Method for producing biocatalytically active particles, biocatalytically active particles that can be obtained using the method, and use of the biocatalytically active particles that can be obtained using the method
The method of producing biocatalytically active particles through peptide hydrogel formation addresses the limitations of enzyme immobilization by achieving high enzyme loading and defined geometry, ensuring efficient catalytic activity and control over particle properties, suitable for batch and continuous flow systems.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- KARLSRUHER INST FUR TECH
- Filing Date
- 2025-12-18
- Publication Date
- 2026-07-09
AI Technical Summary
Existing methods for enzyme immobilization are limited by the available effective surface area, which restricts the efficiency of the immobilization of enzymes, leading to the efficiency of the biocatalytic process, and the use of enzyme immobilization, which restricts the efficiency of biocatalytic processes, and the immobilization methods often require specific process conditions or do not offer sufficient control over particle sizes and properties, leading to a reduction in catalytic activity and stability.
A method for producing biocatalytically active particles by reacting an aqueous solution containing complementary binding peptides, forming droplets in an immiscible medium, and drying them to create stable, cross-linked peptide hydrogels with high enzyme loading and defined geometry, maintaining catalytic activity and allowing precise control over particle size and shape.
The method achieves high enzyme loading (>25% by mass) with maintained catalytic efficiency, enabling efficient use in batch and continuous flow systems, preventing unwanted cross-reactions, and reducing environmental impact and material consumption.
Smart Images

Figure IMGF000029_0001 
Figure IMGF000031_0001 
Figure IMGF000035_0001
Abstract
Description
[0001] Methods for producing biocatalytically active particles, biocatalytically active particles obtainable by the method, and use of the biocatalytically active particles obtainable by the method
[0002] The present invention relates to a method for producing biocatalytically active particles, biocatalytically active particles obtainable by the method, and the use of the biocatalytically active particles obtainable by the method.
[0003] Biocatalysis is an environmentally friendly and sustainable technology considered a key area of industrial ("white") biotechnology and is expected to have a tremendous impact on the development of a bio-based economy. In particular, bio-inspired, multi-step enzymatic cascade reactions are increasingly becoming the focus of research. Compartmentalized flow systems are required for the technical implementation of these reactions, preventing unwanted reaction overlaps and unproductive cross-reactions. While this has been successfully implemented in continuous flow chemistry for the synthesis of small molecules, the introduction of enzyme-based continuous biocatalysis processes is still significantly less developed. In this context, biocatalytically active particles with immobilized enzymes offer enormous potential.
[0004] Prior art methods exist for producing mesoporous spherical particles ranging in size from 100 pm to over 1000 pm for enzyme immobilization. These particles can be used, for example, in (bio)catalytic applications and can be produced using established technologies such as precipitation polymerization, the Stöber process (see W. Stöber, A. Fink, E. Bohn, Journal of Colloid and Interface Science 1968, 26, 62-69), and reverse microemulsion. These methods offer a wide range of materials and flexible process approaches, enabling the production of particles with specific properties.
[0005] However, effective surface immobilization techniques for enzymes are significantly more challenging than for conventional organic or organometallic catalysts. For example, many enzyme immobilization methods rely on binding enzymes to solid surfaces. The amount of immobilized enzyme is limited by the available effective surface area, which severely restricts the efficiency of biocatalytic processes. Therefore, enzyme immobilization presents particular challenges. Immobilization must preserve the natural catalytic activity of the enzymes while simultaneously ensuring their stability and reusability. Many existing methods, however, are difficult to scale up to industrial levels because they often require highly specific process conditions or do not offer sufficient control over the resulting particle sizes and properties.
[0006] Established methods such as physisorption, chemical cross-linking, or genetically encoded immobilization tags have demonstrated applicability; however, the amount of immobilized enzymes remains problematic due to the limited effective surface area. To overcome this limitation, pseudo-3D interfaces made of synthetic polymers or micro / nanoparticles have been used, for example, to increase the enzyme loading capacity (NR Mohamad, NH Marzuki, NA Buang, F. Huyop, RAWahab, Biotechnol. Equip. 2015, 29, 205-220; and M. Misson, H. Zhang, B. Jin, JR Soc. Interface 2015, 12, 20140891). However, this often leads to a reduction in the catalytic activity of the resulting biocatalytically active particles.
[0007] Other approaches, such as cross-linked enzyme aggregates (CLEAs) (RA Sheldon, Org. Process Res. Dev. 2011, 15, 213-223) and cross-linked enzyme crystals (CLECs) (US 5618710 A), utilize chemical crosslinkers like glutaraldehyde to create stable, immobilized enzyme structures. These methods are also often associated with losses in activity and require additional processing steps, which can impair practicality and efficiency.
[0008] The present invention is therefore based on the objective of providing a process for the production of biocatalytically active particles, biocatalytically active particles obtainable by the process, and the use of the biocatalytically active particles obtainable by the process, thereby overcoming the aforementioned disadvantages. A high peptide loading as well as a defined geometry and defined mechanical properties of the biocatalytically active particles are to be achieved.
[0009] The aforementioned problems are solved by the embodiments of the present invention characterized in the claims.
[0010] In particular, a method for producing biocatalytically active particles is provided according to the invention, wherein the method comprises the following steps:
[0011] (a) reacting an aqueous solution containing at least two peptides A and B with complementary binding sites, wherein at least one of the two peptides A and B is a biocatalytically active peptide; (b) introducing the solution obtained in step (a) in the form of droplets into a medium that is immiscible with the aqueous solution, causing the droplets to solidify; and
[0012] (c) Drying of the droplets solidified in step (b), while preserving the biocatalytically active particles.
[0013] The inventive method for producing biocatalytically active particles offers a particularly efficient method for integrating enzymes into a defined geometry and with defined mechanical properties of the biocatalytically active particles. The biocatalytically active particles obtainable by the method are characterized by a high enzyme loading of typically > 25%, which is defined in the present application as a peptide content of at least 25% by mass, based on the total mass of the biocatalytically active particles. Furthermore, the biocatalytically active particles obtainable by the method do not exhibit any significant loss of activity. Thus, the catalytic efficiency of the immobilized enzymes is maintained.Furthermore, the process allows for precise control of the particle size and shape, enabling optimal adaptation of their use in batch processes or, in particular, in compartmentalized flow systems within a continuous flow. The uniform geometry of the particles helps to control reaction conditions and effectively prevent unwanted cross-reactions. Another advantage lies in the simple and scalable process control. The process does not necessarily require complex coupling steps or the use of chemical crosslinking agents, thereby reducing both environmental impact and energy and material consumption. The biocatalytically active particles obtained through this process are therefore not only functional but also sustainable and economically attractive.
[0014] The inventive process for producing biocatalytically active particles is explained in more detail below:
[0015] According to the present invention, the process for producing biocatalytically active particles comprises the step (a) of reacting an aqueous solution containing at least two peptides A and B with complementary binding sites and a solvent, wherein at least one of the two peptides A and B is a biocatalytically active peptide.
[0016] The term "solution" is not further restricted and can also be understood as a suspension, as long as at least one of peptides A and B is at least partially in solution. Preferably, however, the solution is a homogeneous solution without any solid component. This homogeneous solution enables a more efficient interaction between peptides A and B, thereby significantly reducing the assembly time. This leads to faster and more uniform production of the biocatalytically active particles.
[0017] Assembly time can also be understood as reaction time, particularly when the bonds between peptides A and B are covalent. In this case, assembly time describes the period required to fully form the covalent bonds between the complementary binding sites of peptides A and B. For non-covalent bonds, however, assembly time refers to the process of spontaneous attachment and alignment of the bonding partners, thereby establishing specific intermolecular interactions such as hydrogen bonds, van der Waals forces, or electrostatic interactions. Assembly time is thus a crucial parameter that reflects both the kinetic and thermodynamic aspects of bond formation.
[0018] The aqueous solution comprises water or aqueous buffer solutions such as phosphate, Tris, or HEPES buffers, which have a suitable pH for stabilizing the peptides. A KPi-Mg buffer consisting of potassium phosphate (KPi) in the range of 10 mM to 1 M with a pH in the range of 6 to 9 and magnesium chloride (MgCl₂) in the range of 100 pM to 10 mM is particularly preferred. Likewise, organic solvents in low concentrations, for example, in the range of 0 to 20 wt% based on the total mass of the solvent, such as ethanol, methanol, or isopropanol, can be used, provided they do not impair the stability of the peptides. Mixtures of aqueous and organic solvents are also suitable to ensure optimal peptide solubility.
[0019] Furthermore, the aqueous solution reacted in step (a) contains the two peptides A and B, each with complementary binding sites, wherein at least one of the two peptides A and B is a biocatalytically active peptide; preferably, however, both peptides A and B are biocatalytically active. The preferred use of two biocatalytically active peptides opens up particularly versatile application possibilities, as it allows multi-step biocatalysis to be carried out within the same system. This is particularly advantageous for biocatalytic cascade reactions, in which several successive steps can be carried out efficiently and without spatial separation. For the purposes of the present invention, "biocatalytically active" means that the peptide is capable of catalyzing one or more chemical reactions that typically occur in biological or industrial processes.Such reactions include, for example, hydrolysis, oxidation, reduction, amidation, esterification, transesterification, epoxidation, carbonylation, halogenation, dehalogenation, sulfation, sulfurylation, glycosylation, dehydration, hydrogenation, hydroformylation, condensation, isomerization, carboxylation, decarboxylation, deamination, methylation, demethylation, nitrilation, acetylation, hydroxylation, and CH, CN, CS, or other carbon functionalizations. A biocatalytically active peptide is thus able to carry out one of these or a comparable reaction by significantly increasing the reaction rate without being consumed itself. Such peptides are typically enzymes that act as specific catalysts for the reaction in question, thereby considerably increasing its efficiency and selectivity.
[0020] For the purposes of the present invention, the term "complementary binding sites" refers to specific functional regions on peptides A and B that are configured to interact with each other to form a network. These binding sites are designed to form a covalent or non-covalent bond, thereby enabling cross-linking of the peptides and resulting in a stable, cross-linked material. The binding sites can be identical or different. For example, homo-dimer binding sites are configured such that both binding sites are identical. The formation of such a network is made possible by the specific design of the complementary binding sites, which ensures a targeted and stoichiometrically and spatially defined association of the peptides. This leads to the formation of amorphous, cross-linked peptide hydrogels, also known as "all-enzyme hydrogels."These amorphous, cross-linked peptide hydrogels are characterized by their homogeneous structure, high stability, and functionality. The complementary binding sites play a central role, as they control the targeted self-assembly of the peptides into the peptide hydrogel. The term "all-enzyme hydrogels" does not necessarily refer exclusively to the peptide content of the hydrogel, but rather to its structural composition and the type of cross-linking within the hydrogel. While peptides A and B are essential components and, through their complementary binding sites, control the targeted cross-linking and formation of the hydrogel structure, the hydrogels can also contain other components. After drying, the biocatalytically active particles accordingly constitute a dried hydrogel.
[0021] Preferably, each of peptides A and B has at least two complementary binding sites. This minimum number enables effective cross-linking of the peptides, which is necessary for the formation of a stable three-dimensional network within the hydrogel. The presence of at least two binding sites per peptide allows each peptide to interact with multiple other peptides, leading to an increased cross-linking density and improved mechanical properties of the hydrogel. Peptides A and B can also have more than two, for example, three, four, or five, complementary binding sites to achieve an even higher cross-linking density and specifically tailored material properties. The number of binding sites can be selected to achieve the desired balance between the stability, porosity, and functionality of the hydrogel.
[0022] In a preferred embodiment, peptide A has two complementary binding sites and is used in a stoichiometric ratio of 1, while peptide B has only one complementary binding site and is used in a ratio of 2. This combination—two binding sites of peptide A and one binding site of peptide B in a molar ratio of 1:2—achieves directed and efficient cross-linking, since each binding site of peptide A statistically faces two peptide B as reaction partners. This ratio supports the formation of a stable three-dimensional network with a defined cross-linking architecture.
[0023] The complementary binding sites of peptides A and B can be based on covalent or non-covalent interactions. Binding sites such as SH3, PDZ, GBD, or colicin can be used. A preferred system for generating covalent bonds, though not limited to this, is the SpyCatcher-SpyTag system, which is based on the formation of a spontaneous isopeptide bond between the binding domains SpyTag and SpyCatcher. This system has the advantage that binding can occur under physiological conditions without additional chemical reagents, simplifying the process and preserving the functionality of the peptides. Furthermore, the system allows precise control over the crosslinking and the spatial organization of the peptides within the network.Other possible approaches to generating covalent bonds include chemically modified peptides with reactive groups, such as thiol or amine reaction groups, which can react selectively with each other. The use of covalent bonds enables the biocatalytically active particles obtainable by the inventive process to not only be mechanically stable, but also to retain their functionality, in particular the biocatalytic activity of the peptides, over the long term. This is especially advantageous for applications in which the particles are exposed to high stresses or demanding conditions, such as in continuous biocatalytic processes or in industrial reactors.
[0024] For the purposes of the present invention, peptides A and B can be the same or, preferably, different. This flexibility makes it possible to use either identical peptides with complementary binding sites or, preferably, two different peptides, each with complementary binding sites. The terms "same" or "different" refer exclusively to the peptides themselves and not to their complementary binding sites. The complementary binding sites can be designed, regardless of the identity of the peptides, to interact selectively with each other to ensure stable cross-linking and the formation of the biocatalytically active particles. The use of different peptides A and B opens up additional design possibilities, particularly if both peptides are biocatalytically active.In such cases, the combination of different peptides can be used to generate biocatalytically active particles with extended or combined catalytic functions. This is particularly advantageous for applications requiring more than one type of biocatalytic reaction.
[0025] For the purposes of this application, the term 'peptide' is understood to mean a sequence of amino acids, the length of which is not limited. This includes both oligopeptides with short sequences and polypeptides and proteins with 100 or more amino acids. The sequences may consist of naturally occurring amino acids or include non-natural or modified amino acids, provided these contribute the desired biocatalytic or structural properties.
[0026] Peptides A and B can be produced with or without overexpression using recombinant microorganisms. For example, peptides A and B can be produced by heterologous expression in suitable host organisms such as E. coli. In this process, the genes encoding peptides A and B are cloned into expression vectors and introduced into host cells. Peptide expression is carried out under controlled conditions, where specific inducers, such as isopropyl thiogalactose (IPTG), can be used to direct the production of the target peptides. After cultivation, the peptides are purified, for example, by affinity chromatography, to ensure high purity and functionality. Complementary binding sites can be introduced through targeted genetic modification.This is achieved either by fusion of specific binding domains or by mutation of the target sequences, such that peptides A and B acquire complementary binding sites. These binding sites can be based on natural interactions (e.g., antigen-antibody interactions) or generated through synthetic approaches, such as the introduction of specific peptide sequences that interact with each other. Alternatively, chemical modifications or conjugation with specific molecules can be used to selectively develop the complementary binding properties. The conditions and procedures for providing peptides A and B with complementary binding sites are known to those skilled in the art.
[0027] Preferably, peptides A and B, each with complementary binding sites, are not supported by a carrier material, but are themselves carrier-free components of the solution processed in step (a) of the inventive process. Carrier materials, which are preferably deliberately avoided in the present process, include, for example, polymers such as polystyrene, polyacrylamide, or polyethylene glycol, inorganic solids such as silica, aluminum oxide, or glass, as well as bio-based carriers such as cellulose or agarose. This approach offers significant advantages. It enables a high peptide content in the solids of the aqueous solution processed in step (a) and also a high peptide content in the biocatalytically active particles obtainable by the process, since there are no limitations due to the capacity of a carrier material. This increases the catalytic activity of the biocatalytically active particles relative to their mass.A further advantage is the improved solubility of the peptides. Since no binding to external support materials occurs, which can often have hydrophobic or chemically incompatible surfaces, increased solubility is achieved. Furthermore, peptides A and B preferably constitute at least 1, at least 5, at least 10, at least 15, or at least 20 wt% of the solids content of the aqueous solution reacted in step (a). More preferably, peptides A and B constitute at least 25 or 50 wt% of the solids content of the aqueous solution reacted in step (a). Even more preferably, the proportion of peptides A and B in the solids content of the aqueous solution reacted in step (a) is at least 60 wt%, and even more preferably at least 70 wt%, or even at least 80 wt%.Particularly preferably, the proportion of peptides A and B in the solids content of the aqueous solution reacted in step (a) can be at least 85 wt% or even 90 wt%. There is no specific upper limit for the proportion of peptides A and B in the solids content of the aqueous solution reacted in step (a), so that in some cases the solution can consist entirely of peptides A and B (apart from unavoidable impurities). The aforementioned proportion of peptides A and B in the solids content of the aqueous solution reacted in step (a) is achievable regardless of whether the peptides A and B are supported on a carrier material or are themselves a carrier-free component of the solution. Such a high proportion of peptides A and B in the solids content of the aqueous solution reacted in step (a) enables a high peptide content of the biocatalytically active particles obtainable by the process.This increases the catalytic activity of the biocatalytically active particles relative to their mass. For the purposes of this invention, the term "solids content" refers to the proportion of non-volatile components in the total mass of the aqueous solution. The solids content is determined in the dry state after all volatile substances such as water, organic solvents, or other volatile components have been removed. It includes all solid components of the solution, including peptides, any additives, and other solids such as unavoidable impurities present in the solution.
[0028] The concentration of peptides A and B in the aqueous solution reacted in step (a) can range from 0.1 pM to 1 M. In some cases, saturation of the aqueous solution is reached at concentrations below 1 M, so that in these cases the saturation limit can be considered the upper limit for the concentration of peptides A and B. Preferably, the concentration of peptides A and B in the solution is at least 1 pM, more preferably at least 10 pM, even more preferably 100 pM, and particularly preferably 500 pM. With respect to the upper limit, the concentration is preferably at most 100 mM, more preferably at most 10 mM, and even more preferably at most 2 mM. Particularly preferably, the concentration is about 1 mM. The term "about" in connection with the preferred concentration of 1 mM means that slight deviations from this value are possible without affecting the essential properties or the functionality of the solution.In this context, "approximately" refers to a tolerable deviation, which may, for example, encompass ±10% of the specified value, corresponding to a range of 0.9 mM to 1.1 mM. The concentration of peptides A and B is particularly crucial for ensuring defined geometries and mechanical properties of the biocatalytically active particles obtained through the process. A precise concentration of the peptides in the solution significantly influences the self-assembly and cross-linking of the peptides, which in turn determines the structural homogeneity, stability, and functionality of the particles. Maintaining this range ensures that the desired properties of the particles—both in terms of their mechanical integrity and their catalytic activity—can be optimally achieved.The stated concentration of peptides A and B in the solution reacted in step (a) refers to the total concentration of peptides A and B. This means that both peptide A and peptide B together constitute this concentration range, regardless of their respective ratios in the solution.
[0029] The ratio of peptides A and B to each other in the solution can be different or the same. A preferred ratio is one in which the number of complementary binding sites of peptide A equals the number of complementary binding sites of peptide B. This ratio ensures efficient crosslinking of the peptides and the formation of a cross-linked peptide hydrogel. Matching the number of complementary binding sites is particularly advantageous because it allows precise control of the geometric and mechanical properties of the biocatalytically active particles obtained by the process. However, deviations from the preferred ratio may be useful in specific cases to modify certain properties of the resulting particles, such as their flexibility, porosity, or functionality.
[0030] The solution of step (a) of the process according to the invention is not limited to the solvent and peptides A and B. Rather, the solution can also include further components. Such additional components can, for example, be further peptides with specific binding sites that interact synergistically with peptides A and B. This opens up the possibility of tailoring the properties of the solution to specific requirements, such as promoting complex biocatalytic processes or producing particles with extended catalytic and binding-specific functions. In addition, further additives can be added to the solution reacted in step (a) of the process according to the invention. These additives can perform various functions, such as stabilizing the peptides, promoting specific biocatalytic processes, or tailoring the physicochemical properties of the solution.Possible additives include biocompatible surfactants such as polysorbates (e.g., Tween 20 or Tween 80), lecithin, or pluronic block copolymers, which can improve the solubility and stability of the peptides. As mentioned above, buffer systems such as phosphate-buffered salt solutions (PBS), HEPES, or TRIS can also be used to stabilize the pH of the solution and create optimal conditions for peptide activity. Stabilizers such as glycerol, trehalose, or polyethylene glycol (PEG) can be added to ensure the long-term structure and function of the peptides. Complexing agents such as EDTA or citrate can be used to bind interfering metal ions, while reducing agents such as dithiothreitol (DTT) or glutathione protect the peptides from oxidative damage.Additionally, organic or inorganic salts such as sodium chloride (NaCl) or magnesium chloride (MgCl₂) can be added to regulate the ionic strength of the solution. Besides peptides A and B, other peptides with specific functions can also be included to enable complex reaction chains or synergistic effects. Furthermore, lipids or lipid-based structures, such as cholesterol or liposomes, can improve the stability of the solution. Dyes or markers, such as fluorescent dyes (e.g., FITC or rhodamine), can be incorporated to monitor reactions or visualize binding interactions. Through the targeted selection and combination of these additives, the solution can be flexibly adapted to specific requirements, whether for stabilizing the peptides, promoting complex biocatalytic processes, or producing particles with extended catalytic and binding-specific functions.
[0031] Additionally, crosslinking agents can be added to the solution prepared in step (a) of the process according to the invention. These agents promote the formation of a stable, crosslinked network between peptides A and B. Such crosslinking agents can act covalently or non-covalently and are designed to promote specific chemical or physical bonds between the peptides. Examples of covalent crosslinking agents are glutaraldehyde, formaldehyde, or water-soluble carbodiimides (such as EDC or DCC), which can selectively link reactive groups on the peptides. For non-covalent crosslinking, substances such as multivalent ions (e.g., Ca) can be used. 2+ , Mg 2+Crosslinking agents are used in the formulation of a network of ions or supramolecular compounds such as cyclodextrins or poly(ethyleneimines) (PEI), which act through interactions such as hydrogen bonds, van der Waals forces, or hydrophobic effects. The use of such crosslinking agents allows for the targeted control of the mechanical and physical properties of the resulting network and its adaptation to specific applications, such as the stabilization of hydrogel structures or the promotion of catalytic processes. Preferably, however, the solution does not contain any crosslinking agents. Multivalent ions and other reagents are only considered crosslinking agents if they actually fulfill the function described above. Buffers containing ions, for example, are not considered crosslinking agents.
[0032] The conversion in step (a) is to be understood as involving an interaction or a chemical reaction, at least between peptides A and B or their complementary binding sites. This reaction occurs through the targeted interaction of the respective complementary binding sites of the two peptides A and B. Within the scope of this application, the term "reaction" in the case of non-covalent binding sites is to be understood exclusively as coordination. Here, coordination refers to the specific and reversible interaction between the complementary binding sites of peptides A and B, which does not involve a covalent bond but is mediated by intermolecular forces such as hydrogen bonds, van der Waals forces, or electrostatic interactions. This reaction is initiated, for example, by mixing the solution. The assembly time, temperature, and other conditions are known to those skilled in the art.Typical assembly times range from 1 s to 10 min for fast reactions or highly concentrated solutions, from 10 min to 30 min for moderate conditions and typical concentrations, and up to 1 h for less reactive binding sites or at low peptide concentrations. However, the assembly time can also exceed 1 h. The temperature during the conversion in step (a) can vary depending on the stability of the peptides and the specific requirements of the process. Commonly used ranges are 4 °C to 15 °C for temperature-sensitive or unstable peptides, 15 °C to 25 °C for standard conditions with stable peptides, and 25 °C to 40 °C when near-physiological conditions are required. An exemplary setting might involve an assembly time of 15 min at a temperature of 20 °C to ensure an effective reaction without compromising peptide stability.The conditions are not limited to the above exemplary values and are known to a person skilled in the art.
[0033] The present invention further comprises a step (b) of introducing the solution obtained from step (a) in the form of droplets into a medium that is immiscible with the aqueous solution, with the droplets solidifying. The introduction is generally understood as a process by which the solution is transferred into the medium, which can be accomplished in various ways, for example by droplet formation, continuous pouring whereby droplets are formed, spraying, or other suitable methods that ensure that the solution comes into contact with the medium and has a droplet shape.
[0034] In addition to the methods already mentioned, the introduction of droplets can be achieved in various other ways. For example, the solution can be introduced into the medium using a pipetting system to ensure precise droplet formation. Alternatively, microfluidic technology can be used to generate droplets in a controlled manner and with a uniform size. Another option is to use a nozzle or vibrating nozzle to generate droplets through mechanical vibrations. The use of an electrostatic field to promote droplet formation or a compressed air system to spray the solution into the medium can also be considered for this step. Crucially, the chosen method must effectively establish contact between the droplets and the immiscible medium and allow the droplets to solidify.
[0035] Preferably, the introduction in step (b) is achieved by dripping individual drops, using, for example, needles with various shapes (beveled, flat, or conical), lengths (19 mm to 51 mm), inner diameters (108 pm to 127 pm), and materials (e.g., steel or PTFE-coated tip). Depending on the configuration, exemplary drop volumes of approximately 6 pL are obtained with beveled steel tips, 7 pL with conical steel tips, or 5 pL with flat PTFE-coated tips. By selectively choosing these parameters, drop formation can be tailored to specific requirements, ensuring high precision of the droplets within the medium. The drop formation rate is determined, for example, by the flow rates of a pump system, enabling precise control of the drop frequency. Drop volumes typically range from 0.01 pL to 1 mL, with preferred values in the range of 1 pL to 100 pL.Drop volumes in the range of 4 pL to 10 pL are particularly preferred, as these sizes ensure high precision in droplet formation and optimal droplet stability within the medium. The drop rate is typically in the range of 0.1 to 10,000 drops per minute, with preferred values in the range of 1 to 50 drops per minute. However, a drop rate of 1 to 10 drops per minute is particularly preferred, as this allows for very controlled droplet formation. The drops are stabilized by peptides A and B contained in the solution and are detached from the needle as soon as the force of gravity overcomes the capillary forces. This prevents the drops from merging or pooling.Droplet stabilization can be achieved by adding the aforementioned additives, such as surfactants, preferably biocompatible surfactants, or by coating the needle with additional hydrophobic substances, for example, per- and polyfluoroalkyl substances (PFAS). This can ensure reliable droplet formation and supports the formation of uniform and stable biocatalytically active particles with a defined geometry.
[0036] The conditions in step (b) of the process according to the invention are crucial for the defined geometry of the biocatalytically active particles obtainable by the process. In particular, the droplet volume and droplet shape play a central role, as they significantly determine the size and shape of the resulting particles. Precise control of droplet formation, for example by selecting the needle shape, diameter, and material, ensures that the droplets are uniform and stable. Smaller droplet volumes, preferably in the range of 1 pL to 100 pL, produce smaller and more uniform particles, which are particularly suitable for applications in microfluidic systems. Larger droplet volumes, in the range of up to 1 mL, allow the production of larger particles, which are advantageous for macroscopic reactor systems or specific industrial applications.Additionally, the droplet shape and droplet formation rate influence the symmetry of the particles. Uniform droplet volumes and moderate droplet rates, particularly in the range of 1 to 10 drops per minute, promote the formation of spherical particles with a homogeneous, defined geometry. However, alternative shapes can also be generated by selectively adjusting the conditions, if required for specific applications. The stability and precision of droplet formation are therefore crucial in ensuring that the particles produced by the process have a defined geometry and can be optimally adapted to the respective requirements.
[0037] The solution obtained in step (a) is preferably introduced into a medium in the form of droplets at a temperature lower than the melting point of the aqueous solution. Therefore, the temperature is chosen to ensure efficient solidification of the solution, which is typically achieved at a temperature of 0 °C or lower.
[0038] The medium, which is immiscible with the aqueous solution, can include not only organic solvents, vegetable or mineral oils, and specific fluorine compounds, but also liquefied gases such as liquid nitrogen, liquid carbon dioxide, or liquid noble gases. Due to their immiscibility with water, a clear phase boundary is maintained, ensuring that the droplets retain their shape and enabling controlled processing. The use of liquefied gases is particularly advantageous when rapid solidification or specific morphological properties of the droplets are required.
[0039] The immiscibility between the aqueous solution and the medium is defined by the very low solubility of one substance in the other at the relevant temperature. Typically, this solubility is at most 10%, preferably at most 5%, more preferably at most 3%, and even more preferably at most 1%. This low solubility ensures that the droplets of the aqueous solution retain their shape and stability during contact with the medium, thus enabling controlled solidification.
[0040] Furthermore, the medium in step (b) of the process according to the invention is preferably a liquefied gas, for example liquid nitrogen, liquid argon, or liquid helium. Liquid nitrogen is preferred not only because of its extremely low temperature, which enables rapid and effective solidification of the introduced solution, but also because of its high availability and favorable cost compared to other liquefied gases. Liquid argon, which is present at about -186°C (87 K), represents another suitable option, while liquid helium, with a temperature of about -269°C (4 K), can be used in special applications requiring extremely low temperatures.
[0041] The inventive process further comprises step (c) of drying the droplets solidified in step (b), while retaining the biocatalytically active particles. In some cases, steps (b) and (c) of the inventive process can also be carried out in a single step. This is possible, for example, in spray drying, where a gas serves as the immiscible medium. During the spraying process, the droplets of the aqueous solution are introduced directly into the gas, with solidification and drying occurring almost simultaneously. The gas here assumes both the function of the medium for solidifying the droplets and that of the drying agent, which enables efficient and time-saving process control. Even if the medium is an organic solvent, such as isopropanol, steps (b) and (c) can be carried out simultaneously.In this case, water has a low solubility in isopropanol, which is consistent with the miscibility mentioned above. After the droplets are introduced in step (b), the water diffuses through the phase boundary from the droplets into the solvent. This diffusion simultaneously dries the droplets in the sense that water is removed from them, so that the drying step (c) is directly linked to the solidification step (b).
[0042] Preferably, the drying of the solidified droplets in step (c) is carried out by lyophilization, which preserves the biocatalytically active particles. Typical conditions are applied during lyophilization, also called freeze-drying, to ensure the stability and activity of the biocatalytically active particles. The following lyophilization conditions are exemplary. For instance, the solution solidified in step (b) is first heated to a temperature of -20 °C to -80 °C, depending on the sensitivity of the peptides and the stability of the solution. However, the solidified solution can also be lyophilized directly without heating. Subsequently, primary drying can be performed, in which the pressure in a drying chamber of a lyophilizer is reduced to 10 to 100 Pa and the temperature is gradually increased to approximately -10 °C to -30 °C to remove the solvent by sublimation.A secondary drying step can then be performed, in which the pressure is further reduced, typically to below 10 Pa, and the temperature is slowly increased to 20°C to 40°C to remove any remaining bound moisture from the sample. The entire lyophilization process usually takes 12 to 48 hours, depending on the volume and properties of the sample. These conditions can be adjusted to ensure optimal drying and long-term stability of the particles.
[0043] In a preferred embodiment, the solution is converted in step (a) by combining two presolutions A and B, each containing one of the two peptides A and B and optionally other components mentioned above. The mixing of presolutions A and B is not further restricted in this context, as long as interaction of the respective complementary binding sites is permitted. Presolutions A and B can, for example, be mixed together in a batch process, the conditions of which are known to those skilled in the art. Preferably, presolutions A and B are mixed in a continuous flow, the residence time in the continuous flow being at least 1 second. This procedure enables controlled and homogeneous mixing of peptides A and B, thereby ensuring a defined network formation and a uniform structure of the resulting peptide hydrogels.However, other residence times are also possible. Typical lower limits for residence time are at least 30 s, 1 min, 2 min, 3 min, 4 min, 5 min, 10 min, or 15 min. An upper limit for residence time is not specified, but typical values are at most 20 min, 30 min, or 1 h. This flexibility in residence time allows for adaptation to specific process requirements in order to achieve optimal results in the formation of the network and structure of the resulting hydrogels.
[0044] Figure 1 shows a typical setup for a droplet generation apparatus in which the two presolutions A and B are combined. Common materials suitable for droplet generation setups include metals and polymers, with polydimethylsiloxane (PDMS) and polymethyl methacrylate (PMMA) being preferred due to their suitability for microfluidic applications and ease of processing. To utilize these materials, they can be sealed. One method involves bonding the structure to a glass slide (usually a microscope coverslip) or to PDMS using oxygen plasma treatment. Alternatively, an adhesive film, for example made of polyolefin, can be used for sealing.
[0045] The aqueous presolutions A and B can be introduced into a static mixer (2) via two pumps (1) with constant flow rates, each via a separate channel, and homogenized. The pumps (1) of the droplet generation setup are, for example, syringe pumps (e.g., Chemyx Fusion 4000 X) or other pump systems such as peristaltic pumps, each with constant flow rates of, for example, 5 to 10 pL / min. The two channels are focused into a single channel and then homogenized in a static mixer (2) for laminar flow. The static mixer (2) can be equipped with various geometries to meet the specific requirements of the process. Figure 1 shows a static mixer (2) with four chambers.
[0046] This static mixer (2) is shown in detail in Fig. 2. In the example shown here, the static mixer (2) consists of four square chambers with a side length of 3.8 x 100 µm (L x H) and a total length of 35.15 mm. Each chamber is separated from the others by a 2.7 mm long channel. The two vertical inlets and one outlet channel have a diameter of 800 µm. The inlets and outlets of the structure can be connected via special chip-to-world (pCTW) interfaces. The seal between the chip and the interface is ensured by NBR 70 O-rings.
[0047] The mixture flowing from the static mixer (2) is incubated in a chemically suitable tube (3). The geometry of the static mixer (2), the length of the tube (3), and the flow rate determine the residence time and thus influence the degree of cross-linking of the resulting biocatalytically active particles. Droplets are formed by a needle (4) of different shapes and materials and fall by gravity into a vessel containing liquid nitrogen (5), causing the droplets to solidify into solid, spherical particles of defined size. These typically have a diameter (d) of 0.18 cm to 0.26 cm or a radius (r) of 0.09 cm to 0.13 cm and a volume of 0.03 to 0.095 cm³. 3 The resulting particles can then be lyophilized for at least 24 hours, for example. This setup is an example of a droplet generation setup, but is not limited to it.
[0048] In a further embodiment, the process comprises an additional step (d) in which the biocatalytically active particles obtained in step (c) of the process according to the invention are embedded in a molecular framework. This framework serves to stabilize the particles, improve their mechanical properties, and enhance their functionality. Suitable molecular frameworks include metal organic frameworks (MOFs), covalent organic frameworks (COFs), hydrogen-bonded organic frameworks (HOFs), silicon dioxide-based networks, and polymer-based networks. MOFs are particularly suitable for embedding. Embedding is achieved by the reaction of the particles with the specific building blocks of the framework. Organic linker molecules and / or inorganic components can be provided in a solution or dispersion, which interact with the particles to form a network around them.Conditions such as pH, temperature, assembly time, and solvent are adjusted to ensure that the scaffold components react effectively with each other and that the biocatalytic properties of the particles are maintained. These conditions are known to those skilled in the art.
[0049] For example, a metal-organic framework (MOF) can be generated by the targeted linking of an organic linker with metal ions. In such an example, a metal-organic framework (MOF) is created using benzene-1,4-dicarboxylic acid (BDC) as the organic linker and calcium ions (Ca). 2+The biocatalytically active particles are initially suspended in a solution of BDC in water. A calcium chloride solution (CaCl₂) is then added stepwise, facilitating coordination between the BDC molecules and the calcium ions. During this process, a MOF forms directly around the biocatalytically active particles, creating a stabilized framework. This process can also be described as crystallization. Subsequent washing with deionized water can be performed to remove unreacted residues, a process also known as conditioning. The particles can then be dried, for example, for 12 to 48 hours at room temperature (25 °C) under atmospheric conditions.
[0050] Embedding biocatalytically active particles in a molecular framework offers numerous advantages that significantly improve their stability, functionality, and applicability. First, the molecular framework ensures increased mechanical stability by protecting the particles from physical damage that could result from shear forces or mechanical stress during use. Furthermore, the framework contributes to the particles' chemical stability by shielding them from harmful environmental influences such as oxidation, pH fluctuations, and the effects of solvents. This extends their lifetime and considerably increases their long-term stability. Another advantage lies in the controlled porosity of the framework, particularly when using materials such as MOFs or COFs.The highly porous structure of the scaffold facilitates substrate access to the biocatalytic centers and regulates molecular diffusion, thereby increasing the efficiency of the catalytic process or at least preventing its significant inhibition. Furthermore, the functionality of the particles can be specifically enhanced by tailoring the scaffold's physicochemical properties, such as charge, hydrophilicity, or specific interactions, to the application requirements. These diverse advantages make embedding in molecular scaffolds an effective strategy for optimizing biocatalytically active particles.
[0051] The foregoing process is not limited to steps (a) to (c) or, where applicable, step (d), but may additionally include further steps that contribute to optimizing the properties of the biocatalytically active particles. Such additional steps could, for example, include washing the particles obtained in step (c) to remove residues, modifying the particle surface by chemical or physical treatments, or adding additives to improve the stability and functionality of the particles. Furthermore, an additional step may be provided in which the biocatalytically active particles are loaded with specific co-factors or other functional molecules before being embedded in a molecular framework (step (d)) in order to increase their catalytic activity.The preferred order of the steps is as follows: first, the conversion of the solution in step (a), followed by the introduction of the solution into a medium in step (b), then the drying in step (c) and optionally the embedding of the particles in a molecular framework in step (d).
[0052] In a further aspect, the present invention relates to biocatalytically active particles obtainable by the process according to the invention, wherein the biocatalytically active particles have a peptide content of at least 1, at least 5, at least 10, at least 15, or at least 20 wt% based on the total mass of the biocatalytically active particles. More preferably, the biocatalytically active particles have a peptide content of at least 25 or 50 wt% based on the total mass of the biocatalytically active particles. The stated peptide content in wt% refers to the total mass of the particles in the dry state, i.e., without volatile substances such as water or organic solvents. The foregoing descriptions of the process according to the invention apply equally to the particles obtainable by the process according to the invention.More preferably, the peptide content of the particles is at least 60% by mass, even more preferably at least 70% by mass, or even at least 80% by mass. Particularly preferably, the peptide content is at least 85% by mass, or even 90% by mass, based on the total mass of the biocatalytically active particles. The peptide content of the biocatalytically active particles depends significantly on the proportion of peptides A and B in the solution reacted in step (a) of the process according to the invention. Additionally, the peptide content of the biocatalytically active particles is influenced by other components, such as additives that can be added during the process. Likewise, a molecular framework that may be formed within the framework of the process according to the invention can influence the peptide content of the biocatalytically active particles.The biocatalytically active particles obtainable by the process according to the invention are amorphous, cross-linked, freeze-dried peptide hydrogels. The solvent content, such as water, can be determined using various methods, including thermogravimetric analysis (TGA) or Karl Fischer titration. The peptide content can be determined using known methods, such as the Bradford assay, the BCA assay, or analytical polyacrylamide gel electrophoresis with subsequent staining of the peptide-containing bands.
[0053] The biocatalytically active particles obtainable by the process according to the invention preferably have a diameter in the range of 1 pm to 10 mm. The exact diameter of the particles is significantly influenced by the process conditions, in particular by the droplet volumes used in the process according to the invention. Depending on the setting of the droplet volumes, the viscosity of the solution, the surface tension, and the solidification time, the particle sizes can be specifically adapted to achieve optimal properties for various applications. Preferred diameter ranges of the particles are in the range of 100 pm to 5 mm, more preferably in the range of 500 pm to 4 mm, and even more preferably in the range of 1 mm to 3 mm.Preferably, the diameter of the biocatalytically active particles obtainable by the process is between 1 mm and 3 mm, as this size range offers an ideal combination of mechanical stability and biocatalytic activity. The flexibility in adjusting the particle size allows the particles to be specifically tailored to particular requirements and applications.
[0054] The biocatalytically active particles obtainable by the inventive process preferably have a round shape, which ensures a uniformly defined geometry. This is illustrated by way of example in Fig. 3. However, depending on the process conditions, the particles can also have other shapes, such as ellipsoidal, cylindrical, or irregular geometric structures. Such alternative shapes can be used selectively to meet specific requirements regarding the surface area or the reactivity of the particles. For determining the diameter of non-round particles, the so-called equivalent diameter is preferably used. This corresponds to the diameter of an ideal sphere model with the same volume as the particle under investigation. The equivalent diameter can be determined using modern image analysis methods or by volume measurements using microscopy or laser diffraction.In practice, calculations are often performed by evaluating digital images with software that analyzes the particle contours and calculates the volume and equivalent diameter from the acquired data. Scanning electron microscopy (SEM) and corresponding processing software can be used for visualizing and determining the particle sizes. Dynamic light scattering (DLS) can also be used to determine particle sizes.
[0055] For DLS measurements, 100 pL of a peptide solution are transferred to UV cuvettes. The loaded cuvettes are placed in a Nano Series ZetaSizer Nano ZSP instrument (Malvern Instruments, UK) with a 633 nm He-Ne laser. Before measurement, the peptide samples are centrifuged at 25 °C for 5 minutes at 10,000 rpm. The concentration of the resulting supernatant is determined and adjusted to 1 mM. Subsequently, the mean hydrodynamic radius of the peptide particles (z-mean), calculated from the autocorrelated light intensity data using ZetaSizer software, is measured over a period of 3 hours with a data acquisition every 100 seconds. The nanogel formation kinetics (Az-mean min) are then determined. -1 ) can be determined from the linear increase of the z-mean over time.
[0056] The biocatalytically active particles obtainable by the inventive process are characterized by an advantageous combination of structural stability, defined geometry, and high functional performance. The particles preferably possess a compact outer structure, which enables pronounced mechanical robustness and facilitates their handling, storage, and usability under operating conditions. Simultaneously, the particle interior can have an open-pored, permeable architecture that allows efficient mass and solvent transport, thus ensuring high catalytic accessibility. This combination of a stable outer layer and a readily accessible, porous interior results in an excellent balance between strength and reactivity, enabling the particles to be reliably used in both batch and continuous flow processes.Furthermore, their defined size and morphology enable uniform flow distribution in reactor systems as well as reproducible catalytic properties. Overall, the particles thus offer a material platform particularly suitable for biocatalytic applications, combining high peptide densities, good transport properties, and robust process stability.
[0057] Another aspect of the present invention relates to the use of the biocatalytically active particles obtainable by the process according to the invention for carrying out at least one biocatalytic reaction, in particular an enzyme-catalytic reaction, selected from the group consisting of hydrolysis, oxidation, reduction, amidation, esterification, transesterification, epoxidation, carbonylation, halogenation, dehalogenation, sulfation, sulfurylation, glycosylation, dehydration, hydrogenation, hydroformylation, condensation, isomerization, carboxylation, decarboxylation, deamination, methylation, demethylation, nitrilation, acetylation, hydroxylation and CH-, CN-, CS- or other carbon functionalizations.
[0058] The biocatalytically active particles obtainable by the process according to the invention can be used under various reaction conditions, which are adapted according to the type of reaction being catalyzed and are known in detail to those skilled in the art. For hydrolysis reactions, the process is typically carried out in an aqueous environment with a pH of 6 to 8 and temperatures between 25 and 50°C, using moderate stirring speeds to minimize shear forces. Oxidations can be carried out with the addition of oxidizing agents such as hydrogen peroxide or oxygen from the air at temperatures of 20 to 40°C and a neutral to slightly acidic pH (5 to 7). Reduction reactions often require reducing agents such as NADH or FADH₂ in buffered solutions at temperatures of 30 to 60°C, frequently in combination with a coenzyme recycling system.For amidations, organic solvents such as DMSO or ethanol, or aqueous environments with co-catalysts, are suitable, typically at temperatures between 20 and 70°C. Esterifications or transesterifications are preferably carried out in low-water or organic environments such as hexane at temperatures of 30 to 70°C, where the removal of byproducts such as water can be aided by molecular sieves. Epoxidations require oxidizing agents such as peroxycarboxylic acids and usually take place in organic solvents such as acetone or methanol at temperatures of 20 to 40°C. For hydroformylations, reaction pressures of 1 to 10 bar under a carbon monoxide and hydrogen atmosphere and temperatures of 40 to 80°C are typical. Halogenations are carried out with the addition of halogen compounds such as chlorine or bromine at temperatures of 10 to 30°C and a pH of 6 to 7.Carboxylations utilize a carbon dioxide atmosphere at moderate pressure (2 to 5 bar) and temperatures of 30 to 50°C. Methylation and demethylation reactions are carried out with the addition of specific reagents such as dimethyl sulfate at temperatures of 20 to 40°C. Hydrogenation reactions can take place in a hydrogen atmosphere at pressures of 1 to 5 bar and temperatures between 30 and 60°C. For isomerizations, mild temperatures of 25 to 50°C are used in aqueous or organic environments. The reaction conditions mentioned are only examples, and the present invention is not limited to these conditions.
[0059] The catalytic activity of the biocatalytically active particles depends significantly on peptides A and B, whose specific functionality determines the type of reactions catalyzed. It is also conceivable that peptides A and B exhibit different catalytic activities, meaning that a single biocatalytically active particle is capable of catalyzing two different biocatalytic reactions simultaneously or sequentially.
[0060] The reaction is preferably carried out in a flow reactor, but can also take place in a batch reactor. The high stability and functionality of the biocatalytically active particles allow their use under various reaction conditions, making them suitable for a wide range of biocatalytic applications. Particularly in a flow reactor, the particles' amorphous, cross-linked structure ensures efficient catalysis with high reusability and stability over extended process times.
[0061] The biocatalytically active particles obtained through this process possess the ability to swell in both batch and flow-through operation. They are therefore particularly well-suited for use in a flow-through reactor, as the swelling of the particles allows them to reshape themselves, grow together, completely fill the reactor space, and assume its form. This reduces the dead volume, which in turn contributes to process intensification, since the majority of the operating volume is filled with catalytically active biomaterial. Embedding the particles in a molecular framework, such as a MOF, significantly improves their mechanical properties, as they do not irreversibly fuse together during batch or flow-through operation, unlike unembedded biocatalytically active particles, while still retaining the beneficial effect of complete reactor space utilization.This enables the recovery and reuse of the biocatalytically active particles, which is particularly advantageous for cost efficiency in industrial applications.
[0062] The present invention provides a method for producing biocatalytically active particles, as well as for supplying the particles produced by the method and their use in various biocatalytic applications. The method according to the invention enables the production of biocatalytically active particles with a high enzyme loading, defined by the defined peptide content, and a defined geometry, thereby ensuring optimal functionality in catalytic processes. The method is also characterized by simple scalability and environmental friendliness, since preferably no additional chemical crosslinking agents or complex coupling steps are required. High catalytic activity is achieved through the targeted self-assembly of peptides A and B into a crosslinked structure, without compromising the enzymes' functionality.Furthermore, the particles produced by the process are characterized by their high catalytic activity relative to their total mass. These properties make them particularly suitable for use in flow reactors, enabling selective and sustainable biocatalytic processes with short reaction times. A particular advantage of the biocatalytically active particles produced by the process lies in their ability to potentially carry out several biocatalytic reactions simultaneously or sequentially. The present invention is therefore relevant for a wide range of industrial and scientific applications in biocatalysis. Figure description.
[0063] Fig. 1 shows a typical setup for a droplet generation setup in which the two presolutions A and B are combined.
[0064] Figure 2 shows a detailed representation of the static mixer.
[0065] shows an image of a biocatalytically active particle without embedding
[0066]
[0067] The image was taken using a scanning electron microscope (SEM); the scale was determined using image processing software.
[0068] Fig 4 shows A: the time-dependent conversion of a decarboxylase reaction of p-coumaric acid (substrate) to 4-vinylphenol in a batch reactor by using both biocatalytically active particles without embedding in a molecular framework and embedded biocatalytically active particles and B: the time-dependent conversion of a decarboxylase reaction of p-coumaric acid (substrate) to 4-vinylphenol in a flow reactor by using biocatalytically active particles without embedding in a molecular framework (Example 1).
[0069] shows the measurements of the fracture strength of various biocatalytic formulations at 25 °C using an indentation platform according to the methods developed in the following publication: P. Lemke, S. Moench, PS Jäger, C. Oelschlager, KS Rabe, CM Dominguez, CM Niemeyer, Small Methods 2024, 2400251 (Example 1).
[0070] Figure 1 shows the time-dependent conversion of p-coumaric acid (substrate) to 4-vinylphenol in a decarboxylase reaction in a batch reactor using (new) biocatalytically active particles synthesized directly before measurement without embedding in a molecular framework and biocatalytically active particles without embedding that were stored for 100 days at room temperature and in a non-specifically conditioned atmosphere (room air). Figure 2 shows the porosity of biocatalytically active particles determined gravimetrically using water and ethanol as test solvents at peptide concentrations of 1 mM and 2 mM.
[0071] Shows an environmental scanning electron microscopy (ESEM) analysis of biocatalytically active particles; A to D: Outer surface of an intact, monodisperse particle showing a smooth and uniform external morphology; E to H: Cross-sectional views of a ruptured particle revealing the internal architecture with macropores and regions of varying structural density; see arrow in G. Scale bar: 1 to 500 pm (Example 2).
[0072] Figure 9 shows the continuous synthesis of pseudouridine-5'-monophosphate (PMP) using YeiN-based biocatalytically active particles; A: Reaction scheme for the enzymatic condensation of uracil and ribose-5-phosphate to pseudouridine-5'-monophosphate (PMP), catalyzed by the pseudouridine-5'-phosphate glycosidase YeiN from E. coli; B to D: Operation of 100 pL flow reactors loaded with four YeiN-AEH particles in continuous flow mode; shown are the concentrations of uracil (black box) and pseudouridine monophosphate (black circle) at the reactor outlet at flow rates of 2 pL min. -1 (B), 5 pL min -1 (C) and 10 pL min -1 (D); Reaction conditions: 5 mM uracil and 7.5 mM ribose-5-phosphate in 50 mM HEPES buffer with 10 mM MnCl2, pH 7.0, at 37 °C; all measurements were performed in triplicate (n = 3) and presented as mean ± standard deviation (Example 3).
[0073] Figure 4 shows biocatalytically active particles of peptides A and B produced according to the inventive process: A: YeiN-ST + YeiN-SC; B: GDH-ST + GDH-SC; C: SC-ADH + GDH-ST; D: PDZ-Bind.-ADH + GDH-PDZ-Ligand; E: SH3-Bind.-ADH + GDH-SH3-Ligand; F: SC-PPK + STV-ST; G: SC-PPK + ST-PADd-ST; H: ST-PPK + SC-PPK + Poly-Phosphate. The particles have the same size as in Figure 3 and Figure 8, respectively.
[0074] The following examples serve to further illustrate the present invention, without, however, being limited thereto.
[0075] Example 1
[0076]
[0077] The synthesis of the two peptides A and B with complementary binding sites in Example 1 refers to an exemplary description for a general synthesis of the two peptides A and B.
[0078] For heterologous expression of peptides A and B, E. coli BL21 (DE3) was transformed with the corresponding expression vector using heat shock transformation. The freshly transformed E. co / / cells carrying the peptide-encoding plasmids were selected overnight on LB agar plates containing 100 pg / ml ampicillin at 37°C. Liquid cultures of 160 mL of ampicillin-containing LB medium were prepared from clones of the LB agar plates and cultured overnight for 14 to 18 h at 37°C and 180 rpm in a 500 mL shake flask. Two liters of ampicillin-containing LB medium were inoculated 1:20 with an overnight culture. The cultures were grown at 37°C and 180 rpm until an OD600 of 0.6 was reached. The temperature was then lowered to 25°C, IPTG was added to a final concentration of 0.1 mM, and the cultures were incubated for a further 16 h.
[0079] The cultures were combined, and the cells were harvested by centrifugation (10,000 x g, 10 min) and resuspended in 60 mL of buffer A (50 mM NaH₂PO₄, 300 mM NaCl, 10 mM imidazole, pH 8.0). After comminution by sonication, the cell lysate was purified by centrifugation (45,000 x g, 1 h), filtered through a 0.45 pm Durapore PVDF membrane (Steriflip, Millipore), and loaded onto two HisTrap FF Ni NTA columns (5 mL, GE Healthcare, Germany) connected in series and mounted on an Äkta Pure liquid chromatography system (GE Healthcare, Germany). The column was washed with 100 mL of buffer A, and the 6xHis-labeled peptides were eluted over a volume of 200 mL using a gradient from 100% buffer A to 100% buffer B (50 mM NaH₂PO₄, 300 mM NaCl, 500 mM imidazole, pH 8.0). The buffer was then replaced with a suitable storage buffer using Vivaspin 10,000 MWCO (GE Healthcare).
[0080] Production of biocatalytically active particles
[0081] Biocatalytically active particles were produced using a droplet generator, the setup of which is shown in Fig. 1, with a static mixer (2) shown in Fig. 2. Peptide concentrations of 1 mM of peptides A and B, each with complementary binding sites, obtained from the procedure described above, were used. Peptides A and B were mixed in a stoichiometric ratio (1:1), and the total flow rate was 15 pL / min, corresponding to an incubation time of 5 min at room temperature. Once the droplets were released from the needle by gravity, they fell into a double-walled, wide-mouthed container (Dewar tank, capacity 10 to 1000 mL) containing liquid nitrogen, where they solidified. The container was covered with a PTFE lid containing a centrally drilled hole sized to allow the droplets to pass through.The hardened, spherical material with a defined geometry was collected at the bottom of the liquid nitrogen tank and lyophilized directly for at least 72 hours (freeze dryer: Martin Christ Alpha 1-4 LSCbasic, 4 kg ice condenser capacity, -55°C ice condenser temperature). The biocatalytically active particles were then embedded in a molecular framework.
[0082] In the example described here, a MOF was prepared from calcium benzene-1,4-dicarboxylate trihydrate (CaBDC), using calcium chloride (CaCl₂) as the metal source and benzene-1,4-dicarboxylic acid (BDC) as the linker. To prepare the embedded biocatalytically active particles on a small scale, 10 lyophilized biocatalytically active particles obtained from the procedure described above (a total of 30 pL) were first suspended in 500 pL of a 600 mM BDC solution and 170 pL of deionized water. The mixture was homogenized by inversion five times in a 2 mL Eppendorf tube. Subsequently, 300 pL of a 1 M CaCl₂ solution were added dropwise over 1 minute. To ensure uniform distribution, the container was gently tilted before the mixture was left undisturbed for 16 h to allow crystallization.The resulting embedded biocatalytically active particles were purified by five washing steps with 1 mL of deionized water each to remove unbound materials (conditioning). The supernatant was discarded after each washing step. Finally, the particles were dried under a reduced atmosphere for 16 h to fully stabilize the embedded biocatalytically active particles.
[0083] Biocatalytic properties of the biocatalytically active particles
[0084] The properties of both the biocatalytically active particles without embedding in a molecular framework and the embedded biocatalytically active particles obtained from the aforementioned methods were investigated using a decarboxylase reaction with a phenolic acid as a model reaction. In this case, the conversion of p-coumaric acid (substrate) to 4-vinylphenol (product) was used as the performance measure.
[0085] To determine the reactor performance, the conversion was measured over a period of 1 h in a batch reactor (Fig. 4, A) and 4 h in a flow reactor (Fig. 4, B). In batch mode, one biocatalytically active particle (0.5 mg) was added to a glass vial containing 1 mL of 100 mM p-coumaric acid (substrate) in MTBE, orbitally shaken, and heated to 30°C. Samples were taken at regular intervals and diluted by a dilution factor of 20 in a stop solution of acetonitrile: water 0.1% TFA (50 / 50 v / v). In the flow reactor, five particles (0.5 mg each) were placed in a miniaturized packed bed reactor, and 100 mM p-coumaric acid (substrate) was continuously pumped through the reactor at 30°C using a peristaltic pump. Samples were taken at regular intervals and diluted by a dilution factor of 20 in a stop solution of acetonitrile: water 0.1% TFA (50 / 50 v / v).The samples were placed in special vials with inserts and analyzed using HPLC with a UV detector. The conversion rate is based on the substrate degradation over time.
[0086] Figure 4, A also shows the time-dependent conversion in a batch reactor using both unembedded and embedded biocatalytically active particles. Surprisingly, the embedded biocatalytically active particles still exhibited relatively high catalytic activity. The results demonstrate the high efficiency of the systems. The combination of unembedded and embedded biocatalytically active particles offers not only high catalytic activity but also improved mechanical stability and reusability. Regarding mechanical stability, measurements of the breaking strength of various biocatalytic formulations were performed (Figure 5).For the measurements, a piston with a length of 18 mm and a diameter of 4.3 mm, as well as a sample container with a diameter of 8 mm and a depth of 4 mm, were used. The measurements were carried out at a speed of 1 mm / s. 1 120 pL of the unformulated hydrogel were prepared from 1 mM of peptides A and B, each possessing complementary binding sites, mixed in a stoichiometric ratio (1:1), and gelled directly in the sample container for 30 minutes in a controlled atmosphere (ventilated incubator at 30 °C). Particles with and without embedding, prepared at similar concentrations, were manually centered in the sample container. Measurements were performed in triplicate (n = 3) until complete penetration or rupture of the respective materials and are presented as mean ± standard deviation.
[0087] Particularly in continuous operation, the system demonstrated its process intensification and efficiency by preventing particle aggregation and reducing dead volume. These properties, coupled with its ability to deliver excellent results even at high substrate loadings (> 100 mM p-coumaric acid) under unconventional reaction conditions such as the use of MTBE, make the system a promising technology for industrial applications. This specific formulation of enzymes in particles allows the biocatalytic activity to be maintained at a high level even without a scaffold, following storage of up to 100 days at room temperature and without a controlled atmosphere, as shown in Fig. 6. This is highly unconventional for enzymatic formulations, which are typically only stable for a few days or weeks under these conditions.
[0088] Example 2
[0089] In Example 2, PAD dimer is provided in two variants: one with a single SpyCatcher binding site (PAD-SC, peptide A) and one with two SpyTag binding sites (ST-PAD-ST, peptide B). Mixing peptides A and B in a molar ratio of 2:1 (SC : ST) enables a defined covalent cross-linking. This mixture leads to the rapid formation of isopeptide bonds between SpyTag and SpyCatcher binding sites, resulting in a densely cross-linked enzymatic network.
[0090]
[0091] 2.5 L of superpower cultures, starting from individual E. coli BL21 (DE3) colonies carrying the respective plasmids, were harvested by centrifugation (10000 g, 10 min, 4 °C) and resuspended in 20 mL NPi-10 buffer (50 mM NaH2PO4, 500 mM NaCl, 10 mM imidazole, pH 8.0). Cells were lysed using ultrasound, cell debris was removed by centrifugation (45,000 g, 1 h, 4 °C), and the supernatant was filtered through a 0.45 pm Durapore PVDF membrane (Steriflip, Millipore) and then loaded onto a HisTrap FF (5 mL) Ni-NTA column (GE Healthcare, Germany) operated on an Äkta Pure liquid chromatography system (GE Healthcare, Germany). After washing with 100 mL of NPi-10 buffer, the His6-labeled peptides were eluted by a gradient from 100% NPi-10 buffer to 100% NPi-500 buffer (50 mM NaH₂PO₄, 500 mM NaCl, 500 mM imidazole, pH 8.0).The buffer was then replaced with Vivaspin units containing suitable MWCO (GE Healthcare) with KMB (100 mM potassium phosphate buffer pH 7.5, 1 mM MgCl₂). The purified peptides were analyzed using standard discontinuous SDS-polyacrylamide Laemmli gels with Coomassie staining, and the molecular masses were compared to the Color Prestained Protein Ladder, Broad Range (New England Biolabs). Peptide concentrations were determined by UV-Vis spectroscopy using theoretical molar extinction coefficients at 280 nm, calculated with Geneious software version 9.1.3. The pET vectors used contained ampicillin resistance and were induced with 0.1 mM IPTG. The buffer was replaced with KMB containing 150 mM NaCl.
[0092]
[0093] active particle
[0094] The peptide predilutions were adjusted accordingly; for example, to achieve a final concentration of 1 mM, 0.667 mM ST-PAD-ST (peptide B) and 1.333 mM SC-PAD (peptide A) were used. Two 1 mL glass syringes (Hamilton) were filled with the respective enzyme solutions and installed in a Chemyx syringe pump. The flow rate was set to 10 pL min. -1 The setup consisted of a syringe connected via Teflon tubing (0.5 mm inner diameter) to a four-chamber mixing reactor, allowing for the simultaneous addition and mixing of the enzyme solutions. The mixed solution exited the reactor through another Teflon tube (0.5 mm inner diameter) positioned above a Dewar flask containing liquid nitrogen. A Hamilton capillary (RN NDL, ga26s / 19 mm / Pst 3T) was attached to the tubing to produce ~10 pL drops, which were subsequently lyophilized for 72 h.
[0095] pore volume of the bi
[0096]
[0097] active particle
[0098] To quantify the accessible pore volume of the biocatalytically active particles obtained in Example 2, a simple gravimetric solvent uptake method was applied using water and ethanol as test media (Fig. 7). The analysis reveals high porosities in the range of 76 to 88%, depending on the peptide concentration and solvent. At a total peptide concentration of 1 mM, porosities of approximately 84% in water and 88% in ethanol are observed, which is consistent with the improved wetting by ethanol due to its lower surface tension. Increasing the peptide concentration to 2 mM leads to a reduction in porosity to approximately 76% (water) and 84% (ethanol), respectively, thus demonstrating the formation of a denser, more cross-linked network with reduced pore accessibility. Furthermore, a denser formulation exhibits increased stiffness and shape stability in aqueous environments.The ability to selectively adjust both biochemical and physical properties via peptide concentration and process parameters underlines the versatility of the inventive process and the potential of the biocatalytically active particles obtainable through the process for applications in batch and continuous flow operation.
[0099] The measurements were performed in triplicate for both 1-mM and 2-mM formulations according to the preparation of biocatalytically active particles as described above in Example 2. For each measurement, three individual particles were weighed together, corresponding to an average total dry mass of 0.6 ± 0.2 mg for the 1-mM particles and 1.63 ± 0.05 mg for the 2-mM particles. The dry mass (rrinass) was determined after the particles were stored overnight under vacuum. Subsequently, the particles were immersed in either ethanol or deionized water and equilibrated for 5 min at room temperature to ensure complete solvent penetration into the pores. After equilibration, excess liquid was carefully removed by blotting with lint-free paper, and the wet mass (rrinass) was determined immediately.
[0100] The pore volume (V pores) was calculated as:
[0101] >
[0102]
[0103] The relative porosity (E) was subsequently obtained by normalizing the pore volume to the wet mass of the particle and the density of the test liquid:
[0104]
[0105] where pliquid is the density of the test liquid (0.998 g ern). -3 for water and 0.789 g ern -3 (for ethanol at 25 °C). All measurements were performed in triplicate and the results are given as mean ± standard deviation for each condition.
[0106]
[0107] active particle
[0108] Environmental scanning electron microscopy (ESEM) was used to investigate the microscopic architecture of the biocatalytically active particles produced according to Example 2 in detail (Fig. 8). The images confirm a controlled spherical morphology with a mean diameter of approximately 1500 pm and reveal a heterogeneous internal structure. Surface views (Fig. 8, A to D) show a continuous and largely uniform outer layer, while cross-sectional images (Fig. 8, E to H) reveal a network of macropores with characteristic diameters of about 10 pm, as well as regions of varying structural density. The pore sizes and their connectivity are not homogeneously distributed within the particle: some regions exhibit open, interconnected channels, while others consist of more compact, denser-packed domains.These observations are consistent with the gravimetric porosity data and are due to differences in drying kinetics during the freeze-drying process. Water removal occurs more rapidly and uniformly at the surface than in the interior, where dehydration is slower and favors locally varying pore formation and mechanical consolidation. A particularly noteworthy feature is the appearance of angular, partially hexagonal motifs within the particles (Fig. 8, G arrow). These faceted patterns may result from solidification processes at interfaces between adjacent microdomains during freeze-drying, where uneven dehydration promotes the formation of angular pore boundaries.In this process, water structures are "frozen" in the peptide matrix through rapid cryogenic freezing and subsequently sublimated during lyophilization, leaving behind cavities that retain their original geometry. The resulting polygonal pore shapes suggest that local melting and resolidification during drying can serve as a temporary template for the final internal architecture.
[0109] The morphological properties observed by ESEM provide important insights into how the structural organization of the biocatalytically active particles determines their mechanical and functional behavior. The combination of a compact outer shell and a heterogeneous, macroporous interior contributes significantly to high mechanical stability while maintaining sufficient permeability for substrates and products. The dense outer layer acts as a reinforcing shell that resists deformation, while the interconnected internal channels facilitate solvent and mass transport through the enzymatic matrix. Furthermore, the presence of angular or faceted pores can increase stiffness by distributing mechanical stresses across multiple interfaces.This hierarchical structure corresponds to the design principles of natural biomaterials, where density and porosity gradients optimize both strength and mass transport. For biocatalytic applications, such a dual-scale architecture is particularly advantageous because it combines high volumetric peptide charges with efficient mass transport under flow conditions. The observed particle morphology thus represents a favorable compromise between mechanical robustness and catalytic accessibility.
[0110] Example 3
[0111] To demonstrate a further applicability of the present invention, the biocatalytically active particles according to the invention were used for the synthesis of the C-nucleotide pseudouridine-5'-monophosphate (PMP). PMP represents an important intermediate in the production of modern mRNA vaccines and cancer therapeutics, since, as a modified nucleotide, it increases the stability and translation efficiency of mRNA.
[0112] Production of Biocatalytically Active Particles: The trimeric pseudouridine 5'-phosphate glycosidase from E. coli (EC 4.2.1.70) was selected, which catalyzes the condensation of uracil and ribose 5-phosphate to PMP (Fig. 9, A). This enzyme class has previously been used in batch multi-enzyme cascades for the synthesis of pseudouridine derivatives, but not yet in a continuous flow system with support-free immobilized enzymes. For the formation of the biocatalytically active particles, YeiN was genetically fused with SpyCatcher (SC-YeiN, peptide A) or SpyTag domains (ST-YeiN, peptide B). Both peptides were expressed in E. coli as in Examples 1 and 2 and purified by Ni-NTA affinity chromatography. For the production of the YeiN-AEH particles, equimolar amounts of the purified peptides were adjusted to a total peptide concentration of 1 mM and processed and dried according to the formulation protocol from Example 2.
[0113] Biocatalytic properties of the biocatalytically active particles
[0114] After drying, the resulting particles (four particles per 100 pL reactor, 18.2 nmol total peptide) were loaded into packed flow reactors and perfused at room temperature with a solution of uracil and ribose-5-phosphate. Continuous flow experiments were performed at flow rates of 2, 5, and 10 pL min⁻¹. -1 The reactor outlets were automatically collected, stopped, and analyzed for PMP formation using HPLC. Under these conditions, the YeiN-AEH particles achieved up to 90% uracil conversion (Fig. 9B and C). At 10 pL min -1Over 80 h, the reactor produced a total of 48 mL of a 4.5 mM PMP solution at a stable 90% conversion (Fig. 9, D). The increased conversion at higher flow rates is attributed to the fact that the reversible C-glycosylation reaction is driven out of equilibrium by faster product removal, thereby reducing reverse reactions and favoring net product formation.
[0115] Construction of the plasmids for examples 1 to 3
[0116] The in vitro recombination method according to Gibson et al. (Gibson, DG, Young, L., Chuang, RY, Venter, JC, Hutchison, CA, 3rd, Smith, HO (Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 6 343 345;10.1038 / nmeth.1318) was used in Examples 1 to 3, employing oligonucleotide primers with homologous overlaps of 20 to 30 bp.
[0117] The nucleotide sequences of the codon-optimized genes are listed in SEQ ID NO: 1 to SEQ ID NO: 5.
[0118] The sequences of the oligonucleotide primers used are listed in SEQ ID NO: 5 to SEQ ID NO: 12.
[0119] Example 4 - Transfer to other peptide systems
[0120] To demonstrate the general applicability of the platform, several structurally and mechanistically distinct enzymes were selected: glucose dehydrogenase (GDH), alcohol dehydrogenase (ADH), polyphosphate kinase (PPK), streptavidin (STV), and an inactive phenolic acid decarboxylase (PADd, a PAD variant with the mutations Y19F, Y21F, and E72S). All five peptides were expressed, purified, and biophysically characterized. Each of these peptides could be converted into biocatalytically active particles using the same synthesis protocol as in Examples 2 and 3. For this purpose, either ST / SC-modified fusion proteins or fusion proteins equipped with complementary, non-covalent binding units were used, for example, a PDZ-binding domain and PDZ ligand or an SH3-binding domain and SH3 ligand (Fig. 10, B to G). These results demonstrate the generality and modularity of the present invention.Furthermore, particles could also be formed in the presence of additional molecules as additives, as exemplified by the PPK-ST + PPK-SC system with the addition of polyphosphate (Fig. 10, H).
[0121] The nucleotide sequences of the codon-optimized genes are listed in SEQ ID NO: 13 to SEQ ID NO: 23. This patent application relates to the following SEQ ID NO: 1 to SEQ ID NO: 23.
[0122] SEQ ID NO 1
[0123] PAD- SC ATGAACACCTTCGACAAACATGATCTGAGCGGTTTTGTTGGTAAACATCTGGTGTATACCTA TGATAATGGCTGGGAGTATGAGATCTATGTGAAAAATGAAAACACCCTGGATTATCGCATTC ATAGCGGTCTGGTTGGTAATCGTTGGGTTAAAGATCAGCAGGCATATATTGTTCGTGTGGGT GAAAGCATCTATAAAATCAGCTGGACCGAACCGACCGGCACCGATGTTAGCCTGATTGTTAA TCTGGGTGATAGCCTGTTTCATGGCACCATCTTTTTTCCGCGTTGGGTGATGAATAATCCGG AAAAAACCGTTTGCTTTCAGAACGATCATATTCCGCTGATGAATAGCTATCGTGATGCAGGT CCGGCATATCCGACCGAAGTTATTGATGAATTTGCCACCATTACCTTTGTTCGTGATTGTGG TGCAAATAACGAAAGCGTTATTGCATGTGCAGCAAGCGAACTGCCGAAAAACTTTCCGGATA ATCTGAAAGGTGGTGGTGGTAGCGTTGATACCCTGAGCGGTCTGAGCAGCGAACAGGGTCAG AGCGGTGATATGACCATTGAAGAAGATAGCGCAACCCACATCAAATTCAGCAAACGTGATGA AGATGGTAAAGAACTGGCAGGCGCAACCATGGAACTGCGTGATAGCAGCGGTAAAACCATTA GCACCTGGATTAGTGATGGTCAGGTGAAAGATTTTTATCTGTACCCTGGCAAATACACCTTT GTTGAAACCGCAGCACCGGATGGTTATGAAGTTGCAACCGCAATTACCTTTACCGTTAATGA ACAGGGCCAGGTTACCGTGAATGGTAAAGCAACCAAAGGTGATGCACATATTGGTCATCATC AC CAT CAT CAT TAA SEQ ID NO 2
[0124] ST-PAD-ST ATGGCTCACATCGTTATGGTGGACGCTTACAAACCGACCAAAGGTGGTGGTGGTAGCAACAC CTTCGACAAACATGATCTGAGCGGTTTTGTTGGTAAACATCTGGTGTATACCTATGATAATG GCTGGGAGTATGAGATCTATGTGAAAAATGAAAACACCCTGGATTATCGCATTCATAGCGGT CTGGTTGGTAATCGTTGGGTTAAAGATCAGCAGGCATATATTGTTCGTGTGGGTGAAAGCAT CTATAAAATCAGCTGGACCGAACCGACCGGCACCGATGTTAGCCTGATTGTTAATCTGGGTG ATAGCCTGTTTCATGGCACCATCTTTTTTCCGCGTTGGGTGATGAATAATCCGGAAAAAACC GTTTGCTTTCAGAACGATCATATTCCGCTGATGAATAGCTATCGTGATGCAGGTCCGGCATA TCCGACCGAAGTTATTGATGAATTTGCCACCATTACCTTTGTTCGTGATTGTGGTGCAAATA ACGAAAGCGTTATTGCATGTGCAGCAAGCGAACTGCCGAAAAACTTTCCGGATAATCTGAAA GGTGGTGGTGGTAGCGCACATATTGTTATGGTTGATGCATATAAACCGACCAAAGGTCATCA T C AC CAT CAT CAT TAA SEQ ID NO 3
[0125] ST-YeiN ATGCATCACCACCATCATCATGGTGCACACATAGTAATGGTAGACGCCTACAAGCCGACGAA GGGCGGTGGTGGTAGCAGCGAACTGAAAATTAGTCCGGAACTGCTGCAGATTTCACCGGAAG TTCAGGATGCACTGAAAAATAAGAAACCGGTTGTTGCACTGGAAAGCACCATTATTAGCCAT GGTATGCCGTTTCCGCAGAATGCACAGACCGCAATTGAAGTTGAAGAAACCATTCGTAAACA GGGTGCCGTTCCGGCAACCATTGCAATTATTGGTGGTGTTATGAAAGTGGGCCTGAGCAAAG AAGAAATTGAACTGCTGGGTCGTGAAGGTCATAATGTTACCAAAGTTAGCCGTCGTGATCTG CCGTTTGTTGTTGCAGCAGGTAAAAATGGTGCAACCACCGTTGCAAGTACCATGATTATTGC AGCACTGGCAGGTATTAAAGTTTTTGCGACCGGTGGTATTGGTGGCGTTCATCGTGGTGCAG AAC AT AC C T T T GAT AT T AG T G C C GAT C T G C AAGAAC T G G C C AAT AC C AAT G T T AC C G T T G T T TGTGCCGGTGCAAAAAGCATTCTGGATCTGGGTCTGACCACCGAATATCTGGAAACCTTTGG TGTTCCGCTGATTGGTTATCAGACCAAAGCACTGCCTGCATTTTTCTGTCGTACCAGTCCGT TTGATGTTAGCATTCGTCTGGATAGCGCAAGCGAAATTGCACGTGCCATGGTTGTTAAATGG CAGAGCGGTCTGAATGGTGGTCTGGTTGTTGCCAATCCGATTCCGGAACAGTTTGCAATGCCGGAACATACCATTAATGCAGCAATTGATCAGGCAGTTGCCGAAGCCGAAGCACAGGGTGTTA TTGGTAAAGAAAGCACCCCGTTTCTGCTGGCACGTGTTGCAGAACTGACCGGTGGCGATAGC C TGAAAAGCAATAT T CAGC T GGT T T T TAACAAT GCCAT T C T GGCAT CAGAAAT CGCCAAAGA ATATCAGCGTCTGGCAGGTTAATGA SEQ ID NO 4
[0126] SC-YeiN ATGCATCACCACCATCATCATGGTGTGGATACCCTGAGCGGTCTGAGCAGCGAACAGGGTCA GAGCGGTGATATGACCATTGAAGAAGATAGCGCAACCCACATCAAATTCAGCAAACGTGATG AAGATGGCAAAGAACTGGCAGGCGCAACCATGGAACTGCGTGATAGCAGCGGTAAAACCATT AGCACCTGGATTAGTGATGGTCAGGTGAAAGATTTTTATCTGTATCCGGGTAAATATACCTT CGTTGAAACCGCAGCACCGGATGGTTATGAAGTTGCAACCGCAATTACCTTTACCGTGAATG AACAAGGTCAGGTTACCGTTAATGGTAAAGCAACCAAAGGTGATGCACATATTGGCGGTGGT GGTAGCAGCGAACTGAAAATTAGTCCGGAACTGCTGCAGATTTCACCGGAAGTTCAGGATGC ACTGAAAAATAAGAAACCGGTTGTTGCACTGGAAAGCACCATTATTAGCCATGGTATGCCGT TTCCGCAGAATGCACAGACCGCAATTGAAGTTGAAGAAACCATTCGTAAACAGGGTGCCGTT CCGGCAACCATTGCAATTATTGGTGGTGTTATGAAAGTGGGCCTGAGCAAAGAAGAAATTGA ACTGCTGGGTCGTGAAGGTCATAATGTTACCAAAGTTAGCCGTCGTGATCTGCCGTTTGTTG TTGCAGCAGGTAAAAATGGTGCAACCACCGTTGCAAGTACCATGATTATTGCAGCACTGGCA GGTATTAAAGTTTTTGCGACCGGTGGTATTGGTGGCGTTCATCGTGGTGCAGAACATACCTT TGATATTAGTGCCGATCTGCAAGAACTGGCCAATACCAATGTTACCGTTGTTTGTGCCGGTG CAAAAAGCATTCTGGATCTGGGTCTGACCACCGAATATCTGGAAACCTTTGGTGTTCCGCTGATTGGTTATCAGACCAAAGCACTGCCTGCATTTTTCTGTCGTACCAGTCCGTTTGATGTTAG CATTCGTCTGGATAGCGCAAGCGAAATTGCACGTGCCATGGTTGTTAAATGGCAGAGCGGTC TGAATGGTGGTCTGGTTGTTGCCAATCCGATTCCGGAACAGTTTGCAATGCCGGAACATACC ATTAATGCAGCAATTGATCAGGCAGTTGCCGAAGCCGAAGCACAGGGTGTTATTGGTAAAGA AAGCACCCCGTTTCTGCTGGCACGTGTTGCAGAACTGACCGGTGGCGATAGCCTGAAAAGCA ATATTCAGCTGGTTTTTAACAATGCCATTCTGGCATCAGAAATCGCCAAAGAATATCAGCGT CTGGCAGGTTAATGA SEQ ID NO 5
[0127] GATCCGGCTGCTAACAAAGCCCG
[0128] Linearization for insertion of YeiN
[0129] SEQ ID NO 6
[0130] ATGTATATCTCCTTCT T AAAG T T AAAC AAAAT T AT T T C T AGAG G
[0131] Linearization for insertion of YeiN
[0132] SEQ ID NO 7 TAATGGTAGACGCCTACAAGCCGACGAAGGGCGGTGGTGGTAGCAGCG
[0133] Insertion of N-term. ST
[0134] SEQ ID NO 8 GCGTCTACCATTACTATGTGTGCACCATGATGATGGTGGTGATGCATATG
[0135] Insertion of N-term. ST
[0136] SEQ ID NO 9 GGTAAAGCAACCAAAGGTGATGCACATATTGGCGGTGGTGGTAGCAGCG
[0137] Linearization for insertion of SCSEQ ID NO 10 TCGCTGCTCAGACCGCTCAGGGTATCCACACCATGATGATGGTGGTGATGCATATG
[0138] Linearization for insertion of SC
[0139] SEQ ID NO 11
[0140] AATATGTGCATCACCTTTGGTTGCTTTACC
[0141] Amplification of SC
[0142] SEQ ID NO 12
[0143] GTGGATACCCTGAGCGGTCTGAG
[0144] Amplification of SC
[0145] SEQ ID NO 13
[0146] GDH-ST ATGTATCCGGATTTAAAAGGAAAAGTCGTCGCTATTACAGGAGCTGCTTCAGGGCTCGGAAA GGCAATGGCCATTCGCTTCGGCAAGGAGCAGGCAAAAGTGTTATCAACTATTATAGTAATA AACAAGATCCGAACGGTTAAAAGAGGTCATCAAGGGGGGGCTGTTTCGA CAAGGAGATGTCACGAAAGAGGAAGATGTAAAAAATATCGTGCAAACGGCAATTAAAGTT CGGCACACTCGATATTATGATTAATAATGCCGGTCTTGAAAATCCTGTGCCATCTCACGAAA TGCCGCTTAAGGATTGGGATAAGTCATCGGCAAACTTAACGTGCTTTTTAGGAGAGGTAGGATT GATTCTA CATTCTA AGAAAAC GAT AT C AAG G GAAAT GTC AT C AAC AT GTCC AG TGTGCACGAAGTGATTCCTTGGCCGTTATTTGTTCACTACGGCAAGTAAAGGCGGGATAA AGCTGATGACAGAAACATTGGCGTTGGAATACGCCGAAGGGCATTCGCGTGAACAATATC GGGCCAGGTGCGATCAATACGCCAATCAATGCTGAAAAATTTGCTGACCCTAAACAGAAAGC AGATGTAGAAAGCATGATTCCGATGGGGTATATCGGCGAACCGGAGGATCGCCGCAGTGG CAGTGTGGCTTGCTTCGAAGGAATCCAGCTATGTTACAGGCATCATCGATTGGCTT GGAATGACGAAATATCCTTCTTTCCAGGCAGGACGCGGTGGTGGTGGTGGTAGCGGTGGTGG TGGTAGCGCCCATATTGTTATGGTGGATGCATAAACCGACCAAAGGTCATCATCACCATC AC CAT T GA SEQ ID NO 14
[0147] GDH-SC :
[0148] ATGTATCCGGATTTAAAAGGAAAAGTCGTCGCTATTACAGGAGCTGCTTCAGGGCTCGGAAA GGCAATGGCCATTCGCTTCGGCAAGGAGCAGGCAAAAGTGTTATCAACTATTATAGTAATA AACAAGATCCGAACGGTAAAAGAAGGTCATCAAGGCGGGGGGGCGTTCGTTCGTT CAAGGAGATGTCACGAAAGAGGAAGATGTAAAAAATATCGTGCAAACGGCAATTAAAGTT CGGCACACTCGATATTATGATTAATAATGCCGGTCTTGAAAATCCTGTGCCATCTCACGAAA TGCCGCTTAAGGATTGGGATAAGTCATCGGCAAACTTAACGTGCTTTTTAGGAGAGGTAGGATT GATTCTA CATTCTA AGAAAAC GAT AT C AAG G GAAAT GTC AT C AAC AT GTCC AG TGTGCACGAAGTGATTCCTTGGCCGTTATTTGTTCACTACGGCAAGTAAAGGCGGGATAA AGCTGATGACAGAAACATTGGCGTTGGAATACGCCGAAGGGCATTCGCGTGAACAATATC GGGCCAGGTGCGATCAATACGCCAATCAATGCTGAAAAATTTGCTGACCCTAAACAGAAAGC AGATGTAGAAAGCATGATTCCGATGGGGTATATCGGCGAACCGGAGGATCGCCGCAGTGG CAGTGTGGCTTGCTTCGAAGGAATCCAGCTATGTTACAGGCATCATCGATTGGCTT GGAATGACGAAATATCCTTCTTTCCAGGCAGGACGCGGTGGTGGTGGTGGTAGCGGTGGTGG TGGTAGCGTTGATACCCTGAGCGGTCTGAGCAGCGAACAGGGTCAGAGCGGTGATATGACCA TT GAAGAAGAT AG CGC AAC CC AC AT C AAAT TC ACAG GT AAAGA GAT AAAGAT G GCAGGCGCAACCATGGAACTGCGTGATAGCAGCGGTAAAACCATTAGCACCTGGATTAGTGA TGGTCAGGTGAAAGATTTTTATCTGTACCCTGGCAAATACACCTTTGTTGAAACCGCAGCACCGGATGGTTATGAAGTTGCAACCGCAATTACCTTTACCGTTAATGAACAGGGCCAGGTTACC GTGAATGGTAAAGCAACCAAAGGTGATGCACATATTGGTCATCATCACCATCACCATTGA SEQ ID NO 15
[0149] SC-ADH ATGCATCATCACCACCATCATGGTGTTGATACCCTGAGCGGTCTGAGCAGCGAACAGGGTCA GAGCGGTGATATGACCATTGAAGAAGATAGCGCAACCCACATCAAATTCAGCAAACGTGATG AAGATGGTAAAGAACTGGCAGGCGCAACCATGGAACTGCGTGATAGCAGCGGTAAAACCATT AGCACCTGGATTAGTGATGGTCAGGTGAAAGATTTTTATCTGTACCCTGGCAAATACACCTT TGTTGAAACCGCAGCACCGGATGGTTATGAAGTTGCAACCGCAATTACCTTTACCGTTAATG AACAGGGCCAGGTTACCGTGAATGGTAAAGCAACCAAAGGTGATGCACATATTGGTGGTGGT GGTAGCAGCAATCGCCTGGATGGTAAAGTTGCAATTATTACCGGTGGCACCCTGGGTATTGG TCTGGCAATTGCAACCAAATTTGTTGAAGAGGGTGCCAAAGTTATGATTACCGGTCGTCATA GTGATGTTGGTGAAAAAGCAGCAAAAAGCGTTGGTACACCGGATCAGATTCAGTTTTTTCAG CATGATAGCAGTGATGAAGATGGTTGGACCAAACTGTTTGATGCAACCGAAAAAGCATTTGG TCCGGTTAGCACCCTGGTTAATAATGCAGGTATTGCAGTGAATAAAAGCGTGGAAGAAACCA CCACCGCAGAATGGCGTAAACTGCTGGCAGTTAATCTGGATGGTGTTTTTTTTGGTACACGT CTGGGTATTCAGCGCATGAAAAACAAAGGTCTGGGTGCAAGCATTATCAACATGAGCAGCAT TGAAGGTTTTGTTGGTGATCCGAGCCTGGGTGCATATAATGCAAGCAAAGGTGCAGTTCGTA TTATGAGCAAAAGCGCAGCACTGGATTGTGCACTGAAAGATTATGATGTTCGTGTGAATACCGTTCATCCGGGTTATATCAAAACACCGCTGGTTGATGATCTGCCTGGTGCCGAAGAAGCAAT GAGCCAGCGTACCAAAACCCCGATGGGTCATATTGGTGAACCGAATGATATTGCCTATATCT GTGTTTATCTGGCCAGCAACGAAAGTAAATTTGCAACCGGTAGCGAATTTGTTGTGGATGGT GGTTATACCGCACAGTAA SEQ ID NO 16
[0150] PDZ-Bind . ADH ATGCATCATCACCACCATGGTCTGCAGCGTCGTCGTGTTACCGTTCGTAAAGCAGATGC CGGTGGTCTGGGTATTAGCATTAAAGGTGGTCGTGAAAACAAATGCCGATCCTGATTAGCA AAATCTTTAAAGGTCTGGCAGCAGATCAGACCGAAGCACTGTTGATTGATTGTTGATTGCTGCTGATTAGCA AGCGTTAATGGTGAAGATCTGAGCAGCGCAACCCATGATGAAGCAGTTCAGGCACTGAAAAA AAC CGGT AAAGAAG TTGTTCTG GAAG TC AAAT AC AT GAAAGAAG T GAG CCCGTACTT T AAAG GTGGTGGTGGTAGCAGCAATCCTGGGATCAGCAGTTCACCTTGTTGAGTTGGTTGGGGTTACTT GGTATTGGTCTGGCAATTGCAACCAAATTTGTTGAAGAGGGTGCCAAAGTTATGATTACCGG TCGTCATAGTGATGTTGGTGAAAAAGCAGCAAAAAAGCGTTGGTACACCGGATCAGATTCAGT TTTTTCAGCATGATAGCAGTGATGAAGATGGTTGGACCAACTGAACCAACCGATTGAAGATGAAGAT GCATTTGGTCCGGTTAGCACCCTGGTTAATAATGCAGGTATTGCAGTGAATAAAAGGGTGGA AGAAACCACCACCGCAGAATGGCGTAAACTGCTGGCAGTTAATCTGGATGGTGTTTTTTTTG GTACACGTCTGGGTATTCAGGCATGAAAAACAAAGGTCTGGGCAGCATTCAGATTCA AGCAGCATTGAAGGTTTTGTTGGTGATCCGAGCCTGGGTGCATATAATGCAAGCAAAGGTGC AGTTCGTATTATGAGCAAAAGCGCAGCACTGGATTGTGCACTGAAAGATTATGATGTTCGTG TGAATACCGTTCATCCGGGGTTATATCAAACACCGCTGGTTGATGATCCAAGCGTGCAAGCGAAGCAATGAGCCAGCGTACCAAAACCCCGATGGGTCATATTGGTGAACCGAATGATATTGC CTATATCTGTGTTTATCTGGCCAGCAACGAAAGTAAATTTGCAACCGGTAGCGAATTTGTTG TGGATGGTGGTTATACCGCACAGTAATAA SEQ ID NO 17
[0151] GDH-PDZ-Ligand ATGTATCCGGATTTAAAAGGAAAAGTCGTCGCTATTAGGAGCTGCTTCAGGGCTCGGAAA GGCAATGGCCATTCGCTTCGGCAAGGAGCAGGCAAGTGGTTATCAACTATTATAGTAATAAACAAGATCCGAACGAGGTAAGAAGAGGAGTCATCAGGTTGCGGTCGGGGGGGGCCATTCGCTTCGGCAAGGAGCAA CAAGGAGATGTCACGAAAGAGGAAGATGTAAAAAATATCGTGCAAACGGCAATTAAAGATTT CGGCACACTCGATATTATGATTAATAATGCCGGTCTTGAAAATCCTGTGCCATCTCACGAAA TGCCGCTTAAGGATTGGGATAAGTCATCGGCAAACTTAACGTGCTTTTTAGGAGTAGGATT GATTCGATT CATTCTAAC AGAAAAC GAT AT C AAG G GAAAT GTC AT C AAC AT GTC GAG TGTGCACGAAGTGATTCCTTGGCCGTTATTTGTTCACTACGGCAAGTAAAGGCGGGATAA AGCTGATGACAGAAACATTGGCGTTGGAATACGCGCCGAAGGGCATTCGCGTGAACAATATC GGGCCAGGTGCGATCAATACGCCAATCAATGCTGAAAAATTTGCTGACCCTAAACAGAAAGC AGATGTAGAAAGCATGATTCCGATGGGGTATATCGGCGAACCGGAGGATCGCCGCAGTGG CAGTGTGGCTTGCTTCGAAGGAATCCAGCTATGTTACAGGCATCATCGATTGCGTTGTT GGAATGACGAAATATCCTTCTTTCCAGGCAGGACGCGGTGGTGGTGGTGGTAGCGGTGGTGG TGGTAGCGGTGTTAAAGAATCTCTGGTTGGTCATCATCACCATCACCATTTGA SEQ ID NO 18
[0152] SH3-Bind . -ADH ATGCATCATCACCACCATCATGGTGCAGAATATGTTCGTGCCCTGTTTGATTTTAATGGCAA C GAT GAAGAAGAT CTGCCGTTC AAAAAAG GT GAT AT TCTGCGT AT TCGT GAG AAAC CG GAAG AACAGTGGTGGAATGCAGAAGATAGGAGGAGTTGATTGTTGTTGTTGTT GAAAAATATGGTGGTGGTGGTAGCAGCAATCGCCTGGATGGTAAAGTTGCAATTATTACCGG TGGCACCCTGGGTATTGGTCTGGCAATTGCAACCAAATTTGTTGAAGAGGGTGCCAAAGTTA TGATTACCGGTCGTCATAGTGTTGTTGGTGAAAAAGCAGCAAGCAAGCCGGTTGTT CAGATTCAGTTTTTTCAGCATGATAGCAGTGATGAAGATGGTTGGACCAACTGTTTGATGC AACCGAAAAAGCATTTGGTCCGGTTAGCACCCTGGTTAATAATGCAGGTATTGCAGTGAATA AAAGCGTGGAAGAAACCACCACCGCAGAATGGCGTAAACTGCTGGCAGTGGTTGGAT GTTTTTTTTGGTACACGTCTGGGTATTCAGGCATGAAAAAACAAAGGTCTGGGTGCAAGCAT TATCAACATGAGCAGCATTGAAGGTTTTGTTGGTGATCCGAGCCTGGGTGCATATAATGCAA GCAAAGGTGCAGTTCGTATTATGAGCAAGCGCAGCACTGGATTGCACTGCACTGAACTGATTAT GATGTTCGTGTGAATACCGTTCATCCGGGTTATATCAAAACACCGCTGGTTGATCTGCC TGGTGCCGAAGAAGCAATGAGCCAGCGTACCAAAACCCCGATGGGTCATATTGGTGAACCGA ATGATATTGCCTATATCTGTGTTTATCTGGCCAGCAACGAAAGTTAATTTGCAACCGTATTGTCGAACGAGAATTTGTTGTGGATGGTGGTTATACCGCACAGTAA SEQ ID NO 19
[0153] GDH-SH3-Ligand ATGTATCCGGATTTAAAAGGAAAAGTCGTCGCTATTAGGAGCTGCTTCAGGGCTCGGAAA GGCAATGGCCATTCGCTTCGGCAAGGAGCAGGCAAGTGGTTATCAACTATTATAGTAATA AACAAGATCCGAACGAGGTAAGAAGAGGTCATCAGTCGATTGGGGGGGGAG CAAGGAGATGTCACGAAAGAGGAAGATGTAAAAAATATCGTGCAAACGGCAATTAAAGTT CGGCACACTCGATATTATGATTAATAATGCCGGTCTTGAAAATCCTGTGCCATCTCACGAAA TGCCGCTTAAGGATTGGGATAAGTCATCGGCAAACTTAACGTGCTTTTTAGGAGAGGTAGGATT GATTCTA CATTCTA AGAAAAC GAT AT GAAG G GAAAT GTC AT GAAG AT GTC GAG TGTGCACGAAGTGATTCCTTGGCCGTTATTTGTTCACTACGCGGCAAGTAAAGGCGGGATAA AGCTGATGACAGAAACATTGGCGTTGGAATACGCCGAAGGGCATTCGCGTGAACAATATC GGGCCAGGTGCGATCAATACGCCAATCAATGCTGAAAAATTTGCTGACCCTAAACAGAAAGC AGATGTAGAAAGCATGATTCCGATGGGGTATATCGGCGAACCGGAGGATCGCCGCAGTGG CAGTGTGGCTTGCTTCGAAGGAATCCAGCTATGTTACAGGCATCATCGATTGGCTT GGAATGACGAAATATCCTTCTTTCCAGGCAGGACGCGGTGGTGGTGGTGGTAGCGGTGGTGG TGGTAGCCCGCCCGGCGCTGCCGCCGAAACGTCGTCGTGGTCATCATCACCATCACCATT GSEQ ID NO 20
[0154] SC-PPK ATGCATCATCACCATCATCATGGTGTGGATACCCTGAGCGGTCTGAGCAGCGAACAGGGTCA GAGCGGTGATATGACCATTGAAGAAGATAGCGCAACCCACATCAAATTCAGCAAACGTGATG AAGATGGCAAAGAACTGGCAGGCGCAACCATGGAACTGGAAGGGAGGAGGAGGAGTTTA AGCACCTGGATTAGTGATGGTCAGGTGAAAGATTTTTATCTGTATCCGGGTAAATACCTT CGTTGAAACCGCAGCACCGGATGGTTATGAAGTTGCACCGCAATTACCTTTACCGTGAATG AACAAGGTCAGGTTACC GGCAGCGCAACCGATTTTAGCAAACTGAGCAAATATGTTGAAACCCTGCGTGTTAAACCGAA AC AGAG C AT T GAT CT GAAAAAG GAT TTC GAT AC C GAC TAG GAT C AT AAAAT GCT GAC C AAAG AAGAAGGCGAAGAAC T GC T GAAT CTGAAGCAGACATTCA GAACGATCA TG TATGCAAGCGGCACCAAAAGCGTTCTGATTGTTTTTCAGGCAATGGATGCAGCAGGTAAAGA TGGCACCGTTAAACATATTATGACCGGTCTGAATCCAGGGTGTTAAAGTTACCAGCTTTTA AAGTTCCGAGCAAATCCGAACTGAGCCATGATTATCTGGCGTCATTGCTGTT GCAACCGGTGAAATTGGTATCTTTAATCGTAGCCACTATGAAAATGTTCTGGTTACCCGTGT TCATCCGGAATATCTGCTGAGCGAACAGACCAGCGGTGTTACCGCAATTGAACAGGTTAATC AGAAAT TCT GGGATAAACGC TTT CAGCAGAT CAACAAC TTT GAACAGCATATTAGCGAAAAC GGCACCATTGTGCTGAAATTCTTTCTGCATGTTAGCAAGAAAGAGCAGAAAAAGCGTTTTAT CGAACGCATTGAACTGGACACCAAAAACTGGAAATTTAGCACAGGCGATCTGAAAGAACGTG CACATTGGAAAGATTATCGCAACGCCTATGAAGATATGCTGGCAAATACCAGCACCAAACAG GCACCGTGGTTTGTTATTCCGGCAGATGATAAATGGTTTACCCGTCTGCTGATTGCCGAAAT T AT C T G T AC C GAAC T G GAAAAAC T GAAT C T GAC C T T T C C GAC C G T T AG C C T G GAAC AGAAAG CAGAGC T GGAAAAAGCAAAAGCAGAAC T GGT T GCAGAAAAGT CCAGCGAT TAAT GA SEQ ID NO 21
[0155] STV-ST ATGGAAGCAGGTATCACCGGCACCTGGTACAACCAGCTCGGCTCGACCTTCATCGTGACCGC GGGCGCCGACGGCGCCCTGACCGGAACCTACGAGTCGGCCGTCGGCAACGCCGAGAGCCGCT ACGTCCTGACCGGTCGTTACGACAGCGCCCCGGCCACCGACGGCAGCGGCACCGCCCTCGGT TGGACGGTGGCCTGGAAGAATAACTACCGCAACGCCCACTCCGCGACCACGTGGAGCGGCCA GTACGTCGGCGGCGCCGAGGCGAGGATCAACACCCAGTGGCTGCTGACCTCCGGCACCACCG AGGCCAACGCCTGGAAGTCCACGCTGGTCGGCCACGACACCTTCACCAAGGTGAAGCCGTCC GCCGCCTCCGGTGGTGGTGGTAGCGCACATATTGTTATGGTTGATGCATATAAACCGACCAA ATAATAA SEQ ID NO 22
[0156] ST-PAD d-ST (Y19F, Y21F, E72S ) ATGGCTCACATCGTTATGGTGGACGCTTACAAACCGACCAAAGGTGGTGGTGGTAGCAACAC CTTCGACAAACATCTGAGCGGTTTTGTTGGTAAACATCTGGTGTATACCTATGATAATG GCTGGGAGTATGAGATCTATGTGAAAAATGAAAACACCTGGATTATCGCATTCATAGCGGT CTGGTTGGTAATCGTTGGGTTAAAGATCAGCAGGCATATTGTTCGTGTGGGTGAAAGCAT ATAGCCTGTTTCATGGCACCATCTTTTCCGTTGGGTGATGAATAATCCGGAAAAAACC GTTTGCTTTCAGAACGATCATATTCCGCTGATGAATAGCTATCGTGATGCAGGTCCGGCATA TCCGACCGAAGTTATTGATTTGCCACCATTACCTTTTGTTCGATTGGTGATTGGTGCAACC ACGAAAGCGTTATTGCATGTGCAGCAAGCGAACTGCCGAAAAACTTTCCGGATAATCTGAAA GGTGGTGGTGGTAGCGCACATATTGTTATGGTTGATGCATATAAACCGACCAAAGGTCATCA TC AC CAT CAT CAT TAA SEQ ID NO 23ST-PPK ATGGGCAGCAGCCATCACCATCATCATCATGGTGCACACATAGTAATGGTAGACGCCTACAA GCCGACGAAGGGTGGTGGTGGCAGCGCAACCGATTTTAGCAAACTGAGCAAATATGTTGAAA CCCTGCGTGT T AAAC C GAAAC AGAG C AT T GAT CT GAAAGAA GAT GAT GAT GAT CAT CAT CAT GC T GACCAAAGAAGAAGGCGAAGAAC T GC T GAAT CT GGGTAT TT CAAAAC T GAGCGAGATCCAAGAAAAACTGTATGCAAGCGGCACCAAAAGCGTTCTGATTGTTTTTCAGGCAA TGGATGCAGCAGGTAAAGATGGCACCGTTAAACATATTATGACCGGTCTGAATCCGCAGGGT GTTAAAGTTACCAGCTTTAAAGTTCCGAGCAAAATCGAACTGAGCCATGATTATCTGTGGCG TCATTATGTTGCACTGCCTGCAACCGGTGAAATTGGTATCTTTAATCGTAGCCACTATGAAA ATGTTCTGGTTACCCGTGTTCATCCGGAATATCTGCTGAGCGAACAGACCAGCGGTGTTACC GCAAT T GAACAGGT TAAT CAGAAAT T C T GGGATAAACGC T T T CAGCAGAT CAACAAC T T T GA ACAGCATATTAGCGAAAACGGCACCATTGTGCTGAAATTCTTTCTGCATGTTAGCAAGAAAG AGCAGAAAAAGCGTTTTATCGAACGCATTGAACTGGACACCAAAAACTGGAAATTTAGCACA GGCGATCTGAAAGAACGTGCACATTGGAAAGATTATCGCAACGCCTATGAAGATATGCTGGC AAATACCAGCACCAAACAGGCACCGTGGTTTGTTATTCCGGCAGATGATAAATGGTTTACCC GTCTGCTGATTGCCGAAATTATCTGTACCGAACTGGAAAAACTGAATCTGACCTTTCCGACC GT TAGCC T GGAACAGAAAGCAGAGC T GGAAAAAGCAAAAGCAGAAC T GGT T GCAGAAAAGT C CAGCGATTAATGABezugszeichenliste
[0157] A, B Vorlösung A, B
[0158] 1 Pumpe
[0159] 2 Statischer Mischer
[0160] 3 Schlauch
[0161] 4 needles
[0162] 5 containers with liquid nitrogen
Claims
1. Claims 1. A method for producing biocatalytically active particles, the method comprising the following steps: (a) reacting an aqueous solution containing at least two peptides A and B with complementary binding sites, wherein at least one of the two peptides A and B is a biocatalytically active peptide; (b) introducing the solution obtained in step (a) in the form of droplets into a medium that is immiscible with the aqueous solution, causing the droplets to solidify; and (c) Drying of the droplets solidified in step (b), while preserving the biocatalytically active particles.
2. Method according to claim 1, wherein the solution obtained in step (a) is introduced in the form of drops into a medium at a temperature lower than the melting point of the aqueous solution.
3. Method according to claim 1 or 2, wherein the drying of the solidified drops in step (c) is carried out by lyophilization.
4. Method according to any one of claims 1 to 3, wherein the peptides A and B constitute at least 1 wt%, preferably at least 25 wt%, of a solids content of the aqueous solution reacted in step (a).
5. A method according to any one of claims 1 to 4, wherein the complementary binding sites of peptides A and B are each at least one binding site selected from the group consisting of a SpyTag binding site, a SpyCatcher binding site, an SH3 binding site, a PDZ binding site, a GBD binding site, and a colicin binding site, wherein the complementary binding sites of peptides A and B are preferably a SpyTag or SpyCatcher binding site.
6. A method according to any one of claims 1 to 5, wherein the concentration of peptides A and B in the solution is in the range of 0.1 pM to 1 M.
7. A method according to any one of claims 1 to 6, wherein the conversion of the solution in step (a) is carried out by combining two presolutions A and B, each containing one of the two peptides A and B, and by mixing the two presolutions A and B in a batch process or in a continuous flow, wherein the conversion of the solution in step (a) is preferably carried out in a continuous flow with a residence time in the continuous flow of at least one second.
8. Method according to any one of claims 1 to 7, wherein the introduction in step (b) is the dripping of individual drops with a drop volume of 0.01 pL to 1 mL and a drip rate of 0.1 to 10000 drops per minute.
9. Method according to any one of claims 1 to 8, wherein the medium is a liquefied gas, preferably liquid nitrogen.
10. A method according to any one of claims 1 to 9, wherein the method further comprises the following step: (d) Embedding the biocatalytically active particles in a molecular framework, wherein the molecular framework is at least one selected from the group consisting of metal organic frameworks (MOFs), covalent organic frameworks (COFs), hydrogen-bonded organic frameworks (HOFs), silicon dioxide-based networks and polymer-based networks.
11. Method according to any one of claims 1 to 10, wherein the peptides A and B are not supported on a carrier material.
12. Biocatalytically active particles obtainable by the method according to any one of claims 1 to 11, wherein the biocatalytically active particles have a peptide content of at least 1 wt%, preferably at least 25 wt%, based on the total mass of the biocatalytically active particles.
13. Biocatalytically active particles according to claim 12, wherein the biocatalytically active particles have a diameter in the range of 1 pm to 10 mm.
14. Use of the biocatalytically active particles according to claim 12 or 13 for carrying out at least one biocatalytic reaction, in particular an enzyme-catalytic reaction, selected from the group consisting of hydrolysis, oxidation, reduction, amidation, esterification, transesterification, epoxidation, carbonylation, halogenation, dehalogenation, sulfation, sulfurylation, glycosylation, dehydration, hydrogenation, hydroformylation, condensation, isomerization, carboxylation, decarboxylation, deamination, methylation, demethylation, nitrilation, acetylation, hydroxylation and CH-, CN-, CS- or other carbon functionalizations in a batch reactor or a flow reactor, preferably in a flow reactor.