A molecular marker related to chicken muscle inosinic acid content character and its breeding application method

Abstract

The application discloses a molecular marker related to a chicken meat inosinic acid content character and a breeding application method thereof, and belongs to the technical field of molecular breeding. The InDel molecular marker corresponds to the sequence information of a chicken reference genome Gallus_gallus-6.0 version sequence information No. 5 chromosome 14,447,547 bp (genotype CTGAAACTGAAA, CTGAAAC, CC). Here, the base is the advantageous genotype of the CTGAAACTGAAA genotype of the site, and the inosinic acid content of the individual carrying the site is significantly higher than that of the individual carrying the CC genotype. Molecular assisted breeding using the molecular marker can realize screening of high inosinic acid individuals at an early stage, effectively reduce production costs, promote genetic improvement progress, and has high economic benefits and application value.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology, specifically relating to a molecular marker related to the inosinic acid content trait in chicken meat and its selection and application method. Background Technology

[0002] As people's living standards improve, chicken quality has gradually become a key focus for producers. Inosinic acid, a key flavor nucleotide that influences the taste of chicken, has a significant impact on its umami and texture. Recent studies have found that inosinic acid content is closely related to chicken flavor, and its synthesis process is regulated by various genetic factors.

[0003] Inosinic acid (IAA) content in chicken is a trait with low to medium heritability, generally ranging from 0.15 to 0.30, indicating that genetic selection can effectively increase IAA content, thereby improving the flavor and quality of chicken meat. Traditional breeding methods have certain limitations. Therefore, using marker-assisted selection (MAS) to improve IAA content in chicken has become an important direction in broiler breeding. Genome-wide association analysis (GWAS) has been widely used to reveal the genetic relationship between phenotype and genotype, identifying several candidate gene loci associated with IAA content. These loci, including single nucleotide polymorphisms (SNPs) and insertion / deletion (InDel) variations, are potential targets for improving chicken flavor and meat quality. Recent studies have also shown that specific SNPs or InDel loci affect key enzyme genes in the IAA synthesis pathway, thus influencing IAA synthesis and metabolism. These findings provide new research directions for improving chicken IAA content through molecular markers. Summary of the Invention

[0004] The purpose of this invention is to identify genetic variations related to inosinic acid content, provide a basis for early selection of chicken inosinic acid content traits, save production costs and accelerate genetic progress, and promote precision breeding of chicken flavor quality by providing a molecular marker related to chicken inosinic acid content traits and its selection and application method.

[0005] To solve the above-mentioned technical problems, the basic concept of the technical solution of this invention is as follows: Based on the needs of breeding and production practices, a group of Beijing Oil Chickens of the same batch and market age (135 days old) are selected. During the rearing process, free access to feed and water is provided, and the diet is based on the feeding standards for yellow-feathered broilers (NY / T33). (2004). Post-slaughter, the inosinic acid content in pectoral muscle was measured. Genome-wide association analysis was performed using whole-genome resequencing data to screen and identify genetic variations that significantly affect inosinic acid content in chickens. This provides technical support for early selection of inosinic acid content and the breeding of high-quality broiler breeds.

[0006] Increasing inosinic acid (IAA) content in production faces numerous challenges, primarily due to its susceptibility to various genetic and environmental factors. Large-scale assays are an effective strategy to improve the accuracy of phenotypic data and uncover potential genetic variations. Furthermore, deep whole-genome resequencing can efficiently reveal genetic variations associated with IAA content. Association analysis combining phenotypic and whole-genome sequencing data can help identify reliable molecular markers, thus supporting precise breeding for chicken flavor quality.

[0007] Specifically, the technical solution of the present invention is as follows:

[0008] A molecular marker related to the inosinic acid content of chicken meat, wherein the inosinic acid content refers to the amount of inosinic acid obtained by homogenizing chicken breast muscle samples, using high performance liquid chromatography (HPLC) combined with ultraviolet detection, and quantitative analysis by external standard method.

[0009] The InDel molecular marker is chr5:14447547, which contains a nucleotide sequence with a polymorphism of CTGAAA / C at positions 14,447,547 bp on chicken chromosome 5.

[0010] The physical locations of the above molecular markers are based on the chicken reference genome Gallus_gallus-6.0 version.

[0011] In this invention, the genotype of the molecular marker chr5:14447547 showed a significant correlation with the inosinic acid content in chicken meat. Specifically, the inosinic acid content in chicken samples was highest when individuals carried the CTGAAACTGAAA genotype; moderate when individuals carried the CTGAAAC genotype; and lowest when individuals carried the CC genotype.

[0012] The present invention also provides primers for amplifying the above-mentioned molecular markers.

[0013] In this invention, the specific primer sequences for amplifying molecular markers are shown in SEQ ID NO.1-2:

[0014] SEQ ID NO.1: TCTGCACAGATGAGGGAGAG;

[0015] SEQ ID NO. 2: GCTCAAGCCTCATACCTTCTT.

[0016] The present invention also provides a reagent or kit containing the above-mentioned primers.

[0017] The molecular markers, primers, reagents, or kits provided by this invention can be used in any of the following applications:

[0018] (1) Application in early prediction of inosinic acid content in chicken meat;

[0019] (2)(2) Application in chicken genetic resource identification, flavor improvement or molecular marker-assisted breeding;

[0020] The inosinic acid content of chicken meat refers to the amount of inosinic acid obtained by quantitative analysis using HPLC combined with ultraviolet detection and external standard method after homogenizing chicken breast muscle samples.

[0021] This invention also provides a molecular marker-assisted breeding method for high-quality chickens, comprising:

[0022] (1) Extract genomic DNA from the chickens to be tested;

[0023] (2) Using DNA as a template, perform PCR amplification using the primers described above;

[0024] (3) Analyze the PCR amplification products to determine the genetic potential of chickens for breeding and propagation.

[0025] In this invention, step (3) includes: performing allele detection on the amplification products, and determining the following based on the genotyping results:

[0026] The genotype of the polymorphic site contained in the molecular marker chr5:14447547 is CTGAAACTGAAA, indicating that the chicken meat of the tested chicken has a high level of inosinic acid.

[0027] The present invention has the following beneficial effects:

[0028] The molecular marker-assisted breeding method for chicken inosinic acid content of this invention can effectively increase the inosinic acid content in chicken breast muscle by determining the genotype of the InDel locus in the chicken to be tested, thereby improving the flavor and quality of chicken meat and helping to meet consumer demand for meat quality. Compared with traditional meat quality assessment methods, molecular markers related to chicken inosinic acid content can accurately identify genetic loci at an early stage, avoiding later slaughter and meat quality testing. This provides a scientific basis for breeding high-quality yellow-feathered broilers, has significant application value, significantly improves the economic benefits of the broiler industry, and accelerates genetic progress in breeding. Attached Figure Description

[0029] Figure 1This is a Manhattan plot of genome-wide association analysis (GWAS) for the inosine monophosphate trait in Beijing You chickens on chromosome 5, according to a preferred embodiment of the present invention. The X-axis of the Manhattan plot represents chromosomes 1–28, and the Y-axis represents the significance level (-log10(P)). A total of 1,178,454 loci were analyzed for the InDel variant, with a suggested significance threshold of -log10(1 / 1,178,454) = 6.21 and a significance threshold of -log10(0.05 / 1,178,454) = 7.51. Loci exceeding the corresponding thresholds were considered significantly associated with the inosine monophosphate trait. The QQ plot on the right represents the goodness of fit between the observed and expected values.

[0030] Figure 2 This is a box plot comparing the differences in inosinic acid content among different genotypes of chr5:14447547 in this invention.

[0031] Figure 3 This is a box plot comparing the differences in inosinic acid content among different genotypes of the Wenchang chicken population chr5:14447547.

[0032] Figure 4 This is a dual-luciferase reporter result graph. The wild-type homozygous genotype of the InDel molecular marker chr5:14447547 is CTGAAACTGAAA, and the mutant homozygous genotype is CC. When CTGAAACTGAAA mutates to CC... MOB2 Gene promoter activity is reduced, and inosine monophosphate content is reduced.

[0033] Figure 5 This is an analysis of the population differentiation index (Fst) of the genomic data of Beijing Youji and Wenchang chickens.

[0034] Figure 6 A comparison of inosinic acid content in Beijing oil chicken and Wenchang chicken. Detailed Implementation

[0035] To make the objectives, technical solutions, and effects of this invention clearer, the technical solutions of this invention are described in detail below with reference to specific examples. It should be understood that the specific embodiments described herein are only for explaining this invention and are not intended to limit this invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available reagents and materials.

[0036] Detailed information on the molecular markers of this invention is shown in Table 1, and primer information is shown in Table 2.

[0037] Table 1. Detailed information on molecular markers

[0038]

[0039] Table 2 Primer Information

[0040]

[0041] The detection of the above molecular marker site genotypes can be performed using the genome of the chicken to be tested as a template. After PCR amplification using the primers (SEQ ID NO. 1-2) in Table 2, allele detection and sequencing of the amplification primers can be performed using direct sequencing or other effective methods.

[0042] The PCR reaction program was as follows: 94℃ for 5 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 1 min, for a total of 35 cycles; 72℃ for 5 min. The PCR reaction volume (20 μl) consisted of: 10 pg-1 μg template DNA, 0.5 μl upstream primer, 0.5 μl downstream primer, 10 μl 2×Taq PCR MasterMix, and ddH2O to a final volume of 20 μl.

[0043] Example 1. GWAS analysis to identify InDel loci associated with inosine monophosphate content in pectoral muscles

[0044] This invention used 389 Beijing Oil Chickens, all from the Changping Experimental Base of the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences. During the rearing process, they were provided with free access to feed and water, and their diet was based on the feeding standards for yellow-feathered broiler chickens (NY / T33). (2004). The inosinic acid content in the pectoral muscle was determined by HPLC after slaughter at 135 days of age. The phenotypic description is shown in Table 3.

[0045] Table 3. Phenotypic descriptive statistics of inosinic acid content

[0046]

[0047] DNA extraction

[0048] Collect 0.5 mL of venous blood from the wings of all test chickens using blood collection tubes, and use standard phenol. Whole-genome DNA was extracted using the chloroform method. The concentration and purity of the DNA samples (OD values: OD260 / 280, OD260 / 230) were accurately determined using a Nanodrop 2000 / 2000C nucleic acid and protein analyzer. DNA samples that passed the initial test were then subjected to 0.7% agarose gel electrophoresis to assess their purity and integrity. The DNA samples were then sent to BGI Genomics Co., Ltd. in Shenzhen for whole-genome resequencing.

[0049] The genotypic data of 442 individuals were processed using PLINK v1.9 software for quality control. The quality control criteria were: locus detection rate (geno) > 0.90; minimum allele frequency (MAF) > 0.05; individual detection rate (mind) > 0.90.

[0050] Ultimately, 438 individuals were retained, yielding 1,178,454 InDel loci. Based on the quality-controlled genomic data, genome-wide association analysis of the inosine monophosphate trait was performed using GEMMA software.

[0051] Specifically:

[0052]

[0053] Where y is the phenotypic vector, i.e., inosinic acid content; W is the indicator matrix for fixed effects, with the first column being 1 and subsequent columns representing fixed effects or covariate values; α is the coefficient vector for fixed effects; x is the genotype vector; β is the InDel / SNP effect; and u is the vector for random effects. The residual vector; MVN n Let be an n-dimensional multivariate normal distribution, where λ is the ratio of the two variance components. For residual variance, K is the kinship matrix calculated based on InDel, and I is... n It is an identity matrix.

[0054] GWAS analysis results are as follows Figure 1 As shown, the inosine nucleotide phenotype corresponds to the 0.24 Mb region on chromosome 5 (chr5:14,241,300). A significant association exists between 14,484,100 and other sites. Further site annotation was performed on all sites within the associated genome region, located in... MOB2 The intron region of the gene was ultimately identified as chr5: 14447547 as a key candidate site affecting inosine nucleotide traits.

[0055] A significant difference analysis of genotypes was performed on chr5: 14447547 by combining phenotypic data, see [link to data]. Figure 2 At the InDel locus on chromosome 5, individuals with the CTGAAACTGAAA genotype had the highest inosinic acid content, significantly higher than those with the CTGAAAC and CC genotypes. CTGAAACTGAAA is identified as the favorable genotype at this locus and can be used for early selection of the inosinic acid trait. Table 4 shows the dominant genotypes at this locus.

[0056] Table 4. Distribution of the InDel locus chr5: 14447547 CTGAAA / C genotype in the Beijing Oil Chicken population.

[0057]

[0058] Example 2. Verification of the effect of the molecular marker chr5: 14447547

[0059] (1) Contribution of chr5: 14447547 to genome-wide inosine nucleotide content phenotypic variation

[0060] The analysis process is as follows:

[0061] Based on the inosinic acid content phenotype and individual genotype of all individuals in the material population of this invention, a G matrix was constructed using GEMMA software;

[0062] Calculate PVE (equivalent to generalized heritability, based on the formula: genotype variance / phenotypic variance = Vg / Vp);

[0063] Perform Linear Mixed Model (LMM) analysis;

[0064] The GEMMA output results are used to calculate PVE (equivalent to generalized heritability, i.e., genotypic variance / phenotypic variance = Vg / Vp) using R4.0.4. The algorithm is as follows:

[0065]

[0066] The proportion of PVE at a locus to the total PVE in the genome is the locus contribution rate. In the population of materials used in this invention, the InDel / SNP loci have a high genetic interpretability, as shown in Table 5.

[0067] Table 5. Population-wide heritability

[0068]

[0069] (2) chr5: 14447547 MOB2 Contribution of gene and phenotypic effects

[0070] A dual-luciferase reporter gene was constructed using chr5: 14447547. The results are shown in [the table below]. Figure 4 After mutation at the InDel site (from the wild-type homozygous genotype CTGAAACTGAAA to the mutant homozygous genotype CC), the effect was significantly reduced. MOB2 The transcriptional activity of the gene promoter was reduced, and the inosinic acid content in chicken meat was significantly decreased. These results suggest that the chr5:14447547 site may promote transcriptional activity by inhibiting the inosinic acid content of the gene promoter. MOB2 The expression of [something] positively regulates the deposition of inosinic acid in chicken meat.

[0071] Example 3. Population validation of molecular markers

[0072] Three hundred and sixty Wenchang chickens were selected and slaughtered at 115 days of age. The inosinic acid content in their pectoral muscles was measured. Simultaneously, venous blood was collected, and genomic DNA was extracted for testing. DNA samples that passed the initial test were subjected to 0.7% agarose gel electrophoresis to determine their purity and integrity. The DNA samples were then sent to BGI Genomics Co., Ltd. in Shenzhen for whole-genome resequencing.

[0073] By combining phenotypes to perform a significant analysis of differences between genotypes, see [link to relevant documentation]. Figure 3 The genotype chr5: 14447547 was found to be beneficial and can be used to identify phenotypic differences in inosinic acid content among Wenchang chicken populations.

[0074] The genotype data of 360 individuals were processed for quality control using PLINK v1.9 software. The quality control standards were: locus detection rate (geno) > 0.90, minimum allele frequency (MAF) > 0.05, and individual detection rate (mind) > 0.90.

[0075] To further verify the genetic effect of the chr5:14447547 locus in the population, the inosinic acid content of the Beijing You chicken population was compared with that of the Wenchang chicken population. The results are as follows: Figure 5 As shown, the inosinic acid content in the Beijing You chicken population was significantly higher than that in the Wenchang chicken population. Population differentiation index (Fst) using genomic data of the Beijing You and Wenchang chickens revealed significant differentiation at the chr5:14447547 locus between the two breeds. Figure 6 ).

[0076] Genotyping of the two populations revealed that the frequency of the wild genotype CTGAAACTGAAA was significantly higher in Beijing You chickens than in Wenchang chickens, a result consistent with the trend of phenotypic differences (Table 6). The above population genetic evidence indicates that the chr5:14447547 locus is a key mutation that broadly affects the inosinic acid content of chicken meat flavor compounds. In breeding practice, auxiliary selection at this locus can be used to improve the flavor quality of chicken meat.

[0077] Table 6. Distribution of the InDel locus chr5: 14447547 CTGAAA / C genotype in the Wenchang chicken population.

[0078]

[0079] Example 4. Early breeding method for inosine monophosphate content trait using InDel molecular markers of the present invention.

[0080] All selected individuals had wing vein blood collected at approximately 28 days of age, and EDTA anticoagulant was added. The blood was then stored at -20°C for later use.

[0081] Genomic DNA was extracted using the salting-out method, dissolved in ddH2O, and its purity and concentration were determined by both agarose gel electrophoresis and ultraviolet spectrophotometry. The DNA was then diluted to a concentration of 50 ng / μl.

[0082] Amplification was performed using the primers listed in Table 2 and the PCR reaction conditions described above. Allele sequencing of the amplified products was performed using direct sequencing to genotype the chr5:14447547 locus. Healthy male and female chickens with the CTGAAACTGAAA genotype were selected for breeding based on the genotyping results.

[0083] Each genotype should have at least 30 roosters, with a male-to-female ratio of at least 1:3, for breeding. Record the individual number of each rooster to establish a pedigree. After raising them to 30 weeks of age and reaching peak egg production, mate healthy roosters and hens with the favorable genotypes at the above-mentioned loci. Inbreeding within three generations should be avoided during mating. Record the individual numbers of the mated roosters and hens to establish a complete pedigree file.

[0084] At least one offspring hen was randomly selected from each family, and a total of 50 chickens were slaughtered from each purebred line. All 100 selected individuals were slaughtered at market age, and the right pectoral muscle was collected to measure the inosinic acid content. The inosinic acid content at the chr5:14447547 locus genotype frequency was statistically analyzed after breeding.

[0085] This invention provides a molecular marker associated with inosinic acid content in chicken meat and its selection and application method, including: identifying the key InDel site chr5: 14447547 on chicken chromosome 5 through GWAS analysis, a method for detecting this mutation site, and a technical solution for marker-assisted selection of broiler chickens based on the genotype of this site. This invention provides a new approach to marker-assisted selection related to inosinic acid content in chicken meat.

[0086] The above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the protection scope of the present invention.

Claims

1. An InDel molecular marker associated with inosine acidity in broiler chickens, characterized in that: The fragment sequence of the InDel molecular marker is GGCAGTTATTCAGAG C The InDel molecular marker TGTAGCTTCTGTCAT is located at chromosome 5, 14,447,547 bp, in the Gallus_gallus-6.0 version of the chicken reference genome published in NCBI. The variant type is a sequence polymorphism of the CTGAAA fragment and the base C. There are three genotypes: CTGAAA / CTGAAA, CTGAAA / C, and C / C. Among them, the inosinic acid content of the CTGAAA / CTGAAA genotype is significantly higher than that of the CTGAAA / C and C / C genotypes.

2. A specific primer pair for detecting the InDel molecular marker as described in claim 1, characterized in that, The upstream and downstream primer sequences of the primer pair are shown in SEQ ID NO.1-2, respectively; TCTGCACAGATGAGGGAGAG (SEQ ID NO.1); GCTCAAGCCTCATACCTTCTT (SEQ ID NO. 2).

3. A reagent or kit containing the primer pair as described in claim 2.

4. A method for detecting chicken inosine acidity, characterized in that, The inosine monophosphate content of the CTGAAA / CTGAAA genotype was significantly higher than that of the CTGAAA / C and C / C genotypes when the InDel molecular marker as described in claim 1 was detected in the chicken samples to be tested.

5. The method according to claim 4, characterized in that, Includes the following steps: (1) Extract genomic DNA from the chickens to be tested; (2) Detect the genotype of the InDel molecular marker at positions 14, 447, and 547 on chicken chromosome 5; (3) PCR amplification is performed using the primer pair described in claim 2 to obtain the amplification product; (4) The alleles of the obtained PCR amplification products were sequenced by direct sequencing. (5) Based on the sequencing results, determine the genotype of the chicken to be tested; 6. Any application of the InDel molecular marker of claim 1 or the reagent or kit of claim 3: (1) Application in early prediction of inosinic acid content in chicken meat; (2) Application in flavor improvement or molecular marker-assisted breeding of chicken genetic resources; 7. The application as described in claim 6, characterized in that, Genotypes at 14,447,547 bp on chromosome 5 of the chicken reference genome Gallus_gallus-6.0 were detected. Individuals carrying the CTGAAA / CTGAAA genotype had higher levels of inosinic acid.

Images