the amino acid sequence of the above protein to increase protein activity; (4) Modification of the polynucleotide sequence encoding the protein to increase protein activity; (5) Introduction of a foreign protein that exhibits protein activity or a foreign polynucleotide encoding the same; or Microorganisms that are one or more combinations selected from (1) to (5) above.
9. A microorganism according to claim 7, wherein the enhancement of the activity of the 5'-inosinic acid effluxing protein is the substitution of the gene promoter on the chromosome encoding the protein with a strong promoter.
10. A method for producing 5'-inosinic acid, comprising the step of culturing a microorganism of the genus Corynebacterium in a medium having branched-chain amino acid transporter activity reduced relative to its intrinsic activity.
11. The method of claim 10, further comprising the step of recovering 5'-inosinic acid from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium.
12. In paragraph 10, the microorganism is Corynebacterium stationis.
13. A method according to claim 10, wherein the microorganism further has enhanced activity of 5'-inosinic acid effluxing protein.
14. A composition for producing 5'-inosinic acid comprising a microorganism of the genus Corynebacterium having reduced branched-chain amino acid transporter activity compared to its intrinsic activity, a culture of said microorganism, a fermented product of said microorganism, or a combination of two or more of these.
15. Use of 5'-inosinic acid production by microorganisms of the genus Corynebacterium with reduced branched-chain amino acid transporter activity relative to intrinsic activity.